UNIVERSITY OF CINCINNATI
Date:______
I, ______, hereby submit this work as part of the requirements for the degree of: in:
It is entitled:
This work and its defense approved by:
Chair: ______
The Retinoblastoma Tumor Suppressor Protein is a Critical Regulator of Lung Epithelial Repair after Injury
Nicole Ann Richie
B.S. Indiana University, 2002
October 14, 2008
Degree to be conferred: Doctorate of Philosophy
Pathobiology and Molecular Medicine College of Medicine
Committee Members:
Kathryn Wikenheiser-Brokamp, M.D., Ph.D. (Chairperson)
David Askew, Ph.D.
Greg Boivin, D.V.M.
Eric Knudsen, Ph.D.
Thomas Korfhagen, M.D., Ph.D.
i Abstract
Airway remodeling is associated with the vast majority of lung diseases including chronic obstructive pulmonary disease, asthma, and lung cancer. Epithelial regeneration is a key component in airway remodeling after injury. Accordingly, deregulated epithelial cell proliferation, survival, and differentiation play a prominent role in the pathogenesis of chronic lung disease. The lung epithelium is composed of specialized cell types that result from coordinate regulation of progenitor/stem cell proliferation and differentiation. The retinoblastoma gene product (Rb) regulates both proliferation and differentiation, and is inactivated in nearly all cases of lung cancer strongly implicating Rb as a critical regulator in the lung epithelium. The objective of this dissertation project was to test the hypothesis that Rb is essential for proper lung epithelial repair after injury. Rb ablation was targeted to the lung epithelium using a tetracycline regulated Cre/LoxP system, and epithelial injury was induced with naphthalene to mimic human lung disease. These studies demonstrate that although Rb is not required for establishing and maintaining epithelial quiescence during homeostasis, Rb is essential for establishing quiescence during epithelial repair after injury. Rb ablation during development and in the postnatal lung had similar effects providing evidence that timing of Rb loss was not critical to the phenotypic outcomes, and that the injury induced phenotype was not secondary to compensatory alterations occurring during development. After establishing this critical role for Rb in epithelial remodeling after a single episode of injury, Rb function was assessed in a chronic injury model to more closely mimic human lung disease. These studies led to the discovery of previously unknown effects of the
ii highly utilized naphthalene injury model; namely naphthalene injury results in altered
epithelial composition and subsequent inflammation. Importantly, Rb dependent
sustained epithelial proliferation enhanced progenitor cell restoration after injury
without resulting in tumor formation. Altogether, this dissertation project identifies a unique critical role for Rb in the context of epithelial remodeling after injury, and provides evidence that precise regulation of Rb function is important for balancing progenitor cell regeneration, and thus tissue renewal capacity, against the risk of developing cancer.
iii
iv Acknowledgments
The progression of my graduate career was made possible by endless contributions from my dissertation committee, dissertation advisor, and friends and family. First of all, I would like to thank the members of my dissertation committee,
Dr. David Askew, Dr. Eric Knudsen, Dr. Thomas Korfhagen, and Dr. Greg Boivin.
They have been closely involved with my work and have provided valuable insights and direction to my project. Most of all, I would like to express my gratitude to Dr.
Kathryn Wikenheiser-Brokamp. Kathryn was a phenomenal mentor who was always willing to share her knowledge, insights, and encouragement. I am truly lucky to have had her as my dissertation advisor. In addition to her being a patient and excellent teacher; personally, she has been a wonderful support in my life, and I credit her for much of my success at the University of Cincinnati. I would also like to extend a special thank you to Dr. Judith Rhodes who was an important influence on my graduate career and a great source of knowledge and advice.
Additionally, I would like to thank the graduate students for their support throughout my time here, specifically, my particular graduate class. On that note I would have to single out one specific person in my class, my husband. Really, I have to express great appreciation to the University of Cincinnati graduate program, not only for the phenomenal training I have received here, but it was through the Pathology program that I met my husband. Daryl has truly provided wonderful and loving support system throughout this process.
I would like to especially thank my friends and family. I have many wonderful and encouraging friends, too many to thank individually, but they have all
v contributed in supporting me in this process. In particular, Heather, our program coordinator, is not only amazing at her job; she is one of my best friends and was truly a shoulder to lean on throughout the duration of my graduate career. Most importantly,
I am blessed with a truly amazing and wonderful family; words cannot express how important they are in my life. My mom, dad, and brother are the most supportive, encouraging family one could ever ask for and have been truly instrumental in my life endeavors.
vi Table of Contents
List of Tables viii
List of Figures viii
List of Symbols xi
Chapters
Chapter 1: Introduction
A) Introduction to the Retinoblastoma (Rb) tumor suppressor gene 1
B) Rb is a critical regulator in the pulmonary epithelium 13
C) Proper lung epithelial remodeling is important in restoring lung 16
function after injury
Chapter 2: Rb function is essential for establishing lung epithelial 44
quiescence after injury
Chapter 3: Rb is a critical regulator of progenitor cells in the 87
context of epithelial remodeling after injury
Chapter 4: Discussion and Future Directions 133
vii List of Tables
Table 2-1: Tumor Incidence. 66
List of Figures:
Figure 1-1: Rb and Cell Cycle Regulation. 2
Figure 1-2: Classic Rb Pathway. 6
Figure 2-1: Rb ablation results in sustained epithelial proliferation after injury. 67
Figure 2-2: Aberrantly proliferating cells in Rb null lungs progress into S-phase 69 and mitosis.
Figure 2-3: Aberrant cell cycle progression is sustained in Rb ablated lungs 9 71
months after a single episode of injury and is associated with increased apoptosis.
Figure 2-4: Prenatal and postnatal RB ablation occurs throughout the lung 73
epithelium and is present in both Clara and ciliated cells.
Figure 2-5: Postnatal Rb ablation results in aberrant cell cycle progression after 75 injury.
Figure 2-6: Loss of one Rb allele is not sufficient to cause aberrant proliferation 77 in the remodeling lung epithelium.
Figure 2-7: Rb ablation is not associated with altered p53 or Bax expression. 79
viii
Figure 3-1: Chronic injury model. 108
Figure 3-2: Chronic injury results in altered cellular composition. 110
Figure 3-3: Chronic injury results in pulmonary inflammation. 112
Figure 3-4: A single episode of naphthalene induced injury results in 114 pulmonary inflammation through an Rb independent mechanism.
Figure 3-5: Rb loss contributes to Clara cell restoration after injury. 116
Figure 3-6: Chronic injury results in increased ciliated cell number through 118 an Rb independent mechanism.
Figure 3-7: Continual injury cooperates with Rb loss over time. 120
Figure 3-8: Rb ablation results in a transient decrease in BASCs. 122
Figure 3-9: Sustained epithelial cell proliferation occurs in Rb ablated lungs. 124
ix
Figure 4-1: Rb ablation is associated with a transient alteration in 145 p21 expression after injury.
Figure 4-2: Rb regulates p27 stability through APC/C. 147
Figure 4-2: Apoptosis is primarily localized to the terminal bronchioles in 149
Rb ablated lungs.
x
List of Symbols:
APC/C: Anaphase-promoting complex/cyclosome
ATP: Adenosine-5'-triphosphate
BALF: Bronchioalveolar lavage fluid
BASC: Bronchioalveolar stem cells
BMP-2: Bone morphogenic protein-2
BrdU: 5-bromo-2-deoxyuridine
CCSP: Clara cell secretory protein
CEBP: CCAAT/enhancer binding protein
Cdk: Cyclin dependent kinase
CKI: Cyclin Kinase Inhibitor
CMV promoter: Cytomegalovirus promoter
COPD: Chronic obstructive pulmonary disease
Cre: Cre recombinase
CYP-2F2: Cytochrome P450-2F2 monooxygenases
DAB: Diaminobenzidine
DNA: Deoxyribonucleic acid
HDAC: Histone deacetylase
IPF: Idiopathic pulmonary fibrosis
MEFS: Murine embryonic fibroblasts mRNA: messenger ribonucleic acid
MyoD: myogenic differentiation factor
NE: Neuroendocrine cells
xi
NEB: Neuroendocrine bodies
PP1: Type 1 protein phosphotase
SPC: Surfactant protein C
SCF-skp2: Skp1-Cullin-F-Box protein E3 ligase complex
SCLC: Small cell lung cancer
TUNEL: Terminal deoxynucleotidyl transferase dUTP nick end labeling
xii
Chapter 1: Introduction to the Retinoblastoma (Rb) tumor
suppressor gene
Discovery and characterization of Rb
The retinoblastoma gene encodes the retinoblastoma protein (Rb) that is
inactivated in the majority (70%) of a wide range of human tumors (Bartek et al.
1997; Nevins 2001; Sherr 2000; Sherr et al. 2002). Rb was initially discovered as the causative factor in development of retinoblastoma, the most common childhood ocular malignancy (DiCiommo et al. 2000). Retinoblastoma occurs in two clinically distinct forms; 40% of cases are heritable, while 60% are sporadic (DiCiommo et al.
2000; Falls et al. 1951; Knudson 1971). Retinoblastoma underlies the development
of the classical “two hit hypothesis”. In 1971, Dr. Alfred Knudson performed
statistical analyses of heritable and sporadic disease and developed the theory that retinoblastoma requires the occurrence of two genetic events (Knudson 1971). In
heritable cases, the disease is transmitted in an autosomal dominant fashion. The first
“hit” is carried in the germline which predisposes somatic cells to a second “hit”.
Heritable retinoblastoma is characterized by early onset disease and multiple tumors.
The non-inherited spontaneous form requires two somatic mutations, resulting in unilateral, unifocal cancers (DiCiommo et al. 2000). The development of the two hit hypothesis and study of the transmission of retinoblastoma provided the basis for analysis of the molecular mechanisms governing cancer development.
In 1986, the Rb gene became the first tumor suppressor to be cloned and subsequently verified as a tumor suppressor (Friend et al. 1986). It is the strictly regulated process of Rb mediated cell cycle control that is nearly universally
1 circumvented in human tumor development, indicating the significance of the Rb
pathway in tumor suppression. Following the discovery of the Rb tumor suppressor,
a new era in cancer biology ensued and many other tumor suppressors were
identified, contributing greatly to our understanding of human malignancies.
Rb regulates proliferation by interaction with E2F transcription factors
Rb is ubiquitously
expressed and functions as a
primary negative regulator of cell
cycle (Classon et al. 2002; Sherr &
McCormick 2002). The primary
role of Rb in regulation of cellular
proliferation is through control of
the transition from the G1 to the S
phase of the cell cycle (Figure 1-1).
Specifically, Rb blocks at late G1
Figure 1-1 Rb and Cell Cycle Regulation. phase and inhibits DNA synthesis Rb is functional when bound to an E2F/DP complex and is located at active promoter at the beginning of S phase. where E2F resides. In this state Rb serves as a unit of transcriptional repression. Cyclin D/cdk Although Rb can interact 4/6 and Cyclin E/cdk 2 faciliatate Rb phosphorylation. Cyclin A is responsible for with multiple proteins, most maintaining Rb phosphorylation throughout cell cycle. After mitosis Rb is current models propose that the dephosphorylated by the type 1 family of protein phosphatases (PP1) and regains central function of Rb is mediated function to repress transcription through associtation with E2F/DP complexes. through its interaction with the
E2F family of transcription factors. The best characterized forms of E2F are
2 heterodimeric complexes composed of an E2F factor and its DP binding partner
(Dimova et al. 2005). The DP binding partner proteins are found in two forms, DP1 and DP2, and are critical for E2F complex function. E2F transcription factors regulate the expression of various genes important during cell cycle. Specifically,
E2F sites are located in promoters of genes important in cell cycle progression such as Cyclin E and A as well as genes important in DNA replication such as DNA polymerase alpha and cdc6 (DeGregori et al. 1995; Lipinski et al. 1999; Nevins 1992;
Sherr & McCormick 2002). In its active state, Rb binds the E2F/DP heterodimer and forms a complex that serves as a unit of transcriptional repression (Dimova & Dyson
2005). In vitro overexpression assays illuminated the importance of Rb/E2F complexes in the G1/S phase transition since E2F overexpression and Rb inactivation are both sufficient to stimulate S phase entry (Dyson 1998; Weinberg 1995). Taken together, this data demonstrates the importance of Rb/E2F complexes in control of the G1/S phase border.
While the best characterized role of Rb is at the G1/S transition, there is mounting evidence that Rb functions in S as well as G2/M phase control (Knudsen et al. 2006a). Specifically, studies have demonstrated the ability of Rb to directly bind
DNA replication factors, indicating that Rb may directly control DNA replication machinery (Morris et al. 2001; Sterner et al. 1998). Similarly, Rb/E2F complexes are important in regulation of several factors important in G2/M control indicating that
Rb could function in these phases as well (Ishida et al. 2001; Markey et al. 2002;
Vernell et al. 2003). Taken together, these data provide evidence that Rb may play a significant regulatory role throughout the cell cycle. These findings provide the
3 rationale for examining the effects of Rb loss in multiple phases of the cell cycle in the
studies comprising this dissertation.
Rb represses transcription by at least three different mechanisms. First, Rb
can directly bind the transactivation domain of E2F, thus blocking E2F ability to
activate transcription (Flemington et al. 1993; Helin et al. 1993). Second, the
recruitment of Rb to a promoter can physically block the assembly of pre-initiation complexes, potentially allowing it to inhibit the activity of adjacent transcription factors (Frolov et al. 2004; Ross et al. 1999). Finally, Rb can actively repress transcription by recruiting chromatin remodeling enzymes (Macaluso et al. 2006). Rb can recruit histone deacetylases, histone methyl transferases, DNA methyltransferases, and ATP dependent chromatin remodeling proteins. Chromatin- modifying complexes cause chromatin condensation, which leads to inhibition of transcriptional activity (Brehm et al. 1998; Harbour et al. 2000). Recruitment of chromatin remodeling enzymes and the physical association of Rb and the E2F transactivation domain underlies the ability of Rb to repress cell cycle progression.
The E2F family of proteins is composed of eight members (DeGregori et al.
2006; Dimova & Dyson 2005). The proteins are subdivided into groups based on their transcriptional and cell cycle regulatory functions. E2F family members include activator and repressors E2Fs. E2Fs 1-3 are potent transcriptional activators that promote cell cycle progression and interact with Rb. E2Fs 4-5 are repressor E2Fs and are thought to function in cell cycle exit and differentiation. E2Fs 6-8 lack sequences required for binding to Rb, and are thought to repress transcription in an Rb independent manner (Dimova & Dyson 2005; Iaquinta et al. 2007).
4 Rb is regulated by phosphorylation
The transition from G1 to S phase instigates an irreversible commitment to
DNA synthesis and proliferation (Sherr & McCormick 2002). G1 to S phase is
governed by positive and negative regulatory signals and is a highly synchronized
process. In nonproliferating cells, Rb is hypophosphorylated and considered
maximally active. During this time Rb is most effectively able to complex with E2F
transcription factors and restrict cell cycle at the G1/S border (Buchkovich et al.
1989; Cobrinik 2005; Knudsen et al. 1996; Knudsen et al. 1997). Upon mitogenic
stimulation, Rb is progressively phosphorylated at distinct residues by Cyclin/cyclin
dependent kinase (cdk) complexes. Subsequently, Rb losses capability to interact
with E2F transcription factors, and E2F is liberated from the Rb/E2F complex
(Knudsen & Wang 1997; Rubin et al. 2005). Passage into S phase is controlled by
cdks that are regulated by Cyclins D, E, and A (Sherr et al. 2004). Cyclin D binds
and positively regulates cdk4/cdk6, which are inactive as monomers (Agami et al.
2002). Evidence verifying Rb phosphorylation by Cyclin D includes in vitro assays that revealed phosphorylation of Rb via incubation of Cyclin D with cdk4/cdk6 and
Rb fusion proteins (Ewen et al. 1993; Kato et al. 1993). Cyclin E/cdk2 facilitates progressive rounds of Rb phosphorylation on a distinct set of residues during the S phase transition (Mittnacht 1998). This phosphorylation can be observed by in vitro assays wherein ectopic expression of Cyclin E induces Rb phosphorylation (Hinds et al. 1992). Further supporting the importance of Cyclin E in Rb phosphorylation is the observation that Cyclin E mRNA and protein increase substantially in mid to late G1, during the time at which Rb undergoes phosphorylation (Koff et al. 1991; Lew et al.
5 1991). Rb is maintained in the hyperphosphorylated state throughout cell cycle at
least partially by Cyclin A/cdk2, indicating the importance of Rb inactivation
throughout cell cycle progression (Mittnacht 1998). In mitosis, it is thought that Rb is
dephosphorylated by the type 1 family of protein phosphatases (PP1). This
hypothesis is supported by a study by Berndt et al.
demonstrating that electroporation of constitutively active
PP1 prevented Rb phosphorylation and S phase entry in G1
cells (Berndt et al. 1997). Dephosphorylation restores Rb
to its hypophosphorylated state reinstating its ability to
restrain cell cycle progression (Ludlow et al. 1993;
Mittnacht 1998; Tamrakar et al. 1999; Tamrakar et al.
2000).
Rb is regulated by Cyclin/cdk complexes which are
Figure 1-2 Classic Rb in turn regulated by cyclin dependent kinases pathway. Cyclin D/cdk4/6 phosphorylates Rb, resulting in inhibitors (CKIs) (Figure 1-2). cdk 4 and cdk 6 inactivation. Cyclin D/cdk4/6 is in turn negatively regulated are inhibited by the Ink 4 family of CKIs; p16, by p16. p15, p18, and p19. p16 restrains Cyclin D,
maintaining Rb in its active hypophosphorylated state. Upon p16 inactivation, Cyclin
D/cdk4/6 phosphorylates Rb, resulting in freed E2F and cell cycle progression
(Canepa et al. 2007).
Rb belongs to the pocket protein family
Rb belongs to the “pocket proteins”, a family of cell cycle regulators which also includes p107 and p130 (Classon et al. 2000). The pocket proteins are defined
6 by their highly homologous “pocket region”, which is composed of two domains, A and B. While Rb shares homology to the other family members, p107 and p130 are more closely related in terms of structure and function than Rb is to either protein
(Classon et al. 2001). Members of the pocket protein family members demonstrate overlapping as well as distinct functions.
The pocket proteins exhibit several functional similarities, including: 1) binding and regulating E2F transcription factors, 2) functioning at the G1/S transition,
3) undergoing phosphorylation in G1 by Cyclin/cdk complexes, 4) binding viral oncoproteins, and 5) resulting in G1 arrest when overexpressed in vitro (Classon &
Dyson 2001; Dyson 1998; Harbour & Dean 2000; Lukas et al. 1995; Qin et al. 1992;
Smith et al. 1998; Zhu et al. 1993). However, functional similarities of Rb, p107, and p130 does not indicate complete protein redundancy, as the proteins also have unique functions. Specifically, Rb, p107, and p130 regulate different genes at distinct periods of cell cycle. In most tissues, p107 expression is most prominent in proliferating cells and low in terminally differentiated cells. Conversely, p130 is expressed at its highest levels in arrested cells and expression decreases upon mitogenic stimulation (Classon & Dyson 2001; Macaluso et al. 2006). Notably, Rb is nearly universally expressed and present in both proliferating and non-proliferating cells. Distinct roles are further evidenced by in vitro assays demonstrating that murine embryonic fibroblasts (MEFs) mutant for both p107 and p130 result in deregulation of different E2F target genes than Rb-/- MEFs (Hurford et al. 1997).
Additionally, p107 and p130 preferentially bind and regulate repressor E2Fs (E2F4 and E2F5), while Rb binds activating as well as repressing E2Fs (Sun et al. 2007).
7 Thus, although the pocket proteins are highly homologous, they exhibit unique
regulatory functions.
Germline Rb loss results in tissue specific defects despite its widespread
expression. Rb-/- embryos exhibit ectopic proliferation, increased apoptosis, and
differentiation defects in erythroid, neuronal, and lens tissues. The survival of Rb
null embryos to E13.5-14.5 indicates that either Rb function is dispensable in most
cell types during embryogenesis or that differing cellular sensitivity to Rb loss
signifies variable degrees of functional redundancy among family members in
specific cell types (Wikenheiser-Brokamp 2006a). The phenotypes of double mutant
Rb-/-p107-/- or Rb-/-p130-/- embryos support the latter notion (Lee et al. 1996). Rb-
/-p107-/- and Rb-/-p130-/- embryos exhibit an exacerbated phenotype and die two
embryonic days earlier (E11-13) than Rb-/- embryos indicating that p107 and p130 can at least partially compensate for Rb loss during embryogenesis (G Mulligan and
T Jacks, 1999, unpublished results).
While the pocket proteins share extensive homology, Rb is the only member that acts as a classical tumor suppressor in humans. p107 and p130 however can cooperate with Rb in tumor suppression in the mouse. Accordingly, a subset of Rb-/- p107-/- and Rb-/-p130-/- retinas develop retinoblastoma in mice, whereas loss of Rb alone is not sufficient to generate murine retinoblastoma (Dannenberg et al. 2004;
Robanus-Maandag et al. 1998). Since Rb loss alone does not lead to tumorigenesis and Rb function is highly context specific, this dissertation project aimed to determine whether Rb has unique and or more prominent roles in the context of injury and
8 subsequent epithelial remodeling that characterizes the environment wherein cancers
frequently occur.
Rb regulates differentiation
Rb is important in controlling cellular differentiation. Accordingly, the Rb knockout mouse exhibits differentiation defects including lack of erythrocyte and lens cell terminal differentiation (Jacks et al. 1992; Lee et al. 1992). Tissue specific ablation of Rb has also demonstrated the importance of Rb in neuronal and myoblast differentiation (Chen et al. 2007; Zacksenhaus et al. 1996). Rb regulates differentiation through interaction with a diverse range of transcription factors and signaling molecules. Numerous in vitro studies have demonstrated the interaction of
Rb with factors important in differentiation in multiple cell types including, myocytes, adipocytes, and osteoblasts. For example, C/EBPs (CCAAT/enhancer- binding proteins) are important in adipose lineage regulation. Rb is known to bind to
C/EBP ß and enhance its transactivational activity (Chen et al. 1996). Furthermore,
C/EBP ß DNA-binding activity is regulated by its interaction with hypophosphorylated Rb, thus the progression of the cell cycle is linked to initiation of adipocyte differentiation (Cole et al. 2004). Rb is also an inducer of osteoblast differentiation. Rb is required for osteoblastic differentiation stimulated by BMP-2 in
MEFs in culture (Thomas et al. 2001). The role of Rb in differentiation has been characterized in myogenesis both in vivo and in vitro. MyoD is a transcription factor important in muscle differentiation, and Rb is known to modulate MyoD transcriptional activity and induce MyoD gene expression. Therefore, Rb plays a
9 critical role in induction of differentiation in many cell types, at least in part through
interactions with transcription factors (Novitch et al. 1999; Zacksenhaus et al. 1996).
The role of Rb in differentiation is not entirely secondary to its role in cell
cycle regulation. Studies in Rb-/- embryos demonstrated that although
mechanosensory hair cells fail to exit cell cycle, they maintain a proper differentiation
schedule and function (Mantela et al. 2005; Sage et al. 2005). Additionally, ablation
of Rb in the skin epithelium results in hyperplasia and increased proliferation
coincident with expression of terminal differentiation markers (Ruiz et al. 2004).
Thus, Rb regulates differentiation and proliferation through independent mechanisms.
For this reason, the effects of Rb loss on lung epithelial proliferation and differentiation were both assessed in the current studies.
Rb regulates apoptosis
The first studies revealing the role of Rb as an inhibitor of apoptosis involved
the observation of extensive apoptosis in the Rb null mouse. Germline Rb ablation
results in apoptosis in the ocular lens, liver, and nervous systems (Jacks et al. 1992;
Lee et al. 1992; Morgenbesser et al. 1994). Consistent with this observation, tissue
specific Rb loss results in increased apoptosis in a variety of cell types, including the
lung and prostate, indicating the importance of eliminating aberrant Rb null cells
(Maddison et al. 2004; Wikenheiser-Brokamp 2004). Additionally, in vitro Rb-/-
muscle and neuronal cells are hypersensitive to apoptotic stimuli (Lipinski & Jacks
1999).
Rb mediated apoptotic control involves negative regulation of E2F1 and
E2F3. E2F1 and E2F3 can function as proapoptotic molecules, in addition to
10 controlling cell cycle promotion. Accordingly, Rb-/-E2F1-/- and Rb-/-E2F3-/- double
mutant mice exhibit increased survival resulting from partial suppression of apoptosis
(Yamasaki et al. 1998; Ziebold et al. 2001). Therefore, E2F inhibition provides a
mechanism underlying Rb mediated apoptotic control.
Timing of Rb ablation determines phenotypic outcomes in cells in culture
The precise timing of Rb ablation is important in determining phenotypic outcomes in cells in culture (Ruiz et al. 2004; Sage et al. 2003). Sage et al. evaluated the effects of Rb loss under two conditions: 1) acute inactivation by conditionally ablating Rb in vitro, and 2) germline inactivation by ablating Rb in vivo before cell culture. These studies highlighted distinct phenotypes that were directly dependent on timing of Rb loss in MEFs. Specifically, acute Rb loss resulted in cell cycle reentry in quiescent cells while cells that had undergone germline Rb loss maintained the growth arrested state. A similar finding was observed in senescent cells whereby acute Rb loss caused reversal of cellular senescence while germline Rb loss did not affect the senescent state (Sage et al. 2003). Additional studies in keratinocytes in culture further highlighted phenotypic distinctions based upon timing of Rb loss.
Specifically, keratinocytes were refractory to cell cycle arrest via calcium induced differentiation upon acute Rb loss (Ruiz et al. 2004). In contrast, keratinocytes that had undergone Rb loss in vivo resembled wild type cells in this study.
Loss of cellular senescence and quiescence in Rb nulls cells could reflect Rb
dependent functions that are critical for tumor suppression. However, the
physiological significance of timing of Rb ablation is not fully understood in vivo.
Mouse models of human cancer often utilize germline knockout strategies that do not
11 account for possible developmental compensation. Thus, germline gene ablation may
have different consequences than somatic gene loss. Through use of conditional
knockout strategies, the significance of specific timing of Rb loss can be determined in vivo. This dissertation project directly tests the effects of prenatal vs postnatal Rb loss on the pulmonary epithelium by utilizing conditional lung epithelial specific ablation.
12 Rb is a critical regulator in the lung epithelium
Rb is inactivated in lung cancer
The Rb pathway is inactivated in nearly all lung cancers demonstrating its
crucial role in tumor suppression in the lung epithelium and highlighting the
importance of studying Rb mediated regulation in the pulmonary epithelium. Lung
cancer is the leading cause of cancer related deaths in both males and females
(Minna et al. 2002). It accounts for more cancer deaths than breast, prostate, and
colon cancer combined. Perhaps most striking is the tremendous lethality of lung
cancer. The five year patient survival rate is approximately 10-15% (ACS, 2005)
(Salgia et al. 1998). Late stage presentation is the fundamental cause of this minimal
survival rate and is compounded by the lack of effective treatment options. The
survival advantage to early lung cancer detection is highlighted by the dramatic
difference in five year survival rates in different stages of the disease. The five year
survival of patients that present with Stage 1 disease is approximately 50%. In drastic
contrast, the five year survival rate for patients in late Stage IV disease is
approximately 2% (American Joint Committee on Cancer, 2002). The need to
diagnose lung cancer at an early and potentially curable stage emphasizes the
importance of understanding the molecular pathogenesis of this disease. Through
identification of cancer related genes that are genetically altered in human cancers, we can begin to understand the disease process.
Rb inactivation can occur through multiple mechanisms. First, Rb loss can result from Rb gene mutation or deletion (Cobrinik 2005; Wang et al. 1994). Second,
Rb function can be inhibited by binding to viral oncogenes such as the human
13 papillomavirus E7, although there is no evidence of this phenomenon in lung tumors
(Dyson et al. 1989; Munger et al. 1989). Lastly, Rb can be inactivated by phosphorylation due to deregulation of upstream pathway components. This mode of
Rb inactivation most frequently occurs through loss of p16 expression and subsequent increased Cyclin D/cdk4/cdk6 mediated Rb phosphorylation (Sherr 1996; Sherr
2000). Generally, p16 inactivation occurs through allelic loss or promoter hypermethylation rather than direct mutation (Belinsky 2004; Dammann et al. 2005;
Divine et al. 2005; Kim et al. 2001; Russo et al. 2005). Regardless of the mechanism, loss of Rb function is considered to be the critical consequence that facilitates carcinogenesis.
The vast majority of adult primary lung malignancies are derived from
epithelial cells (Minna et al. 2002). Germline and somatic Rb loss is associated with a
heightened incidence of lung cancer (Kleinerman et al. 2000). Accordingly, people
who are carriers of a germline Rb mutation are 15 times more likely to die from lung
cancer than the general public, and develop lung carcinomas at a younger age
(Sanders et al. 1989; Strong et al. 1984). Strikingly, Rb function is lost in most, if not
all, lung cancers irrespective of subtype and deregulation of the Rb pathway is
detected in preneoplastic lesions providing evidence that Rb inactivation represents
an early event in lung cancer progression (Wistuba et al. 2002). Loss of p16 expression, and thus Rb inactivation, is detected in epithelial dysplasia and carcinoma in situ that precedes development of invasive squamous cell carcinoma
(Wikenheiser-Brokamp 2006b). Interestingly, loss of heterozygosity at the p16 gene locus and p16 hypermethylation have even been reported in histologically normal
14 epithelium in lungs of smokers but not non-smokers, implicating the Rb pathway in
lung cancer initiation in the setting of tobacco smoke induced chronic injury. This
dissertation project directly tests whether Rb function is critical in lung epithelial remodeling after injury with the goal of identifying Rb functions that are not only important in the repairing lung epithelium, but also critical in suppressing lung cancer initiation. These studies represent an initial step in the long term goal to develop new screening and treatment modalities for this devastating disease.
15 Proper lung epithelial remodeling is important in restoring lung
function after injury
Pulmonary injury contributes to the pathogenesis of lung disease
One of the most common causes of chronic lung injury is cigarette smoke
which is toxic to the respiratory epithelium. Chronic epithelial remodeling is thus
thought to contribute to multiple lung diseases including chronic obstructive
pulmonary disease and emphysema. Tobacco smoke is a complex mixture of
chemical compounds including genotoxic agents, free radicals, and other oxidants that induce DNA and tissue damage (Hogg 2001; MacNee 2005; Smith et al. 2006).
Cigarette smoke causes lung damage by direct release of toxic reactive products, as well as activating inflammatory processes. Various components of cigarette smoke, such as nicotine, act as cytotoxants that directly damage tissue. Smoke irritates airway passages by causing excess mucus production, that in combination with inflammation, is destructive to the pulmonary epithelium (Saetta et al. 2000). Thus, exposure to cigarette smoke causes DNA damage as well as creates an environment of inflammation and chronic epithelial remodeling.
Emerging hypotheses suggest that chronic injury could contribute to lung
tumor formation (Hill et al. 2003; Samet 2000). If chronic epithelial remodeling contributed to lung tumorigenesis, one would expect that chronic lung disease unassociated with cigarette smoking would be correlated with increased cancer risk.
This is in fact the case. Specifically, patients with idiopathic pulmonary fibrosis, a condition characterized by continual epithelial damage, have a significantly increased risk of lung cancer independent of patient smoking status (Hubbard et al. 2000;
16 Mayne et al. 1999; Samet 2000; Subramanian et al. 2007). Further support that
chronic injury can predispose to lung cancer is demonstrated in the correlation
between systemic sclerosis associated lung disease and an elevated risk of lung cancer
(Daniels et al. 2005; Hill et al. 2003; Peters-Golden et al. 1985; Roumm et al. 1985).
The association of chronic lung disease with increased cancer risk supports the
hypothesis that the state of chronic epithelial remodeling could provide prime
conditions for lung cancer initiation and/or progression. Therefore, the remodeling
lung epithelium may provide an environment wherein the lung is particularly
sensitive to Rb loss. Rb ablation in multiple epithelial cell types in the mouse results
in minimal phenotypes despite convincing human data clearly identifying Rb as a
critical tumor suppressor. A possible explanation for this discrepancy is that Rb may
play a unique or more prominent role in specific cellular contexts, such as repair after
injury. Studies in porcine cardiac models suggest that Rb contributes to repair in the context of vascular restenosis (Gallo et al. 1999). Although lung cancer frequently occurs in the setting of chronic injury, the role of Rb in this microenvironment has not been established. This dissertation directly compares the effects of pulmonary epithelial Rb loss in the context of homeostasis versus lung remodeling after injury with the goal of elucidating context specific Rb functions that have relevance to Rb’s role as a tumor suppressor.
Pulmonary progenitor/stem cells are critical in epithelial remodeling
The lung is a dynamic organ responsible for ventilation, air conduction, and respiration (Kierszenbaum, 2002). The respiratory tract is divided into conducting and respiratory segments. The conducting portion of the lung is lined by a
17 heterogeneous pseudostratified columnar epithelium including five major cell types;
ciliated cells, goblet cells, Clara cells, basal cells, and neuroendocrine cells. The
respiratory airways function in gas exchange and are lined by of Type I and Type II
cells. During homeostasis, the lung has very low levels of cellular turnover.
However, rapid epithelial proliferation and differentiation can be induced following
lung injury, and these processes are essential for epithelial reconstitution.
The current understanding of lung epithelial repair after injury is broadly based on studies utilizing a mouse injury model generated by exposure to the polyaromatic hydrocarbon, naphthalene. This model is a well characterized and accepted means of studying acute lung epithelial repair. Moreover, naphthalene injury has been widely utilized for identifying progenitor and stem cell populations in the lung epithelium.
Multiple cell types with progenitor and stem cell characteristics are important for proper airway repair after injury. In the conducting airway, Clara cells act as progenitor cells capable of self renewal and differentiating into ciliated cells (Evans et al. 1978; Van Winkle et al. 1995). A subpopulation of Clara cells, termed variant
Clara cells, are resistant to naphthalene induced injury, and have been identified as an important population that proliferates after injury (Buckpitt et al. 1995; Reynolds et al. 2000). Transgenic mice with Clara cell specific ablation are not able to repopulate the airway after naphthalene exposure, demonstrating that Clara cells are required for epithelial regeneration after injury (Hong et al. 2001). Pulmonary neuroendocrine cells are also important in the lung injury response. Clusters of neuroendocrine (NE) cells called neuroendocrine bodies (NEBs) are critical components of the progenitor/stem cell niche (Reynolds et al. 2000; Van Winkle et al. 1995). NEBs
18 serve as a reservoir for variant Clara cells, and current hypotheses state that proliferation of NE cells after injury contributes to focal regeneration (Reynolds et al.
2000).
Recently, a population of cells with stem cell properties were identified in the murine lung (Kim et al. 2005). Bronchioalveolar stem cells (BASCs) are located at the junction between the bronchiolar and alveolar region, and by definition, co- express the Clara cell marker, Clara cell secretory protein (CCSP) and the Type II cell marker, surfactant protein C (SPC). BASCs exhibit self renewal and multipotency in culture, however, their ability to perform these functions in vivo has not been demonstrated. Recent data by Kim et al. suggests that BASCs are involved in lung epithelial repair after injury (Kim et al. 2005). Characteristic of a stem cell population, BASCs are resistant to multiple types of pulmonary injury, and proliferate and differentiate in response to epithelial damage presumably as an initial response that results in reconstitution of the lung epithelium. BASCs also become highly proliferative following unilateral pneumonectomy, supporting a role for BASCs in compensatory lung regrowth (Nolen-Walston et al. 2008). Recently, studies identified Gata6, a transcription factor important in the Wnt-ß-catenin signaling pathway, as a factor important in BASC regulation during epithelial regeneration
(Zhang et al. 2008). Accordingly, depletion of Gata6, resulted in BASC expansion, decreased differentiation, and incomplete airway repair after lung injury. These data indicate that Gata6 is critical in BASC regulation during airway regeneration, and importantly, proper BASCs control is essential to appropriate airway remodeling.
Since Rb function is vital in the repairing lung, a facet of Rb mediated regulation
19 could involve control of pulmonary stem cells. Altogether these data demonstrate a
pulmonary cell population with stem cell characteristics that is involved in repair after injury.
BASCs not only play a role in epithelial regeneration, but have also been
implicated as cells of origin for lung cancer (Kim 2007). Several regulatory pathways
have been identified in BASC control, some of which include cell cycle components.
For example, when mutant p27, a CKI, is expressed in the murine lung, tumors and
BASC expansion occur (Besson et al. 2007). Additionally, p18, a member of the ink4
family of cyclin dependent kinase inhibitors, negatively regulates BASCs number.
Accordingly, p18-/- lungs exhibit increased BASCs and p18 loss cooperates with loss
of the tumor suppressor Men1 in lung tumorigenesis (Pei et al. 2007). The proposed
central roles for BASCs in lung epithelial repair after injury and cancer initiation led
us to hypothesize that an aspect of Rb’s tumor suppressive function could involve
control of pulmonary stem cells. This hypothesis is further supported by recent
studies that show Rb plays a critical role in stem cell regulation. For example, Rb
ablation in trophoblast stem cells leads to hyperproliferation, global placental
disruption, and embryonic lethality (Wenzel et al. 2007). Rb also plays an essential
role in stem cell regulation in the plant Arabidopsis (Wildwater et al. 2005).
Reduction of Rb expression via a root specific RNAi system results in increased
numbers of stem cells. Conversely, Rb overexpression in Arabidopsis roots leads to
rapid stem cell loss. Finally, Rb regulates epithelial stem cells in the skin.
Interestingly, Rb ablation in the skin epithelium results in reduced stem cell number
(Ruiz et al. 2004). Taken together, these data demonstrate that Rb is important in
20 stem cell regulation and that Rb influences stem cell populations in a context and/or
cell type specific manner. This dissertation project directly tests the effects of Rb ablation on pulmonary stem cells under homeostasic conditions and in the repairing lung.
21
Summary
Lung cancer and other lung diseases including, asthma, emphysema, and
chronic obstructive pulmonary disease occur in the context of chronic pulmonary
injury and airway remodeling. These pulmonary disorders are significant
contributors to human morbidity and mortality. Rb is a critical regulator in the lung
epithelium as evidenced by its nearly universal inactivation in lung cancer. The
central hypothesis of this dissertation is that Rb function is critical during pulmonary
repair after injury. This hypothesis is directly tested in an in vivo mouse model by
the following specific aims:
Specific Aim 1: Determine the effects of Rb ablation on lung epithelial repair after
injury.
Specific Aim 2: Elucidate phenotypic effects of prenatal Rb ablation induced during development versus postnatal Rb ablation induced after birth.
Specific Aim 3: Elucidate the role of Rb in the lung after chronic epithelial damage.
Specific Aim 4: Elucidate the effects of Rb loss on bronchiolalveolar stem cell number.
22
REFERENCES
American Joint Committee on Cancer. (2002) AJCC Cancer Staging Handbook.
Springer-Verlag, New York, New York.
American Cancer Society. Cancer Facts And Figures. (2005). www.cancer.org.
Agami R, Bernards R. Convergence of mitogenic and DNA damage signaling in the
G1 phase of the cell cycle. Cancer Lett 2002; 177 (2):111-8.
Alexander K, Hinds PW. Requirement for p27(KIP1) in retinoblastoma protein-
mediated senescence. Mol Cell Biol 2001; 21 (11):3616-31.
Artinian V, Kvale PA. Cancer and interstitial lung disease. Curr Opin Pulm Med
2004; 10 (5):425-34.
Balmer A, Zografos L, Munier F. Diagnosis and current management of retinoblastoma. Oncogene 2006; 25 (38):5341-9.
Balsitis SJ, Sage J, Duensing S et al. Recapitulation of the effects of the human
papillomavirus type 16 E7 oncogene on mouse epithelium by somatic Rb deletion and
detection of pRb-independent effects of E7 in vivo. Mol Cell Biol 2003; 23
(24):9094-103.
Bartek J, Bartkova J, Lukas J. The retinoblastoma protein pathway in cell cycle
control and cancer. Exp Cell Res 1997; 237 (1):1-6.
Beier HM, Kirchner C, Mootz U. Uteroglobin-like antigen in the pulmonary epithelium and secretion of the lung. Cell Tissue Res 1978; 190 (1):15-25.
Belinsky SA. Gene-promoter hypermethylation as a biomarker in lung cancer. Nat
Rev Cancer 2004; 4 (9):707-17.
23 Ben-Porath I, Weinberg RA. The signals and pathways activating cellular senescence.
Int J Biochem Cell Biol 2005; 37 (5):961-76.
Bernard A, Marchandise FX, Depelchin S et al. Clara cell protein in serum and
bronchoalveolar lavage. Eur Respir J 1992; 5 (10):1231-8.
Berndt N, Dohadwala M, Liu CW. Constitutively active protein phosphatase 1alpha
causes Rb-dependent G1 arrest in human cancer cells. Curr Biol 1997; 7 (6):375-86.
Besson A, Hwang HC, Cicero S et al. Discovery of an oncogenic activity in p27Kip1
that causes stem cell expansion and a multiple tumor phenotype. Genes Dev 2007; 21
(14):1731-46.
Binne UK, Classon MK, Dick FA et al. Retinoblastoma protein and anaphase-
promoting complex physically interact and functionally cooperate during cell-cycle
exit. Nat Cell Biol 2007; 9 (2):225-32.
Brehm A, Miska EA, McCance DJ et al. Retinoblastoma protein recruits histone
deacetylase to repress transcription. Nature 1998; 391 (6667):597-601.
Broeckaert F, Clippe A, Knoops B et al. Clara cell secretory protein (CC16): features as a peripheral lung biomarker. Ann N Y Acad Sci 2000; 923:68-77.
Buchkovich K, Duffy LA, Harlow E. The retinoblastoma protein is phosphorylated during specific phases of the cell cycle. Cell 1989; 58 (6):1097-105.
Buckpitt A, Chang AM, Weir A et al. Relationship of cytochrome P450 activity to
Clara cell cytotoxicity. IV. Metabolism of naphthalene and naphthalene oxide in microdissected airways from mice, rats, and hamsters. Mol Pharmacol 1995; 47
(1):74-81.
24 Canepa ET, Scassa ME, Ceruti JM et al. INK4 proteins, a family of mammalian CDK
inhibitors with novel biological functions. IUBMB Life 2007; 59 (7):419-26.
Chen D, Opavsky R, Pacal M et al. Rb-Mediated Neuronal Differentiation through
Cell-Cycle-Independent Regulation of E2f3a. PLoS Biol 2007; 5 (7):e179.
Chen PL, Riley DJ, Chen Y et al. Retinoblastoma protein positively regulates
terminal adipocyte differentiation through direct interaction with C/EBPs. Genes Dev
1996; 10 (21):2794-804.
Clarke AR, Maandag ER, van Roon M et al. Requirement for a functional Rb-1 gene
in murine development. Nature 1992; 359 (6393):328-30.
Classon M, Dyson N. p107 and p130: versatile proteins with interesting pockets. Exp
Cell Res 2001; 264 (1):135-47.
Classon M, Harlow E. The retinoblastoma tumour suppressor in development and
cancer. Nat Rev Cancer 2002; 2 (12):910-7.
Classon M, Salama S, Gorka C et al. Combinatorial roles for pRB, p107, and p130 in
E2F-mediated cell cycle control. Proc Natl Acad Sci U S A 2000; 97 (20):10820-5.
Cobrinik D. Pocket proteins and cell cycle control. Oncogene 2005; 24 (17):2796-
809.
Cole KA, Harmon AW, Harp JB et al. Rb regulates C/EBPbeta-DNA-binding activity
during 3T3-L1 adipogenesis. Am J Physiol Cell Physiol 2004; 286 (2):C349-54.
Dammann R, Strunnikova M, Schagdarsurengin U et al. CpG island methylation and
expression of tumour-associated genes in lung carcinoma. Eur J Cancer 2005; 41
(8):1223-36.
25 Daniels CE, Jett JR. Does interstitial lung disease predispose to lung cancer? Curr
Opin Pulm Med 2005; 11 (5):431-7.
Dannenberg JH, Schuijff L, Dekker M et al. Tissue-specific tumor suppressor activity of retinoblastoma gene homologs p107 and p130. Genes Dev 2004; 18 (23):2952-62.
Daria D, Filippi MD, Knudsen ES et al. The retinoblastoma tumor suppressor is a critical intrinsic regulator for hematopoietic stem and progenitor cells under stress.
Blood 2008; 111 (4):1894-902.
Decesse JT, Medjkane S, Datto MB et al. RB regulates transcription of the p21/WAF1/CIP1 gene. Oncogene 2001; 20 (8):962-71.
DeGregori J, Johnson DG. Distinct and Overlapping Roles for E2F Family Members in Transcription, Proliferation and Apoptosis. Curr Mol Med 2006; 6 (7):739-48.
DeGregori J, Kowalik T, Nevins JR. Cellular targets for activation by the E2F1 transcription factor include DNA synthesis- and G1/S-regulatory genes. Mol Cell
Biol 1995; 15 (8):4215-24.
Deng C, Zhang P, Harper JW et al. Mice lacking p21CIP1/WAF1 undergo normal development, but are defective in G1 checkpoint control. Cell 1995; 82 (4):675-84.
Devi SS, Mehendale HM. Disrupted G1 to S phase clearance via cyclin signaling impairs liver tissue repair in thioacetamide-treated type 1 diabetic rats. Toxicol Appl
Pharmacol 2005; 207 (2):89-102.
DiCiommo D, Gallie BL, Bremner R. Retinoblastoma: the disease, gene and protein provide critical leads to understand cancer. Semin Cancer Biol 2000; 10 (4):255-69.
26 Dierynck I, Bernard A, Roels H et al. Potent inhibition of both human interferon- gamma production and biologic activity by the Clara cell protein CC16. Am J Respir
Cell Mol Biol 1995; 12 (2):205-10.
Dimova DK, Dyson NJ. The E2F transcriptional network: old acquaintances with new faces. Oncogene 2005; 24 (17):2810-26.
Divine KK, Pulling LC, Marron-Terada PG et al. Multiplicity of abnormal promoter methylation in lung adenocarcinomas from smokers and never smokers. Int J Cancer
2005; 114 (3):400-5.
Dyson N. The regulation of E2F by pRB-family proteins. Genes Dev 1998; 12
(15):2245-62.
Dyson N, Howley PM, Munger K et al. The human papilloma virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product. Science 1989; 243
(4893):934-7.
Evans MJ, Cabral-Anderson LJ, Freeman G. Role of the Clara cell in renewal of the bronchiolar epithelium. Lab Invest 1978; 38 (6):648-53.
Ewen ME, Sluss HK, Sherr CJ et al. Functional interactions of the retinoblastoma protein with mammalian D-type cyclins. Cell 1993; 73 (3):487-97.
Falls HF, Neel JV. Genetics of retinoblastoma. AMA Arch Ophthalmol 1951; 46
(4):367-89.
Fausto N. Mouse liver tumorigenesis: models, mechanisms, and relevance to human disease. Semin Liver Dis 1999; 19 (3):243-52.
27 Flemington EK, Speck SH, Kaelin WG, Jr. E2F-1-mediated transactivation is
inhibited by complex formation with the retinoblastoma susceptibility gene product.
Proc Natl Acad Sci U S A 1993; 90 (15):6914-8.
Friend SH, Bernards R, Rogelj S et al. A human DNA segment with properties of the
gene that predisposes to retinoblastoma and osteosarcoma. Nature 1986; 323
(6089):643-6.
Frolov MV, Dyson NJ. Molecular mechanisms of E2F-dependent activation and
pRB-mediated repression. J Cell Sci 2004; 117 (Pt 11):2173-81.
Gallo R, Padurean A, Jayaraman T et al. Inhibition of intimal thickening after balloon
angioplasty in porcine coronary arteries by targeting regulators of the cell cycle.
Circulation 1999; 99 (16):2164-70.
Giangreco A, Reynolds SD, Stripp BR. Terminal bronchioles harbor a unique airway
stem cell population that localizes to the bronchoalveolar duct junction. Am J Pathol
2002; 161 (1):173-82.
Haigis K, Sage J, Glickman J et al. The related retinoblastoma (pRb) and p130 proteins cooperate to regulate homeostasis in the intestinal epithelium. J Biol Chem
2006; 281 (1):638-47.
Harbour JW, Dean DC. Chromatin remodeling and Rb activity. Curr Opin Cell Biol
2000; 12 (6):685-9.
Harrington EA, Bruce JL, Harlow E et al. pRB plays an essential role in cell cycle arrest induced by DNA damage. Proc Natl Acad Sci U S A 1998; 95 (20):11945-50.
Harrod KS, Mounday AD, Stripp BR et al. Clara cell secretory protein decreases lung inflammation after acute virus infection. Am J Physiol 1998; 275 (5 Pt 1):L924-30.
28 Helin K, Ed H. The retinoblastoma protein as a transcriptional repressor. Trends Cell
Biol 1993; 3 (2):43-6.
Herrera RE, Sah VP, Williams BO et al. Altered cell cycle kinetics, gene expression, and G1 restriction point regulation in Rb-deficient fibroblasts. Mol Cell Biol 1996; 16
(5):2402-7.
Hill CL, Nguyen AM, Roder D et al. Risk of cancer in patients with scleroderma: a population based cohort study. Ann Rheum Dis 2003; 62 (8):728-31.
Hinds PW, Mittnacht S, Dulic V et al. Regulation of retinoblastoma protein functions by ectopic expression of human cyclins. Cell 1992; 70 (6):993-1006.
Hogg JC. Chronic obstructive pulmonary disease: an overview of pathology and pathogenesis. Novartis Found Symp 2001; 234:4-19; discussion -26.
Hong KU, Reynolds SD, Giangreco A et al. Clara cell secretory protein-expressing cells of the airway neuroepithelial body microenvironment include a label-retaining subset and are critical for epithelial renewal after progenitor cell depletion. Am J
Respir Cell Mol Biol 2001; 24 (6):671-81.
Hubbard R, Venn A, Lewis S et al. Lung cancer and cryptogenic fibrosing alveolitis.
A population-based cohort study. Am J Respir Crit Care Med 2000; 161 (1):5-8.
Huh MS, Parker MH, Scime A et al. Rb is required for progression through myogenic differentiation but not maintenance of terminal differentiation. J Cell Biol 2004; 166
(6):865-76.
Hurford RK, Jr., Cobrinik D, Lee MH et al. pRB and p107/p130 are required for the regulated expression of different sets of E2F responsive genes. Genes Dev 1997; 11
(11):1447-63.
29 Iaquinta PJ, Lees JA. Life and death decisions by the E2F transcription factors. Curr
Opin Cell Biol 2007; 19 (6):649-57.
Iavarone A, King ER, Dai XM et al. Retinoblastoma promotes definitive erythropoiesis by repressing Id2 in fetal liver macrophages. Nature 2004; 432
(7020):1040-5.
Ishida S, Huang E, Zuzan H et al. Role for E2F in control of both DNA replication and mitotic functions as revealed from DNA microarray analysis. Mol Cell Biol
2001; 21 (14):4684-99.
Jacks T, Fazeli A, Schmitt EM et al. Effects of an Rb mutation in the mouse. Nature
1992; 359 (6393):295-300.
Janzen V, Forkert R, Fleming HE et al. Stem-cell ageing modified by the cyclin- dependent kinase inhibitor p16INK4a. Nature 2006; 443 (7110):421-6.
Ji P, Jiang H, Rekhtman K et al. An Rb-Skp2-p27 pathway mediates acute cell cycle inhibition by Rb and is retained in a partial-penetrance Rb mutant. Mol Cell 2004; 16
(1):47-58.
Johnston CJ, Mango GW, Finkelstein JN et al. Altered pulmonary response to hyperoxia in Clara cell secretory protein deficient mice. Am J Respir Cell Mol Biol
1997; 17 (2):147-55.
Johnston CJ, Stripp BR, Piedbeouf B et al. Inflammatory and epithelial responses in mouse strains that differ in sensitivity to hyperoxic injury. Exp Lung Res 1998; 24
(2):189-202.
30 Kato J, Matsushime H, Hiebert SW et al. Direct binding of cyclin D to the retinoblastoma gene product (pRb) and pRb phosphorylation by the cyclin D- dependent kinase CDK4. Genes Dev 1993; 7 (3):331-42.
Kierszenbaum A.L. Histology and Cell Biology, Mosby Inc. New York, New York,
2002
Kim CF. Paving the road for lung stem cell biology: bronchioalveolar stem cells and
other putative distal lung stem cells. Am J Physiol Lung Cell Mol Physiol 2007; 293
(5):L1092-8.
Kim CF, Jackson EL, Woolfenden AE et al. Identification of bronchioalveolar stem
cells in normal lung and lung cancer. Cell 2005; 121 (6):823-35.
Kim DH, Nelson HH, Wiencke JK et al. p16(INK4a) and histology-specific
methylation of CpG islands by exposure to tobacco smoke in non-small cell lung
cancer. Cancer Res 2001; 61 (8):3419-24.
Kleinerman RA, Tarone RE, Abramson DH et al. Hereditary retinoblastoma and risk
of lung cancer. J Natl Cancer Inst 2000; 92 (24):2037-9.
Knudsen ES, Knudsen KE. Retinoblastoma tumor suppressor: where cancer meets the
cell cycle. Exp Biol Med (Maywood) 2006a; 231 (7):1271-81.
Knudsen ES, Sexton CR, Mayhew CN. Role of the retinoblastoma tumor suppressor
in the maintenance of genome integrity. Curr Mol Med 2006b; 6 (7):749-57.
Knudsen ES, Wang JY. Differential regulation of retinoblastoma protein function by
specific Cdk phosphorylation sites. J Biol Chem 1996; 271 (14):8313-20.
31 Knudsen ES, Wang JY. Dual mechanisms for the inhibition of E2F binding to RB by cyclin-dependent kinase-mediated RB phosphorylation. Mol Cell Biol 1997; 17
(10):5771-83.
Knudson AG, Jr. Mutation and cancer: statistical study of retinoblastoma. Proc Natl
Acad Sci U S A 1971; 68 (4):820-3.
Koff A, Cross F, Fisher A et al. Human cyclin E, a new cyclin that interacts with two members of the CDC2 gene family. Cell 1991; 66 (6):1217-28.
Krishnamurthy J, Ramsey MR, Ligon KL et al. p16INK4a induces an age-dependent decline in islet regenerative potential. Nature 2006; 443 (7110):453-7.
Kucherlapati MH, Nguyen AA, Bronson RT et al. Inactivation of conditional Rb by
Villin-Cre leads to aggressive tumors outside the gastrointestinal tract. Cancer Res
2006; 66 (7):3576-83.
Lee EY, Chang CY, Hu N et al. Mice deficient for Rb are nonviable and show defects in neurogenesis and haematopoiesis. Nature 1992; 359 (6393):288-94.
Lee MH, Williams BO, Mulligan G et al. Targeted disruption of p107: functional overlap between p107 and Rb. Genes Dev 1996; 10 (13):1621-32.
Lesur O, Bernard A, Arsalane K et al. Clara cell protein (CC-16) induces a phospholipase A2-mediated inhibition of fibroblast migration in vitro. Am J Respir
Crit Care Med 1995; 152 (1):290-7.
Lew DJ, Dulic V, Reed SI. Isolation of three novel human cyclins by rescue of G1 cyclin (Cln) function in yeast. Cell 1991; 66 (6):1197-206.
Li Y, Jenkins CW, Nichols MA et al. Cell cycle expression and p53 regulation of the cyclin-dependent kinase inhibitor p21. Oncogene 1994; 9 (8):2261-8.
32 Lipinski MM, Jacks T. The retinoblastoma gene family in differentiation and
development. Oncogene 1999; 18 (55):7873-82.
Lipinski MM, Macleod KF, Williams BO et al. Cell-autonomous and non-cell-
autonomous functions of the Rb tumor suppressor in developing central nervous
system. Embo J 2001; 20 (13):3402-13.
Loonstra A, Vooijs M, Beverloo HB et al. Growth inhibition and DNA damage
induced by Cre recombinase in mammalian cells. Proc Natl Acad Sci U S A 2001; 98
(16):9209-14.
Ludlow JW, Glendening CL, Livingston DM et al. Specific enzymatic
dephosphorylation of the retinoblastoma protein. Mol Cell Biol 1993; 13 (1):367-72.
Lukas J, Parry D, Aagaard L et al. Retinoblastoma-protein-dependent cell-cycle
inhibition by the tumour suppressor p16. Nature 1995; 375 (6531):503-6.
Macaluso M, Montanari M, Giordano A. Rb family proteins as modulators of gene expression and new aspects regarding the interaction with chromatin remodeling enzymes. Oncogene 2006; 25 (38):5263-7.
MacNee W. Oxidants and COPD. Curr Drug Targets Inflamm Allergy 2005; 4
(6):627-41.
Maddison LA, Sutherland BW, Barrios RJ et al. Conditional deletion of Rb causes early stage prostate cancer. Cancer Res 2004; 64 (17):6018-25.
Maeda S, Kamata H, Luo JL et al. IKKbeta couples hepatocyte death to cytokine-
driven compensatory proliferation that promotes chemical hepatocarcinogenesis. Cell
2005; 121 (7):977-90.
33 Mantela J, Jiang Z, Ylikoski J et al. The retinoblastoma gene pathway regulates the postmitotic state of hair cells of the mouse inner ear. Development 2005; 132
(10):2377-88.
Markey MP, Angus SP, Strobeck MW et al. Unbiased analysis of RB-mediated transcriptional repression identifies novel targets and distinctions from E2F action.
Cancer Res 2002; 62 (22):6587-97.
Mason-Richie NA, Mistry MJ, Gettler CA et al. Retinoblastoma function is essential for establishing lung epithelial quiescence after injury. Cancer Res 2008; 68
(11):4068-76.
Mattsson J, Remberger M, Andersson O et al. Decreased serum levels of clara cell secretory protein (CC16) are associated with bronchiolitis obliterans and may permit early diagnosis in patients after allogeneic stem-cell transplantation. Transplantation
2005; 79 (10):1411-6.
Mayhew CN, Bosco EE, Fox SR et al. Liver-specific pRB loss results in ectopic cell cycle entry and aberrant ploidy. Cancer Res 2005; 65 (11):4568-77.
Mayne ST, Buenconsejo J, Janerich DT. Previous lung disease and risk of lung cancer among men and women nonsmokers. Am J Epidemiol 1999; 149 (1):13-20.
Meuwissen R, Linn SC, Linnoila RI et al. Induction of small cell lung cancer by somatic inactivation of both Trp53 and Rb1 in a conditional mouse model. Cancer
Cell 2003; 4 (3):181-9.
Miele L, Cordella-Miele E, Facchiano A et al. Novel anti-inflammatory peptides from the region of highest similarity between uteroglobin and lipocortin I. Nature 1988;
335 (6192):726-30.
34 Minna JD, Roth JA, Gazdar AF. Focus on lung cancer. Cancer Cell 2002; 1 (1):49-
52.
Mittnacht S. Control of pRB phosphorylation. Curr Opin Genet Dev 1998; 8 (1):21-7.
Molofsky AV, Slutsky SG, Joseph NM et al. Increasing p16INK4a expression
decreases forebrain progenitors and neurogenesis during ageing. Nature 2006; 443
(7110):448-52.
Morgenbesser SD, Williams BO, Jacks T et al. p53-dependent apoptosis produced by
Rb-deficiency in the developing mouse lens. Nature 1994; 371 (6492):72-4.
Morris EJ, Dyson NJ. Retinoblastoma protein partners. Adv Cancer Res 2001; 82:1-
54.
Munger K, Werness BA, Dyson N et al. Complex formation of human papillomavirus
E7 proteins with the retinoblastoma tumor suppressor gene product. Embo J 1989; 8
(13):4099-105.
Nevins JR. The Rb/E2F pathway and cancer. Hum Mol Genet 2001; 10 (7):699-703.
Nevins JR. Transcriptional regulation. A closer look at E2F. Nature 1992; 358
(6385):375-6.
Nolen-Walston RD, Kim CF, Mazan MR et al. Cellular kinetics and modeling of
bronchioalveolar stem cell response during lung regeneration. Am J Physiol Lung
Cell Mol Physiol 2008; 294 (6):L1158-65.
Novitch BG, Mulligan GJ, Jacks T et al. Skeletal muscle cells lacking the retinoblastoma protein display defects in muscle gene expression and accumulate in S and G2 phases of the cell cycle. J Cell Biol 1996; 135 (2):441-56.
35 Novitch BG, Spicer DB, Kim PS et al. pRb is required for MEF2-dependent gene expression as well as cell-cycle arrest during skeletal muscle differentiation. Curr
Biol 1999; 9 (9):449-59.
O'Brien KA, Suverkropp C, Kanekal S et al. Tolerance to multiple doses of the pulmonary toxicant, naphthalene. Toxicol Appl Pharmacol 1989; 99 (3):487-500.
Okudela K, Ito T, Mitsui H et al. The role of p53 in bleomycin-induced DNA damage in the lung. A comparative study with the small intestine. Am J Pathol 1999; 155
(4):1341-51.
O'Reilly MA, Staversky RJ, Huyck HL et al. Bcl-2 family gene expression during severe hyperoxia induced lung injury. Lab Invest 2000; 80 (12):1845-54.
Pacal M, Bremner R. Insights from animal models on the origins and progression of retinoblastoma. Curr Mol Med 2006; 6 (7):759-81.
Park KS, Wells JM, Zorn AM et al. Transdifferentiation of ciliated cells during repair of the respiratory epithelium. Am J Respir Cell Mol Biol 2006; 34 (2):151-7.
Pei XH, Bai F, Smith MD et al. p18Ink4c collaborates with Men1 to constrain lung stem cell expansion and suppress non-small-cell lung cancers. Cancer Res 2007; 67
(7):3162-70.
Perl AK, Tichelaar JW, Whitsett JA. Conditional gene expression in the respiratory epithelium of the mouse. Transgenic Res 2002; 11 (1):21-9.
Peters-Golden M, Wise RA, Hochberg M et al. Incidence of lung cancer in systemic sclerosis. J Rheumatol 1985; 12 (6):1136-9.
Plopper CG, Suverkropp C, Morin D et al. Relationship of cytochrome P-450 activity to Clara cell cytotoxicity. I. Histopathologic comparison of the respiratory tract of
36 mice, rats and hamsters after parenteral administration of naphthalene. J Pharmacol
Exp Ther 1992; 261 (1):353-63.
Qin XQ, Chittenden T, Livingston DM et al. Identification of a growth suppression
domain within the retinoblastoma gene product. Genes Dev 1992; 6 (6):953-64.
Rawlins EL, Ostrowski LE, Randell SH et al. Lung development and repair:
contribution of the ciliated lineage. Proc Natl Acad Sci U S A 2007; 104 (2):410-7.
Reynolds SD, Giangreco A, Power JH et al. Neuroepithelial bodies of pulmonary airways serve as a reservoir of progenitor cells capable of epithelial regeneration. Am
J Pathol 2000; 156 (1):269-78.
Robanus-Maandag E, Dekker M, van der Valk M et al. p107 is a suppressor of
retinoblastoma development in pRb-deficient mice. Genes Dev 1998; 12 (11):1599-
609.
Rodin SN, Rodin AS. Origins and selection of p53 mutations in lung carcinogenesis.
Semin Cancer Biol 2005; 15 (2):103-12.
Ross JF, Liu X, Dynlacht BD. Mechanism of transcriptional repression of E2F by the
retinoblastoma tumor suppressor protein. Mol Cell 1999; 3 (2):195-205.
Roumm AD, Medsger TA, Jr. Cancer and systemic sclerosis. An epidemiologic
study. Arthritis Rheum 1985; 28 (12):1336-40.
Rubin SM, Gall AL, Zheng N et al. Structure of the Rb C-terminal domain bound to
E2F1-DP1: a mechanism for phosphorylation-induced E2F release. Cell 2005; 123
(6):1093-106.
37 Ruiz S, Santos M, Segrelles C et al. Unique and overlapping functions of pRb and
p107 in the control of proliferation and differentiation in epidermis. Development
2004; 131 (11):2737-48.
Russo AL, Thiagalingam A, Pan H et al. Differential DNA hypermethylation of
critical genes mediates the stage-specific tobacco smoke-induced neoplastic
progression of lung cancer. Clin Cancer Res 2005; 11 (7):2466-70.
Saetta M, Turato G, Baraldo S et al. Goblet cell hyperplasia and epithelial
inflammation in peripheral airways of smokers with both symptoms of chronic
bronchitis and chronic airflow limitation. Am J Respir Crit Care Med 2000; 161 (3 Pt
1):1016-21.
Sage C, Huang M, Karimi K et al. Proliferation of functional hair cells in vivo in the absence of the retinoblastoma protein. Science 2005; 307 (5712):1114-8.
Sage J, Miller AL, Perez-Mancera PA et al. Acute mutation of retinoblastoma gene function is sufficient for cell cycle re-entry. Nature 2003; 424 (6945):223-8.
Salgia R, Skarin AT. Molecular abnormalities in lung cancer. J Clin Oncol 1998; 16
(3):1207-17.
Samet JM. Does idiopathic pulmonary fibrosis increase lung cancer risk? Am J
Respir Crit Care Med 2000; 161 (1):1-2.
Sanders BM, Jay M, Draper GJ et al. Non-ocular cancer in relatives of retinoblastoma patients. Br J Cancer 1989; 60 (3):358-65.
Sankaran VG, Orkin SH, Walkley CR. Rb intrinsically promotes erythropoiesis by coupling cell cycle exit with mitochondrial biogenesis. Genes Dev 2008; 22 (4):463-
75.
38 Schiffmann E, Geetha V, Pencev D et al. Adherence and regulation of leukotaxis.
Agents Actions Suppl 1983; 12:106-20.
Schmidt EE, Taylor DS, Prigge JR et al. Illegitimate Cre-dependent chromosome rearrangements in transgenic mouse spermatids. Proc Natl Acad Sci U S A 2000; 97
(25):13702-7.
Scholzen T, Gerdes J. The Ki-67 protein: from the known and the unknown. J Cell
Physiol 2000; 182 (3):311-22.
Sherr CJ. Cancer cell cycles. Science 1996; 274 (5293):1672-7.
Sherr CJ. Cell cycle control and cancer. Harvey Lect 2000; 96:73-92.
Sherr CJ, McCormick F. The RB and p53 pathways in cancer. Cancer Cell 2002; 2
(2):103-12.
Sherr CJ, Roberts JM. Living with or without cyclins and cyclin-dependent kinases.
Genes Dev 2004; 18 (22):2699-711.
Shijubo N, Itoh Y, Yamaguchi T et al. Clara cell protein-positive epithelial cells are reduced in small airways of asthmatics. Am J Respir Crit Care Med 1999; 160
(3):930-3.
Shijubo N, Itoh Y, Yamaguchi T et al. Serum and BAL Clara cell 10 kDa protein
(CC10) levels and CC10-positive bronchiolar cells are decreased in smokers. Eur
Respir J 1997; 10 (5):1108-14.
Shimkin MB, Stoner GD. Lung tumors in mice: application to carcinogenesis bioassay. Adv Cancer Res 1975; 21:1-58.
Singh G, Katyal SL. Clara cells and Clara cell 10 kD protein (CC10). Am J Respir
Cell Mol Biol 1997; 17 (2):141-3.
39 Sisson TH, Hansen JM, Shah M et al. Expression of the reverse tetracycline-
transactivator gene causes emphysema-like changes in mice. Am J Respir Cell Mol
Biol 2006; 34 (5):552-60.
Smith CJ, Perfetti TA, King JA. Perspectives on pulmonary inflammation and lung
cancer risk in cigarette smokers. Inhal Toxicol 2006; 18 (9):667-77.
Smith EJ, Leone G, Nevins JR. Distinct mechanisms control the accumulation of the
Rb-related p107 and p130 proteins during cell growth. Cell Growth Differ 1998; 9
(4):297-303.
Soriano P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat
Genet 1999; 21 (1):70-1.
Spike BT, Dirlam A, Dibling BC et al. The Rb tumor suppressor is required for stress erythropoiesis. Embo J 2004; 23 (21):4319-29.
Srinivasan SV, Mayhew CN, Schwemberger S et al. RB loss promotes aberrant ploidy by deregulating levels and activity of DNA replication factors. J Biol Chem
2007; 282 (33):23867-77.
Sterner JM, Dew-Knight S, Musahl C et al. Negative regulation of DNA replication by the retinoblastoma protein is mediated by its association with MCM7. Mol Cell
Biol 1998; 18 (5):2748-57.
Stripp BR, Lund J, Mango GW et al. Clara cell secretory protein: a determinant of
PCB bioaccumulation in mammals. Am J Physiol 1996; 271 (4 Pt 1):L656-64.
Stripp BR, Reynolds SD. Maintenance and repair of the bronchiolar epithelium. Proc
Am Thorac Soc 2008; 5 (3):328-33.
40 Strong LC, Herson J, Haas C et al. Cancer mortality in relatives of retinoblastoma patients. J Natl Cancer Inst 1984; 73 (2):303-11.
Subramanian J, Govindan R. Lung cancer in never smokers: a review. J Clin Oncol
2007; 25 (5):561-70.
Sun A, Bagella L, Tutton S et al. From G0 to S phase: a view of the roles played by the retinoblastoma (Rb) family members in the Rb-E2F pathway. J Cell Biochem
2007; 102 (6):1400-4.
Tamrakar S, Mittnacht S, Ludlow JW. Binding of select forms of pRB to protein phosphatase type 1 independent of catalytic activity. Oncogene 1999; 18 (54):7803-9.
Tamrakar S, Rubin E, Ludlow JW. Role of pRB dephosphorylation in cell cycle regulation. Front Biosci 2000; 5:D121-37.
Thilly WG. Have environmental mutagens caused oncomutations in people? Nat
Genet 2003; 34 (3):255-9.
Thomas DM, Carty SA, Piscopo DM et al. The retinoblastoma protein acts as a transcriptional coactivator required for osteogenic differentiation. Mol Cell 2001; 8
(2):303-16.
Van Winkle LS, Buckpitt AR, Nishio SJ et al. Cellular response in naphthalene- induced Clara cell injury and bronchiolar epithelial repair in mice. Am J Physiol
1995; 269 (6 Pt 1):L800-18.
Vasanthakumar G, Manjunath R, Mukherjee AB et al. Inhibition of phagocyte chemotaxis by uteroglobin, an inhibitor of blastocyst rejection. Biochem Pharmacol
1988; 37 (3):389-94.
41 Vernell R, Helin K, Muller H. Identification of target genes of the p16INK4A-pRB-
E2F pathway. J Biol Chem 2003; 278 (46):46124-37.
Walkley CR, Shea JM, Sims NA et al. Rb regulates interactions between hematopoietic stem cells and their bone marrow microenvironment. Cell 2007; 129
(6):1081-95.
Wang JY, Knudsen ES, Welch PJ. The retinoblastoma tumor suppressor protein. Adv
Cancer Res 1994; 64:25-85.
Weinberg RA. The retinoblastoma protein and cell cycle control. Cell 1995; 81
(3):323-30.
Wenzel PL, Wu L, de Bruin A et al. Rb is critical in a mammalian tissue stem cell population. Genes Dev 2007; 21 (1):85-97.
Wikenheiser-Brokamp KA. Rb family proteins differentially regulate distinct cell lineages during epithelial development. Development 2004; 131 (17):4299-310.
Wikenheiser-Brokamp KA. Retinoblastoma family proteins: insights gained through genetic manipulation of mice. Cell Mol Life Sci 2006a; 63 (7-8):767-80.
Wikenheiser-Brokamp KA. Retinoblastoma regulatory pathway in lung cancer. Curr
Mol Med 2006b; 6 (7):783-93.
Wildwater M, Campilho A, Perez-Perez JM et al. The RETINOBLASTOMA-
RELATED gene regulates stem cell maintenance in Arabidopsis roots. Cell 2005; 123
(7):1337-49.
Wistuba, II, Mao L, Gazdar AF. Smoking molecular damage in bronchial epithelium.
Oncogene 2002; 21 (48):7298-306.
42 Witschi H, Espiritu I, Maronpot RR et al. The carcinogenic potential of the gas phase
of environmental tobacco smoke. Carcinogenesis 1997; 18 (11):2035-42.
Wu L, de Bruin A, Saavedra HI et al. Extra-embryonic function of Rb is essential for
embryonic development and viability. Nature 2003; 421 (6926):942-7.
Yamasaki L, Bronson R, Williams BO et al. Loss of E2F-1 reduces tumorigenesis and
extends the lifespan of Rb1(+/-)mice. Nat Genet 1998; 18 (4):360-4.
Yanagi S, Kishimoto H, Kawahara K et al. Pten controls lung morphogenesis,
bronchioalveolar stem cells, and onset of lung adenocarcinomas in mice. J Clin Invest
2007; 117 (10):2929-40.
Zacksenhaus E, Jiang Z, Chung D et al. pRb controls proliferation, differentiation,
and death of skeletal muscle cells and other lineages during embryogenesis. Genes
Dev 1996; 10 (23):3051-64.
Zhang Y, Goss AM, Cohen ED et al. A Gata6-Wnt pathway required for epithelial
stem cell development and airway regeneration. Nat Genet 2008; 40 (7):862-70.
Zheng L, Flesken-Nikitin A, Chen PL et al. Deficiency of Retinoblastoma gene in
mouse embryonic stem cells leads to genetic instability. Cancer Res 2002; 62
(9):2498-502.
Zhu L, van den Heuvel S, Helin K et al. Inhibition of cell proliferation by p107, a
relative of the retinoblastoma protein. Genes Dev 1993; 7 (7A):1111-25.
Ziebold U, Reza T, Caron A et al. E2F3 contributes both to the inappropriate
proliferation and to the apoptosis arising in Rb mutant embryos. Genes Dev 2001; 15
(4):386-91.
43
Chapter 2: Retinoblastoma function is essential for establishing lung
epithelial quiescence after injury
Nicole A. Mason-Richie, Meenakshi J. Mistry, Caitlin A. Gettler, Asmaa Elayyadi and Kathryn A. Wikenheiser-Brokamp Published in part: Cancer Res 2008; 68 (11):4068-76.
ABSTRACT
The retinoblastoma gene product (Rb) regulates cell cycle, quiescence and
survival in a cell type and environment dependent manner. Rb function is critical in
the pulmonary epithelium as evidenced by nearly universal Rb inactivation in lung
cancer and increased lung cancer risk in persons with germline Rb gene mutations.
Lung carcinomas occur in the context of epithelial remodeling induced by cytotoxic
damage. While the role of Rb in development and normal organ homeostasis has been
extensively studied, Rb function in the context of cellular injury and repair has
remained largely unexplored. In the current studies, the Rb gene was selectively deleted in the respiratory epithelium of the mouse. Although Rb was not required for establishing or maintaining quiescence during lung homeostasis, Rb was essential for establishing quiescence during epithelial repair after injury. Notably, aberrant cell cycle progression was sustained for 9 months after injury in Rb deficient lungs.
Prenatal and postnatal Rb ablation had similar effects providing evidence that timing of Rb loss was not critical to the outcome, and that the injury induced phenotype was not secondary to compensatory alterations occurring during development. These data demonstrate that Rb is essential for repair of the respiratory epithelium following cytotoxic damage, and support a critical unique role for Rb in the context of epithelial
44 remodeling after injury. Since human cancers are associated with chronic cellular
damage, these findings have important new implications for Rb mediated tumor
suppression.
INTRODUCTION
The retinoblastoma gene product (Rb) is a critical cell cycle regulator and influences numerous cellular processes including cellular differentiation, survival, terminal cell cycle exit and maintenance of the post mitotic state (Cobrinik 2005;
Dimova & Dyson 2005). The current model of Rb function suggests a critical regulatory role in many, if not all, cell types. Consistent with this notion, Rb is widely expressed during development and in adult tissues. However, germline Rb gene ablation in the mouse results in embryonic lethality associated with organ specific defects predominantly in the nervous system, hematopoietic system and eye lens (Clarke et al. 1992; Jacks et al. 1992; Lee et al. 1992). Many of these phenotypes are secondary to inadequate placental function and represent non-cell autonomous Rb functions. Accordingly, many of the neurological and erythroid abnormalities seen in conventional knockout mice are rescued when Rb deficient fetuses are supplied with a Rb sufficient placenta (Wu et al. 2003). Additionally, defective erythropoiesis in Rb null embryos results, at least in part, from abnormalities in fetal liver macrophages rather than erythrocytes (Iavarone et al.
2004). Taken together, these data provide evidence that Rb function is highly cell type specific, and that many cells do not require cell autonomous Rb functions during development.
45 Rb is inactivated in many, if not all, human cancers providing convincing evidence that Rb is essential for tumor suppression (Sherr & McCormick 2002).
Over 80% of adult malignancies are carcinomas; i.e. malignancies that arise from epithelial cells. Surprisingly, ablation of Rb in multiple epithelial cell types in the mouse leads to relatively mild phenotypes (Haigis et al. 2006; Kucherlapati et al.
2006; Maddison et al. 2004; Mayhew et al. 2005; Meuwissen et al. 2003; Ruiz et al.
2004; Wikenheiser-Brokamp 2004). This is due in part to functional redundancy and/or compensation by the other Rb family proteins, p107 and p130. However, cellular response to loss of Rb function is also highly dependent upon cellular context. Rb ablation in the lung and prostate epithelium results in increased proliferation and apoptosis, whereas apoptosis does not accompany the aberrant proliferation observed in Rb deficient skin (Maddison et al. 2004; Ruiz et al. 2004;
Wikenheiser-Brokamp 2004). Hepatocyte specific Rb ablation leads to aberrant S- phase entry that is associated with neither hyperplasia nor apoptosis (Mayhew et al.
2005). Finally, Rb ablation targeted to the intestinal epithelium using the villin promoter causes no intestinal abnormalities (Kucherlapati et al. 2006). Thus, although Rb is inactivated in carcinomas arising in multiple organs, epithelial cell response to Rb loss is highly context specific.
Timing of Rb ablation appears to play a critical role in determining phenotypic outcomes in vitro. Acute loss of Rb in mouse embryo fibroblasts and keratinocytes in culture causes more severe cell cycle abnormalities than Rb loss during development in vivo (Ruiz et al. 2004; Sage et al. 2003). The physiologic relevance of temporally dependent effects of Rb loss in culture remains unclear.
46 Nonetheless, the data suggest that Rb related phenotypes may be influenced by the precise timing of Rb loss.
Rb is almost universally inactivated in lung cancers providing strong evidence that Rb is a critical regulator in the pulmonary epithelium (Minna et al. 2002).
Moreover, humans with Rb germline mutations are at increased risk for developing lung cancer (Kleinerman et al. 2000; Strong et al. 1984). Lung carcinomas are associated with cigarette smoking in 80-85% of sporadic cases as well as in patients with germline Rb mutations (Kleinerman et al. 2000; Strong et al. 1984).
Additionally, chronic lung diseases characterized by continual epithelial remodeling are associated with an increased risk of lung cancer in the absence of smoking
(Artinian et al. 2004; Daniels & Jett 2005). Thus, like many other malignancies, lung cancer occurs in the context of chronic epithelial damage.
The present studies were designed to directly test whether Rb function is critical in the context of lung epithelial remodeling after injury. Although Rb was not required for establishing and maintaining epithelial cell quiescence during lung homeostasis, Rb was essential for establishing cellular quiescence in the context of epithelial regeneration after injury. Aberrant cell cycle progression in Rb deficient lungs was sustained for at least 9 months after injury, whereas the epithelium in Rb proficient lungs was quiescent two weeks after injury. The phenotype was similar regardless of whether Rb loss occurred during development or in the postnatal lung.
These studies demonstrate that Rb is essential in the remodeling lung epithelium, and support a more critical role for Rb in the setting of epithelial repair after injury as compared to lung homeostasis. Since human malignancies are commonly associated
47 with chronic injury, these findings have important implications for Rb mediated tumor suppression.
MATERIALS AND METHODS
Animal generation and treatment. Mice with Rb deficient lung epithelium were
generated by mating CC10-rtTA and tetO-Cre double transgenic mice to RbLoxP/LoxP mice and genotyped using tail and lung DNA as previously described (Wikenheiser-
Brokamp 2004). Primers Rb-18 and Rb-19 were used to differentiate the floxed (746 bp), wild type (678 bp) and recombined (321 bp) Rb alleles. Thyroid stimulating hormone beta subunit (TSHbeta) was amplified as an endogenous internal control to verify template DNA quality and quantity using primers
5’TCCTCAAAGATGCTCATTAG3’ and 5’GTAACTCACTCATGCAAAGT3’ at an annealing temperature of 55°C for 35 cycles resulting in a 386 bp band.
Gestational age was determined by detection of a vaginal plug (designated embryonic day E0.5). Prenatal Rb ablation was induced by doxycycline (Sigma) administration to pregnant dams with a single intraperitoneal injection (125µg/0.5ml saline) on E0.5-
E1.5 followed by maintenance on doxycycline in the drinking water (1.0 mg/ml) until birth. Postnatal Rb ablation was induced in adult mice at 2-3 months of age by a single intraperitoneal doxycycline injection (125µg/0.5ml saline) followed by maintenance on doxycycline food (Modified Prolab RMH 1500 with 0.0625%
Doxycycline, TestDiet/Purina Mills). Adult mice treated with naphthalene were fed doxycycline food 3 weeks prior to naphthalene treatment, and were maintained on doxycycline food until the time of sacrifice. Naphthalene (Sigma-Aldrich) was suspended in corn oil and administered to adult mice at 2-4 months of age by a single
48 intraperitoneal injection (300 mg/kg). Animals were given BrdU (Amersham
Biosciences) by intraperitoneal injection (2 mg/100gm) one hour prior to sacrifice.
Immunohistochemistry and TUNEL analysis. Tissues were fixed in 10% neutral buffered formalin and paraffin embedded. Morphology was assessed on hematoxylin and eosin stained sections. Immunohistochemistry and TUNEL analysis was performed on deparaffinized 5 micron sections after antigen retrieval in 10 mM citrate solution microwaved for seven minutes. Primary antibodies were diluted in
0.1% bovine serum albumin in phosphate buffered saline, applied to tissue sections and incubated overnight at 4°C using the following dilutions: Ki67 1:50 (Clone B56,
BD PharMingen), phosphorylated (Ser10) Histone H3 1:1000 (US Biological), and
CCSP 1:20,000 (kind gift from Steven Brody, Washington University, St. Louis,
MO). Antibody staining was detected with Vectastain Elite ABC, M.O.M.
Immunodetection and DAB Substrate Kits (Vector Laboratories, Inc.). For dual
CCSP/BrdU immunolabeling, tissue sections were incubated with anti-CCSP antibody overnight followed by application of secondary antibody and ABC Elite
Vectastain ABC-AP reagent (Vector Laboratories, Inc). Positive staining was detected with Vector Alkaline Phosphatase Blue Substrate Kit III (Vector
Laboratories, Inc). Subsequent BrdU analysis was performed using Zymed BrdU
Staining Kit (Zymed Laboratories, Inc.). Tissues were counterstained with hematoxylin or nuclear fast red. Counts represent evaluation of an average of 350 epithelial cells representing both proximal and distal conducting airways and at least two lung lobes per mouse. TUNEL analysis was performed using ApopTag
49 Peroxiodase In Situ Apoptosis Detection Kit (Chemicon International). Percent
positive cells were determined on samples blinded to genotype by locating a TUNEL positive cell and counting 100 cells surrounding the initially identified positive cell.
Counts represent 200-400 epithelial cells per animal including both proximal and
distal conducting airways and at least two lung lobes per mouse. Only cells that were
TUNEL positive, showed morphologic features of apoptosis and remained attached to
the basement membrane were counted. Statistical significance was determined by
unpaired Student's t-tests.
ß-galactosidase staining. In situ staining for ß-galactosidase activity was performed on frozen tissue sections as previously described (Wikenheiser-Brokamp 2004).
RESULTS
Quiescence is established and maintained in adult Rb deficient lung epithelium.
A conditional Rb knockout model was utilized to target Rb ablation to the lung
epithelium (Wikenheiser-Brokamp 2004). Double transgenic mice bearing the
reverse tetracycline responsive transactivator under control of the rat Clara cell 10kD
protein (CC10)/Scgb1a1 gene promoter, and Cre recombinase (Cre) under control of
the tet operator and a minimal CMV promoter were bred into a RbLoxP/LoxP background (Figure 2-1). Previous studies demonstrated that Cre mediated recombination is epithelial specific and occurs in the vast majority of epithelial cells throughout the conducting airway in a doxycycline dependent manner (Wikenheiser-
Brokamp 2004). The rat CC10 promoter differs slightly from the endogenous mouse
50 promoter and therefore Cre recombination expression, and thus Rb ablation, is not
restricted to Clara cells.
We previously reported that Rb ablation in the lung epithelium causes
epithelial hypercellularity with increased proliferation and apoptosis at birth
(Wikenheiser-Brokamp 2004). Adult lungs showed increased neuroendocrine cells
but lacked the morphologic features of hyperplasia and apoptosis present at birth
suggesting that the majority of Rb deficient epithelial cells were capable of
compensating for loss of Rb function postnatally (Figure 2-1 and (Wikenheiser-
Brokamp 2004)). To directly determine whether Rb deficient epithelial cells in the
adult lung entered quiescence, lungs from double transgenic mice were analyzed for
the proliferation marker Ki67. Ki67 is expressed in all phases of the cell cycle except
G0 and thus marks non-quiescent cells (Scholzen et al. 2000). Controls for this and
subsequent experiments consisted of littermates lacking one or both transgenes
required for Rb ablation. Ki67 expression was similar in Rb ablated and control
lungs (Figure 2-1) providing evidence that Rb function is not essential for establishing and maintaining quiescence in the mature respiratory epithelium despite the marked cell cycle abnormalities present at birth.
Rb is critical for establishing quiescence after injury. Mice with Rb deficient lungs were exposed to naphthalene to directly test whether Rb function is critical during epithelial remodeling after injury. Cytotoxic damage induced by naphthalene is targeted to the lung epithelium because pulmonary epithelial cells contain high concentrations of the specific P-450 isoenzyme, CYP2F2, required for metabolizing
51 naphthalene to its toxic metabolite (Buckpitt et al. 1995). Temporal and morphologic characteristics of naphthalene induced injury and subsequent repair are well characterized (Park et al. 2006; Van Winkle et al. 1995). Briefly, diffuse epithelial damage occurs within the first 24 hours after naphthalene administration. Thereafter the denuded airways are repopulated by naphthalene resistant cells. Cellular proliferation peaks on day 2-4, and the repair process is largely complete two weeks after injury. Adult mice were treated with a single naphthalene injection at a dose known to induce epithelial injury throughout the conducting airways (Plopper et al.
1992). Epithelial damage occurred in both proximal and distal conducting airways as confirmed morphologically (data not shown). Some death was observed within the first two weeks after treatment; however, Rb ablated and control mice were similarly affected (21% (21/102) versus 26% (15/58), respectively). Rb ablated and control
lung epithelium was largely quiescent prior to treatment (Figure 2-1). On day 4 after
injury, epithelial proliferation was significantly increased over baseline levels in Rb
ablated (26% ± 5% vs. 3% ± 1%, p=0.002) and control lungs (21% ± 4% vs. 2% ±
0.5%, p=0.002) (Figure 2-1). Increased proliferation was noted in both the proximal
(30% ± 7% and 20% ± 5%, Rb ablated and controls respectively, p=0.30) and distal
(25% ± 4% and 23% ± 4%, respectively, p=0.65) conducting airways providing evidence that epithelial remodeling occurred throughout the airway. Remarkably,
Ki67 expression was sustained in Rb ablated lungs on day 14 after injury, whereas proliferation in control lungs returned to baseline levels (Figure 2-1). Thus, Rb is essential for establishing quiescence following naphthalene induced injury.
52 Loss of Rb function results in sustained cell cycle progression after injury. Rb
blocks cells in the G1 to S phase transition of the cell cycle (Cobrinik 2005; Sherr &
McCormick 2002). Therefore, an expected consequence of Rb loss is aberrant entry
into S phase. As expected, the proportion of epithelial cells in S-phase was <1% in
both control and Rb ablated lungs on day 0 and significantly increased by day 4 after
injury (Figure 2-2 and data not shown). A modest increase in BrdU positive
epithelial cells was noted in Rb ablated lungs on day 0 as compared to controls
(Figure 2-2). The physiologic significance of this increase is unknown since BrdU
positive cells represent <1% of the epithelial cells on day 0, and no concomitant
increase in Ki67 expression (Figure 2-1) or mitotic cells (Figure 2-2) was detected at
this time point. Given that Rb null fibroblasts have shortened G1 and extended S
phases, this finding could reflect a slightly different cell cycle profile in the Rb
ablated versus control lungs (Classon et al. 2000; Herrera et al. 1996). On day 14
after injury, however, BrdU incorporation was markedly increased in Rb ablated
lungs as compared to controls (Figure 2-2) demonstrating that Rb deficiency results in aberrant progression into S-phase.
Aberrant cell cycle progression induced by Rb loss can result in cell cycle arrest. For example, Rb deficient myocytes are unable to maintain G0 arrest upon restimulation with serum and eventually arrest in the S and G2 phases of the cell cycle (Novitch et al. 1996). Rb null cells in the brains of chimeric embryos show increased G2 fractions without progression into mitosis suggesting that Rb null neuronal cells arrest in late S or G2 phase of the cell cycle (Lipinski et al. 2001).
Finally, Rb is essential for G1/S phase arrest after DNA damage in mouse embryonic
53 fibroblasts (MEFs) in culture; however Rb null MEFs accumulate in G2/M phase
providing evidence that the G2/M phase checkpoint remains intact in the absence of
Rb (Harrington et al. 1998). Rb deficient lung epithelial cells progressed into mitosis
as evidenced by increased expression of phosphorylated histone H3 (PH3) compared
to controls on day 14 after injury (Figure 2-2). While these data cannot exclude an
arrest in mitosis, they indicate that Rb deficient lung epithelial cells progress through
S and G2 phases of the cell cycle. Thus, Rb is essential for cell cycle exit during
epithelial repair after injury, and aberrantly proliferating Rb deficient epithelial cells
progress into mitosis.
Non-ciliated Clara cells constitute the vast majority of aberrantly proliferating
cells in the remodeling Rb deficient lung. The airways are lined by diverse and
specialized cell types required for normal lung function. Non-ciliated Clara cells function as progenitor cells in the conducting airways (Van Winkle et al. 1995).
Since studies in the hematopoietic system indicate that Rb is essential for regulating progenitor cells (Spike et al. 2004; Walkley et al. 2007), double immunolabeling for the Clara cell marker, Clara cell secretory protein (CCSP), and BrdU was done to determine whether Clara cells constitute the aberrantly proliferating population.
Clara cells accounted for 81% ± 7% of the S-phase population in Rb deficient lungs on day 14 after injury (Figure 2-2). This was comparable to the proportion of S-phase
Clara cells in Rb ablated and control lungs on day 4 after injury (80% ± 16% and
71% ± 15%, respectively) (Figure 2-2). Thus, Clara cells represent the vast majority of aberrantly cycling cells in the repairing Rb deficient lung epithelium.
54 Aberrant cell cycle progression in Rb deficient lungs is sustained for at least 9 months after a single episode of injury. Epithelial proliferation was significantly increased in Rb deficient lungs 9 months after injury (Figure 2-3). Moreover, the percentage of epithelial cells in S- and M-phases remained elevated providing evidence that aberrant cell cycle progression was still occurring 9 months after the initiating event (Figure 2-3). A trend towards decreased overall proliferation was noted in Rb ablated lungs at 9 months as compared to day 14 after injury; however this decrease reached statistical significance only for BrdU labeled cells (7.9 ± 1.3
(day 14) vs. 2.9 ± 1.0 (9 months) p=0.009) (Figure 2-3). Epithelial cell cycle abnormalities were separately assessed in proximal and distal conducting airways at 9 months and day 14 after injury to determine if a regional difference existed.
Although, there was a trend toward increased proliferation in the distal airways, this difference was not consistently statistically significant among the assessed cell cycle markers. While it is possible that distal airway epithelial cells are slightly more sensitive to Rb loss, the trend toward increased cell cycle abnormalities in the distal airway epithelium may simply reflect the higher proportion of Clara cells in distal versus proximal conducting airways.
Tumor incidence was not increased in Rb ablated lungs at 9 months after injury despite the prolonged period of sustained proliferation. Gross and microscopic examination of Rb deficient lungs from mice at 8-16 months of age showed no increase in tumor incidence irrespective of naphthalene treatment (Table 1). A possible explanation for lack of tumor formation despite sustained proliferation is that
Rb ablated cells are selectively lost after injury resulting in a Rb proficient
55 epithelium. While this explanation is highly unlikely given the relatively uniform Rb
ablation throughout the conducting airway (Wikenheiser-Brokamp 2004), Cre
mediated recombination was directly assessed at the cellular level by performing in
situ ß-galactosidase assays on Rb deficient lungs from mice harboring the ROSA26
reporter locus. LacZ is expressed in this reporter strain only in cells expressing
functional Cre recombinase and their descendants (Soriano 1999). The vast majority
of epithelial cells in Rb deficient lungs at 9 months after injury were ß-galactosidase
positive (data not shown). Therefore, Rb ablated cells are not selectively eliminated
during epithelial regeneration after injury.
Increased cell death could account for lack of tumor formation in Rb deficient
lungs. Apoptosis was detected in Rb ablated lungs at baseline before injury and on
day 14 and 9 months after injury. The increase in TUNEL positive epithelial cells in
Rb ablated lungs was not statistically significant over controls prior to injury, but did
reach statistical significance on day 14 and 9 months after injury (Figure 2-3).
Apoptosis in Rb ablated lungs at day 14 and 9 months after injury was significantly elevated over Rb ablated lungs prior to injury (p=0.003 and p=0.008, respectively)
(Figure 2-3). Finally, Rb ablated lungs could be blindly identified based upon
morphologic features of apoptosis when assessed by a pathologist (KAWB). Thus,
sustained cell cycle progression in Rb deficient lungs was accompanied by apoptotic
cell death. The 6-7 fold increase in apoptosis in Rb ablated injured lungs as
compared to controls corresponds to a 4-8 fold increase in proliferation (Figure 2-1).
Taken together, these data provide evidence that increased cell death accounts, at
56 least in part, for the absence of tumor formation in Rb ablated lungs despite long term
aberrant cell cycle progression.
Postnatal and prenatal Rb ablation result in similar phenotypic outcomes. To
determine whether timing of Rb ablation significantly impacts the phenotypic
outcomes in the lung epithelium in vivo, Rb recombination was induced postnatally
rather than during development by treating adult mice with doxycycline. Rb
recombination was consistently detected in the lungs of double transgenic mice treated with doxycycline but not in controls lacking Cre recombinase (Figure 2-4 and data not shown). Surprisingly, Rb recombination was also detected in double transgenic adult lungs in the absence of doxycycline treatment (Figure 2-4). Despite the finding that postnatal Rb ablation occurs independently of doxycycline treatment, this mouse model remains valuable for assessing the effects of developmental versus postnatal Rb ablation since Rb ablation during development is strictly dependent upon doxycycline induction (Wikenheiser-Brokamp 2004).
The conducting airways in the mature mouse lung are lined predominantly by ciliated cells and non-ciliated Clara cells. To determine the extent of postnatal Rb ablation in these distinct cell types, in situ ß-galactosidase analysis was performed on lungs from double transgenic mice containing the ROSA26 locus. As expected, ß- galactosidase positive cells were restricted to the epithelium (Figure 2-4). The majority of epithelial cells in the conducting airways were ß-galactosidase positive and included both ciliated and Clara cells. Doxycycline administration during gestation induces Cre recombinase expression in early progenitor cells within the
57 lung epithelium (Perl et al. 2002). Accordingly, the overall ß-galactosidase staining was more uniform after doxycycline treatment during development as compared to postnatal treatment (Figure 2-4 and (Wikenheiser-Brokamp 2004)). A similar pattern of ß-galactosidase staining was seen in the conducting airways of double transgenic adult mice not treated with doxycycline (Figure 2-4). Scattered ß-galactosidase positive alveolar cells, consistent with the location of Type II cells, were detected and appeared to be more frequent in the presence of doxycycline treatment. Thus, both
prenatal and postnatal Rb ablation is epithelial specific, occurs in the majority of
conducting airway epithelial cells, and is present in both Clara and ciliated cells.
Postnatal Rb ablation resulted in similar phenotypic outcomes as that seen
after Rb ablation during development. Epithelial quiescence was maintained in Rb
deficient lungs after doxycycline administration to adult mice at 2-3 months of age
(Figure 2-5). Similar to Rb ablation during development, postnatal Rb loss resulted
in aberrant cell cycle progression during epithelial repair after injury (Figure 2-5).
Non-quiescent Ki67 positive cells were increased in Rb ablated lungs on day 14 after
injury as compared to controls.
Rb ablated lungs exhibited progression into S-phase and mitosis. Despite the
aberrant cell cycle progression, lung tumors were not detected in mice analyzed at 8-
16 months of age either in the presence or absence of naphthalene induced injury
(Table 1). Taken together, the data further demonstrate that Rb function is critical
during epithelial repair after injury and provide evidence that prenatal versus
postnatal timing of Rb ablation does not significantly affect phenotypic outcome.
58 Loss of one Rb allele is not sufficient to cause aberrant proliferation after lung
injury. Rb haploinsufficiency has been reported in both in vivo and in vitro models.
Specifically, loss of one Rb allele is sufficient to induce chromosomal instability in
mouse embryonic stem cells, and was reported to result in hyperplasia in the murine
prostate epithelium (Maddison et al. 2004; Zheng et al. 2002). In order to directly determine if loss of a single Rb allele is sufficient to cause aberrant proliferation after lung injury, double transgenic mice homozygous (RbLoxP/LoxP) and heterozygous
(Rb+/LoxP) for the floxed Rb alleles were compared to double transgenic mice with
wild type Rb alleles (Rb+/+). Mice were treated with doxycycline postnatally and
lungs were analyzed for non-quiescent Ki67 positive cells. No significant difference
in Ki67 positive epithelial cells was detected in Rb haploinsufficient lungs as
compared to Rb wild type controls (Figure 2-6). Consistent with previous data, Rb
ablated lungs exhibited aberrant proliferation after injury as evidenced by a
statistically significant increase in Ki67 positive cells as compared to Rb wild type
controls. Additionally, proliferation in Rb ablated lungs was significantly increased
over Rb haploinsufficient lungs. These studies directly demonstrate that loss of a
single Rb allele is not sufficient to cause aberrant proliferation in the remodeling lung
epithelium. Furthermore, the data provide direct evidence that the lung phenotype is
due to Rb loss rather than representing toxic effects of Cre recombinase or rtTA
transgene expression. This is an important conclusion given that rtTA expression was
previously shown to cause emphysema-like changes in the mouse lung and Cre
recombinase can result in DNA damage and growth abnormalities in cells in culture
and spermatids in vivo (Loonstra et al. 2001; Schmidt et al. 2000; Sisson et al. 2006).
59 DISCUSSION
Quiescence is established and maintained in adult Rb deficient lung epithelium providing evidence that Rb is not required for these processes during lung homeostasis. In contrast, Rb function is essential for establishing cellular quiescence in the context of epithelial remodeling after injury. Furthermore, the aberrant epithelial cell cycle progression in Rb ablated lungs was noted 9 months after a single episode of injury providing evidence that epithelial cells do not compensate for Rb loss during epithelial remodeling after injury. This is in stark contrast to the compensation that occurs in the postnatal lung after Rb ablation in the absence of injury. These studies provide evidence that Rb plays a critical and unique role in epithelial remodeling after injury.
The essential role for Rb in lung regeneration after injury differs from skeletal muscle wherein Rb is essential for muscle development but is not required for muscle regeneration after cardiotoxin induced injury (Huh et al. 2004; Zacksenhaus et al.
1996). Interestingly, there is a unique requirement for Rb in stress erythropoiesis
(Spike et al. 2004). Although Rb is not critical for steady state hematopoiesis, Rb loss is associated with increased erythroblasts that fail to undergo terminal maturation under stress conditions. These studies suggest that Rb loss confers a growth advantage on progenitor cells. Consistent with this concept, Walkley et al. showed that Rb is dispensable in hematopoietic stem cells and raised the hypothesis that the
requirement for Rb in self-renewal is lineage dependent, with progenitor cells having a greater dependence on Rb for their division than stem cells (Walkley et al. 2007).
The current studies identify Rb as a critical regulator of progenitor cells in the
60 repairing lung epithelium. Thus, our data support the notion that Rb has unique and
essential functions during cellular regeneration after injury, and that progenitor cells are critically dependent on Rb for control of cell division.
Rb is required in specific cellular contexts and time periods. Rb ablation targeted to the lung epithelium resulted in aberrant cellular proliferation and apoptosis in specific cellular contexts, namely in the newborn lung and during regeneration after injury (current data and (Wikenheiser-Brokamp 2004)). These findings are consistent with Rb being essential during limited time periods wherein cells transition into quiescence. Cells withdraw from the cell cycle and enter G0 in response to mitogen deprivation (Agami & Bernards 2002). This process is dependent upon p27 accumulation and reduction in cyclin D activity. In contrast, cell cycle arrest in response to DNA damage requires p21 and not p27. Interestingly, Rb has previously been reported to transcriptionally regulate p21 specifically in epithelial cells, and to increase p27 stability by targeting Skp2, a component of the Skp1-Cullin-F-box protein (SCF) E3 ubiquitin ligase complex, for degradation (Binne et al. 2007;
Decesse et al. 2001). Additionally, p27 was shown to be required for Rb mediated senescence in cells in culture (Alexander et al. 2001). Thus, deregulated p21 and/or p27 activity pose a potential link between loss of Rb function and inability to enter quiescence.
Rb is classically viewed as an essential regulator of cell cycle; however, Rb function is also important in regulating cell survival, chromatin remodeling, genomic stability and cellular ploidy (Cobrinik 2005; Dimova & Dyson 2005; Srinivasan et al.
61 2007). Many of these functions depend upon Rb mediated gene regulation resulting
from Rb interactions with the E2F family of transcription factors. Transcriptional
control of DNA replication genes by the E2F/Rb pathway is important for maintaining proper cell cycle control and regulating additional cellular processes including ploidy (Srinivasan et al. 2007). Apoptosis in Rb deficient cells also results, at least in part, from deregulation of E2F/Rb target genes. Although the response to
Rb loss is cell type specific, apoptosis in Rb null cells frequently occurs in a p53
dependent manner. Interestingly, p53 and its proapoptotic target gene Bax are
induced in the lung epithelium after hyperoxia and bleomycin induced injury
(Okudela et al. 1999; O'Reilly et al. 2000). However, no change in p53, Bax, or
activated p53 expression was detected in Rb ablated lungs compared to controls, and
protein expression was not induced after naphthalene injury (Figure 2-7).
The timing of Rb dependent phenotypes in the lung epithelium has striking
parallels with Rb function in developing retina and skeletal muscle. Rb is critical for
cell cycle exit in retinal transitional cells during a limited time window during
development (Pacal et al. 2006). Rb ablation prior to this critical time period results in
abnormal retinal development, whereas Rb loss at later time points results in no
abnormalities. This appears to be true in skeletal muscle as well. Rb function is
required in myoblasts whereas Rb loss has no effect in mature myocytes (Huh et al.
2004; Zacksenhaus et al. 1996). The critical requirement for Rb in limited time
periods is likely relevant to Rb mediated tumor suppression since retinoblastoma is
almost exclusively a disease of childhood occurring within the temporal window
wherein retinoblasts undergo final maturation (Balmer et al. 2006).
62
Postnatal and prenatal Rb ablation result in similar phenotypic outcomes.
Germline versus acute loss of Rb function results in different phenotypic outcomes in
cells in culture. Quiescent MEFs undergo cell cycle reentry after acute, but not germline, Rb loss (Sage et al. 2003). In addition, acute Rb ablation in senescent
MEFs leads to reversal of the senescence associated phenotype whereas MEFs with germline Rb loss undergo and maintain senescence similar to wild type cells.
Keratinocytes undergoing acute loss of Rb in culture are completely refractory to growth arrest when induced to differentiate (Ruiz et al. 2004). In contrast, Rb null keratinocytes derived after conditional Rb ablation in mice in vivo undergo growth arrest similar to wild type cells, albeit with a 24 hour delay. These findings suggest that precise timing of Rb ablation affects phenotypic outcomes, and that Rb is critical for maintaining cellular quiescence and senescence. Additionally, these studies raise the possibility that phenotypes in adult mouse models could reflect secondary affects of developmental compensation after Rb loss during embryogenesis.
Rb ablation in the postnatal lung did not lead to aberrant cell cycle control under homeostatic conditions providing evidence that Rb is not required to maintain lung epithelial quiescence. Rb, however, was essential for establishing lung epithelial quiescence after injury regardless of whether Rb was ablated during development or in the postnatal lung. These results directly demonstrate that prenatal versus postnatal timing of Rb ablation does not significantly affect the injury induced phenotype.
Furthermore, the studies provide direct evidence that the injury induced phenotype is not simply secondary to epithelial alterations occurring during development.
63
Relationship to human carcinogenesis. Carcinogenesis occurs through sequential
steps including tumor initiation and promotion. Initiation depends upon somatic
mutations. Promotion mechanisms are less well defined but involve epigenetic
factors such as inflammation and substances that trigger cell death and proliferation.
The current studies demonstrate that Rb and cytotoxic damage cooperate to transform the normally quiescent lung epithelium into an organ with sustained epithelial cell
death and proliferation. Cytotoxic damage could thereby function as a tumor
promoter by creating a cellular context wherein Rb function is particularly critical.
Loss of Rb function by somatic mutation or deregulation of other proteins in
the Rb pathway is known to be critical, if not essential, for lung carcinogensis.
However, mechanisms underlying tumor promotion are poorly understood. In the
liver, many tumor promoters are cytotoxic and therefore indirectly trigger hepatocyte
proliferation by causing cell death (Fausto 1999). Cytotoxic damage and
compensatory proliferation induced by mitogen production are also important
components of the tumor promoting microenvironment linking inflammation and
carcinogenesis (Maeda et al. 2005). Since the liver is comprised of quiescent
differentiated cells, induction of hepatocyte proliferation is a prerequisite for
transformation. In corollary, the adult lung epithelium is quiescent and therefore
transition of Rb null epithelial cells from a quiescent to a constitutively replicating
state after cytotoxic damage may set the stage for tumorigenesis.
Lung carcinogenesis is associated with tobacco smoking in 80-85% of cases.
Increased cancer incidence in tobacco users has traditionally been attributed solely to
64 the mutagenic affects of cigarette smoke. However, reevaluation of the data suggests
that cytotoxic damage and chronic epithelial remodeling induced by tobacco smoke act as critical promoters of carcinogenesis by selecting rather than simply inducing tumorigenic mutations (Rodin et al. 2005; Thilly 2003). Repetitive smoking may therefore promote carcinogenesis by creating a microenvironment that facilitates preferential expansion of cells with mutations that confer a proliferative advantage or resistance to cytotoxic damage.
If smoking promotes carcinogensis by causing chronic injury, one would predict that pulmonary diseases that arise in response to chronic lung injury would be associated with an increased risk of lung cancer. Indeed, patients with chronic interstitial lung disease are at increased risk for developing lung cancer independent of smoking history (Artinian & Kvale 2004; Daniels & Jett 2005). Although the pathogenetic mechanisms are unknown, an association between chronic injury and lung cancer provides correlative evidence that cytotoxic damage and epithelial remodeling promote lung carcinogenesis. The current studies identify Rb as a critical regulator in the context of lung epithelial repair after cytotoxic damage, and suggest
Rb as a potential molecular link between chronic lung injury and carcinogenesis.
ACKNOWLEDGEMENTS
Grant support: National Heart Lung and Blood Institute R01 HL079193 (KAWB).
We thank J.A. Whitsett, S.I. Wells, J.C. Rhodes and D.S. Askew for critical review of the manuscript.
65 Table 1
66 Figure 2-1
A
67
Figure 2-1: Rb ablation results in sustained epithelial proliferation after injury.
Inducible Rb ablation was targeted to the lung epithelium by mating CC10-rtTA and tetO-Cre double transgenic mice with RbLoxP/LoxP mice (A). Pregnant dams were treated with doxycycline (circles) which activates rtTA (arches) expressed under control of the lung epithelial specific promoter. Activated rtTA induces Cre expression leading to recombination at LoxP sites flanking exon 19 in the Rb gene locus. Hematoxylin and eosin stained sections of Rb ablated and control adult lungs show similar overall morphology (B). Immunohistochemical analysis for Ki67 in
Rb ablated and control adult lungs from mice treated with doxycycline throughout gestation (C). The percent Ki67 positive cells (arrows) was comparable in Rb ablated and control lungs before naphthalene treatment (Day 0) and at day 4 after injury (Day 4). A statistically significant increase in Ki67 positive cells was noted on day 4 as compared to day 0 in Rb ablated (p=0.009) and control (p=0.011) lungs.
In contrast, the percent Ki67 positive cells was significantly increased in Rb ablated lungs versus controls on day 14 after injury (Day 14). Quantitative analysis is presented as average + SE (D, *p=0.01). Data is representative of 5-7 animals per time point. br=bronchiole; Original magnification: 1000x
68
Figure 2-2
69
Figure 2-2: Aberrantly proliferating cells in Rb null lungs progress into S-phase and mitosis. Immunohistochemical analysis for BrdU incorporation (A) and PH3
(B) in Rb ablated and control adult lungs from mice treated with doxycycline throughout gestation. Statistically significant increases in BrdU and PH3 positive cells (arrows) were noted in Rb ablated versus control lungs on day 14 after injury
(*p=0.001 and *p=0.005, respectively). A minimal increase in percent BrdU positive cells was seen on day 0 in Rb ablated versus control lungs (*p=0.02), but no significant increase was seen in percent PH3 positive cells on day 0 (p=0.39).
Quantitative analysis is presented as average + SE. Data is representative of 6-7 animals per time point. Double label immunohistochemical analysis for BrdU
(brown nuclear stain, open arrowhead) and CCSP (blue cytoplasmic stain, closed arrowhead) in Rb ablated and control adult lungs from mice treated with doxycycline throughout gestation (C). The majority of BrdU incorporating cells were CCSP positive (arrow) in the Rb ablated and control lungs on day 4 after injury
(BrdU-CCSP double positive/BrdU positive cells = 80.1 ± 16.1 and 71 ± 14.9, respectively). The increase in S-phase Clara cells was maintained in Rb ablated lungs on day 14 after injury (BrdU-CCSP double positive/BrdU positive = 81.4 ±
6.6). The overall labeling index (BrdU positive/total epithelial cells) in control lungs at day 14 after injury was 1.6 ± 1.5 which is comparable to baseline levels before injury. Quantitative data represents average + SD. Percent positive cells was calculated counting >250 BrdU positive epithelial cells representing 3-5 animals per time point. br=bronchiole; Original magnification: 1000x
70 Figure 2-3
A D
71
Figure 2-3: Aberrant cell cycle progression is sustained in Rb ablated lungs 9 months after a single episode of injury and is associated with increased apoptosis. Quantitative data for cell cycle markers and TUNEL analysis on Rb ablated and control adult lungs from mice treated with doxycycline throughout gestation. BrdU incorporation and PH3 and Ki67 expression were assessed by immunohistochemistry 9 months after injury. Quantified data is presented as average percent positive cells + SEM (A). Rb ablated lungs showed a statistically significant increase in S-phase cells (BrdU), mitotic cells (PH3) and overall proliferation (Ki67) as compared to controls (*p=0.04, *p=0.01 and *p=0.02, respectively). Apoptosis was assessed by TUNEL assay on lung sections before injury (day 0) and on day 4, day 14 and 9 months after injury. Representative results from the 9 month time point are shown for Rb ablated (B) and control (C) lungs. Percent TUNEL positive cells (arrow) were quantified and data represented as average percent positive cells + SE (D). Apoptosis was increased in Rb ablated lungs as compared to controls at all time points analyzed with the increase reaching statistical significance on day 14 (*p=2.9x10-5) and 9 months (*p=0.006) after injury. Data is representative of 5-11 animals per time point. br=bronchiole;
Original magnification: 1000x
72 Figure 2-4
73 Figure 2-4: Prenatal and postnatal Rb ablation occurs throughout the lung epithelium and is present in both Clara and ciliated cells. PCR analysis on lung DNA from postnatal (PN) day 1 or adult double transgenic mice treated wi th doxycycline (Dox) during gestation (Prenatal
Dox), for 3 weeks at 2-3 months of age (Postnatal Dox) or not treated with doxycycline (No
Dox) (A). Control lanes show migration of the recombined (RbRec), wild type (RbWT), and floxed (RbLoxP) RB alleles. Adult mice were homozygous for RbLoxP, and day 1 pups were homozygous or heterozygous for RbLoxP. RbRec was detected in the PN day 1 lungs only after doxycycline treatment. In contrast, RbRec was detected in adult lungs in the absence and presence of doxycycline treatment. Thyroid stimulating hormone beta subunit (TSHbeta) was amplified in each sample as an endogenous internal control to verify equivalent template DNA quality and quantity. Data is representative of 5 No Dox and 36 Prenatal Dox (15 homozygous and 21 heterozygous for RbLox) PN day 1 lungs, and ≥ 3 adult lungs for each treatment group.
Varied levels of recombination among samples is due, at least in part, to differences in the relative proportion of conducting airway epithelium represented in the lung tissue used to isolate DNA. Enzymatic staining for ß-galactosidase performed on lung sections from adult double transgenic mice harboring the ROSA26 reporter locus after prenatal doxycycline treatment (B), postnatal doxycycline treatment (C) or no doxycycline treatment (D).
Representative low (top panels) and high (bottom panels) power images are shown. ß- galactosidase staining (blue) was epithelial specific and present throughout the conducting airways in all groups indicating active Cre recombinase and thus Rb ablation. Epithelial staining in the conducting airways was less uniform after postnatal treatment and no treatment as compared to prenatal treatment (compare B to C and D). Ciliated (arrows) and Clara cells
(arrowheads) were stained in all three treatment groups. Data is representative of at least 3 animals for each treatment group. br=bronchiole; Original magnification: 200x (top panels)
1000x (bottom panels) 74
Figure 2-5
*
* *
75
Figure 2-5: Postnatal Rb ablation results in aberrant cell cycle progression after injury. Immunohistochemical analysis for BrdU incorporation (A), and PH3
(B) and Ki67 (C) expression on day 14 after injury in Rb ablated and control adult lungs from mice treated with doxycycline as adults. Percent positive cells (arrows) were quantified and data represented as average percent positive cells + SE (D). Rb ablated lungs showed a statistically significant increase in S-phase cells (BrdU), mitotic cells (PH3) and overall proliferation (Ki67) as compared to controls
(*p=0.03, *p=0.04 and *p=0.004, respectively). Data is representative of 5-6 animals per time point. br=bronchiole; Original magnification: 1000x
76
Figure 2-6
77
Figure 2-6: Loss of one Rb allele is not sufficient to cause aberrant proliferation in the remodeling lung epithelium. Immunohistochemical analysis for Ki67 expression on day 14 after injury in double transgenic mice homozygous
(RbLoxP/LoxP) or heterozygous (Rb+/LoxP) for the floxed Rb allele and control mice with wild type Rb alleles (Rb+/+). Lungs were analyzed from mice treated with doxycycline as adults. Percent positive epithelial cells were quantified and data represented as average percentage of positive cells average + SE. Rb haploinsufficient (Rb+/LoxP) lungs did not show a statistically significant difference in Ki67 positive epithelial cells as compared to Rb wild type controls (Rb+/+).
(p=0.08). In contrast, Rb ablated lungs (RbLoxP/LoxP) exhibited increased proliferation as compared to Rb wild type controls (Rb+/+) (*p=0.0006) and Rb haploinsufficient lungs (Rb+/LoxP), (**p=0.002). Data is representative of 6-7 animals per time point.
78
Figure 2-7
A B
79
Figure 2-7: Rb ablation is not associated with altered p53 or Bax expression.
A. Lysates were prepared from Rb ablated and control lungs before injury (Day 0) and on day 14 and 9 months after naphthalene induced injury. Western blot analysis was performed for total p53 (p53), activated p53 as indicated by phosphorylation at serine 15 (Phospho-p53), and Bax. Blots were reprobed for actin to control for protein loading. Representative Western blots are shown. Total p53 (arrow) and Bax were detected in RB ablated and control lungs.
Phosphorylated p53 was not detected in any of the samples despite detection in the positive control. B. Signal intensities were quantified and normalized to actin
(*sample not included in quantitative analysis due to defective lane). Data is represented as expression relative to day 0 control lungs (average + SD). No statistically significant difference in total p53 or Bax expression was detected in Rb ablated versus control lungs at any time point analyzed. Additionally, p53 and Bax expression was not altered at day 14 or 9 months after naphthalene treatment as compared to baseline (Day 0) regardless of Rb status.
80 REFERENCES
Agami R, Bernards R. Convergence of mitogenic and DNA damage signaling in the
G1 phase of the cell cycle. Cancer Lett 2002; 177 (2):111-8.
Alexander K, Hinds PW. Requirement for p27(KIP1) in retinoblastoma protein- mediated senescence. Mol Cell Biol 2001; 21 (11):3616-31.
Artinian V, Kvale PA. Cancer and interstitial lung disease. Curr Opin Pulm Med
2004; 10 (5):425-34.
Balmer A, Zografos L, Munier F. Diagnosis and current management of retinoblastoma. Oncogene 2006; 25 (38):5341-9.
Binne UK, Classon MK, Dick FA et al. Retinoblastoma protein and anaphase- promoting complex physically interact and functionally cooperate during cell-cycle exit. Nat Cell Biol 2007; 9 (2):225-32.
Buckpitt A, Chang AM, Weir A et al. Relationship of cytochrome P450 activity to
Clara cell cytotoxicity. IV. Metabolism of naphthalene and naphthalene oxide in microdissected airways from mice, rats, and hamsters. Mol Pharmacol 1995; 47
(1):74-81.
Clarke AR, Maandag ER, van Roon M et al. Requirement for a functional Rb-1 gene in murine development. Nature 1992; 359 (6393):328-30.
Classon M, Salama S, Gorka C et al. Combinatorial roles for pRB, p107, and p130 in
E2F-mediated cell cycle control. Proc Natl Acad Sci U S A 2000; 97 (20):10820-5.
Cobrinik D. Pocket proteins and cell cycle control. Oncogene 2005; 24 (17):2796-
809.
81 Daniels CE, Jett JR. Does interstitial lung disease predispose to lung cancer? Curr
Opin Pulm Med 2005; 11 (5):431-7.
Decesse JT, Medjkane S, Datto MB et al. RB regulates transcription of the
p21/WAF1/CIP1 gene. Oncogene 2001; 20 (8):962-71.
Dimova DK, Dyson NJ. The E2F transcriptional network: old acquaintances with
new faces. Oncogene 2005; 24 (17):2810-26.
Fausto N. Mouse liver tumorigenesis: models, mechanisms, and relevance to human
disease. Semin Liver Dis 1999; 19 (3):243-52.
Haigis K, Sage J, Glickman J et al. The related retinoblastoma (pRb) and p130 proteins cooperate to regulate homeostasis in the intestinal epithelium. J Biol Chem
2006; 281 (1):638-47.
Harrington EA, Bruce JL, Harlow E et al. pRB plays an essential role in cell cycle
arrest induced by DNA damage. Proc Natl Acad Sci U S A 1998; 95 (20):11945-50.
Herrera RE, Sah VP, Williams BO et al. Altered cell cycle kinetics, gene expression,
and G1 restriction point regulation in Rb-deficient fibroblasts. Mol Cell Biol 1996; 16
(5):2402-7.
Huh MS, Parker MH, Scime A et al. Rb is required for progression through myogenic
differentiation but not maintenance of terminal differentiation. J Cell Biol 2004; 166
(6):865-76.
Iavarone A, King ER, Dai XM et al. Retinoblastoma promotes definitive
erythropoiesis by repressing Id2 in fetal liver macrophages. Nature 2004; 432
(7020):1040-5.
82 Jacks T, Fazeli A, Schmitt EM et al. Effects of an Rb mutation in the mouse. Nature
1992; 359 (6393):295-300.
Kleinerman RA, Tarone RE, Abramson DH et al. Hereditary retinoblastoma and risk of lung cancer. J Natl Cancer Inst 2000; 92 (24):2037-9.
Kucherlapati MH, Nguyen AA, Bronson RT et al. Inactivation of conditional Rb by
Villin-Cre leads to aggressive tumors outside the gastrointestinal tract. Cancer Res
2006; 66 (7):3576-83.
Lee EY, Chang CY, Hu N et al. Mice deficient for Rb are nonviable and show defects in neurogenesis and haematopoiesis. Nature 1992; 359 (6393):288-94.
Lipinski MM, Macleod KF, Williams BO et al. Cell-autonomous and non-cell- autonomous functions of the Rb tumor suppressor in developing central nervous system. Embo J 2001; 20 (13):3402-13.
Loonstra A, Vooijs M, Beverloo HB et al. Growth inhibition and DNA damage induced by Cre recombinase in mammalian cells. Proc Natl Acad Sci U S A 2001; 98
(16):9209-14.
Maddison LA, Sutherland BW, Barrios RJ et al. Conditional deletion of Rb causes early stage prostate cancer. Cancer Res 2004; 64 (17):6018-25.
Maeda S, Kamata H, Luo JL et al. IKKbeta couples hepatocyte death to cytokine- driven compensatory proliferation that promotes chemical hepatocarcinogenesis. Cell
2005; 121 (7):977-90.
Mayhew CN, Bosco EE, Fox SR et al. Liver-specific pRB loss results in ectopic cell cycle entry and aberrant ploidy. Cancer Res 2005; 65 (11):4568-77.
83 Meuwissen R, Linn SC, Linnoila RI et al. Induction of small cell lung cancer by somatic inactivation of both Trp53 and Rb1 in a conditional mouse model. Cancer
Cell 2003; 4 (3):181-9.
Minna JD, Roth JA, Gazdar AF. Focus on lung cancer. Cancer Cell 2002; 1 (1):49-
52.
Novitch BG, Mulligan GJ, Jacks T et al. Skeletal muscle cells lacking the retinoblastoma protein display defects in muscle gene expression and accumulate in S and G2 phases of the cell cycle. J Cell Biol 1996; 135 (2):441-56.
Okudela K, Ito T, Mitsui H et al. The role of p53 in bleomycin-induced DNA damage in the lung. A comparative study with the small intestine. Am J Pathol 1999; 155
(4):1341-51.
O'Reilly MA, Staversky RJ, Huyck HL et al. Bcl-2 family gene expression during severe hyperoxia induced lung injury. Lab Invest 2000; 80 (12):1845-54.
Pacal M, Bremner R. Insights from animal models on the origins and progression of retinoblastoma. Curr Mol Med 2006; 6 (7):759-81.
Park KS, Wells JM, Zorn AM et al. Transdifferentiation of ciliated cells during repair of the respiratory epithelium. Am J Respir Cell Mol Biol 2006; 34 (2):151-7.
Perl AK, Tichelaar JW, Whitsett JA. Conditional gene expression in the respiratory epithelium of the mouse. Transgenic Res 2002; 11 (1):21-9.
Plopper CG, Suverkropp C, Morin D et al. Relationship of cytochrome P-450 activity to Clara cell cytotoxicity. I. Histopathologic comparison of the respiratory tract of mice, rats and hamsters after parenteral administration of naphthalene. J Pharmacol
Exp Ther 1992; 261 (1):353-63.
84 Rodin SN, Rodin AS. Origins and selection of p53 mutations in lung carcinogenesis.
Semin Cancer Biol 2005; 15 (2):103-12.
Ruiz S, Santos M, Segrelles C et al. Unique and overlapping functions of pRb and
p107 in the control of proliferation and differentiation in epidermis. Development
2004; 131 (11):2737-48.
Sage J, Miller AL, Perez-Mancera PA et al. Acute mutation of retinoblastoma gene
function is sufficient for cell cycle re-entry. Nature 2003; 424 (6945):223-8.
Schmidt EE, Taylor DS, Prigge JR et al. Illegitimate Cre-dependent chromosome rearrangements in transgenic mouse spermatids. Proc Natl Acad Sci U S A 2000; 97
(25):13702-7.
Scholzen T, Gerdes J. The Ki-67 protein: from the known and the unknown. J Cell
Physiol 2000; 182 (3):311-22.
Sherr CJ, McCormick F. The RB and p53 pathways in cancer. Cancer Cell 2002; 2
(2):103-12.
Sisson TH, Hansen JM, Shah M et al. Expression of the reverse tetracycline- transactivator gene causes emphysema-like changes in mice. Am J Respir Cell Mol
Biol 2006; 34 (5):552-60.
Soriano P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat
Genet 1999; 21 (1):70-1.
Spike BT, Dirlam A, Dibling BC et al. The Rb tumor suppressor is required for stress erythropoiesis. Embo J 2004; 23 (21):4319-29.
85 Srinivasan SV, Mayhew CN, Schwemberger S et al. RB loss promotes aberrant
ploidy by deregulating levels and activity of DNA replication factors. J Biol Chem
2007; 282 (33):23867-77.
Strong LC, Herson J, Haas C et al. Cancer mortality in relatives of retinoblastoma
patients. J Natl Cancer Inst 1984; 73 (2):303-11.
Thilly WG. Have environmental mutagens caused oncomutations in people? Nat
Genet 2003; 34 (3):255-9.
Van Winkle LS, Buckpitt AR, Nishio SJ et al. Cellular response in naphthalene-
induced Clara cell injury and bronchiolar epithelial repair in mice. Am J Physiol
1995; 269 (6 Pt 1):L800-18.
Walkley CR, Shea JM, Sims NA et al. Rb regulates interactions between
hematopoietic stem cells and their bone marrow microenvironment. Cell 2007; 129
(6):1081-95.
Wikenheiser-Brokamp KA. Rb family proteins differentially regulate distinct cell
lineages during epithelial development. Development 2004; 131 (17):4299-310.
Wu L, de Bruin A, Saavedra HI et al. Extra-embryonic function of Rb is essential for
embryonic development and viability. Nature 2003; 421 (6926):942-7.
Zacksenhaus E, Jiang Z, Chung D et al. pRb controls proliferation, differentiation,
and death of skeletal muscle cells and other lineages during embryogenesis. Genes
Dev 1996; 10 (23):3051-64.
Zheng L, Flesken-Nikitin A, Chen PL et al. Deficiency of Retinoblastoma gene in
mouse embryonic stem cells leads to genetic instability. Cancer Res 2002; 62
(9):2498-502.
86
Chapter 3: Rb is a critical regulator of progenitor cells in the context
of chronic epithelial remodeling after injury
Nicole A. Mason-Richie, Nagako Stewart, and Kathryn A. Wikenheiser-Brokamp Manuscript in preparation.
ABSTRACT
The retinoblastoma gene product (Rb) regulates cell cycle, differentiation, and
survival in a cell type and context specific manner. Rb function is critical in the pulmonary epithelium as evidenced by nearly universal Rb inactivation in lung cancer. Lung diseases, including lung cancer, COPD, emphysema, and IPF occur in the context of epithelial remodeling induced by cytotoxic damage. Our previous studies demonstrated that Rb plays a critical role in lung epithelial remodeling after
one episode of injury. In the current studies, the role of Rb was assessed during
chronic injury in order to more closely recapitulate chronic human lung disease. Rb
ablation was targeted to the murine lung epithelium, and chronic injury was induced
utilizing naphthalene, a well characterized injury method, that mimics toxic epithelial
damage in human lung disease. These studies led to the discovery of previously
unidentified consequences of naphthalene injury, namely altered epithelial cell
composition and subsequent recruitment of inflammatory cells through an Rb
independent mechanism. Notably, this work revealed a critical role for Rb regulation
in progenitor cell control. Specifically, Rb loss in cooperation with chronic injury
restored pulmonary progenitor cells in the absence of carcinogenesis. These data
provide evidence that coordinate regulation of Rb in balancing regenerative capacity
87 of pulmonary progenitor cells against the development of tumorigenesis is important
in the repairing lung epithelium.
INTRODUCTION
Chronic pulmonary injury and airway remodeling is associated with the vast
majority of lung diseases including asthma, emphysema, chronic obstructive
pulmonary disease, and lung cancer. These pulmonary disorders are common and
thus significant contributors to human morbidity and mortality. Epithelial
regeneration after injury is a key component in airway remodeling and is critical to
restoring respiratory function. The airways are lined by numerous distinct cell types
with specialized functions required for pulmonary maintenance. After injury, this
heterogeneous epithelium is regenerated by a concerted process involving
proliferation, differentiation and morphologic alterations in progenitor, stem and
differentiated cell populations. Specifically, differentiated ciliated cells undergo
morphologic alterations to maintain the epithelial lining after injury but do not
proliferate (Park et al. 2006; Rawlins et al. 2007). In contrast, proliferation and subsequent differentiation of progenitor Clara cells and recently identified epithelial cells with stem cell characteristics (termed bronchioalveolar stem cells (BASCs)) is believed to be critical for lung epithelial repopulation after injury (Kim et al. 2005;
Nolen-Walston et al. 2008). Finally, neuroendocrine cells localize to stem cell niches within the lung epithelium and neuroendocrine cell proliferation after injury is thought to contribute to epithelial regeneration (Reynolds et al. 2000). A prerequisite to understanding chronic lung disease is to identify molecular regulators that control
88 airway repair after injury and to identify cell types in which these signaling molecules
function.
Deregulated epithelial cell proliferation, survival, and differentiation play a
prominent role in the pathogenesis of chronic disease. Rb regulates cell proliferation, differentiation, and survival in a cell type and environment dependent manner. Rb is a critical regulator in the pulmonary epithelium during development and has a unique role in the context of epithelial repair after injury (Mason-Richie et al. 2008;
Wikenheiser-Brokamp 2004). Additionally, Rb is a critical tumor suppressor in epithelial cells as evidenced by Rb inactivation in most, if not all, epithelial derived human malignancies including lung cancer (Sherr & McCormick 2002). The modest phenotypes observed after Rb ablation targeted to multiple epithelial cell types in the mouse is surprising given that Rb is expressed in all tissues and is in involved in so many important processes that are critical for development and cancer suppression
(Cobrinik 2005; Dimova & Dyson 2005; Haigis et al. 2006; Kucherlapati et al. 2006;
Maddison et al. 2004; Mayhew et al. 2005; Meuwissen et al. 2003; Ruiz et al. 2004;
Wikenheiser-Brokamp 2004). The mild phenotypes in many Rb deficient tissues may relate to a unique role for Rb in specific biological settings. Indeed, recent findings showed that although Rb is not required for establishing or maintaining quiescence during lung homeostasis, Rb is essential for establishing epithelial quiescence during repair after injury (Mason-Richie et al. 2008). These data provide evidence that Rb has a critical and unique role in the context of epithelial regeneration after injury.
Cancers frequently occur in the context of chronic epithelial remodeling. Thus, the
89 tumor suppressive function of Rb may relate to unique biochemical properties in the setting of chronic injury or the nature of the cell in which Rb functions.
Progenitor and stem cell populations are critical for tissue repair after injury and are proposed cells of origin for cancer. Several studies identified a role for Rb in stem and progenitor cell regulation and function. Rb ablation in placental trophoblast stem cells leads to hyperproliferation, global placental disruption, and embroyonic lethality (Wenzel et al. 2007). Additionally, reduction of Rb expression in
Arabidopsis roots results in increased numbers of stem cells, and conversely overexpression of Rb in Arabidopsis roots leads to rapid stem cell loss (Wildwater et al. 2005). Rb also regulates hematopoetic progenitor cells (Daria et al. 2008;
Sankaran et al. 2008; Spike et al. 2004; Walkley et al. 2007). Finally, p16, an upstream positive regulator of Rb, suppresses stem and progenitor cell proliferation, function, and regenerative capacity in the brain, hematopoietic system, and pancreas
(Janzen et al. 2006; Krishnamurthy et al. 2006; Molofsky et al. 2006). Mechanisms underlying Rb dependent stem/progenitor cell regulation are incompletely understood, but may be related to changes in cellular proliferation, differentiation, and/or interactions with cellular microenvironment.
Similar to development and cancer, Rb function in epithelial remodeling likely involves multiple interactions between different cell types and signaling cues within the organ. Pulmonary cell types important for epithelial regeneration after injury have been largely identified utilizing the naphthalene induced lung injury model which targets cytotoxic damage to the pulmonary epithelium and mimics epithelial damage caused by toxicant inhalants such as tobacco smoke (Park et al.
90 2006; Plopper et al. 1992; Van Winkle et al. 1995; Witschi et al. 1997). In the present study, Rb ablation was targeted to the lung epithelium and a naphthalene based chronic injury model was developed to elucidate the temporal and cellular requirements for Rb in the context of epithelial remodeling after injury. The results show that chronic exposure to naphthalene results in altered epithelial composition and subsequent recruitment of inflammatory cells, thus identifying a previously unknown long term effect of naphthalene induced injury. Epithelial regeneration after injury is regulated by Rb, whereas recruitment of inflammatory cells occurs through an Rb independent mechanism. Rb loss specifically affected progenitor cell regeneration after injury. In contrast, loss of Rb function did not alter differentiated ciliated cells, and led only to transient alterations in stem cells. Sustained epithelial cell proliferation after injury resulted in progenitor cell restoration in Rb ablated lungs in the absence of tumorigenesis. These studies demonstrate a unique regulatory role for Rb in progenitor cells and support the conclusion that precise control of Rb function is critical for balancing progenitor cell proliferation, and thus tissue renewal capacity, against the risk of developing cancer.
METHODS
Generation of animals with Rb ablated lungs and induction of chronic pulmonary injury. Lung epithelial Rb ablation was induced prenatally with doxycycline treatment during development as previously reported (Mason-Richie et al. 2008). Briefly, mice with Rb deficient lung epithelium were generated by mating
CC10-rtTA and tetO-Cre double transgenic mice to RbLoxP/LoxP mice. Rb ablation
91 was targeted to the lung epithelium during development by doxycycline
administration to pregnant dams. Controls consisted of littermates lacking one or
both transgenes required for Rb ablation. Two to four month old mice were treated
with naphthalene (Sigma-Aldrich) at a dose of 200mg/kg by intraperitoneal injection
weekly for 7 consecutive weeks. One week later, mice were challenged with a
300mg/kg naphthalene dose.
Tissue processing and analysis. Tissues were fixed in 10% neutral buffered formalin and paraffin embedded. Morphology was assessed by hematoxylin and eosin stained sections. Immunohistochemistry was performed on deparaffinized 5 micron sections after antigen retrieval in 10 mM citrate solution microwaved for seven minutes. Primary antibodies were diluted in 0.1% bovine serum albumin in
phosphate buffered saline, applied to tissue sections, and incubated overnight at 4°C
using the following dilutions: Ki67 1:50 (Clone B56, BD PharMingen), CCSP
1:20000 (kind gift from Jeffery Whitsett), β-tubulin 1:500 (BioGenex MU178-UC).
Antibody staining was detected with Vectastain Elite ABC, M.O.M.
Immunodetection and DAB Substrate Kits (Vector Laboratories, Inc.). Tissues were counterstained with nuclear fast red. CCSP positive cells were also identified by immunofluorescence as described below for BASC identification. The percentage of positive staining cells was determined by counting 200-400 epithelial cells per animal representing at least two lung lobes per mouse. Proximal and distal airways were analyzed separately. Total airway values reflect combined counts representing proximal and distal airways. Analyses represent 4-9 animals per group. Statistical
92 significance was accepted as a p-value < 0.05 as determined by unpaired Student's t- tests.
Bronchoalveolar lavage and cell analysis. Mice were administered pentobarbital sodium by intraperitoneal or intramuscular injection and sacrificed by exsanguination.
Five 1 ml aliquots of 0.9% NaCl were flushed into the lungs, withdrawn by syringe three times for each aliquot and pooled. Total volume of bronchoalveolar lavage fluid (BALF) was recorded and was similar among animals (4.87 ± 0.28 ml, n = 8).
BALF was centrifuged at 150 g for 10 min and cells were resuspended in PBS, mixed
with trypan blue (0.4%) and counted on a hemocytometer. Differential cell counts were performed on Diff Quik stained (Dade Behring, Inc) cytospin preparations.
Two hundred cells were counted per animal.
BASC identification and quantification. Tissues were fixed in 10% neutral buffered formalin, embedded in paraffin, and sectioned at 5 microns. Sections were deparaffinized, hydrated, and subsequently blocked for 2 hours with 4% donkey serum. Primary antibodies against CCSP (1:1000 antibody generated in rabbit) and the C-terminus of SP-C (1:500 dilution of antibody generated in guinea pig)
(antibodies kind gifts from Dr. Jeffrey Whitsett Cincinnati Children’s Hospital
Medical Center) were applied simultaneously and incubated overnight at 4°C.
Sections were subsequently washed 6 times in PBS/0.3% Triton X-100. Secondary
antibody Alexa 594 (anti-guinea pig, Invitrogen) was applied at a dilution of 1:200
and incubated for 1 hour at room temperature. Sections were again washed 6 times in
93 PBS/0.3% Triton X-100 and secondary antibody Alexa 488 (anti-rabbit, Invitrogen) was applied at a dilution of 1:200 and incubated for 1 hour at room temperature.
Sections were rinsed once in PBS/0.3% Triton X-100, followed by washes in 0.1M
PB and 0.05M PB. Sections were then coverslipped with Vectashield mounting medium containing DAPI and analyzed on a Zeiss fluorescent microscope (Vector
Laboratories, INC). Potential double positive cells were examined by optical sectioning to produce Z stack images. Each optical section was ≤ 0.55 microns to optimize confidence that staining with both antibodies localized to the same cell. Z stack images were evaluated using the Axiovision computer software. BASCs were quantified by determining the number of double positive cells per terminal bronchiole. Statistical significance was determined by chi-square analysis. Results represent 7-10 animals from both Rb ablated and control groups, and 132-215 terminal bronchioles for each time point.
RESULTS
Generation of chronic injury model. Our previous studies establishing an essential
role for Rb in lung epithelial remodeling after injury utilized a single naphthalene
injection of 300 mg/kg to induce uniform damage throughout the conducting airways
(Mason-Richie et al. 2008; Plopper et al. 1992). While this protocol induced marked epithelial injury, the high naphthalene dose resulted in a 28% animal mortality rate.
To avoid the anticipated high mortality following multiple naphthalene administrations at this dose, chronic injury was induced by seven weekly naphthalene injections at a decreased dose of 200 mg/kg followed by a final challenge dose of 300
94 mg/kg (Figure 3-1). Injections were given at weekly intervals to avoid epithelial tolerance to naphthalene induced injury that occurs with more frequent dosing
(O'Brien et al. 1989). A 200 mg/kg naphthalene dose was chosen since this dose is reported to result in significant epithelial damage throughout the airway without a reported high animal mortality rate (Plopper et al. 1992; Van Winkle et al. 1995).
The final challenge dose was given to mimic epithelial injury induced after the single higher naphthalene dose used in our previous studies thus allowing for a more direct comparison between epithelial remodeling after single versus multiple episodes of injury.
The death rate following the chronic injury protocol was 38% (25/66), just slightly higher than the 28% (16/58) mortality rate after a single 300 mg/kg naphthalene dose. Epithelial injury was induced in the animals administered 200 mg/kg naphthalene as confirmed by morphologic analysis of lungs four days after the first naphthalene administration. Airways were lined by flattened or regenerating low cuboidal cells and exfoliated epithelial cells were present within airway lumens, in accordance with published morphological characteristics of naphthalene injury (Van
Winkle et al. 1995). Tolerance to naphthalene induced injury did not occur as evidenced by the physically ill appearance of the mice and the similar number of animal death after one dose of 300mg/kg and the final challenge dose following multiple injury episodes. Thus, the developed treatment regimen results in chronic injury targeted to the lung epithelium in the absence of substantial animal mortality or tolerance to naphthalene induced airway damage.
95 Chronic naphthalene injury results in altered epithelial composition and
pulmonary inflammation. Clara and ciliated cell number and distribution were
markedly altered in chronically injured lungs 14 days after the final naphthalene
challenge dose as assessed by morphologic examination. An increase in ciliated cells and a coincident decrease in Clara cells were present within the airways of chronically injured lungs as compared to uninjured controls. To determine whether the alterations in epithelial morphology were accompanied by changes in cell specific gene expression, chronically injured lungs were assessed for expression of the Clara cell marker, Clara cell secretory protein (CCSP/Scgb1a1), and the ciliated cell marker, β-tubulin. Consistent with the morphological changes, CCSP positive cells were significantly decreased and ciliated cells were significantly increased in injured lungs as compared to uninjured controls (Figure 3-2). Thus, chronic injury leads to changes in epithelial cell composition characterized by a depletion of Clara cells and coincident increase in ciliated cells.
To determine the long term effects of chronic naphthalene injury and resultant alterations in epithelial composition, chronically injured Rb proficient lungs were assessed nine months after the final challenge dose. Interestingly, 81% (9/11) of the chronically injured lungs contained tan, firm, poorly defined gross lesions that varied in size from 1 mm to involving entire lobes. Morphologically the lesions were comprised of marked inflammation within airway lumens and alveolar spaces characterized by enlarged macrophages containing abundant, eosinphilic cytoplasmic material and cholesterol clefts (Figure 3-3). Variable numbers of neutrophils were also present in histologic sections (Figure 3-3). The number of inflammatory cells
96 recruited into the airways varied among animals as assessed by total cell counts in the bronchioalveolar lavage fluid (BALF) (Figure 3-3). The variation in total BALF cells among animals correlated well with the variable extent of lung involvement noted upon gross examination. Differential cell counts of BALF cells confirmed that macrophages represented the majority of the cells within the airway (Figure 3-3).
Neutrophils were also present in BALF but the neutrophil contribution varied among animals, consistent with the variable presence of neutrophils in lung sections examined morphologically (Figure 3-3). Taken together, these data demonstrate that chronic naphthalene induced injury results in alterations in pulmonary epithelial cell composition and subsequent recruitment of inflammatory cells.
Pulmonary inflammatory cell recruitment represents a long term effect of naphthalene induced injury and occurs through an Rb independent mechanism.
Our previous studies demonstrated that Rb has a critical and unique function in the remodeling lung epithelium (Mason-Richie et al. 2008). Thus, we hypothesized that loss of Rb function would alter pulmonary response to chronic injury. To directly test this hypothesis, Rb ablation was targeted to the lung epithelium and mice with Rb ablated lungs and control littermates with Rb proficient lungs were subjected to chronic naphthalene induced epithelial injury. Pulmonary inflammation was similar in Rb ablated and Rb proficient control lungs nine months after the final naphthalene challenge dose (data not shown). Gross focal lesions were detected in 72% (8/11) of
Rb ablated lungs similar to the 81% (9/11) incidence of lesions in lungs from Rb proficient control littermates. Morphologic analysis confirmed the inflammatory nature of the gross lesions and showed a similar infiltration of macrophages and
97 neutrophils in Rb ablated and proficient lungs. Interestingly, a similar inflammatory infiltrate was also present in Rb ablated lungs nine months after a single episode of naphthalene induced injury. To determine whether the inflammatory cell recruitment after a single episode of injury was dependent upon Rb ablation, Rb ablated and Rb proficient lungs were examined 9 to 14.5 months after a single episode of naphthalene induced injury. Pulmonary inflammation was not markedly affected by Rb status since inflammation was similar in Rb ablated and Rb proficient injured lungs as determined by gross and microscopic examination (Figure 3-4). Importantly, pulmonary inflammation was dependent upon naphthalene induced injury since Rb ablated lungs from oil vehicle treated mice lacked gross lesions and significant inflammation morphologically (Figure 3-4). These data directly demonstrate that pulmonary inflammation is dependent upon naphthalene treatment, and that the injury dependent recruitment of chronic inflammatory cells occurs through an Rb independent mechanism. Moreover, the studies provide evidence that a single episode of naphthalene induced injury is sufficient to result in pulmonary inflammation, thus revealing a previously unidentified long term effect of naphthalene induced injury.
Rb loss facilitates restoration of the progenitor Clara cell population in the
context of chronic injury. In contrast to the inflammatory phenotype, the epithelial
response to chronic injury was affected by Rb loss. CCSP positive Clara cells were
increased in Rb ablated chronically injured lungs as compared to Rb proficient
controls 14 days after the final naphthalene challenge dose (Figure 3-5).
98 Interestingly, the Rb dependent increase in Clara cells was restricted to the distal
airways suggesting that Rb function may be more critical in specific regions of the
airway. In contrast to Clara cells, no change in β-tubulin positive ciliated cells was seen in Rb ablated lungs as compared to Rb proficient controls. A similar increase in ciliated cells was present in chronically injured lungs independent of Rb status
(Figure 3-6). Thus, Rb ablation results in region and cell type specific effects on pulmonary epithelial remodeling in the context of chronic injury.
The Rb dependent increase in Clara cell contribution to the remodeling airway epithelium was still present nine months after the final naphthalene challenge dose providing evidence that this phenotype represented a sustained effect of Rb loss
(Figure 3-7). Two weeks after the final episode of naphthalene induced injury, it was noted that Clara cell number was not restored to baseline levels in uninjured lungs despite being more numerous in Rb ablated lungs (Figure 3-5). However, Clara cell number continued to increase after injury cessation, and the percentage of CCSP positive Clara cells in chronically injured Rb ablated lungs returned to baseline levels nine months after the final episode of epithelial injury (Figure 3-7). In contrast to chronic injury, Clara cells were not restored in Rb ablated lungs exposed to a single episode of injury. Furthermore, Clara cells represented a significantly greater proportion of epithelial cells in the distal airway of chronically injured lungs as compared to lungs exposed to a single episode of injury (Figure 3-7). Taken together, these data indicate that Rb is a critical regulator of Clara cells in the context of chronic injury, and that continual epithelial damage cooperates with loss of Rb function to restore Clara cells in the remodeling airway epithelium.
99
Rb ablation and epithelial injury result in a transient decrease in BASCs that is
not sustained in the context of chronic injury. Clara cells are capable of self
renewal but can also arise from pulmonary stem cells (Evans et al. 1978; Kim et al.
2005). Therefore, Clara cell expansion in Rb ablated lungs could result from Clara
cell intrinsic defects or reflect abnormalities in stem cells that give rise to Clara cells
(Kim et al. 2005). BASCs were previously reported to have stem cell characteristics
and have been implicated as important for maintaining bronchiolar Clara cells in the
context of naphthalene induced injury (Kim et al. 2005; Nolen-Walston et al. 2008;
Zhang et al. 2008). Moreover, Rb ablation results in stem cell expansion in the murine placenta and Arabidopsis roots providing evidence that Rb has a role in stem cell regulation (Wenzel et al. 2007; Wildwater et al. 2005). An increase in BASCs after Rb ablation could also predispose to tumors since BASC expansion is correlated with lung tumorigenesis in several murine models (Kim et al. 2005; Yanagi et al.
2007), and BASCs were recently implicated as cells of origin for lung cancer (Kim
2007).
To determine whether BASC expansion was an underlying mechanism for the
increased Clara cells in Rb ablated lungs, BASCs were quantified in injured and
uninjured Rb ablated and proficient lungs by identifying cells co-expressing CCSP and the type II cell marker, surfactant protein C (SPC) (Figure 3-8). BASCs were localized predominantly to the bronchioalveolar duct junction (BADJ) in Rb ablated and proficient lungs, as previously described (Kim et al. 2005). No significant difference in BASC number was observed in Rb ablated versus Rb proficient
100 uninjured lungs (Figure 3-8). Additionally, BASC number was similar in Rb ablated and proficient lungs four days after a single episode of naphthalene induced injury, a time point within the window of maximal proliferation in the repairing lung (Figure
3-8). Interestingly, BASCs were significantly decreased in Rb ablated lungs as
compared to Rb proficient controls on day 14 after a single episode of injury (Figure
3-8). A significantly greater number of terminal bronchioles with no BASCs were
seen in Rb ablated as compared to Rb proficient controls. Conversely, Rb proficient
lungs exhibited a greater number of terminal bronchioles with two or more BASCs as
compared to Rb ablated lungs. To determine whether the Rb dependent decrease in
BASCs was sustained in the context of chronic injury, BASCs were quantified in Rb
ablated and proficient lungs from mice treated with the chronic injury protocol. No
significant difference in BASC number was observed in Rb ablated versus Rb
proficient controls 14 days following the final naphthalene administration (Figure 3-
8) despite the increase in Clara cells noted in Rb ablated lungs at this time point
(Figure 3-5). Thus, Rb loss does not affect BASC number during homeostatic
conditions but results in a transient decrease in BASCs at the initiation of pulmonary
injury that is not sustained in the context of chronic injury. These data provide
evidence that Clara cell alterations in chronically injured Rb ablated lungs are not due
to Rb dependent expansion of this stem cell population.
Sustained epithelial cell proliferation contributes to Clara cell restoration in Rb
ablated lungs in the absence of tumor formation. Our previous studies
demonstrated that Clara cells constitute the vast majority of aberrantly proliferating
101 cells in the remodeling Rb deficient lung (Mason-Richie et al. 2008). Moreover,
Rawlins, et al. reported that ciliated cells do not proliferate or transdifferentiate as
part of the repair process (Rawlins et al. 2007). Thus, we hypothesized that enhanced
Clara cell proliferation was the mechanism underlying Clara cell restoration in
chronically injured Rb ablated lungs. To test this hypothesis, Rb ablated and proficient lungs were assessed for expression of the proliferation marker, Ki67. Rb ablated lungs exhibited increased proliferation as compared to Rb proficient controls after chronic injury despite similar proliferation rates in uninjured Rb ablated and proficient controls (Figure 3-9). Additionally, epithelial proliferation was significantly increased in distal airways of Rb deficient lungs after chronic injury as compared to lungs exposed to a single episode of injury (Figure 3-9). The concomitant increase in epithelial proliferation and Clara cells (Figure 3-5) after
chronic versus single injury supports a mechanism wherein enhanced proliferation
results in Clara cell restoration. Importantly, enhanced and sustained epithelial
proliferation in chronically injured Rb ablated lungs occurred in the absence of
tumorigenesis. No tumors were detected in 11 Rb ablated chronically injured lungs at
11-14 months of age, and a single microscopic tumor was detected in 1 of 11 age
matched Rb proficient chronically injured controls. Rb loss alone or Rb loss in the
presence of a single episode of naphthalene treatment also does not result in
tumorigenesis (Mason-Richie et al. 2008). Taken together, these data demonstrate
that Rb loss results in sustained epithelial proliferation in the context of chronic injury
that lead to progenitor cell restoration within the airway. Importantly, the sustained
progenitor cell proliferation in Rb ablated lungs occurs in the absence of neoplastic
102 transformation even when combined with multiple exposures to naphthalene, a
component of tobacco smoke thought to have carcinogenic properties (Abdo et al.
1992). Collectively, the results provide evidence that precise Rb regulation is critical
for balancing progenitor cell proliferation, and thus tissue renewal capacity against
the risk of developing cancer.
DISCUSSION
Chronic injury induced depletion of Clara cells occurs in human lung disease
and may contribute to inflammatory influx following chronic naphthalene
injury. The current studies demonstrate decreased Clara cell number after chronic naphthalene injury. Since naphthalene is toxic to Clara cells, a decrease in Clara cell number after multiple episodes of naphthalene treatment is not entirely unexpected.
Furthermore, one could hypothesize that increased ciliated cell number is simply a compensatory response to Clara cell depletion, the other prominent lung epithelial population. However, decreased Clara cell number is associated with pulmonary damage in humans, indicating that altered cellular composition is not a naphthalene specific response. Smoking related epithelial damage causes decreased Clara cell number. Decreased CCSP concentration is observed in the BALF of smokers as compared to nonsmokers. Accordingly, smokers exhibit decreased CCSP positive cells as compared to their nonsmoking counterparts (Shijubo et al. 1997).
Additionally, decreased proportions of CCSP positive epithelial cells are observed in asthmatic patients airways concurrent with inflammatory influx as compared to non asthmatic subjects (Shijubo et al. 1999). These data indicate examples of injury that
103 induce Clara cell depletion, similar to what is observed in the murine lung following chronic injury in the current studies. Thus, Clara cell loss after naphthalene injury is not simply a naphthalene specific effect and closely mimics the cellular alterations observed in the human condition of chronic lung disease.
Clara cell depletion could contribute to inflammatory influx with subsequent reduction of CCSP after chronic injury. Clara cells abundantly produce CCSP, one of the most plentiful proteins in the lining fluid of airways, and a potent anti- inflammatory mediator (Beier et al. 1978; Broeckaert et al. 2000; Dierynck et al.
1995). In addition to its anti-cytokine activities, CCSP is an inhibitor of phospholipase A2 (PLA2) secretion, which is important in induction of the inflammatory response (Miele et al. 1988). Human patient analysis reveals that severe lung disease results in Clara cell depletion as evidenced by decreased CCSP concentrations observed in BALF collected from patients with late stage asthma,
COPD, idiopathic pulmonary fibrosis, and bronchiolitus obliterans associated with lung transplantation (Bernard et al. 1992; Lesur et al. 1995; Mattsson et al. 2005;
Shijubo et al. 1999). Accordingly, CCSP null mice exhibit exaggerated inflammatory responses to inhaled oxidants and respiratory viruses (Harrod et al. 1998; Johnston et al. 1997; Johnston et al. 1998; Stripp et al. 1996). Interestingly, there is a parallel between the inflammatory cell types CCSP inhibits and the influx of cells observed in naphthalene injured lungs. Specifically, CCSP has been shown to inhibit chemotaxis and phagocytosis of neutrophils and monocytes, the precise cell types that contribute to pulmonary inflammation upon chronic naphthalene treatment (Schiffmann et al.
1983; Vasanthakumar et al. 1988). Moreover, CCSP-/- mice exhibit pulmonary
104 consolidation and infiltration of neutrophils and macrophages in response to adenoviral infection (Harrod et al. 1998). Therefore, decreased Clara cell number provides a potential mechanism underlying pulmonary inflammation following chronic airway damage.
Rb loss contributes to progenitor cell restoration in the absence of lung tumorigenesis. Although Rb loss is thought to be a negative consequence that enhances the likelihood of tumorigenesis, our data suggests that Rb loss contributes to progenitor cell restoration through sustained proliferation and possibly enhances epithelial regeneration during chronic remodeling. Interestingly, some studies have proposed that losing Rb function may actually be beneficial to repair after injury in specific circumstances. Mammal hair cell loss causes irreversible hearing and balance damage due to lack of spontaneous hair cell regeneration, and Rb loss actually contributes to repair in this specific case. Particularly, Rb loss in hair cells in vivo reestablishes the ability of differentiated cells to regenerate and become functional (Sage et al. 2005). Sage et. al hypothesizes that induction of a reversible block of functional Rb may contribute to reestablishing this cellular population without complete Rb inactivation. In another example, Rb inactivation by phosphorylation is associated with cell cycle progression and enhanced tissue repair in a liver injury model in rats (Devi et al. 2005). These data indicate that loss of Rb may be beneficial in tissue repair after injury, but likely involves tight regulation of
Rb function for protection against tumorigenesis.
105 Similar to Rb, p16 is critical in balancing regenerative capacity with cancer risk. p16 is important in cancer prevention by induction of cellular senescence which is an important tumor suppressive function (Ben-Porath et al. 2005). Increased p16 levels in stem/progenitor cells contributes to altered tissue maintenance and repair
(Janzen et al. 2006). For example, p16 induction causes a decline in proliferation in hematopoetic and neural stem cells, as well as pancreatic beta cells, a unipotent progenitor population. Accordingly, p16 deficient animals exhibit increased stem cell number, enhanced self renewal, and ability to regenerate after injury in several stem/progenitor cell types (Janzen et al. 2006). The function of p16 has striking similarities with Rb in the lung since Rb loss contributes to pulmonary progenitor cell restoration and p16 loss contributes to enhanced neural progenitor self renewal and pancreatic islet cell regeneration (Krishnamurthy et al. 2006; Molofsky et al. 2006).
This data demonstrates that naphthalene administration results in altered cellular composition and marked pulmonary inflammation, revealing previously unidentified consequences of naphthalene treatment. Given that naphthalene is a commonly used injury method that has been utilized extensively to understand pulmonary epithelial repair and identify cell types important in these process, it is important to fully understand this injury method and its long term effects.
These studies demonstrate that loss of Rb in cooperation with chronic injury results in pulmonary progenitor cell reconstitution, in a critical epithelial population
(Giangreco et al. 2002; Hong et al. 2001; Van Winkle et al. 1995). These data identify an important role for Rb loss of function in facilitating progenitor cell restoration during chronic injury conditions. Since Rb is critical in progenitor cell
106 regulation in the lung epithelium and progenitor cells are imperative for lung
remodeling, these data provide evidence that Rb inactivation could actually facilitate pulmonary repair. However, it is clear that Rb has to be tightly regulated in order to restore progenitor cells without increasing the risk for lung tumorigenesis.
ACKNOWLEDGEMENTS
Grant support: National Heart Lung and Blood Institute R01 HL079193 (KAWB).
I thank Shawn Grant and Machiko Ikegami for their help in BALF collection and analysis. I also thank Angela Keiser and Dave Loudy for their help with immunohistochemistry/immunofluorescent protocols.
107
Figure 3-1
108 Figure 3-1: Chronic injury model. Chronic injury was targeted to the lung epithelium by multiple intraperitoneal naphthalene injections. Lungs were collected and examined before injury at Day 0 to establish a baseline lung phenotype. Mice were treated weekly with a dose of 200 mg/kg for seven weeks followed by a single challenge dose of 300mg/kg one week later. Lungs were collected on Day 14 and 9 months after the final challenge dose in order to assess the short and long term effects of chronic injury on the pulmonary epithelium.
109 Figure 3-2
110 Figure 3-2: Chronic injury results in altered cellular composition.
Immunohistochemical analysis for CCSP and ß-tubulin on Day 0 and Day 14 after chronic injury. (A) A statistically significant decrease in CCSP positive cells was noted at Day 14 as compared to Day 0 (*p=0.0000476). (B) In contrast, a statistically significant increase in ß-tubulin positive cells was observed in lungs at
Day 14 as compared Day 0 (*p=0.0236). Data is representative of 4-5 animals per time point for CCSP analysis and 5-7 animals per time point for ß-tubulin analysis.
Quantitative data represents average + SE.
111 Figure 3-3
112 Figure 3-3: Chronic injury results in pulmonary inflammation. Morphologic and quantitative cellular analysis of BALF (bronchioalveolar lavage fluid) on lungs collected 9 months after chronic injury. (A) Inflammatory lesion is represented in
H&E stained section. (B) Higher power H&E stained lung section demonstrated specific inflammatory cells types present in lesions, including macrophages
(arrowhead) and neutrophils (arrow). (C) BALF exhibited animal to animal variability in number of cells. (D) Cell differential analysis showed that the vast majority of inflammatory cells present in inflamed lungs were macrophages.
Number of neutrophils varied between animals, and few lymphocytes were present.
Data is representative of 8 animals for BALF analysis. Quantitative data represents average + SE. (A) Magnification 20x (B) Magnification 100x.
113
Figure 3-4
114
Figure 3-4: A single episode of naphthalene induced injury results in pulmonary inflammation through an Rb independent mechanism.
Morphological analysis of inflammation on H&E stained sections of lungs 9 months after a single episode of injury. H&E stained sections of Rb ablated (A) and Rb proficient control lungs (B) demonstrate a similar inflammatory phenotype, showing that inflammation is not dependent on Rb function. (C) Inflammation was dependent on naphthalene treatment since vehicle treated Rb ablated lungs lacked significant inflammation. Quantitative data represents average + SE. (A-C) Magnification 40x.
115
Figure 3-5
Proximal Distal
116
Figure 3-5: Rb loss contributes to Clara cell restoration after injury. (A-C)
Immunofluoroscence analysis for CCSP (green) in proximal and distal airways at
Day 0 and Day 14 after chronic injury. Nuclei are visualized with DAPI (blue) and
Type II cells stain red. (A) Proximal and distal airways of Day 0 controls exhibit uniform CCSP positive cell staining. (B) CCSP positive cells are decreased in the proximal and distal airway as compared to Day 0 (A). (C) Day 14 Rb ablated lungs exhibit decreased CCSP positive cells in the proximal and distal airway as compared to Day 0 (A). (D) Quantitative analysis revealed a statistical decrease in
Rb proficient controls and Rb ablated lungs after injury in both the proximal and distal airways (p=0.001 proximal, p=0.000012 distal, Control Day 0 vs Day 14)
(p=0.003 proximal, p=0.0006 distal, Rb Ablated Day 0 vs Day 14). Additionally, a statistically significant increase in CCSP positive cells was observed in Rb ablated lungs in the distal airway as compared to controls at Day 14 (p*=0.016). Data is representative of 4-5 animals per time point. Quantitative data represents average +
SE. (A-C) Magnification 40x.
117
Figure 3-6
A C E
B D
118
Figure 3-6: Chronic injury results in increased ciliated cell number through an
Rb independent mechanism. Immunohistochemmical analysis for ß-tubulin before injury (Day 0) and at Day 14 after chronic injury. (B&D) ß-tubulin immunohistochemistry demonstrates increased numbers of ß-tubulin positive cells after injury (arrows) as compared to before injury (A&C) in both Rb ablated and control lungs. (E) Quantitation of ß-tubulin positive cells demonstrated a significantly greater number of ß-tubulin positive cells after injury (p=0.0001 Rb ablated, p=0.02 Rb proficient controls). No significant differences in number of ciliated cells in Rb ablated versus control lungs were observed at any time point.
Data is representative of 5-7 animals per time point. Quantitative data represents average + SE. (A-D) Magnification 40x.
119 Figure 3-7
120
Figure 3-7: Continual injury cooperates with Rb loss over time.
Immunohistochemistry for CCSP was performed on Rb ablated and Rb proficient control lungs 9 months after chronic injury. (A) There were no statistically significant differences between controls and Rb ablated lungs in the proximal airway. Contrastingly, Rb ablated lungs exhibited a statistically significant increase in CCSP positive cells as compared to controls in the distal airway (p*=0.0004).
(B) Rb ablated lungs were examined at 9 months after single and chronic injury, as well as after exposure to the vehicle control (oil). There were no significant differences in Clara cell number after chronic injury versus vehicle treatment, indicating that Rb loss and chronic injury restore Clara cell number to that of the baseline untreated lung. Significantly fewer Clara cells were present in lungs subjected to a single naphthalene dose in both proximal (*p=0.008) and distal airways (*p=0.04) as compared to vehicle controls. Furthermore, more Clara cells were present in the distal airway of Rb ablated lungs following chronic as compared to single injury (**p=0.014), demonstrating that multiple injury cooperates with Rb ablation to resolve loss of Clara cell number. Data is representative of 4-5 animals per time. Quantitative data represents average + SE.
121 Figure 3-8
E F
G H *
122
Figure 3-8: Rb ablation results in a transient decrease in BASCs. BASCs were identified by immunofluorescence. Representative Day 0 Rb proficient control lung shown (A-D). (A) Immunofluorescence for CCSP (green) and (C) SPC (red) are represented. Arrow designates a double positive cell. (B) Nuclei are visualized with
DAPI (blue). (D) The merged image demonstrates a double positive cell (arrow).
Quantitation of BASC per terminal bronchiole region (E-H). (E&F) No significant differences in number of BASCs between Rb ablated and control lungs were observed. (G) Rb loss resulted in significantly decreased number of terminal bronchioles with one or more BASCs (p=0.012) and two or more BASCs (p=0.03) as compared to controls at Day 14 after single injury. (H) No significant differences in BASCs were observed between Rb ablated and control lungs at Day 0. Data is representative of 7-10 animals and 131-210 terminal bronchioles per time point.
Magnification of (A-D) 40x.
123 Figure 3-9
124
Figure 3-9: Sustained epithelial cell proliferation occurs in Rb ablated lungs.
(A) Ki67 was assessed in Rb ablated lungs and compared to control lungs after chronic injury. Proliferation was significantly increased in Rb ablated lungs over controls 14 days after chronic injury (p=**0.0000003), as well as over baseline at
Day 0 (p*=0.00001). (B) Ki67 was assessed in the distal airways of Rb ablated lungs after single and chronic injury. Rb ablated lungs showed a statistically significant increase in proliferation after chronic as compared to single injury in the distal airway (p*=0.014). Data is representative of 5-9 animals per time point. Quantitative data represents average + SE.
125 REFERENCES
Abdo KM, Eustis SL, McDonald M et al. Naphthalene: A respiratory tract toxicant and carcinogen for mice. Inhalation Toxicology 1992 (4):393-409.
Beier HM, Kirchner C, Mootz U. Uteroglobin-like antigen in the pulmonary epithelium and secretion of the lung. Cell Tissue Res 1978; 190 (1):15-25.
Ben-Porath I, Weinberg RA. The signals and pathways activating cellular senescence.
Int J Biochem Cell Biol 2005; 37 (5):961-76.
Bernard A, Marchandise FX, Depelchin S et al. Clara cell protein in serum and bronchoalveolar lavage. Eur Respir J 1992; 5 (10):1231-8.
Broeckaert F, Clippe A, Knoops B et al. Clara cell secretory protein (CC16): features as a peripheral lung biomarker. Ann N Y Acad Sci 2000; 923:68-77.
Cobrinik D. Pocket proteins and cell cycle control. Oncogene 2005; 24 (17):2796-
809.
Daria D, Filippi MD, Knudsen ES et al. The retinoblastoma tumor suppressor is a critical intrinsic regulator for hematopoietic stem and progenitor cells under stress.
Blood 2008; 111 (4):1894-902.
Devi SS, Mehendale HM. Disrupted G1 to S phase clearance via cyclin signaling impairs liver tissue repair in thioacetamide-treated type 1 diabetic rats. Toxicol Appl
Pharmacol 2005; 207 (2):89-102.
Dierynck I, Bernard A, Roels H et al. Potent inhibition of both human interferon- gamma production and biologic activity by the Clara cell protein CC16. Am J Respir
Cell Mol Biol 1995; 12 (2):205-10.
126 Dimova DK, Dyson NJ. The E2F transcriptional network: old acquaintances with
new faces. Oncogene 2005; 24 (17):2810-26.
Evans MJ, Cabral-Anderson LJ, Freeman G. Role of the Clara cell in renewal of the
bronchiolar epithelium. Lab Invest 1978; 38 (6):648-53.
Giangreco A, Reynolds SD, Stripp BR. Terminal bronchioles harbor a unique airway
stem cell population that localizes to the bronchoalveolar duct junction. Am J Pathol
2002; 161 (1):173-82.
Haigis K, Sage J, Glickman J et al. The related retinoblastoma (pRb) and p130 proteins cooperate to regulate homeostasis in the intestinal epithelium. J Biol Chem
2006; 281 (1):638-47.
Harrod KS, Mounday AD, Stripp BR et al. Clara cell secretory protein decreases lung inflammation after acute virus infection. Am J Physiol 1998; 275 (5 Pt 1):L924-30.
Hong KU, Reynolds SD, Giangreco A et al. Clara cell secretory protein-expressing cells of the airway neuroepithelial body microenvironment include a label-retaining subset and are critical for epithelial renewal after progenitor cell depletion. Am J
Respir Cell Mol Biol 2001; 24 (6):671-81.
Janzen V, Forkert R, Fleming HE et al. Stem-cell ageing modified by the cyclin- dependent kinase inhibitor p16INK4a. Nature 2006; 443 (7110):421-6.
Johnston CJ, Mango GW, Finkelstein JN et al. Altered pulmonary response to hyperoxia in Clara cell secretory protein deficient mice. Am J Respir Cell Mol Biol
1997; 17 (2):147-55.
127 Johnston CJ, Stripp BR, Piedbeouf B et al. Inflammatory and epithelial responses in mouse strains that differ in sensitivity to hyperoxic injury. Exp Lung Res 1998; 24
(2):189-202.
Kim CF. Paving the road for lung stem cell biology: bronchioalveolar stem cells and other putative distal lung stem cells. Am J Physiol Lung Cell Mol Physiol 2007; 293
(5):L1092-8.
Kim CF, Jackson EL, Woolfenden AE et al. Identification of bronchioalveolar stem cells in normal lung and lung cancer. Cell 2005; 121 (6):823-35.
Krishnamurthy J, Ramsey MR, Ligon KL et al. p16INK4a induces an age-dependent decline in islet regenerative potential. Nature 2006; 443 (7110):453-7.
Kucherlapati MH, Nguyen AA, Bronson RT et al. Inactivation of conditional Rb by
Villin-Cre leads to aggressive tumors outside the gastrointestinal tract. Cancer Res
2006; 66 (7):3576-83.
Lesur O, Bernard A, Arsalane K et al. Clara cell protein (CC-16) induces a phospholipase A2-mediated inhibition of fibroblast migration in vitro. Am J Respir
Crit Care Med 1995; 152 (1):290-7.
Maddison LA, Sutherland BW, Barrios RJ et al. Conditional deletion of Rb causes early stage prostate cancer. Cancer Res 2004; 64 (17):6018-25.
Mason-Richie NA, Mistry MJ, Gettler CA et al. Retinoblastoma function is essential for establishing lung epithelial quiescence after injury. Cancer Res 2008; 68
(11):4068-76.
Mattsson J, Remberger M, Andersson O et al. Decreased serum levels of clara cell secretory protein (CC16) are associated with bronchiolitis obliterans and may permit
128 early diagnosis in patients after allogeneic stem-cell transplantation. Transplantation
2005; 79 (10):1411-6.
Mayhew CN, Bosco EE, Fox SR et al. Liver-specific pRB loss results in ectopic cell
cycle entry and aberrant ploidy. Cancer Res 2005; 65 (11):4568-77.
Meuwissen R, Linn SC, Linnoila RI et al. Induction of small cell lung cancer by
somatic inactivation of both Trp53 and Rb1 in a conditional mouse model. Cancer
Cell 2003; 4 (3):181-9.
Miele L, Cordella-Miele E, Facchiano A et al. Novel anti-inflammatory peptides from
the region of highest similarity between uteroglobin and lipocortin I. Nature 1988;
335 (6192):726-30.
Molofsky AV, Slutsky SG, Joseph NM et al. Increasing p16INK4a expression
decreases forebrain progenitors and neurogenesis during ageing. Nature 2006; 443
(7110):448-52.
Nolen-Walston RD, Kim CF, Mazan MR et al. Cellular kinetics and modeling of
bronchioalveolar stem cell response during lung regeneration. Am J Physiol Lung
Cell Mol Physiol 2008; 294 (6):L1158-65.
O'Brien KA, Suverkropp C, Kanekal S et al. Tolerance to multiple doses of the pulmonary toxicant, naphthalene. Toxicol Appl Pharmacol 1989; 99 (3):487-500.
Park KS, Wells JM, Zorn AM et al. Transdifferentiation of ciliated cells during repair of the respiratory epithelium. Am J Respir Cell Mol Biol 2006; 34 (2):151-7.
Plopper CG, Suverkropp C, Morin D et al. Relationship of cytochrome P-450 activity to Clara cell cytotoxicity. I. Histopathologic comparison of the respiratory tract of
129 mice, rats and hamsters after parenteral administration of naphthalene. J Pharmacol
Exp Ther 1992; 261 (1):353-63.
Rawlins EL, Ostrowski LE, Randell SH et al. Lung development and repair:
contribution of the ciliated lineage. Proc Natl Acad Sci U S A 2007; 104 (2):410-7.
Reynolds SD, Giangreco A, Power JH et al. Neuroepithelial bodies of pulmonary airways serve as a reservoir of progenitor cells capable of epithelial regeneration. Am
J Pathol 2000; 156 (1):269-78.
Ruiz S, Santos M, Segrelles C et al. Unique and overlapping functions of pRb and
p107 in the control of proliferation and differentiation in epidermis. Development
2004; 131 (11):2737-48.
Sage C, Huang M, Karimi K et al. Proliferation of functional hair cells in vivo in the
absence of the retinoblastoma protein. Science 2005; 307 (5712):1114-8.
Sankaran VG, Orkin SH, Walkley CR. Rb intrinsically promotes erythropoiesis by
coupling cell cycle exit with mitochondrial biogenesis. Genes Dev 2008; 22 (4):463-
75.
Schiffmann E, Geetha V, Pencev D et al. Adherence and regulation of leukotaxis.
Agents Actions Suppl 1983; 12:106-20.
Sherr CJ, McCormick F. The RB and p53 pathways in cancer. Cancer Cell 2002; 2
(2):103-12.
Shijubo N, Itoh Y, Yamaguchi T et al. Clara cell protein-positive epithelial cells are
reduced in small airways of asthmatics. Am J Respir Crit Care Med 1999; 160
(3):930-3.
130 Shijubo N, Itoh Y, Yamaguchi T et al. Serum and BAL Clara cell 10 kDa protein
(CC10) levels and CC10-positive bronchiolar cells are decreased in smokers. Eur
Respir J 1997; 10 (5):1108-14.
Spike BT, Dirlam A, Dibling BC et al. The Rb tumor suppressor is required for stress erythropoiesis. Embo J 2004; 23 (21):4319-29.
Stripp BR, Lund J, Mango GW et al. Clara cell secretory protein: a determinant of
PCB bioaccumulation in mammals. Am J Physiol 1996; 271 (4 Pt 1):L656-64.
Van Winkle LS, Buckpitt AR, Nishio SJ et al. Cellular response in naphthalene- induced Clara cell injury and bronchiolar epithelial repair in mice. Am J Physiol
1995; 269 (6 Pt 1):L800-18.
Vasanthakumar G, Manjunath R, Mukherjee AB et al. Inhibition of phagocyte chemotaxis by uteroglobin, an inhibitor of blastocyst rejection. Biochem Pharmacol
1988; 37 (3):389-94.
Walkley CR, Shea JM, Sims NA et al. Rb regulates interactions between hematopoietic stem cells and their bone marrow microenvironment. Cell 2007; 129
(6):1081-95.
Wenzel PL, Wu L, de Bruin A et al. Rb is critical in a mammalian tissue stem cell population. Genes Dev 2007; 21 (1):85-97.
Wikenheiser-Brokamp KA. Rb family proteins differentially regulate distinct cell lineages during epithelial development. Development 2004; 131 (17):4299-310.
Wildwater M, Campilho A, Perez-Perez JM et al. The RETINOBLASTOMA-
RELATED gene regulates stem cell maintenance in Arabidopsis roots. Cell 2005; 123
(7):1337-49.
131 Witschi H, Espiritu I, Maronpot RR et al. The carcinogenic potential of the gas phase of environmental tobacco smoke. Carcinogenesis 1997; 18 (11):2035-42.
Yanagi S, Kishimoto H, Kawahara K et al. Pten controls lung morphogenesis, bronchioalveolar stem cells, and onset of lung adenocarcinomas in mice. J Clin Invest
2007; 117 (10):2929-40.
Zhang Y, Goss AM, Cohen ED et al. A Gata6-Wnt pathway required for epithelial stem cell development and airway regeneration. Nat Genet 2008; 40 (7):862-70.
132 Chapter 4: Discussion and Future Directions
SPECIFIC AIMS
1: Determine the effects of Rb ablation on lung epithelial repair after injury.
Airway remodeling is associated with the vast majority of lung diseases including
chronic obstructive pulmonary disease, asthma, and lung cancer. Since Rb is
inactivated in the vast majority of lung cancers, we hypothesized that Rb function
would be critical in the repairing lung epithelium. To test this hypothesis Rb was
ablated in the lung epithelium with a tetracycline regulated Cre/LoxP system, and
pulmonary injury was induced by naphthalene administration to cause cytotoxic
damage. These data demonstrate that pulmonary Rb loss results in sustained long
term aberrant proliferation that is not sufficient for tumorigenesis and this phenotype
is unique to the environment of cellular injury.
2: Elucidate phenotypic effects of prenatal Rb ablation induced during
development versus postnatal Rb ablation induced after birth. Timing of Rb loss
determines phenotypic outcomes in cells in culture. (Ruiz et al. 2004; Sage et al.
2003). We hypothesized that timing of Rb ablation would effect phenotypic outcomes in vivo. Phenotypic consequences related to timing of Rb loss were compared by assessing prenatal and postnatal lung epithelial Rb ablation. These data demonstrate that prenatal and postnatal Rb loss result in similar phenotypic outcomes.
3: Elucidate the role of Rb in the lung after chronic epithelial damage. Lung
diseases, including lung cancer, occur in the context of chronic epithelial remodeling
induced by cytotoxic damage. Furthermore, we observed long term phenotypic
consequence of Rb loss after one episode of injury in the absence of tumorigenesis.
133 Therefore, we hypothesized that pulmonary Rb loss would cooperate with chronic
epithelial remodeling in tumorigenesis. We tested this hypothesis by establishing a
chronic injury protocol and subjecting animals with Rb ablated and Rb proficient
lungs to multiple episodes of injury in order to more closely mimic human disease.
Previously uncharacterized outcomes of the naphthalene injury model were
discovered, including altered epithelial composition and induction of marked
pulmonary inflammation. These studies demonstrate that Rb loss and chronic injury
is not sufficient for tumorigenesis. Interestingly, this data shows that Rb loss plays a
critical role in progenitor cell restoration through enhanced proliferation in the
context of chronic injury.
4: Elucidate the effects of Rb loss on bronchioalveolar stem cell number.
Regulation of stem/progenitor cells is critical in the remodeling lung. Since Rb function is important after lung injury and plays a role in stem cell regulation in other organs, we hypothesized that Rb regulates pulmonary stem cell number in the repairing lung. These studies demonstrate that Rb loss results in a transitory injury induced decrease in pulmonary stem cells.
134 FUTURE DIRECTIONS
Deregulation of CDKIs of the CIP/KIP protein family could underlie aberrant
cell cycling in Rb ablated lungs. p21 and p27 are involved in cell cycle exit, are
members of the cip/kip family, and are important negative regulators of cell cycle.
(Agami & Bernards 2002). Interestingly, there is evidence that Rb mediates control
of both p21 and p27 (Binne et al. 2007; Decesse et al. 2001). Thus, p21 deregulation could contribute to the inability of Rb deficient cells to enter quiescence after injury.
Recent studies have demonstrated that Rb transcriptionally activates p21, particularly in epithelial cells (Decesse et al. 2001). Thus, loss of Rb function could lead to decreased p21 expression. Additionally, MEFs lacking p21 are defective in G1 checkpoint control and exhibit accelerated growth rates in culture (Deng et al. 1995).
p21 levels were assessed by western blot analysis and no decrease in p21 expression
was observed before or after injury, providing evidence that decreased p21 levels do
not underlie aberrant proliferation in Rb ablated lungs.
Another possibility is that p21 could be upregulated. Evidence supports that
Rb loss may result in induction of the DNA damage response wherin p21
upregulation is often under control of p53. Rb loss is associated with genomic
instability in several model systems (Balsitis et al. 2003; Knudsen et al. 2006b;
Mayhew et al. 2005). Liver specific Rb loss promotes elevated hepatocyte ploidy
(Mayhew et al. 2005). A similar loss of genetic integrity occurs in Rb null
keratinocytes which exhibit hyperplasia, centrosome abnormalities, and aneuploidy
(Balsitis et al. 2003; Mayhew et al. 2005).
135 In order to determine if p21 protein levels were upregulated, Rb ablated and control lungs were assessed before and after injury by western blot analysis. A
transient increase in p21 that was not maintained and had high sample to sample
variability was observed in Rb ablated lungs (Figure 4-1). Even though p21 levels
reached statistical significance in Rb ablated as compared to control lungs with a p
value of 0.04, the biological significance of this induction is unclear. Additionally,
p21 levels are expressed in high amounts in cycling cells, therefore this result could
simply represent a mitotic response (Li et al. 1994). Since the DNA damage response
is typically mediated by p53, p53 and activated p53, phosphorylated at serine 15,
were assessed by western blot analysis. However, no induction of p53 or activated
p53 was observed before or after injury, providing evidence that the DNA damage
pathway is not induced (Figure 2-7). Although we cannot rule out cell type specific
p21 induction, these data provide evidence that there are no global changes in p21
protein levels after Rb ablation.
I hypothesize that Rb loss results in decreased p27 levels. Recent studies have
shown that Rb controls the stability of p27 through the interaction with APC/C
(anaphase-promoting complex/cyclosome) by targeting SKP2 for degradation (Figure
4-2) (Binne et al. 2007). Furthermore, Rb ablation leads to enhanced p27 degradation
in vitro and disruption of p27 function prevents Rb mediated G1 arrest (Ji et al.
2004). Therefore, Rb loss could lead to decreased p27 and compromise the ability of
cells to exit cycle. I expect that p27 protein levels will be decreased in Rb ablated
lungs undergoing amplified cell cycling. An initial step toward testing this
hypothesis would include analysis of p27 protein levels in Rb ablated and control
136 lungs during homeostasis and after lung injury. I attempted to test if p27 levels were
downregulated by immunohistochemistry and western blot analysis. However, my
initial attempts at these experiments involved technical difficulties, including non
specific bands in the Western blot analysis and background staining in the immunohistochemical analysis. Further experiments could resolve these technical issues and allow for p27 protein to be assessed. Another method to determine if
decreased p27 underlies the inability of Rb null cells to exit cell cycle, would be to overexpress p27 protein in the Rb ablated lung. If upregulated p27 rescued aberrant proliferation in Rb ablated injured lungs, I would conclude that decreased p27 protein levels govern aberrant proliferation observed with Rb loss.
The time period immediately following Rb ablation may be more important in determining phenotypic outcomes than postnatal Rb loss. The comparison of the exact timing of Rb loss is a complex process in the studies comparing prenatal and postnatal Rb ablation. Since postnatal Rb ablation was not dependent on doxycycline, the acute effects of Rb loss were not assessed by this method since the exact timing of postnatal Rb ablation is unclear. Importantly, Rb ablation did not occur in the absence of doxycycline during development, making this system a significant technique for the comparison of prenatal versus postnatal Rb ablation.
Since postnatal Rb ablation occurred after birth in the absence of doxycycline, these methods do not directly compare the period directly following Rb loss in the same manner that was utilized in the aforementioned in vitro studies (Ruiz et al. 2004; Sage et al. 2003).
137 In the current studies we compared developmental Rb loss with Rb ablation
after birth and found that they resulted in similar phenotypic outcomes. However, it
is possible that there is a critical time period immediately following Rb loss before
potential compensatory mechanisms are engaged in the pulmonary epithelium. One
potential compensatory mechanism that has been shown to be important in
maintaining the quiescent/senescent state in MEFs is p107 upregulation (Ruiz et al.
2004; Sage et al. 2003). Assessing the immediate time period following Rb loss
could reveal a different phenotypic outcome than that observed after Rb ablation in
the postnatal lung. These analyses would be dependent on determining precisely when Rb ablation occurs in vivo. Once the time period of Rb loss after birth was determined, phenotypic analysis would include assessing proliferation and apoptosis in the lung epithelium. Furthermore, injury could be induced at the precise time of
Rb ablation and phenotypic effects assessed to determine if a more severe phenotypic outcome results. These experiments would provide an initial step in determining if the immediate time period following Rb ablation is important as compared to chronic Rb loss after birth. If timing of Rb ablation is important during this period, I would expect induction of proliferation and apoptosis would be more severe than that observed during developmental Rb loss.
Depletion of Clara cells could contribute to recruitment of pulmonary inflammatory cells. CCSP is the predominant product from Clara cells and is a potent anti-inflammatory mediator. Thus, I hypothesize that reduced Clara cell number induces pulmonary inflammation after chronic injury (Broeckaert et al. 2000;
138 Dierynck et al. 1995; Shimkin et al. 1975; Singh et al. 1997). Since decreased Clara cell number occurs in chronically injured lungs, the first step in determining if CCSP is mediating inflammation in injured lungs would be to assess CCSP protein levels by western blot analysis at three time points: 1) in uninjured lungs to establish baseline
2), 14 days after chronic injury, when the initial decrease in Clara cell number is observed, and 3) 9 months after chronic injury when inflammation is apparent.
Decreased Clara cell number and reduced CCSP production in addition to inflammatory influx is observed in other models of chronic injury (Shijubo et al.
1999; Shijubo et al. 1997). Therefore, I would expect CCSP levels to be reduced after chronic naphthalene injury.
In order to determine if loss of CCSP leads to pulmonary inflammation following naphthalene injury, I would examine inflammatory influx in wild type and
CCSP deficient mice after naphthalene treatment. I would expect that if inflammation following naphthalene treatment is due to decreased CCSP, CCSP -/- lungs would exhibit exacerbated inflammation as compared to wild type naphthalene treated lungs.
Enhanced apoptosis could underlie decreased BASC number after acute injury.
I hypothesize that apoptosis could explain decreased BASC number after a single episode of injury. Our previous studies demonstrated increased apoptosis in Rb ablated lungs at a time point coincident with decreased BASCs (Mason-Richie et al.
2008). If BASCs are depleted by apoptosis, one would expect apoptotic cells to localize to the site that harbors BASCs, namely the terminal bronchioles. Indeed, apoptosis was significantly increased in terminal bronchioles as compared to
139 proximal airways in Rb ablated lungs after a single episode of naphthalene induced
injury (Figure 4-3). These data support the notion that decreased BASC number in
Rb ablated lungs could be due, at least in part, to enhanced stem cell death. In order
to directly test this possibility, apoptosis could be assessed by TUNEL analysis in
cells co-expressing CCSP and SPC at the time point coincident with decreased BASC
number. If BASCs are undergoing apoptosis, I would expect to see an increased number of TUNEL positive BASCs after as compared to before injury in Rb ablated lungs.
Altered cellular proliferation could account for decreased BASC number.
Increased or decreased BASC proliferation could account for depleted BASC number. Since Rb deficient lung epithelium exhibits aberrant proliferation and decreased stem cell number simultaneously, BASC reduction could result from depletion of the stem cell compartment. Comparably, Rb deficient skin epithelium exhibits concurrent aberrant proliferation and decreased stem cell number. In this case, Ruiz et al. hypothesized that the decreased stem cell number was due to enhanced cellular turnover caused by Rb loss that depleted the epidermal stem cell compartment. (Ruiz et al. 2004). Alternatively, decreased BASC number after acute injury could be due to a lack of proliferation in this cell type. In order to determine if
BASC proliferation plays a role in the transient change observed after injury, cells co- expressing CCSP, SPC and BrdU would be assessed at baseline and after single and chronic injury. If BASC depletion is due to proliferation defects, I would expect that
analysis of these time points would reveal if proliferation is important in determining
140 BASC number. This study would provide initial insights into if whether the decrease in BASC number was due, at least in part, to a proliferation defect.
141
DISCUSSION AND DISSERTATION CONTRIBUTIONS
The Rb protein is well recognized as having a prominent role in the regulation
of proliferation, differentiation, and apoptosis. Surprisingly, Rb ablation in multiple
murine cell types results in mild phenotypes that do not progress to tumor formation.
These data suggest that Rb may play a more important role in environmental contexts other than homeostasis. Since malignancies including lung cancer frequently occur in the context of epithelial remodeling, we hypothesized that Rb function may be more critical in the context of remodeling after injury. These studies identify a unique and critical role for Rb in the context of repair after injury. Specifically, these data directly demonstrate that Rb loss leads to aberrant proliferation in the setting of epithelial repair but not during homeostasis. Proliferation is sustained for at least 9 months after the inciting event providing evidence that Rb loss has long term effects.
Since a marked phenotype was observed in Rb ablated lungs after one episode of injury, Rb abalted lungs were subjected to chronic injury in order to determine if a more severe phenotypic outcome would result. Chronic naphthalene injury results in previously uncharacterized phenotypes including altered cellular composition and subsequent recruitment of inflammatory cells, contributing to a more full understanding of the naphthalene injury model. Importantly, Rb loss facilitates progenitor cell restoration in cooperation with chronic injury, through enhanced cellular proliferation. These data bring to light an important clinical consideration that manipulation of the Rb pathway may ultimately allow for enhanced repair. Since
Rb is critical in progenitor cell restoration in the pulmonary epithelium and progenitor
142 cells are vital in the lung remodeling process, these data implicate that Rb inactivation
could actually facilitate pulmonary repair. However, it is clear that Rb has to be
tightly regulated to restore progenitor cells without causing an increased risk for lung
cancer.
These studies establish a function of Rb in BASC regulation specific to the condition of pulmonary injury. Recent data demonstrate that proper BASC control is
essential to appropriate airway remodeling. Further studies elucidating how Rb
controls stem cell number will provide insights into Rb mediated tumor suppressive
functions in the context of injury.
Timing of Rb ablation was assessed in vivo since experiments in culture demonstrated that timing of Rb ablation is critical in determining phenotypic
outcomes. These studies demonstrate that prenatal and postnatal Rb ablation resulted
in similar phenotypic effects providing evidence that timing of Rb loss was not
critical to phenotypic outcomes, and that the injury induced phenotype was not
secondary to compensatory alterations occurring during development. Numerous
models of human disease utilize germline gene deletion knockout strategies; although
many conditions studied in this manner are often a result of somatic gene loss. By
more closely modeling the human condition of Rb inactivation in the lung, these data
contribute to a more complete understanding of the role of Rb in the pulmonary
epithelium.
143
SUMMARY AND FINAL THOUGHTS
The data generated in this dissertation project established a critical and unique function for the tumor suppressor Rb in the repairing lung epithelium. Taken together, these data provide direct evidence that Rb is an essential regulator in the remodeling lung epithelium and that Rb has a more prominent role in the setting of epithelial damage than during lung homeostasis. Since human malignancies frequently occur in the context of cellular injury, elucidating Rb dependent functions in this environment is of critical importance to better understanding Rb mediated tumor suppression.
144 Figure 4-1
A
B
145 Figure 4-1: Rb ablation is associated with a transient alteration in p21 expression after injury. (A) Lysates were prepared from Rb ablated and control lungs before injury (Day 0) and on day 14 and 9 months after naphthalene induced injury. Western blot analysis was performed for p21. Blots were reprobed for actin to control for protein loading. Representative Western blot is shown. p21 was detected in Rb ablated and control lungs. (B) Signal intensities were quantified and normalized to actin (*sample not included in quantitative analysis due to defective lane). Data is represented as expression relative to day 0 control lungs (average +
SD). No statistically significant difference in p21 was detected in Rb ablated versus control lungs at Day 0 or 9 months. p21 was only significantly increased at one time point, on day 14 after injury in Rb ablated as compared to control lungs (*p=0.04).
146
Figure 4-2
A
B
147 Figure 4-2 Rb regulates p27 stability through APC/C. (A) Degradation of p27 is mediated by Skp2 ubiquitin dependent targeting. (B) Rb promotes p27 stability by interacting with the anaphase-promoting complex/cyclosome (APC/C) that targets
Skp2 for ubiquitin mediated degradation.
148
Figure 4-3
*
149 Figure 4-3: Apoptosis is primarily localized to the terminal bronchioles in Rb ablated lungs. Quantitative data for TUNEL analysis on RB ablated lungs from mice treated with doxycycline throughout gestation. Apoptosis was assessed by
TUNEL assay on lung sections in the proximal and distal lung regions at Day 14 after a single episode of injury. Percent TUNEL positive cells were quantified and data represented as average percent positive cells + SEM. Apoptosis was increased in the distal airways of Rb ablated lungs as compared to the proximal airways after injury (*p=0.01). Data is representative of 6 animals and counts of 200-400 cells per animal.
150 REFERENCES
Agami R, Bernards R. Convergence of mitogenic and DNA damage signaling in the
G1 phase of the cell cycle. Cancer Lett 2002; 177 (2):111-8.
Alexander K, Hinds PW. Requirement for p27(KIP1) in retinoblastoma protein- mediated senescence. Mol Cell Biol 2001; 21 (11):3616-31.
Artinian V, Kvale PA. Cancer and interstitial lung disease. Curr Opin Pulm Med
2004; 10 (5):425-34.
Balmer A, Zografos L, Munier F. Diagnosis and current management of retinoblastoma. Oncogene 2006; 25 (38):5341-9.
Balsitis SJ, Sage J, Duensing S et al. Recapitulation of the effects of the human papillomavirus type 16 E7 oncogene on mouse epithelium by somatic Rb deletion and detection of pRb-independent effects of E7 in vivo. Mol Cell Biol 2003; 23
(24):9094-103.
Bartek J, Bartkova J, Lukas J. The retinoblastoma protein pathway in cell cycle control and cancer. Exp Cell Res 1997; 237 (1):1-6.
Beier HM, Kirchner C, Mootz U. Uteroglobin-like antigen in the pulmonary epithelium and secretion of the lung. Cell Tissue Res 1978; 190 (1):15-25.
Belinsky SA. Gene-promoter hypermethylation as a biomarker in lung cancer. Nat
Rev Cancer 2004; 4 (9):707-17.
Ben-Porath I, Weinberg RA. The signals and pathways activating cellular senescence.
Int J Biochem Cell Biol 2005; 37 (5):961-76.
151 Bernard A, Marchandise FX, Depelchin S et al. Clara cell protein in serum and
bronchoalveolar lavage. Eur Respir J 1992; 5 (10):1231-8.
Berndt N, Dohadwala M, Liu CW. Constitutively active protein phosphatase 1alpha
causes Rb-dependent G1 arrest in human cancer cells. Curr Biol 1997; 7 (6):375-86.
Besson A, Hwang HC, Cicero S et al. Discovery of an oncogenic activity in p27Kip1
that causes stem cell expansion and a multiple tumor phenotype. Genes Dev 2007; 21
(14):1731-46.
Binne UK, Classon MK, Dick FA et al. Retinoblastoma protein and anaphase-
promoting complex physically interact and functionally cooperate during cell-cycle
exit. Nat Cell Biol 2007; 9 (2):225-32.
Brehm A, Miska EA, McCance DJ et al. Retinoblastoma protein recruits histone
deacetylase to repress transcription. Nature 1998; 391 (6667):597-601.
Broeckaert F, Clippe A, Knoops B et al. Clara cell secretory protein (CC16): features as a peripheral lung biomarker. Ann N Y Acad Sci 2000; 923:68-77.
Buchkovich K, Duffy LA, Harlow E. The retinoblastoma protein is phosphorylated during specific phases of the cell cycle. Cell 1989; 58 (6):1097-105.
Buckpitt A, Chang AM, Weir A et al. Relationship of cytochrome P450 activity to
Clara cell cytotoxicity. IV. Metabolism of naphthalene and naphthalene oxide in microdissected airways from mice, rats, and hamsters. Mol Pharmacol 1995; 47
(1):74-81.
Canepa ET, Scassa ME, Ceruti JM et al. INK4 proteins, a family of mammalian CDK inhibitors with novel biological functions. IUBMB Life 2007; 59 (7):419-26.
152 Chen D, Opavsky R, Pacal M et al. Rb-Mediated Neuronal Differentiation through
Cell-Cycle-Independent Regulation of E2f3a. PLoS Biol 2007; 5 (7):e179.
Chen PL, Riley DJ, Chen Y et al. Retinoblastoma protein positively regulates
terminal adipocyte differentiation through direct interaction with C/EBPs. Genes Dev
1996; 10 (21):2794-804.
Clarke AR, Maandag ER, van Roon M et al. Requirement for a functional Rb-1 gene
in murine development. Nature 1992; 359 (6393):328-30.
Classon M, Dyson N. p107 and p130: versatile proteins with interesting pockets. Exp
Cell Res 2001; 264 (1):135-47.
Classon M, Harlow E. The retinoblastoma tumour suppressor in development and
cancer. Nat Rev Cancer 2002; 2 (12):910-7.
Classon M, Salama S, Gorka C et al. Combinatorial roles for pRB, p107, and p130 in
E2F-mediated cell cycle control. Proc Natl Acad Sci U S A 2000; 97 (20):10820-5.
Cobrinik D. Pocket proteins and cell cycle control. Oncogene 2005; 24 (17):2796-
809.
Cole KA, Harmon AW, Harp JB et al. Rb regulates C/EBPbeta-DNA-binding activity
during 3T3-L1 adipogenesis. Am J Physiol Cell Physiol 2004; 286 (2):C349-54.
Dammann R, Strunnikova M, Schagdarsurengin U et al. CpG island methylation and expression of tumour-associated genes in lung carcinoma. Eur J Cancer 2005; 41
(8):1223-36.
Daniels CE, Jett JR. Does interstitial lung disease predispose to lung cancer? Curr
Opin Pulm Med 2005; 11 (5):431-7.
153 Dannenberg JH, Schuijff L, Dekker M et al. Tissue-specific tumor suppressor activity of retinoblastoma gene homologs p107 and p130. Genes Dev 2004; 18 (23):2952-62.
Daria D, Filippi MD, Knudsen ES et al. The retinoblastoma tumor suppressor is a critical intrinsic regulator for hematopoietic stem and progenitor cells under stress.
Blood 2008; 111 (4):1894-902.
Decesse JT, Medjkane S, Datto MB et al. RB regulates transcription of the p21/WAF1/CIP1 gene. Oncogene 2001; 20 (8):962-71.
DeGregori J, Johnson DG. Distinct and Overlapping Roles for E2F Family Members in Transcription, Proliferation and Apoptosis. Curr Mol Med 2006; 6 (7):739-48.
DeGregori J, Kowalik T, Nevins JR. Cellular targets for activation by the E2F1 transcription factor include DNA synthesis- and G1/S-regulatory genes. Mol Cell
Biol 1995; 15 (8):4215-24.
Deng C, Zhang P, Harper JW et al. Mice lacking p21CIP1/WAF1 undergo normal development, but are defective in G1 checkpoint control. Cell 1995; 82 (4):675-84.
Devi SS, Mehendale HM. Disrupted G1 to S phase clearance via cyclin signaling impairs liver tissue repair in thioacetamide-treated type 1 diabetic rats. Toxicol Appl
Pharmacol 2005; 207 (2):89-102.
DiCiommo D, Gallie BL, Bremner R. Retinoblastoma: the disease, gene and protein provide critical leads to understand cancer. Semin Cancer Biol 2000; 10 (4):255-69.
Dierynck I, Bernard A, Roels H et al. Potent inhibition of both human interferon- gamma production and biologic activity by the Clara cell protein CC16. Am J Respir
Cell Mol Biol 1995; 12 (2):205-10.
154 Dimova DK, Dyson NJ. The E2F transcriptional network: old acquaintances with new faces. Oncogene 2005; 24 (17):2810-26.
Divine KK, Pulling LC, Marron-Terada PG et al. Multiplicity of abnormal promoter methylation in lung adenocarcinomas from smokers and never smokers. Int J Cancer
2005; 114 (3):400-5.
Dyson N. The regulation of E2F by pRB-family proteins. Genes Dev 1998; 12
(15):2245-62.
Dyson N, Howley PM, Munger K et al. The human papilloma virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product. Science 1989; 243
(4893):934-7.
Evans MJ, Cabral-Anderson LJ, Freeman G. Role of the Clara cell in renewal of the bronchiolar epithelium. Lab Invest 1978; 38 (6):648-53.
Ewen ME, Sluss HK, Sherr CJ et al. Functional interactions of the retinoblastoma protein with mammalian D-type cyclins. Cell 1993; 73 (3):487-97.
Falls HF, Neel JV. Genetics of retinoblastoma. AMA Arch Ophthalmol 1951; 46
(4):367-89.
Fausto N. Mouse liver tumorigenesis: models, mechanisms, and relevance to human disease. Semin Liver Dis 1999; 19 (3):243-52.
Flemington EK, Speck SH, Kaelin WG, Jr. E2F-1-mediated transactivation is inhibited by complex formation with the retinoblastoma susceptibility gene product.
Proc Natl Acad Sci U S A 1993; 90 (15):6914-8.
155 Friend SH, Bernards R, Rogelj S et al. A human DNA segment with properties of the
gene that predisposes to retinoblastoma and osteosarcoma. Nature 1986; 323
(6089):643-6.
Frolov MV, Dyson NJ. Molecular mechanisms of E2F-dependent activation and
pRB-mediated repression. J Cell Sci 2004; 117 (Pt 11):2173-81.
Gallo R, Padurean A, Jayaraman T et al. Inhibition of intimal thickening after balloon
angioplasty in porcine coronary arteries by targeting regulators of the cell cycle.
Circulation 1999; 99 (16):2164-70.
Giangreco A, Reynolds SD, Stripp BR. Terminal bronchioles harbor a unique airway
stem cell population that localizes to the bronchoalveolar duct junction. Am J Pathol
2002; 161 (1):173-82.
Haigis K, Sage J, Glickman J et al. The related retinoblastoma (pRb) and p130 proteins cooperate to regulate homeostasis in the intestinal epithelium. J Biol Chem
2006; 281 (1):638-47.
Harbour JW, Dean DC. Chromatin remodeling and Rb activity. Curr Opin Cell Biol
2000; 12 (6):685-9.
Harrington EA, Bruce JL, Harlow E et al. pRB plays an essential role in cell cycle arrest induced by DNA damage. Proc Natl Acad Sci U S A 1998; 95 (20):11945-50.
Harrod KS, Mounday AD, Stripp BR et al. Clara cell secretory protein decreases lung inflammation after acute virus infection. Am J Physiol 1998; 275 (5 Pt 1):L924-30.
Helin K, Ed H. The retinoblastoma protein as a transcriptional repressor. Trends Cell
Biol 1993; 3 (2):43-6.
156 Herrera RE, Sah VP, Williams BO et al. Altered cell cycle kinetics, gene expression, and G1 restriction point regulation in Rb-deficient fibroblasts. Mol Cell Biol 1996; 16
(5):2402-7.
Hill CL, Nguyen AM, Roder D et al. Risk of cancer in patients with scleroderma: a population based cohort study. Ann Rheum Dis 2003; 62 (8):728-31.
Hinds PW, Mittnacht S, Dulic V et al. Regulation of retinoblastoma protein functions by ectopic expression of human cyclins. Cell 1992; 70 (6):993-1006.
Hogg JC. Chronic obstructive pulmonary disease: an overview of pathology and pathogenesis. Novartis Found Symp 2001; 234:4-19; discussion -26.
Hong KU, Reynolds SD, Giangreco A et al. Clara cell secretory protein-expressing cells of the airway neuroepithelial body microenvironment include a label-retaining subset and are critical for epithelial renewal after progenitor cell depletion. Am J
Respir Cell Mol Biol 2001; 24 (6):671-81.
Hubbard R, Venn A, Lewis S et al. Lung cancer and cryptogenic fibrosing alveolitis.
A population-based cohort study. Am J Respir Crit Care Med 2000; 161 (1):5-8.
Huh MS, Parker MH, Scime A et al. Rb is required for progression through myogenic differentiation but not maintenance of terminal differentiation. J Cell Biol 2004; 166
(6):865-76.
Hurford RK, Jr., Cobrinik D, Lee MH et al. pRB and p107/p130 are required for the regulated expression of different sets of E2F responsive genes. Genes Dev 1997; 11
(11):1447-63.
Iaquinta PJ, Lees JA. Life and death decisions by the E2F transcription factors. Curr
Opin Cell Biol 2007; 19 (6):649-57.
157 Iavarone A, King ER, Dai XM et al. Retinoblastoma promotes definitive
erythropoiesis by repressing Id2 in fetal liver macrophages. Nature 2004; 432
(7020):1040-5.
Ishida S, Huang E, Zuzan H et al. Role for E2F in control of both DNA replication
and mitotic functions as revealed from DNA microarray analysis. Mol Cell Biol
2001; 21 (14):4684-99.
Jacks T, Fazeli A, Schmitt EM et al. Effects of an Rb mutation in the mouse. Nature
1992; 359 (6393):295-300.
Janzen V, Forkert R, Fleming HE et al. Stem-cell ageing modified by the cyclin-
dependent kinase inhibitor p16INK4a. Nature 2006; 443 (7110):421-6.
Ji P, Jiang H, Rekhtman K et al. An Rb-Skp2-p27 pathway mediates acute cell cycle
inhibition by Rb and is retained in a partial-penetrance Rb mutant. Mol Cell 2004; 16
(1):47-58.
Johnston CJ, Mango GW, Finkelstein JN et al. Altered pulmonary response to
hyperoxia in Clara cell secretory protein deficient mice. Am J Respir Cell Mol Biol
1997; 17 (2):147-55.
Johnston CJ, Stripp BR, Piedbeouf B et al. Inflammatory and epithelial responses in
mouse strains that differ in sensitivity to hyperoxic injury. Exp Lung Res 1998; 24
(2):189-202.
Kato J, Matsushime H, Hiebert SW et al. Direct binding of cyclin D to the retinoblastoma gene product (pRb) and pRb phosphorylation by the cyclin D- dependent kinase CDK4. Genes Dev 1993; 7 (3):331-42.
158 Kim CF. Paving the road for lung stem cell biology: bronchioalveolar stem cells and other putative distal lung stem cells. Am J Physiol Lung Cell Mol Physiol 2007; 293
(5):L1092-8.
Kim CF, Jackson EL, Woolfenden AE et al. Identification of bronchioalveolar stem cells in normal lung and lung cancer. Cell 2005; 121 (6):823-35.
Kim DH, Nelson HH, Wiencke JK et al. p16(INK4a) and histology-specific methylation of CpG islands by exposure to tobacco smoke in non-small cell lung cancer. Cancer Res 2001; 61 (8):3419-24.
Kleinerman RA, Tarone RE, Abramson DH et al. Hereditary retinoblastoma and risk of lung cancer. J Natl Cancer Inst 2000; 92 (24):2037-9.
Knudsen ES, Knudsen KE. Retinoblastoma tumor suppressor: where cancer meets the cell cycle. Exp Biol Med (Maywood) 2006a; 231 (7):1271-81.
Knudsen ES, Sexton CR, Mayhew CN. Role of the retinoblastoma tumor suppressor in the maintenance of genome integrity. Curr Mol Med 2006b; 6 (7):749-57.
Knudsen ES, Wang JY. Differential regulation of retinoblastoma protein function by specific Cdk phosphorylation sites. J Biol Chem 1996; 271 (14):8313-20.
Knudsen ES, Wang JY. Dual mechanisms for the inhibition of E2F binding to RB by cyclin-dependent kinase-mediated RB phosphorylation. Mol Cell Biol 1997; 17
(10):5771-83.
Knudson AG, Jr. Mutation and cancer: statistical study of retinoblastoma. Proc Natl
Acad Sci U S A 1971; 68 (4):820-3.
Koff A, Cross F, Fisher A et al. Human cyclin E, a new cyclin that interacts with two members of the CDC2 gene family. Cell 1991; 66 (6):1217-28.
159 Krishnamurthy J, Ramsey MR, Ligon KL et al. p16INK4a induces an age-dependent decline in islet regenerative potential. Nature 2006; 443 (7110):453-7.
Kucherlapati MH, Nguyen AA, Bronson RT et al. Inactivation of conditional Rb by
Villin-Cre leads to aggressive tumors outside the gastrointestinal tract. Cancer Res
2006; 66 (7):3576-83.
Lee EY, Chang CY, Hu N et al. Mice deficient for Rb are nonviable and show defects in neurogenesis and haematopoiesis. Nature 1992; 359 (6393):288-94.
Lee MH, Williams BO, Mulligan G et al. Targeted disruption of p107: functional overlap between p107 and Rb. Genes Dev 1996; 10 (13):1621-32.
Lesur O, Bernard A, Arsalane K et al. Clara cell protein (CC-16) induces a phospholipase A2-mediated inhibition of fibroblast migration in vitro. Am J Respir
Crit Care Med 1995; 152 (1):290-7.
Lew DJ, Dulic V, Reed SI. Isolation of three novel human cyclins by rescue of G1 cyclin (Cln) function in yeast. Cell 1991; 66 (6):1197-206.
Li Y, Jenkins CW, Nichols MA et al. Cell cycle expression and p53 regulation of the cyclin-dependent kinase inhibitor p21. Oncogene 1994; 9 (8):2261-8.
Lipinski MM, Jacks T. The retinoblastoma gene family in differentiation and development. Oncogene 1999; 18 (55):7873-82.
Lipinski MM, Macleod KF, Williams BO et al. Cell-autonomous and non-cell- autonomous functions of the Rb tumor suppressor in developing central nervous system. Embo J 2001; 20 (13):3402-13.
160 Loonstra A, Vooijs M, Beverloo HB et al. Growth inhibition and DNA damage
induced by Cre recombinase in mammalian cells. Proc Natl Acad Sci U S A 2001; 98
(16):9209-14.
Ludlow JW, Glendening CL, Livingston DM et al. Specific enzymatic
dephosphorylation of the retinoblastoma protein. Mol Cell Biol 1993; 13 (1):367-72.
Lukas J, Parry D, Aagaard L et al. Retinoblastoma-protein-dependent cell-cycle
inhibition by the tumour suppressor p16. Nature 1995; 375 (6531):503-6.
Macaluso M, Montanari M, Giordano A. Rb family proteins as modulators of gene expression and new aspects regarding the interaction with chromatin remodeling enzymes. Oncogene 2006; 25 (38):5263-7.
MacNee W. Oxidants and COPD. Curr Drug Targets Inflamm Allergy 2005; 4
(6):627-41.
Maddison LA, Sutherland BW, Barrios RJ et al. Conditional deletion of Rb causes early stage prostate cancer. Cancer Res 2004; 64 (17):6018-25.
Maeda S, Kamata H, Luo JL et al. IKKbeta couples hepatocyte death to cytokine-
driven compensatory proliferation that promotes chemical hepatocarcinogenesis. Cell
2005; 121 (7):977-90.
Mantela J, Jiang Z, Ylikoski J et al. The retinoblastoma gene pathway regulates the
postmitotic state of hair cells of the mouse inner ear. Development 2005; 132
(10):2377-88.
Markey MP, Angus SP, Strobeck MW et al. Unbiased analysis of RB-mediated
transcriptional repression identifies novel targets and distinctions from E2F action.
Cancer Res 2002; 62 (22):6587-97.
161 Mason-Richie NA, Mistry MJ, Gettler CA et al. Retinoblastoma function is essential for establishing lung epithelial quiescence after injury. Cancer Res 2008; 68
(11):4068-76.
Mattsson J, Remberger M, Andersson O et al. Decreased serum levels of clara cell secretory protein (CC16) are associated with bronchiolitis obliterans and may permit early diagnosis in patients after allogeneic stem-cell transplantation. Transplantation
2005; 79 (10):1411-6.
Mayhew CN, Bosco EE, Fox SR et al. Liver-specific pRB loss results in ectopic cell cycle entry and aberrant ploidy. Cancer Res 2005; 65 (11):4568-77.
Mayne ST, Buenconsejo J, Janerich DT. Previous lung disease and risk of lung cancer among men and women nonsmokers. Am J Epidemiol 1999; 149 (1):13-20.
Meuwissen R, Linn SC, Linnoila RI et al. Induction of small cell lung cancer by somatic inactivation of both Trp53 and Rb1 in a conditional mouse model. Cancer
Cell 2003; 4 (3):181-9.
Miele L, Cordella-Miele E, Facchiano A et al. Novel anti-inflammatory peptides from the region of highest similarity between uteroglobin and lipocortin I. Nature 1988;
335 (6192):726-30.
Minna JD, Roth JA, Gazdar AF. Focus on lung cancer. Cancer Cell 2002; 1 (1):49-
52.
Mittnacht S. Control of pRB phosphorylation. Curr Opin Genet Dev 1998; 8 (1):21-7.
Molofsky AV, Slutsky SG, Joseph NM et al. Increasing p16INK4a expression decreases forebrain progenitors and neurogenesis during ageing. Nature 2006; 443
(7110):448-52.
162 Morgenbesser SD, Williams BO, Jacks T et al. p53-dependent apoptosis produced by
Rb-deficiency in the developing mouse lens. Nature 1994; 371 (6492):72-4.
Morris EJ, Dyson NJ. Retinoblastoma protein partners. Adv Cancer Res 2001; 82:1-
54.
Munger K, Werness BA, Dyson N et al. Complex formation of human papillomavirus
E7 proteins with the retinoblastoma tumor suppressor gene product. Embo J 1989; 8
(13):4099-105.
Nevins JR. The Rb/E2F pathway and cancer. Hum Mol Genet 2001; 10 (7):699-703.
Nevins JR. Transcriptional regulation. A closer look at E2F. Nature 1992; 358
(6385):375-6.
Nolen-Walston RD, Kim CF, Mazan MR et al. Cellular kinetics and modeling of
bronchioalveolar stem cell response during lung regeneration. Am J Physiol Lung
Cell Mol Physiol 2008; 294 (6):L1158-65.
Novitch BG, Mulligan GJ, Jacks T et al. Skeletal muscle cells lacking the retinoblastoma protein display defects in muscle gene expression and accumulate in S and G2 phases of the cell cycle. J Cell Biol 1996; 135 (2):441-56.
Novitch BG, Spicer DB, Kim PS et al. pRb is required for MEF2-dependent gene expression as well as cell-cycle arrest during skeletal muscle differentiation. Curr
Biol 1999; 9 (9):449-59.
O'Brien KA, Suverkropp C, Kanekal S et al. Tolerance to multiple doses of the pulmonary toxicant, naphthalene. Toxicol Appl Pharmacol 1989; 99 (3):487-500.
163 Okudela K, Ito T, Mitsui H et al. The role of p53 in bleomycin-induced DNA damage in the lung. A comparative study with the small intestine. Am J Pathol 1999; 155
(4):1341-51.
O'Reilly MA, Staversky RJ, Huyck HL et al. Bcl-2 family gene expression during severe hyperoxia induced lung injury. Lab Invest 2000; 80 (12):1845-54.
Pacal M, Bremner R. Insights from animal models on the origins and progression of retinoblastoma. Curr Mol Med 2006; 6 (7):759-81.
Park KS, Wells JM, Zorn AM et al. Transdifferentiation of ciliated cells during repair of the respiratory epithelium. Am J Respir Cell Mol Biol 2006; 34 (2):151-7.
Pei XH, Bai F, Smith MD et al. p18Ink4c collaborates with Men1 to constrain lung stem cell expansion and suppress non-small-cell lung cancers. Cancer Res 2007; 67
(7):3162-70.
Perl AK, Tichelaar JW, Whitsett JA. Conditional gene expression in the respiratory epithelium of the mouse. Transgenic Res 2002; 11 (1):21-9.
Peters-Golden M, Wise RA, Hochberg M et al. Incidence of lung cancer in systemic sclerosis. J Rheumatol 1985; 12 (6):1136-9.
Plopper CG, Suverkropp C, Morin D et al. Relationship of cytochrome P-450 activity to Clara cell cytotoxicity. I. Histopathologic comparison of the respiratory tract of mice, rats and hamsters after parenteral administration of naphthalene. J Pharmacol
Exp Ther 1992; 261 (1):353-63.
Qin XQ, Chittenden T, Livingston DM et al. Identification of a growth suppression domain within the retinoblastoma gene product. Genes Dev 1992; 6 (6):953-64.
164 Rawlins EL, Ostrowski LE, Randell SH et al. Lung development and repair:
contribution of the ciliated lineage. Proc Natl Acad Sci U S A 2007; 104 (2):410-7.
Reynolds SD, Giangreco A, Power JH et al. Neuroepithelial bodies of pulmonary airways serve as a reservoir of progenitor cells capable of epithelial regeneration. Am
J Pathol 2000; 156 (1):269-78.
Robanus-Maandag E, Dekker M, van der Valk M et al. p107 is a suppressor of
retinoblastoma development in pRb-deficient mice. Genes Dev 1998; 12 (11):1599-
609.
Rodin SN, Rodin AS. Origins and selection of p53 mutations in lung carcinogenesis.
Semin Cancer Biol 2005; 15 (2):103-12.
Ross JF, Liu X, Dynlacht BD. Mechanism of transcriptional repression of E2F by the
retinoblastoma tumor suppressor protein. Mol Cell 1999; 3 (2):195-205.
Roumm AD, Medsger TA, Jr. Cancer and systemic sclerosis. An epidemiologic
study. Arthritis Rheum 1985; 28 (12):1336-40.
Rubin SM, Gall AL, Zheng N et al. Structure of the Rb C-terminal domain bound to
E2F1-DP1: a mechanism for phosphorylation-induced E2F release. Cell 2005; 123
(6):1093-106.
Ruiz S, Santos M, Segrelles C et al. Unique and overlapping functions of pRb and
p107 in the control of proliferation and differentiation in epidermis. Development
2004; 131 (11):2737-48.
Russo AL, Thiagalingam A, Pan H et al. Differential DNA hypermethylation of
critical genes mediates the stage-specific tobacco smoke-induced neoplastic
progression of lung cancer. Clin Cancer Res 2005; 11 (7):2466-70.
165 Saetta M, Turato G, Baraldo S et al. Goblet cell hyperplasia and epithelial
inflammation in peripheral airways of smokers with both symptoms of chronic
bronchitis and chronic airflow limitation. Am J Respir Crit Care Med 2000; 161 (3 Pt
1):1016-21.
Sage C, Huang M, Karimi K et al. Proliferation of functional hair cells in vivo in the absence of the retinoblastoma protein. Science 2005; 307 (5712):1114-8.
Sage J, Miller AL, Perez-Mancera PA et al. Acute mutation of retinoblastoma gene function is sufficient for cell cycle re-entry. Nature 2003; 424 (6945):223-8.
Salgia R, Skarin AT. Molecular abnormalities in lung cancer. J Clin Oncol 1998; 16
(3):1207-17.
Samet JM. Does idiopathic pulmonary fibrosis increase lung cancer risk? Am J
Respir Crit Care Med 2000; 161 (1):1-2.
Sanders BM, Jay M, Draper GJ et al. Non-ocular cancer in relatives of retinoblastoma patients. Br J Cancer 1989; 60 (3):358-65.
Sankaran VG, Orkin SH, Walkley CR. Rb intrinsically promotes erythropoiesis by coupling cell cycle exit with mitochondrial biogenesis. Genes Dev 2008; 22 (4):463-
75.
Schiffmann E, Geetha V, Pencev D et al. Adherence and regulation of leukotaxis.
Agents Actions Suppl 1983; 12:106-20.
Schmidt EE, Taylor DS, Prigge JR et al. Illegitimate Cre-dependent chromosome rearrangements in transgenic mouse spermatids. Proc Natl Acad Sci U S A 2000; 97
(25):13702-7.
166 Scholzen T, Gerdes J. The Ki-67 protein: from the known and the unknown. J Cell
Physiol 2000; 182 (3):311-22.
Sherr CJ. Cancer cell cycles. Science 1996; 274 (5293):1672-7.
Sherr CJ. Cell cycle control and cancer. Harvey Lect 2000; 96:73-92.
Sherr CJ, McCormick F. The RB and p53 pathways in cancer. Cancer Cell 2002; 2
(2):103-12.
Sherr CJ, Roberts JM. Living with or without cyclins and cyclin-dependent kinases.
Genes Dev 2004; 18 (22):2699-711.
Shijubo N, Itoh Y, Yamaguchi T et al. Clara cell protein-positive epithelial cells are reduced in small airways of asthmatics. Am J Respir Crit Care Med 1999; 160
(3):930-3.
Shijubo N, Itoh Y, Yamaguchi T et al. Serum and BAL Clara cell 10 kDa protein
(CC10) levels and CC10-positive bronchiolar cells are decreased in smokers. Eur
Respir J 1997; 10 (5):1108-14.
Shimkin MB, Stoner GD. Lung tumors in mice: application to carcinogenesis bioassay. Adv Cancer Res 1975; 21:1-58.
Singh G, Katyal SL. Clara cells and Clara cell 10 kD protein (CC10). Am J Respir
Cell Mol Biol 1997; 17 (2):141-3.
Sisson TH, Hansen JM, Shah M et al. Expression of the reverse tetracycline- transactivator gene causes emphysema-like changes in mice. Am J Respir Cell Mol
Biol 2006; 34 (5):552-60.
Smith CJ, Perfetti TA, King JA. Perspectives on pulmonary inflammation and lung cancer risk in cigarette smokers. Inhal Toxicol 2006; 18 (9):667-77.
167 Smith EJ, Leone G, Nevins JR. Distinct mechanisms control the accumulation of the
Rb-related p107 and p130 proteins during cell growth. Cell Growth Differ 1998; 9
(4):297-303.
Soriano P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat
Genet 1999; 21 (1):70-1.
Spike BT, Dirlam A, Dibling BC et al. The Rb tumor suppressor is required for stress erythropoiesis. Embo J 2004; 23 (21):4319-29.
Srinivasan SV, Mayhew CN, Schwemberger S et al. RB loss promotes aberrant ploidy by deregulating levels and activity of DNA replication factors. J Biol Chem
2007; 282 (33):23867-77.
Sterner JM, Dew-Knight S, Musahl C et al. Negative regulation of DNA replication by the retinoblastoma protein is mediated by its association with MCM7. Mol Cell
Biol 1998; 18 (5):2748-57.
Stripp BR, Lund J, Mango GW et al. Clara cell secretory protein: a determinant of
PCB bioaccumulation in mammals. Am J Physiol 1996; 271 (4 Pt 1):L656-64.
Strong LC, Herson J, Haas C et al. Cancer mortality in relatives of retinoblastoma patients. J Natl Cancer Inst 1984; 73 (2):303-11.
Subramanian J, Govindan R. Lung cancer in never smokers: a review. J Clin Oncol
2007; 25 (5):561-70.
Sun A, Bagella L, Tutton S et al. From G0 to S phase: a view of the roles played by the retinoblastoma (Rb) family members in the Rb-E2F pathway. J Cell Biochem
2007; 102 (6):1400-4.
168 Tamrakar S, Mittnacht S, Ludlow JW. Binding of select forms of pRB to protein phosphatase type 1 independent of catalytic activity. Oncogene 1999; 18 (54):7803-9.
Tamrakar S, Rubin E, Ludlow JW. Role of pRB dephosphorylation in cell cycle regulation. Front Biosci 2000; 5:D121-37.
Thilly WG. Have environmental mutagens caused oncomutations in people? Nat
Genet 2003; 34 (3):255-9.
Thomas DM, Carty SA, Piscopo DM et al. The retinoblastoma protein acts as a transcriptional coactivator required for osteogenic differentiation. Mol Cell 2001; 8
(2):303-16.
Van Winkle LS, Buckpitt AR, Nishio SJ et al. Cellular response in naphthalene- induced Clara cell injury and bronchiolar epithelial repair in mice. Am J Physiol
1995; 269 (6 Pt 1):L800-18.
Vasanthakumar G, Manjunath R, Mukherjee AB et al. Inhibition of phagocyte chemotaxis by uteroglobin, an inhibitor of blastocyst rejection. Biochem Pharmacol
1988; 37 (3):389-94.
Vernell R, Helin K, Muller H. Identification of target genes of the p16INK4A-pRB-
E2F pathway. J Biol Chem 2003; 278 (46):46124-37.
Walkley CR, Shea JM, Sims NA et al. Rb regulates interactions between hematopoietic stem cells and their bone marrow microenvironment. Cell 2007; 129
(6):1081-95.
Wang JY, Knudsen ES, Welch PJ. The retinoblastoma tumor suppressor protein. Adv
Cancer Res 1994; 64:25-85.
169 Weinberg RA. The retinoblastoma protein and cell cycle control. Cell 1995; 81
(3):323-30.
Wenzel PL, Wu L, de Bruin A et al. Rb is critical in a mammalian tissue stem cell population. Genes Dev 2007; 21 (1):85-97.
Wikenheiser-Brokamp KA. Rb family proteins differentially regulate distinct cell lineages during epithelial development. Development 2004; 131 (17):4299-310.
Wikenheiser-Brokamp KA. Retinoblastoma family proteins: insights gained through genetic manipulation of mice. Cell Mol Life Sci 2006a; 63 (7-8):767-80.
Wikenheiser-Brokamp KA. Retinoblastoma regulatory pathway in lung cancer. Curr
Mol Med 2006b; 6 (7):783-93.
Wildwater M, Campilho A, Perez-Perez JM et al. The RETINOBLASTOMA-
RELATED gene regulates stem cell maintenance in Arabidopsis roots. Cell 2005; 123
(7):1337-49.
Wistuba, II, Mao L, Gazdar AF. Smoking molecular damage in bronchial epithelium.
Oncogene 2002; 21 (48):7298-306.
Witschi H, Espiritu I, Maronpot RR et al. The carcinogenic potential of the gas phase of environmental tobacco smoke. Carcinogenesis 1997; 18 (11):2035-42.
Wu L, de Bruin A, Saavedra HI et al. Extra-embryonic function of Rb is essential for embryonic development and viability. Nature 2003; 421 (6926):942-7.
Yamasaki L, Bronson R, Williams BO et al. Loss of E2F-1 reduces tumorigenesis and extends the lifespan of Rb1(+/-)mice. Nat Genet 1998; 18 (4):360-4.
170 Yanagi S, Kishimoto H, Kawahara K et al. Pten controls lung morphogenesis,
bronchioalveolar stem cells, and onset of lung adenocarcinomas in mice. J Clin Invest
2007; 117 (10):2929-40.
Zacksenhaus E, Jiang Z, Chung D et al. pRb controls proliferation, differentiation,
and death of skeletal muscle cells and other lineages during embryogenesis. Genes
Dev 1996; 10 (23):3051-64.
Zhang Y, Goss AM, Cohen ED et al. A Gata6-Wnt pathway required for epithelial
stem cell development and airway regeneration. Nat Genet 2008; 40 (7):862-70.
Zheng L, Flesken-Nikitin A, Chen PL et al. Deficiency of Retinoblastoma gene in
mouse embryonic stem cells leads to genetic instability. Cancer Res 2002; 62
(9):2498-502.
Zhu L, van den Heuvel S, Helin K et al. Inhibition of cell proliferation by p107, a
relative of the retinoblastoma protein. Genes Dev 1993; 7 (7A):1111-25.
Ziebold U, Reza T, Caron A et al. E2F3 contributes both to the inappropriate
proliferation and to the apoptosis arising in Rb mutant embryos. Genes Dev 2001; 15
(4):386-91.
171
172
173