RCHRCH FRACPFRACP GeneticsGenetics 20052005 ComplexComplex GeneticGenetic MechanismsMechanisms Dr David Amor [email protected] The human genome • 3.1 gigabases of DNA • About 20,000 genes distributed unevenly across the genome – 17,19,22 gene dense – 4,8,13,18, Y are gene poor • Contained in 46 chromosomes (and mitochondria) • Disease-causing mutations known for about 1,000 genes • Less than 2% codes for proteins • Over 50% repeat sequences of uncertain function Genetic Mechanisms of Disease • Traditional – Single gene disorders • Autosomal dominant • Autosomal recessive • X-linked – Chromosomal – Polygenic • Novel/Complex Mechanisms/inheritance – Genomic imprinting – Trinucleotide repeat disorders – Mitochondrial (Maternal inheritance) – Mosaicism Genomic Imprinting Genomic Imprinting • Epigenetic: a heritable (at the level of the cell and/or the organism) that is not encoded by DNA sequence • Imprinting: the differential expression of a gene according to its parent of origin • Most genes are expressed equally from both paternal and maternal alleles • Genomic imprinting is the epigenetic marking of a gene based on its parental origin that results in monoallelic expression • Genomic imprinting differs from classical genetics in that the maternal and paternal complement of imprinted genes are not equivalent • The mechanism of imprinting appears to involve a parental specific methylation of CpG-rich domains, that is reset during gametogenesis Genomic imprinting and embryogenesis • Approximately 100-200 imprinted genes thought to exist – Involved in many aspects of development including • Fetal and placental growth • Cell proliferation • Brain development • Adult behaviour • Haploid sperm + haploid egg → normal embryo • Haploid sperm + haploid sperm → hydatidiform mole • Haploid egg + haploid egg → ovarian dermoid cyst • Indicate that normal human development only proceeds when a complement of the paternal and maternal genomes is present Imprinting in Genetic Diseases • A number of human diseases are associated with imprinting defects • Diseases result from either – Loss of imprinting (resulting in diallelic rather than monoallelic expression) – Uniparental disomy (resulting in either x2 or no expression) • Imprinting changes can be either – congenital, e.g. • Prader-Willi syndrome, Angelman syndrome • Beckwith-Wiedemann syndrome, Russell-Silver syndrome – or acquired, e.g. • Altered expression of growth control genes in human cancer Uniparental disomy Uniparental disomy: When both copies of a chromosome pair are derived from the same parent. One cause of abnormal imprinting patterns. Typically a result of ‘trisomy rescue’ in early embryonic life Example: Chromosome 15 Methylation status of the SNRPN gene x ! x ! x methylated ! unmethylated Maternally derived ! xx chromosome 15 Paternally derived chromosome 15 xx This child would have Prader-Willi syndrome Prader-Willi syndrome xx xx Deletion on Both 15s are paternal 15 maternal Absence of paternally functioning genes •70% have paternally derived deletion of 15q12 •25% have matUPD15 Angelman syndrome xx xx Deletion on Both 15s are maternal 15 paternal Absence of maternally functioning genes 70 % maternally-derived deletion of 15q12 10 % patUPD15 5 % maternal UBE3A mutation 10 % imprinting centre defects Beckwith-Wiedemann syndrome I • 1 in 15,000 births • Macroglossia • Pre/post natal overgrowth • Anterior abdominal wall defects – Hemihypertrophy – neonatal hypoglycaemia – facial naevus flammeus – ear pits/creases – increased risk of abdominal tumours Genetic / Epigenetic Changes associated with BWS • Chromosome changes associated with 11p (1%) • Segmental UPD11 (20%) – post-zygotic (mitotic) error • DNA mutations in CDKN1C (p57KIP2) (5% but 40% of familial cases) • Loss of imprinting (LOI)of H19 gene (5-10%) – =hypermethylation (silencing) of maternal H19 ⇒ biallelic expression of IGF2 • LOI of LIT1 (40-50% incl some familial cases) – = loss of methylation of maternal LIT1 allele • LOI of both H19 and and LIT1 (rare other than in UPD) • No cause found (15-25%) Molecular basis of BWS Tel H19 H19DMR IGF2 LIT1 KvDMR1 CDKN1C Cent Mat Expressed Silenced Silenced Ch3 Expressed Pat Silenced Ch3 Expressed Expressed Silenced • BWS thought to result from tipping the balance towards the paternal allele – Increased expression of growth promoting gene (? IGF2) – Silencing of growth inhibiting gene (? CDKN1C) Increased tumour risk in BWS • Main risk is for Wilms tumour • Also increased risk for – Hepatoblastoma – Neuroblastoma – Adrenocortical carcinoma – Rhabdomyosarcoma • Overall tumour risk during childhood – Wiedemann (1983) 29/388 = 7.5% – DeBaun (1998) 13/183 = 7.1% – Goldman (2002) 22/159 = 14% – Total 64/730 = 8.8% Genotype-Phenotype correlation • Wiedemann (1983) reported association between hemihyperplasia and cancer – Hemihyperplasia in 12.5% total BWS – Hemihyperplasia in 40% BWS with cancer – Tumours seen in >25% of BWS with hemihyperplasia • Henry (1993) reported tumours more frequent in UPD11 • Lam (1999), Engel (2000), Weksberg (2001) and others showed tumours mainly associated with dysregulation of telomeric domain rather than centromeric domain Tel H19 H19DMR IGF2 LIT1 KvDMR1 CDKN1C Cent Mat Expressed Silenced Silenced Ch3 Expressed Pat Silenced Ch3 Expressed Expressed Silenced Tumour frequencies according to molecular defect (Rump et al. AJMG 2005) • No Wilms tumour seen in patients with defect in centromeric domain (LOI LIT1 or CDKN1C mutation) • Other tumour types seen with comparable frequency in patients with defects in centromeric and telomeric domain Tel H19 H19DMR IGF2 LIT1 KvDMR1 CDKN1C Cent Mat Expressed Silenced Silenced Ch3 Expressed Pat Silenced Ch3 Expressed Expressed Silenced Non-Wilms tumours Wilms tumours Syndromes involving imprinted genes • Syndromes involving imprinted genes – Beckwith–Wiedemann syndrome 11p15 – Prader–Willi syndrome 15q11-q12 – Angelman syndrome 15q11-q12 – Silver–Russell syndrome 7p11-p13, 7q31-qter – Transient neonatal diabetes mellitus 6q24 – PHP1b, Albright hereditary osteodystrophy, McCune–Albright 20q13 – Familial nonchromaffin paraganglioma 11q13 – Maternal and paternal UPD14 syndromes 14 • Syndromes that probably involve imprinted genes – Turner syndrome phenotypes X – Familial pre-eclampsia 10q22 – Maternal UPD2 syndrome 2 – Maternal UPD16 syndrome 16 • Complex genetic diseases with parent-of-origin effects – Asthma, atopy 4q35, 11q13, 16q24, 16p12 – Autism 7q22-q31, 15q11-q13 – Hirschsprung disease 10q11 – Cornelia de Lange syndrome 3q26, 5p13 – Psoriasis 6p, 16q – Handedness 2p12-q11 – Type I diabetes 6p21, 6q25-q27, 10p11-q11, 16q – Type II diabetes 5p, 12q, 18p11 – Alcoholism 1, 2, 4, 8, 9, 16, – Alzheimer disease 10q, 12q – Bipolar affective disorder 1q, 2p, 2q, 6q, 13q, 14q, 16q, 18q – Schizophrenia 2p12-q11, 22q12 Trinucleotide (triplet) Repeat Disorders Trinucleotide Repeats • Repetition of three Nucleotides – e.g. CAGCAGCAGCAGCAGCAGCAGCAGCAG •Normal • Disease Causing When Expanded Beyond a Certain Threshold • Below That Threshold They Are Stable Both in Mitosis and Meiosis • Beyond a Certain Number the Repeat Can Be Unstable in Meiosis ± Mitosis (Dynamic mutations) Characteristics of trinucleotide repeats • Intergenerational Instability – Repeat Changes In Size From Parent To Offspring – Sex Of Transmitting Parent Important – Some More Unstable From Father, Others From Mother • Anticipation – More Severe Phenotype With Successive Generations – Best Example Is Myotonic Dystrophy • Premutations – Repeat Size Which Is Unstable But Does Not Result In A Phenotype – Best Example Is Fragile X Syndrome • Genotype-Phenotype correlation – For All Trinucleotide Repeat Disorders, the Larger the Repeat, the Earlier the Onset – Cannot Use the Repeat Size to Predict Phenotype With Accuracy • Eg: Myotonic Dystrophy Prenatal • Huntington Disease Predictive Test Location of trinucleotide expansions in humans ATG TAA 5’ 3’ CGGCGGCGG GAAGAAGAA CAGCAGCAG CTGCTGCTG Fragile X syndrome Friedreich Ataxia Huntington disease Myotonic dystrophy DRPLA SBMA SCA1 SCA2 SCA3 SCA6 SCA7 Myotonic Dystrophy • Muscle Weakness / Cataract / Myotonia / Infertility • Progressive • CTG Repeat – <37- No Problem – >50- Disease – 50-100- Generally Mild – Congenital Form Often >1000 • Congenital Form Almost Always Maternally Inherited • Worse With Succeeding Generations ( Anticipation) Fragile X syndrome • CGG Repeat • <50- Normal and No Risk for Offspring • 50-200= Premutation- Normal Intellect but Risk to Offspring of Females • >200- Males Have Intellectual Disability but Intellect in Females Is Variably Affected (50% intellectual disability) Fragile X Premutation • Not Truly a Premutation – Females • Premature Ovarian Failure • “Shy” Personality – Males • Ataxia, tremor (FAXTAS) Huntington Disease 1 • Progressive Neurodegenerative Condition • Affects About 1:10 000 • Autosomal Dominant • Gene Identified In 1993 • CAG Repeat → Polyglutamine • Intergenerational instability – Repeats >29 Unstable – Much Greater For Male Than Female Transmission – Juvenile Onset HD Almost Always Paternally Inherited • Protein = Huntingtin- Unknown Function • Likely That Expansion Confers A Toxic Gain Of Function Huntington Disease 2 • Onset 4-80 Years- Mean 40 Years • Inevitably Fatal • No Treatment Known To Alter The Natural History • Onset To Death Averages About 15 Years • Three Main Groups Of Symptoms – 1) Chorea – 2) Cognitive Impairment – 3) Psychiatric Symptoms Including Depression, Personality Changes • Able To Diagnose Presymptomatically • Able To Offer Prenatal