First Molecular Approach to the Octopus Fauna from the Southern Caribbean

First molecular approach to the octopus fauna from the southern Caribbean

Elena A. Ritschard1,2, Jürgen Guerrero-Kommritz3 and Juan A. Sanchez1

1 Laboratorio de Biología Molecular Marina (BIOMMAR), Departamento de Ciencias Biológicas- Facultad de Ciencias, Universidad de Los Andes, Bogotá, Colombia 2 Department of Molecular Evolution and Development, University of Vienna, Vienna, Austria 3 Fundación Fundabas, Bogotá, Colombia

ABSTRACT The octopus fauna from the southern Caribbean is an understudied field. However, recent taxonomic work in the Colombian Caribbean has led to the discovery of several new species in the family Octopodidae. To provide molecular evidence for recent descriptions in the area (i.e., Octopus taganga, O. tayrona and Macrotritopus beatrixi) and contribute to the systematics of the family, we reconstructed the first molecular phylogenies of the family including Colombian Caribbean octopus species. Using cytochrome c oxidase subunit I and rhodopsin sequences from specimens collected in three sites (Santa Marta, Old Providence and San Andrés Islands) we inferred maximum-likelihood trees and delimited species with PTP. Our mitochondrial analysis supported the monophyly of species found in the area (i.e., O. taganga, O. hummelincki and O. briareus). The genetic distinction of the species O. tayrona and O. insularis was not resolved, as these were found in one clade together with Caribbean O. vulgaris and O. aff. tayrona species (O. spB) and delimited as a single species. Additionally, our results suggest a distant relationship of the Type I O. vulgaris group (Caribbean region) from the other forms of the species complex (Old World and Brazil). Lastly, the third newly described species M. beatrixi emerged as an independent lineage and was delimited as a single species. However, its relationship to other species of its genus remains unknown due to the lack of sequences in databases. Altogether, our molecular approach to the octopus fauna from the southern Caribbean adds on information to the Submitted 7 December 2018 relationship of Octopodidae species world-wide by providing sequences from recently Accepted 14 June 2019 described species from an understudied region. Further studies employing higher taxon Published 29 July 2019 sampling and more molecular information are needed to fill taxonomic gaps in the area Corresponding author and account for single-locus resolution on the systematics of this group. Elena A. Ritschard, [email protected] Academic editor Subjects Biodiversity, Genetics, Molecular Biology, Taxonomy James Reimer Keywords Octopodidae, Molecular phylogeny, Rhodopsin, Southern Caribbean, Species Additional Information and delimitation, Octopus, Cytochrome c oxidase subunit I Declarations can be found on page 11 DOI 10.7717/peerj.7300 INTRODUCTION Copyright The Caribbean region represents a global-scale hotspot of marine biodiversity, which 2019 Ritschard et al. includes the greatest concentration of marine species in the tropical Atlantic Ocean (Roberts Distributed under et al., 2002). However, many gaps in biodiversity studies remain and need to be filled in Creative Commons CC-BY 4.0 order to define conservation priorities and design regional-scale management strategies OPEN ACCESS (Miloslavich et al., 2010). An accurate evaluation of marine biodiversity in the Caribbean

How to cite this article Ritschard EA, Guerrero-Kommritz J, Sanchez JA. 2019. First molecular approach to the octopus fauna from the southern Caribbean. PeerJ 7:e7300 http://doi.org/10.7717/peerj.7300 needs comprehensive identification guides and taxonomic expertise. This phenomenon has also been called taxonomic impediment (see Wheeler, 2004; Wheeler, Raven & Wilson, 2004; Crisci, 2006) and, together with poor sampling efforts, represents an enduring issue for many invertebrates (e.g., Coleman, 2015), including cephalopods (Norman & Hochberg, 2005). All of the major cephalopod lineages contain taxa with unstable systematics (Allcock, Strugnell & Johnson, 2008). In 2005, Norman and Hochberg reported 186 resolved octopus species names in the family Octopodidae d’Orbigny. Until then, around 50% of the described species were lumped in the genus Octopus Cuvier, 1798 (Allcock, Strugnell & Johnson, 2008). This genus, sensu stricto, has only 11 accepted species, all other belong to different genera and most still need to be defined (Norman, Finn & Hochberg, 2014). This has led to an underestimation of several genera within Octopodidae. Regional surveys around the globe additionally revealed a higher octopod diversity, with a recent increase in discovery of new species (Norman & Hochberg, 2005). Moreover, in recent years, studies of cryptic species complexes have increased the number of putative species in the family (e.g., Amor et al., 2016; Amor et al., 2014; Leite et al., 2008). Despite these improvements to octopod systematics, some regions around the globe remain understudied. For instance, within the highly diverse Caribbean, its southern area (Panama, Venezuela and Colombia) represents a remarkable taxonomic gap of the Octopodidae (Guerrero-Kommritz & Camelo- Guarin, 2016). Twenty-nine (29) cephalopod species have been reported from the Colombian Caribbean (Díaz, Ardila & Gracia, 2002; Díaz, Ardila & Gracia, 2000; Guerrero-Kommritz & Camelo- Guarin, 2016; Guerrero-Kommritz et al., 2016) and 12 of them belong to the family Octopodidae sensu Strugnell et al. (2014). Recent taxonomic work based on morphology (Guerrero-Kommritz & Camelo-Guarin, 2016; Guerrero-Kommritz & Camelo-Guarin, 2016; Guerrero-Kommritz & Rodriguez-Bermudez, 2018) from the Taganga Bay at Santa Marta, Colombia, revealed three newly described octopus species (i.e., Octopus tayrona Guerrero-Kommritz & Camelo-Guarin, 2016; O. taganga Guerrero-Kommritz & Camelo- Guarin, 2016, and Macrotritopus beatrixi Guerrero-Kommritz & Rodriguez-Bermudez, 2018) and at least seven more remain undescribed (J G-K, pers. obs., 2018), which highlights the currently unrecognized biodiversity of this understudied region. These morphological studies performed in the country are the first step to understand the diversity of Colombian octopod species, and molecular phylogenetic analyses comprise a next step to follow. Therefore, the purpose of this study was to assess the biodiversity of benthic shallow-water octopuses from three locations in the Colombian Caribbean using genetics by constructing the first molecular phylogeny of the family Octopodidae that included Colombian samples. Particular goals were to: (1) provide molecular evidence for recently described species in the area (namely, O. tayrona, O. taganga and M. beatrixi); and (2) contribute to the systematics of the Octopodidae family by adding data from an understudied area of the globe.

Ritschard et al. (2019), PeerJ, DOI 10.7717/peerj.7300 2/14 Figure 1 Sampling locations at the Colombian Caribbean Sea. San Andrés Island (A), Old Providence Island (B) and Taganga Bay at Santa Marta (C). Maps were generated with QGIS. Full-size DOI: 10.7717/peerj.7300/fig-1

MATERIALS AND METHODS Specimens A total of 38 tissue samples and 36 specimens were obtained between February and March of 2016 with the help of local fishermen by hand capture with aid of a hook or a shovel (Guerrero-Kommritz & Camelo-Guarin, 2016; Guerrero-Kommritz & Rodriguez-Bermudez, 2018). The sampling was performed in three areas with depths less than 7 m near the shore at the Caribbean Sea: San Andrés Island, Old Providence Island and Taganga Bay at Santa Marta, Colombia (Fig. 1). Mantle tissues were stored in 90% ethanol at −20 ◦C until DNA extraction. Voucher specimens were fixed in formalin 4% for 24 to 48 h, preserved in ethanol 70% and identified by morphometries and counts following Guerrero-Kommritz et al. (2016) catalogue for southern Caribbean octopod species. These were deposited in the ANDES Natural History Museum at Los Andes University, Bogota, Colombia (Table S1). The samples corresponded by morphological identifications (summarized in Table S2) to four genera and six described species. Namely, O. tayrona (Guerrero-Kommritz & Camelo-Guarin, 2016), O. taganga Guerrero-Kommritz & Camelo-Guarin, 2016, O. briareus Robson, 1929, O. hummelincki Adam, 1936, Amphioctopus burryi Voss, 1950 and M. beatrixi (Guerrero-Kommritz & Rodriguez-Bermudez, 2018). Specimens belonging to the O. aff. tayrona complex (O. spB and O. spD; Guerrero-Kommritz & Camelo-Guarin, 2016), which are currently being described as new species by J. G-K, and to the genus Callistoctopus Taki, 1964 were also found.

Ritschard et al. (2019), PeerJ, DOI 10.7717/peerj.7300 3/14 Research and collection were approved by the National Environmental Licensing Authority (ANLA, Spanish acronym): Collection Framework Agreement granted to Universidad de los Andes through resolution 1177 of October 9th, 2014 - IBD 0359. Molecular techniques DNA was obtained from tissues by phenol-chloroform extraction and ethanol precipitation following the Coffroth et al. (1992) protocol. Genomic DNA was stored in ultrapure water at −20 ◦C until polymerase chain reaction (PCR) amplification. The mitochondrial gene cytochrome c oxidase subunit I (COI) was amplified using the primers LCO1490 and HC02198 (Folmer et al., 1994) and the nuclear gene Rhodopsin (Rho) with the primers 50-TTGCCTGTACTGTTTGCTAAAGC-30 and 50- GCCATCATTTCTTTCATTTGTGCGGCAT -30(Strugnell, Norman & Drummond, 2004). Each 15 µl PCR reaction contained the following reagents: 9.2 µl of ddH2O, 1.5 µl of 10x buffer, 2.1 µl of 25 mM MgCl2, 0.3 µl of 10 mM dNTPs, 0.3 µl of 5 U/ µl Taq DNA polymerase (Promega), 0.3 µl of 10 mM of both the forward and reverse primers and 1 µl of 20 ng/ µl DNA. PCR thermal cycling program for COI was: denaturation at 92 ◦C for 5 min; 35 cycles of 94 ◦C for 50 s, 54 ◦C for 1 min and 72 ◦C for 1 min; and final extension at 72 ◦C for 7 min completed each PCR. Thermal cycling program for Rho was: denaturation at 94 ◦C for 2 min; 35 cycles of 94 ◦C for 40 s, 50 ◦C for 40 s and 72 ◦C for 90s; and final extension at 72 ◦C for 10 min. PCR products were purified with the ExoSAP-IT protocol (Thermo Fisher Scientific) and sequenced by Macrogen Inc (Korea) in both directions using the same primers as for the PCR amplifications. Sequences generated in this study are available under the GenBank accession numbers MG778037–MG778111(Table S1). Taxon sampling To assess relationships between the individuals found in the three sampling sites and their position within the Octopodidae, the dataset included COI and Rho sequences from different sources (Table S3) of species of the family as the ingroup, and Enteroctopus dofleini Wülker, 1910 and Muusoctopus Gleadall, 2004 sequences as outgroup. The ingroup was selected taking into account the identification to genus of the specimens collected, which belonged all to the family Octopodidae sensu Strugnell et al. (2014). The outgroup species were selected because these were found to be part of the Octopodidae sister group, following the latest Octobrachia phylogeny (Sanchez et al., 2018). Phylogenetic analyses and species delimitation Haplotypes of the COI and Rho datasets were firstly collapsed using the online fasta sequence toolbox FaBox 1.41 (http://www.birc.au.dk/software/fabox). Sequences were aligned with MAFFT v7 (multiple sequence alignment method based on fast Fourier transform (FFT); Katoh & Standley, 2013) with default parameters. Alignments were cleaned with trimAl v1.4 (automated trimming alignment tool; Capella-Gutierrez, Silla- Martinez & Gabaldon, 2009) using a 0.5 gap threshold, 0.25 residue overlap and 90% sequence overlap to erase non-informative sites and sequences. The best-fit model for each dataset was selected with ModelFinder (Kalyaanamoorthy et al., 2017) implemented in IQTree v1.6.2 (Nguyen et al., 2014) using the corrected Akaike Information criterion

Ritschard et al. (2019), PeerJ, DOI 10.7717/peerj.7300 4/14 (AICc). For both COI and Rho datasets, the Generalized Time-Reversible plus Gamma (GTR + G) model of nucleotide substitution was assigned. Best scoring maximum- likelihood trees were constructed with RAxML v8.2.11 (Randomized Axelerated Maximum Likelihood; Stamatakis, 2014) using the rapid bootstrap algorithm, 1,000 bootstrap replicates and 20 alternative runs on distinct starting trees. These resulting trees were finally used as input for the species delimitation analysis with the maximum-likelihood Poisson Tree Process method (PTP; Zhang et al., 2013) as implemented in the web server (https://species.h-its.org/ptp/). Analyses were performed for each gene separately and bootstrap supports >70% were considered significant. Final datasets (sequence files with unique haplotypes), alignments and tree files are available in (Data S1).

RESULTS The COI (625 base pairs, 164 sequences) and Rho (235 base pairs, 40 sequences) maximum- likelihood trees of the family Octopodidae are depicted in Figs. 2 and3, respectively. The COI tree recovered well-supported relationships (bootstrap/BS >70%) mainly at the species level (Fig. 2), whereas deeper branches remain unresolved (BS < 70%). The Rho tree (Fig. 3) included fewer sequences than the COI tree due to the limited availability of this molecular marker in GenBank, resulting in a lower representation of species from the family. Relationships in this analysis were found to be in general discrepant with the COI tree, as detailed below. However, most of these topology inconsistencies were supported below the 70% support level. The maximum-likelihood approach with the mitochondrial gene (Fig. 2) recovered the monophyly of three species found in the studied area, namely O. hummelincki, O. briareus and O. taganga (BS = 100%). These were also delimited as single species with the PTP analysis (92%, 77% and 92% BS support, respectively; detailed PTP results in the Data S1). The recently described species M. beatrixi resulted as a sister lineage of a well-supported clade (BS = 85%) containing Wunderpus photogenicus and Thaumoctopus mimicus, although with a low bootstrap support (BS = 65%). The Callistoctopus sp. specimen (SM1) was found to be a sister lineage to the two C. ornatus representatives from Hawaii and Australia (BS = 85%) and the A. burryi sample (2017–01) was found within its genus as a sister lineage to A. arenicola, A. aegina and A. marginatus (BS = 100%). These three Colombian samples (i.e., M. beatrixi, Callistoctopus SM1. and A. burryi) were delimited each as single species with PTP (BS = 100%). Conversely, the monophyly of the species O. tayrona could not be resolved. This is because O. vulgaris representatives of Puerto Rico and the Lesser Antilles (Caribbean region), and O. insularis (Leite et al., 2008) from Brazil and the mid- Atlantic Islands appeared nested in the same clade as O. tayrona sequences with a bootstrap support of 100% (Fig. 2). The undescribed species O. spD and O. spB proposed by Guerrero-Kommritz & Camelo-Guarin (2016) and O.s sp. samples from Old Providence Island resulted within this clade as well, in both mitochondrial and nuclear phylogenetic analyses (Figs. 2 and 3). The PTP analysis with COI delimited this clade as one single species (BS = 89%; Fig. 2), whereas the Rho delimitation resulted in the delimitation of individual sequences

Ritschard et al. (2019), PeerJ, DOI 10.7717/peerj.7300 5/14 DQ683216.1_Octopus_vulgaris_isolate_ODB3 ●DQ683214.1_Octopus_vulgaris_isolate_ODB1 HQ908431.1_Octopus_vulgaris_voucher_OVMed06 HQ908432.1_Octopus_vulgaris_voucher_OVMed07 HQ908428.1_Octopus_vulgaris_voucher_OVMed03 A. C. HQ908426.1_Octopus_vulgaris_voucher_OVMed01 HQ908427.1_Octopus_vulgaris_voucher_OVMed02 HQ908430.1_Octopus_vulgaris_voucher_OVMed05 HQ908429.1_Octopus_vulgaris_voucher_OVMed04 neA JX500633.1_Octopus_vulgaris_voucher_MMIIM_16 Med JX500630.1_Octopus_vulgaris_voucher_MMIIM_13 JX500631.1_Octopus_vulgaris_voucher_MMIIM_14 JX500632.1_Octopus_vulgaris_voucher_MMIIM_15 JX500660.1_Octopus_vulgaris_voucher_MMIIM_43 KU525761.1_Octopus_vulgaris_isolate_OvMO2 Ca nAs DQ683211.1_Octopus_vulgaris_isolate_OSB6 DQ683209.1_Octopus_vulgaris_isolate_OHB4 DQ683205.1_Octopus_vulgaris_isolate_OTC2 KJ605283.1_Octopus_vulgaris_isolate_OVAL4 ●KJ605279.1_Octopus_vulgaris_isolate_SAVULG01 O. vulgaris s. s. mPac Bra FN424379.1_Octopus_vulgaris nePac KJ605282.1_Octopus_vulgaris_isolate_OVAL3 ●KJ605280.1_Octopus_vulgaris_isolate_OVAL1 O. vulgaris type II KJ605284.1_Octopus_vulgaris_isolate_OVAL5 Ind KU525769.1_Octopus_vulgaris_isolate_OvMo1 nAf JX500664.1_Octopus_vulgaris_voucher_MMIIM_47 ● JX500626.1_Octopus_vulgaris_voucher_MMIIM_9 O. vulgaris type III JX500666.1_Octopus_vulgaris_voucher_MMIIM_49 JX500676.1_Octopus_vulgaris_voucher_MMIIM_59 JX500677.1_Octopus_vulgaris_voucher_MMIIM_60 KF844042.1_Octopus_vulgaris_isolate_OvuPT5 O. sinensis sePac DQ683221.1_Octopus_vulgaris_isolate_OGA1 JX500655.1_Octopus_vulgaris_voucher_MMIIM_38 ● JX500636.1_Octopus_vulgaris_voucher_MMIIM_19 mIO JX500629.1_Octopus_vulgaris_voucher_MMIIM_12 KF844027.1_Octopus_vulgaris_isolate_OvuPA173 SAf KU525767.1_Octopus_vulgaris_isolate_MA10Chl mAI KF489451.1_Octopus_vulgaris IndPac KF844026.1_Octopus_vulgaris_isolate_OvuAP225 ●KF844040.1_Octopus_vulgaris_isolate_OvuSC10 ● KF844031.1_Octopus_vulgaris_isolate_OvuBA117 KF844030.1_Octopus_vulgaris_isolate_OvuPA184 HQ908435.1_Octopus_vulgaris_voucher_OVMed10 HQ908434.1_Octopus_vulgaris_voucher_OVMed09 ●HQ908433.1_Octopus_vulgaris_voucher_OVMed08 ● HQ908436.1_Octopus_vulgaris_voucher_OVMed11 KU525758.1_Octopus_jollyorum_isolate_MA11Tai ●AB430546.1_Octopus_sinensis ● HQ846154.1_Octopus_sinensis_isolate_K3 KU525760.1_Octopus_jollyorum_isolate_EBU54865 KJ605253.1_Octopus_tetricus_isolate_NQ029 KJ605248.1_Octopus_tetricus_isolate_NQ003 KJ605249.1_Octopus_tetricus_isolate_NQ010 KJ605250.1_Octopus_tetricus_isolate_NQ011 KJ605252.1_Octopus_tetricus_isolate_NQ028 KJ605256.1_Octopus_tetricus_isolate_TAS4124 O. tetricus KJ605258.1_Octopus_tetricus_isolate_LML1 KF844044.1_Octopus_hummelincki_isolate_OhumCE1 ● KJ605254.1_Octopus_tetricus_isolate_TAS4113 B. ● ● KJ605261.1_Octopus_tetricus_isolate_NZ1 MG778037.1_Octopus_hummelincki_isolate_2015−42 KJ605251.1_Octopus_tetricus_isolate_NQ015 AB191271.1_Octopus_parvus KJ605247.1_Octopus_tetricus_isolate_NQ002 ● * KJ605270.1_Octopus_cf._tetricus_WAM6702 ● AB430542.1_Octopus_incella KJ605277.1_Octopus_cf._tetricus_WAM6709 AB430545.1_Octopus_wolfi KJ605269.1_Octopus_cf._tetricus_WAM6701 KJ605268.1_Octopus_cf._tetricus_SWA010 HM104258.1_Cistopus_indicus KJ605264.1_Octopus_cf._tetricus_SWA006 AB430544.1_Octopus_parvus KJ605263.1_Octopus_cf._tetricus_CT133 O. cf. tetricus ●KJ605262.1_Octopus_cf._tetricus_CT123 ● GQ900748.1_Wunderpus_photogenicus_isolate_Wunder24 KJ605276.1_Octopus_cf._tetricus_WAM6708 GQ900746.1_Thaumoctopus_mimicus_isolate_ThauMim11 JX500618.1_Octopus_briareus_voucher_MMIIM_1 MG778070.1_Octopus_sp._SA6 MG778072.1_Macrotritopus_beatrixi_2017-02 MG778069.1_Octopus_briareus_isolate_SA5 * ● HM104254.1_Abdopus_aculeatus ● MG778066.1_Octopus_briareus_isolate_SA1 * O. briareus * MG778071.1_Octopus_briareus_isolate_SA4 * AB430543.1_Octopus_laqueus AB430532.1_Octopus_oliveri * AB430534.1_Octopus_cyanea MH550423.1_Octopus_insularis_isolate_P3AA ● MG778056.1_Octopus_tayrona_isolate_SM16 ●AB191280.1_Octopus_cyanea JX500651.1_Octopus_vulgaris_voucher_MMIIM_34 * AB430535.1_Octopus_cyanea JX500622.1_Octopus_vulgaris_voucher_MMIIM_5 MG778041.1_Octopus_sp._B_PR2 ●HQ846138.1_Amphioctopus_marginatus_isolate_TS1 JX500654.1_Octopus_vulgaris_voucher_MMIIM_37 * AB191276.1_Amphioctopus_aegina MG778042.1_Octopus_sp._PR3 JX500652.1_Octopus_vulgaris_voucher_MMIIM_35 * ●HQ846140.1_Amphioctopus_marginatus_isolate_TS3 MG778051.1_Octopus_tayrona_isolate_SM21 ● GQ900730.1_Amphioctopus_marginatus_isolate_AmphMarg29 MH550422.1_Octopus_insularis_isolate_P2AA * MG778038.1_Octopus_tayrona_isolate_SM2 O. vulgaris type I (?) ● GQ900729.1_Amphioctopus_arenicola_isolate_AmphAren74 MH550425.1_Octopus_insularis_isolate_P1IE * ● MG778074.1_Amphioctopus_burryi_isolate_2017−01 MG778040.1_Octopus_sp._PR1 MG778055.1_Octopus_tayrona_isolate_SA8 * ● HQ846124.1_Amphioctopus_kagoshimensis_isolate_OK3 MG778047.1_Octopus_tayrona_isolate_SM17 * O. insularis HQ846157.1_Amphioctopus_ovulum_isolate_SP44 * MG778050.1_Octopus_tayrona_isolate_SM20 * ● MG778043.1_Octopus_sp._PR4 * ●HQ846159.1_Amphioctopus_ovulum_isolate_SP47 MG778048.1_Octopus_tayrona_isolate_SM18 * HQ846158.1_Amphioctopus_ovulum_isolate_SP45 MG778044.1_Octopus_sp._PR5 * O. tayrona KF844000.1_Octopus_insularis_isolate_OinPA14 * HQ846155.1_Amphioctopus_fangsiao_isolate_L21 KP056552.1_Octopus_insularis_isolate_Q5901 HQ846163.1_Hapalochlaena_maculosa_isolate_R4 KF844016.1_Octopus_insularis_isolate_OinRN34 ● ●KF844010.1_Octopus_insularis_isolate_OinRN12 O. spB AF000043.1_Hapalochlaena_maculosa KF844022.1_Octopus_insularis_isolate_OinBA05 KC894941.1_Octopus_salutii_isolate_OSA4 ●KF844025.1_Octopus_insularis_isolate_OinBA199 ● KF844020.1_Octopus_insularis_isolate_OinPE1 KC894940.1_Octopus_salutii_isolate_OSA2 JX500649.1_Octopus_vulgaris_voucher_MMIIM_32 HM104255.1_Ameloctopus_litoralis KF844024.1_Octopus_insularis_isolate_OinBA125 ● KF844003.1_Octopus_insularis_isolate_OinCE38 HM104259.1_Grimpella_thaumastocheir KF844018.1_Octopus_insularis_isolate_OinPB266 GQ900732.1_Callistoctopus_ornatus_isolate_CallOrna85 ● GU362545.1_Octopus_maya ● ● MG778065.1_Octopus_taganga_isolate_SM11 ● AY616892.1_Callistoctopus_ornatus ●MG778063.1_Octopus_taganga_isolate_SM7 * O. taganga MG778073.1_Callistoctopus_sp._SM1 GU355924.1_Octopus_mimus_isolate_L25I * GQ900731.1_Callistoctopus_luteus_isolate_CallLute77 ● KP056551.1_Octopus_mimus_isolate_mimusPa3 * ●GU355925.1_Octopus_mimus_isolate_L31I ● AY545188.1_Octopus_kaurna KP056550.1_Octopus_mimus_isolate_mimusM2 GU355923.1_Octopus_mimus_isolate_C10I AB191277.1_Octopus_sasakii ● KF225005.1_Octopus_hubbsorum_isolate_Col1 AB191275.1_Callistoctopus_minor ● KF225001.1_Octopus_hubbsorum_isolate_M5 ●KF225003.1_Octopus_hubbsorum_isolate_Oax3 HM104263.1_Scaeurgus_unicirrhus KF225004.1_Octopus_hubbsorum_isolate_GC90 HM104260.1_Macroctopus_maorum AF377967.1_Octopus_bimaculoides 0.02 ●AY545189.1_Octopus_bimaculoides ● KF774309.1_Octopus_bimaculoides OUTGROUP KT335828.1_Octopus_bimaculatus_isolate_83 0.06

Figure 2 Cytochrome c oxidase subunit I (COI) Maximum Likelihood tree. (B–C) Black dots represent bootstrap support over the 70% threshold, and asterisks (*) demark sequences generated in this study. Thick grey bars to the right of the phylogeny represent the delimitation of species using PTP with a bootstrap support higher than 70%. Clades with no such bars were not resolved by the species delimitation analysis. Sequences are colored corresponding to their area of sampling (map in A). Abbreviations as follow - mPac: mid-Pacific; nePac: north-eastern Pacific; sePac: south-eastern Pacific; Ca: Caribbean; Br: Brazil; mAI: mid-Atlantic Islands; SAf: South Africa; nAf: northern Africa; neA: north-eastern Atlantic; Me: Mediterranean Sea; mIO: mid-Indian Ocean Islands; Ind: India; IndPac: Indo-Pacific; nAs: northern Asia. The map template was downloaded from www.onlyGFX.com. Full-size DOI: 10.7717/peerj.7300/fig-2

within this clade as single species (Fig. 3). Moreover, this highly-supported clade resulted in the COI tree (Fig. 2) as sister lineage of O. maya (BS = 45%), followed by O. taganga (BS = 70%). In the Rho tree the latter resulted to be paraphyletic to the O. aff tayrona complex (Fig. 3), thus not establishing two separate groups. However, this relationship was supported below the 70% bootstrap level (55%). Other species relationships found in the three sampling areas were found to be discordant between the COI and Rho tree. For instance, in the nuclear analysis (Fig. 3) O. hummelincki appeared nested within the O. tayrona clade (BS = 85%). Conversely, Callistoctopus SM1 was found, as in the COI tree, in a clade with C. ornatus and O. kaurna (BS = 80%; Fig. 3). Moreover, the PTP analysis with the nuclear marker resulted in the delimitation of 10 species supported over the 70% bootstrap level (Fig. 3). However, many of these results were non-concordant with the phylogenetic signal (e.g., delimitation of sequences within the O. aff tayrona/O. taganga as single species; Fig. 3).

Ritschard et al. (2019), PeerJ, DOI 10.7717/peerj.7300 6/14 A.

neA Med

Ca nAs

mPac nePac Bra Ind nAf

sePac mIO mAI SAf IndPac

MG778093.1_Octopus_tayrona_isolate_SM8 B. MG778087.1_Octopus_sp._PR4_EAR−2018 * MG778096.1_Octopus_tayrona_isolate_SM14* MG778095.1_Octopus_tayrona_isolate_SM13 * MG778094.1_Octopus_tayrona_isolate_SM15 * MG778075.1_Octopus_tayrona_isolate_SM2 * MG778076.1_Octopus_tayrona_isolate_SM21* MG778086.1_Octopus_tayrona_isolate_SM6 * MG778078.1_Octopus_tayrona_isolate_SM3 * MG778099.1_Octopus_sp._B_SM19_EAR−2018 * MG778100.1_Octopus_sp._B_PR2_EAR−2018 * MG778103.1_Octopus_sp._PR5_EAR−2018* MG778098.1_Octopus_tayrona_isolate_SM10 * MG778097.1_Octopus_tayrona_isolate_SM9 * MG778089.1_Octopus_tayrona_isolate_SM17* ●MG778088.1_Octopus_tayrona_isolate_SM18 * MG778090.1_Octopus_tayrona_isolate_SM16 * MG778081.1_Octopus_tayrona_isolate_SM20 * MG778092.1_Octopus_hummelincki_isolate_2015−42 * MG778101.1_Octopus_taganga_isolate_SM7 * MG778110.1_Octopus_taganga_isolate_SM12 * MG778102.1_Octopus_taganga_isolate_SM11 * HM104297.1_Octopus_vulgaris * HM104288.1_Ameloctopus_litoralis AY545171.1_Hapalochlaena_maculosa HM104291.1_Cistopus_indicus HM104287.1_Abdopus_aculeatus AY545172.1_Octopus_bimaculoides MG778108.1_Amphioctopus_burryi_isolate_2017−01 * ●MG778104.1_Octopus_briareus_isolate_SA5 MG778107.1_Octopus_briareus_isolate_SA4 * MG778109.1_Macrotritopus_beatrixi_2017* −02_EAR−2018 ● AY616926.1_Callistoctopus_ornatus * ● AY545169.1_Octopus_kaurna MG778111.1_Callistoctopus_sp._SM1_EAR−2018 * ● HM104298.1_Scaeurgus_unicirrhus ● AY545168.1_Octopus_berrima AY545170.1_Octopus_rubescens OUTGROUP 0.01

Figure 3 Rhodopsin (Rho) Maximum Likelihood tree. (B) Black dots represent bootstrap support over the 70% threshold, and asterisks (*) demark sequences generated in this study. Thick grey bars to the right of the phylogeny represent the delimitation of species using PTP with a bootstrap support higher than 70%. Clades with no such bars were not resolved by the species delimitation analysis. Sequences are colored corresponding to their area of sampling (map in A). Abbreviations as follow - mPac: mid-Pacific; nePac: north-eastern Pacific; sePac: south-eastern Pacific; Ca: Caribbean; Br: Brazil; mAI: mid-Atlantic Is- lands; SAf: South Africa; nAf: northern Africa; neA: north-eastern Atlantic; Me: Mediterranean Sea; mIO: mid-Indian Ocean Islands; Ind: India; IndPac: Indo-Pacific; nAs: northern Asia. The map template was downloaded from www.onlyGFX.com. Full-size DOI: 10.7717/peerj.7300/fig-3

Ritschard et al. (2019), PeerJ, DOI 10.7717/peerj.7300 7/14 DISCUSSION Regional ﬁndings Our study provides, for the first time, molecular data from octopods found in the Colombian Caribbean and newly described species from this area. The mitochondrial analysis (Fig. 2) resolved the monophyly (BS = 100%) and species delimitation (BS = 92%) of O. taganga, the third ocellated species (with O. hummelincki and O. maya) from the Atlantic. Morphologically, O. taganga is closely related to O. hummelincki and appears to be related to the Pacific Ocean species Octopus oculifer (Hoyle, 1904), Octopus bimaculoides Pickford and McConnaughey, 1994 and Octopus bimaculatus Verrill, 1883 (Guerrero-Kommritz & Camelo-Guarin, 2016). However, preliminary molecular results showed it as more similar to O. maya than any other species present in the NCBI database (Guerrero-Kommritz & Camelo-Guarin, 2016). We found in the COI tree (BS = 70%) O. taganga as sister lineage of the O. tayrona/O. insularis clade and O. maya (Fig. 2). This group, together with O. mimus and O. hubbsorum, showed a close relationship with the ocellated species O. bimaculoides and O. bimaculatus (BS = 100%). The species O. tayrona formed a monophyletic group with O. insularis, Caribbean O. vulgaris, Octopus sp. B, and Octopus sp. sequences from Old Providence Island in the COI analysis (Fig. 2, BS = 100%) and was delimited as one single species with PTP (BS = 89%). Until its description, O. tayrona and any other large octopus in the Caribbean were identified as O. vulgaris (Guerrero-Kommritz & Camelo-Guarin, 2016). However, it can be morphologically distinguished from European O. vulgaris by its smaller ligula (O. tayrona: 0.6 –1.6 mm; O. vulgaris: 1.2 –2.1 mm) and the absence of enlarged suckers in all arms, both in males and females. O. tayrona can be additionally distinguished from other similar species, such as O. insularis, mainly by its smaller size, the presence of large warts on the arms’ base and the absence of enlarged suckers on arms II and III (Guerrero-Kommritz & Camelo-Guarin, 2016). These features, together with other reproduction-related characters (e.g., relative size of the hectocotylus, presence and form of the calamus) and internal structures related to digestion (e.g., size of liver, teeth on radula, form of salivary glands and structure of stomach), are the base for morphological octopod species delimitation due to their role on ecological adaptation, reproductive isolation and, consequently, speciation. Currently, O. tayrona is considered by morphology part of the O. vulgaris type I group (Guerrero-Kommritz & Camelo-Guarin, 2016), the species complex form representing the wider Caribbean area (Norman, Finn & Hochberg, 2014). The inclusion of sequences identified as O. vulgaris from Puerto Rico and the Lesser Antilles within this clade in our COI tree either supports this claim or, most probably, indicates misidentification of the specimens, as already suggested by Lima et al. (2017). Regardless, these phylogenetic results create a conflict with the morphological species delimitation based on reproduction-related characters of O. tayrona and O. insularis. Moreover, the Rho tree consistently resulted on a highly supported (BS = 85%) monophyletic group of O. tayrona, O. sp. B and O. sp. from Old Providence. An O. insularis sequence from (González-Gómez et al., 2018) was included in the analysis, but during trimming it was erased due to its low coverage in the alignment. Therefore, together with the lack of rhodopsin sequences for Caribbean

Ritschard et al. (2019), PeerJ, DOI 10.7717/peerj.7300 8/14 O. vulgaris, the mitochondrial results regarding O. tayrona could not be confirmed with the nuclear marker. Future work using more molecular data would be necessary to follow up these results. This would help to further evaluate the evolutionary relationship between O. tayrona, O. insularis and Type I O. vulgaris and confirm or reject their taxonomical distinction. The newly described species Macrotritopus beatrixi resulted as an independent lineage in our analyses (Figs. 2 and3) and was delimited as a single species (COI, BS = 100%; Rho, BS = 93%). So far, it represents the first published sequence of its genus. Thus, data from other Macrotritopus species are needed to resolve the genetic distinction of this new species. Moreover, our COI phylogeny and PTP results suggest that Callistoctopus SM1 from Santa Marta represents one independent lineage and a single species (BS = 100%), different from all other representatives of this genus included in the analysis (Fig. 2). A new species of Callistoctopus is currently under description by J. G-K., expected to be closely related to C. macropus Risso, 1826 from the east Atlantic Ocean and Mediterranean Sea (due to morphological similarities; J G-K, pers. obs., 2018). Callistoctopus macropus is also reported for the southern Caribbean (Díaz, Ardila & Gracia, 2000; Guerrero-Kommritz & Camelo- Guarin, 2016). However, after analyzing specimens from France the morphometrics and counts were different, and we considered this a misidentification (research in process J. G-K). Unfortunately, the sequence generated here was taken from an individual whose whole body could not be collected. Therefore, its morphological identification to species level was not possible to achieve. Moreover, due to the lack of sequences of C. macropus in databases, their evolutionary relationship could not be molecularly assessed here and warrants further investigation. Contributions to the Octopodidae systematics Our COI and Rho phylogenies help to fulfill the taxonomic gap in the Octopodidae family of species previously lacking molecular information and thus not considered in the phylogenetic systematics of the family (i.e., O. tayrona, O taganga, A. burryi and M. beatrixi). For instance, the Macrotritopus beatrixi sample contributes the first sequences of its genus, providing new insights on the Octopodidae genus-level systematics. Additionally, the inclusion of O. tayrona in our COI analysis, considered morphologically as part of the Type I O. vulgaris group, allowed the inference of the evolutionary relationship of this species with other forms of the species complex. Our results suggest that O. tayrona is more closely related to other species also found in the New World (e.g., O. taganga from Colombia, O. hubbsorum, O. bimaculatus and O. maya from Mexico, O. mimus from Chile and Peru, O. bimaculoides from California, USA) than to the O. vulgaris forms from the Old World and Brazil (Fig. 2). Moreover, its genetic distinction with O. insularis remains unresolved. Our mitochondrial analysis showed a better-resolved topology, with less polytomies and more significantly-supported branches (BS > 70%) than the Rho tree. This could be explained by the general smaller effective population size of mitochondrial DNA compared to nuclear genes (Moore, 1995). This leads to a higher probability of coalescence in short internodes and can result on a more accurate recovery of the species-tree topology.

Ritschard et al. (2019), PeerJ, DOI 10.7717/peerj.7300 9/14 However, even a well-resolved gene tree can hardly resemble a species tree due to incomplete lineage sorting and DNA barcodes are known to decrease their performance on poorly sampled groups (Meyer & Paulay, 2005). Moreover, recent genome-wide findings on the O. vulgaris species complex (Amor et al., 2019) highlight that phylogenetic analyses using only mitochondrial DNA underestimate octopus species diversity. Thus, despite the better performance of our COI analysis, more informative nuclear markers are needed to complement our results. The number of cephalopod species in the Caribbean should increase as more surveys are made (Judkins et al., 2010; Miloslavich et al., 2010). Here we show a first attempt to fulfill taxonomic gaps on the octopod species of an understudied area of the highly diverse Caribbean. However, more sampling and taxonomic efforts are still needed to contribute to the local and the world-wide picture of the Octopodidae systematics. Therefore, for future studies we suggest the inclusion of more taxa poorly represented in databases to account for incomplete taxon sampling and further tests using more molecular information to account for insufficient single-locus resolution.

CONCLUSIONS Here we present the first molecular approach to the octopus fauna from the southern Caribbean in Colombia. Our mitochondrial analysis supports the monophyly of species found in the Colombian Caribbean, like Octopus taganga, O. hummelincki and O. briareus. The genetic distinction of the species O. insularis and O. tayrona was not resolved, as these were found in one unresolved clade and delimited as one species together with Caribbean Octopus vulgaris and Octopus aff. tayrona species (O. spB). Moreover, our results suggest a distant relationship of the O. vulgaris-like species from the Caribbean region (e.g., O. tayrona and O. insularis) from the O. vulgaris species complex forms of the Old World and Brazil. Lastly, the newly described species Macrotritopus beatrixi was delimited as a single species but its relationship to other species of its genus remains unknown. Altogether, our work contributes to the fulfilment of taxonomic gaps in the Octopodidae family and adds molecular evidence for recent descriptions in this area. We suggest for future studies to use more molecular markers to compensate for insufficient single-locus resolution. Furthermore, molecular data of poorly represented species should be amended to databases to improve taxon sampling.

ACKNOWLEDGEMENTS Special thanks to the fishermen Julián Matos (Taganga, Santa Marta), ‘‘Waily’’ (San Andrés Island) and Casimiro Newball (Old Providence Island) for their help on the collection of specimens; and to Carlos Pardo for his support on the data analysis. Thanks to the Biommar lab team for their support in laboratory procedures and discussion.

Ritschard et al. (2019), PeerJ, DOI 10.7717/peerj.7300 10/14 ADDITIONAL INFORMATION AND DECLARATIONS

Funding This work was funded by Vicerrectoría de Investigaciones—Universidad de los Andes, under the research program ‘‘Completando la teoría del origen de las especies de Darwin: especiación ecológica en octocorales, desde niños a doctores’’. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Grant Disclosures The following grant information was disclosed by the authors: Vicerrectoría de Investigaciones—Universidad de los Andes. Competing Interests Jürgen Guerrero-Kommritz is employed by Fundación Fundabas. Author Contributions • Elena A. Ritschard conceived and designed the experiments, performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the paper, approved the final draft. • Jürgen Guerrero-Kommritz and Juan A. Sanchez conceived and designed the experiments, contributed reagents/materials/analysis tools, authored or reviewed drafts of the paper, approved the final draft. Animal Ethics The following information was supplied relating to ethical approvals (i.e., approving body and any reference numbers): Research and collection of specimens were approved by National Environmental Licensing Authority (ANLA, Spanish acronym): Collection Framework Agreement granted to Universidad de los Andes through resolution 1177 of October 9th, 2014 - IBD 0359. DNA Deposition The following information was supplied regarding the deposition of DNA sequences: The sequences generated here are accesible via GenBank accession numbers MG778037 to MG778111. Sequences can be also found in Data S1. Data Availability The following information was supplied regarding data availability: Sequences and alignments used for the phylogenetic analyses and resulting trees for both cytochrome c oxidase subunit I and rhodopsin genes are available in Data S1. Supplemental Information Supplemental information for this article can be found online at http://dx.doi.org/10.7717/ peerj.7300#supplemental-information.

Ritschard et al. (2019), PeerJ, DOI 10.7717/peerj.7300 11/14 REFERENCES Allcock AL, Strugnell JM, Johnson MP. 2008. How useful are the recommended counts and indices in the systematics of the Octopodidae (Mollusca: Cephalopoda). Biologi- cal Journal of the Linnean Society 95:205–218 DOI 10.1111/j.1095-8312.2008.01031.x. Amor MD, Doyle SR, Norman MD, Roura A, Hall NE, Robinson AJ, Leite TS, Strugnell JM. 2019. Genome-wide sequencing uncovers cryptic diversity and mito-nuclear discordance in the Octopus vulgaris species complex. bioRxiv 9 DOI 10.1101/573493. Amor MD, Norman MD, Cameron HE, Strugnell JM. 2014. Allopatric speciation within a cryptic species complex of Australasian Octopuses. PLOS ONE 9(6):e98982 DOI 10.1371/journal.pone.0098982. Amor MD, Norman MD, Roura A, Leite TS, Gleadall IG, Reid A, Perales-Raya C, Lu CC, Silvey CJ, Vidal EAG, Hochberg FG, Zheng X, Strugnell JM. 2016. Morphological assessment of the Octopus vulgaris species complex evaluated in light of molecular-based phylogenetic inferences. Zoologica Scripta 46:275–288 DOI 10.1111/zsc.12207. Capella-Gutierrez S, Silla-Martinez JM, Gabaldon T. 2009. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 25:1972–1973 DOI 10.1093/bioinformatics/btp348. Coffroth MA, Lasker HR, Diamond ME, Bruenn JA, Bermingham E. 1992. DNA fingerprints of a gorgonian coral: a method for detecting clonal structure in a vegetative species. Marine Biology 114:317–325 DOI 10.1007/BF00349534. Coleman CO. 2015. Taxonomy in times of the taxonomic impediment—examples from the community of experts on Amphipod Crustaceans. Journal of Crustacean Biology 35(6):729–740 DOI 10.1163/1937240X-00002381. Crisci JV. 2006. One-dimensional systematist: perils in a time of steady progress. Systematic Botany 31(1):217–221 DOI 10.1600/036364406775971859. Díaz JM, Ardila N, Gracia A. 2000. Calamares y Pulpos (Mollusca: Cephalopoda) del Mar Caribe Colombiano. Biota Colombiana 1:195–201. Díaz JM, Ardila NE, Gracia CA. 2002. Cefalópodos (Mollusca: Cephalopoda) del talud superior del Caribe colombiano. Boletín Investig Mar y Costeras 31:219–238. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse meta- zoan invertebrates. Molecular Marine Biology and Biotechnology 3:294–299 DOI 10.1371/journal.pone.0013102. González-Gómez R, Barriga-Sosa IDLA, Pliego-Cárdenas R, Jiménez-Badillo L, Markaida U, Meiners-Mandujano C, Morillo-Velarde P. 2018. An integrative taxonomic approach reveals Octopus insularis as the dominant species in the Veracruz Reef System (southwestern Gulf of Mexico). PeerJ 6:e6015 DOI 10.7717/peerj.6015. Guerrero-Kommritz J, Camelo-Guarin S. 2016. Two new octopod species (Mollusca: Cephalopoda) from the southern Caribbean. Marine Biodiversity 46:589–602 DOI 10.1007/s12526-015-0406-9.

Ritschard et al. (2019), PeerJ, DOI 10.7717/peerj.7300 12/14 Guerrero-Kommritz J, Rodriguez-Bermudez A. 2018. Soft-bottom octopods (Cephalopoda: Octopodidae) of the southern Caribbean with the description of a new species of Macrotritopus. Marine Biodiversity 49:1197–1215 DOI 10.1007/s12526-018-0903-8. Guerrero-Kommritz J, Rodríguez-Bermúdez A, Camelo-Guarín S, Quiñones Duarte R. 2016. Catálogo de pulpos de aguas someras de la bahía de Taganga, Sector Tayrona, Caribe sur. Bogota, Colombia: Fundabas. Judkins HL, Vecchione M, Roper CFE, Torres J. 2010. Cephalopod species richness in the wider Caribbean region. ICES Journal of Marine Science 67:1392–1400 DOI 10.1093/icesjms/fsq092. Kalyaanamoorthy S, Minh BQ, Wong TKF, Von Haeseler A, Jermiin LS. 2017. Mod- elFinder: fast model selection for accurate phylogenetic estimates. Nature Methods 14:587–589 DOI 10.1038/nmeth.4285. Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30:772–780 DOI 10.1093/molbev/mst010. Leite TS, Haimovici M, Molina W, Warnke K. 2008. Morphological and genetic description of Octopus insularis, a new cyrptic species in the Octopus vulgaris complex (Cephalopoda: Octopodidae) from the Tropical Southwestern Atlantic. Journal of Molluscan Studies 74(1):63–74 DOI 10.1093/mollus/eym050. Lima FD, Berbel-Filho WM, Leite TS, Rosas C, Lima SMQ. 2017. Occurrence of Octopus insularis Leite and Haimovici, 2008 in the Tropical Northwestern Atlantic and implications of species misidentification to octopus fisheries management. Marine Biodiversity 47(3):723–734 DOI 10.1007/s12526-017-0638-y. Meyer CP, Paulay G. 2005. DNA barcoding: error rates based on comprehensive sampling. PLOS Biology 3:e422 DOI 10.1371/journal.pbio.0030422. Miloslavich P, Díaz JM, Klein E, Alvarado JJ, Díaz C, Gobin J, Escobar-Briones E, Cruz-Motta JJ, Weil E, Cortés J, Bastidas AC, Robertson R, Zapata F, Martín A, Castillo J, Kazandjian A, Ortiz M. 2010. Marine biodiversity in the Caribbean: regional estimates and distribution patterns. PLOS ONE 5(8):e11916 DOI 10.1371/journal.pone.0011916. Moore WS. 1995. Inferring phylogenies from mtDNA variation: mitochondrial-gene trees versus nuclear-gene trees. Evolution 49:718–726 DOI 10.2307/2410325. Nguyen L-T, Schmidt HA, Von Haeseler A, Minh BQ. 2014. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32:268–274 DOI 10.1093/molbev/msu300. Norman MD, Finn JK, Hochberg FG. 2014. Family Octopodidae. In: Jereb P, Roper CFE, Norman MD, Finn JK, eds. Cephalopods of the world. An annotated and illustrated catalogue of cephalopod species known to date, vol. 3: octopods and vampire squids. FAO species catalogue for fishery purposes, No. 4, Rome: FAO, 36–215. Norman MD, Hochberg FG. 2005. The current state of octopus taxonomy. Phuket Marine Biological Center Research Bulletin 66:127–154.

Ritschard et al. (2019), PeerJ, DOI 10.7717/peerj.7300 13/14 Roberts CM, McClean CJ, Veron JEN, Hawkins JP, Allen GR, McAllister DE, Mit- termeier CG, Schueler FW, Spalding M, Wells F, Vynne C, Werner TB. 2002. Marine biodiversity hotspots and conservation priorities for tropical reefs. Science 295(80):1280–1284 DOI 10.1126/science.1067728. Sanchez G, Setiamarga DHE, Tuanapaya S, Tongtherm K, Winkelmann IE, Schmid- baur H, Umino T, Albertin C, Allcock L, Perales-Raya C, Gleadall I, Strugnell JM, Simakov O, Nabhitabhata J. 2018. Genus-level phylogeny of cephalopods using molecular markers: current status and problematic areas. PeerJ 6:e4331 DOI 10.7717/peerj.4331. Stamatakis A. 2014. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30:1312–1313 DOI 10.1093/bioinformatics/btu033. Strugnell J, Norman M, Drummond AJ. 2004. Neotenous origins for pelagic octopuses. Current Biology 14:300–301 DOI 10.1016/j.cub.2004.03.048. Strugnell JM, Norman MD, Vecchione M, Guzik M, Allcock AL. 2014. The ink sac clouds octopod evolutionary history. Hydrobiologia 725:215–235 DOI 10.1007/s10750-013-1517-6. Wheeler QD. 2004. Taxonomic triage and the poverty of phylogeny. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences 359:571–583 DOI 10.1098/rstb.2003.1452. Wheeler QD, Raven PH, Wilson EO. 2004. Taxonomy: impediment or expedient? Science 303(80):285 DOI 10.1126/science.303.5656.285. Zhang J, Kapli P, Pavlidis P, Stamatakis A. 2013. A general species delimitation method with applications to phylogenetic placements. Bioinformatics 29:2869–2876 DOI 10.1093/bioinformatics/btt499.

Ritschard et al. (2019), PeerJ, DOI 10.7717/peerj.7300 14/14