A Phenomic Assessment of Yeast DNA Damage Foci Using Synthetic Genetic Array Analysis and High-Content Screening

A Phenomic Assessment of Yeast DNA Damage Foci using Synthetic Genetic Array Analysis and High-Content Screening

Karen Joanna Founk

A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Molecular Genetics University of Toronto

A Phenomic Assessment of Yeast DNA Damage Foci using Synthetic Genetic Array Analysis and High-content Screening

Karen Joanna Founk

Master of Science

Graduate Department of Molecular Genetics University of Toronto

2011

Abstract

Aberrant DNA synthesis and maintenance have been implicated in numerous human diseases. I describe here a novel strategy for systematically identifying budding yeast mutants with elevated levels of DNA damage foci, which represent hubs of DNA damage and repair. A previous study manually scored foci in single mutants but was limited in its ability to survey many conditions in large populations. I developed an automated and statistically robust method for identifying aberrant foci phenotypes by combining synthetic genetic array (SGA) and high-content screening

(HCS) methodology. Using this approach, I scored thousands of essential and non-essential gene mutants subjected to environmental and genetic perturbations, including the DNA damaging agent, phleomycin, and deletions of DNA repair genes, SGS1 and YKU80. Collectively, I identified a functionally enriched set of 367 mutants that had increased frequencies of DNA damage foci and established SGA-HCS as a powerful tool for investigating the yeast DNA damage response.

Acknowledgements

First and foremost, I offer my sincerest gratitude to my supervisors, Dr. Brenda Andrews and Dr. Charlie Boone, who have supported me throughout my thesis project. Thank-you to you both – your research excellence and high caliber thinking is truly inspiring and working in your laboratories has beyond doubt made me a better scientist. I very much appreciate all of your past encouragement and thank-you for investing in me throughout the past 2 years.

To my committee members, Dr. Dan Durocher and Dr. Jason Moffat, thank-you for all of your great ideas! Your guidance and helpful advice has made an important contribution to this thesis.

To Erin “GFP” Styles - one simply could not wish for a better or friendlier team member. Thanks for all of the hard work you have put into this project. It has been a delight. As they say, Rad52 could not have gotten far in this project if it was not for GFP.

To Dr. Zhaolei Zhang and his graduate student, Lee Zamparo – your collaborative effort on the computational side of this project has made a significant impact. It has been really great working with you.

To all the members of the Andrews and the Boone labs – thanks for always giving me your best insights, keeping me on my toes, and not stealing my beaded blocks. It has been a pleasure to work in a lab of such high caliber people. Specific thanks goes to other members of the cell biology team, Yolanda Chong, Mike Cox, Franco Vizeacoumar and Julia Endicott, as well as the SGA team, Anastasia Baryshnikova and Wei Jiao.

To Dr. Jason Moffat – thank you for allowing me to use your microscope and robotics.

I would like to thank the University of Toronto and its Department of Molecular Genetics for the exposure to amazing, cutting-edge science and world-class knowledge. It has truly been a privilege.

iii

I would also like to acknowledge our lab’s funding from the Canadian Institute of Health Research as well as student funding from the Ontario Graduate Scholarship Program and the Natural Sciences and Engineering Research Council of Canada.

Lastly, I would like to thank my friends and family. To my dodgeball friends – U of T would not have been the same without you. To my parents – no matter what I choose to do, you’re always there encouraging me. To Jon – thanks for always acting like you’re interested in DNA. You, of all people, know how much this means to me and I am so lucky to have such a supportive and loving person in my life. Finally, I would like to thank Hot Mix Pickles, and the whole pickle community – I just plain love you guys.

Table of Contents

Acknowledgements ...... iii

Table of Contents...... v

List of Tables...... vii

List of Figures ...... viii

List of Appendices ...... x

1.0 INTRODUCTION...... 1 1.1 Budding yeast is a premier model organism for genetic studies...... 1 1.2 Arrayed collections in yeast provide invaluable tools for functional genomics studies...... 1 1.3 Synthetic genetic array technology automates yeast genetics to yield systematically constructed genetic interaction networks...... 3 1.4 High‐resolution phenotypes can be visualized using fluorescent proteins...... 3 1.5 Systematic detection of mutants with subcellular morphology defects is accomplished using high‐throughput microscopy and automated image analysis...... 5 1.6 Supervised machine learning approaches permit pattern recognition of subtle phenotypes. ..7 1.7 Genomic studies in yeast uncover new proteins involved in DNA damage and repair...... 9 1.8 Project rationale ...... 12

2.0 RESULTS ...... 15 2.1 Overview: An SGA‐HCS pipeline for identifying novel players in DNA damage and repair.....15 2.2 RAD52GFP fusion marks DNA damage foci and is functional under DNA damaging conditions...... 15 2.3 Introduction of fluorescent markers into the yeast deletion and ts collections using SGA...... 18 2.4 Qualitative fitness assessment of SGA output arrays confirms fluorescent tags do not interfere with protein function...... 20 2.5 Visualization of fluorescent proteins in mutant backgrounds using high‐throughput confocal microscopy...... 22 2.6 Development of a highly automated image analysis strategy to identify DNA damage foci using segmentation and classification...... 22

2.7 Assessment of the performance of computational image analysis for identifying Rad52 foci...... 24 2.8 Statistical parameters employed to eliminate bias as a result of cell sampling errors: Bootstrapping and binomial testing...... 26 2.9 Replicate screens in genetically and chemically sensitized backgrounds...... 30 2.10 Identification and correction of spatial and batch effects using the B‐score...... 31 2.11 Non‐essential gene primary screens identify new genes involved in DNA damage and repair...... 33 2.12 Essential gene primary screens identify new genes involved in DNA damage and repair. ...41 2.13 High vs. low‐resolution screening: Assessment of subcellular morphology phenotypes reveals new genes not detected by fitness screening alone...... 46 2.14 Sensitized backgrounds reveal new hits not detected in single mutant screens alone...... 46

3.0 DISCUSSION ...... 49

4.0 MATERIALS AND METHODS...... 54 4.1 Yeast strains used in this study...... 54 4.2 Tagging genes with fluorescent proteins via PCR mutagenesis...... 54 4.3 Liquid growth curve analysis...... 54 4.4 Yeast serial spot dilutions...... 57 4.5 Synthetic genetic array strategy for introducing reporters into essential ts and non‐essential yeast collections ...... 57 4.6 Determining the mating type of yeast strains using standard halo test...... 58 4.7 High‐throughput imaging using Evotec OperaTM...... 58 4.8 Image analysis pipeline from CellProfilerTM ...... 59 4.9 Classification of DNA damage foci...... 59 4.10 Applying bootstrapping principles to determine ideal cell counts...... 60 4.11 Applying B‐Scores to DNA damage foci data ...... 60

5.0 REFERENCES...... 62

6.0 APPENDICES...... 68 Appendix A. Detailed CellProfilerTM pipeline...... 68 Appendix B. List of Alvaro et al. (2007) mutants detected and not detected in this study ...... 75 Appendix C. GO term enrichment for all individual screens...... 76

List of Tables

Table 1: Summary of DNA damage foci screens performed in this study...... 29

Table 2: Summary of screen results for identifying mutants with increased foci...... 34

Table 3: List of yeast strains used in this study...... 55

Table 4: Primers used in this study for C-terminally tagging RAD52 and HTA2 at endogenous loci...... 56

vii

List of Figures

Figure 1: Synthetic genetic array (SGA) methodology...... 4

Figure 2: Assessing spindle morphology in the yeast deletion collection...... 8

Figure 3: Overview of double strand break repair in yeast...... 10

Figure 4: List of clearly defined subcellular compartments in yeast...... 14

Figure 5: Strategy for automating yeast genetics and high throughput live cell microscopy...... 16

Figure 6: Phenotypic analysis of a RAD52-GFP strain...... 17

Figure 7: Mating type test of the SGA output array...... 19

Figure 8: Using single mutant fitness of RAD52-GFP and HTA2-RFP arrays to test for tag interference...... 21

Figure 9: Strategy for automating image and data analysis to identify mutants that have an increased fraction of cells with Rad52 DNA damage foci...... 23

Figure 10: Comparison of detection of DNA damage foci by computational image analysis and manual inspection...... 25

Figure 11: Calculation of ideal cell count number using bootstrapping techniques...... 27

Figure 12: Strategy for eliminating false positives arising from a known plate effect...... 32

Figure 13: Single mutants identified with high fractions of cells containing DNA damage foci.35

Figure 14: Single mutants identified with high fractions of cells containing DNA damage foci in the presence of 2.5 ng/µl phleomycin...... 36

Figure 15: Double mutants with sgs1Δ identified with high fractions of cells containing DNA damage foci...... 37

viii

Figure 16: Double mutants with yku80Δ identified with high fractions of cells containing DNA damage foci...... 38

Figure 17: Hits from non-essential screens partially overlap with previously published data and reveal new mutants with increases in DNA damage foci...... 39

Figure 18: Ts single mutants identified with high fractions of cells containing DNA damage foci...... 42

Figure 19: Ts alleles identified with high fractions of cells containing DNA damage foci in the presence of 2.5 ng/µl phleomycin...... 43

Figure 20: Ts double mutants with sgs1Δ identified with high fractions of cells containing DNA damage foci...... 44

Figure 21: Ts double mutants with yku80Δ identified with high fractions of cells containing DNA damage foci...... 45

Figure 22: The use of sensitized backgrounds expands the number of mutants implicated in elevated levels of DNA damage foci...... 48

List of Appendices

Appendix A. Detailed CellProfilerTM pipeline ...... 67

Appendix B. List of Alvaro et al. (2007) mutants detected and not detected in this study...... 74

Appendix C. GO term enrichment for all individual screens...... 75

x 1

1.0 INTRODUCTION

1.1 Budding yeast is a premier model organism for genetic studies.

Many human diseases, such as cancer, are associated with genome instability, genetic heterogeneity and phenotypic variability. To tease apart the underlying mechanisms of these maladies, scientists have employed simpler model systems to establish the underlying framework of complex diseases. In the last two decades, the sequencing of many eukaryotic genomes has led to a rich understanding of the gene inventory for a variety of model organisms. In 1996, an international effort produced the genome sequence of the simple baker’s yeast Saccharomyces cerevisiae, the first eukaryote genome to be sequenced. The project led to the discovery of roughly 6000 genes embedded among 16 chromosomes and 12,000 kilobases of sequence (Goffeau et al., 1996). Excitingly, this revealed what many biologists had long suspected – a large proportion of yeast genes are biologically conserved in humans, making yeast both a valid and medically relevant model system (Botstein et al., 1997). For example, the SGS1 helicase gene shares high sequence identity with the human gene implicated in Werner’s and Bloom syndromes and plays a crucial role in the repair of DNA lesions in both yeast and humans (reviewed in Ashton and Hickson, 2009). Budding yeast is non-pathogenic, inexpensively cultured, and can be easily manipulated in either a haploid or diploid state allowing for the addition, deletion or tagging of genes through homologous recombination (Goffeau et al., 1996). For these primary reasons, baker’s yeast continues to offer the most efficient path for investigating eukaryotic gene function.

1.2 Arrayed collections in yeast provide invaluable tools for functional genomics studies.

The sequencing of the yeast genome paved the way for the pioneering development of new functional genomic tools for studying eukaryotes on a genome-wide level. In 2002, scientists took advantage of the genetic tractability of yeast to construct an arrayed collection of ~5000

2 viable mutants now hallmarked as the yeast deletion collection (Winzeler et al., 1999; Giaever et al., 2002). The first array of its kind, this collection was constructed by replacing all non- essential genes with a kanMX4 antibiotic resistance marker that conferred resistance to the drug geneticin. Examination of this collection revealed that only ~20% of deleted open reading frames (ORFs) were essential for haploid viability in rich medium - a strikingly small number emphasizing the fact that genetic redundancy in biological circuits may strongly buffer cells from both genetic and environmental perturbation, even in the simplest of eukaryotes (reviewed in Costanzo et al., 2006). The deletion collection allowed many groups to begin characterizing single mutants systematically via chemical profiling (Giaever et al., 2002; Hillenmeyer et al., 2008). For example, assaying mutants for fitness defects in the presence of sensitizing DNA damaging agents, including bleomycin, hydroxyurea (HU) and methyl methanesulfonate (MMS), led to the discovery of a series of genes linked to DNA damage and repair pathways.

Recently an array of strains carrying temperature-sensitive (ts) alleles of essential genes has been constructed to complement other essential collections (Kanemaki et al., 2003; Mnaimneh et al., 2004; Schuldiner et al., 2005). The most recent collection is composed of ~1500 strains carrying ts alleles of ~500 unique ORFs (Li et al., submitted). This collection complements that generated by the Hieter lab, which is composed of ~250 non-overlapping genes (Ben-Aroya et al., 2008). Typically, ts mutants are generated by random mutagenesis and behave like wild type cells at permissive temperatures but exhibit marked drops in gene product levels or activity when grown at higher restrictive temperatures (Chakshusmathi et al., 2004). These collections allow for systematic analysis of phenotypic defects in essential genes, which are involved in most major biological processes. Other arrays of yeast mutants have been constructed that allow for the assessment of genetic perturbations beyond loss-of-function mutants. For example, the inception of libraries with inducible and endogenous gene overexpression has allowed for systematic analysis of gain-of-function effects (Sopko et al., 2006; Ho et al., 2009). The ultimate goal of yeast functional genomics is to chart an entire eukaryotic cell. The daunting task now remains for biologists to systematically scrutinize these yeast collections to unmask all mechanisms and connections between various genes and pathways.

1.3 Synthetic genetic array technology automates yeast genetics to yield systematically constructed genetic interaction networks.

The realization that genetic redundancy plays a strong role in yeast survival and evolution prompted scientists to begin systematically analyzing not just single mutants, but double mutants as well. Specifically, a key challenge was to work towards better understanding the way in which genes function as networks to carry out and regulate cellular processes (Boone et al., 2007). Our group has taken advantage of the yeast system to develop and implement a revolutionary technology for automated yeast genetics known as synthetic genetic array (SGA) analysis (Figure 1; Tong et al., 2001). SGA is a method for introducing any marked allele (e.g. gene deletion or a tagged protein) into any set of arrayed yeast strains (e.g. deletion collection or ts collection) using robotic pinning steps to carry out standard mating, sporulation and haploid selection (Tong et al., 2001). SGA has enabled facile, large-scale screens that have begun to produce maps of a variety of different types of genetic interactions (reviewed in Boone et al., 2007). A major application of the SGA platform uses arrays of haploid viable deletion mutants to map digenic interactions that either cause a more severe fitness defect than expected based on the fitness of the individual single mutants – termed synthetic lethal (SL) or negative fitness interactions – or result in a less severe growth than expected – termed positive fitness interactions. So far, 5.4 million gene pairs have been constructed and examined, producing a map of tens of thousands of synthetic lethal interactions (Costanzo et al., 2010). Importantly, this study also confirmed that genes with similar genetic interaction profiles tend to share similar biological functions within the cell, indicating that large-scale genetic interaction mapping can be used as a prediction tool for discovering new gene functions and unanticipated connections between biological processes.

1.4 High-resolution phenotypes can be visualized using fluorescent proteins.

While the systematic mapping of genetic interactions has proved to be a powerful tool for understanding genetic networks, genome-wide studies to date have relied heavily on relatively simple assays that use colony size as a proxy for measuring cellular fitness. However, there are many defined instances in budding yeast where growth in rich media is normal in single and

563"7# 8""(7#

!"#,+ -./&)(0!*+ %# !"#!" 1()2%334#56!"&7586# $$$%&'()!*+

'()*+#,#-.!/0.1# 23/34)0*#

9":2+ 1()2%334#56!"&7586# !"#!&,+ -3/3)0*#<6;()0*=#

>./1#;7!3#(//3/3=#

2!0"6/()0*#

9(!/0.1#23/34)0*#

-06:/3#'6;(*;#23/34)0*#

Figure 1: Synthetic genetic array (SGA) methodology

(A) A MATα strain carries a query mutation linked to a selectable marker (natMX) and a CAN1 locus-integrated SGA reporter composed of a mating-type specific promoter$# driving expression of a selectable marker (can1∆::STE2pr–LEU2). The query strain is mated to an ordered array of MATa strains carrying a selectable marker (kanMX deletion collection). Resultant heterozygous diploids are transferred to low carbon/nitrogen medium to induce sporulation. Spores are then transferred to synthetic medium selecting for MATa meiotic progeny (medium lacking leucine & arginine, contains canavanine) as well as query and array dominant markers (medium containing nourseothricin and G418). YFG = your favourite gene. Based on the protocol from Tong et al., 2001.

double mutants despite significant morphological defects present within subcellular compartments. For example, a mus81Δ strain has wild type fitness but exhibits increased numbers of DNA damage foci compared to a wild type strain (Alvaro et al., 2007).

In the past few years, a number of fluorescent proteins have been developed as tools for labeling proteins in vivo to visualize the localization and abundance of virtually any protein amenable to C- or N-terminal tagging. Two prominent examples are the green fluorescent protein (GFP) from the jellyfish Aequorea victoria and red fluorescent protein (RFP) variants from the Discosoma species – these proteins vaulted from obscurity to become some of the most widely studied and heavily exploited proteins in cell biology, earning Roger Tsien, Martin Chalfie, and Osamu Shimomura the Nobel Prize in 2008 (reviewed by Tsien, 1998; Shaner et al., 2004). The use of these proteins as live-cell markers within yeast not only eliminated labour-intensive multi- step staining procedures using various dyes (e.g. fluorescein, rhodamine), but also reduced experimental artifacts that occur due to fixing procedures (Pepperkok & Ellenberg, 2006). One of the most basic tools of modern biology is visual inspection of cells under the microscope. Systematic assessment of subcellular spatio-temporal phenotypes has emerged as a formidable and yet warranted challenge for analyzing the complete repertoire of biological connections in yeast and other systems (Carpenter et al., 2006).

1.5 Systematic detection of mutants with subcellular morphology defects is accomplished using high-throughput microscopy and automated image analysis.

Fortunately, the path to understanding high-resolution phenotypes across the genome is already paved. The GFP collection, a library of ~5000 yeast ORFs C-terminally tagged with GFP, was constructed in 2003, making it possible to systematically examine protein localization and abundance within the cell (Huh et al., 2003). Furthermore, SGA technology has made it easy to introduce queries containing fluorescent markers into any genome-wide yeast collection. Moreover, the emergence of high-throughput (HTP) microscopy platforms has made it possible to rapidly and systematically observe subcellular phenotypes and spatio-temporal traits across the proteome (reviewed by Krausz, 2007). For example, the Evotec OperaTM from PerkinElmer is a state-of-the-art confocal microscope designed with maximum automation capabilities and

6 exceptional optical quality delivered via Nipkow spinning disk technology (PerkinElmer, 2009). These reagents and technologies have enabled the so-called “phenomics” era – the assessment of cell biological phenotypes across the genome.

Perhaps surprisingly, the bottleneck for phenomic studies has not been generating images but in downstream processing – that is, analysis of images to mine new gene-phenotype relationships. With few exceptions, most yeast groups have relied primarily on visual scoring of images to draw biological conclusions. Visual assessment has included analysis of morphological changes in nucleoli, nuclear pore complexes, mitochondria, eisosomes, and DNA damage foci (Teixeira et al., 2002; Dimmer et al., 2002, Altmann & Westermann, 2005; Fröhlich et al., 2009; Alvaro et al., 2007). While there are many benefits to manual scoring by a trained expert – the ability to quickly intuit meaning from appearance, easily ignore irrelevant variations in illumination and contrast, and deal with a wide variety of cellular phenotypes – there is always individual bias and the full spectrum of information necessary for biological clarity is often not extracted (Carpenter et al., 2006).

High-content screening (HCS), a drug discovery term coined in the 1990’s, is a method that combines high-throughput microscopy with automated image analysis and has allowed researchers to generate quantitative datasets in a very fast manner (Giuliano et al., 1997). To date, advances have been made in both commercial and Open Source software to yield automated image analysis strategies capable of computationally identifying relevant objects within an image and extracting hundreds of morphological measurements from each object. For example, CellProfilerTM is a software program designed by researchers at the Broad Institute that can analyze virtually any cellular image (Carpenter et al., 2006; http://www.cellprofiler.org/).

Several groups have begun systematically assessing subcellular compartments in yeast mutants using high-content screening approaches. Ohya et al. (2005) quantitatively screened the yeast deletion collection for morphological phenotypes in cell shape, actin cytoskeleton, and nuclear morphology. The group harnessed custom-made software, called CalMorphTM, and made two striking observations. First, by extracting hundreds of quantitative morphological features, subtle phenotypes could be readily identified across the genome that would not have been detected by eye; this result emphasized the importance of using automated analysis. Second, functionally related genes tended to have similar morphological phenotypes. For example,

mutants with a “large bud size before mitosis” phenotype were highly enriched for DNA metabolism genes (P < 2.2x10-16). This reinforced the idea that a guilt-by-association approach can be successfully applied to morphological data to predict gene function.

Recently, our group, spearheaded by post-doctoral fellow Franco Vizeacoumar, established an automated pipeline for using yeast phenomics to study genetic interactions. As shown in Figure 2, an SGA-HCS marriage was employed to quantitatively examine a spindle marker (GFP-Tub1) in both the single mutant array and arrays of double mutants lacking BNI1 and BIM1 (Vizeacoumar et al., 2010). In these experiments, images were taken using a high-throughput wide-field fluorescence microscope (ImageXpress 5000ATM, Molecular Devices) and analyzed using commercially available image analysis software (MetaXpressTM, Molecular Devices). Computational analysis of these three screens revealed 182 mutants with aberrant spindle morphology. Interestingly, almost half of these mutants were identified in double mutant backgrounds alone, strongly emphasizing the importance of using sensitizing backgrounds to overcome functional redundancy. Furthermore, a guilt-by-association rationale was applied to a rare fishhook spindle phenotype to implicate novel roles for Mcm21p in spindle disassembly. The ability to identify mutant phenotypes, even in challenging test cases such as dynamic spindle processes, reveals that SGA-HCS is a powerful tool for mining biological novelty. Our group has now extended the principles of this technology to strengthen our understanding of additional subcellular compartments and bioprocesses in yeast.

1.6 Supervised machine learning approaches permit pattern recognition of subtle phenotypes.

Segmentation is a method for object identification that uses thresholding to identify borders between bright objects and dark backgrounds. This approach is extremely useful for identifying simple compartments with strong fluorescent signals and straightforward phenotypes (e.g. number of spindle pole bodies within a cell). However, there are often cases when segmentation is not sensitive or informative enough to identify a specific phenotype within a subcellular compartment (e.g. mitochondrial phenotypes). An alternative image analysis strategy is to use pattern recognition approaches based on supervised machine learning techniques. By predefining sets of ‘positive’ or ‘negative’ cells, this approach takes advantage of support vector

!J="KL$GMF#=F!$ .NMOKL$GMF#=F!$

!),1-*/$ I$ !),1-*/$ I$

!"#&$ !"#!" !"#&$ !"#!" $%&'(#)*+, '()*+,-$./*/0+1$ /01+.,23,/14+., '()*+,-$./*/0+1$ #22(3$4$---., $%&'(#)*+, #22(3$4$---., !"#$ !"#$

!"#!" !"#!" $%&'(#)*+, $%&'(#)*+, ---., /01+.,23,/14+., ---., 'J"'STN=FL=F$!TULL=J="$

%A$ @$ >B$ >H%$758(189$P,8Q$ A%$ >%$ CB$ 9),1-*/$7+2)Q+*+D3$ -/R/:89$ >B$

!,1D*/$758(18$9:2//1$=4E%$ .+56*/$758(18$9:2//1$;/14+.<$=4>??$ .+56*/$758(18$9:2//1$;/01+.<$=4>AC$ F+8(*$G58(189$=4>H%$

Figure 2: Assessing spindle morphology in the yeast deletion collection.

Synthetic genetic array (SGA) technology was coupled to high-content screening (HCS), a HTP method for automated imaging and analysis (Giuliano et al., 1997), to detect spindle morphology defects in yeast mutants. SGA-HCS was employed to assess a GFP-TUB1 spindle marker in both single and double (bin1Δ and bim1Δ) mutant backgrounds. This screen revealed 182 mutants to have aberrant spindle morphology. Close to half of these mutants were identified in the double mutant backgrounds alone, emphasizing the importance of using sensitized backgrounds. Based on the protocol from Vizeacoumar et al., 2010. %$

machines (SVM), decision trees, and/or neural networks to distinguish ‘positive’ cells from ‘negative’ cells (Tarca et al., 2007). Feature selection is first performed to reduce the number of extracted morphological features to only an informative set. Machine learning is then applied to refine the informative features by establishing a set of rules that distinguish the various classes. Chen et al., 2006 used this strategy extensively to develop SVM-based classifiers capable of recognizing 22 clearly defined patterns present in the GFP collection; this was a significant improvement over previous work that scored all localization patterns by eye (Huh et al., 2003) and revealed the power of machine learning for detecting complex patterns and phenotypes.

1.7 Genomic studies in yeast uncover new proteins involved in DNA damage and repair.

Now that scientists have the capability of inspecting high-resolution phenotypes in both a robust and automated fashion, subcellular morphology phenotypes can be assessed in more detail and at a much faster pace. One biological process of great interest, due to its implications in numerous human diseases (Altmannova et al., 2010), is the synthesis and maintenance of DNA. DNA damage response pathways have been studied extensively in the budding yeast and yet new genes with novel roles in the DNA damage response are still being identified (Chang et al., 2006). Genome-wide screens of the viable yeast deletion mutant collection have played a major role in this discovery process. In particular, various groups have screened the yeast deletion collection for sensitivity to a variety of different drugs – MMS (Chang et al., 2002; Begley et al., 2002; Hillenmeyer et al., 2008), HU (Hartman & Tippery, 2004; Woolstencroft et al., 2006; Parsons et al., 2004; Hillenmeyer et al., 2008), bleomycin (Aouida et al., 2002; Hillenmeyer et al., 2008), and ionizing radiation (IR) (Bennett et al., 2001) – resulting in the identification of hundreds of mutants with a phenotype that might reflect defects in the DNA damage response. Furthermore, a series of chromosome instability screens (Yuen et al., 2007) and telomere length assays (Askree et al., 2004) have been used to identify genes that maintain genome structure.

Screens such as these, as well as other more directed experiments, have provided the foundation for understanding how double strand break (DSB) repair pathways play a role in DNA repair. We now know that the majority of DSBs in yeast are repaired through homologous recombination (HR) during S and G2/M phases (Figure 3) (Barlow and Rothstein, 2010). Once

89\" !F" +F"

#$%&&'()*+,'-$./"

0123)341" 9Y"X/V#" X&" 674&" 81)/" D(" CD6E" 9:.&" (%.%5341" 8C<"$%@)2$" G%H&" =.L!" W?MJ," (;<" G4R&" W?MN," #$5&" ..8C<" #%5&' D/<" ;$4A%5341" 8*5/" Z2R&" ()*K" Z2:)341" 81HI" C%[&" =*?&" (S="T" (R5&" ()*+!" ()*+/" 6H:&" =>?&" ()*/I" X)@"S2HH21:" ;4HI" =UNV=U&NV855&"

8C<"$%@)2$" =%HH" 5Q5H%" !F" #%5!"8*5/"()*&J" )$$%.A" +F" 6$$4$"@$41%"$%@)2$%*"8C<" =>%5?@421A" ()*+&" ()*+I" ()*++" 9A$)1*"" ()*+J" 01B).241" ()*+K"

9:.&'G4@!'(L2&" #M.N&'#L.I" DE"(%.4HM341" O"82.)..%LPHQ" 9H7&'9H7I" !F" +F" 6$$4$"R$%%"$%@)2$%*"8C<"

Figure 3: Overview of double strand break (DSB) repair in yeast.

DSBs are initially recognized by the Mre11-Rad50-Xrs2 complex and Tel1 (ATM homolog) is activated. If a DSB is detected in S or G2/M, repair takes place through homogolous recombination and DNA ends are resected by multiple nucleases forming 3’ ssDNA tails. RPA protects ssDNA and recruits Mec1-Ddc2 (ATR homolog) as well as other proteins to activate the DNA damage checkpoint. Rad52 catalyzes the formation of a Rad51 nucleoprotein filament along the ssDNA to allow for strand invasion. Repair is accomplished via members of the Rad52 epistasis group, including Rad54, Rad55, Rad57, and Rad59, as well as other proteins that promote Holliday junction resolution and protein!" disassembly. If a DSB is detected in G1, repair takes place through non-homologous end joining involving the Yku70-Yku80 complex as well as other proteins that promote DNA ligation and gap filling. Based on reviews by Lisby & Rothstein, 2009 and Barlow &

Rothstein, 2010.

11 a double strand break is detected via the Mre11-Rad50-Xrs2 complex, DNA ends are resected by multiple nucleases to form 3’ ssDNA tails. RPA protein then binds ssDNA and recruits Mec1- Ddc2 (ATR homolog) and Ddc1-Mec3-Rad17 (9-1-1 complex) to activate DNA damage checkpoints. Rad52 is then able to aid Rad51 in strand invasion. Key players such as Rad54, Rad55, Rad57, and Rad59 then accomplish lesion repair, most often leading to Holliday junction resolution and protein disassembly. An alternative mechanism to HR is non-homologous end joining (NHEJ), a G1-specific form of illegitimate recombination that strongly relies on the Ku proteins (Yku70, Yku80) to rejoin DNA ends by ligation (Figure 3; reviewed by Daley et al., 2005).

The budding yeast has also served as an important test bed for identifying and characterizing DNA damage foci. DNA damage foci are giga-dalton sized assemblies of proteins that arise spontaneously in the cell and act as recombination centers for the repair of DNA damage (Lisby et al., 2001). They typically form in approximately 50% of cells in S-phase and persist for less than 10 minutes (Lisby et al., 2003). The Rothstein laboratory at Columbia University used a plasmid-based RAD52-GFP fusion to develop a loss-of-heterozygosity approach for assaying the yeast deletion collection as hybrid diploids (Alvaro et al., 2006; Alvaro et al., 2007). Rad52 is an evolutionarily conserved key player in HR-mediated DNA repair that specifically colocalizes with DSBs (Lisby et al., 2003). Importantly, this group identified 87 gene deletions that caused increased levels of spontaneous Rad52 foci in proliferating diploid cells. This group of genes included all non-essential members of the Rad52 epistasis group (rad51Δ, rad54Δ, rad55Δ, rad57Δ, rad59Δ, mre11Δ and xrs2Δ) – all of which play key roles in the detection and repair of DSBs (Figure 3; reviewed by Symington, 2002; Barlow & Rothstein, 2010). The list also included, among others, chromatin remodelers, metabolic genes, and 22 previously uncharacterized IRC proteins. While this study represents a profound increase in knowledge of genes involved in the DNA damage and repair process, the screen has several key limitations. First, manual inspection of all mutants made it logistically impossible to image and score more than 200-300 cells per mutant, making it difficult to make statistically sound conclusions. Perhaps more importantly, only single mutants were assessed. In fact, no group to date has looked at DNA damage foci in double mutants or in the presence of DNA damaging agents. As it is well established that yeast displays large amounts of genetic redundancy, further investigation in sensitized backgrounds is warranted to understand the full repertoire of genes

impacting DNA damage foci.

1.8 Project rationale

The specific success of the spindle morphology screens described by Vizeacoumar et al. (2010) paved the way for the so-called “marker project” which has been the focus of my thesis research. This project has the over-arching goal of combining SGA and HCS platforms to assess yeast single and double mutants for morphology defects in over 20 cellular compartments (Figure 4). For this thesis, I focused my efforts on the DNA damage repair pathways by once again examining the well-characterized DNA damage foci marker, RAD52-GFP. As mentioned above, while many central players in repair pathways have been discovered, many gaps remain in our understanding of how repair pathways are regulated and connected to other cellular events. For instance, genome-wide genetic interaction data from Costanzo et al., 2010 suggest DNA damage pathways are functionally linked to vesicular trafficking, a connection that is still poorly understood. Furthermore error-free repair of DNA is important in many human disease models (Altmannova et al., 2010). Moreover, while Rad52-GFP foci have been assessed in the past in single mutants (Alvaro et al., 2007), no group to date has looked at DNA damage foci in a genome-wide mutant collection in chemically or genetically sensitized backgrounds.

To gain new insight into DNA damage and repair pathways in yeast, I had two main objectives. My first aim was to implement and develop a pipeline for detecting DNA damage foci within yeast loss-of-function mutants. To do this, I aimed to screen both the yeast deletion collection and the ts essential gene collection by coupling SGA technology with HCS. By taking advantage of existing positive controls (Alvaro et al., 2007), I endeavored to optimize a pipeline that addresses cell-sampling errors through the application of robust statistical tests as well as identifies and corrects for batch effects. My second aim was to shed new light on the DNA damage and repair landscape by applying SGA-HCS to identify loss-of-function mutants with elevated levels of DNA damage foci. With the guilt-by-association rationale that similar phenotypes result from similarities in protein function, I aimed to uncover genes with previously unrecognized mutant phenotypes and discover unanticipated connections between distinct biological pathways.

I reasoned that the use of sensitized backgrounds would allow me to identify new players with more peripheral roles in DNA damage and repair and I tested this idea by screening for changes in DNA damage foci in the presence of chemical (phleomycin) and genetic (sgs1Δ, ykuo80Δ) perturbations. These studies have involved collaborations with a fellow graduate student, Erin Styles, a summer student, Julia Endicott, as well as computational scientist, Lee Zamparo, from Zhaolei Zhang’s lab at the University of Toronto.

Actin Late Golgi Peroxisomes SPB Septins INM (Sac6, Abp140) (Sec7) (Pex11) (Spc29) (Cdc11) (Heh2)

Cell Wall Early Golgi ER Spindle Actomyosin Ring Nucleus (Psr1) (Cop1) (Sec63) (Tub1) (Iqg1) (Hta2)

Mitochondria Endosome Exocyst Spindle Midzone Vacuole NPC (Om45) (Vps35) (Sec3) (Ase1) (Vph1) (Nup53)

DNA damage foci Eisosomes Kinetochore Lipid Droplets Nucleolus Unmarked Cell (Rad52) (Pil1) (Nuf2) (BODIPY stain) (Nop53)

Figure 4: List of clearly defined subcellular compartments in yeast.

23 subcellular compartments were annotated by Huh et al. (2003) after systematically assessing the yeast GFP collection for localization patterns. The gene in brackets mark a compartment of interest when fused with a fluorescent protein, with the exception of BODIPY, which is a stain that marks lipid droplets. This study focuses on the examination of RAD52-GFP, a marker of DNA damage foci. SPB = spindle pole body; INM = inner nuclear membrane; NPC = nuclear pore complex; ER = endoplasmic reticulum.

!" 15

2.0 RESULTS

2.1 Overview: An SGA-HCS pipeline for identifying novel players in DNA damage and repair.

To implicate new genes in DNA damage and repair, I harnessed the power of SGA coupled to HCS to systematically assess DNA damage foci in a variety of yeast mutants. To do this, I developed and optimized an extensive pipeline for introducing reporters into the yeast deletion and ts collections, acquiring images of mutant phenotypes using state-of-the-art confocal microscopy, and scoring images quantitatively using automated image analysis and statistical parameters (Figures 5 and 9). This highly automated and statistically robust strategy was tested in a variety of chemically and genetically sensitized backgrounds and used to identify mutants with elevated levels of DNA damage foci within a population.

2.2 RAD52-GFP fusion marks DNA damage foci and is functional under DNA damaging conditions.

To highlight DNA damage foci within the cell, I fused a GFP-HIS3 cassette to the C-terminus of the endogenous RAD52 gene using polymerase chain reaction (PCR)-directed mutagenesis (Figure 6A, see Materials and Methods). RAD52 was selected due to its extensive characterization and specific localization to sites of DSBs (Lisby et al., 2003). To provide spatial and cell cycle context, I also fused an RFP-natMX cassette to the endogenous HTA2 locus to mark the nucleus and RPL39pr-RFP-CaURA3 was integrated into the CAN1 promoter locus to mark the cytoplasm. To provide SGA compatibility, all fluorescent reporters were added to the SGA ‘query strain’ background (MATα his3Δ1 leu2Δ0 ura3Δ0 MET15 can1Δ::STE2pr-LEU2 lyp1Δ).

To verify that the GFP tags did not compromise RAD52 function due to steric hindrance or interruption of critical C-terminal sequence, I carried out three independent tests. First, I used confocal microscopy to verify the localization of Rad52-GFP to distinct foci within the nucleus

Figure 5: Strategy for automating yeast genetics and high-throughput live cell microscopy.

SGA-compatible query strains are labeled with fluorescent proteins to mark specific compartments within the cell. A RAD52-GFP fusion marks DNA damage foci while nuclear (HTA2-RFP) and cytoplasmic (RPL39pr-RFP) signals provide spatial and cell cycle context. Quality control steps are implemented to assess if RFP or GFP tags affect protein function by assessing localization, growth rate in rich media, and sensitivity to the DNA damaging agent, hydroxyurea. SGA query strains are then crossed into the deletion collection using SGA methodology and robotic pinning steps. Colony sizes are quantified as a measure of cellular fitness. Mating type tests are performed on select strains to ensure SGA outputs are pure MATa populations. Haploid phenotypes are then imaged in early log phase in low fluorescent media using confocal microscopy (OperaTM platform). Images are taken in both the red and green channels using simultaneous imaging.

Figure 6: Phenotypic analysis of a RAD52-GFP strain. (A) Polymerase chain reaction (PCR) -based mutagenesis and homologous recombination were used to tag RAD52 C-terminally at the endogenous locus with a GFP cassette containing a transcriptional terminator and yeast selectable marker HIS3. Integration was confirmed via PCR using primer sites indicated by arrows. (B) Confocal microscopy of SGA query strain marked with RAD52-GFP, HTA2-RFP, and RPL39pr-RFP. Foci within a wild type population are visible in the GFP panel. (C) Liquid growth curves of RAD52-GFP (red), RAD52 (blue), and NOP53-GFP (green) strains are shown. (D) Growth of RAD52, RAD52-GFP, and rad52Δ in the presence (right panel) and absence (left panel) of hydroxyurea (HU). Strains were serially diluted and plated on the appropriate medium.

as expected (Lisby et al., 2003). Furthermore, preliminary quantification revealed spontaneous foci in ~7% of wild type cells, similar to previous reports of 5% spontaneous foci (Figure 6B; Alvaro et al., 2007). Next, liquid growth curve assays measuring turbidity over time showed that the RAD52-GFP strain had normal growth in rich media similar to a RAD52 strain (Figure 6C; see Materials and Methods). Finally, a RAD52-GFP strain was serially diluted and spotted on synthetic media containing 100 mM hydroxyurea (HU) (Figure 6D; see Materials and Methods). HU is a ribonucleotide reductase inhibitor that depletes dNTP pools causing decreased growth in rad52Δ backgrounds (Woolstencroft et al., 2006). Upon testing, the RAD52-GFP strain grew comparably to wild type on HU-containing media, whereas a rad52Δ::kanMX strain showed the expected sensitivity. Collectively, these experiments suggested that the GFP tag did not interfere with Rad52 function and that the RAD52-GFP strain was suitable for use in biological screens.

2.3 Introduction of fluorescent markers into the yeast deletion and ts collections using SGA.

I used SGA to introduce the DNA damage foci, nuclear and cytoplasmic fluorescent markers (MATα his3Δ1 leu2Δ0 ura3Δ0 MET15 can1Δ::STE2pr-LEU2 lyp1Δ starting background) into the kanMX-marked deletion and ts collections (MATa his3Δ1 leu2Δ0 ura3Δ0 met15Δ0). This procedure was completed using a series of replica plating steps via robotic pinning that allowed for mating, sporulation and haploid selection (see Materials and Methods). Consequent SGA output arrays yielded MATa haploids containing all fluorescent markers in both ~4300 single gene knockouts and ~1500 ts alleles. To test the robustness of the SGA pipeline, I performed mating type tests on single colonies streaked from the output arrays. In my pipeline, SGA is designed to select for haploid cells of MATa mating type, as well as other markers of interest. One test of the SGA protocol is to ensure all output colonies are MATa as expected. To test for mating type, I assessed the production of alpha mating pheromone, secreted by MATα and of a mating pheromone, produced by MATa cells. By growing singles in the presence of MATa bar1Δ and MATα sst2Δ mutant strains, singles could be identified as MATa or MATα based on the presence or absence of a pheromone-induced halo of G1 arrested cells that fail to grow and form a lawn (see Materials and Methods). As shown in Figure 7, all colonies tested were MATa as expected verifying the integrity of my SGA pipeline.

Figure 7: Mating type test of the SGA output array. Halo assays were used to determine the mating type of SGA output cells. 5 randomly selected mutants (A-E) were streaked from the SGA output array and six (1-6) singles were streaked on YEPD media overlaid with low melting point agarose containing bar1Δ or sst2Δ cells. The presence of a halo on bar1Δ lawns indicates MATα cells and the presence of a halo on sst2Δ lawns indicates MATa cells. A his3Δ::kanMX strain from the deletion collection was used as a MATa positive control. The SGA query strain (RAD52-GFP, HTA2-RFP, RPL39pr-RFP) was used as a MATα positive control.

2.4 Qualitative fitness assessment of SGA output arrays confirms fluorescent tags do not interfere with protein function.

As described above, I used a number of phenotypic tests to confirm that the Rad52-GFP fusion protein was functional. To confirm the integrity of the Rad52-GFP marker, as well as assess potential phenotypic effects of the other tagged genes in my query strain (e.g. HTA2-RFP nuclear marker), I assessed all colonies on my SGA output arrays for fitness defects. As noted earlier, colony size has been used extensively by our group as a proxy for measuring cellular fitness and has been used to detect genetic interactions in double mutants (Costanzo et al., 2010). Using this same principle, I rationalized that if GFP tags compromised RAD52 function then small colonies on my SGA output array would mostly likely be mutants known to be synthetic sick or lethal (SSL) with rad52Δ. For example, rad51Δ is known to be synthetic lethal with rad52Δ, therefore a rad51Δ fitness defect on my SGA output array would indicate tag interference with Rad52 function.

To test this systematically for both RAD52-GFP and HTA2-RFP, I quantified colony sizes using customized software (Qt Colony Imager V20090716) and compared these values to the wealth of single mutant fitness scores obtained by our group. This assessment was done with the help of two graduate students from our group, Anastasia Baryshnikova and Wei Jiao (Figure 8A). I then examined the top 100 mutants exhibiting differential colony sizes on my SGA output arrays and determined if any of these mutants were known to be SSL with RAD52. Out of 117 rad52Δ and 34 hta2Δ known SSL interactions from Costanzo et al., 97% and 94% of mutants in the marker screen did not exhibit a fitness defect, respectively, including our positive control rad51Δ (Figure 8B). These results suggest that the fluorescent tags on my marker proteins did not significantly interfere with either RAD52 or HTA2 function, further corroborating my other phenotypic tests (Figure 6).

Figure 8: Using single mutant fitness of RAD52-GFP and HTA2-RFP arrays to test for tag interference.

(A) Fitness of single mutants (RAD52 HTA2 background) obtained from previous SGA screens (Costanzo et al., 2010) (y-axis) were compared with single mutant fitness for marked RAD52- GFP HTA2-RFP strains from this study (x-axis). A fitness score of 1 indicates wild type fitness. Fitness scores greater than 1 indicate the mutant has a larger or positive fitness compared to wild type. Fitness scores less than 1 indicate the mutant has a smaller or negative fitness compared to wild type. (B) 117 mutants known to have negative genetic interactions (GI) with rad52Δ were examined in the RAD52-GFP background. 97% of these mutants did not reproducibly exhibit a noticeable fitness defect. Similarly, of the 34 mutants known to have negative GI with hta2Δ, 94% did not display a reproducible fitness defect in the HTA2-RFP background.

2.5 Visualization of fluorescent proteins in mutant backgrounds using high-throughput confocal microscopy.

Following SGA, I employed the OperaTM microscope platform to perform live cell imaging of the deletion and ts collections to visualize DNA damage foci, nuclei, and the cytoplasm with their respective reporters (RAD52-GFP, HTA2-RFP, RPL39pr-RFP) (Figure 5; see Materials and Methods). In short, I imaged early log phase cells using a 60X objective in low fluorescent media to yield ~20,000 to 40,000 images per screen of the deletion collection and ~7500 images per screen of the ts collection. To avoid non-fixed yeast cells moving between separate exposures, green and red channels were imaged simultaneously using the two OperaTM cameras and 800 ms exposure times. When appropriate, cells were imaged, treated in 2.5 ng/µl phleomycin for 3 hours at room temperature and then re-imaged. All ts-alleles were incubated at both permissive (22oC) and non-permissive (37oC) temperatures before imaging. Overall, the highly automated nature of both sample preparation using liquid handling robots and high- throughput OperaTM-based microscopy represents a vast improvement in speed as the entire deletion collection could be imaged in 9 h (800 ms exposure, 4 sites/well). In contrast, the ImageXpressTM system used in previous studies by our group (Vizeacoumar et al., 2010) is approximately 8 times slower than the OperaTM and acquisition of images manually by Alvaro et al. (2007) is slower still, requiring weeks to image.

2.6 Development of a highly automated image analysis strategy to identify DNA damage foci using segmentation and classification.

In order to assess thousands of images in an automated fashion, I took advantage of TM CellProfiler software to develop a new strategy for identifying DNA damage foci computationally (Figure 9; see Materials and Methods). I began by identifying cells (RPL39pr- RFP) and nuclei (HTA2-RFP) by exploiting segmentation-based strategies that distinguish bright objects from dark backgrounds using intensity thresholds (Carpenter et al., 2006). This procedure was followed by the extraction of hundreds of quantitative measurements (area/shape, intensity and texture) from each identified object. See Appendix A for a detailed breakdown of the CellProfilerTM pipeline used in my analysis.

Figure 9: Strategy for automating image and data analysis to identify mutants that have an increased fraction of cells with Rad52 DNA damage foci.

Acquired images undergo automated image analysis using CellProfilerTM where nuclei and cells are segmented and morphological measurements are extracted. Classification using supervised machine learning approaches is used to recognize cells with foci. A training set is generated manually using CellProfiler AnalystTM, informative features are selected via Wilcoxon rank sum tests, and rules are generated using support vector machines. Each mutant is then scored, assigned a p-value using the binomial test and Fisher’s method, and ranked to generate a hit list.

While segmentation-based approaches were extremely successful for identifying nuclei and cytoplasm, intensity variation of the RAD52-GFP signal made foci segmentation very unreliable, even after applying various intensity and area/shape filters (data not shown). To overcome this problem, I employed machine-learning techniques to generate a classifier capable of recognizing a nucleus containing a DNA damage focus. To do this, I generated a training set using CellProfiler AnalystTM of ~2000 segmented nuclei by manually sorting nuclei into 1 of 2 bins – a positive bin containing only nuclei with foci and a negative bin containing only nuclei without foci. As each nucleus is associated with a series of quantitative measurements, a Wilcoxon rank sum test could be applied to select only the measurements that were most informative for distinguishing the positive nuclei from the negative nuclei. Feature selection was then coupled to support vector machine (SVM)-based machine learning to define a set of rules for predicting T whether or not a nucleus contained a focus. In brief, an SVM formula [Yi (β xi+β0) ≥ 1−ξi] was then applied to establish a hyperplane between positively and negatively labeled nuclei in high dimensional space (Zhu, 2008). I developed this classifier in collaboration with Lee Zamparo, a graduate student in Zhaolei Zhang’s laboratory at the University of Toronto. Using this approach, we developed a classifier capable of identifying nuclei with foci with ~98% cross- validation as defined by a receiver operating characteristic (ROC) curve (Fawcett, 2006) (Figure 9).

2.7 Assessment of the performance of computational image analysis for identifying Rad52 foci.

Next, I sought to assess the accuracy and reliability of my automated image analysis pipeline. To do this, I confirmed both aspects of the computational pipeline – [1] the ability of CellProfilerTM to identify nuclei accurately via segmentation and [2] the ability of my classifier to distinguish nuclei with foci. First, I applied segmentation-based methods and classification to count the number of nuclei and foci in 50 test images. I then manually counted nuclei and foci in the same images. For each method, I calculated the percent of nuclei within a population that contained a focus. This test revealed that computational analysis performed comparably to inspection by eye (Pearson correlation coefficient of 0.96), validating our approach (Figure 10). Together, this data confirms that I successfully established a robust image analysis pipeline for

Figure 10: Comparison of detection of DNA damage foci by computational image analysis and manual inspection.

Images were first examined by eye to determine the number of nuclei and foci. These same images were then analyzed computationally where nuclei were counted using segmentation- TM based methods (CellProfiler ) and nuclei with foci were counted using classification (CellProfiler AnalystTM and machine learning). The graph shows results from inspection of 50 mutants where the fraction of cells within the population that contained a focus was calculated. Plotting and computing a Pearson correlation coefficient compared the two methods.

rapid and systematic assessment of DNA damage foci in yeast. This signifies an enormous leap in throughput as compared to manual inspection performed by Alvaro et al., 2007.

2.8 Statistical parameters employed to eliminate bias as a result of cell sampling errors: Bootstrapping and binomial testing.

Published data from the study by Alvaro et al., 2007 reveals clear examples of phenotypic variation between replicates of certain mutants. For example, an elg1Δ hybrid diploid strain exhibited highly variable levels of spontaneous foci, ranging all the way from 8% in some cell populations to 41% in other cell populations (Figure 11A; elg1Δ portion). Similarly, several positive controls from this study of the deletion collection also revealed some variability. For example, the number of foci I observed in a rad51Δ strain varied from 13%-30% (Figure 11A; rad51Δ portion). It is possible that this variation is due to experimental error. For example, only one focal plane was captured for each cell; it is therefore possible that foci outside of the focal range were missed. It is also possible that the variability may reflect an innate property of spontaneous foci themselves that make them difficult to capture. For example, foci in wild type cells have very short duration times, lasting only 10 min on average and are present in only a small subset of the population (~7%). Most likely, however, the variability in spontaneous foci reflects a cell sampling bias that exists within the screen - that is, statistical insignificance as a result of low cell sampling numbers. To explore this idea further, I applied two basic statistical parameters: bootstrapping and binomial testing.

Bootstrapping by definition is random sampling with replacement of size n from the data to approximate samples of size n from the population (Johnson et al., 2001). I hypothesized that if varying cell counts were randomly sampled from an extremely large pool of RAD52-marked cells I would be able to determine the point at which the cell count number stopped changing the standard deviation (SD). For instance, if random samples of 50, 500, 5000, and 50,000 cells were taken from a population 100 times, I would expect that the cell counts of 50 would have a higher standard deviation than sampling cell counts of 500. However, if the SDs for 500, 5000, 50,000 cells are the same then I could reason that cell counts of >500 give statistically reliable results.

Figure 11: Calculation of ideal cell count number using bootstrapping techniques.

(A) A chart showing variation in foci levels within replicate cell populations in published data (elg1Δ; Alvaro et al., 2007) and data from this study (rad51Δ and xrs2Δ) (B) An ideal cell count number of 1000 cells was determined using bootstrapping techniques. Cells of varying sample sizes from 0 to 3000 were randomly sampled 100 times and the means (red line) and standard deviations (red bars) were calculated. Cell count numbers for low, medium and high accuracy measurements were estimated manually. Bootstrapping parameters: Pool of cells = 170 000, Sample size range = 1-3000 cells, Sample size interval = 10-50 cells, Random sampling = 100X with replacement.

To validate this idea, I imaged a rad51Δ strain (the mutant exhibiting variability among replicates) 384 times to generate a pool of cells totaling 170,000. In collaboration with Lee Zamparo, we applied bootstrapping methods (range: 1-3000 cells; sample number: 100 times; sample interval: 1-100 cells=10 cells, 101-3000=50 cells) and calculated the SD for each increment (Figure 11B). This mini-study was extremely informative as it allowed us to find cell count cutoffs that yielded low, medium and high accuracy results. The low category (<1000 cells) generally yields high SD (~5-8%) however the medium (1000 to 2500 cells) and high (>2500 cells) categories have relatively low variability (2% and 1%, respectively). We obtained similar results in tests of two other mutants, xrs2Δ and his3Δ (data not shown). We also found analogous cutoffs between three biological replicates of rad51Δ pools (data not shown). Based on this rigorous analysis, we have now modified our cell imaging protocol to include a target cell count of at least 1000 cells. So far, we have reached this goal in over 80% of strains that we have imaged (Table 1).

The binomial test is based on the binomial distribution and is represented by the following formula, where n is the total number of cells, i is the number of cells without foci and p is the probability that a cell will not contain a focus based on the average of the wild type: |x| n i n−i F(x;n, p) = ∑ ( i )p (1− p) i= 0 Importantly, this test not only compares mutants to wild type but can also generate p-values that account for the number of cells present. This means that even if 2 mutants have the exact same € percent foci, the mutant with the greater number of cells will have a more statistically significant p-value. For example, if one mutant exhibits 10 foci in 100 cells (10%) and another produces 100 foci in 1000 cells (10%), the binomial test reveals that the second case is more statistically significant (p-values equal 10-02 and 10-11, respectively, given a 5% wild type population).

To apply the binomial test to my research, I first assigned p-values to each biological replicate and then combined them using Fisher’s method, a technique developed by Ronald Fisher used to amalgamate results from multiple tests bearing the same overall hypothesis (Elston, 1991). By ordering based on Fisher score, I then ranked each mutant to discover which contained increased frequencies of DNA damage foci within a population.

Table 1: Summary of DNA damage foci screens performed in this study.

DNA damage foci were assessed in four main experiments covering 3 types of genetic backgrounds (single mutants, sgs1Δ double mutants, and yku80Δ double mutants), 1 type of chemical perturbation (phleomycin) and 2 different collections (non-essential deletion collection and essential ts collection). The number of ORFs, number of images, and number of cells (non-adjusted nuclei) assessed were calculated. In addition, in light of our previously calculated 1000 cell/mutant target cell count, the percent of mutants with greater than 1000 cells was calculated. For reference, numbers were compared to previously published work (Alvaro et al., 2007). αCovers 1541 alleles, *Numbers calculated for 37oC, **Includes additional 4 experimental replicates.

Ref. Markers Collection Sensitiz‐ Scoring No. No. No. No. % of screened ation Method Biol. ORF Images Cells mutants with Rep. > 1000 cells

This RAD52‐GFP Non‐ None Binomial 5 4309 107 520 13 942 94% study HTA2‐RFP essential + Fisher 731** can1pr:: RPL39pr‐RFP Essential None Binomial 2 α 30 720* 4 488 85% 501 + Fisher 658*

RAD52‐GFP Non‐ Phleo‐ Binomial 3 4309 64 512 10 336 92% HTA2‐RFP essential mycin + Fisher 543 can1pr:: RPL39pr‐RFP

Essential Phleo‐ Binomial 2 α 30 720* 4 179 82% 501 mycin + Fisher 191*

RAD52‐GFP Non‐ sgs1Δ Binomial 3 4309 69 888 6 864 58% HTA2‐RFP essential + Fisher 643 sgs1Δ:: RPL39pr‐RFP

Essential sgs1Δ Binomial 2 α 30 720* 4 470 82% 501 + Fisher 732*

RAD52‐GFP Non‐ yku80Δ Binomial 3 4309 86 736 9 678 81% HTA2‐RFP essential + Fisher 922 yku80Δ:: RPL39pr‐RFP

Essential yku80Δ Binomial 2 α 30 720* 4 149 82% 501 + Fisher 984*

Alvaro RAD52‐GFP Non‐ None Percentage 1 4818 n/a 1 143 0% et al., (plasmid) essential 008 2007

Together with our target cell count of 1000 cells per mutant and the employment of biological replicates, the implementation of the binomial test represents a significant improvement in statistical significance compared to previously published work (Alvaro et al., 2007) which sampled only 238 cells on average, employed only 1 biological replicate and ranked mutants based solely on percentages (Table 1).

2.9 Replicate screens in genetically and chemically sensitized backgrounds.

The pipeline described above was applied to screen yeast mutant arrays for DNA damage foci in a variety of different conditions (Table 1). In summary, I assessed DNA damage foci in four main experiments covering 3 types of genetic backgrounds (single mutants, sgs1Δ double mutants, and yku80Δ double mutants), 1 type of chemical perturbation (phleomycin) and 2 different arrayed yeast collections (non-essential deletion collection and essential ts collection). The total number of biological replicates, ORFs covered, images taken, and cells assessed are tabulated in Table 1 along with previously published work (Alvaro et al., 2007). Examination of double mutants in sgs1Δ and yku80Δ backgrounds was accomplished by integrating the RPL39pr-RFP-CaURA3 cassette into the SGS1 and YKU80 gene loci, respectively, instead of the CAN1 promoter region used in my single mutants.

Each type of genetic and chemical sensitization was selected for a variety of reasons. Phleomycin is a bulky glycopeptide analogous to the anti-tumour drug bleomycin, and specifically induces free-radical-mediated DNA damage leading to DSBs (Enserink et al., 2009). Treatment with phleomycin therefore provides the chance to observe mutants in the presence of increased exogenous DNA damage. Similarly, SGS1 encodes a DNA helicase involved in chromosome synapsis and DNA end resection and is a homolog of the disease-associated human BLM protein (Ashton and Hickson, 2010). Deletion of SGS1 thus offers an opportunity to observe DNA damage foci in mutants when the repair machinery is impaired. Finally, YKU80 is one of the defining members of NHEJ and is capable of binding DSB ends and recruiting ligation machinery (Daley et al., 2005). As NHEJ represents only a minor form of repair in yeast, only occurring during G1, I thought it would be interesting to systematically assess how HR via Rad52 is affected by impaired NHEJ.

2.10 Identification and correction of spatial and batch effects using the B-score.

Work from our group has shown that large-scale SGA screens are prone to false positives and negatives as a result of both spatial and batch effects (Baryshnikova et al., 2010). Furthermore, single cell assays tend to show higher variability compared to colony-based assays as there are not nearly as many cells contributing to the overall average (Krausz et al., 2007). To address these potential problems, I integrated an automated solution for correcting for negative effectors. The B-score, or ‘better-score’ is a method for spatial and batch effect corrections without knowing a priori what the effectors might be and is obtained by dividing the row and column residuals by the median absolute deviation (Malo et al., 2006). As a test of its merit, this score was recently applied to a screen with a previously identified plate effect (Figure 12A, B; Plate 5) implicating 71 likely false positives (no significant gene ontology enrichment and not reproducible in subsequent replicate screens). As shown in Figure 12C, 93% of these hits were successfully removed from the final hit list after applying a B-score correction (cutoff=3.5). Interestingly, this method performed better than other methods (binomial test using plate-specific wild-type values), which was only able to remove 79% of false positives (Figure 12C). These results indicate that the B-score is a useful tool and I have now included B-score correction in our imaging pipeline in order to apply it to our entire dataset in conjunction with our previously described binomial tests.

Figure 12: Strategy for eliminating false positives arising from a known plate effect.

(A) A plate effect was identified in plate 5 as revealed by heat map analysis (Grammar of Graphics plot package) of a single mutant screen of the deletion collection. (B) Quantification of (a) based on wild type averages for each plate. (C) Three scoring methods are compared based on the number of false positives remaining after correction.

2.11 Non-essential gene primary screens identify new genes involved in DNA damage and repair.

Our optimized and statistically robust pipeline was next applied to determine which mutants have elevated levels of DNA damage foci within our collection of non-essential gene deletion mutants. To do this, I ranked mutants using the binomial test and p-values between replicate screens were combined using Fisher’s method. Non-essential mutants with increased DNA damage foci were ranked by Fisher score and grouped according to gene ontology (GO) using OspreyTM and organized using CytoscapeTM (Figures 13-16). Overall, I was encouraged by the fact that all non-essential screens showed a statistically significant enrichment in genes annotated for roles in DNA metabolism, DNA repair, and response to DNA damage (GO Term Finder) (Figure 13-16; Table 2). In addition, at least half of the mutants detected in each screen were found to be sensitive to a variety of DNA damaging agents including MMS, HU, bleomycin and IR (Table 2). Moreover, preliminary assessment of single mutant hits in the context of genetic interaction data indicated that a large percentage of hits have genetic interaction profiles that are correlated (Pearson correlation coefficient > 0.2) with genes known to be involved in DNA damage, repair and replication (Table 2). Lastly, while the results of our screen of the non- essential gene deletion collection partially overlapped with the results reported in Alvaro et al. (2007) (Figure 17), a large majority of the mutants (~200) I identified had not been previously reported to have a foci phenotype. See Appendix B for a complete list of genes. Together, these results illustrate the power of my SGA-HCS platform for detecting novel players in DNA damage and repair processes.

Based on what I know about DNA damage foci, there are several categories of genes that I expected to detect as hits. First, mutants that cause more DNA damage would result in an increased number of DSBs and subsequent foci. The phenotype may reflect spontaneous forms of damage – increased nuclease activity, stalled or collapsed DNA replication forks, physical stress on chromosomes during anaphase, or damage arising from metabolically derived reactive oxygen species (Daley et al., 2005). Indeed, I detected a significant number of DNA replication genes in our screen including dpb4Δ, pol32Δ, elg1Δ, and rnh203Δ. Similarly, single mutants with elevated foci in the presence of phleomycin, an exogenous source of damage, included genes that likely play a role in protecting the cell against outside sources of damage caused by environmental contaminants such as drugs. Indeed, 28% of hits recovered in the phleomycin

Table 2: Summary of screen results for identifying mutants with increased foci.

A Fisher score cutoff was applied manually based on gene ontology (GO) enrichment. Each screen was tallied for the number of mutants exhibiting increased foci at its specified cutoff. Hits lists were examined for GO enrichment using GO Term Finder and p-values were calculated for each category. Hit lists were also compared to other published phenotypic datasets – mutants previously shown to have increased DNA damage foci (Alvaro et al., 2007) or growth sensitivity in the presence of DNA damaging agents [MMS (Chang et al., 2002; Begley et al., 2002; Hillenmeyer et al., 2008), HU (Hartman & Tippery, 2004; Woolstencroft et al., 2006; Parsons et al., 2004; Hillenmeyer et al., 2008), bleomycin (Aouida et al., 2002; Hillenmeyer et al., 2008), and IR (Bennett et al., 2001)]. A percentage was calculated based on the number of hits that overlapped with any 1 of these datasets. Lastly, genetic interaction profiles of single mutant hits were examined based on data from Costanzo et al., 2010. A percentage was calculated based on the number of hits that had genetic interaction profiles greater than 0.2 correlated with that of a known DNA damage, replication or repair gene.

Markers Collection Sensitiz‐ Fisher No. GO Enrichment Overlap : Overlap: ation Score Hits via GO Term Finder Published GI data Cutoff (GO category and P‐value) phenotypic data

RAD52‐GFP Non‐ None 65 82 ‐26 68% 56% DNA metabolism: 3.17 x 10 HTA2‐RFP essential ‐20 can1pr:: DNA repair: 8.87 x 10 ‐24 RPL39pr‐RFP Response to DNA damage: 1.77 x 10

Essential None 400 79 ‐09 ‐ ‐ DNA replication: 4.13 x 10 alleles =08 / 64 DNA metabolism: 7.26 x 10 ‐07 ORFs DNA repair: 5.04 x 10

RAD52‐GFP Non‐ Phleo‐ 80 110 ‐16 71% ‐ DNA repair: 8.55 x 10 HTA2‐RFP essential mycin ‐20 can1pr:: Response to DNA damage: 2.62 x 10 ‐09 RPL39pr‐RFP Vesicle‐mediated transport: 2.91 x 10

Essential Phleo‐ 1000 79 ‐04 ‐ ‐ Golgi vesicle transport: 9.90 x 10 mycin alleles / 71 ORFs

RAD52‐GFP Non‐ sgs1Δ 30 95 ‐23 68% ‐ DNA metabolism: 5.89 x 10 HTA2‐RFP essential ‐19 sgs1Δ:: DNA repair: 5.87 x 10 ‐19 RPL39pr‐RFP Response to DNA damage: 1.69 x 10

Essential sgs1Δ 350 80 ‐08 ‐ ‐ DNA metabolism: 4.78 x 10 alleles ‐06 / 67 DNA repair: 1.57 x 10 ‐08 ORFs DNA replication: 1.37 x 10

RAD52‐GFP Non‐ yku80Δ 50 90 ‐41 67% ‐ DNA metabolism: 9.87 x 10 HTA2‐RFP essential ‐30 yku80Δ:: DNA repair: 2.55 x 10 ‐34 RPL39pr‐RFP Response to DNA damage: 1.06 x 10 ‐13 Chromosome organization: 1.04 x 10

Essential yku80Δ 500 64 ‐07 ‐ ‐ DNA metabolism: 2.91 x 10 alleles ‐05 / 54 DNA repair: 4.42 x 10 ‐11 ORFs DNA replication: 6.30 x 10

Figure 13: Single mutants identified with high fractions of cells containing DNA damage foci.

Mutants were ranked using the binomial test and replicate p-values were combined using Fisher’s method. Mutants with a Fisher score greater than 65 were grouped according to gene ontology (GO) category using OspreyTM and organized using CytoscapeTM. Hits include 6 out of 7 non-essential members of the Rad52 epistasis group (RAD51, RAD54, RAD55, RAD57, RAD59, XRS2, MRE11). Hits are enriched for DNA metabolism (P=3.17 x 10-26), DNA repair (P=8.87 x 10-20) and response to DNA damage (P=1.77 x 10-24), among others, using GO Term Finder – refer to Appendices for complete list.

Figure 14: Single mutants identified with high fractions of cells containing DNA damage foci in the presence of 2.5 ng/µl phleomycin.

Mutants were ranked using the binomial test and replicate p-values were combined using Fisher’s method. Mutants with a Fisher score greater than 80 were grouped according to gene ontology (GO) category using OspreyTM and organized using CytoscapeTM. Hits include 6 out of 7 non-essential members of the Rad52 epistasis group (RAD51, RAD54, RAD55, RAD57, RAD59, XRS2, MRE11). Hits are enriched for DNA metabolism (P=1.69 x 10-15), DNA repair (P=8.55 x 10-16), vesicle-mediated trafficking (P=2.91 x 10-09) and response to DNA damage (P=2.62 x 10-20), among others, using GO Term Finder – refer to Appendices for complete list. Mutants highlighted in red are frequent flyers in Hillenmeyer et al., 2008.

Figure 15: Double mutants with sgs1Δ identified with high fractions of cells containing DNA damage foci.

Mutants were ranked using the binomial test and replicate p-values were combined using Fisher’s method. Mutants with a Fisher score greater than 30 were grouped according to gene ontology (GO) category using OspreyTM and organized using CytoscapeTM. Hits include 6 out of 7 non-essential members of the Rad52 epistasis group (RAD51, RAD54, RAD55, RAD57, RAD59, XRS2, MRE11). Hits are enriched for DNA metabolism (P=5.89 x 10-23), DNA repair (P=5.87 x 10-19) and response to DNA damage (P=1.69 x 10-19), among others, using GO Term Finder – refer to Appendices for complete list.

Figure 16: Double mutants with yku80Δ identified with high fractions of cells containing DNA damage foci. Mutants were ranked using the binomial test and replicate p-values were combined using Fisher’s method. Mutants with a Fisher score greater than 50 were grouped according to gene ontology (GO) category using OspreyTM and organized using CytoscapeTM. Hits include 7 out of 7 non-essential members of the Rad52 epistasis group (RAD51, RAD54, RAD55, RAD57, RAD59, XRS2, MRE11). Hits are enriched for DNA metabolism (P=9.87 x 10-41), DNA -30 -34 repair (P=2.55 x 10 ), response to DNA damage (P=1.06 x 10 ), chromosome organization (P= 1.04 x 10-13), among others, using GO Term Finder – refer to Appendices for complete list.

Figure 17: Hits from non-essential screens partially overlap with previously published data and reveal new mutants with increases in DNA damage foci.

(A) A Venn diagram illustrates the overlap between single mutant non-essential hits from this study and previously published data (Alvaro et al., 2007). (B) A Venn diagram illustrates the overlap between all non-essential hits from this study (single mutants, single mutants + phleomycin, sgs1Δ double mutants, yku80Δ double mutants) and previously published data (Alvaro et al., 2007).

40 screen were also found to be chemical hubs within the chemical genomic dataset produced by Hillenmeyer et al., 2008 – so-called multi-resistant genes, as indicated by the red nodes in Figure 14. A large number of these ‘chemical hubs’ were genes with annotated roles in vesicular trafficking and vacuolar function (Figure 14). As bleomycin, an analog of phleomycin, is taken into the cell via vesicle trafficking and sequestered to the vacuole (Aouida et al., 2004), these genes may play a role in drug clearing mechanisms within the cell.

A second category of genes that I might expect in our screens is those involved in repairing DSBs. These genes should include members of the Rad52 epistasis group which are directly involved in repairing damage, or genes with a more indirect role – for example genes encoding chromatin remodelers that may be involved in creating the appropriate DNA topology for efficient DNA repair (Osley et al., 2007). Indeed, mutants such as eaf1Δ, a component of the NuA4 histone acetyltransferase complex (Auger et al., 2008), were detected as having increased foci in our assessment of single mutants. Similarly, the yku80Δ double mutant screen actually showed enrichment for genes involved in chromosome organization (P=1.04 x 10-13, GO Term Finder) and included, among others, components associated with the INO80 complex (nhp10Δ, ies1Δ, ies2Δ, ies5Δ), COMPASS complex (swd3Δ, bre2Δ), chromatin assembly complex (cac2Δ, rlf2Δ), THO complex (tho1Δ, thp2Δ, mft1Δ), and histone deacetylase complexes (hda1Δ, hda3Δ, hst1Δ, hst3Δ, sir2Δ, sin3Δ, sap30Δ, hda1Δ, hda3).

In addition to the expected categories of genes, I also identified a large number of genes that had no appreciated link to DNA damage and repair. For example, deletion of YKL069W in the presence of phleomycin or yku80Δ gave increased levels of foci. As YKL069W encodes a reductase responsible for protecting cells against oxidative stress, this activity may be important in the regulation of the DNA damage response.

Similarly, as noted above, single mutants assessed in the presence of phleomycin were enriched for vesicle-mediated transport genes (P=2.91 x 10-09, GO Term Finder), a somewhat unexpected but highly intriguing biological connection that I also observe in our essential gene screens (see below). It is unanticipated because it is not clear how vesicle-mediated transport is connected to DNA damage, but it is interesting because genes associated with vesicle-mediated transport are highly pleiotropic on the genetic interaction network (Costanzo, et al., 2010). It would therefore be expected that hubs on the genetic interaction network would also be represented in our

screens because we know there is a strong correlation between genes that show a high degree of genetic interaction and those that show a high degree of chemical-genetic interaction (Costanzo et al., 2010). Thus, because vesicle-mediated transport genes are highly pleiotropic in the genetic interaction network, I would expect them to be highly represented in our screens. Interestingly, while some of these genes define chemical hubs and are presumably involved in multidrug resistance, many of them do not; this suggests that vesicular trafficking may be more highly linked to DNA repair processes than previously anticipated. This corroborates the idea put forth by Costanzo et al., 2010 that secretion and vesicular trafficking are genetic hubs that connect to many biological processes including DNA damage and repair processes. Continued exploration of this connection promises to be a fruitful avenue for follow up studies.

2.12 Essential gene primary screens identify new genes involved in DNA damage and repair.

The success of our screens of the non-essential gene deletion collection encouraged me to perform similar experiments with the ts collection assembled by our group (see Introduction). Like the non-essential gene mutant array, I assessed strains carrying ts alleles of essential genes both as single mutants and in sensitized (sgs1Δ, yku80Δ, phleomycin) backgrounds. All ts allele strains were screened at both permissive (incubation for 16 hours at 22oC; imaged 40 min at 30oC) and non-permissive temperatures (incubated 3 hours at 37oC; imaged 40 min at 37oC). Once again, mutants were ranked using the binomial test and Fisher’s method, grouped according to GO category using OspreyTM, and organized using CytoscapeTM (Figures 18-21).

Once again, I was encouraged to discover that, with the exception of ts mutants in the presence of phleomycin, my ‘hit-lists’ were strongly enriched for genes with known roles in DNA metabolism, DNA repair and the response to DNA damage (GO Term Finder) (Figure 18-21; summarized in Table 2). These genes include most essential DNA replication genes (mcm2-1, mcm3-1, mcm10-43, pol1-ts, pol2-ts, rfc4-20 and rfc5-1). In fact, all screens revealed a striking number of genes involved in transport – including a number of secretion proteins (Figures 18, 20 and 21). For instance, mutation of 6 out of 8 members of the exocyst complex (SEC5, SEC6, SEC8, SEC10, SEC15, EXO70) and 2 exocyst associating factors (SEC2, SEC4) all caused increased foci, forming a compelling case for follow-up studies.

Figure 18: Ts single mutants identified with high fractions of cells containing DNA damage foci.

Mutants were ranked using the binomial test and replicate p-values were combined using Fisher’s method. Mutants with a Fisher score greater than 400 were grouped according to TM TM gene ontology (GO) category using Osprey and organized using Cytoscape . Hits are enriched for DNA replication (P=4.13 x 10-09), DNA metabolism (P=7.26 x 10=08), DNA repair (P=5.04 x 10-07) and response to DNA damage (P=1.90 x 10-06), among others, using GO Term Finder – refer to Appendices for complete list.

Figure 19: Ts alleles identified with high fractions of cells containing DNA damage foci in the presence of 2.5 ng/µl phleomycin.

Mutants were ranked using the binomial test and replicate p-values were combined using Fisher’s method. Mutants with a Fisher score greater than 1000 were grouped according to gene ontology (GO) category using OspreyTM and organized using CytoscapeTM. Hits are enriched for Golgi vesicle transport (P=9.90 x 10-04), among others, using GO Term Finder – refer to Appendices for complete list.

Figure 20: Ts double mutants with sgs1Δ identified with high fractions of cells containing DNA damage foci.

Mutants were ranked using the binomial test and replicate p-values were combined using Fisher’s method. Mutants with a Fisher score greater than 350 were grouped according to gene ontology (GO) category using OspreyTM and organized using CytoscapeTM. Hits are enriched for DNA metabolism (P=4.78 x 10=08), DNA repair (P=1.57 x 10-06), response to -06 -08 DNA damage (P=5.83 x 10 ), and DNA replication (P=1.37 x 10 ), among others, using GO Term Finder – refer to Appendices for complete list.

Figure 21: Ts double mutants with yku80Δ identified with high fractions of cells containing DNA damage foci.

Mutants were ranked using the binomial test and replicate p-values were combined using Fisher’s Method. Mutants with a Fisher score greater than 500 were grouped according to gene ontology (GO) category using OspreyTM and organized using CytoscapeTM. Hits are enriched for DNA metabolism (P=2.91 x 10-07), DNA repair (P=4.42 x 10-05), response to DNA damage (P=1.20 x

10-04) and DNA replication (P=6.30 x 10-11), among others, using GO Term Finder – refer to Appendices for complete list.

2.13 High vs. low-resolution screening: Assessment of subcellular morphology phenotypes reveals new genes not detected by fitness screening alone.

By assaying DNA damage foci in mutant arrays, I aimed to increase the resolution of our assay beyond our previous work that looked at colony size (Costanzo et al., 2010) to the level of the single cell. In other words, I expected to detect subcellular morphology hits in my screens that would not have been detected by traditional assessments of fitness. For example, of the 180 genes reported by Vizeacoumar et al. (2010) to be implicated in spindle morphology, approximately 75% of the tested gene combinations had normal fitness when compared to known bin1Δ and bim1Δ SSL interactions (Costanzo et al., 2010). Similarly, assessment of our screens revealed that of the 162 hits detected in both essential and non-essential sgs1Δ screens, 117 (72%) did not have a significant fitness defect (SSL interaction data for yku80Δ are not yet available). This result further supports the notion that a true network of cellular pathways will be revealed by assessing not only fitness data but also by performing high-resolution screening of subcellular morphology phenotypes.

2.14 Sensitized backgrounds reveal new hits not detected in single mutant screens alone.

As discussed above, Vizeacoumar et al. (2010) reported twice as many mutants with aberrant spindles when sensitized backgrounds were screened. Given this result, I reasoned that I would discover more mutants with aberrant DNA damage foci by performing screens not only in single mutants but also in phleomycin or in sgs1Δ and yku80Δ backgrounds. Figure 22 illustrates the overlap between single mutant and sensitized screens for both non-essential and essential genes. Of 243 non-essential hits, 219 (roughly 90%) were detected in sensitized backgrounds. This result is particularly striking, as 161 of those hits, roughly 77%, would not have been detected in single mutant screens alone. For example, a gos1Δ mutant was a hit in both our sgs1Δ and phleomycin screens, but showed no foci phenotype as a single mutant. I made a similar observation in our essential gene screens – of 124 hits total, 122 (roughly 98%) were detected in sensitized backgrounds, 74 (roughly 60%) of which were not detected in the single mutant screen

47 alone. Together, these results emphasize the importance of using sensitized backgrounds to surmount the genetic redundancy in important biological pathways.

M" )*)+,--,)./01'2,),-'3)4(567' P+),4(".56%)62"" Q"974(/.><+)"$DDF&'

O' @' @' JF'

DO' DE' D' J' 61%>?@"" */5:4("" .56%)62"$EF&" K' O' J' BD'

@A' O' OO' P+),4("" &2&A@$ .56%)62"$L@&' "*/5:4("" .56%)62"$EO&"

N" ,--,)./01'2,),-'3)48(57' P+),4("62".56%)62"" Q"974(/.><+)"$KD&"

D' O' B' AB'

D' DJ' D' D' 61%>?@"" */5:4("" A' @O' D' O' 62".56%)62"$OA&"

DF" J' P+),4("" @' &2&A@$$ 62".56%)62"$JA&" */5:4(" "62".56%)62"$JK&"

Figure 22: The use of sensitized backgrounds expands the number of mutants implicated in!"#$%&'(( elevated!""!"#$%&#$'($&#)&*+,#-$./0123'%)-&$23#/456$#78/)-&$4"#$)%9.#3$'($9%4/)4&$*985*0/4#-$ levels of DNA damage foci. *)$#5#:/4#-$5#:#5&$'($;<=$-/9/2#$('0*#""$%&""'())"*+%,-%."/0")/)1(22()3%4",()(2"+44526-%6(2"67(" /8(-4%9":(6;(()"2+),4(".56%)62"%)*",()(3<=<7(.+<%44>"9(-65-:(*"2+),4(".56%)62#" "?56"/0"@AB" (A) Venn diagram of non-essential genes illustrates the overlap between single mutants and 7+62" 6/6%4C" @DE" $-/5,74>" EFG&" ;(-(" *(6(<6(*" +)" 2()2+3H(*" :%" KKG&" /0" genetic/chemically;7+<7";(-(")/6"*(6(<6(*"+)"67("2+),4(".56%)6"2<-(()"%4/)(#""$ perturbed single mutants. Out of: 243&"'())"*+%,-%."/0"(22()3%4",()(2" hits total, 219 (roughly 90%) were detecte+44526-%6(2"67("/8(-4%9":(6;(()"d in sensitized backgrounds,62".56%)62"%)*",()(3<=<7(.+<%44>"9(-65-:(*" 161 (roughly 77%) of which were62".56%)62#""?56"/0" not detected in the single mutantD@A"7+62"6/6%4C"D@@"$-/5,74>"ELG&";(-("*(6(<6(*"+)"2()2+3H(*":%"JFG&"/0" screen alone. (B) Venn diagram of essential genes illustrates the overlap between ts mutants;7+<7";(-(")/6"*(6(<6(*"+)"67("2+),4(".56%)6"2<-(()"%4/)(#" and genetic/chemically perturbed ts mutants. Out of 124 hits total, 122 (roughly 98%) were detected in sensitized backgrounds, 74 (roughly 60%) of which were not detected in the single mutant screen alone.

@@" 49

3.0 DISCUSSION

I describe here a novel strategy for identifying mutants with elevated levels of DNA damage foci within a budding yeast population. My ultimate goal was to expand our global knowledge of fitness-based genetic interactions by assessing high-resolution DNA damage foci phenotypes in a variety of genetic and environmental perturbations. My major challenge was to generate an automated pipeline that enabled accurate and systematic screening of tens of thousands of mutant strains for a cell biological phenotype. Previous studies have relied on manual inspection to score single mutants for increased levels of foci but were limited in their ability to score a wide variety of conditions and large populations of cells (Alvaro et al., 2007). This study expands the current list of mutants with DNA damage foci phenotypes by assessing single viable mutants in the presence of a DNA damaging agent, phleomycin, as well as in the absence of SGS1 and YKU80. Furthermore, essential genes were also examined through the employment of an arrayed collection of ts-alleles, representing the first global essential gene assessment of DNA damage foci phenotypes. While my work focused on loss-of-function mutants assayed under specific conditions, the flexible platform that I have developed is compatible with virtually any yeast collection, query of interest, or chemical treatment.

To create a screening protocol that was completely high-throughput, I used SGA technology to automate constructions of mutant arrays. I then coupled SGA with high-throughput microscopy and a validated image analysis solution to automate yeast cell biology. To put this automation in perspective, Alvaro et al. assessed ~1 million cells in their effort to survey the yeast deletion collection for mutants that affected DNA damage foci; in this study, I was able to observe over 50 million cells in a very short period of time in an automated fashion. This represents a huge statistical advantage as it greatly aids in eliminating false positives and negatives arising from sampling error as more cells can be imaged per mutant. Indeed, optimization tests showed that sampling at least 1000 cells gives percent-based foci calculations that have minimal variation (Figure 11; 2-3%). Excitingly, this goal was achieved in over 80% of all mutants screened. Our analysis has established general parameters that ought to be implemented in any comparable cell biological screen in yeast – our results provide yeast researchers with information about how many cells should be screened and the statistical parameters that should be implemented (e.g. binomial test and B-score).

Perhaps the major contribution this study has made to the field of DNA damage and repair was the identification of 367 genes that, when disrupted, lead to increased Rad52 DNA damage foci. Our method was validated by the fact that this set is highly enriched for DNA repair, DNA metabolism, DNA replication, and the response to DNA damage. Furthermore, in all screens of the non-essential gene deletion array, at least half of the mutants were found by other groups to be sensitive to DNA damaging agents (MMS, HU, bleomycin, IR). One striking observation was that hits from our study only partially overlapped with those reported in Alvaro et al. (Figure 17), suggesting that many genes with potential roles in DNA damage and repair remain to be characterized. This difference is perhaps not surprising as Alvaro et al. used a loss-of- heterozygosity assay to assess hybrid diploid strains whereas I used SGA to assay haploid strains. While it is still unclear how DNA repair might differ in haploids vs diploids (Tourrette et al., 2007), it is possible that the detection of 56 mutants in the loss-of-heterozygosity screen but not in our assay was a consequence of a diploid state. For example, this study did not detect any of the 18 so-termed ‘increased recombination frequency” or IRC proteins identified by Alvaro et al.; this could suggest that a major function of these genes is to coordinate repair under diploid circumstances. It also remains possible that secondary mutations that are unlinked to the kanMX-marked deletion allele actually impede the mutant phenotype. In other words, extragenic suppressors that arose during our screens of the deletion collection may mask a potential mutant phenotype. However, these specific cases can be assessed by confirmation of an independently constructed strain such as those present in the natMX-marked deletion set constructed as query genes for large-scale SGA analysis (also discussed below).

Interestingly, a large number of protein transport genes were unexpectedly detected in our screens. For example, phleomycin treatment of mutants deleted for non-essential genes involved in protein transport, or mutation of essential genes involved in secretion produced elevated levels of foci. Some phleomycin hits are chemical hubs and likely reflect drug-clearing mechanisms (Hillenmeyer et al., 2008), but most hits cannot be easily explained this way. Our data complement large-scale genetic interaction data that suggest significant links between vesicle trafficking and many bioprocesses (Costanzo et al., 2010). It is possible that my results reflect a relatively unappreciated yet direct role for vesicle trafficking in DNA damage and repair. For example, vesicular trafficking may play an important role in sequestering hazardous DNA damaging bio-products from the cell, such as reactive oxygen species. Alternatively, our results

51 may reflect links between cell growth, lipid metabolism and DNA damage as others have speculated that lipids in general represent a highly efficient means of cell signaling. For example, as cellular division elicits DNA damage both through DNA replication and the physical stresses of anaphase, an increase in nutrients may signal the production of relevant repair enzymes. The critical next step will be to elucidate the connecting points between implicated transport proteins and DNA damage.

Another exciting result of my thesis work was that genetic and chemical perturbations dramatically increased the number of mutants detected with elevated levels of DNA damage foci – over 60% of the mutants I discovered would not have been detected if I had screened only single mutants (Figure 22). Genetic redundancy is well established in yeast and other systems, and my results emphasize the importance of using SGA to rapidly create sensitized arrays when screening for genetic interactions or a mutant phenotype of interest. Perhaps more importantly, the use of specific genetic perturbations enables the formulation of specific mechanistic questions. For example, I screened the YKU80 deletion to provide information about HR and NHEJ repair pathways. Specifically, as NHEJ is considered a minor player in yeast, it was of particular interest to see how impairment of this pathway impacted HR. Interestingly our YKU80 mutant screens identified genes encoding chromatin remodelers; this result was intriguing as other evidence supports the idea that chromatin remodeling is important for NHEJ (reviewed by Daley et al., 2005). For example, Sin3, a histone deacetylase picked up in my screen is known to be required for efficient NHEJ (Jazayeri et al., 2004). Together, this emphasizes the usefulness of double mutants for providing insight into poorly understood cellular mechanisms.

While I identified many mutants with increased levels of foci, no study to date has yet been able to identify mutant strains with decreased levels of foci. This may be essentially a statistical problem – the number of foci in wild type cells is quite low (7% reported in this study), so detecting reduced levels of foci may be challenging. It may be useful to screen for mutants with reduced foci by manipulating the starting conditions for the screen such that wild type cells have more foci (e.g. phleomycin treatment). Indeed, phleomycin-treated wild type cells had 12-13% foci on average. Interestingly, the mutants with the lowest number of foci in the phleomycin- treated single mutant screen from this study had tantalizing links to chromatin remodeling, including Isw2, an ATP-dependent DNA translocase, and Acs1, an acetyl-coA synthetase that provides the nuclear source of acetyl-coA for histone acetylation (Tsukiyama et al., 1999;

Takahashi et al., 2006). As chromatin architecture is known to play an important role in both DNA lesion recognition and recruitment of repair proteins (reviewed by Osley et al., 2007), these genes are excellent candidates for future follow-up studies.

Another advantage of our image analysis strategy is that the pipeline can be easily adapted to mine existing datasets for more complex DNA damage foci phenotypes. For example, Lisby et al. (2003) reported that most DNA damage foci are present during S-phase. It may be useful to take advantage of the cytoplasmic marker included in our screens, RPL39pr-RFP, to develop classifiers capable of using bud morphology to identify cells at specific cell cycle stages. Alternatively, I could enrich for cells with foci at specific cell cycle stages by treating cells with HU, a chemical agent capable of arresting cells in S-phase. As foci have not yet been globally assessed in the context of the cell cycle, these studies would constitute a powerful next step for identifying key regulators of DNA focus formation.

One of the limitations of this study is our lack of a secondary assay to confirm the increased foci phenotype. Indeed, some hits detected in our assay may be false positives due to second-site mutations (Alvaro et al., 2006). We will use two distinct approaches to address this possibility. First, complementation assays will be performed using CEN-based plasmids carrying the gene of interest under the control of its endogenous promoter (Ho et al., 2009). Upon transformation into deletion mutants, a restoration of foci levels back to wild type would confirm that the focus phenotype is due to the deleted gene. The high-foci phenotype of gos1Δ mutants in the presence of phleomycin has already been confirmed using this assay (data not shown). Alternatively, non- essential gene deletion mutants with elevated foci levels can be confirmed by assaying the phenotype in an independent deletion collection constructed by our group, marked with natMX (Costanzo et al, 2010).

Lastly, the hit lists that I have produced are based on somewhat arbitrary thresholds for each of the 8 different types of screens (Table 2). While methods for systematically establishing cutoffs have been debated, our group has used precision curves to establish cutoffs based on gold standards (Costanzo et al., 2010). Precision is the fraction of true hits in the set of all identified hits (Fawcett, 2006). For our study, a gold standard can be constructed based on genes with either a DNA damage-related GO function, sensitivity to a DNA damaging agent, or high genetic interaction correlation with a gene known to be involved in DNA damage and repair. Using this

53 approach, one precision cutoff can be applied to all screens making this study truly systematic.

In summary, over the course of my MSc work I have implemented an SGA-HCS protocol for the systematic assessment of DNA damage pathways in budding yeast. By harnessing, refining, and improving this pipeline, my investigations have provided a powerful way of linking subcellular morphology phenotypes with DNA damage and repair. This long-term resource of mutant phenotypes will contribute substantially to our overall understanding of the highly conserved pathways of DNA damage and repair and provide the essential framework for which more complex systems, such as human disease, can be studied. After all, a picture is worth a thousand words.

4.0 MATERIALS AND METHODS

4.1 Yeast strains used in this study

Yeast strains used in this study are summarized in Table 3.

4.2 Tagging genes with fluorescent proteins via PCR mutagenesis

Two gene fusions (RAD52-GFP-HIS3 and HTA2-RFP-natMX) were created in the BY4741 background using polymerase chain reaction (PCR)-directed mutagenesis. natMX is an antibiotic resistance marker that provides resistance to nourseothricin (NAT). HIS3 is an auxotrophic marker that allows for growth in the absence of histidine. Primers were designed to include 45-60 base pairs of sequence homologous to upstream (excluding the stop codon) and downstream regions of RAD52 and HTA2 as well as common primer sequences to plasmids containing GFP-HIS3 (modified from Longtine et al., 1998) or RFP-natMX (modified from Sheff & Thorn, 2004) (Table 4). RPL39pr-RFP-CaURA3 was PCR amplified from genomic DNA (courtesy of Yolanda T. Chong, University of Toronto). CaURA3 is an auxotrophic marker from Candida albicans that allows for growth in the absence of uracil. Subsequent PCR products were transformed into SGA-compatible BY4741 strains (MATα his3Δ1 leu2Δ0 ura3Δ0 MET15 can1Δ::STE2pr-LEU2 lyp1Δ) using lithium acetate and polyethylene glycol-based transformations (Gietz and Schiestl, 2007). Integrations were confirmed using upstream and downstream primers flanking the integration site.

4.3 Liquid growth curve analysis

Liquid growth curve analysis was performed to compare the fitness of RAD52-GFP to RAD52 in rich media. Yeast cultures were grown to saturation overnight in YEPD, diluted 1000-fold, and then grown at 30oC until an optical density of 0.0625 was reached. 100 µl of each sample was then transferred to a CellStarTM 96-well plate and covered with an optically clear adhesive lid. Optical density was measured at 600 nm in a TECANTM plate reader every 15 min for 48 h.

Table 3: List of yeast strains used in this study.

STRAIN BACKGROUND COLLECTION GENOTYPE REFERENCE

BY4741 - MATα his3Δ1 leu2Δ0 ura3Δ0 MET15 This study can1Δ::STE2pr-LEU2 lyp1Δ RAD52-GFP-HIS3 HTA2-RFP-NATMX can1pr::RPL39pr-RFP-CaURA3 BY4741 - MATα his3Δ1 leu2Δ0 ura3Δ0 MET15 This study can1Δ::STE2pr-LEU2 lyp1Δ RAD52-GFP-HIS3 HTA2-RFP-NATMX sgs1Δ::RPL39pr-RFP-CaURA3

BY4741 - MATα his3Δ1 leu2Δ0 ura3Δ0 MET15 This study can1Δ::STE2pr-LEU2 lyp1Δ RAD52-GFP-HIS3 HTA2-RFP-NATMX yku80Δ::RPL39pr-RFP-CaURA3

BY4741 Yeast deletion MATa his3Δ1 leu2Δ0 ura3Δ0 Giaever et al., 2002 collection met15Δ0 xxxΔ::KANMX

BY4741 Yeast ts MATa his3Δ1 leu2Δ0 ura3Δ0 Li et al., submitted collection met15Δ0 xxx-ts::KANMX

Table 4: Primers used in this study for C-terminally tagging RAD52 and HTA2 at endogenous loci.

PRIMER NAME PRIMER SEQUENCE INTEGRATION PLASMID SITE

F_RAD52-GFP- TCGACACGAAGAGAAGTTGGAAGACC RAD52 pGFP-HIS3 HIS3 AAAGATCAATCCCCTGCATGCACGCA C-terminus (modified from AGCCTACTGGTGAAGCTCAAAAACTTAAT Longtine et al., 1998) R_RAD52-GFP- AGAATTTTTTATTCGATTTAAAGTAAAT RAD52 pGFP-HIS3 HIS3 ATTAATACGACACATGGAGGAAAGAAAA C-terminus (modified from ACTAGCTGACGGTATCGATAAGCTT Longtine et al., 1998)

F_HTA2-RFP- TTGCCAAAGAAGTCTGCCAAGACTGCC HTA2 pRFP-NATMX NATMX AAAGCTTCTCAAGAACTGGGTGACGGT C-terminus (Sheff & Thorn, GCTGGTTTAATTAACATG 2004)

R_HTA2-RFP- ACAAGAATGTTTGATTTGCTTTGTTTCTT HTA2 RFP-NATMX NATMX TTCAACTCAGTTCTTACTAGTGGATCTG C-terminus (Sheff & Thorn, ATATCATCGATGAATTCG 2004)

4.4 Yeast serial spot dilutions

A serial spot dilution assay was used to compare the growth of RAD52-GFP to RAD52 and rad52Δ in the presence of hydroxyurea. Yeast cultures were grown to saturation overnight and then diluted 10-fold five times by hand. 5 µl of the dilutions were plated on synthetic complete (SC) media and SC media containing 100 mM hydroxyurea and grown at 30oC for 2 and 3 days respectively.

4.5 Synthetic genetic array strategy for introducing reporters into essential ts and non-essential yeast collections

SGA query strains were marked with natMX, HIS3, and CaURA3 as well as a MATa-specific promoter driving LEU2. natMX is an antibiotic resistance marker that confers resistance to nourseothricin (N). HIS3, CaURA3 and LEU2 are auxotrophic markers that allow for growth in the absence of histidine (H), uracil (U), and leucine (L), respectively. Queries were crossed to a kanMX-marked collection of non-essential mutants and a kanMX-marked collection of ts essential collection. kanMX is an antibiotic resistance marker that confers resistance to G418 (G). Mating, diploid selection, sporulation and haploid selections were carried out in 384-format using robotic replica pinning steps on a Virtek Colony Arrayer (Biorad Laboratories). Haploid strains with the mating type a were selected for by excluding leucine from the medium. The deletion of CAN1 and LYP1 confer resistance to the drugs canavanine (C) and S-aminoethyl-L- cysteine (S), respectively, and prevent selection of rare mitotic recombination events that result in MATa/a cells. Otherwise as previously described (Tong et al., 2001), SGA was performed by sequential pinning of arrays onto the following selective media: 1X mating on YEPD, 1X diploid selection on SD –HU +NG, 1X on sporulation media, 1X haploid selection on SD –LRK +CS, 1X partial selection on SD –LRK +CSG, and 1X final selection on SD –HULRK +CSGN.

4.6 Determining the mating type of yeast strains using standard halo test

Mating type tests were performed on single colonies streaked from SGA output arrays to verify the integrity of the SGA pipeline. Singles colonies were grown on YEPD medium overlaid with 1% low-melting point agarose containing either MATa bar1Δ or MATα sst2Δ mutant strains. Strains were allowed to grow for 1 day at 30oC. Colonies could be identified as MATa or MATα based on the presence or absence of a pheromone-induced halo of G1 arrested cells that fail to grow and form a lawn. Colonies that formed a halo on sstΔ lawns were considered to be MATa and colonies that formed a halo on bar1Δ lawns were considered to be MATα.

4.7 High-throughput imaging using Evotec OperaTM

High-throughput preparation of yeast cells for imaging: Cells were transferred from 384- format SGA final selection plates into four 96-well plates containing liquid synthetic media. Transfers were done manually using 96-format pin pads and plates were covered with breathable adhesive lids. Cells were grown to saturation overnight. Two 1:25 dilutions were then made in low fluorescent media using the Zymark RapidPlateTM liquid handler (courtesy of Dr. Jason Moffat, University of Toronto). Cells were grown for approximately 16 hours. 100 microlitres of subculture were then transferred to Greiner 96-well OD plates using the RapidPlateTM and the average optical density was measured per plate using a spectrophotometer. Based on the average concentration of cells per plate, specific volumes were transferred to an Evotec 384-well Cell Carrier glass slide using the RapidPlateTM. Liquid synthetic media (SD +M +NG) and low fluorescent media (LFD +M +NG) contained only essential amino acids (methionine) and nourseothricin and G418 antibiotic drug selection. Low fluorescent media contains yeast nitrogen base that has been cleared of light-reactive compounds such as riboflavin and folic acid. All non-essential mutants were grown at 30oC and all essential ts-mutants were grown at 22oC.

High-throughput microscopy of yeast cells: The Evotec OperaTM from PerkinElmer is a highly automated spinning disk confocal microscope used to visualize DNA damage foci (RAD52-GFP), nuclei (HTA2-RFP) and cytoplasm (RPL39pr-RFP) within each cell. Green fluorescent proteins were detected using 488 nm laser excitation and 520/35 nm emission filters.

Red fluorescent proteins were detected using 561 nm laser excitation and 600/40 nm emission filters. Non-fixed yeast cells tend to move between separate exposures therefore red and green fluorescent proteins were simultaneously imaged using 568 nm detection dichroics and a 405/488/561/640 nm primary dichroic. Optimal signal was achieved using 800 ms exposure times using the 60X objective (water immersion, NA=1.2) and Evotec 384-format Cell Carrier plates. Laser-based autofocusing was used to image 1 z-axis plane per field. 4-8 sites or fields in a well were imaged for each mutant strain and green and red channel images for each mutant were stored as proprietary multi-page 16-bit TIFF files called FLEX files.

Phleomycin treatment of yeast cells: Following imaging of untreated cells, phleomycin (Sigma P 9564, 11006-33-0) was added directly to the 384-format class slide using the RapidPlateTM to yield a final concentration of 2.5 ng/µl. Plates were wrapped in tin foil to avoid deactivating the light-sensitive phleomycin, incubated for 3 hours at 22oC and then re-imaged.

Heat shock of temperature-sensitive mutants: Following imaging of ts alleles at permissive temperature, imaging slides were incubated for 3 hours at 37oC and then re-imaged.

4.8 Image analysis pipeline from CellProfilerTM

CellProfilerTM was used to detect cells and nuclei in yeast confocal images using segmentation- based approaches. Intensity, texture and morphological measurements were extracted from each identified object. CellProfilerTM can be downloaded from http://www.cellprofiler.org/. Version 1.0.5811 was used in this study. A pipeline was constructed from pre-existing modules as shown in Appendix A.

4.9 Classification of DNA damage foci

Classification was used to detect DNA damage foci in cellular objects identified and measured using CellProfilerTM image analysis software. A training set was constructed using CellProfiler AnalystTM and consisted of ~1000 cells containing at least one DNA damage focus (positive bin) and ~1000 cells that did not contain a DNA damage focus (negative bin). A Wilcoxon ranksum test was used to select only features that were informative for distinguishing the positive and

negative bins. Support vector machine (SVM) (libSVM package and libSVM interface to MATLAB) were constructed using a routine SVM training model, called svmtrain. This allows the user to specify what type of kernel is used, as well as other options affecting convergence of the objective function. A linear kernel for training was used in this study. Reiterations of training was performed on 1/5th of the training set and a receiver operating characteristic (ROC) curve was generated by calculating a false positive rate (TP/[TP+FP]) and a true positive rate or recall (TP/[TP+FN). Following training, the classifier was used to make predictions for all identified cells within the screen.

4.10 Applying bootstrapping principles to determine ideal cell counts

To estimate the behavior of the mean and variance of a sample as a function of the number of cells we performed a sampling experiment using the R software package. We sampled from three populations of yeast cells, deficient for the genes HIS3, XRS2 and RAD51 respectively. We sampled smaller sizes from 10 cells to 100 cells in increments of 10. We also sampled larger sizes, from 150 cells to 3000 cells in increments of 50. For each of the sample sizes and each of the three strains, we sampled with replacement from the whole population 100 times for each of the three genes. We then calculated the mean and standard deviation for each of the 100 samples and plotted the results as a bar graph.

4.11 Applying B-Scores to DNA damage foci data

The B-score is analogous to the well-known Z-score as it is centered at zero and has unit measure of deviation, but it is advantageous in the fact that it is nonparametric, minimizes measurement bias due to positional effects, and is resistant to statistical outliers. Since the B- score uses the median absolute deviation rather than the standard deviation, it is less affected by outliers of extreme values. To normalize the results from our screen, we used response values (ratio of nuclei with foci to total nuclei) to fit an additive model (2-way median polish, developed by John Tukey) of four components: the plate wide effect, one row and one column effect, and an error term. The difference between the measured response and modeled response

61 are called the residuals, and the residuals divided by the median absolute deviation of all residuals for a plate is called the B-score, which is the normalized value used in further analysis.

rijp Bscore = MADp ˆ ˆ rijp = yijp − (uˆ + Rip + C jp )

MADp = median{| rijp − median(rijp ) |} where : th rijp = residual measurement for row i and column j on the p plate

yijp = observed ratio of nuclei with foci to total nuclei uˆ = estimated plate average ˆ Rip = estimated row offset ˆ C jp = estimated column offset

€

5.0 REFERENCES

Altmann, K. and Westermann, B. (2005). “Role of essential genes in mitochondrial morphogenesis in Saccharomyces cerevisiae.” Molecular Biology of the Cell. 16. 5410-5417.

Altmannova, V., Eckert-Boulet, N., Arneric, M., Kolesar, P., Chaloupkova, R., Damborsky, J., Sung, P., Zhao, X., Lisby, M., Krejci1, L. (2010). “RAD52 SUMOylation affects the efficiency of the DNA repair.” Nucleic Acids Research. 38. 4708-21

Alvaro, D., Sunjevaric, I., Reid, R.J.D., Lisby, M., Stillman, D.J., Rothstein, R. (2006). “Systematic hybrid LOH: a new method to reduce false positives and negatives during screening of yeast gene deletion libraries.” Yeast. 23. 1097-1106.

Alvaro, D., Lisby, M., Rothstein R. (2007). “Genome-wide analysis of Rad52 foci reveals diverse mechanisms impacting recombination.” PLoS Genetics. 3. 2439-2449.

Aouida, M., Leduc, A., Wang, H., Ramotar, D. (2004). “Characterization of a transport and detoxification pathway for the antitumour drug bleomycin in Saccharomyces cerevisiae.” Biochemistry. 384. 47-58

Aouida, M., Page, N., Leduc, A., Peter, M., and Ramotar, D. (2004). “A genome‐wide screen in Saccharomyces cerevisiae reveals altered transport as a mechanism of resistance to the anticancer drug bleomycin.” Cancer Research. 64. 1102–1109.

Ashton, T.M., Hickson, I.D. (2010). “Yeast as a model system to study RecQ helicase function.” DNA repair. 9. 303-314.

Askree, S.H., Yehuda, T., Smolikov, S., Gurevich, R., Hawk, J., Coker, C., Krauskopf, A., Kupiec, M., McEachern., M.J. (2004). “A genome-wide screen for Saccharomyces cerevisiae deletion mutants that affect telomere length.” PNAS. 101. 8658-8663.

Auger A.A., Galarneau, L., Altaf, M., Nourani, A., Doyon, Y., Utley, R.T., Cronier, D., Allard, S., and Cote, J. (2008). “Eaf1 is the platform for NuA4 molecular assembly that evolutionarily links chromatin acetylation to ATP-dependent exchange of histone H2A variants.” Molecular and Cellular Biology. 28. 2257-2270.

Barlow, J.H., Rothstein, R. (2010). “Timing is everything: cell cycle control of Rad52.” Cell Division. 5. 7-14.

Baryshnikova, A., Costanzo, M., Dixon, S., Vizeacoumar, F.J., Myers, C.L., Andrews, B. and Boone, C. (2010). “Synthetic genetic array (SGA) analysis in Saccharomyces cerevisiae and Schizosaccharomyces pombe.” Methods in Enzymology. 470. 145-179.

Begley, T.J., Rosenbach, A.S., Ideker, T., and Samson, L.D. (2002). “Damage recovery pathways in Saccharomyces cerevisiae revealed by genomic phenotyping and interactome mapping. Molecular Cancer Research. 1. 103–112.

Ben-Aroya, S., Coombes, C., Kwok, T., O’Donnell, K.A., Boeke, J.D., Hieter, P. (2008). “Toward a comprehensive temperature-sensitive mutant repository of the essential genes of Saccharomyces cerevisiae.” Molecular Cell. 30. 248-258.

Bennett, C.B., Lewis, L.K., Karthikeyan, G., Lobachev, K.S., Jin, Y.H., Sterling, J.F., Snipe, J.R., and Resnick, M.A. (2001). “Genes required for ionizing radiation resistance in yeast.” Nature Genetics. 29. 426–434.

Boone, C., Bussey, H., Andrews, B.J. (2007). “Exploring genetic interactions and networks with yeast.” Nature Reviews: Genetics. 8. 437-449.

Botstein, D., Chervitz, S.A., Cherry, J.M. (1997). “Yeast as a Model Organism.” Science. 277. 1259-1260.

Carpenter, A.E., Jones, T.R., Lamprecht, M.R., Clarke, C., Kang, I.H., Friman, O., Guertin, D.A., Chang, J.H, Lindquist, R.A, Moffat, J., Golland, P. and Sabatini, D.M. (2006). “CellProfiler: image analysis software for identifying and quantifying cell phenotypes.” Genome Biology. 7. R100-111.

Chakshusmathi, G., Mondal, K., Lakshmi, G.S., Singh, G., Roy, A., Babu, Ch R., Madhusudhanan, S., and Varadarajan, R. (2004). “Design of temperature-sensitive mutants solely from amino acid sequence.” PNAS. 101. 7925-7930.

Chang, M., Bellaoui, M., Boone, C., and Brown, G.W. (2002). “A genome‐wide screen for methyl methanesulfonate‐sensitive mutants reveals genes required for S phase progression in the presence of DNA damage.” PNAS. USA 99, 16934–16939.

Chang, M., Parsons, A.B., Sheikh, B.H., Boone, C., Brown, G.W. (2006). “Genomic approaches for identifying DNA damage response pathways in S. cerevisiae.” Methods in Enzymology. 409. 213-235

Chen, S-C. & Murphy, R.F. (2006). “A graphical model approach to automated classification of protein subcellular location patterns in multi-cell images.” BMC Bioinformatics. 7. 90-103.

Costanzo, M., Giaever, G., Nislow, C., Andrews, B. (2006). “Experimental approaches to identify genetic networks.” Current Opinion in Biotechnology. 17. 472-480.

Costanzo, M., Baryshnikova, A., Bellay, J., Kim, Y., Spear, E.D., Sevier, C.S., Ding, H., Koh, J.L., Toufighi, K., Mostafavi, S., Prinz, J., St Onge, R.P., VanderSluis, B., Makhnevych, T., Vizeacoumar, F.J., Alizadeh, S., Bahr, S., Brost, R.L., Chen, Y., Cokol, M., Deshpande, R., Li, Z., Lin, Z.Y., Liang, W., Marback, M., Paw, J., San Luis, B.J., Shuteriqi, E., Tong, A.H., van Dyk, N., Wallace, I.M., Whitney, J.A., Weirauch, M.T., Zhong, G., Zhu, H., Houry, W.A., Brudno, M., Ragibizadeh, S., Papp, B., Pal, C., Roth, F.P., Giaever, G., Nislow, C., Troyanskaya, O.G., Bussey, H., Bader, G.D., Gingras, A.C., Morris, Q.D., Kim, P.M., Kaiser, C.A., Myers, C.L., Andrews, B.J., and Boone, C. (2010). “The genetic landscape of a cell.” Science. 327. 425-431.

Daley, J.M., Palmbos, P.L., Wu, D., Wilson, T.E. (2005). “Nonhomologous end joining in yeast.” Annual Review of Genetics. 39. 431-451.

Dimmer, K.S., Fritz, S., Fuchs, F., Messerschmitt, M., Weinbach, N., Neupert, W., Westermann, B. (2002). “Genetic basis of mitochondrial function and morphology in Saccharomyces cerevisiae.” Molecular Biology of the Cell. 13. 847-853.

Elston, R.C. (1991). “On Fisher’s method of combining p-values.” Biometrical Journal. 33. 339-345.

Enserink, J.M., Hombauer, H., Huang, M-R., Kolodner, R.D. (2009). “Cdc28/Cdk1 positively and negatively affects genome stability in S. cerevisiae.” Journal of Cell Biology. 185. 423-437.

Fawcett, T. (2006). “An introduction to ROC analysis.” Pattern Recognition Letters. 27. 861- 874.

Fröhlich, F., Moreira, K., Aguilar, P.S., Hubner, N.C., Mann, M., Walter, P., Walther, T.C. (2009). “A genome-wide screen for genes affection eisosomes reveals Nce102 funciton in sphingolipid signaling.” Journal of Cell Biology. 185. 1227-1242.

Giaever, G., Chu, A.M., Ni, L., Connelly, C., Riles, L., Veronneau, S., Dow, S., Lucau-Danila, A., Anderson, K., Andre, B., Arkin, A.P., Astromoff, A., El-Bakkoury, M., Bangham, R., Benito, R., Brachat, S., Campanaro, S., Curtiss, M., Davis, K., Deutschbauer, A., Entian, K.D., Flaherty, P., Foury, F., Garfinkel, D.J., Gerstein, M., Gotte, D., Guldener, U., Hegemann, J.H., Hempel, S., Herman, Z., Jaramillo, D.F., Kelly, D.E., Kelly, S.L., Kotter, P., LaBonte, D., Lamb, D.C., Lan, N., Liang, H., Liao, H., Liu, L., Luo, C., Lussier, M., Mao, R., Menard, P., Ooi, S.L., Revuelta, J.L., Roberts, C.J., Rose, M., Ross-Macdonald, P., Scherens, B., Schimmack, G., Shafer, B., Shoemaker, D.D., Sookhai-Mahadeo, S., Storms, R.K., Strathern, J.N., Valle, G., Voet, M., Volckaert, G., Wang, C.Y., Ward, T.R., Wilhelmy, J., Winzeler, E.A., Yang, Y., Yen, G., Youngman, E., Yu, K., Bussey, H., Boeke, J.D., Snyder, M., Philippsen, P., Davis, R.W., and Johnston, M. (2002). “Functional profiling of the Saccharomyces cerevisiae genome.” Science. 418. 387-391.

Gietz, R.D., Schiestl, R.H. (2007). “Quick and easy yeast transformation using the LiAc/SS carrier DNA/PEG method.” Nature Protocols. 2. 35-37.

Giuliano, K.A., DeBiasio, R.L., Dunlay, R.T., Gough, A. Volosky, J.M., Zock, J., Pavlakis, G.N., Taylor, D.L. (1997). “High-content screening: A new approach to easing key bottlenecks in the drug discovery process.”

Goffeau, A., Barrell, B.G., Bussey, H., Davis, R.W., Dujon, B., Feldmann, H., Galibert, F., Hoheisel, J.D., Jacq, C., Johnston, M., Louis, E.J., Mewes, H.W., Murakami, Y., Philippsen, P., Tettelin, H., Oliver, S.G. (1996) “Life with 6000 genes.” Science. 274. 546

Hartman, J.L. & Tippery, N.P. (2004). “Systematic quantification of gene interactions by phenotypic array analysis.” Genome Biology. 5. R49.1-49.18.

Hillenmeyer, M.E., Fung, E., Wildenhain, J., Pierce, S.E., Hoon S., Lee, W., Proctor, M., St.Onge, R.P., Tyers, M., Koller, D., Altman, R.B., Davis, R.W., Nislow, C., Giaever, G. (2008). “The chemical genomic portrait of yeast: uncovering a phenotype for all genes.” Science. 320. 362-365.

Ho, C.H., Magtanong, L., Barker, S.L, Gresham, D., Nishimura, S., Natarajan, P., Koh, J.L.Y., Porter, J., Gray, C.A., Andersen, R.J., Giaever, G., Nislow, C., Andrews, B.J., Botstein, D., Graham, T.R., Yoshida, M., Boone, C. (2009) “Molecular barcoded yeast ORF library enables mode-of-action analysis of bioactive compounds.” Nature Biotechnology. 27. 369-377.

Huh, W-K., Falvo, J.V., Gerke, L.C., Carroll, A.S., Howson, R.W., Weissman, J.S., O’Shea, E.K. (2003). “Global analysis of protein localization in budding yeast.” Nature. 425. 686-691.

Jazayeri, A., McAinsh, A.D., Jackson, S.P. (2004). “Saccharomyces cerevisiae Sin3p facilitates DNA double-strand break repair.” PNAS. USA 101. 1644–1649.

Johnston, R.W. (2001). “An introduction to the bootstrap.” Teaching statistics. 23. 49-54.

Kanemaki, M., Sanchez-Diaz, A., Gambus, A., Labib, K. (2003) “Functional proteomic identification of replication proteins by induced proteolysis in vivo.” Nature. 423. 720-724.

Krausz, E. (2007) “High-content siRNA screening.” Molecular BioSystems. 3. 232-240.

Li, Z., Vizeacoumar, F.J., Bahr, S., Li J., Warringer, J., Vizeacoumar, F.S., VanderSluis, B., Bellay, J., DeVit, M., Fleming, J.A., Stephens, A., Haase, J., Lin, Z-Y., Baryshnikova, A., Min, R., Lu, H., Yan, Z., Jin, K., Barker, S., Datti, A., Giaever, G., Nislow, C., Bulawa, C., Costanzo, M., Myers, C.L., Gingras, A-C., Zhang, Z., Blomberg, A., Bloom, K., Andrews, B.J., Boone, C. (2010). “Systematic exploration of essential yeast gene function with temperature-sensitive mutants.” Submitted to Nature Biotechnology.

Lisby, M., Rothstein, R., Mortensen, U.H. (2001). “Rad52 forms DNA repair and recombination centers during S phase.” PNAS. 98. 8276-8282.

Lisby, M., Mortensen, U.H., Rothstein, R. (2003). “Co-localization of multipe DNA double- strand breaks at a single Rad52 repair centre.” Nature Cell Biology. 5. 572-577.

Lisby, M. & Rothstein, R. (2009). “Choreography of recombination proteins during the DNA damage response.” DNA Repair. 8. 1068-1076.

Longtine, M.S., McKenzie, A., Demarini, D.J., Shah, N.G., Wach, A., Brachat, A., Philippsen, P., Pringle, J.R. (1998). “Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae.” Yeast. 4. 953-961.

Malo, N., Hanley, J.A., Cerquozzi, S., Pelletier, J., Nadon, R. (2006). “Statistical practice in high-throughput screening data analysis.” Nature Biotechnology. 24. 167-175.

Mnaimneh, S., Davierwala, A.P., Haynes, J., Moffat, J., Peng, W-T., Zhang, W. Yang, X., Pootoolal, J., Chua, G., Lopez, A., Trochesset, M., Morse, D., Krogan, N.J., Hiley, S.L., Li, Z., Morris, Q., Grigull, J., Mitsakakis, N., Roberts, C.J., Greenblatt, J.F., Boone, C., Kaiser, C.A., Andrews, B.J., Hughes, T.R. (2004) “Exploration of essential gene functions via titratable promoter alleles.” Cell. 118. 31-44.

Ohya, Y., Sese, J., Yukawa, M., Sano, F., Nakatani, Y., Saito, T.L., Saka, A., Fukuda, T., Ishihara, S., Oka, S., Suzuki, G., Watanabe, M., Hirata, A., Ohtani, M., Sawai, H., Fraysse, N.,

Latge, J-P, Francois, J.M., Aebi, M., Tanaka, S., Muramatsu, S., Araki, H., Sonoike, K., Nogami, S., and Morishita, S. (2005). “High-dimensional and large-scale phenotyping of yeast mutants.” PNAS. 102. 19015-19020.

Osley, M.A., Tsukuda, T., Nickoloff, J.A. (2007). “ATP-dependent chromatin remodeling factors and DNA damage and repair.” Mutation Research. 618. 65-80.

Parsons, A.B., Brost, R.L., Ding, H., Li, Z., Zhang, C., Sheikh, B., Brown, G.W., Kane, P.M., Hughes, T.R., Boone, C. (2004). “Integration of chemical-genetic and genetic interaction data links bioactive compounds to cellular target pathways.” Nature Biotechnology. 22. 62-69.

Pepperkok, R. and Ellenberg, J. (2006) “High-throughput fluorescence microscopy for systems biology.” Nature Reviews. 7. 690-696.

Perkin Elmer (2009) “Opera: The ultra high speed high resolution solution for high content screening.” Pamphlet. p.2

Schuldiner, M., Collins, S.R., Thompson, N.J., Denic, V., Bhamidipati, A., Punna, T., Ihmels, J., Andrews, B.J., Boone, C., Greenblatt, J., Weissman, J.S., Krogan, N.J. (2005). “Exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile.” Cell. 123. 507-519.

Shaner, N.C., Campbell, R.E., Steinbach, P.A., Giepmans, B.N.G., Palmer, A.E., Tsien R.Y. (2004) “Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein.” Nature Biotechnology. 22. 1567-1572.

Sheff, M.A. and Thorn, K.S. (2004). “Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae.” Yeast. 21. 661-670.

Sopko, R., Huang, D., Preston, N., Chua, G., Papp, B., Kafadar, K., Snyder, M., Oliver, S.G., Cyert, M., Hughes, T.R, Boone, C., and Andrews, B.J. (2006) “Mapping pathways and phenotypes by systematic gene overexpression.” Molecular Cell. 21. 319-330.

Syminton, L.S. (2002). “The role of RAD52 epistasis group genes in homologous recombination and double-strand break repair.” 66. 630-670.

Takahashi, H., McCaffery, J.M., Irizarry, R.A., Boeke, J.D. (2006). “Nucleocytosolic acetyl- coenzyme A synthetase is required for histone acetylation and global transcription.” Molecular Cell. 23. 207-217.

Tarca, A.L., Carey, V.J., Chen, X., Romero, R., Draghici, S. (2007) “Machine learning and its applications to biology.” PLoS Computational Biology. 3. 0953-0963.

Teixeira, M.T., Dujon, B., Fabre, E. (2002) “Genome-wide nuclear morphology screen identifies novel genes involved in nuclear architecture and gene-silencing in Saccharomyces cerevisiae.” Journal of Molecular Biology. 321. 551-561.

Tong, A.H.Y., Evangelista, M., Parsons, A.B., Xu, H., Bader, G.D., Page, N., Robinson M., Raghibizadeh, S., Hogue, C.W.V., Bussey, H., Andrews, B.J., Tyers, M., Boone, C. (2001)

“Systematic genetic analysis with ordered arrays of yeast deletion mutants.” Science. 294. 2364-2368.

Tourrette, Y., Schacherer, J., Fritsch, E., Potier, S., Souciet, J-L, de Montigny, J. (2007). “Spontaneous deletions and reciprocal translocations in Saccharomyces cerevisiae: influence of ploidy.” Molecular Microbiology. 64. 382-395.

Tsien, R.Y. (1998) “The green fluorescent protein.” Annual Review in Biochemistry. 67. 509- 544.

Tsukiyama, T., Palmer, J., Landel, C.C., Shiloach, J., Wu, C. (1999). “Characterization of the Imitation Switch subfamily of ATP-dependent chromatin-remodeling factors in Saccharomyces cerevisiae.” Genes and Development. 13. 686-697.

Vizeacoumar, F.J., Chong, Y., Boone, C., Andrews, B.J. (2009). “A picture is worth a thousand words: Genomics to phenomics in the yeast Saccharomyces cerevisiae.” FEBS Letters. 583. 1656-1661.

Vizeacoumar, F.J., van Dyk, N., Vizeacoumar, F.S., Cheung, V., Li, J., Sydorskyy, Y., Case, N., Li, Z., Datti, A., Nislow, C., Raught, B., Zhang, Z., Frey, B., Bloom, K., Boone, C., Andrews, B.J. (2010). “Integrating high-throughput genetic interaction mapping and high-content screening to explore yeast spindle morphlogenesis.” Journal of Cell Biology. 188. 69-81.

Wheeler, R.T. and Fink, G.R. (2006) “A drug-sensitive genetic network masks fungi from the immune system.” PLoS. 2. 0328-0339.

Winzeler, E.A., Shoemaker, D.D., Astromoff, A., Liang, H., Anderson, K., Andre, B., Bangham, R., Benito, R., Boeke, J.D., Bussey, H., Chu, A.M., Connelly, C., Davis, K., Dietrich, F., Dow, S.W., El Bakkoury, M., Foury, F., Friend, S.H., Gentalen, E., Giaever, G., Hegemann, J.H., Jones, T., Laub, M., Liao, H., Liebundguth, N., Lockhart, D.J., Lucau-Danila, A., Lussier, M., M'Rabet, N., Menard, P., Mittmann, M., Pai, C., Rebischung, C., Revuelta, J.L., Riles, L., Roberts, C.J., Ross-MacDonald, P., Scherens, B., Snyder, M., Sookhai-Mahadeo, S., Storms, R.K., Veronneau, S., Voet, M., Volckaert, G., Ward, T.R., Wysocki, R., Yen, G.S., Yu, K., Zimmermann, K., Philippsen, P., Johnston, M., and Davis, R.W. (1999). “Function characterization of the S. cerevisiae genome by gene deletion and parallel analysis.” Science. 285. 901-906

Woolstencroft, R.N., Beilharz, T.H., Cook, M.A., Preiss, T., Durocher, D., Tyers, M. (2006). “Ccr4 contributes to tolerance of replication stress through control of CRT1 mRNA poly(A) tail length.” Journal of Cell Science. 19. 5178-5192

Yuen, K.W.Y., Warren, C.D., Chen, O., Kwok, T., Hieter, P., Spencer, F.A. (2007). “Systematic genome instability screens in yeast and their potential relevance to cancer.” PNAS. 104. 3925- 3930.

Zhu, M. (2008). “Kernels and ensembles: perspectives on statistical learning.” University of Waterloo. Waterloo, Ontario, Canada. 1-22.

6.0 APPENDICES

Appendix A. Detailed CellProfilerTM pipeline

OVERVIEW OF MODULE SEQUENCE

LoadImages, GroupMovieFrames, RescaleIntensity, RescaleIntensity, IdentifyPrimAutomatic, MeasureObjectAreaShape, MeasureObjectIntensity, MeasureTexture, MeasureTexture, MeasureTexture, MeasureTexture, MeasureTexture, MeasureTexture, MeasureTexture, MeasureTexture, MeasureObjectIntensity, MeasureTexture, MeasureTexture, MeasureTexture MeasureTexture, MeasureTexture, MeasureTexture, MeasureTexture, MeasureTexture, ExpandOrShrink, MeasureObjectAreaShape, MeasureObjectIntensity, MeasureTexture MeasureTexture, MeasureTexture, MeasureTexture, MeasureTexture, MeasureTexture MeasureTexture, MeasureTexture, MeasureObjectIntensity, MeasureTexture, MeasureTexture MeasureTexture, MeasureTexture, MeasureTexture, MeasureTexture, MeasureTexture, MeasureTexture, IdentifySecondary, MeasureObjectAreaShape, MeasureObjectIntensity MeasureTexture, MeasureTexture, MeasureTexture, MeasureTexture, MeasureTexture MeasureTexture, MeasureTexture, MeasureTexture, MeasureObjectIntensity, MeasureTexture MeasureTexture, MeasureTexture, MeasureTexture, MeasureTexture, MeasureTexture MeasureTexture, MeasureTexture, OverlayOutlines, OverlayOutlines, ExportToDatabase, CreateBatchFiles

PARAMETERS WITHIN MODULES

Module #1: LoadImages Text-Exact match: Type the text that one type of image has in common (for TEXT options), or their position in each group (for ORDER option): .flex What do you want to call these images within CellProfiler? Orig Type the text that one type of image has in common (for TEXT options), or their position in each group (for ORDER option). Type "Do not use" to ignore: Do not use What do you want to call these images within CellProfiler? (Type "Do not use" to ignore) Do not use Type the text that one type of image has in common (for TEXT options), or their position in each group (for ORDER option): Do not use What do you want to call these images within CellProfiler? Do not use Type the text that one type of image has in common (for TEXT options), or their position in each group (for ORDER option): Do not use What do you want to call these images within CellProfiler? Do not use If using ORDER, how many images are there in each group (i.e. each field of view)? 3 What type of files are you loading? tif,tiff,flex movies

Analyze all subfolders within the selected folder? Yes Enter the path name to the folder where the images to be loaded are located. Type period (.) for default image folder. . Note - If the movies contain more than just one image type (e.g., brightfield, fluorescent, field-of-view), add the GroupMovieFrames module.

Module #2: GroupMovieFrames revision - 2 What did you call the movie you want to extract from? Orig How many frames should be extracted each cycle? 2 Are the frames grouped by cycle interleaved (ABCABC...) or separated (AA..BB..CC..)? Interleaved What do you want to call frame 1 in each cycle (or "Do not use" to ignore)? GFP What do you want to call frame 2 in each cycle (or "Do not use" to ignore)? RFP What do you want to call frame 3 in each cycle (or "Do not use" to ignore)? Do not use What do you want to call frame 4 in each cycle (or "Do not use" to ignore)? Do not use What do you want to call frame 5 in each cycle (or "Do not use" to ignore)? Do not use What do you want to call frame 6 in each cycle (or "Do not use" to ignore)? Do not use

Module #3: RescaleIntensity revision - 4 What did you call the image to be rescaled? RFP What do you want to call the rescaled image? RescaledRFP Rescaling method. (S) Stretch the image (0 to 1). (E) Enter the minimum and maximum values in the boxes below. (G) rescale so all pixels are equal to or Greater than one. (M) Match the maximum of one image to the maximum of another. (C) Convert to 8 bit. (T) Divide by loaded text value. See the help for details. Stretch 0 to 1 (Method E only): Enter the intensity from the original image that should be set to the lowest value in the rescaled image, or type AA to calculate the lowest intensity automatically from all of the images to be analyzed and AE to calculate the lowest intensity from each image independently. AA (Method E only): Enter the intensity from the original image that should be set to the highest value in the rescaled image, or type AA to calculate the highest intensity automatically from all of the images to be analyzed and AE to calculate the highest intensity from each image independently. AA (Method E only): What value should pixels at the low end of the original intensity range be mapped to (range [0,1])? 0 (Method E only): What value should pixels at the high end of the original intensity range be mapped to (range [0,1])? 1 (Method E only): What value should pixels *below* the low end of the original intensity range be mapped to (range [0,1])? 0 (Method E only): What value should pixels *above* the high end of the original intensity range be mapped to (range [0,1])? 1 (Method M only): What did you call image whose maximum you want rescaled image to match? Orig (Method T only): What did you call the loaded text in the LoadText module?

Module #4: RescaleIntensity revision - 4 What did you call the image to be rescaled? GFP

What do you want to call the rescaled image? RescaledGFP Rescaling method. (S) Stretch the image (0 to 1). (E) Enter the minimum and maximum values in the boxes below. (G) rescale so all pixels are equal to or Greater than one. (M) Match the maximum of one image to the maximum of another. (C) Convert to 8 bit. (T) Divide by loaded text value. See the help for details. Stretch 0 to 1 (Method E only): Enter the intensity from the original image that should be set to the lowest value in the rescaled image, or type AA to calculate the lowest intensity automatically from all of the images to be analyzed and AE to calculate the lowest intensity from each image independently. AA (Method E only): Enter the intensity from the original image that should be set to the highest value in the rescaled image, or type AA to calculate the highest intensity automatically from all of the images to be analyzed and AE to calculate the highest intensity from each image independently. AA (Method E only): What value should pixels at the low end of the original intensity range be mapped to (range [0,1])? 0 (Method E only): What value should pixels at the high end of the original intensity range be mapped to (range [0,1])? 1 (Method E only): What value should pixels *below* the low end of the original intensity range be mapped to (range [0,1])? 0 (Method E only): What value should pixels *above* the high end of the original intensity range be mapped to (range [0,1])? 1 (Method M only): What did you call image whose maximum you want rescaled image to match? Orig (Method T only): What did you call the loaded text in the LoadText module?

Module #5: IdentifyPrimAutomatic revision - 12 What did you call the images you want to process? RFP What do you want to call the objects identified by this module? Nuclei Typical diameter of objects, in pixel units (Min,Max): 6,40 Discard objects outside the diameter range? Yes Try to merge too small objects with nearby larger objects? No Discard objects touching the border of the image? Yes Select an automatic thresholding method or enter an absolute threshold in the range [0,1]. To choose a binary image, select "Other" and type its name. Choosing 'All' will use the Otsu Global method to calculate a single threshold for the entire image group. The other methods calculate a threshold for each image individually. "Set interactively" will allow you to manually adjust the threshold during the first cycle to determine what will work well. Otsu Global Threshold correction factor 2 Lower and upper bounds on threshold, in the range [0,1] 0.0013,1 For MoG thresholding, what is the approximate fraction of image covered by objects? 0.01 Method to distinguish clumped objects (see help for details): Intensity Method to draw dividing lines between clumped objects (see help for details): Intensity Size of smoothing filter, in pixel units (if you are distinguishing between clumped objects). Enter 0 for low resolution images with small objects (~< 5 pixel diameter) to prevent any smoothing. Automatic Suppress local maxima within this distance, (a positive integer, in pixel units) (if you are distinguishing between clumped objects) Automatic

Speed up by using lower-resolution image to find local maxima? (if you are distinguishing between clumped objects) Yes Enter the following information, separated by commas, if you would like to use the Laplacian of Gaussian method for identifying objects instead of using the above settings: Size of neighborhood(height,width),Sigma,Minimum Area,Size for Wiener Filter(height,width),Threshold Do not use What do you want to call the outlines of the identified objects (optional)? NucleiOutline Do you want to fill holes in identified objects? Yes Do you want to run in test mode where methods for distinguishing clumped objects are compared? No

Module #6: MeasureObjectAreaShape revision - 3 What did you call the objects that you want to measure? Nuclei Would you like to calculate the Zernike features for each object? Yes

Module #7: MeasureObjectIntensity revision - 2 What did you call the greyscale images you want to measure? GFP What did you call the objects that you want to measure? Nuclei

Module #8-15: MeasureTexture revision - 2 What did you call the greyscale images you want to measure? GFP What did you call the objects that you want to measure? Nuclei What is the scale of texture? 1-8

Module #16: MeasureObjectIntensity revision - 2 What did you call the greyscale images you want to measure? RFP What did you call the objects that you want to measure? Nuclei

Module #17-24: MeasureTexture revision - 2 What did you call the greyscale images you want to measure? RFP What did you call the objects that you want to measure? Nuclei What is the scale of texture? 1-8

Module #25: ExpandOrShrink revision - 2 What did you call the objects that you want to expand or shrink? Nuclei What do you want to call the expanded or shrunken objects? ExpandNuclei Were the objects identified using an Identify Primary or Identify Secondary module (note: shrinking results are not perfect with Secondary objects)? Primary Do you want to expand or shrink the objects? Expand Enter the number of pixels by which to expand or shrink the objects, or "Inf" to either shrink to a point or expand until almost touching, or 0 (the number zero) to simply add partial dividing lines between objects that are touching (experimental feature). 2 What do you want to call the outlines of the identified objects (optional)? ExpandedNucleiOutline

Module #26: MeasureObjectAreaShape revision - 3 What did you call the objects that you want to measure? ExpandNuclei

Would you like to calculate the Zernike features for each object? Yes

Module #27: MeasureObjectIntensity revision - 2 What did you call the greyscale images you want to measure? GFP What did you call the objects that you want to measure? ExpandNuclei

Module #28-35: MeasureTexture revision - 2 What did you call the greyscale images you want to measure? GFP What did you call the objects that you want to measure? ExpandNuclei What is the scale of texture? 1-8

Module #36: MeasureObjectIntensity revision - 2 What did you call the greyscale images you want to measure? RFP What did you call the objects that you want to measure? ExpandNuclei

Module #37-44: MeasureTexture revision - 2 What did you call the greyscale images you want to measure? RFP What did you call the objects that you want to measure? ExpandNuclei What is the scale of texture? 1-8

Module #45: IdentifySecondary revision - 3 What did you call the primary objects you want to create secondary objects around? Nuclei What do you want to call the objects identified by this module? Cells Select the method to identify the secondary objects (Distance - B uses background; Distance - N does not): Propagation What did you call the images to be used to find the edges of the secondary objects? For DISTANCE - N, this will not affect object identification, only the final display. RescaledRFP Select an automatic thresholding method or enter an absolute threshold in the range [0,1]. To choose a binary image, select "Other" and type its name. Choosing 'All' will use the Otsu Global method to calculate a single threshold for the entire image group. The other methods calculate a threshold for each image individually. Set interactively will allow you to manually adjust the threshold during the first cycle to determine what will work well. Otsu Global Threshold correction factor 0.8 Lower and upper bounds on threshold, in the range [0,1] 0.04,1 For MoG thresholding, what is the approximate fraction of image covered by objects? 0.01 For DISTANCE, enter number of pixels by which to expand the primary objects [Positive integer] 10 For PROPAGATION, enter the regularization factor (0 to infinity). Larger=distance,0=intensity 0.05 What do you want to call the outlines of the identified objects (optional)? CellOutline Do you want to run in test mode where each method for identifying secondary objects is compared? No

Module #46: MeasureObjectAreaShape revision - 3 What did you call the objects that you want to measure? Cells Would you like to calculate the Zernike features for each object? Yes

Module #47: MeasureObjectIntensity revision - 2 What did you call the greyscale images you want to measure? GFP What did you call the objects that you want to measure? Cells

Module #48-55: MeasureTexture revision - 2 What did you call the greyscale images you want to measure? GFP What did you call the objects that you want to measure? Cells What is the scale of texture? 1-8

Module #56: MeasureObjectIntensity revision - 2 What did you call the greyscale images you want to measure? RFP What did you call the objects that you want to measure? Cells

Module #57-64: MeasureTexture revision - 2 What did you call the greyscale images you want to measure? RFP What did you call the objects that you want to measure? Cells What is the scale of texture? 1-8

Module #65: OverlayOutlines revision - 2 On which image would you like to display the outlines? RescaledRFP What did you call the outlines that you would like to display? CellOutline Would you like to set the intensity (brightness) of the outlines to be the same as the brightest point in the image, or the maximum possible value for this image format? Max of image What do you want to call the image with the outlines displayed? CellRFP For color images, what do you want the color of the outlines to be? Red

Module #66: OverlayOutlines revision - 2 On which image would you like to display the outlines? RescaledGFP What did you call the outlines that you would like to display? ExpandedNucleiOutline Would you like to set the intensity (brightness) of the outlines to be the same as the brightest point in the image, or the maximum possible value for this image format? Max of image What do you want to call the image with the outlines displayed? ExpNucleiGFP For color images, what do you want the color of the outlines to be? Green

Module #67: ExportToDatabase revision - 5 What type of database do you want to use? MySQL For MySQL only, what is the name of the database to use? FociDB What prefix should be used to name the tables in the database (should be unique per experiment, or leave "Do not use" to have generic Per_Image and Per_Object tables)? Do not use What prefix should be used to name the SQL files? SQL_ Enter directory where the SQL files are to be saved. Type period (.) to use the default output folder. . Do you want to create a CellProfiler Analyst properties file? Yes

Module #68: CreateBatchFiles revision - 8

What is the path to the folder where the batch control file (Batch_data.mat) will be saved? Leave a period (.) to use the default output folder. /Volumes/MetaXpress/MxDatabase/Phenomics_Opera/Karen/Screens/RAD52GH_HTA2mCN_ RPL39prtdTU/Batches/Rad52Batch_11_17_09_1IPA1ISA_WithImages_AllMeasurements_581 1 If pathnames are specified differently between the local and cluster machines, enter that part of the pathname from the local machine's perspective, omitting trailing slashes. Otherwise, leave a period (.) /Volumes/MetaXpress/ If pathnames are specified differently between the local and cluster machines, enter that part of the pathname from the cluster machines' perspective, omitting trailing slashes. Otherwise, leave a period (.) /home/MetaXpress/ Note: This module must be the last one in the analysis pipeline. n/a

Appendix B. List of Alvaro et al. (2007) mutants detected and not detected in this study

*In total there are 87 hits detected by Alvaro et al., 2007 that were also screened in this study. The following two tables show which of the 87 mutants were detected as hits in our assessment of non-essential mutants (single mutants, single mutants + phleomycin, sgs1Δ double mutants, and yku80Δ double mutants).

Detected in this study Not detected in this study

Gene Cellular Role Gene Cellular Role Gene Cellular Role ASF1 Chromatin remodeling AHC1 Chromatin remodeling IRC6 Undetermined CTF18 DNA repair ATR1 Membrane transport IRC7 Undetermined DNA BCK1 IRC8 CTF4 replication/cohesion Stress response Undetermined DNA damage BDF2 IRC9 DDC1 checkpoint Chromatin remodeling Undetermined ELG1 DNA replication BUB1 Spindle checkpont IZH2 Zinc/phosphate homeostasis ESC2 Chromatin remodeling BUB2 Mitotic checkpoint LAG2 Cell aging HST3 Chromatin remodeling BUD27 Stress response LRS4 Chromatin remodeling MMS1 Chromatin remodeling CBT1 Mitochondrial function MAD1 Mitotic checkpoint MMS22 DNA repair CTF19 Chromosome segregation MAD2 Mitotic checkpoint MMS4 DNA repair DAK2 Stress response MAD3 Mitotic checkpoint MUS81 DNA repair ECM11 Undetermined MCM16 Chromosome segregation NUP133 Nuclear pore GDH1 Amino acid metabolism MCM22 Chromosome segregation NUP60 Nuclear pore GSH2 Stress response MED1 Transcription POL32 DNA replication HRT2 Undetermined MLH1 DNA repair RAD17 DNA repair IRC10 Undetermined MRPL1 Mitochondrial function RAD27 DNA repair IRC13 Undetermined PAC10 Protein folding RAD51 DNA repair IRC14 Undetermined PDR10 Membrane transport RAD54 DNA repair IRC15 Undetermined POM152 Nuclear pore RAD55 DNA repair IRC16 Undetermined RCO1 Chromatin remodeling RAD57 DNA repair IRC18 Undetermined RIM9 Sporulation RAD59 DNA repair IRC2 Undetermined RMI1 DNA repair RAD61 Chromatid cohesion IRC20 Undetermined RTT103 Ty1 transposition RRM3 DNA replication and repair IRC21 Undetermined SAE2 DNA repair RTT101 DNA replication and repair IRC24 Undetermined SET2 Chromatin remodeling RTT107 DNA silencing IRC25 Undetermined SGS1 DNA repair RTT109 Chromatin remodeling IRC3 Undetermined TOF2 Chromatin remodeling SLX5 DNA repair IRC4 Undetermined TRF4 RNA poly(A) polymerase SLX8 Genome stability IRC5 Undetermined YMR31 Mitochondrial function VPS71 Chromatin remodeling VPS72 Chromatin remodeling WSS1 Undetermined

Appendix C. GO term enrichment for all individual screens

GO term enrichment for single mutant screen of non-essential genes

GOID GO_term P- Gene(s) annotated to the term value 6259 DNA 3.17E- MRC1/YCL061C:RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:UBC13/Y metabolic 26 DR092W:DPB4/YDR121W:RAD9/YDR217C:XRS2/YDR369C:DOT1/YDR440W:RA process D51/YER095W:SLX8/YER116C:RAD24/YER173W:MMS2/YGL087C:RAD54/YGL16 3C:RRM3/YHR031C:RTT107/YHR154W:THP2/YHR167W:CSM2/YIL132C:RTT101/ YJL047C:POL32/YJR043C:RTT109/YLL002W:RAD5/YLR032W:SLX4/YLR135W:RN H203/YLR154C:TOP3/YLR234W:MMS22/YLR320W:TSA1/YML028W:MFT1/YML06 2C:RAD10/YML095C:MSC1/YML128C:CSM3/YMR048W:CTF18/YMR078C:MRE11/ YMR224C:EAF7/YNL136W:ELG1/YOR144C:DDC1/YPL194W:CLB5/YPR120C:CTF4 /YPR135W:MMS1/YPR164W 6974 response 1.77E- DCC1/YCL016C:MRC1/YCL061C:RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR to DNA 24 076W:UBC13/YDR092W:RAD9/YDR217C:XRS2/YDR369C:DOT1/YDR440W:SLX8 damage /YER116C:RAD24/YER173W:MMS2/YGL087C:RAD54/YGL163C:WSS1/YHR134W: stimulus RTT107/YHR154W:CTF8/YHR191C:CSM2/YIL132C:RTT101/YJL047C:POL32/YJR0 43C:RTT109/YLL002W:RAD5/YLR032W:SLX4/YLR135W:MMS22/YLR320W:TSA1/ YML028W:RAD10/YML095C:CSM3/YMR048W:CTF18/YMR078C:MRE11/YMR224C :EAF7/YNL136W:ELG1/YOR144C:DDC1/YPL194W:CTF4/YPR135W:MMS1/YPR16 4W 33554 cellular 7.77E- DCC1/YCL016C:MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL059C:RAD57/YDR00 response 22 4W:RAD55/YDR076W:UBC13/YDR092W:RAD9/YDR217C:XRS2/YDR369C:DOT1/ to stress YDR440W:SLX8/YER116C:RAD24/YER173W:MMS2/YGL087C:RAD54/YGL163C: WSS1/YHR134W:RTT107/YHR154W:CTF8/YHR191C:SKN7/YHR206W:CSM2/YIL1 32C:RTT101/YJL047C:ASF1/YJL115W:POL32/YJR043C:YKL069W:RTT109/YLL00 2W:RAD5/YLR032W:SIC1/YLR079W:SLX4/YLR135W:MMS22/YLR320W:YAP1/YM L007W:TSA1/YML028W:RAD10/YML095C:SUB1/YMR039C:CSM3/YMR048W:CTF 18/YMR078C:MRE11/YMR224C:EAF7/YNL136W:ELG1/YOR144C:DDC1/YPL194W :CTF4/YPR135W:MMS1/YPR164W 51716 cellular 4.70E- DCC1/YCL016C:MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL059C:GET3/YDL100 response 20 C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:RAD9/YDR217C:XRS2/ to YDR369C:DOT1/YDR440W:SLX8/YER116C:RAD24/YER173W:MMS2/YGL087C:RA stimulus D54/YGL163C:WSS1/YHR134W:RTT107/YHR154W:CTF8/YHR191C:SKN7/YHR20 6W:CSM2/YIL132C:RTT101/YJL047C:ASF1/YJL115W:POL32/YJR043C:YKL069W: RTT109/YLL002W:RAD5/YLR032W:SIC1/YLR079W:SLX4/YLR135W:MMS22/YLR3 20W:YAP1/YML007W:TSA1/YML028W:RAD10/YML095C:SUB1/YMR039C:CSM3/Y MR048W:CTF18/YMR078C:MRE11/YMR224C:EAF7/YNL136W:MDG1/YNL173C:EL G1/YOR144C:DDC1/YPL194W:CTF4/YPR135W:MMS1/YPR164W 6281 DNA 8.87E- MRC1/YCL061C:RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:UBC13/Y repair 20 DR092W:RAD9/YDR217C:XRS2/YDR369C:DOT1/YDR440W:RAD24/YER173W:M MS2/YGL087C:RAD54/YGL163C:RTT107/YHR154W:CSM2/YIL132C:POL32/YJR0 43C:RTT109/YLL002W:RAD5/YLR032W:SLX4/YLR135W:MMS22/YLR320W:RAD1 0/YML095C:CSM3/YMR048W:CTF18/YMR078C:MRE11/YMR224C:EAF7/YNL136W :ELG1/YOR144C:DDC1/YPL194W:CTF4/YPR135W:MMS1/YPR164W 6950 response 1.28E- DCC1/YCL016C:MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL059C:GET3/YDL100 to stress 19 C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:RAD9/YDR217C:XRS2/ YDR369C:DOT1/YDR440W:SLX8/YER116C:RAD24/YER173W:MMS2/YGL087C:RA D54/YGL163C:ORM1/YGR038W:WSS1/YHR134W:RTT107/YHR154W:CTF8/YHR1 91C:SKN7/YHR206W:CSM2/YIL132C:RTT101/YJL047C:ASF1/YJL115W:POL32/YJ R043C:YKL069W:RTT109/YLL002W:RAD5/YLR032W:SIC1/YLR079W:SLX4/YLR1 35W:MMS22/YLR320W:YAP1/YML007W:TSA1/YML028W:RAD10/YML095C:SUB1 /YMR039C:CSM3/YMR048W:CTF18/YMR078C:MRE11/YMR224C:EAF7/YNL136W: ELG1/YOR144C:DDC1/YPL194W:CTF4/YPR135W:MMS1/YPR164W 90304 nucleic 2.01E- RPS8A/YBL072C:MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL059C:RAD57/YDR0 acid 18 04W:RAD55/YDR076W:UBC13/YDR092W:DPB4/YDR121W:RAD9/YDR217C:XRS metabolic 2/YDR369C:DOT1/YDR440W:RAD51/YER095W:SLX8/YER116C:SPT2/YER161C:C process HD1/YER164W:RAD24/YER173W:MMS2/YGL087C:RAD54/YGL163C:RRM3/YHR0 31C:RTT107/YHR154W:THP2/YHR167W:SKN7/YHR206W:CSM2/YIL132C:RTT10

1/YJL047C:ASF1/YJL115W:POL32/YJR043C:MRS4/YKR052C:RTT109/YLL002W:R AD5/YLR032W:SLX4/YLR135W:RNH203/YLR154C:TOP3/YLR234W:MMS22/YLR3 20W:YAP1/YML007W:TSA1/YML028W:MFT1/YML062C:RAD10/YML095C:MSC1/Y ML128C:SUB1/YMR039C:CSM3/YMR048W:CTF18/YMR078C:MRE11/YMR224C:E AF7/YNL136W:HST3/YOR025W:AZF1/YOR113W:ELG1/YOR144C:DDC1/YPL194 W:RLF2/YPR018W:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W 725 recombina 3.23E- RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:DOT1/YD tional 17 R440W:RAD54/YGL163C:CSM2/YIL132C:POL32/YJR043C:MMS22/YLR320W:CTF repair 18/YMR078C:MRE11/YMR224C:ELG1/YOR144C:DDC1/YPL194W:CTF4/YPR135W :MMS1/YPR164W 6310 DNA 4.11E- RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:DOT1/YD recombina 17 R440W:RAD51/YER095W:RAD24/YER173W:RAD54/YGL163C:THP2/YHR167W:C tion SM2/YIL132C:POL32/YJR043C:SLX4/YLR135W:TOP3/YLR234W:MMS22/YLR320 W:MFT1/YML062C:RAD10/YML095C:MSC1/YML128C:CTF18/YMR078C:MRE11/Y MR224C:ELG1/YOR144C:DDC1/YPL194W:CTF4/YPR135W:MMS1/YPR164W 50896 response 3.77E- DCC1/YCL016C:MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL059C:GET3/YDL100 to 16 C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:RAD9/YDR217C:XRS2/ stimulus YDR369C:DOT1/YDR440W:SLX8/YER116C:RAD24/YER173W:MMS2/YGL087C:RA D54/YGL163C:ORM1/YGR038W:WSS1/YHR134W:RTT107/YHR154W:CTF8/YHR1 91C:SKN7/YHR206W:CSM2/YIL132C:RTT101/YJL047C:ASF1/YJL115W:POL32/YJ R043C:YKL069W:RTT109/YLL002W:RAD5/YLR032W:SIC1/YLR079W:SLX4/YLR1 35W:MMS22/YLR320W:YAP1/YML007W:TSA1/YML028W:RAD10/YML095C:SUB1 /YMR039C:CSM3/YMR048W:CTF18/YMR078C:MRE11/YMR224C:EAF7/YNL136W: MDG1/YNL173C:AZF1/YOR113W:ELG1/YOR144C:DDC1/YPL194W:CTF4/YPR135 W:MMS1/YPR164W 6139 nucleobas 1.29E- RPS8A/YBL072C:MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL059C:RAD57/YDR0 e, 15 04W:RAD55/YDR076W:UBC13/YDR092W:DPB4/YDR121W:RAD9/YDR217C:XRS nucleoside 2/YDR369C:DOT1/YDR440W:RAD51/YER095W:SLX8/YER116C:SPT2/YER161C:C , HD1/YER164W:RAD24/YER173W:MMS2/YGL087C:RAD54/YGL163C:RRM3/YHR0 nucleotide 31C:RTT107/YHR154W:THP2/YHR167W:SKN7/YHR206W:CSM2/YIL132C:RTT10 and 1/YJL047C:ASF1/YJL115W:POL32/YJR043C:MRS4/YKR052C:RTT109/YLL002W:R nucleic AD5/YLR032W:SLX4/YLR135W:RNH203/YLR154C:TOP3/YLR234W:MMS22/YLR3 acid 20W:YAP1/YML007W:TSA1/YML028W:MFT1/YML062C:RAD10/YML095C:MSC1/Y metabolic ML128C:SUB1/YMR039C:CSM3/YMR048W:CTF18/YMR078C:MRE11/YMR224C:E process AF7/YNL136W:HST3/YOR025W:AZF1/YOR113W:ELG1/YOR144C:DDC1/YPL194 W:RLF2/YPR018W:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W 43170 macromol 1.45E- RPS8A/YBL072C:MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL059C:RAD57/YDR0 ecule 15 04W:RAD55/YDR076W:UBC13/YDR092W:DPB4/YDR121W:RAD9/YDR217C:XRS metabolic 2/YDR369C:DOT1/YDR440W:RAD51/YER095W:SLX8/YER116C:SPT2/YER161C:C process HD1/YER164W:RAD24/YER173W:SGF73/YGL066W:MMS2/YGL087C:RAD54/YGL 163C:ORM1/YGR038W:PEX4/YGR133W:RRM3/YHR031C:WSS1/YHR134W:RTT10 7/YHR154W:THP2/YHR167W:SKN7/YHR206W:CSM2/YIL132C:AIM22/YJL046W: RTT101/YJL047C:ASF1/YJL115W:POL32/YJR043C:MRS4/YKR052C:RTT109/YLL0 02W:RAD5/YLR032W:SLX4/YLR135W:RNH203/YLR154C:TFS1/YLR178C:TOP3/Y LR234W:MMS22/YLR320W:RPL6B/YLR448W:YAP1/YML007W:TSA1/YML028W:M FT1/YML062C:RAD10/YML095C:MSC1/YML128C:IMP2/YMR035W:SUB1/YMR039 C:CSM3/YMR048W:CTF18/YMR078C:MRE11/YMR224C:RPL16B/YNL069C:EAF7/Y NL136W:RTS1/YOR014W:HST3/YOR025W:AZF1/YOR113W:ELG1/YOR144C:NFI1 /YOR156C:LIP5/YOR196C:DDC1/YPL194W:RLF2/YPR018W:CLB5/YPR120C:CTF4 /YPR135W:MMS1/YPR164W 44260 cellular 1.25E- RPS8A/YBL072C:MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL059C:RAD57/YDR0 macromol 14 04W:RAD55/YDR076W:UBC13/YDR092W:DPB4/YDR121W:RAD9/YDR217C:XRS ecule 2/YDR369C:DOT1/YDR440W:RAD51/YER095W:SLX8/YER116C:SPT2/YER161C:C metabolic HD1/YER164W:RAD24/YER173W:SGF73/YGL066W:MMS2/YGL087C:RAD54/YGL process 163C:PEX4/YGR133W:RRM3/YHR031C:WSS1/YHR134W:RTT107/YHR154W:THP 2/YHR167W:SKN7/YHR206W:CSM2/YIL132C:AIM22/YJL046W:RTT101/YJL047C: ASF1/YJL115W:POL32/YJR043C:MRS4/YKR052C:RTT109/YLL002W:RAD5/YLR03 2W:SLX4/YLR135W:RNH203/YLR154C:TOP3/YLR234W:MMS22/YLR320W:RPL6B /YLR448W:YAP1/YML007W:TSA1/YML028W:MFT1/YML062C:RAD10/YML095C:M SC1/YML128C:IMP2/YMR035W:SUB1/YMR039C:CSM3/YMR048W:CTF18/YMR07 8C:MRE11/YMR224C:RPL16B/YNL069C:EAF7/YNL136W:RTS1/YOR014W:HST3/Y OR025W:AZF1/YOR113W:ELG1/YOR144C:NFI1/YOR156C:LIP5/YOR196C:DDC1/ YPL194W:RLF2/YPR018W:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W 6302 double- 1.05E- RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:RAD54/Y strand 13 GL163C:RTT107/YHR154W:POL32/YJR043C:RTT109/YLL002W:RAD5/YLR032W: break SLX4/YLR135W:MMS22/YLR320W:RAD10/YML095C:CTF18/YMR078C:MRE11/YM repair R224C:ELG1/YOR144C:CTF4/YPR135W

51276 chromoso 8.50E- DCC1/YCL016C:MRC1/YCL061C:RAD59/YDL059C:RAD57/YDR004W:XRS2/YDR3 me 13 69C:DOT1/YDR440W:RAD51/YER095W:SLX8/YER116C:SPT2/YER161C:CHD1/YE organizati R164W:SGF73/YGL066W:RAD54/YGL163C:CTF8/YHR191C:ASF1/YJL115W:RTT1 on 09/YLL002W:TOP3/YLR234W:MMS22/YLR320W:CSM3/YMR048W:CTF18/YMR07 8C:CIK1/YMR198W:EAF7/YNL136W:RTS1/YOR014W:HST3/YOR025W:ELG1/YOR 144C:NFI1/YOR156C:RLF2/YPR018W:CTF4/YPR135W 279 M phase 8.38E- DCC1/YCL016C:MRC1/YCL061C:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR 12 369C:DOT1/YDR440W:RAD51/YER095W:RAD24/YER173W:CTF8/YHR191C:CSM 2/YIL132C:RTT101/YJL047C:TOP3/YLR234W:MMS22/YLR320W:RAD10/YML095C :MSC1/YML128C:CSM3/YMR048W:CTF18/YMR078C:CIK1/YMR198W:MRE11/YM R224C:RTS1/YOR014W:ELG1/YOR144C:DDC1/YPL194W:CLB5/YPR120C:CTF4/Y PR135W 34641 cellular 1.24E- RPS8A/YBL072C:MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL059C:RAD57/YDR0 nitrogen 11 04W:RAD55/YDR076W:UBC13/YDR092W:DPB4/YDR121W:RAD9/YDR217C:XRS compound 2/YDR369C:DOT1/YDR440W:RAD51/YER095W:SLX8/YER116C:SPT2/YER161C:C metabolic HD1/YER164W:RAD24/YER173W:MMS2/YGL087C:RAD54/YGL163C:RRM3/YHR0 process 31C:RTT107/YHR154W:THP2/YHR167W:SKN7/YHR206W:CSM2/YIL132C:RTT10 1/YJL047C:ASF1/YJL115W:POL32/YJR043C:MRS4/YKR052C:RTT109/YLL002W:R AD5/YLR032W:SLX4/YLR135W:RNH203/YLR154C:TOP3/YLR234W:MMS22/YLR3 20W:YAP1/YML007W:TSA1/YML028W:MFT1/YML062C:RAD10/YML095C:MSC1/Y ML128C:SUB1/YMR039C:CSM3/YMR048W:CTF18/YMR078C:MRE11/YMR224C:E AF7/YNL136W:HST3/YOR025W:AZF1/YOR113W:ELG1/YOR144C:DDC1/YPL194 W:RLF2/YPR018W:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W 22403 cell cycle 1.26E- DCC1/YCL016C:MRC1/YCL061C:RAD57/YDR004W:RAD55/YDR076W:RAD9/YDR phase 11 217C:XRS2/YDR369C:DOT1/YDR440W:RAD51/YER095W:RAD24/YER173W:CTF 8/YHR191C:CSM2/YIL132C:RTT101/YJL047C:SIC1/YLR079W:TOP3/YLR234W:M MS22/YLR320W:RAD10/YML095C:MSC1/YML128C:CSM3/YMR048W:CTF18/YMR 078C:CIK1/YMR198W:MRE11/YMR224C:RTS1/YOR014W:ELG1/YOR144C:DDC1/ YPL194W:CLB5/YPR120C:CTF4/YPR135W 6807 nitrogen 2.96E- RPS8A/YBL072C:MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL059C:RAD57/YDR0 compound 11 04W:RAD55/YDR076W:UBC13/YDR092W:DPB4/YDR121W:RAD9/YDR217C:XRS metabolic 2/YDR369C:DOT1/YDR440W:RAD51/YER095W:SLX8/YER116C:SPT2/YER161C:C process HD1/YER164W:RAD24/YER173W:MMS2/YGL087C:RAD54/YGL163C:RRM3/YHR0 31C:RTT107/YHR154W:THP2/YHR167W:SKN7/YHR206W:CSM2/YIL132C:RTT10 1/YJL047C:ASF1/YJL115W:POL32/YJR043C:MRS4/YKR052C:RTT109/YLL002W:R AD5/YLR032W:SLX4/YLR135W:RNH203/YLR154C:TOP3/YLR234W:MMS22/YLR3 20W:YAP1/YML007W:TSA1/YML028W:MFT1/YML062C:RAD10/YML095C:MSC1/Y ML128C:SUB1/YMR039C:CSM3/YMR048W:CTF18/YMR078C:MRE11/YMR224C:E AF7/YNL136W:HST3/YOR025W:AZF1/YOR113W:ELG1/YOR144C:DDC1/YPL194 W:RLF2/YPR018W:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W 71842 cellular 5.20E- NUP60/YAR002W:DCC1/YCL016C:MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL0 componen 11 59C:GET3/YDL100C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:XRS t 2/YDR369C:DOT1/YDR440W:RAD51/YER095W:SLX8/YER116C:SPT2/YER161C:C organizati HD1/YER164W:SGF73/YGL066W:MMS2/YGL087C:RAD54/YGL163C:PEX4/YGR13 on at 3W:RRM3/YHR031C:CTF8/YHR191C:RTT101/YJL047C:ASF1/YJL115W:NUP133/Y cellular KR082W:RTT109/YLL002W:RAD5/YLR032W:TOP3/YLR234W:MMS22/YLR320W: level RPL6B/YLR448W:IMP2/YMR035W:SUB1/YMR039C:CSM3/YMR048W:CTF18/YMR 078C:CIK1/YMR198W:EAF7/YNL136W:RTS1/YOR014W:HST3/YOR025W:ELG1/Y OR144C:NFI1/YOR156C:BEM4/YPL161C:RLF2/YPR018W:CLB5/YPR120C:CTF4/Y PR135W 6260 DNA 2.42E- MRC1/YCL061C:DPB4/YDR121W:RRM3/YHR031C:RTT101/YJL047C:POL32/YJR0 replication 10 43C:SLX4/YLR135W:RNH203/YLR154C:TOP3/YLR234W:MMS22/YLR320W:CSM3 /YMR048W:ELG1/YOR144C:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W 724 double- 2.75E- RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:RAD54/Y strand 10 GL163C:POL32/YJR043C:CTF18/YMR078C:MRE11/YMR224C:ELG1/YOR144C:CT break F4/YPR135W repair via homologo us recombina tion 22402 cell cycle 9.82E- DCC1/YCL016C:MRC1/YCL061C:RAD57/YDR004W:RAD55/YDR076W:RAD9/YDR process 10 217C:XRS2/YDR369C:DOT1/YDR440W:RAD51/YER095W:RAD24/YER173W:CTF 8/YHR191C:CSM2/YIL132C:RTT101/YJL047C:SIC1/YLR079W:TOP3/YLR234W:M MS22/YLR320W:TSA1/YML028W:RAD10/YML095C:MSC1/YML128C:CSM3/YMR0 48W:CTF18/YMR078C:CIK1/YMR198W:MRE11/YMR224C:RTS1/YOR014W:ELG1/ YOR144C:DDC1/YPL194W:CLB5/YPR120C:CTF4/YPR135W

44238 primary 1.56E- RPS8A/YBL072C:MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL059C:RAD57/YDR0 metabolic 09 04W:RAD55/YDR076W:UBC13/YDR092W:DPB4/YDR121W:RAD9/YDR217C:XRS process 2/YDR369C:DOT1/YDR440W:RAD51/YER095W:SLX8/YER116C:SPT2/YER161C:C HD1/YER164W:RAD24/YER173W:SGF73/YGL066W:MMS2/YGL087C:RAD54/YGL 163C:ORM1/YGR038W:PEX4/YGR133W:RRM3/YHR031C:WSS1/YHR134W:RTT10 7/YHR154W:THP2/YHR167W:SKN7/YHR206W:CSM2/YIL132C:AIM22/YJL046W: RTT101/YJL047C:ASF1/YJL115W:POL32/YJR043C:MRS4/YKR052C:RTT109/YLL0 02W:RAD5/YLR032W:SLX4/YLR135W:RNH203/YLR154C:TFS1/YLR178C:TOP3/Y LR234W:MMS22/YLR320W:RPL6B/YLR448W:YAP1/YML007W:TSA1/YML028W:M FT1/YML062C:RAD10/YML095C:MSC1/YML128C:IMP2/YMR035W:SUB1/YMR039 C:CSM3/YMR048W:CTF18/YMR078C:MRE11/YMR224C:RPL16B/YNL069C:EAF7/Y NL136W:RTS1/YOR014W:HST3/YOR025W:AZF1/YOR113W:ELG1/YOR144C:NFI1 /YOR156C:LIP5/YOR196C:MCT1/YOR221C:DDC1/YPL194W:RLF2/YPR018W:CLB 5/YPR120C:CTF4/YPR135W:MMS1/YPR164W 7049 cell cycle 2.98E- DCC1/YCL016C:MRC1/YCL061C:RAD57/YDR004W:RAD55/YDR076W:RAD9/YDR 09 217C:XRS2/YDR369C:DOT1/YDR440W:RAD51/YER095W:RAD24/YER173W:CTF 8/YHR191C:CSM2/YIL132C:RTT101/YJL047C:SIC1/YLR079W:TOP3/YLR234W:M MS22/YLR320W:TSA1/YML028W:RAD10/YML095C:MSC1/YML128C:CSM3/YMR0 48W:CTF18/YMR078C:CIK1/YMR198W:MRE11/YMR224C:RTS1/YOR014W:ELG1/ YOR144C:DDC1/YPL194W:CLB5/YPR120C:CTF4/YPR135W 6996 organelle 4.79E- DCC1/YCL016C:MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL059C:GET3/YDL100 organizati 09 C:RAD57/YDR004W:XRS2/YDR369C:DOT1/YDR440W:RAD51/YER095W:SLX8/Y on ER116C:SPT2/YER161C:CHD1/YER164W:SGF73/YGL066W:RAD54/YGL163C:PEX 4/YGR133W:RRM3/YHR031C:CTF8/YHR191C:RTT101/YJL047C:ASF1/YJL115W:N UP133/YKR082W:RTT109/YLL002W:TOP3/YLR234W:MMS22/YLR320W:RPL6B/YL R448W:IMP2/YMR035W:CSM3/YMR048W:CTF18/YMR078C:CIK1/YMR198W:EAF 7/YNL136W:RTS1/YOR014W:HST3/YOR025W:ELG1/YOR144C:NFI1/YOR156C:B EM4/YPL161C:RLF2/YPR018W:CLB5/YPR120C:CTF4/YPR135W 6261 DNA- 5.95E- MRC1/YCL061C:DPB4/YDR121W:RTT101/YJL047C:POL32/YJR043C:SLX4/YLR13 dependent 09 5W:RNH203/YLR154C:MMS22/YLR320W:CSM3/YMR048W:ELG1/YOR144C:CTF4 DNA /YPR135W:MMS1/YPR164W replication 65007 biological 1.73E- MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL059C:GET3/YDL100C:RAD57/YDR00 regulation 08 4W:UBC13/YDR092W:DPB4/YDR121W:RAD9/YDR217C:XRS2/YDR369C:DOT1/Y DR440W:RAD51/YER095W:SLX8/YER116C:SPT2/YER161C:CHD1/YER164W:RAD 24/YER173W:MMS2/YGL087C:RAD54/YGL163C:ORM1/YGR038W:RTT107/YHR15 4W:SKN7/YHR206W:RTT101/YJL047C:ASF1/YJL115W:RTT109/YLL002W:RAD5/ YLR032W:SIC1/YLR079W:TFS1/YLR178C:TOP3/YLR234W:YAP1/YML007W:TSA1 /YML028W:SUB1/YMR039C:CSM3/YMR048W:MRE11/YMR224C:EAF7/YNL136W: MDG1/YNL173C:RTS1/YOR014W:HST3/YOR025W:AZF1/YOR113W:ELG1/YOR14 4C:BEM4/YPL161C:DDC1/YPL194W:RLF2/YPR018W:CLB5/YPR120C:MMS1/YPR1 64W 71841 cellular 2.93E- NUP60/YAR002W:RPS8A/YBL072C:DCC1/YCL016C:MRC1/YCL061C:PTC1/YDL00 componen 08 6W:RAD59/YDL059C:GET3/YDL100C:RAD57/YDR004W:RAD55/YDR076W:UBC1 t 3/YDR092W:XRS2/YDR369C:DOT1/YDR440W:RAD51/YER095W:SLX8/YER116C: organizati SPT2/YER161C:CHD1/YER164W:SGF73/YGL066W:MMS2/YGL087C:RAD54/YGL1 on or 63C:PEX4/YGR133W:RRM3/YHR031C:CTF8/YHR191C:RTT101/YJL047C:ASF1/YJ biogenesis L115W:NUP133/YKR082W:RTT109/YLL002W:RAD5/YLR032W:TOP3/YLR234W:M at cellular MS22/YLR320W:RPL6B/YLR448W:IMP2/YMR035W:SUB1/YMR039C:CSM3/YMR0 level 48W:CTF18/YMR078C:CIK1/YMR198W:EAF7/YNL136W:RTS1/YOR014W:HST3/Y OR025W:ELG1/YOR144C:NFI1/YOR156C:BEM4/YPL161C:RLF2/YPR018W:CLB5/ YPR120C:CTF4/YPR135W 44237 cellular 8.44E- RPS8A/YBL072C:MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL059C:RAD57/YDR0 metabolic 08 04W:RAD55/YDR076W:UBC13/YDR092W:DPB4/YDR121W:RAD9/YDR217C:XRS process 2/YDR369C:DOT1/YDR440W:RAD51/YER095W:SLX8/YER116C:SPT2/YER161C:C HD1/YER164W:RAD24/YER173W:SGF73/YGL066W:MMS2/YGL087C:RAD54/YGL 163C:ORM1/YGR038W:PEX4/YGR133W:RRM3/YHR031C:WSS1/YHR134W:RTT10 7/YHR154W:THP2/YHR167W:SKN7/YHR206W:CSM2/YIL132C:AIM22/YJL046W: RTT101/YJL047C:ASF1/YJL115W:POL32/YJR043C:MRS4/YKR052C:RTT109/YLL0 02W:RAD5/YLR032W:SIC1/YLR079W:SLX4/YLR135W:RNH203/YLR154C:TOP3/Y LR234W:MMS22/YLR320W:RPL6B/YLR448W:YAP1/YML007W:TSA1/YML028W:M FT1/YML062C:RAD10/YML095C:MSC1/YML128C:IMP2/YMR035W:SUB1/YMR039 C:CSM3/YMR048W:CTF18/YMR078C:MRE11/YMR224C:RPL16B/YNL069C:EAF7/Y NL136W:RTS1/YOR014W:HST3/YOR025W:AZF1/YOR113W:ELG1/YOR144C:NFI1 /YOR156C:LIP5/YOR196C:MCT1/YOR221C:DDC1/YPL194W:RLF2/YPR018W:CLB 5/YPR120C:CTF4/YPR135W:MMS1/YPR164W

8152 metabolic 8.91E- RPS8A/YBL072C:MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL059C:RAD57/YDR0 process 08 04W:RAD55/YDR076W:UBC13/YDR092W:DPB4/YDR121W:RAD9/YDR217C:XRS 2/YDR369C:DOT1/YDR440W:RAD51/YER095W:SLX8/YER116C:SPT2/YER161C:C HD1/YER164W:RAD24/YER173W:SGF73/YGL066W:MMS2/YGL087C:RAD54/YGL 163C:ORM1/YGR038W:PEX4/YGR133W:RRM3/YHR031C:WSS1/YHR134W:RTT10 7/YHR154W:THP2/YHR167W:SKN7/YHR206W:CSM2/YIL132C:AIM22/YJL046W: RTT101/YJL047C:ASF1/YJL115W:POL32/YJR043C:MRS4/YKR052C:RTT109/YLL0 02W:RAD5/YLR032W:SIC1/YLR079W:SLX4/YLR135W:RNH203/YLR154C:TFS1/Y LR178C:TOP3/YLR234W:MMS22/YLR320W:RPL6B/YLR448W:YAP1/YML007W:TS A1/YML028W:MFT1/YML062C:RAD10/YML095C:MSC1/YML128C:IMP2/YMR035W :SUB1/YMR039C:CSM3/YMR048W:CTF18/YMR078C:MRE11/YMR224C:RPL16B/Y NL069C:EAF7/YNL136W:RTS1/YOR014W:HST3/YOR025W:AZF1/YOR113W:ELG1 /YOR144C:NFI1/YOR156C:LIP5/YOR196C:MCT1/YOR221C:DDC1/YPL194W:RLF2 /YPR018W:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W 7059 chromoso 9.25E- DCC1/YCL016C:MRC1/YCL061C:CTF8/YHR191C:CSM2/YIL132C:TOP3/YLR234W: me 08 MMS22/YLR320W:CSM3/YMR048W:CTF18/YMR078C:CIK1/YMR198W:RTS1/YOR segregatio 014W:ELG1/YOR144C:NFI1/YOR156C:CTF4/YPR135W n 50794 regulation 2.07E- MRC1/YCL061C:PTC1/YDL006W:GET3/YDL100C:UBC13/YDR092W:DPB4/YDR12 of cellular 07 1W:RAD9/YDR217C:DOT1/YDR440W:SPT2/YER161C:CHD1/YER164W:RAD24/YE process R173W:MMS2/YGL087C:ORM1/YGR038W:RTT107/YHR154W:RTT101/YJL047C:A SF1/YJL115W:RTT109/YLL002W:RAD5/YLR032W:SIC1/YLR079W:TFS1/YLR178C :TOP3/YLR234W:YAP1/YML007W:TSA1/YML028W:SUB1/YMR039C:CSM3/YMR04 8W:MRE11/YMR224C:EAF7/YNL136W:MDG1/YNL173C:RTS1/YOR014W:HST3/Y OR025W:AZF1/YOR113W:ELG1/YOR144C:BEM4/YPL161C:DDC1/YPL194W:RLF2 /YPR018W:CLB5/YPR120C:MMS1/YPR164W 51327 M phase 2.62E- RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:DOT1/YDR440W:RAD51/YE of meiotic 07 R095W:RAD24/YER173W:CSM2/YIL132C:TOP3/YLR234W:MMS22/YLR320W:RA cell cycle D10/YML095C:MSC1/YML128C:CSM3/YMR048W:CIK1/YMR198W:MRE11/YMR22 4C:RTS1/YOR014W:DDC1/YPL194W 7126 meiosis 2.62E- RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:DOT1/YDR440W:RAD51/YE 07 R095W:RAD24/YER173W:CSM2/YIL132C:TOP3/YLR234W:MMS22/YLR320W:RA D10/YML095C:MSC1/YML128C:CSM3/YMR048W:CIK1/YMR198W:MRE11/YMR22 4C:RTS1/YOR014W:DDC1/YPL194W 50789 regulation 2.73E- MRC1/YCL061C:PTC1/YDL006W:GET3/YDL100C:UBC13/YDR092W:DPB4/YDR12 of 07 1W:RAD9/YDR217C:DOT1/YDR440W:SPT2/YER161C:CHD1/YER164W:RAD24/YE biological R173W:MMS2/YGL087C:RAD54/YGL163C:ORM1/YGR038W:RTT107/YHR154W:R process TT101/YJL047C:ASF1/YJL115W:RTT109/YLL002W:RAD5/YLR032W:SIC1/YLR079 W:TFS1/YLR178C:TOP3/YLR234W:YAP1/YML007W:TSA1/YML028W:SUB1/YMR0 39C:CSM3/YMR048W:MRE11/YMR224C:EAF7/YNL136W:MDG1/YNL173C:RTS1/Y OR014W:HST3/YOR025W:AZF1/YOR113W:ELG1/YOR144C:BEM4/YPL161C:DDC 1/YPL194W:RLF2/YPR018W:CLB5/YPR120C:MMS1/YPR164W 16043 cellular 2.99E- NUP60/YAR002W:DCC1/YCL016C:MRC1/YCL061C:PTC1/YDL006W:RAD59/YDL0 componen 07 59C:GET3/YDL100C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:XRS t 2/YDR369C:DOT1/YDR440W:RAD51/YER095W:SLX8/YER116C:SPT2/YER161C:C organizati HD1/YER164W:SGF73/YGL066W:MMS2/YGL087C:RAD54/YGL163C:PEX4/YGR13 on 3W:RRM3/YHR031C:CTF8/YHR191C:SKN7/YHR206W:RTT101/YJL047C:ASF1/YJ L115W:NUP133/YKR082W:RTT109/YLL002W:RAD5/YLR032W:TOP3/YLR234W:M MS22/YLR320W:RPL6B/YLR448W:IMP2/YMR035W:SUB1/YMR039C:CSM3/YMR0 48W:CTF18/YMR078C:CIK1/YMR198W:EAF7/YNL136W:RTS1/YOR014W:HST3/Y OR025W:ELG1/YOR144C:NFI1/YOR156C:BEM4/YPL161C:RLF2/YPR018W:CLB5/ YPR120C:CTF4/YPR135W 51321 meiotic 3.36E- RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:DOT1/YDR440W:RAD51/YE cell cycle 07 R095W:RAD24/YER173W:CSM2/YIL132C:TOP3/YLR234W:MMS22/YLR320W:RA D10/YML095C:MSC1/YML128C:CSM3/YMR048W:CIK1/YMR198W:MRE11/YMR22 4C:RTS1/YOR014W:DDC1/YPL194W 7062 sister 3.54E- DCC1/YCL016C:MRC1/YCL061C:CTF8/YHR191C:TOP3/YLR234W:CSM3/YMR048 chromatid 07 W:CTF18/YMR078C:RTS1/YOR014W:ELG1/YOR144C:CTF4/YPR135W cohesion 71840 cellular 3.57E- NUP60/YAR002W:RPS8A/YBL072C:DCC1/YCL016C:MRC1/YCL061C:PTC1/YDL00 componen 07 6W:RAD59/YDL059C:GET3/YDL100C:RAD57/YDR004W:RAD55/YDR076W:UBC1 t 3/YDR092W:XRS2/YDR369C:DOT1/YDR440W:RAD51/YER095W:SLX8/YER116C: organizati SPT2/YER161C:CHD1/YER164W:SGF73/YGL066W:MMS2/YGL087C:RAD54/YGL1 on or 63C:ORM1/YGR038W:PEX4/YGR133W:RRM3/YHR031C:CTF8/YHR191C:SKN7/YH biogenesis R206W:RTT101/YJL047C:ASF1/YJL115W:NUP133/YKR082W:RTT109/YLL002W: RAD5/YLR032W:TOP3/YLR234W:MMS22/YLR320W:RPL6B/YLR448W:IMP2/YMR0 35W:SUB1/YMR039C:CSM3/YMR048W:CTF18/YMR078C:CIK1/YMR198W:EAF7/Y

NL136W:RTS1/YOR014W:HST3/YOR025W:ELG1/YOR144C:NFI1/YOR156C:BEM4 /YPL161C:RLF2/YPR018W:CLB5/YPR120C:CTF4/YPR135W 9059 macromol 1.13E- RPS8A/YBL072C:MRC1/YCL061C:DPB4/YDR121W:RAD9/YDR217C:DOT1/YDR44 ecule 06 0W:SPT2/YER161C:CHD1/YER164W:ORM1/YGR038W:RRM3/YHR031C:THP2/YH biosynthet R167W:SKN7/YHR206W:RTT101/YJL047C:ASF1/YJL115W:POL32/YJR043C:RTT1 ic process 09/YLL002W:SLX4/YLR135W:RNH203/YLR154C:TOP3/YLR234W:MMS22/YLR320 W:RPL6B/YLR448W:YAP1/YML007W:TSA1/YML028W:MFT1/YML062C:SUB1/YMR 039C:CSM3/YMR048W:MRE11/YMR224C:RPL16B/YNL069C:EAF7/YNL136W:HST 3/YOR025W:AZF1/YOR113W:ELG1/YOR144C:RLF2/YPR018W:CLB5/YPR120C:CT F4/YPR135W:MMS1/YPR164W 7064 mitotic 1.46E- DCC1/YCL016C:MRC1/YCL061C:CTF8/YHR191C:TOP3/YLR234W:CSM3/YMR048 sister 06 W:CTF18/YMR078C:ELG1/YOR144C:CTF4/YPR135W chromatid cohesion 32200 telomere 1.96E- MRC1/YCL061C:RAD59/YDL059C:RAD57/YDR004W:XRS2/YDR369C:RAD51/YER organizati 06 095W:SLX8/YER116C:RAD54/YGL163C:TOP3/YLR234W:ELG1/YOR144C on 60249 anatomica 1.96E- MRC1/YCL061C:RAD59/YDL059C:RAD57/YDR004W:XRS2/YDR369C:RAD51/YER l structure 06 095W:SLX8/YER116C:RAD54/YGL163C:TOP3/YLR234W:ELG1/YOR144C homeosta sis 723 telomere 1.96E- MRC1/YCL061C:RAD59/YDL059C:RAD57/YDR004W:XRS2/YDR369C:RAD51/YER maintenan 06 095W:SLX8/YER116C:RAD54/YGL163C:TOP3/YLR234W:ELG1/YOR144C ce 819 sister 2.53E- DCC1/YCL016C:MRC1/YCL061C:CTF8/YHR191C:TOP3/YLR234W:MMS22/YLR320 chromatid 06 W:CSM3/YMR048W:CTF18/YMR078C:CIK1/YMR198W:ELG1/YOR144C:CTF4/YPR segregatio 135W n 34645 cellular 4.03E- RPS8A/YBL072C:MRC1/YCL061C:DPB4/YDR121W:RAD9/YDR217C:DOT1/YDR44 macromol 06 0W:SPT2/YER161C:CHD1/YER164W:RRM3/YHR031C:THP2/YHR167W:SKN7/YHR ecule 206W:RTT101/YJL047C:ASF1/YJL115W:POL32/YJR043C:RTT109/YLL002W:SLX4 biosynthet /YLR135W:RNH203/YLR154C:TOP3/YLR234W:MMS22/YLR320W:RPL6B/YLR448 ic process W:YAP1/YML007W:TSA1/YML028W:MFT1/YML062C:SUB1/YMR039C:CSM3/YMR 048W:MRE11/YMR224C:RPL16B/YNL069C:EAF7/YNL136W:HST3/YOR025W:AZF 1/YOR113W:ELG1/YOR144C:RLF2/YPR018W:CLB5/YPR120C:CTF4/YPR135W:MM S1/YPR164W 9987 cellular 4.85E- NUP60/YAR002W:RPS8A/YBL072C:DCC1/YCL016C:MRC1/YCL061C:PTC1/YDL00 process 06 6W:RAD59/YDL059C:GET3/YDL100C:RAD57/YDR004W:RAD55/YDR076W:UBC1 3/YDR092W:DPB4/YDR121W:RAD9/YDR217C:XRS2/YDR369C:DOT1/YDR440W: RAD51/YER095W:SLX8/YER116C:SPT2/YER161C:CHD1/YER164W:RAD24/YER17 3W:SGF73/YGL066W:MMS2/YGL087C:RAD54/YGL163C:ORM1/YGR038W:PEX4/ YGR133W:RRM3/YHR031C:WSS1/YHR134W:RTT107/YHR154W:THP2/YHR167W :CTF8/YHR191C:SKN7/YHR206W:CSM2/YIL132C:AIM22/YJL046W:RTT101/YJL0 47C:ASF1/YJL115W:POL32/YJR043C:YKL069W:MRS4/YKR052C:NUP133/YKR082 W:RTT109/YLL002W:RAD5/YLR032W:SIC1/YLR079W:SLX4/YLR135W:RNH203/Y LR154C:TFS1/YLR178C:TOP3/YLR234W:MMS22/YLR320W:RPL6B/YLR448W:YAP 1/YML007W:TSA1/YML028W:MFT1/YML062C:RAD10/YML095C:MSC1/YML128C:I MP2/YMR035W:SUB1/YMR039C:CSM3/YMR048W:CTF18/YMR078C:CIK1/YMR19 8W:MRE11/YMR224C:RPL16B/YNL069C:EAF7/YNL136W:MDG1/YNL173C:TEX1/Y NL253W:RTS1/YOR014W:HST3/YOR025W:AZF1/YOR113W:ELG1/YOR144C:NFI1 /YOR156C:LIP5/YOR196C:MCT1/YOR221C:BEM4/YPL161C:DDC1/YPL194W:RLF2 /YPR018W:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W 31570 DNA 8.57E- MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/YER173W:TSA1/YML02 integrity 06 8W:CSM3/YMR048W:DDC1/YPL194W checkpoint 48523 negative 1.29E- MRC1/YCL061C:DPB4/YDR121W:RAD9/YDR217C:DOT1/YDR440W:SPT2/YER161 regulation 05 C:RAD24/YER173W:ORM1/YGR038W:RTT107/YHR154W:RTT101/YJL047C:ASF1 of cellular /YJL115W:RTT109/YLL002W:SIC1/YLR079W:TSA1/YML028W:CSM3/YMR048W:R process TS1/YOR014W:HST3/YOR025W:ELG1/YOR144C:DDC1/YPL194W:RLF2/YPR018W :MMS1/YPR164W 48519 negative 1.93E- MRC1/YCL061C:DPB4/YDR121W:RAD9/YDR217C:DOT1/YDR440W:SPT2/YER161 regulation 05 C:RAD24/YER173W:ORM1/YGR038W:RTT107/YHR154W:RTT101/YJL047C:ASF1 of /YJL115W:RTT109/YLL002W:SIC1/YLR079W:TSA1/YML028W:CSM3/YMR048W:R biological TS1/YOR014W:HST3/YOR025W:ELG1/YOR144C:DDC1/YPL194W:RLF2/YPR018W process :MMS1/YPR164W 10526 negative 1.97E- RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS1/Y regulation 05 PR164W

of transpositi on, RNA- mediated 10529 negative 1.97E- RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS1/Y regulation 05 PR164W of transpositi on 45005 maintenan 1.97E- MRC1/YCL061C:RTT101/YJL047C:MMS22/YLR320W:CSM3/YMR048W:MMS1/YPR ce of 05 164W fidelity involved in DNA- dependent DNA replication 70 mitotic 2.12E- DCC1/YCL016C:MRC1/YCL061C:CTF8/YHR191C:TOP3/YLR234W:CSM3/YMR048 sister 05 W:CTF18/YMR078C:CIK1/YMR198W:ELG1/YOR144C:CTF4/YPR135W chromatid segregatio n 278 mitotic 5.06E- DCC1/YCL016C:MRC1/YCL061C:RAD9/YDR217C:CTF8/YHR191C:RTT101/YJL047 cell cycle 05 C:SIC1/YLR079W:TOP3/YLR234W:CSM3/YMR048W:CTF18/YMR078C:CIK1/YMR 198W:RTS1/YOR014W:ELG1/YOR144C:DDC1/YPL194W:CLB5/YPR120C:CTF4/YP R135W 727 double- 5.19E- RAD59/YDL059C:XRS2/YDR369C:POL32/YJR043C:MRE11/YMR224C:CTF4/YPR1 strand 05 35W break repair via break- induced replication 7067 mitosis 9.68E- DCC1/YCL016C:MRC1/YCL061C:CTF8/YHR191C:RTT101/YJL047C:TOP3/YLR234 05 W:CSM3/YMR048W:CTF18/YMR078C:CIK1/YMR198W:ELG1/YOR144C:CTF4/YPR 135W 280 nuclear 0.000 DCC1/YCL016C:MRC1/YCL061C:CTF8/YHR191C:RTT101/YJL047C:TOP3/YLR234 division 11 W:CSM3/YMR048W:CTF18/YMR078C:CIK1/YMR198W:ELG1/YOR144C:CTF4/YPR 135W 42770 signal 0.000 MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/YER173W:TSA1/YML02 transducti 12 8W:DDC1/YPL194W on in response to DNA damage 77 DNA 0.000 MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/YER173W:TSA1/YML02 damage 12 8W:DDC1/YPL194W checkpoint 7127 meiosis I 0.000 RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:DOT1/YDR440W:RAD51/YE 27 R095W:RAD24/YER173W:TOP3/YLR234W:RAD10/YML095C:MSC1/YML128C:MR E11/YMR224C 48285 organelle 0.000 DCC1/YCL016C:MRC1/YCL061C:CTF8/YHR191C:RTT101/YJL047C:TOP3/YLR234 fission 35 W:CSM3/YMR048W:CTF18/YMR078C:CIK1/YMR198W:ELG1/YOR144C:CTF4/YPR 135W 10525 regulation 0.000 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS1/Y of 41 PR164W transpositi on, RNA- mediated 10528 regulation 0.000 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS1/Y of 41 PR164W transpositi on 87 M phase 0.000 DCC1/YCL016C:MRC1/YCL061C:CTF8/YHR191C:RTT101/YJL047C:TOP3/YLR234 of mitotic 52 W:CSM3/YMR048W:CTF18/YMR078C:CIK1/YMR198W:ELG1/YOR144C:CTF4/YPR cell cycle 135W

19222 regulation 0.000 MRC1/YCL061C:PTC1/YDL006W:DPB4/YDR121W:RAD9/YDR217C:DOT1/YDR440 of 57 W:SPT2/YER161C:CHD1/YER164W:RAD54/YGL163C:ORM1/YGR038W:ASF1/YJL metabolic 115W:RTT109/YLL002W:SIC1/YLR079W:TFS1/YLR178C:TOP3/YLR234W:YAP1/Y process ML007W:TSA1/YML028W:SUB1/YMR039C:CSM3/YMR048W:MRE11/YMR224C:EA F7/YNL136W:HST3/YOR025W:AZF1/YOR113W:ELG1/YOR144C:RLF2/YPR018W: CLB5/YPR120C 42592 homeostat 0.000 MRC1/YCL061C:RAD59/YDL059C:RAD57/YDR004W:UBC13/YDR092W:XRS2/YD ic process 66 R369C:RAD51/YER095W:SLX8/YER116C:MMS2/YGL087C:RAD54/YGL163C:RAD 5/YLR032W:TOP3/YLR234W:TSA1/YML028W:ELG1/YOR144C 30491 heterodupl 0.000 RAD57/YDR004W:RAD55/YDR076W:RAD51/YER095W:RAD54/YGL163C ex 76 formation 6301 postreplic 0.001 UBC13/YDR092W:DOT1/YDR440W:MMS2/YGL087C:POL32/YJR043C:RAD5/YLR0 ation 11 32W repair 71156 regulation 0.001 MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/YER173W:TSA1/YML02 of cell 35 8W:CSM3/YMR048W:RTS1/YOR014W:DDC1/YPL194W cycle arrest 75 cell cycle 0.001 MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/YER173W:TSA1/YML02 checkpoint 35 8W:CSM3/YMR048W:RTS1/YOR014W:DDC1/YPL194W 60255 regulation 0.001 MRC1/YCL061C:DPB4/YDR121W:RAD9/YDR217C:DOT1/YDR440W:SPT2/YER161 of 39 C:CHD1/YER164W:ORM1/YGR038W:ASF1/YJL115W:RTT109/YLL002W:TFS1/YLR macromol 178C:TOP3/YLR234W:YAP1/YML007W:TSA1/YML028W:SUB1/YMR039C:CSM3/Y ecule MR048W:MRE11/YMR224C:EAF7/YNL136W:HST3/YOR025W:AZF1/YOR113W:EL metabolic G1/YOR144C:RLF2/YPR018W:CLB5/YPR120C process 43618 regulation 0.001 ASF1/YJL115W:RTT109/YLL002W:YAP1/YML007W:SUB1/YMR039C of 75 transcripti on from RNA polymeras e II promoter in response to stress 722 telomere 0.001 RAD59/YDL059C:RAD57/YDR004W:RAD51/YER095W:RAD54/YGL163C maintenan 75 ce via recombina tion 726 non- 0.001 RAD59/YDL059C:XRS2/YDR369C:RTT109/YLL002W:SLX4/YLR135W:RAD10/YML recombina 81 095C:MRE11/YMR224C tional repair 7050 cell cycle 0.002 MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/YER173W:TSA1/YML02 arrest 15 8W:CSM3/YMR048W:RTS1/YOR014W:DDC1/YPL194W 45786 negative 0.002 MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/YER173W:TSA1/YML02 regulation 49 8W:CSM3/YMR048W:RTS1/YOR014W:DDC1/YPL194W of cell cycle 32196 transpositi 0.002 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS1/Y on 5 PR164W 32197 transpositi 0.002 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS1/Y on, RNA- 5 PR164W mediated 10994 free 0.002 UBC13/YDR092W:MMS2/YGL087C:RAD5/YLR032W ubiquitin 8 chain polymeriz ation 31297 replication 0.002 RTT101/YJL047C:MMS22/YLR320W:MMS1/YPR164W fork 8 processing

23046 signaling 0.002 MRC1/YCL061C:PTC1/YDL006W:GET3/YDL100C:RAD9/YDR217C:DOT1/YDR440 process 91 W:RAD24/YER173W:PEX4/YGR133W:TFS1/YLR178C:TSA1/YML028W:CSM3/YMR 048W:MDG1/YNL173C:RTS1/YOR014W:BEM4/YPL161C:DDC1/YPL194W 31323 regulation 0.003 MRC1/YCL061C:PTC1/YDL006W:DPB4/YDR121W:RAD9/YDR217C:DOT1/YDR440 of cellular 4 W:SPT2/YER161C:CHD1/YER164W:ORM1/YGR038W:ASF1/YJL115W:RTT109/YL metabolic L002W:SIC1/YLR079W:TOP3/YLR234W:YAP1/YML007W:TSA1/YML028W:SUB1/ process YMR039C:CSM3/YMR048W:MRE11/YMR224C:EAF7/YNL136W:HST3/YOR025W:A ZF1/YOR113W:ELG1/YOR144C:RLF2/YPR018W:CLB5/YPR120C 10564 regulation 0.003 MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/YER173W:RTT101/YJL of cell 81 047C:TSA1/YML028W:CSM3/YMR048W:RTS1/YOR014W:DDC1/YPL194W:CLB5/ cycle YPR120C process 80090 regulation 0.004 MRC1/YCL061C:DPB4/YDR121W:RAD9/YDR217C:DOT1/YDR440W:SPT2/YER161 of primary 47 C:CHD1/YER164W:ORM1/YGR038W:ASF1/YJL115W:RTT109/YLL002W:TFS1/YLR metabolic 178C:TOP3/YLR234W:YAP1/YML007W:TSA1/YML028W:SUB1/YMR039C:CSM3/Y process MR048W:MRE11/YMR224C:EAF7/YNL136W:HST3/YOR025W:AZF1/YOR113W:EL G1/YOR144C:RLF2/YPR018W:CLB5/YPR120C 19219 regulation 0.005 MRC1/YCL061C:DPB4/YDR121W:RAD9/YDR217C:DOT1/YDR440W:SPT2/YER161 of 44 C:CHD1/YER164W:ASF1/YJL115W:RTT109/YLL002W:TOP3/YLR234W:YAP1/YML nucleobas 007W:SUB1/YMR039C:CSM3/YMR048W:MRE11/YMR224C:EAF7/YNL136W:HST3 e, /YOR025W:AZF1/YOR113W:ELG1/YOR144C:RLF2/YPR018W:CLB5/YPR120C nucleoside , nucleotide and nucleic acid metabolic process 51171 regulation 0.005 MRC1/YCL061C:DPB4/YDR121W:RAD9/YDR217C:DOT1/YDR440W:SPT2/YER161 of 93 C:CHD1/YER164W:ASF1/YJL115W:RTT109/YLL002W:TOP3/YLR234W:YAP1/YML nitrogen 007W:SUB1/YMR039C:CSM3/YMR048W:MRE11/YMR224C:EAF7/YNL136W:HST3 compound /YOR025W:AZF1/YOR113W:ELG1/YOR144C:RLF2/YPR018W:CLB5/YPR120C metabolic process 51726 regulation 0.006 MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/YER173W:RTT101/YJL of cell 27 047C:SIC1/YLR079W:TSA1/YML028W:CSM3/YMR048W:RTS1/YOR014W:DDC1/ cycle YPL194W:CLB5/YPR120C 16070 RNA 0.007 RPS8A/YBL072C:MRC1/YCL061C:PTC1/YDL006W:DPB4/YDR121W:RAD9/YDR21 metabolic 14 7C:DOT1/YDR440W:SPT2/YER161C:CHD1/YER164W:THP2/YHR167W:RTT101/Y process JL047C:ASF1/YJL115W:POL32/YJR043C:MRS4/YKR052C:RTT109/YLL002W:RNH 203/YLR154C:YAP1/YML007W:MFT1/YML062C:SUB1/YMR039C:MRE11/YMR224 C:EAF7/YNL136W:HST3/YOR025W:AZF1/YOR113W:RLF2/YPR018W:MMS1/YPR1 64W 44249 cellular 0.007 RPS8A/YBL072C:MRC1/YCL061C:DPB4/YDR121W:RAD9/YDR217C:DOT1/YDR44 biosynthet 23 0W:SPT2/YER161C:CHD1/YER164W:ORM1/YGR038W:RRM3/YHR031C:THP2/YH ic process R167W:SKN7/YHR206W:RTT101/YJL047C:ASF1/YJL115W:POL32/YJR043C:RTT1 09/YLL002W:SLX4/YLR135W:RNH203/YLR154C:TOP3/YLR234W:MMS22/YLR320 W:RPL6B/YLR448W:YAP1/YML007W:TSA1/YML028W:MFT1/YML062C:SUB1/YMR 039C:CSM3/YMR048W:MRE11/YMR224C:RPL16B/YNL069C:EAF7/YNL136W:HST 3/YOR025W:AZF1/YOR113W:ELG1/YOR144C:RLF2/YPR018W:CLB5/YPR120C:CT F4/YPR135W:MMS1/YPR164W 6312 mitotic 0.007 RAD59/YDL059C:RAD57/YDR004W:RAD51/YER095W:RAD54/YGL163C:SLX4/YL recombina 25 R135W:RAD10/YML095C tion 6289 nucleotide 0.009 RAD9/YDR217C:DOT1/YDR440W:RAD24/YER173W:POL32/YJR043C:RAD10/YML -excision 11 095C repair 7165 signal 0.009 MRC1/YCL061C:PTC1/YDL006W:GET3/YDL100C:RAD9/YDR217C:DOT1/YDR440 transducti 95 W:RAD24/YER173W:TFS1/YLR178C:TSA1/YML028W:CSM3/YMR048W:MDG1/YN on L173C:RTS1/YOR014W:BEM4/YPL161C:DDC1/YPL194W

GO term enrichment for single mutant screen of non-essential genes in the presence of phleomycin

GOID GO_term P- Gene(s) annotated to the term value 6974 response to 2.62E PIN4/YBL051C:RAD16/YBR114W:DCC1/YCL016C:MRC1/YCL061C:SLX5/YD DNA damage -20 L013W:RPN4/YDL020C:RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076 stimulus W:UBC13/YDR092W:RAD9/YDR217C:XRS2/YDR369C:DOT1/YDR440W:SLX 8/YER116C:RAD24/YER173W:RAD54/YGL163C:SHU1/YHL006C:RTT107/YH R154W:CTF8/YHR191C:CSM2/YIL132C:MPH1/YIR002C:RTT101/YJL047C:P OL32/YJR043C:RTT109/YLL002W:RAD5/YLR032W:MMS22/YLR320W:TSA1/ YML028W:RAD10/YML095C:CSM3/YMR048W:EAF7/YNL136W:ELG1/YOR14 4C:RAD17/YOR368W:DDC1/YPL194W:CTF4/YPR135W:MMS1/YPR164W 6281 DNA repair 8.55E RAD16/YBR114W:MRC1/YCL061C:RPN4/YDL020C:RAD59/YDL059C:RAD57 -16 /YDR004W:RAD55/YDR076W:UBC13/YDR092W:RAD9/YDR217C:XRS2/YDR 369C:DOT1/YDR440W:RAD24/YER173W:RAD54/YGL163C:SHU1/YHL006C: RTT107/YHR154W:CSM2/YIL132C:MPH1/YIR002C:POL32/YJR043C:RTT109 /YLL002W:RAD5/YLR032W:MMS22/YLR320W:RAD10/YML095C:CSM3/YMR 048W:EAF7/YNL136W:ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W: CTF4/YPR135W:MMS1/YPR164W 6259 DNA metabolic 1.69E RAD16/YBR114W:MRC1/YCL061C:SLX5/YDL013W:RPN4/YDL020C:RAD59/ process -15 YDL059C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:RAD9/YDR 217C:XRS2/YDR369C:DOT1/YDR440W:RAD51/YER095W:SLX8/YER116C:R AD24/YER173W:RAD54/YGL163C:SHU1/YHL006C:RTT107/YHR154W:THP2 /YHR167W:CSM2/YIL132C:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR04 3C:RTT109/YLL002W:RAD5/YLR032W:MMS22/YLR320W:TSA1/YML028W:R AD10/YML095C:CSM3/YMR048W:EAF7/YNL136W:ELG1/YOR144C:RAD17/Y OR368W:CHL1/YPL008W:DDC1/YPL194W:CLB5/YPR120C:CTF4/YPR135W: MMS1/YPR164W 33554 cellular 1.97E PIN4/YBL051C:RAD16/YBR114W:DCC1/YCL016C:MRC1/YCL061C:SLX5/YD response to -14 L013W:RPN4/YDL020C:RAD59/YDL059C:ARF1/YDL192W:RAD57/YDR004W stress :RAD55/YDR076W:UBC13/YDR092W:RAD9/YDR217C:XRS2/YDR369C:DOT 1/YDR440W:SLX8/YER116C:RAD24/YER173W:RAD54/YGL163C:SHU1/YHL 006C:RTT107/YHR154W:CTF8/YHR191C:SKN7/YHR206W:CSM2/YIL132C: MPH1/YIR002C:RTT101/YJL047C:ASF1/YJL115W:POL32/YJR043C:YKL069 W:RTT109/YLL002W:RAD5/YLR032W:SIC1/YLR079W:MMS22/YLR320W:TS A1/YML028W:RAD10/YML095C:CSM3/YMR048W:EAF7/YNL136W:ELG1/YO R144C:RAD17/YOR368W:DDC1/YPL194W:CTF4/YPR135W:MMS1/YPR164W 725 recombinational 7.28E RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:DOT repair -13 1/YDR440W:RAD54/YGL163C:SHU1/YHL006C:CSM2/YIL132C:POL32/YJR0 43C:MMS22/YLR320W:ELG1/YOR144C:DDC1/YPL194W:CTF4/YPR135W:M MS1/YPR164W 6950 response to 1.39E PIN4/YBL051C:RAD16/YBR114W:TPS1/YBR126C:DCC1/YCL016C:MRC1/YC stress -12 L061C:SLX5/YDL013W:RPN4/YDL020C:RAD59/YDL059C:GET3/YDL100C:A RF1/YDL192W:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:RAD 9/YDR217C:XRS2/YDR369C:DOT1/YDR440W:SLX8/YER116C:RAD24/YER1 73W:RAD54/YGL163C:SHU1/YHL006C:RTT107/YHR154W:CTF8/YHR191C: SKN7/YHR206W:CSM2/YIL132C:MPH1/YIR002C:MGA2/YIR033W:RTT101/Y JL047C:ASF1/YJL115W:POL32/YJR043C:YKL069W:RTT109/YLL002W:RAD5 /YLR032W:SIC1/YLR079W:MMS22/YLR320W:TSA1/YML028W:RAD10/YML0 95C:CSM3/YMR048W:EAF7/YNL136W:ELG1/YOR144C:RAD17/YOR368W:D DC1/YPL194W:CTF4/YPR135W:MMS1/YPR164W 51716 cellular 1.49E PIN4/YBL051C:RAD16/YBR114W:DCC1/YCL016C:MRC1/YCL061C:SLX5/YD response to -11 L013W:RPN4/YDL020C:RAD59/YDL059C:GET3/YDL100C:ARF1/YDL192W:R stimulus AD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:RAD9/YDR217C:XRS 2/YDR369C:DOT1/YDR440W:SLX8/YER116C:RAD24/YER173W:RAD54/YGL 163C:SHU1/YHL006C:RTT107/YHR154W:CTF8/YHR191C:SKN7/YHR206W: CSM2/YIL132C:MPH1/YIR002C:RTT101/YJL047C:ASF1/YJL115W:POL32/YJ R043C:YKL069W:RTT109/YLL002W:RAD5/YLR032W:SIC1/YLR079W:MMS2 2/YLR320W:TSA1/YML028W:RAD10/YML095C:CSM3/YMR048W:EAF7/YNL1 36W:ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W:CTF4/YPR135W:M MS1/YPR164W

6310 DNA 7.08E RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:DOT recombination -11 1/YDR440W:RAD51/YER095W:RAD24/YER173W:RAD54/YGL163C:SHU1/Y HL006C:THP2/YHR167W:CSM2/YIL132C:MPH1/YIR002C:POL32/YJR043C: MMS22/YLR320W:RAD10/YML095C:ELG1/YOR144C:RAD17/YOR368W:CHL 1/YPL008W:DDC1/YPL194W:CTF4/YPR135W:MMS1/YPR164W 16192 vesicle- 2.91E VPS8/YAL002W:DRS2/YAL026C:FEN1/YCR034W:VAM6/YDL077C:GET3/YDL mediated -09 100C:ARF1/YDL192W:VPS41/YDR080W:RVS167/YDR388W:GET2/YER083C transport :VAM7/YGL212W:ART5/YGR068C:GOS1/YHL031C:VPS29/YHR012W:GGA2/ YHR108W:VPS53/YJL029C:PEP8/YJL053W:VPS35/YJL154C:VPS51/YKR020 W:RIC1/YLR039C:YPT6/YLR262C:COG8/YML071C:COG6/YNL041C:COG5/Y NL051W:BRE5/YNR051C:TLG2/YOL018C:VAM3/YOR106W:VPS17/YOR132 W:ARL3/YPL051W:KES1/YPL145C 22403 cell cycle phase 7.42E PIN4/YBL051C:DCC1/YCL016C:MRC1/YCL061C:RPN4/YDL020C:RAD57/YD -09 R004W:RAD61/YDR014W:RAD55/YDR076W:RAD9/YDR217C:XRS2/YDR369 C:DOT1/YDR440W:RAD51/YER095W:RAD24/YER173W:CTF8/YHR191C:CS M2/YIL132C:RTT101/YJL047C:SAP190/YKR028W:SET3/YKR029C:SIC1/YLR 079W:MMS22/YLR320W:RAD10/YML095C:CSM3/YMR048W:ELG1/YOR144C :RAD17/YOR368W:CHL1/YPL008W:DDC1/YPL194W:CLB2/YPR119W:CLB5/ YPR120C:CTF4/YPR135W 90304 nucleic acid 1.63E RPS8A/YBL072C:RAD16/YBR114W:MRC1/YCL061C:SLX5/YDL013W:RPN4/Y metabolic -08 DL020C:RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR process 092W:RAD9/YDR217C:XRS2/YDR369C:DOT1/YDR440W:RAD51/YER095W: SLX8/YER116C:RAD24/YER173W:RAD54/YGL163C:SHU1/YHL006C:STP2/Y HR006W:RTT107/YHR154W:THP2/YHR167W:SKN7/YHR206W:CSM2/YIL13 2C:MPH1/YIR002C:DAL81/YIR023W:MGA2/YIR033W:RTT101/YJL047C:ASF 1/YJL115W:POL32/YJR043C:CBF1/YJR060W:CTK1/YKL139W:SAP190/YKR0 28W:SET3/YKR029C:RTT109/YLL002W:RAD5/YLR032W:MMS22/YLR320W: TSA1/YML028W:RAD10/YML095C:GTR1/YML121W:CSM3/YMR048W:EAF7/ YNL136W:HTZ1/YOL012C:AZF1/YOR113W:ELG1/YOR144C:RAD17/YOR368 W:CHL1/YPL008W:DDC1/YPL194W:LEA1/YPL213W:CLB5/YPR120C:CTF4/Y PR135W:MMS1/YPR164W 50896 response to 1.79E PIN4/YBL051C:RAD16/YBR114W:TPS1/YBR126C:DCC1/YCL016C:MRC1/YC stimulus -08 L061C:SLX5/YDL013W:RPN4/YDL020C:RAD59/YDL059C:GET3/YDL100C:A RF1/YDL192W:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:RAD 9/YDR217C:XRS2/YDR369C:DOT1/YDR440W:SLX8/YER116C:RAD24/YER1 73W:RAD54/YGL163C:SHU1/YHL006C:RTT107/YHR154W:CTF8/YHR191C: SKN7/YHR206W:CSM2/YIL132C:MPH1/YIR002C:MGA2/YIR033W:RTT101/Y JL047C:ASF1/YJL115W:POL32/YJR043C:YKL069W:RTT109/YLL002W:RAD5 /YLR032W:SIC1/YLR079W:MMS22/YLR320W:TSA1/YML028W:RAD10/YML0 95C:CSM3/YMR048W:EAF7/YNL136W:AZF1/YOR113W:ELG1/YOR144C:RA D17/YOR368W:DDC1/YPL194W:CTF4/YPR135W:MMS1/YPR164W 6302 double-strand 1.96E RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:RAD break repair -08 54/YGL163C:RTT107/YHR154W:POL32/YJR043C:RTT109/YLL002W:RAD5/Y LR032W:MMS22/YLR320W:RAD10/YML095C:ELG1/YOR144C:RAD17/YOR3 68W:CTF4/YPR135W 65007 biological 4.18E PIN4/YBL051C:MRC1/YCL061C:SLX5/YDL013W:RPN4/YDL020C:RAD59/YD regulation -08 L059C:VAM6/YDL077C:GET3/YDL100C:RAD57/YDR004W:VPS41/YDR080W :UBC13/YDR092W:RAD9/YDR217C:XRS2/YDR369C:DOT1/YDR440W:RAD5 1/YER095W:SLX8/YER116C:RAD24/YER173W:RAD54/YGL163C:SMI1/YGR2 29C:STP2/YHR006W:RTT107/YHR154W:SKN7/YHR206W:MPH1/YIR002C:D AL81/YIR023W:MGA2/YIR033W:RTT101/YJL047C:PEP8/YJL053W:ASF1/YJL 115W:VPS35/YJL154C:HAL5/YJL165C:CBF1/YJR060W:CTK1/YKL139W:VPS 1/YKR001C:MEH1/YKR007W:VPS51/YKR020W:SAP190/YKR028W:SET3/YK R029C:RTT109/YLL002W:RAD5/YLR032W:SIC1/YLR079W:TSA1/YML028W: GTR1/YML121W:CSM3/YMR048W:EAF7/YNL136W:RHO5/YNL180C:BRE5/Y NR051C:HTZ1/YOL012C:AZF1/YOR113W:ELG1/YOR144C:RAD17/YOR368 W:CHL1/YPL008W:BEM4/YPL161C:DDC1/YPL194W:CLB2/YPR119W:CLB5/Y PR120C:MMS1/YPR164W 9987 cellular process 1.04E VPS8/YAL002W:DRS2/YAL026C:PIN4/YBL051C:RPS8A/YBL072C:RAD16/YB -07 R114W:TPS1/YBR126C:UBS1/YBR165W:DCC1/YCL016C:MRC1/YCL061C:F EN1/YCR034W:SLX5/YDL013W:RPN4/YDL020C:RAD59/YDL059C:VAM6/YD L077C:GET3/YDL100C:ARF1/YDL192W:DTD1/YDL219W:RAD57/YDR004W: RAD61/YDR014W:RAD55/YDR076W:VPS41/YDR080W:UBC13/YDR092W:R AD9/YDR217C:XRS2/YDR369C:RVS167/YDR388W:DOT1/YDR440W:GET2/ YER083C:RAD51/YER095W:SLX8/YER116C:RAD24/YER173W:YFR024C:RA D54/YGL163C:VAM7/YGL212W:ART5/YGR068C:SMI1/YGR229C:SHU1/YHL 006C:GOS1/YHL031C:STP2/YHR006W:VPS29/YHR012W:GGA2/YHR108W:

RTT107/YHR154W:THP2/YHR167W:PTH1/YHR189W:CTF8/YHR191C:SKN7/ YHR206W:CSM2/YIL132C:MPH1/YIR002C:DAL81/YIR023W:MGA2/YIR033 W:VPS53/YJL029C:RTT101/YJL047C:PEP8/YJL053W:ASF1/YJL115W:VPS35 /YJL154C:HAL5/YJL165C:POL32/YJR043C:CBF1/YJR060W:LIA1/YJR070C:Y KL069W:CTK1/YKL139W:VPS1/YKR001C:MEH1/YKR007W:VPS51/YKR020 W:SAP190/YKR028W:SET3/YKR029C:NUP133/YKR082W:RTT109/YLL002W :RAD5/YLR032W:RIC1/YLR039C:ERG3/YLR056W:SIC1/YLR079W:VPS63/YL R261C:YPT6/YLR262C:MMS22/YLR320W:ERG6/YML008C:TSA1/YML028W: VPS71/YML041C:COG8/YML071C:RAD10/YML095C:GTR1/YML121W:CSM3/ YMR048W:ADE17/YMR120C:ERG2/YMR202W:COG6/YNL041C:COG5/YNL05 1W:YDJ1/YNL064C:EAF7/YNL136W:PSD1/YNL169C:RHO5/YNL180C:BRE5/ YNR051C:HTZ1/YOL012C:TLG2/YOL018C:VAM3/YOR106W:INP53/YOR109 W:AZF1/YOR113W:VPS17/YOR132W:ELG1/YOR144C:RAD17/YOR368W:CH L1/YPL008W:ARL3/YPL051W:KES1/YPL145C:BEM4/YPL161C:DDC1/YPL194 W:LEA1/YPL213W:CLB2/YPR119W:CLB5/YPR120C:CTF4/YPR135W:MMS1/Y PR164W 31570 DNA integrity 1.66E PIN4/YBL051C:MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/Y checkpoint -07 ER173W:TSA1/YML028W:CSM3/YMR048W:RAD17/YOR368W:DDC1/YPL19 4W 7049 cell cycle 4.67E PIN4/YBL051C:DCC1/YCL016C:MRC1/YCL061C:RPN4/YDL020C:RAD57/YD -07 R004W:RAD61/YDR014W:RAD55/YDR076W:RAD9/YDR217C:XRS2/YDR369 C:DOT1/YDR440W:RAD51/YER095W:RAD24/YER173W:SMI1/YGR229C:CT F8/YHR191C:CSM2/YIL132C:RTT101/YJL047C:SAP190/YKR028W:SET3/YK R029C:SIC1/YLR079W:MMS22/YLR320W:TSA1/YML028W:RAD10/YML095C :CSM3/YMR048W:ELG1/YOR144C:RAD17/YOR368W:CHL1/YPL008W:DDC1 /YPL194W:CLB2/YPR119W:CLB5/YPR120C:CTF4/YPR135W 22402 cell cycle 7.12E PIN4/YBL051C:DCC1/YCL016C:MRC1/YCL061C:RPN4/YDL020C:RAD57/YD process -07 R004W:RAD61/YDR014W:RAD55/YDR076W:RAD9/YDR217C:XRS2/YDR369 C:DOT1/YDR440W:RAD51/YER095W:RAD24/YER173W:CTF8/YHR191C:CS M2/YIL132C:RTT101/YJL047C:SAP190/YKR028W:SET3/YKR029C:SIC1/YLR 079W:MMS22/YLR320W:TSA1/YML028W:RAD10/YML095C:CSM3/YMR048 W:ELG1/YOR144C:RAD17/YOR368W:CHL1/YPL008W:DDC1/YPL194W:CLB 2/YPR119W:CLB5/YPR120C:CTF4/YPR135W 6139 nucleobase, 8.24E RPS8A/YBL072C:RAD16/YBR114W:MRC1/YCL061C:SLX5/YDL013W:RPN4/Y nucleoside, -07 DL020C:RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR nucleotide and 092W:RAD9/YDR217C:XRS2/YDR369C:DOT1/YDR440W:RAD51/YER095W: nucleic acid SLX8/YER116C:RAD24/YER173W:RAD54/YGL163C:SHU1/YHL006C:STP2/Y metabolic HR006W:RTT107/YHR154W:THP2/YHR167W:SKN7/YHR206W:CSM2/YIL13 process 2C:MPH1/YIR002C:DAL81/YIR023W:MGA2/YIR033W:RTT101/YJL047C:ASF 1/YJL115W:POL32/YJR043C:CBF1/YJR060W:CTK1/YKL139W:SAP190/YKR0 28W:SET3/YKR029C:RTT109/YLL002W:RAD5/YLR032W:MMS22/YLR320W: TSA1/YML028W:RAD10/YML095C:GTR1/YML121W:CSM3/YMR048W:ADE17 /YMR120C:EAF7/YNL136W:HTZ1/YOL012C:AZF1/YOR113W:ELG1/YOR144 C:RAD17/YOR368W:CHL1/YPL008W:DDC1/YPL194W:LEA1/YPL213W:CLB5 /YPR120C:CTF4/YPR135W:MMS1/YPR164W 6996 organelle 1.59E DRS2/YAL026C:RAD16/YBR114W:DCC1/YCL016C:MRC1/YCL061C:SLX5/YD organization -06 L013W:RAD59/YDL059C:VAM6/YDL077C:GET3/YDL100C:RAD57/YDR004W :RAD61/YDR014W:VPS41/YDR080W:XRS2/YDR369C:DOT1/YDR440W:GET 2/YER083C:RAD51/YER095W:SLX8/YER116C:RAD54/YGL163C:VAM7/YGL2 12W:GOS1/YHL031C:PTH1/YHR189W:CTF8/YHR191C:RTT101/YJL047C:AS F1/YJL115W:CBF1/YJR060W:LIA1/YJR070C:VPS1/YKR001C:VPS51/YKR020 W:SET3/YKR029C:NUP133/YKR082W:RTT109/YLL002W:MMS22/YLR320W: VPS71/YML041C:CSM3/YMR048W:YDJ1/YNL064C:EAF7/YNL136W:TLG2/YO L018C:VAM3/YOR106W:ELG1/YOR144C:CHL1/YPL008W:BEM4/YPL161C:CL B2/YPR119W:CLB5/YPR120C:CTF4/YPR135W 42770 DNA damage 1.70E PIN4/YBL051C:MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/Y response, signal -06 ER173W:TSA1/YML028W:RAD17/YOR368W:DDC1/YPL194W transduction 77 DNA damage 1.70E PIN4/YBL051C:MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/Y checkpoint -06 ER173W:TSA1/YML028W:RAD17/YOR368W:DDC1/YPL194W 46907 intracellular 2.09E VPS8/YAL002W:DRS2/YAL026C:UBS1/YBR165W:GET3/YDL100C:ARF1/YDL transport -06 192W:GET2/YER083C:VAM7/YGL212W:GOS1/YHL031C:VPS29/YHR012W: GGA2/YHR108W:THP2/YHR167W:VPS53/YJL029C:PEP8/YJL053W:VPS35/Y JL154C:VPS1/YKR001C:VPS51/YKR020W:NUP133/YKR082W:RIC1/YLR039 C:VPS63/YLR261C:YPT6/YLR262C:VPS71/YML041C:COG8/YML071C:COG6/ YNL041C:COG5/YNL051W:YDJ1/YNL064C:BRE5/YNR051C:TLG2/YOL018C: VAM3/YOR106W:VPS17/YOR132W:ARL3/YPL051W:KES1/YPL145C

71842 cellular 2.86E DRS2/YAL026C:RAD16/YBR114W:DCC1/YCL016C:MRC1/YCL061C:SLX5/YD component -06 L013W:RAD59/YDL059C:VAM6/YDL077C:GET3/YDL100C:RAD57/YDR004W organization at :RAD61/YDR014W:RAD55/YDR076W:VPS41/YDR080W:UBC13/YDR092W:X cellular level RS2/YDR369C:RVS167/YDR388W:DOT1/YDR440W:GET2/YER083C:RAD51/ YER095W:SLX8/YER116C:RAD54/YGL163C:VAM7/YGL212W:GOS1/YHL031 C:PTH1/YHR189W:CTF8/YHR191C:RTT101/YJL047C:ASF1/YJL115W:CBF1/ YJR060W:LIA1/YJR070C:VPS1/YKR001C:VPS51/YKR020W:SET3/YKR029C: NUP133/YKR082W:RTT109/YLL002W:RAD5/YLR032W:MMS22/YLR320W:V PS71/YML041C:CSM3/YMR048W:YDJ1/YNL064C:EAF7/YNL136W:TLG2/YOL 018C:VAM3/YOR106W:ELG1/YOR144C:CHL1/YPL008W:BEM4/YPL161C:CL B2/YPR119W:CLB5/YPR120C:CTF4/YPR135W 279 M phase 2.99E DCC1/YCL016C:MRC1/YCL061C:RAD57/YDR004W:RAD61/YDR014W:RAD5 -06 5/YDR076W:XRS2/YDR369C:DOT1/YDR440W:RAD51/YER095W:RAD24/YE R173W:CTF8/YHR191C:CSM2/YIL132C:RTT101/YJL047C:SET3/YKR029C:M MS22/YLR320W:RAD10/YML095C:CSM3/YMR048W:ELG1/YOR144C:RAD17 /YOR368W:CHL1/YPL008W:DDC1/YPL194W:CLB5/YPR120C:CTF4/YPR135 W 42147 retrograde 3.14E VPS29/YHR012W:VPS53/YJL029C:PEP8/YJL053W:VPS35/YJL154C:VPS51/Y transport, -06 KR020W:RIC1/YLR039C:YPT6/YLR262C:VPS17/YOR132W endosome to Golgi 51276 chromosome 5.39E RAD16/YBR114W:DCC1/YCL016C:MRC1/YCL061C:SLX5/YDL013W:RAD59/ organization -06 YDL059C:RAD57/YDR004W:RAD61/YDR014W:XRS2/YDR369C:DOT1/YDR4 40W:RAD51/YER095W:SLX8/YER116C:RAD54/YGL163C:CTF8/YHR191C:A SF1/YJL115W:CBF1/YJR060W:SET3/YKR029C:RTT109/YLL002W:MMS22/YL R320W:VPS71/YML041C:CSM3/YMR048W:EAF7/YNL136W:ELG1/YOR144C: CHL1/YPL008W:CTF4/YPR135W 48193 Golgi vesicle 6.64E DRS2/YAL026C:GET3/YDL100C:ARF1/YDL192W:GET2/YER083C:VAM7/YGL transport -06 212W:GOS1/YHL031C:GGA2/YHR108W:VPS53/YJL029C:COG8/YML071C:C OG6/YNL041C:COG5/YNL051W:BRE5/YNR051C:TLG2/YOL018C:VAM3/YOR 106W:ARL3/YPL051W:KES1/YPL145C 724 double-strand 1.51E RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:RAD break repair via -05 54/YGL163C:POL32/YJR043C:ELG1/YOR144C:CTF4/YPR135W homologous recombination 51649 establishment of 2.36E VPS8/YAL002W:DRS2/YAL026C:UBS1/YBR165W:GET3/YDL100C:ARF1/YDL localization in -05 192W:GET2/YER083C:VAM7/YGL212W:GOS1/YHL031C:VPS29/YHR012W: cell GGA2/YHR108W:THP2/YHR167W:VPS53/YJL029C:PEP8/YJL053W:VPS35/Y JL154C:VPS1/YKR001C:VPS51/YKR020W:NUP133/YKR082W:RIC1/YLR039 C:VPS63/YLR261C:YPT6/YLR262C:VPS71/YML041C:COG8/YML071C:COG6/ YNL041C:COG5/YNL051W:YDJ1/YNL064C:BRE5/YNR051C:TLG2/YOL018C: VAM3/YOR106W:VPS17/YOR132W:ARL3/YPL051W:KES1/YPL145C 7064 mitotic sister 3.66E DCC1/YCL016C:MRC1/YCL061C:RAD61/YDR014W:CTF8/YHR191C:CSM3/Y chromatid -05 MR048W:ELG1/YOR144C:CHL1/YPL008W:CTF4/YPR135W cohesion 51641 cellular 5.73E VPS8/YAL002W:DRS2/YAL026C:UBS1/YBR165W:GET3/YDL100C:ARF1/YDL localization -05 192W:RVS167/YDR388W:GET2/YER083C:YFR024C:VAM7/YGL212W:GOS1/ YHL031C:VPS29/YHR012W:GGA2/YHR108W:THP2/YHR167W:VPS53/YJL02 9C:PEP8/YJL053W:VPS35/YJL154C:VPS1/YKR001C:VPS51/YKR020W:NUP1 33/YKR082W:RIC1/YLR039C:VPS63/YLR261C:YPT6/YLR262C:VPS71/YML0 41C:COG8/YML071C:COG6/YNL041C:COG5/YNL051W:YDJ1/YNL064C:BRE 5/YNR051C:TLG2/YOL018C:VAM3/YOR106W:VPS17/YOR132W:ARL3/YPL0 51W:KES1/YPL145C 278 mitotic cell cycle 6.10E PIN4/YBL051C:DCC1/YCL016C:MRC1/YCL061C:RPN4/YDL020C:RAD61/YD -05 R014W:RAD9/YDR217C:SMI1/YGR229C:CTF8/YHR191C:RTT101/YJL047C: SAP190/YKR028W:SIC1/YLR079W:CSM3/YMR048W:ELG1/YOR144C:CHL1/ YPL008W:DDC1/YPL194W:CLB2/YPR119W:CLB5/YPR120C:CTF4/YPR135W 34641 cellular nitrogen 6.48E RPS8A/YBL072C:RAD16/YBR114W:MRC1/YCL061C:SLX5/YDL013W:RPN4/Y compound -05 DL020C:RAD59/YDL059C:DTD1/YDL219W:RAD57/YDR004W:RAD55/YDR0 metabolic 76W:UBC13/YDR092W:RAD9/YDR217C:XRS2/YDR369C:DOT1/YDR440W:R process AD51/YER095W:SLX8/YER116C:RAD24/YER173W:RAD54/YGL163C:SHU1/ YHL006C:STP2/YHR006W:RTT107/YHR154W:THP2/YHR167W:SKN7/YHR20 6W:CSM2/YIL132C:MPH1/YIR002C:DAL81/YIR023W:MGA2/YIR033W:RTT1 01/YJL047C:ASF1/YJL115W:POL32/YJR043C:CBF1/YJR060W:CTK1/YKL139 W:SAP190/YKR028W:SET3/YKR029C:RTT109/YLL002W:RAD5/YLR032W:M MS22/YLR320W:TSA1/YML028W:RAD10/YML095C:GTR1/YML121W:CSM3/ YMR048W:ADE17/YMR120C:EAF7/YNL136W:PSD1/YNL169C:HTZ1/YOL012

C:AZF1/YOR113W:ELG1/YOR144C:RAD17/YOR368W:CHL1/YPL008W:DDC 1/YPL194W:LEA1/YPL213W:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164 W 32200 telomere 9.23E MRC1/YCL061C:SLX5/YDL013W:RAD59/YDL059C:RAD57/YDR004W:XRS2/ organization -05 YDR369C:RAD51/YER095W:SLX8/YER116C:RAD54/YGL163C:ELG1/YOR14 4C 60249 anatomical 9.23E MRC1/YCL061C:SLX5/YDL013W:RAD59/YDL059C:RAD57/YDR004W:XRS2/ structure -05 YDR369C:RAD51/YER095W:SLX8/YER116C:RAD54/YGL163C:ELG1/YOR14 homeostasis 4C 723 telomere 9.23E MRC1/YCL061C:SLX5/YDL013W:RAD59/YDL059C:RAD57/YDR004W:XRS2/ maintenance -05 YDR369C:RAD51/YER095W:SLX8/YER116C:RAD54/YGL163C:ELG1/YOR14 4C 50794 regulation of 9.76E PIN4/YBL051C:MRC1/YCL061C:RPN4/YDL020C:VAM6/YDL077C:GET3/YDL1 cellular process -05 00C:VPS41/YDR080W:UBC13/YDR092W:RAD9/YDR217C:DOT1/YDR440W: RAD24/YER173W:SMI1/YGR229C:STP2/YHR006W:RTT107/YHR154W:MPH 1/YIR002C:DAL81/YIR023W:MGA2/YIR033W:RTT101/YJL047C:ASF1/YJL11 5W:CBF1/YJR060W:CTK1/YKL139W:SAP190/YKR028W:SET3/YKR029C:RT T109/YLL002W:RAD5/YLR032W:SIC1/YLR079W:TSA1/YML028W:GTR1/YM L121W:CSM3/YMR048W:EAF7/YNL136W:RHO5/YNL180C:BRE5/YNR051C: HTZ1/YOL012C:AZF1/YOR113W:ELG1/YOR144C:RAD17/YOR368W:CHL1/Y PL008W:BEM4/YPL161C:DDC1/YPL194W:CLB2/YPR119W:CLB5/YPR120C:M MS1/YPR164W 16197 endosome 0.000 VPS8/YAL002W:VPS29/YHR012W:GGA2/YHR108W:VPS53/YJL029C:PEP8/Y transport 12 JL053W:VPS35/YJL154C:VPS51/YKR020W:RIC1/YLR039C:YPT6/YLR262C:V PS17/YOR132W 6807 nitrogen 0.000 RPS8A/YBL072C:RAD16/YBR114W:MRC1/YCL061C:SLX5/YDL013W:RPN4/Y compound 15 DL020C:RAD59/YDL059C:DTD1/YDL219W:RAD57/YDR004W:RAD55/YDR0 metabolic 76W:UBC13/YDR092W:RAD9/YDR217C:XRS2/YDR369C:DOT1/YDR440W:R process AD51/YER095W:SLX8/YER116C:RAD24/YER173W:RAD54/YGL163C:SHU1/ YHL006C:STP2/YHR006W:RTT107/YHR154W:THP2/YHR167W:SKN7/YHR20 6W:CSM2/YIL132C:MPH1/YIR002C:DAL81/YIR023W:MGA2/YIR033W:RTT1 01/YJL047C:ASF1/YJL115W:POL32/YJR043C:CBF1/YJR060W:CTK1/YKL139 W:SAP190/YKR028W:SET3/YKR029C:RTT109/YLL002W:RAD5/YLR032W:M MS22/YLR320W:TSA1/YML028W:RAD10/YML095C:GTR1/YML121W:CSM3/ YMR048W:ADE17/YMR120C:EAF7/YNL136W:PSD1/YNL169C:HTZ1/YOL012 C:AZF1/YOR113W:ELG1/YOR144C:RAD17/YOR368W:CHL1/YPL008W:DDC 1/YPL194W:LEA1/YPL213W:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164 W 45005 maintenance of 0.000 MRC1/YCL061C:RTT101/YJL047C:MMS22/YLR320W:CSM3/YMR048W:MMS fidelity involved 16 1/YPR164W in DNA- dependent DNA replication 6906 vesicle fusion 0.000 VAM6/YDL077C:VPS41/YDR080W:VAM7/YGL212W:GOS1/YHL031C:TLG2/Y 18 OL018C:VAM3/YOR106W 50789 regulation of 0.000 PIN4/YBL051C:MRC1/YCL061C:RPN4/YDL020C:VAM6/YDL077C:GET3/YDL1 biological 19 00C:VPS41/YDR080W:UBC13/YDR092W:RAD9/YDR217C:DOT1/YDR440W: process RAD24/YER173W:RAD54/YGL163C:SMI1/YGR229C:STP2/YHR006W:RTT10 7/YHR154W:MPH1/YIR002C:DAL81/YIR023W:MGA2/YIR033W:RTT101/YJL 047C:ASF1/YJL115W:CBF1/YJR060W:CTK1/YKL139W:SAP190/YKR028W:S ET3/YKR029C:RTT109/YLL002W:RAD5/YLR032W:SIC1/YLR079W:TSA1/YM L028W:GTR1/YML121W:CSM3/YMR048W:EAF7/YNL136W:RHO5/YNL180C: BRE5/YNR051C:HTZ1/YOL012C:AZF1/YOR113W:ELG1/YOR144C:RAD17/Y OR368W:CHL1/YPL008W:BEM4/YPL161C:DDC1/YPL194W:CLB2/YPR119W: CLB5/YPR120C:MMS1/YPR164W 6261 DNA-dependent 0.000 MRC1/YCL061C:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C:MMS22/ DNA replication 21 YLR320W:CSM3/YMR048W:ELG1/YOR144C:CTF4/YPR135W:MMS1/YPR164 W 7062 sister chromatid 0.000 DCC1/YCL016C:MRC1/YCL061C:RAD61/YDR014W:CTF8/YHR191C:CSM3/Y cohesion 23 MR048W:ELG1/YOR144C:CHL1/YPL008W:CTF4/YPR135W 10526 negative 0.000 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MM regulation of 42 S1/YPR164W transposition, RNA-mediated 10529 negative 0.000 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MM regulation of 42 S1/YPR164W

transposition 51726 regulation of cell 0.000 PIN4/YBL051C:MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/Y cycle 43 ER173W:SMI1/YGR229C:RTT101/YJL047C:SET3/YKR029C:SIC1/YLR079W: TSA1/YML028W:CSM3/YMR048W:RAD17/YOR368W:DDC1/YPL194W:CLB2/ YPR119W:CLB5/YPR120C 16043 cellular 0.000 DRS2/YAL026C:RAD16/YBR114W:DCC1/YCL016C:MRC1/YCL061C:SLX5/YD component 49 L013W:RAD59/YDL059C:VAM6/YDL077C:GET3/YDL100C:RAD57/YDR004W organization :RAD61/YDR014W:RAD55/YDR076W:VPS41/YDR080W:UBC13/YDR092W:X RS2/YDR369C:RVS167/YDR388W:DOT1/YDR440W:GET2/YER083C:RAD51/ YER095W:SLX8/YER116C:RAD54/YGL163C:VAM7/YGL212W:ART5/YGR068 C:GOS1/YHL031C:PTH1/YHR189W:CTF8/YHR191C:SKN7/YHR206W:RTT10 1/YJL047C:ASF1/YJL115W:CBF1/YJR060W:LIA1/YJR070C:VPS1/YKR001C: MEH1/YKR007W:VPS51/YKR020W:SET3/YKR029C:NUP133/YKR082W:RTT1 09/YLL002W:RAD5/YLR032W:MMS22/YLR320W:VPS71/YML041C:CSM3/YM R048W:YDJ1/YNL064C:EAF7/YNL136W:TLG2/YOL018C:VAM3/YOR106W:EL G1/YOR144C:CHL1/YPL008W:KES1/YPL145C:BEM4/YPL161C:CLB2/YPR119 W:CLB5/YPR120C:CTF4/YPR135W 48523 negative 0.000 PIN4/YBL051C:MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/Y regulation of 55 ER173W:RTT107/YHR154W:MPH1/YIR002C:RTT101/YJL047C:ASF1/YJL115 cellular process W:CBF1/YJR060W:SET3/YKR029C:RTT109/YLL002W:SIC1/YLR079W:TSA1 /YML028W:GTR1/YML121W:CSM3/YMR048W:HTZ1/YOL012C:ELG1/YOR14 4C:RAD17/YOR368W:CHL1/YPL008W:DDC1/YPL194W:MMS1/YPR164W 10564 regulation of cell 0.000 PIN4/YBL051C:MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/Y cycle process 58 ER173W:RTT101/YJL047C:SET3/YKR029C:TSA1/YML028W:CSM3/YMR048 W:RAD17/YOR368W:DDC1/YPL194W:CLB2/YPR119W:CLB5/YPR120C 48519 negative 0.000 PIN4/YBL051C:MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/Y regulation of 83 ER173W:RTT107/YHR154W:MPH1/YIR002C:RTT101/YJL047C:ASF1/YJL115 biological W:CBF1/YJR060W:SET3/YKR029C:RTT109/YLL002W:SIC1/YLR079W:TSA1 process /YML028W:GTR1/YML121W:CSM3/YMR048W:HTZ1/YOL012C:ELG1/YOR14 4C:RAD17/YOR368W:CHL1/YPL008W:DDC1/YPL194W:MMS1/YPR164W 7059 chromosome 0.000 DCC1/YCL016C:MRC1/YCL061C:RAD61/YDR014W:CTF8/YHR191C:CSM2/YI segregation 98 L132C:CBF1/YJR060W:MMS22/YLR320W:CSM3/YMR048W:ELG1/YOR144C: CHL1/YPL008W:CTF4/YPR135W 71840 cellular 0.001 DRS2/YAL026C:RPS8A/YBL072C:RAD16/YBR114W:DCC1/YCL016C:MRC1/Y component 13 CL061C:SLX5/YDL013W:RAD59/YDL059C:VAM6/YDL077C:GET3/YDL100C: organization or RAD57/YDR004W:RAD61/YDR014W:RAD55/YDR076W:VPS41/YDR080W:U biogenesis BC13/YDR092W:XRS2/YDR369C:RVS167/YDR388W:DOT1/YDR440W:GET2 /YER083C:RAD51/YER095W:SLX8/YER116C:RAD54/YGL163C:VAM7/YGL21 2W:ART5/YGR068C:SMI1/YGR229C:GOS1/YHL031C:PTH1/YHR189W:CTF8 /YHR191C:SKN7/YHR206W:RTT101/YJL047C:ASF1/YJL115W:CBF1/YJR060 W:LIA1/YJR070C:VPS1/YKR001C:MEH1/YKR007W:VPS51/YKR020W:SET3/ YKR029C:NUP133/YKR082W:RTT109/YLL002W:RAD5/YLR032W:MMS22/YL R320W:VPS71/YML041C:CSM3/YMR048W:YDJ1/YNL064C:EAF7/YNL136W: TLG2/YOL018C:VAM3/YOR106W:ELG1/YOR144C:CHL1/YPL008W:KES1/YPL 145C:BEM4/YPL161C:CLB2/YPR119W:CLB5/YPR120C:CTF4/YPR135W 819 sister chromatid 0.001 DCC1/YCL016C:MRC1/YCL061C:RAD61/YDR014W:CTF8/YHR191C:MMS22/ segregation 3 YLR320W:CSM3/YMR048W:ELG1/YOR144C:CHL1/YPL008W:CTF4/YPR135 W 6260 DNA replication 0.001 MRC1/YCL061C:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C:MMS22/ 57 YLR320W:CSM3/YMR048W:ELG1/YOR144C:CLB5/YPR120C:CTF4/YPR135W :MMS1/YPR164W 6892 post-Golgi 0.001 DRS2/YAL026C:ARF1/YDL192W:VAM7/YGL212W:GGA2/YHR108W:VPS53/Y vesicle- 59 JL029C:TLG2/YOL018C:VAM3/YOR106W:ARL3/YPL051W:KES1/YPL145C mediated transport 71156 regulation of cell 0.002 PIN4/YBL051C:MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/Y cycle arrest 33 ER173W:TSA1/YML028W:CSM3/YMR048W:RAD17/YOR368W:DDC1/YPL19 4W 75 cell cycle 0.002 PIN4/YBL051C:MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/Y checkpoint 33 ER173W:TSA1/YML028W:CSM3/YMR048W:RAD17/YOR368W:DDC1/YPL19 4W 16050 vesicle 0.003 VAM6/YDL077C:VPS41/YDR080W:VAM7/YGL212W:GOS1/YHL031C:VPS51/ organization 31 YKR020W:TLG2/YOL018C:VAM3/YOR106W 30491 heteroduplex 0.004 RAD57/YDR004W:RAD55/YDR076W:RAD51/YER095W:RAD54/YGL163C formation 23 6289 nucleotide- 0.004 RAD16/YBR114W:RAD9/YDR217C:DOT1/YDR440W:RAD24/YER173W:POL3

excision repair 43 2/YJR043C:RAD10/YML095C 7050 cell cycle arrest 0.004 PIN4/YBL051C:MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/Y 73 ER173W:TSA1/YML028W:CSM3/YMR048W:RAD17/YOR368W:DDC1/YPL19 4W 10525 regulation of 0.005 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MM transposition, 47 S1/YPR164W RNA-mediated 10528 regulation of 0.005 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MM transposition 47 S1/YPR164W 45786 negative 0.005 PIN4/YBL051C:MRC1/YCL061C:RAD9/YDR217C:DOT1/YDR440W:RAD24/Y regulation of cell 59 ER173W:TSA1/YML028W:CSM3/YMR048W:RAD17/YOR368W:DDC1/YPL19 cycle 4W 70 mitotic sister 0.006 DCC1/YCL016C:MRC1/YCL061C:RAD61/YDR014W:CTF8/YHR191C:CSM3/Y chromatid 97 MR048W:ELG1/YOR144C:CHL1/YPL008W:CTF4/YPR135W segregation 722 telomere 0.009 RAD59/YDL059C:RAD57/YDR004W:RAD51/YER095W:RAD54/YGL163C maintenance via 66 recombination

GO term enrichment for sgs1Δ double mutant screen of non- essential genes

GOID GO_term P- Gene(s) annotated to the term value 6259 DNA metabolic 5.89E MMS4/YBR098W:MRC1/YCL061C:RAD59/YDL059C:RAD57/YDR004W:RAD55 process -23 /YDR076W:SAC3/YDR159W:RNH202/YDR279W:ESC2/YDR363W:XRS2/YDR3 69C:MUS81/YDR386W:RAD51/YER095W:RAD24/YER173W:RAD54/YGL163C: RRM3/YHR031C:RTT107/YHR154W:THP2/YHR167W:RTT101/YJL047C:SRS2/ YJL092W:POL32/YJR043C:RAD27/YKL113C:APN1/YKL114C:RTT109/YLL002 W:RNH203/YLR154C:PSY3/YLR376C:TSA1/YML028W:CSM3/YMR048W:CTF1 8/YMR078C:RNH201/YNL072W:EAF7/YNL136W:TOF1/YNL273W:TOP1/YOL00 6C:EXO1/YOR033C:DIA2/YOR080W:ELG1/YOR144C:RAD17/YOR368W:RAD1 /YPL022W:LGE1/YPL055C:DDC1/YPL194W:MMS1/YPR164W 6974 response to 1.69E MMS4/YBR098W:MRC1/YCL061C:RAD59/YDL059C:RAD57/YDR004W:RAD55 DNA damage -19 /YDR076W:SAC3/YDR159W:ESC2/YDR363W:XRS2/YDR369C:MUS81/YDR38 stimulus 6W:RAD24/YER173W:RAD54/YGL163C:WSS1/YHR134W:RTT107/YHR154W: RTT101/YJL047C:SRS2/YJL092W:POL32/YJR043C:RAD27/YKL113C:APN1/YK L114C:RTT109/YLL002W:PSY3/YLR376C:TSA1/YML028W:CSM3/YMR048W:C TF18/YMR078C:EAF7/YNL136W:TOF1/YNL273W:EXO1/YOR033C:ELG1/YOR1 44C:RAD17/YOR368W:RAD1/YPL022W:DDC1/YPL194W:MMS1/YPR164W 6281 DNA repair 5.87E MMS4/YBR098W:MRC1/YCL061C:RAD59/YDL059C:RAD57/YDR004W:RAD55 -19 /YDR076W:SAC3/YDR159W:ESC2/YDR363W:XRS2/YDR369C:MUS81/YDR38 6W:RAD24/YER173W:RAD54/YGL163C:RTT107/YHR154W:SRS2/YJL092W:P OL32/YJR043C:RAD27/YKL113C:APN1/YKL114C:RTT109/YLL002W:PSY3/YLR 376C:CSM3/YMR048W:CTF18/YMR078C:EAF7/YNL136W:TOF1/YNL273W:EX O1/YOR033C:ELG1/YOR144C:RAD17/YOR368W:RAD1/YPL022W:DDC1/YPL1 94W:MMS1/YPR164W 90304 nucleic acid 6.67E MMS4/YBR098W:MRC1/YCL061C:SRB8/YCR081W:RAD59/YDL059C:RAD57/Y metabolic -17 DR004W:RAD55/YDR076W:SAC3/YDR159W:RNH202/YDR279W:ESC2/YDR3 process 63W:XRS2/YDR369C:MUS81/YDR386W:RAD51/YER095W:SPT2/YER161C:CH D1/YER164W:RAD24/YER173W:DST1/YGL043W:PUS2/YGL063W:RAD54/YGL 163C:RTF1/YGL244W:RRM3/YHR031C:SRB2/YHR041C:RTT107/YHR154W:T HP2/YHR167W:VID28/YIL017C:IST3/YIR005W:RTT101/YJL047C:SRS2/YJL09 2W:ASF1/YJL115W:POL32/YJR043C:RAD27/YKL113C:APN1/YKL114C:RTT10 9/YLL002W:RNH203/YLR154C:PSY3/YLR376C:TSA1/YML028W:CSM3/YMR04 8W:CTF18/YMR078C:RNH201/YNL072W:MKS1/YNL076W:EAF7/YNL136W:GC R2/YNL199C:TOF1/YNL273W:TOP1/YOL006C:RRP6/YOR001W:HST3/YOR025 W:EXO1/YOR033C:DIA2/YOR080W:ELG1/YOR144C:PUS7/YOR243C:RAD17/ YOR368W:RAD1/YPL022W:LGE1/YPL055C:DDC1/YPL194W:MMS1/YPR164W 33554 cellular 7.29E ATG8/YBL078C:MMS4/YBR098W:GPX2/YBR244W:MRC1/YCL061C:RAD59/YD response to -15 L059C:RAD57/YDR004W:RAD55/YDR076W:SAC3/YDR159W:ESC2/YDR363W stress :XRS2/YDR369C:MUS81/YDR386W:RAD24/YER173W:RAD54/YGL163C:WSS 1/YHR134W:RTT107/YHR154W:RTT101/YJL047C:SRS2/YJL092W:ASF1/YJL1 15W:POL32/YJR043C:RAD27/YKL113C:APN1/YKL114C:RTT109/YLL002W:SI C1/YLR079W:PSY3/YLR376C:TSA1/YML028W:CSM3/YMR048W:CTF18/YMR0 78C:EAF7/YNL136W:ATX1/YNL259C:TOF1/YNL273W:EXO1/YOR033C:ELG1/Y OR144C:RAD17/YOR368W:RAD1/YPL022W:DDC1/YPL194W:MMS1/YPR164W 6310 DNA 2.42E MMS4/YBR098W:RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:ESC2 recombination -14 /YDR363W:XRS2/YDR369C:MUS81/YDR386W:RAD51/YER095W:RAD24/YER 173W:RAD54/YGL163C:THP2/YHR167W:POL32/YJR043C:RAD27/YKL113C:P SY3/YLR376C:CTF18/YMR078C:TOP1/YOL006C:EXO1/YOR033C:ELG1/YOR14 4C:RAD17/YOR368W:RAD1/YPL022W:DDC1/YPL194W:MMS1/YPR164W 6139 nucleobase, 4.58E MMS4/YBR098W:MRC1/YCL061C:SRB8/YCR081W:RAD59/YDL059C:RAD57/Y nucleoside, -14 DR004W:RAD55/YDR076W:SAC3/YDR159W:RNH202/YDR279W:ESC2/YDR3 nucleotide and 63W:XRS2/YDR369C:MUS81/YDR386W:RAD51/YER095W:SPT2/YER161C:CH nucleic acid D1/YER164W:RAD24/YER173W:DST1/YGL043W:PUS2/YGL063W:RAD54/YGL metabolic 163C:RTF1/YGL244W:RRM3/YHR031C:SRB2/YHR041C:RTT107/YHR154W:T process HP2/YHR167W:VID28/YIL017C:IST3/YIR005W:RTT101/YJL047C:SRS2/YJL09 2W:ASF1/YJL115W:POL32/YJR043C:RAD27/YKL113C:APN1/YKL114C:RTT10 9/YLL002W:RNH203/YLR154C:PSY3/YLR376C:TSA1/YML028W:CSM3/YMR04 8W:CTF18/YMR078C:RNH201/YNL072W:MKS1/YNL076W:EAF7/YNL136W:GC

R2/YNL199C:TOF1/YNL273W:TOP1/YOL006C:RRP6/YOR001W:HST3/YOR025 W:EXO1/YOR033C:DIA2/YOR080W:ELG1/YOR144C:PUS7/YOR243C:RAD17/ YOR368W:RAD1/YPL022W:LGE1/YPL055C:DDC1/YPL194W:MMS1/YPR164W 6302 double-strand 1.20E RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:ESC2/YDR363W:XRS2 break repair -12 /YDR369C:RAD54/YGL163C:RTT107/YHR154W:SRS2/YJL092W:POL32/YJR04 3C:RAD27/YKL113C:RTT109/YLL002W:CTF18/YMR078C:EXO1/YOR033C:ELG 1/YOR144C:RAD17/YOR368W:RAD1/YPL022W 51716 cellular 1.92E ATG8/YBL078C:MMS4/YBR098W:GPX2/YBR244W:MRC1/YCL061C:RAD59/YD response to -12 L059C:RAD57/YDR004W:RAD55/YDR076W:SAC3/YDR159W:ESC2/YDR363W stimulus :XRS2/YDR369C:MUS81/YDR386W:RAD24/YER173W:RAD54/YGL163C:SRB2 /YHR041C:WSS1/YHR134W:RTT107/YHR154W:RTT101/YJL047C:SRS2/YJL0 92W:ASF1/YJL115W:POL32/YJR043C:RAD27/YKL113C:APN1/YKL114C:RTT1 09/YLL002W:SIC1/YLR079W:PSY3/YLR376C:TSA1/YML028W:CSM3/YMR048 W:CTF18/YMR078C:EAF7/YNL136W:ATX1/YNL259C:TOF1/YNL273W:EXO1/Y OR033C:ELG1/YOR144C:RAD17/YOR368W:RAD1/YPL022W:DDC1/YPL194W: MMS1/YPR164W 6950 response to 5.06E ATG8/YBL078C:UBC4/YBR082C:MMS4/YBR098W:GPX2/YBR244W:MRC1/YCL stress -12 061C:RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:SAC3/YDR159W :ESC2/YDR363W:XRS2/YDR369C:MUS81/YDR386W:RAD24/YER173W:RAD5 4/YGL163C:WSS1/YHR134W:RTT107/YHR154W:RTT101/YJL047C:SRS2/YJL0 92W:ASF1/YJL115W:POL32/YJR043C:RAD27/YKL113C:APN1/YKL114C:RTT1 09/YLL002W:SIC1/YLR079W:PSY3/YLR376C:TSA1/YML028W:CSM3/YMR048 W:CTF18/YMR078C:EAF7/YNL136W:ATX1/YNL259C:TOF1/YNL273W:EXO1/Y OR033C:ELG1/YOR144C:RAD17/YOR368W:RAD1/YPL022W:DDC1/YPL194W: MMS1/YPR164W 725 recombination 4.37E RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:ESC2/YDR363W:XRS2 al repair -11 /YDR369C:RAD54/YGL163C:POL32/YJR043C:PSY3/YLR376C:CTF18/YMR078 C:ELG1/YOR144C:DDC1/YPL194W:MMS1/YPR164W 34641 cellular 9.64E MMS4/YBR098W:MRC1/YCL061C:SRB8/YCR081W:RAD59/YDL059C:RAD57/Y nitrogen -11 DR004W:RAD55/YDR076W:SAC3/YDR159W:RNH202/YDR279W:ESC2/YDR3 compound 63W:XRS2/YDR369C:MUS81/YDR386W:HPA3/YEL066W:RAD51/YER095W:S metabolic PT2/YER161C:CHD1/YER164W:RAD24/YER173W:DST1/YGL043W:PUS2/YGL process 063W:RAD54/YGL163C:RTF1/YGL244W:RRM3/YHR031C:SRB2/YHR041C:RT T107/YHR154W:THP2/YHR167W:VID28/YIL017C:IST3/YIR005W:RTT101/YJL 047C:SRS2/YJL092W:ASF1/YJL115W:POL32/YJR043C:RAD27/YKL113C:APN 1/YKL114C:RTT109/YLL002W:RNH203/YLR154C:PSY3/YLR376C:TSA1/YML0 28W:CSM3/YMR048W:CTF18/YMR078C:RNH201/YNL072W:MKS1/YNL076W: EAF7/YNL136W:GCR2/YNL199C:TOF1/YNL273W:TOP1/YOL006C:RRP6/YOR0 01W:HST3/YOR025W:EXO1/YOR033C:DIA2/YOR080W:ELG1/YOR144C:PUS7 /YOR243C:RAD17/YOR368W:RAD1/YPL022W:LGE1/YPL055C:DDC1/YPL194 W:MMS1/YPR164W 44260 cellular 1.94E UBC4/YBR082C:MMS4/YBR098W:MRC1/YCL061C:SRB8/YCR081W:RAD59/YD macromolecul -10 L059C:RAD57/YDR004W:RAD55/YDR076W:SAC3/YDR159W:RNH202/YDR27 e metabolic 9W:UBX5/YDR330W:ESC2/YDR363W:XRS2/YDR369C:MUS81/YDR386W:RAD process 51/YER095W:SPT2/YER161C:CHD1/YER164W:RAD24/YER173W:DST1/YGL0 43W:PUS2/YGL063W:RAD54/YGL163C:RTF1/YGL244W:RRM3/YHR031C:SRB 2/YHR041C:WSS1/YHR134W:RTT107/YHR154W:THP2/YHR167W:VID28/YIL0 17C:FYV10/YIL097W:IST3/YIR005W:RTT101/YJL047C:SRS2/YJL092W:ASF1/ YJL115W:POL32/YJR043C:RAD27/YKL113C:APN1/YKL114C:RTT109/YLL002 W:RPL22A/YLR061W:RNH203/YLR154C:VID22/YLR373C:PSY3/YLR376C:TSA 1/YML028W:CSM3/YMR048W:CTF18/YMR078C:RPL16B/YNL069C:RNH201/Y NL072W:MKS1/YNL076W:EAF7/YNL136W:GCR2/YNL199C:TOF1/YNL273W:T OP1/YOL006C:RRP6/YOR001W:HST3/YOR025W:EXO1/YOR033C:DIA2/YOR0 80W:ELG1/YOR144C:NFI1/YOR156C:PUS7/YOR243C:RAD17/YOR368W:RAD 1/YPL022W:LGE1/YPL055C:DDC1/YPL194W:MMS1/YPR164W 6807 nitrogen 2.45E MMS4/YBR098W:MRC1/YCL061C:SRB8/YCR081W:RAD59/YDL059C:RAD57/Y compound -10 DR004W:RAD55/YDR076W:SAC3/YDR159W:RNH202/YDR279W:ESC2/YDR3 metabolic 63W:XRS2/YDR369C:MUS81/YDR386W:HPA3/YEL066W:RAD51/YER095W:S process PT2/YER161C:CHD1/YER164W:RAD24/YER173W:DST1/YGL043W:PUS2/YGL 063W:RAD54/YGL163C:RTF1/YGL244W:RRM3/YHR031C:SRB2/YHR041C:RT T107/YHR154W:THP2/YHR167W:VID28/YIL017C:IST3/YIR005W:RTT101/YJL 047C:SRS2/YJL092W:ASF1/YJL115W:POL32/YJR043C:RAD27/YKL113C:APN 1/YKL114C:RTT109/YLL002W:RNH203/YLR154C:PSY3/YLR376C:TSA1/YML0 28W:CSM3/YMR048W:CTF18/YMR078C:RNH201/YNL072W:MKS1/YNL076W: EAF7/YNL136W:GCR2/YNL199C:TOF1/YNL273W:TOP1/YOL006C:RRP6/YOR0 01W:HST3/YOR025W:EXO1/YOR033C:DIA2/YOR080W:ELG1/YOR144C:PUS7 /YOR243C:RAD17/YOR368W:RAD1/YPL022W:LGE1/YPL055C:DDC1/YPL194

W:MMS1/YPR164W 6260 DNA 2.47E MRC1/YCL061C:RNH202/YDR279W:RRM3/YHR031C:RTT101/YJL047C:POL32 replication -10 /YJR043C:RAD27/YKL113C:RNH203/YLR154C:CSM3/YMR048W:RNH201/YNL 072W:TOF1/YNL273W:TOP1/YOL006C:DIA2/YOR080W:ELG1/YOR144C:LGE1 /YPL055C:MMS1/YPR164W 43170 macromolecul 1.02E UBC4/YBR082C:MMS4/YBR098W:MRC1/YCL061C:SRB8/YCR081W:RAD59/YD e metabolic -09 L059C:RAD57/YDR004W:RAD55/YDR076W:SAC3/YDR159W:RNH202/YDR27 process 9W:UBX5/YDR330W:ESC2/YDR363W:XRS2/YDR369C:MUS81/YDR386W:RAD 51/YER095W:SPT2/YER161C:CHD1/YER164W:RAD24/YER173W:DST1/YGL0 43W:PUS2/YGL063W:RAD54/YGL163C:RTF1/YGL244W:RRM3/YHR031C:SRB 2/YHR041C:WSS1/YHR134W:RTT107/YHR154W:THP2/YHR167W:VID28/YIL0 17C:FYV10/YIL097W:IST3/YIR005W:RTT101/YJL047C:SRS2/YJL092W:ASF1/ YJL115W:POL32/YJR043C:RAD27/YKL113C:APN1/YKL114C:RTT109/YLL002 W:RPL22A/YLR061W:RNH203/YLR154C:VID22/YLR373C:PSY3/YLR376C:TSA 1/YML028W:CSM3/YMR048W:CTF18/YMR078C:RPL16B/YNL069C:RNH201/Y NL072W:MKS1/YNL076W:EAF7/YNL136W:GCR2/YNL199C:TOF1/YNL273W:T OP1/YOL006C:RRP6/YOR001W:HST3/YOR025W:EXO1/YOR033C:DIA2/YOR0 80W:ELG1/YOR144C:NFI1/YOR156C:PUS7/YOR243C:RAD17/YOR368W:RAD 1/YPL022W:LGE1/YPL055C:DDC1/YPL194W:MMS1/YPR164W 6261 DNA- 2.67E MRC1/YCL061C:RNH202/YDR279W:RTT101/YJL047C:POL32/YJR043C:RAD2 dependent -09 7/YKL113C:RNH203/YLR154C:CSM3/YMR048W:RNH201/YNL072W:TOF1/YN DNA L273W:TOP1/YOL006C:ELG1/YOR144C:MMS1/YPR164W replication 50896 response to 1.66E ATG8/YBL078C:UBC4/YBR082C:MMS4/YBR098W:GPX2/YBR244W:MRC1/YCL stimulus -08 061C:RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:SAC3/YDR159W :ESC2/YDR363W:XRS2/YDR369C:MUS81/YDR386W:RAD24/YER173W:RAD5 4/YGL163C:SRB2/YHR041C:WSS1/YHR134W:RTT107/YHR154W:RTT101/YJL 047C:SRS2/YJL092W:ASF1/YJL115W:POL32/YJR043C:RAD27/YKL113C:APN 1/YKL114C:RTT109/YLL002W:SIC1/YLR079W:PSY3/YLR376C:TSA1/YML028 W:CSM3/YMR048W:CTF18/YMR078C:EAF7/YNL136W:ATX1/YNL259C:TOF1/Y NL273W:EXO1/YOR033C:ELG1/YOR144C:RAD17/YOR368W:RAD1/YPL022W: DDC1/YPL194W:MMS1/YPR164W 51276 chromosome 2.50E MRC1/YCL061C:RAD59/YDL059C:RAD57/YDR004W:XRS2/YDR369C:VPS72/Y organization -08 DR485C:CHZ1/YER030W:RAD51/YER095W:SPT2/YER161C:CHD1/YER164W: RAD54/YGL163C:RTF1/YGL244W:ASF1/YJL115W:RTT109/YLL002W:CSM3/Y MR048W:CTF18/YMR078C:EAF7/YNL136W:TOF1/YNL273W:TOP1/YOL006C: RRP6/YOR001W:HST3/YOR025W:EXO1/YOR033C:ELG1/YOR144C:NFI1/YOR 156C:LGE1/YPL055C 724 double-strand 5.66E RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:ESC2/YDR363W:XRS2 break repair -08 /YDR369C:RAD54/YGL163C:POL32/YJR043C:CTF18/YMR078C:ELG1/YOR144 via C homologous recombination 31570 DNA integrity 7.35E MRC1/YCL061C:ESC2/YDR363W:RAD24/YER173W:TSA1/YML028W:CSM3/Y checkpoint -07 MR048W:TOF1/YNL273W:RAD17/YOR368W:DDC1/YPL194W 48523 negative 1.55E MRC1/YCL061C:SRB8/YCR081W:ESC2/YDR363W:SPT2/YER161C:RAD24/YE regulation of -06 R173W:SRB2/YHR041C:RTT107/YHR154W:VID28/YIL017C:FYV10/YIL097W: cellular RTT101/YJL047C:ASF1/YJL115W:RTT109/YLL002W:SIC1/YLR079W:TSA1/YM process L028W:CSM3/YMR048W:MKS1/YNL076W:TOF1/YNL273W:TOP1/YOL006C:H ST3/YOR025W:ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W:MMS1/YP R164W 9987 cellular 1.71E NUP60/YAR002W:ATG8/YBL078C:UBC4/YBR082C:MMS4/YBR098W:GPX2/YB process -06 R244W:MRC1/YCL061C:SRB8/YCR081W:RAD59/YDL059C:RAD57/YDR004W: RAD55/YDR076W:SAC3/YDR159W:RNH202/YDR279W:UBX5/YDR330W:ESC 2/YDR363W:XRS2/YDR369C:MUS81/YDR386W:VPS72/YDR485C:HPA3/YEL0 66W:CHZ1/YER030W:RAD51/YER095W:FTR1/YER145C:SPT2/YER161C:CHD 1/YER164W:RAD24/YER173W:DST1/YGL043W:PUS2/YGL063W:RAD54/YGL1 63C:RTF1/YGL244W:PEF1/YGR058W:PEX8/YGR077C:GOS1/YHL031C:NEM1/ YHR004C:RRM3/YHR031C:SRB2/YHR041C:WSS1/YHR134W:RTT107/YHR154 W:THP2/YHR167W:VID28/YIL017C:FYV10/YIL097W:AIM21/YIR003W:IST3/Y IR005W:SNX4/YJL036W:RTT101/YJL047C:SRS2/YJL092W:ASF1/YJL115W:VP S35/YJL154C:PEX2/YJL210W:POL32/YJR043C:MOG1/YJR074W:RAD27/YKL1 13C:APN1/YKL114C:PAM17/YKR065C:RTT109/YLL002W:RPL22A/YLR061W:S IC1/YLR079W:RNH203/YLR154C:VID22/YLR373C:PSY3/YLR376C:TSA1/YML0 28W:CSM3/YMR048W:CTF18/YMR078C:JNM1/YMR294W:VAC7/YNL054W:RP L16B/YNL069C:RNH201/YNL072W:MKS1/YNL076W:EAF7/YNL136W:GCR2/Y

NL199C:ATX1/YNL259C:TOF1/YNL273W:TOP1/YOL006C:RRP6/YOR001W:HS T3/YOR025W:EXO1/YOR033C:GYP1/YOR070C:DIA2/YOR080W:ELG1/YOR14 4C:NFI1/YOR156C:PUS7/YOR243C:MRS2/YOR334W:RAD17/YOR368W:RAD1 /YPL022W:LGE1/YPL055C:BTS1/YPL069C:DDC1/YPL194W:MMS1/YPR164W 43137 DNA 2.20E RNH202/YDR279W:POL32/YJR043C:RAD27/YKL113C:RNH203/YLR154C:RNH replication, -06 201/YNL072W removal of RNA primer 48519 negative 2.45E MRC1/YCL061C:SRB8/YCR081W:ESC2/YDR363W:SPT2/YER161C:RAD24/YE regulation of -06 R173W:SRB2/YHR041C:RTT107/YHR154W:VID28/YIL017C:FYV10/YIL097W: biological RTT101/YJL047C:ASF1/YJL115W:RTT109/YLL002W:SIC1/YLR079W:TSA1/YM process L028W:CSM3/YMR048W:MKS1/YNL076W:TOF1/YNL273W:TOP1/YOL006C:H ST3/YOR025W:ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W:MMS1/YP R164W 44238 primary 4.94E UBC4/YBR082C:MMS4/YBR098W:MRC1/YCL061C:SRB8/YCR081W:RAD59/YD metabolic -06 L059C:RAD57/YDR004W:RAD55/YDR076W:SAC3/YDR159W:RNH202/YDR27 process 9W:UBX5/YDR330W:ESC2/YDR363W:XRS2/YDR369C:MUS81/YDR386W:HPA 3/YEL066W:RAD51/YER095W:SPT2/YER161C:CHD1/YER164W:RAD24/YER17 3W:DST1/YGL043W:PUS2/YGL063W:RAD54/YGL163C:RTF1/YGL244W:NEM1 /YHR004C:RRM3/YHR031C:SRB2/YHR041C:WSS1/YHR134W:RTT107/YHR15 4W:THP2/YHR167W:VID28/YIL017C:FYV10/YIL097W:IST3/YIR005W:RTT101 /YJL047C:SRS2/YJL092W:ASF1/YJL115W:POL32/YJR043C:RAD27/YKL113C: APN1/YKL114C:RTT109/YLL002W:RPL22A/YLR061W:RNH203/YLR154C:VID2 2/YLR373C:PSY3/YLR376C:TSA1/YML028W:CSM3/YMR048W:CTF18/YMR078 C:VAC7/YNL054W:RPL16B/YNL069C:RNH201/YNL072W:MKS1/YNL076W:EA F7/YNL136W:GCR2/YNL199C:TOF1/YNL273W:TOP1/YOL006C:RRP6/YOR001 W:HST3/YOR025W:EXO1/YOR033C:DIA2/YOR080W:ELG1/YOR144C:NFI1/Y OR156C:PUS7/YOR243C:RAD17/YOR368W:RAD1/YPL022W:LGE1/YPL055C:B TS1/YPL069C:DDC1/YPL194W:MMS1/YPR164W 22402 cell cycle 7.48E MMS4/YBR098W:MRC1/YCL061C:RAD57/YDR004W:RAD55/YDR076W:SAC3/ process -06 YDR159W:ESC2/YDR363W:XRS2/YDR369C:MUS81/YDR386W:RAD51/YER09 5W:RAD24/YER173W:PEF1/YGR058W:RTT101/YJL047C:SIC1/YLR079W:TSA 1/YML028W:CSM3/YMR048W:CTF18/YMR078C:JNM1/YMR294W:TOF1/YNL27 3W:TOP1/YOL006C:EXO1/YOR033C:ELG1/YOR144C:RAD17/YOR368W:RAD1 /YPL022W:DDC1/YPL194W 44237 cellular 1.72E ATG8/YBL078C:UBC4/YBR082C:MMS4/YBR098W:MRC1/YCL061C:SRB8/YCR metabolic -05 081W:RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:SAC3/YDR159W process :RNH202/YDR279W:UBX5/YDR330W:ESC2/YDR363W:XRS2/YDR369C:MUS8 1/YDR386W:HPA3/YEL066W:RAD51/YER095W:SPT2/YER161C:CHD1/YER16 4W:RAD24/YER173W:DST1/YGL043W:PUS2/YGL063W:RAD54/YGL163C:RTF 1/YGL244W:RRM3/YHR031C:SRB2/YHR041C:WSS1/YHR134W:RTT107/YHR1 54W:THP2/YHR167W:VID28/YIL017C:FYV10/YIL097W:IST3/YIR005W:SNX4/ YJL036W:RTT101/YJL047C:SRS2/YJL092W:ASF1/YJL115W:POL32/YJR043C: RAD27/YKL113C:APN1/YKL114C:RTT109/YLL002W:RPL22A/YLR061W:SIC1/ YLR079W:RNH203/YLR154C:VID22/YLR373C:PSY3/YLR376C:TSA1/YML028 W:CSM3/YMR048W:CTF18/YMR078C:VAC7/YNL054W:RPL16B/YNL069C:RNH 201/YNL072W:MKS1/YNL076W:EAF7/YNL136W:GCR2/YNL199C:TOF1/YNL27 3W:TOP1/YOL006C:RRP6/YOR001W:HST3/YOR025W:EXO1/YOR033C:DIA2/ YOR080W:ELG1/YOR144C:NFI1/YOR156C:PUS7/YOR243C:RAD17/YOR368W :RAD1/YPL022W:LGE1/YPL055C:BTS1/YPL069C:DDC1/YPL194W:MMS1/YPR1 64W 7049 cell cycle 1.84E MMS4/YBR098W:MRC1/YCL061C:RAD57/YDR004W:RAD55/YDR076W:SAC3/ -05 YDR159W:ESC2/YDR363W:XRS2/YDR369C:MUS81/YDR386W:RAD51/YER09 5W:RAD24/YER173W:PEF1/YGR058W:RTT101/YJL047C:SIC1/YLR079W:TSA 1/YML028W:CSM3/YMR048W:CTF18/YMR078C:JNM1/YMR294W:TOF1/YNL27 3W:TOP1/YOL006C:EXO1/YOR033C:ELG1/YOR144C:RAD17/YOR368W:RAD1 /YPL022W:DDC1/YPL194W 22616 DNA strand 1.96E RNH202/YDR279W:POL32/YJR043C:RAD27/YKL113C:RNH203/YLR154C:RNH elongation -05 201/YNL072W:TOP1/YOL006C 6271 DNA strand 1.96E RNH202/YDR279W:POL32/YJR043C:RAD27/YKL113C:RNH203/YLR154C:RNH elongation -05 201/YNL072W:TOP1/YOL006C involved in DNA replication 8152 metabolic 2.31E ATG8/YBL078C:UBC4/YBR082C:MMS4/YBR098W:MRC1/YCL061C:SRB8/YCR process -05 081W:RAD59/YDL059C:RAD57/YDR004W:RAD55/YDR076W:SAC3/YDR159W :RNH202/YDR279W:UBX5/YDR330W:ESC2/YDR363W:XRS2/YDR369C:MUS8

1/YDR386W:HPA3/YEL066W:RAD51/YER095W:SPT2/YER161C:CHD1/YER16 4W:RAD24/YER173W:DST1/YGL043W:PUS2/YGL063W:RAD54/YGL163C:RTF 1/YGL244W:NEM1/YHR004C:RRM3/YHR031C:SRB2/YHR041C:WSS1/YHR134 W:RTT107/YHR154W:THP2/YHR167W:VID28/YIL017C:FYV10/YIL097W:IST3 /YIR005W:SNX4/YJL036W:RTT101/YJL047C:SRS2/YJL092W:ASF1/YJL115W: POL32/YJR043C:RAD27/YKL113C:APN1/YKL114C:RTT109/YLL002W:RPL22A/ YLR061W:SIC1/YLR079W:RNH203/YLR154C:VID22/YLR373C:PSY3/YLR376C :TSA1/YML028W:CSM3/YMR048W:CTF18/YMR078C:VAC7/YNL054W:RPL16B /YNL069C:RNH201/YNL072W:MKS1/YNL076W:EAF7/YNL136W:GCR2/YNL19 9C:TOF1/YNL273W:TOP1/YOL006C:RRP6/YOR001W:HST3/YOR025W:EXO1/ YOR033C:DIA2/YOR080W:ELG1/YOR144C:NFI1/YOR156C:PUS7/YOR243C:R AD17/YOR368W:RAD1/YPL022W:LGE1/YPL055C:BTS1/YPL069C:DDC1/YPL1 94W:MMS1/YPR164W 279 M phase 3.78E MMS4/YBR098W:MRC1/YCL061C:RAD57/YDR004W:RAD55/YDR076W:SAC3/ -05 YDR159W:XRS2/YDR369C:MUS81/YDR386W:RAD51/YER095W:RAD24/YER1 73W:RTT101/YJL047C:CSM3/YMR048W:CTF18/YMR078C:TOF1/YNL273W:TO P1/YOL006C:ELG1/YOR144C:RAD17/YOR368W:RAD1/YPL022W:DDC1/YPL19 4W 33567 DNA 4.46E RNH202/YDR279W:POL32/YJR043C:RAD27/YKL113C:RNH203/YLR154C:RNH replication, -05 201/YNL072W Okazaki fragment processing 45005 maintenance 4.46E MRC1/YCL061C:RTT101/YJL047C:CSM3/YMR048W:TOF1/YNL273W:MMS1/YP of fidelity -05 R164W involved in DNA- dependent DNA replication 71103 DNA 5.89E MMS4/YBR098W:MUS81/YDR386W:CHD1/YER164W:RAD54/YGL163C:SRS2/ conformation -05 YJL092W:ASF1/YJL115W:TOP1/YOL006C:NFI1/YOR156C change 6996 organelle 5.91E ATG8/YBL078C:MRC1/YCL061C:RAD59/YDL059C:RAD57/YDR004W:SAC3/YD organization -05 R159W:XRS2/YDR369C:VPS72/YDR485C:CHZ1/YER030W:RAD51/YER095W: SPT2/YER161C:CHD1/YER164W:RAD54/YGL163C:RTF1/YGL244W:PEX8/YGR 077C:GOS1/YHL031C:NEM1/YHR004C:RRM3/YHR031C:RTT101/YJL047C:AS F1/YJL115W:PEX2/YJL210W:PAM17/YKR065C:RTT109/YLL002W:CSM3/YMR0 48W:CTF18/YMR078C:JNM1/YMR294W:EAF7/YNL136W:TOF1/YNL273W:TOP 1/YOL006C:RRP6/YOR001W:HST3/YOR025W:EXO1/YOR033C:ELG1/YOR144 C:NFI1/YOR156C:LGE1/YPL055C 6312 mitotic 7.89E RAD59/YDL059C:RAD57/YDR004W:RAD51/YER095W:RAD54/YGL163C:RAD2 recombination -05 7/YKL113C:TOP1/YOL006C:EXO1/YOR033C:RAD1/YPL022W 71842 cellular 0.000 NUP60/YAR002W:ATG8/YBL078C:MRC1/YCL061C:RAD59/YDL059C:RAD57/Y component 12 DR004W:RAD55/YDR076W:SAC3/YDR159W:XRS2/YDR369C:VPS72/YDR485 organization C:CHZ1/YER030W:RAD51/YER095W:SPT2/YER161C:CHD1/YER164W:RAD54 at cellular /YGL163C:RTF1/YGL244W:PEX8/YGR077C:GOS1/YHL031C:NEM1/YHR004C: level RRM3/YHR031C:IST3/YIR005W:RTT101/YJL047C:ASF1/YJL115W:PEX2/YJL2 10W:PAM17/YKR065C:RTT109/YLL002W:CSM3/YMR048W:CTF18/YMR078C:J NM1/YMR294W:EAF7/YNL136W:TOF1/YNL273W:TOP1/YOL006C:RRP6/YOR0 01W:HST3/YOR025W:EXO1/YOR033C:ELG1/YOR144C:NFI1/YOR156C:LGE1/ YPL055C 10526 negative 0.000 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS regulation of 12 1/YPR164W transposition, RNA-mediated 10529 negative 0.000 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS regulation of 12 1/YPR164W transposition 32200 telomere 0.000 MRC1/YCL061C:RAD59/YDL059C:RAD57/YDR004W:XRS2/YDR369C:RAD51/ organization 18 YER095W:RAD54/YGL163C:EXO1/YOR033C:ELG1/YOR144C 60249 anatomical 0.000 MRC1/YCL061C:RAD59/YDL059C:RAD57/YDR004W:XRS2/YDR369C:RAD51/ structure 18 YER095W:RAD54/YGL163C:EXO1/YOR033C:ELG1/YOR144C homeostasis 723 telomere 0.000 MRC1/YCL061C:RAD59/YDL059C:RAD57/YDR004W:XRS2/YDR369C:RAD51/ maintenance 18 YER095W:RAD54/YGL163C:EXO1/YOR033C:ELG1/YOR144C

22403 cell cycle 0.000 MMS4/YBR098W:MRC1/YCL061C:RAD57/YDR004W:RAD55/YDR076W:SAC3/ phase 19 YDR159W:XRS2/YDR369C:MUS81/YDR386W:RAD51/YER095W:RAD24/YER1 73W:RTT101/YJL047C:SIC1/YLR079W:CSM3/YMR048W:CTF18/YMR078C:TO F1/YNL273W:TOP1/YOL006C:ELG1/YOR144C:RAD17/YOR368W:RAD1/YPL02 2W:DDC1/YPL194W 65007 biological 0.000 MMS4/YBR098W:MRC1/YCL061C:SRB8/YCR081W:RAD59/YDL059C:RAD57/Y regulation 24 DR004W:ESC2/YDR363W:XRS2/YDR369C:RAD51/YER095W:FTR1/YER145C: SPT2/YER161C:CHD1/YER164W:RAD24/YER173W:RAD54/YGL163C:NEM1/Y HR004C:SRB2/YHR041C:RTT107/YHR154W:VID28/YIL017C:FYV10/YIL097W :RTT101/YJL047C:ASF1/YJL115W:VPS35/YJL154C:RTT109/YLL002W:SIC1/Y LR079W:TSA1/YML028W:CSM3/YMR048W:VAC7/YNL054W:MKS1/YNL076W: EAF7/YNL136W:GCR2/YNL199C:ATX1/YNL259C:TOF1/YNL273W:TOP1/YOL0 06C:HST3/YOR025W:EXO1/YOR033C:DIA2/YOR080W:ELG1/YOR144C:RAD1 7/YOR368W:LGE1/YPL055C:DDC1/YPL194W:MMS1/YPR164W 42770 signal 0.000 MRC1/YCL061C:ESC2/YDR363W:RAD24/YER173W:TSA1/YML028W:RAD17/Y transduction 31 OR368W:DDC1/YPL194W in response to DNA damage 77 DNA damage 0.000 MRC1/YCL061C:ESC2/YDR363W:RAD24/YER173W:TSA1/YML028W:RAD17/Y checkpoint 31 OR368W:DDC1/YPL194W 16070 RNA metabolic 0.000 MRC1/YCL061C:SRB8/YCR081W:SAC3/YDR159W:RNH202/YDR279W:ESC2/Y process 39 DR363W:SPT2/YER161C:CHD1/YER164W:DST1/YGL043W:PUS2/YGL063W:R TF1/YGL244W:SRB2/YHR041C:THP2/YHR167W:VID28/YIL017C:IST3/YIR005 W:RTT101/YJL047C:ASF1/YJL115W:POL32/YJR043C:RAD27/YKL113C:RTT10 9/YLL002W:RNH203/YLR154C:RNH201/YNL072W:MKS1/YNL076W:EAF7/YNL 136W:GCR2/YNL199C:TOP1/YOL006C:RRP6/YOR001W:HST3/YOR025W:PUS 7/YOR243C:MMS1/YPR164W 6273 lagging strand 0.000 RNH202/YDR279W:POL32/YJR043C:RAD27/YKL113C:RNH203/YLR154C:RNH elongation 51 201/YNL072W 44265 cellular 0.001 UBC4/YBR082C:RNH202/YDR279W:UBX5/YDR330W:VID28/YIL017C:FYV10/ macromolecul YIL097W:RTT101/YJL047C:POL32/YJR043C:RAD27/YKL113C:RNH203/YLR15 e catabolic 4C:VID22/YLR373C:RNH201/YNL072W:RRP6/YOR001W:EXO1/YOR033C:DIA process 2/YOR080W:RAD1/YPL022W:MMS1/YPR164W 34645 cellular 0.001 MRC1/YCL061C:SRB8/YCR081W:RNH202/YDR279W:ESC2/YDR363W:SPT2/Y macromolecul 13 ER161C:CHD1/YER164W:DST1/YGL043W:RTF1/YGL244W:RRM3/YHR031C:S e biosynthetic RB2/YHR041C:THP2/YHR167W:VID28/YIL017C:RTT101/YJL047C:ASF1/YJL1 process 15W:POL32/YJR043C:RAD27/YKL113C:RTT109/YLL002W:RPL22A/YLR061W: RNH203/YLR154C:TSA1/YML028W:CSM3/YMR048W:RPL16B/YNL069C:RNH2 01/YNL072W:MKS1/YNL076W:EAF7/YNL136W:GCR2/YNL199C:TOF1/YNL273 W:TOP1/YOL006C:HST3/YOR025W:DIA2/YOR080W:ELG1/YOR144C:LGE1/YP L055C:MMS1/YPR164W 9059 macromolecul 0.001 MRC1/YCL061C:SRB8/YCR081W:RNH202/YDR279W:ESC2/YDR363W:SPT2/Y e biosynthetic 3 ER161C:CHD1/YER164W:DST1/YGL043W:RTF1/YGL244W:RRM3/YHR031C:S process RB2/YHR041C:THP2/YHR167W:VID28/YIL017C:RTT101/YJL047C:ASF1/YJL1 15W:POL32/YJR043C:RAD27/YKL113C:RTT109/YLL002W:RPL22A/YLR061W: RNH203/YLR154C:TSA1/YML028W:CSM3/YMR048W:RPL16B/YNL069C:RNH2 01/YNL072W:MKS1/YNL076W:EAF7/YNL136W:GCR2/YNL199C:TOF1/YNL273 W:TOP1/YOL006C:HST3/YOR025W:DIA2/YOR080W:ELG1/YOR144C:LGE1/YP L055C:MMS1/YPR164W 30491 heteroduplex 0.001 RAD57/YDR004W:RAD55/YDR076W:RAD51/YER095W:RAD54/YGL163C formation 49 10525 regulation of 0.001 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS transposition, 54 1/YPR164W RNA-mediated 10528 regulation of 0.001 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS transposition 54 1/YPR164W 31324 negative 0.003 MRC1/YCL061C:SRB8/YCR081W:ESC2/YDR363W:SPT2/YER161C:SRB2/YHR regulation of 21 041C:VID28/YIL017C:FYV10/YIL097W:ASF1/YJL115W:SIC1/YLR079W:CSM3 cellular /YMR048W:MKS1/YNL076W:TOF1/YNL273W:TOP1/YOL006C:HST3/YOR025 metabolic W:ELG1/YOR144C process 722 telomere 0.003 RAD59/YDL059C:RAD57/YDR004W:RAD51/YER095W:RAD54/YGL163C maintenance 43 via recombination 9057 macromolecul 0.004 UBC4/YBR082C:RNH202/YDR279W:UBX5/YDR330W:VID28/YIL017C:FYV10/

e catabolic 11 YIL097W:RTT101/YJL047C:POL32/YJR043C:RAD27/YKL113C:RNH203/YLR15 process 4C:VID22/YLR373C:RNH201/YNL072W:RRP6/YOR001W:EXO1/YOR033C:DIA 2/YOR080W:RAD1/YPL022W:MMS1/YPR164W 9892 negative 0.004 MRC1/YCL061C:SRB8/YCR081W:ESC2/YDR363W:SPT2/YER161C:SRB2/YHR regulation of 21 041C:VID28/YIL017C:FYV10/YIL097W:ASF1/YJL115W:SIC1/YLR079W:CSM3 metabolic /YMR048W:MKS1/YNL076W:TOF1/YNL273W:TOP1/YOL006C:HST3/YOR025 process W:ELG1/YOR144C 71156 regulation of 0.004 MRC1/YCL061C:ESC2/YDR363W:RAD24/YER173W:TSA1/YML028W:CSM3/Y cell cycle 29 MR048W:TOF1/YNL273W:RAD17/YOR368W:DDC1/YPL194W arrest 75 cell cycle 0.004 MRC1/YCL061C:ESC2/YDR363W:RAD24/YER173W:TSA1/YML028W:CSM3/Y checkpoint 29 MR048W:TOF1/YNL273W:RAD17/YOR368W:DDC1/YPL194W 726 non- 0.004 RAD59/YDL059C:XRS2/YDR369C:SRS2/YJL092W:RAD27/YKL113C:RTT109/Y recombination 54 LL002W:RAD1/YPL022W al repair 32297 negative 0.004 MRC1/YCL061C:CSM3/YMR048W:TOF1/YNL273W regulation of 77 DNA- dependent DNA replication initiation 6265 DNA 0.004 MMS4/YBR098W:MUS81/YDR386W:TOP1/YOL006C topological 77 change 76 DNA 0.004 MRC1/YCL061C:CSM3/YMR048W:TOF1/YNL273W replication 77 checkpoint 51052 regulation of 0.004 MMS4/YBR098W:MRC1/YCL061C:CSM3/YMR048W:TOF1/YNL273W:TOP1/YO DNA metabolic 8 L006C:DIA2/YOR080W:ELG1/YOR144C process 7059 chromosome 0.006 MMS4/YBR098W:MRC1/YCL061C:MUS81/YDR386W:CSM3/YMR048W:CTF18/ segregation 08 YMR078C:TOF1/YNL273W:TOP1/YOL006C:ELG1/YOR144C:NFI1/YOR156C 51321 meiotic cell 0.006 MMS4/YBR098W:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:MUS8 cycle 24 1/YDR386W:RAD51/YER095W:RAD24/YER173W:CSM3/YMR048W:EXO1/YOR 033C:RAD17/YOR368W:RAD1/YPL022W:DDC1/YPL194W 6368 RNA 0.007 SPT2/YER161C:CHD1/YER164W:DST1/YGL043W:RTF1/YGL244W:THP2/YHR1 elongation 48 67W:TOP1/YOL006C from RNA polymerase II promoter 7050 cell cycle 0.007 MRC1/YCL061C:ESC2/YDR363W:RAD24/YER173W:TSA1/YML028W:CSM3/Y arrest 84 MR048W:TOF1/YNL273W:RAD17/YOR368W:DDC1/YPL194W 32196 transposition 0.007 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS 92 1/YPR164W 32197 transposition, 0.007 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS RNA-mediated 92 1/YPR164W 7127 meiosis I 0.008 MMS4/YBR098W:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:MUS8 76 1/YDR386W:RAD51/YER095W:RAD24/YER173W:RAD17/YOR368W:RAD1/YP L022W 45786 negative 0.009 MRC1/YCL061C:ESC2/YDR363W:RAD24/YER173W:TSA1/YML028W:CSM3/Y regulation of 04 MR048W:TOF1/YNL273W:RAD17/YOR368W:DDC1/YPL194W cell cycle 71841 cellular 0.009 NUP60/YAR002W:ATG8/YBL078C:MRC1/YCL061C:RAD59/YDL059C:RAD57/Y component 86 DR004W:RAD55/YDR076W:SAC3/YDR159W:XRS2/YDR369C:VPS72/YDR485 organization C:CHZ1/YER030W:RAD51/YER095W:SPT2/YER161C:CHD1/YER164W:RAD54 or biogenesis /YGL163C:RTF1/YGL244W:PEX8/YGR077C:GOS1/YHL031C:NEM1/YHR004C: at cellular RRM3/YHR031C:IST3/YIR005W:RTT101/YJL047C:ASF1/YJL115W:PEX2/YJL2 level 10W:PAM17/YKR065C:RTT109/YLL002W:CSM3/YMR048W:CTF18/YMR078C:J NM1/YMR294W:EAF7/YNL136W:TOF1/YNL273W:TOP1/YOL006C:RRP6/YOR0 01W:HST3/YOR025W:EXO1/YOR033C:ELG1/YOR144C:NFI1/YOR156C:PUS7/ YOR243C:LGE1/YPL055C

GO term enrichment for yku80Δ double mutant screen of non- essential genes

GOID GO_term P- Gene(s) annotated to the term value 6259 DNA 9.87E TEL1/YBL088C:SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:NHP10/YDL00 metabolic -41 2C:SLX5/YDL013W:RPN4/YDL020C:SIR2/YDL042C:RAD59/YDL059C:BRE1/YDL0 process 74C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:SAC3/YDR159W:RA D9/YDR217C:XRS2/YDR369C:RAD51/YER095W:SLX8/YER116C:RAD24/YER173 W:RAD54/YGL163C:RRM3/YHR031C:RTT107/YHR154W:THP2/YHR167W:CSM2/Y IL132C:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C:RTT109/YLL002W:BR E2/YLR015W:RAD5/YLR032W:SLX4/YLR135W:RNH203/YLR154C:EST1/YLR233C :TOP3/YLR234W:MMS22/YLR320W:TSA1/YML028W:MFT1/YML062C:RAD10/YML 095C:CAC2/YML102W:CSM3/YMR048W:CTF18/YMR078C:MRE11/YMR224C:TOF 1/YNL273W:SIN3/YOL004W:HST1/YOL068C:DIA2/YOR080W:ELG1/YOR144C:RA D17/YOR368W:DDC1/YPL194W:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164 W 6974 response 1.06E TEL1/YBL088C:SNF5/YBR289W:DCC1/YCL016C:MRC1/YCL061C:NHP10/YDL002 to DNA -34 C:SLX5/YDL013W:RPN4/YDL020C:SIR2/YDL042C:RAD59/YDL059C:BRE1/YDL07 damage 4C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:SAC3/YDR159W:RAD stimulus 9/YDR217C:XRS2/YDR369C:SLX8/YER116C:RAD24/YER173W:RAD54/YGL163C: RTT107/YHR154W:CTF8/YHR191C:CSM2/YIL132C:MPH1/YIR002C:RTT101/YJL0 47C:POL32/YJR043C:RTT109/YLL002W:RAD5/YLR032W:SLX4/YLR135W:MMS22 /YLR320W:TSA1/YML028W:RAD10/YML095C:CAC2/YML102W:CSM3/YMR048W: CTF18/YMR078C:MRE11/YMR224C:TOF1/YNL273W:SIN3/YOL004W:ELG1/YOR1 44C:RAD17/YOR368W:DDC1/YPL194W:CTF4/YPR135W:MMS1/YPR164W 6281 DNA repair 2.55E TEL1/YBL088C:SNF5/YBR289W:MRC1/YCL061C:NHP10/YDL002C:RPN4/YDL020 -30 C:SIR2/YDL042C:RAD59/YDL059C:BRE1/YDL074C:RAD57/YDR004W:RAD55/YD R076W:UBC13/YDR092W:SAC3/YDR159W:RAD9/YDR217C:XRS2/YDR369C:RAD 24/YER173W:RAD54/YGL163C:RTT107/YHR154W:CSM2/YIL132C:MPH1/YIR002 C:POL32/YJR043C:RTT109/YLL002W:RAD5/YLR032W:SLX4/YLR135W:MMS22/Y LR320W:RAD10/YML095C:CAC2/YML102W:CSM3/YMR048W:CTF18/YMR078C:M RE11/YMR224C:TOF1/YNL273W:SIN3/YOL004W:ELG1/YOR144C:RAD17/YOR36 8W:DDC1/YPL194W:CTF4/YPR135W:MMS1/YPR164W 90304 nucleic 4.43E TEL1/YBL088C:SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:NHP10/YDL00 acid -30 2C:SLX5/YDL013W:RPN4/YDL020C:SIR2/YDL042C:RAD59/YDL059C:BRE1/YDL0 metabolic 74C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:SAC3/YDR159W:RA process D9/YDR217C:XRS2/YDR369C:THO1/YER063W:RAD51/YER095W:SLX8/YER116C :RTR1/YER139C:CHD1/YER164W:RAD24/YER173W:RAD54/YGL163C:RTF1/YGL2 44W:UPF3/YGR072W:RRM3/YHR031C:RTT107/YHR154W:THP2/YHR167W:SKN7 /YHR206W:CSM2/YIL132C:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C:CT K1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:RAD5/YLR032W:SLX4/YLR135 W:RNH203/YLR154C:EST1/YLR233C:TOP3/YLR234W:MMS22/YLR320W:YAP1/Y ML007W:TSA1/YML028W:MFT1/YML062C:RAD10/YML095C:CAC2/YML102W:CS M3/YMR048W:CTF18/YMR078C:SKY1/YMR216C:MRE11/YMR224C:SAP30/YMR26 3W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR 025W:DIA2/YOR080W:ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W:RLF2/ YPR018W:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W:HDA3/YPR179C 33554 cellular 2.28E TEL1/YBL088C:SNF5/YBR289W:DCC1/YCL016C:MRC1/YCL061C:NHP10/YDL002 response -27 C:SLX5/YDL013W:RPN4/YDL020C:SIR2/YDL042C:RAD59/YDL059C:BRE1/YDL07 to stress 4C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:SAC3/YDR159W:RAD 9/YDR217C:XRS2/YDR369C:SLX8/YER116C:RAD24/YER173W:RAD54/YGL163C: RTT107/YHR154W:CTF8/YHR191C:SKN7/YHR206W:CSM2/YIL132C:MPH1/YIR00 2C:RTT101/YJL047C:POL32/YJR043C:YKL069W:RTT109/YLL002W:RAD5/YLR032 W:SIC1/YLR079W:SLX4/YLR135W:MMS22/YLR320W:YAP1/YML007W:TSA1/YML 028W:RAD10/YML095C:CAC2/YML102W:CSM3/YMR048W:CTF18/YMR078C:MRE 11/YMR224C:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:ELG1/YOR144C: RAD17/YOR368W:DDC1/YPL194W:CTF4/YPR135W:MMS1/YPR164W 6139 nucleobase 2.95E TEL1/YBL088C:SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:NHP10/YDL00 , -26 2C:SLX5/YDL013W:RPN4/YDL020C:SIR2/YDL042C:RAD59/YDL059C:BRE1/YDL0 nucleoside, 74C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:SAC3/YDR159W:RA nucleotide D9/YDR217C:XRS2/YDR369C:THO1/YER063W:RAD51/YER095W:SLX8/YER116C

100

and nucleic :RTR1/YER139C:CHD1/YER164W:RAD24/YER173W:RAD54/YGL163C:RTF1/YGL2 acid 44W:UPF3/YGR072W:RRM3/YHR031C:RTT107/YHR154W:THP2/YHR167W:SKN7 metabolic /YHR206W:CSM2/YIL132C:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C:CT process K1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:RAD5/YLR032W:SLX4/YLR135 W:RNH203/YLR154C:EST1/YLR233C:TOP3/YLR234W:MMS22/YLR320W:YAP1/Y ML007W:TSA1/YML028W:MFT1/YML062C:RAD10/YML095C:CAC2/YML102W:CS M3/YMR048W:CTF18/YMR078C:SKY1/YMR216C:MRE11/YMR224C:SAP30/YMR26 3W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR 025W:DIA2/YOR080W:ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W:RLF2/ YPR018W:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W:HDA3/YPR179C 6950 response 3.80E TEL1/YBL088C:UBC4/YBR082C:SNF5/YBR289W:DCC1/YCL016C:MRC1/YCL061C to stress -24 :NHP10/YDL002C:SLX5/YDL013W:RPN4/YDL020C:SIR2/YDL042C:RAD59/YDL05 9C:BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:SAC3 /YDR159W:RAD9/YDR217C:XRS2/YDR369C:SLX8/YER116C:RAD24/YER173W:R AD54/YGL163C:RTT107/YHR154W:CTF8/YHR191C:SKN7/YHR206W:CSM2/YIL13 2C:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C:YKL069W:RTT109/YLL002 W:RAD5/YLR032W:SIC1/YLR079W:SLX4/YLR135W:MMS22/YLR320W:YAP1/YML 007W:TSA1/YML028W:RAD10/YML095C:CAC2/YML102W:CSM3/YMR048W:CTF1 8/YMR078C:MRE11/YMR224C:HDA1/YNL021W:SIW14/YNL032W:TOF1/YNL273 W:SIN3/YOL004W:ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W:CTF4/YPR 135W:MMS1/YPR164W 6302 double- 7.90E TEL1/YBL088C:SNF5/YBR289W:NHP10/YDL002C:SIR2/YDL042C:RAD59/YDL059 strand -24 C:BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:RAD54/Y break GL163C:RTT107/YHR154W:POL32/YJR043C:RTT109/YLL002W:RAD5/YLR032W: repair SLX4/YLR135W:MMS22/YLR320W:RAD10/YML095C:CTF18/YMR078C:MRE11/YM R224C:SIN3/YOL004W:ELG1/YOR144C:RAD17/YOR368W:CTF4/YPR135W 51716 cellular 1.12E TEL1/YBL088C:SNF5/YBR289W:DCC1/YCL016C:MRC1/YCL061C:NHP10/YDL002 response -23 C:SLX5/YDL013W:RPN4/YDL020C:SIR2/YDL042C:RAD59/YDL059C:BRE1/YDL07 to stimulus 4C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:SAC3/YDR159W:RAD 9/YDR217C:XRS2/YDR369C:SLX8/YER116C:RAD24/YER173W:STE2/YFL026W:R AD54/YGL163C:RTT107/YHR154W:CTF8/YHR191C:SKN7/YHR206W:CSM2/YIL13 2C:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C:YKL069W:RTT109/YLL002 W:RAD5/YLR032W:SIC1/YLR079W:SLX4/YLR135W:MMS22/YLR320W:YAP1/YML 007W:TSA1/YML028W:RAD10/YML095C:CAC2/YML102W:CSM3/YMR048W:CTF1 8/YMR078C:MRE11/YMR224C:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W: ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W:CTF4/YPR135W:MMS1/YPR16 4W 51276 chromoso 1.04E TEL1/YBL088C:SWD3/YBR175W:SNF5/YBR289W:DCC1/YCL016C:MRC1/YCL061 me -21 C:NHP10/YDL002C:SLX5/YDL013W:SIR2/YDL042C:RAD59/YDL059C:BRE1/YDL0 organizatio 74C:RAD57/YDR004W:XRS2/YDR369C:RAD51/YER095W:SLX8/YER116C:CHD1/ n YER164W:IES1/YFL013C:RAD54/YGL163C:RTF1/YGL244W:CTF8/YHR191C:RTT1 09/YLL002W:BRE2/YLR015W:EST1/YLR233C:TOP3/YLR234W:MMS22/YLR320W: CAC2/YML102W:CSM3/YMR048W:CTF18/YMR078C:SAP30/YMR263W:HDA1/YNL 021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:ELG1/Y OR144C:RLF2/YPR018W:CTF4/YPR135W:HDA3/YPR179C 34641 cellular 2.53E TEL1/YBL088C:SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:NHP10/YDL00 nitrogen -21 2C:SLX5/YDL013W:RPN4/YDL020C:SIR2/YDL042C:RAD59/YDL059C:BRE1/YDL0 compound 74C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:SAC3/YDR159W:RA metabolic D9/YDR217C:XRS2/YDR369C:THO1/YER063W:RAD51/YER095W:SLX8/YER116C process :RTR1/YER139C:CHD1/YER164W:RAD24/YER173W:RAD54/YGL163C:RTF1/YGL2 44W:UPF3/YGR072W:RRM3/YHR031C:RTT107/YHR154W:THP2/YHR167W:SKN7 /YHR206W:CSM2/YIL132C:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C:CT K1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:RAD5/YLR032W:SLX4/YLR135 W:RNH203/YLR154C:EST1/YLR233C:TOP3/YLR234W:MMS22/YLR320W:YAP1/Y ML007W:TSA1/YML028W:MFT1/YML062C:RAD10/YML095C:CAC2/YML102W:CS M3/YMR048W:CTF18/YMR078C:SKY1/YMR216C:MRE11/YMR224C:SAP30/YMR26 3W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR 025W:DIA2/YOR080W:ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W:RLF2/ YPR018W:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W:HDA3/YPR179C 6807 nitrogen 1.05E TEL1/YBL088C:SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:NHP10/YDL00 compound -20 2C:SLX5/YDL013W:RPN4/YDL020C:SIR2/YDL042C:RAD59/YDL059C:BRE1/YDL0 metabolic 74C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:SAC3/YDR159W:RA process D9/YDR217C:XRS2/YDR369C:THO1/YER063W:RAD51/YER095W:SLX8/YER116C :RTR1/YER139C:CHD1/YER164W:RAD24/YER173W:RAD54/YGL163C:RTF1/YGL2 44W:UPF3/YGR072W:RRM3/YHR031C:RTT107/YHR154W:THP2/YHR167W:SKN7 /YHR206W:CSM2/YIL132C:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C:CT K1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:RAD5/YLR032W:SLX4/YLR135

101

W:RNH203/YLR154C:EST1/YLR233C:TOP3/YLR234W:MMS22/YLR320W:YAP1/Y ML007W:TSA1/YML028W:MFT1/YML062C:RAD10/YML095C:CAC2/YML102W:CS M3/YMR048W:CTF18/YMR078C:SKY1/YMR216C:MRE11/YMR224C:SAP30/YMR26 3W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR 025W:DIA2/YOR080W:ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W:RLF2/ YPR018W:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W:HDA3/YPR179C 50896 response 7.81E TEL1/YBL088C:UBC4/YBR082C:SNF5/YBR289W:DCC1/YCL016C:MRC1/YCL061C to stimulus -20 :NHP10/YDL002C:SLX5/YDL013W:RPN4/YDL020C:SIR2/YDL042C:RAD59/YDL05 9C:BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:SAC3 /YDR159W:RAD9/YDR217C:XRS2/YDR369C:SLX8/YER116C:RAD24/YER173W:S TE2/YFL026W:RAD54/YGL163C:RTT107/YHR154W:CTF8/YHR191C:SKN7/YHR20 6W:CSM2/YIL132C:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C:YKL069W: RTT109/YLL002W:RAD5/YLR032W:SIC1/YLR079W:SLX4/YLR135W:MMS22/YLR3 20W:YAP1/YML007W:TSA1/YML028W:RAD10/YML095C:CAC2/YML102W:CSM3/ YMR048W:CTF18/YMR078C:SKY1/YMR216C:MRE11/YMR224C:HDA1/YNL021W: SIW14/YNL032W:TOF1/YNL273W:SIN3/YOL004W:ELG1/YOR144C:RAD17/YOR3 68W:DDC1/YPL194W:CTF4/YPR135W:MMS1/YPR164W 6310 DNA 7.88E SIR2/YDL042C:RAD59/YDL059C:BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR0 recombinat -20 76W:XRS2/YDR369C:RAD51/YER095W:RAD24/YER173W:RAD54/YGL163C:THP2 ion /YHR167W:CSM2/YIL132C:MPH1/YIR002C:POL32/YJR043C:SLX4/YLR135W:TOP 3/YLR234W:MMS22/YLR320W:MFT1/YML062C:RAD10/YML095C:CTF18/YMR078 C:MRE11/YMR224C:HST1/YOL068C:ELG1/YOR144C:RAD17/YOR368W:DDC1/YP L194W:CTF4/YPR135W:MMS1/YPR164W 44260 cellular 4.71E TEL1/YBL088C:UBC4/YBR082C:SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061 macromole -18 C:NHP10/YDL002C:SLX5/YDL013W:RPN4/YDL020C:SIR2/YDL042C:RAD59/YDL0 cule 59C:BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR076W:UBC13/YDR092W:SAC metabolic 3/YDR159W:RAD9/YDR217C:XRS2/YDR369C:YND1/YER005W:THO1/YER063W: process RAD51/YER095W:SLX8/YER116C:RTR1/YER139C:CHD1/YER164W:RAD24/YER1 73W:GUP1/YGL084C:RAD54/YGL163C:RTF1/YGL244W:UPF3/YGR072W:RRM3/Y HR031C:RTT107/YHR154W:THP2/YHR167W:SKN7/YHR206W:CSM2/YIL132C:MP H1/YIR002C:RTT101/YJL047C:POL32/YJR043C:CTK1/YKL139W:RTT109/YLL002 W:BRE2/YLR015W:RAD5/YLR032W:SLX4/YLR135W:RNH203/YLR154C:EST1/YLR 233C:TOP3/YLR234W:MMS22/YLR320W:YAP1/YML007W:TSA1/YML028W:MFT1/ YML062C:RAD10/YML095C:CAC2/YML102W:CSM3/YMR048W:CTF18/YMR078C: SKY1/YMR216C:MRE11/YMR224C:SAP30/YMR263W:HDA1/YNL021W:SIW14/YN L032W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:DIA2/Y OR080W:ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W:RLF2/YPR018W:CL B5/YPR120C:CTF4/YPR135W:MMS1/YPR164W:HDA3/YPR179C 43170 macromole 5.81E TEL1/YBL088C:UBC4/YBR082C:SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061 cule -18 C:NHP10/YDL002C:SLX5/YDL013W:RPN4/YDL020C:SIR2/YDL042C:RAD59/YDL0 metabolic 59C:BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR076W:VPS41/YDR080W:UBC process 13/YDR092W:SAC3/YDR159W:RAD9/YDR217C:XRS2/YDR369C:YND1/YER005W :THO1/YER063W:RAD51/YER095W:SLX8/YER116C:RTR1/YER139C:CHD1/YER16 4W:RAD24/YER173W:GUP1/YGL084C:RAD54/YGL163C:RTF1/YGL244W:UPF3/Y GR072W:RRM3/YHR031C:RTT107/YHR154W:THP2/YHR167W:SKN7/YHR206W:C SM2/YIL132C:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C:CTK1/YKL139W :RTT109/YLL002W:BRE2/YLR015W:RAD5/YLR032W:SLX4/YLR135W:RNH203/YL R154C:EST1/YLR233C:TOP3/YLR234W:MMS22/YLR320W:YAP1/YML007W:TSA1/ YML028W:MFT1/YML062C:RAD10/YML095C:CAC2/YML102W:CSM3/YMR048W:C TF18/YMR078C:SKY1/YMR216C:MRE11/YMR224C:SAP30/YMR263W:HDA1/YNL0 21W:SIW14/YNL032W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/Y OR025W:DIA2/YOR080W:ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W:RL F2/YPR018W:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W:HDA3/YPR179C 725 recombinat 1.95E RAD59/YDL059C:BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR ional repair -16 369C:RAD54/YGL163C:CSM2/YIL132C:POL32/YJR043C:MMS22/YLR320W:CTF1 8/YMR078C:MRE11/YMR224C:ELG1/YOR144C:DDC1/YPL194W:CTF4/YPR135W: MMS1/YPR164W 6260 DNA 4.70E MRC1/YCL061C:SIR2/YDL042C:RRM3/YHR031C:MPH1/YIR002C:RTT101/YJL047 replication -16 C:POL32/YJR043C:SLX4/YLR135W:RNH203/YLR154C:EST1/YLR233C:TOP3/YLR 234W:MMS22/YLR320W:CSM3/YMR048W:TOF1/YNL273W:SIN3/YOL004W:DIA2 /YOR080W:ELG1/YOR144C:CLB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W 71842 cellular 1.39E TEL1/YBL088C:SWD3/YBR175W:SNF5/YBR289W:DCC1/YCL016C:MRC1/YCL061 component -14 C:NHP10/YDL002C:SLX5/YDL013W:SIR2/YDL042C:RAD59/YDL059C:BRE1/YDL0 organizatio 74C:RAD57/YDR004W:RAD55/YDR076W:VPS41/YDR080W:UBC13/YDR092W:SA n at C3/YDR159W:XRS2/YDR369C:THO1/YER063W:RAD51/YER095W:SLX8/YER116C cellular :CHD1/YER164W:IES1/YFL013C:STE2/YFL026W:RAD54/YGL163C:RTF1/YGL244 level W:RRM3/YHR031C:CTF8/YHR191C:RTT101/YJL047C:NUP133/YKR082W:RTT109

102

/YLL002W:BRE2/YLR015W:RAD5/YLR032W:EST1/YLR233C:TOP3/YLR234W:MM S22/YLR320W:CAC2/YML102W:CSM3/YMR048W:CTF18/YMR078C:SKY1/YMR21 6C:SAP30/YMR263W:HDA1/YNL021W:SIW14/YNL032W:TOF1/YNL273W:SIN3/Y OL004W:HST1/YOL068C:HST3/YOR025W:ELG1/YOR144C:BEM4/YPL161C:RLF2/ YPR018W:CLB5/YPR120C:CTF4/YPR135W:HDA3/YPR179C 65007 biological 3.37E TEL1/YBL088C:SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:SLX5/YDL013 regulation -13 W:RPN4/YDL020C:SIR2/YDL042C:RAD59/YDL059C:BRE1/YDL074C:RAD57/YDR 004W:VPS41/YDR080W:UBC13/YDR092W:RAD9/YDR217C:XRS2/YDR369C:RAD 51/YER095W:SLX8/YER116C:RTR1/YER139C:CHD1/YER164W:RAD24/YER173W :STE2/YFL026W:RAD54/YGL163C:RTT107/YHR154W:SKN7/YHR206W:MPH1/YIR 002C:RTT101/YJL047C:CTK1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:RAD5 /YLR032W:SIC1/YLR079W:EST1/YLR233C:TOP3/YLR234W:YAP1/YML007W:TSA 1/YML028W:CAC2/YML102W:CSM3/YMR048W:SKY1/YMR216C:MRE11/YMR224C :SAP30/YMR263W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL0 68C:HST3/YOR025W:DIA2/YOR080W:ELG1/YOR144C:RAD17/YOR368W:BEM4/Y PL161C:DDC1/YPL194W:RLF2/YPR018W:CLB5/YPR120C:MMS1/YPR164W:HDA3/ YPR179C 32200 telomere 4.43E TEL1/YBL088C:SWD3/YBR175W:MRC1/YCL061C:SLX5/YDL013W:RAD59/YDL05 organizatio -13 9C:RAD57/YDR004W:XRS2/YDR369C:RAD51/YER095W:SLX8/YER116C:RAD54/ n YGL163C:BRE2/YLR015W:EST1/YLR233C:TOP3/YLR234W:ELG1/YOR144C 60249 anatomical 4.43E TEL1/YBL088C:SWD3/YBR175W:MRC1/YCL061C:SLX5/YDL013W:RAD59/YDL05 structure -13 9C:RAD57/YDR004W:XRS2/YDR369C:RAD51/YER095W:SLX8/YER116C:RAD54/ homeostasi YGL163C:BRE2/YLR015W:EST1/YLR233C:TOP3/YLR234W:ELG1/YOR144C s 723 telomere 4.43E TEL1/YBL088C:SWD3/YBR175W:MRC1/YCL061C:SLX5/YDL013W:RAD59/YDL05 maintenan -13 9C:RAD57/YDR004W:XRS2/YDR369C:RAD51/YER095W:SLX8/YER116C:RAD54/ ce YGL163C:BRE2/YLR015W:EST1/YLR233C:TOP3/YLR234W:ELG1/YOR144C 6996 organelle 7.87E TEL1/YBL088C:SWD3/YBR175W:SNF5/YBR289W:DCC1/YCL016C:MRC1/YCL061 organizatio -13 C:NHP10/YDL002C:SLX5/YDL013W:SIR2/YDL042C:RAD59/YDL059C:BRE1/YDL0 n 74C:RAD57/YDR004W:VPS41/YDR080W:SAC3/YDR159W:XRS2/YDR369C:RAD5 1/YER095W:SLX8/YER116C:CHD1/YER164W:IES1/YFL013C:RAD54/YGL163C:RT F1/YGL244W:RRM3/YHR031C:CTF8/YHR191C:RTT101/YJL047C:NUP133/YKR082 W:RTT109/YLL002W:BRE2/YLR015W:EST1/YLR233C:TOP3/YLR234W:MMS22/YL R320W:CAC2/YML102W:CSM3/YMR048W:CTF18/YMR078C:SAP30/YMR263W:H DA1/YNL021W:SIW14/YNL032W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068 C:HST3/YOR025W:ELG1/YOR144C:BEM4/YPL161C:RLF2/YPR018W:CLB5/YPR12 0C:CTF4/YPR135W:HDA3/YPR179C 34645 cellular 2.22E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 macromole -12 C:BRE1/YDL074C:RAD9/YDR217C:YND1/YER005W:THO1/YER063W:RTR1/YER1 cule 39C:CHD1/YER164W:GUP1/YGL084C:RTF1/YGL244W:RRM3/YHR031C:THP2/YH biosyntheti R167W:SKN7/YHR206W:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C:CTK1 c process /YKL139W:RTT109/YLL002W:BRE2/YLR015W:SLX4/YLR135W:RNH203/YLR154C :EST1/YLR233C:TOP3/YLR234W:MMS22/YLR320W:YAP1/YML007W:TSA1/YML02 8W:MFT1/YML062C:CAC2/YML102W:CSM3/YMR048W:MRE11/YMR224C:SAP30/ YMR263W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST 3/YOR025W:DIA2/YOR080W:ELG1/YOR144C:RLF2/YPR018W:CLB5/YPR120C:CT F4/YPR135W:MMS1/YPR164W:HDA3/YPR179C 9059 macromole 2.51E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 cule -12 C:BRE1/YDL074C:RAD9/YDR217C:YND1/YER005W:THO1/YER063W:RTR1/YER1 biosyntheti 39C:CHD1/YER164W:GUP1/YGL084C:RTF1/YGL244W:RRM3/YHR031C:THP2/YH c process R167W:SKN7/YHR206W:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C:CTK1 /YKL139W:RTT109/YLL002W:BRE2/YLR015W:SLX4/YLR135W:RNH203/YLR154C :EST1/YLR233C:TOP3/YLR234W:MMS22/YLR320W:YAP1/YML007W:TSA1/YML02 8W:MFT1/YML062C:CAC2/YML102W:CSM3/YMR048W:MRE11/YMR224C:SAP30/ YMR263W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST 3/YOR025W:DIA2/YOR080W:ELG1/YOR144C:RLF2/YPR018W:CLB5/YPR120C:CT F4/YPR135W:MMS1/YPR164W:HDA3/YPR179C 22403 cell cycle 3.77E DCC1/YCL016C:MRC1/YCL061C:RPN4/YDL020C:BRE1/YDL074C:RAD57/YDR004 phase -12 W:RAD55/YDR076W:SAC3/YDR159W:RAD9/YDR217C:XRS2/YDR369C:RAD51/Y ER095W:RAD24/YER173W:CTF8/YHR191C:CSM2/YIL132C:RTT101/YJL047C:SIC 1/YLR079W:TOP3/YLR234W:MMS22/YLR320W:RAD10/YML095C:CSM3/YMR048 W:CTF18/YMR078C:MRE11/YMR224C:TOF1/YNL273W:SIN3/YOL004W:ELG1/YO R144C:RAD17/YOR368W:DDC1/YPL194W:CLB5/YPR120C:CTF4/YPR135W 44238 primary 9.68E TEL1/YBL088C:UBC4/YBR082C:SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061 metabolic -12 C:NHP10/YDL002C:SLX5/YDL013W:RPN4/YDL020C:SIR2/YDL042C:RAD59/YDL0 process 59C:BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR076W:VPS41/YDR080W:UBC 13/YDR092W:SAC3/YDR159W:RAD9/YDR217C:XRS2/YDR369C:YND1/YER005W

103

:THO1/YER063W:RAD51/YER095W:SLX8/YER116C:RTR1/YER139C:CHD1/YER16 4W:RAD24/YER173W:GUP1/YGL084C:RAD54/YGL163C:RTF1/YGL244W:UPF3/Y GR072W:RRM3/YHR031C:RTT107/YHR154W:THP2/YHR167W:SKN7/YHR206W:C SM2/YIL132C:SUC2/YIL162W:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C :CTK1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:RAD5/YLR032W:SLX4/YLR1 35W:RNH203/YLR154C:EST1/YLR233C:TOP3/YLR234W:MMS22/YLR320W:YAP1/ YML007W:TSA1/YML028W:MFT1/YML062C:RAD10/YML095C:CAC2/YML102W:CS M3/YMR048W:CTF18/YMR078C:SKY1/YMR216C:MRE11/YMR224C:SAP30/YMR26 3W:SCS7/YMR272C:HDA1/YNL021W:SIW14/YNL032W:TOF1/YNL273W:SIN3/YO L004W:HST1/YOL068C:HST3/YOR025W:DIA2/YOR080W:ELG1/YOR144C:RAD17 /YOR368W:DDC1/YPL194W:RLF2/YPR018W:CLB5/YPR120C:CTF4/YPR135W:MM S1/YPR164W:HDA3/YPR179C 724 double- 1.61E RAD59/YDL059C:BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR strand -11 369C:RAD54/YGL163C:POL32/YJR043C:CTF18/YMR078C:MRE11/YMR224C:ELG break 1/YOR144C:CTF4/YPR135W repair via homologou s recombinat ion 44237 cellular 3.30E TEL1/YBL088C:UBC4/YBR082C:SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061 metabolic -11 C:NHP10/YDL002C:SLX5/YDL013W:RPN4/YDL020C:SIR2/YDL042C:RAD59/YDL0 process 59C:BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR076W:VPS41/YDR080W:UBC 13/YDR092W:SAC3/YDR159W:RAD9/YDR217C:XRS2/YDR369C:YND1/YER005W :THO1/YER063W:RAD51/YER095W:SLX8/YER116C:RTR1/YER139C:CHD1/YER16 4W:RAD24/YER173W:GUP1/YGL084C:RAD54/YGL163C:RTF1/YGL244W:UPF3/Y GR072W:RRM3/YHR031C:RTT107/YHR154W:THP2/YHR167W:SKN7/YHR206W:C SM2/YIL132C:SUC2/YIL162W:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C :CTK1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:RAD5/YLR032W:SHM2/YLR0 58C:SIC1/YLR079W:SLX4/YLR135W:RNH203/YLR154C:EST1/YLR233C:TOP3/YL R234W:MMS22/YLR320W:YAP1/YML007W:TSA1/YML028W:MFT1/YML062C:RAD 10/YML095C:CAC2/YML102W:CSM3/YMR048W:CTF18/YMR078C:SKY1/YMR216C :MRE11/YMR224C:SAP30/YMR263W:SCS7/YMR272C:HDA1/YNL021W:SIW14/Y NL032W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:DIA2 /YOR080W:ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W:RLF2/YPR018W:C LB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W:HDA3/YPR179C 6261 DNA- 6.26E MRC1/YCL061C:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C:SLX4/YLR135 dependent -11 W:RNH203/YLR154C:MMS22/YLR320W:CSM3/YMR048W:TOF1/YNL273W:SIN3/ DNA YOL004W:ELG1/YOR144C:CTF4/YPR135W:MMS1/YPR164W replication 279 M phase 1.42E DCC1/YCL016C:MRC1/YCL061C:BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR0 -10 76W:SAC3/YDR159W:XRS2/YDR369C:RAD51/YER095W:RAD24/YER173W:CTF8 /YHR191C:CSM2/YIL132C:RTT101/YJL047C:TOP3/YLR234W:MMS22/YLR320W:R AD10/YML095C:CSM3/YMR048W:CTF18/YMR078C:MRE11/YMR224C:TOF1/YNL2 73W:ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W:CLB5/YPR120C:CTF4/Y PR135W 50794 regulation 2.21E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 of cellular -10 C:BRE1/YDL074C:VPS41/YDR080W:UBC13/YDR092W:RAD9/YDR217C:RTR1/YE process R139C:CHD1/YER164W:RAD24/YER173W:STE2/YFL026W:RTT107/YHR154W:MP H1/YIR002C:RTT101/YJL047C:CTK1/YKL139W:RTT109/YLL002W:BRE2/YLR015 W:RAD5/YLR032W:SIC1/YLR079W:TOP3/YLR234W:YAP1/YML007W:TSA1/YML0 28W:CAC2/YML102W:CSM3/YMR048W:SKY1/YMR216C:MRE11/YMR224C:SAP30 /YMR263W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HS T3/YOR025W:DIA2/YOR080W:ELG1/YOR144C:RAD17/YOR368W:BEM4/YPL161C :DDC1/YPL194W:RLF2/YPR018W:CLB5/YPR120C:MMS1/YPR164W:HDA3/YPR17 9C 48523 negative 2.33E SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:RAD9/YDR217 regulation -10 C:RAD24/YER173W:RTT107/YHR154W:MPH1/YIR002C:RTT101/YJL047C:RTT10 of cellular 9/YLL002W:BRE2/YLR015W:SIC1/YLR079W:TSA1/YML028W:CAC2/YML102W:C process SM3/YMR048W:SAP30/YMR263W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL00 4W:HST1/YOL068C:HST3/YOR025W:ELG1/YOR144C:RAD17/YOR368W:DDC1/Y PL194W:RLF2/YPR018W:MMS1/YPR164W:HDA3/YPR179C 8152 metabolic 2.51E TEL1/YBL088C:UBC4/YBR082C:SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061 process -10 C:NHP10/YDL002C:SLX5/YDL013W:RPN4/YDL020C:SIR2/YDL042C:RAD59/YDL0 59C:BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR076W:VPS41/YDR080W:UBC 13/YDR092W:SAC3/YDR159W:RAD9/YDR217C:XRS2/YDR369C:YND1/YER005W :THO1/YER063W:RAD51/YER095W:SLX8/YER116C:RTR1/YER139C:CHD1/YER16

104

4W:RAD24/YER173W:GUP1/YGL084C:RAD54/YGL163C:RTF1/YGL244W:UPF3/Y GR072W:RRM3/YHR031C:RTT107/YHR154W:THP2/YHR167W:SKN7/YHR206W:C SM2/YIL132C:SUC2/YIL162W:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C :CTK1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:RAD5/YLR032W:SHM2/YLR0 58C:SIC1/YLR079W:SLX4/YLR135W:RNH203/YLR154C:EST1/YLR233C:TOP3/YL R234W:MMS22/YLR320W:YAP1/YML007W:TSA1/YML028W:MFT1/YML062C:RAD 10/YML095C:CAC2/YML102W:CSM3/YMR048W:CTF18/YMR078C:SKY1/YMR216C :MRE11/YMR224C:SAP30/YMR263W:SCS7/YMR272C:HDA1/YNL021W:SIW14/Y NL032W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:DIA2 /YOR080W:ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W:RLF2/YPR018W:C LB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W:HDA3/YPR179C 22402 cell cycle 3.97E DCC1/YCL016C:MRC1/YCL061C:RPN4/YDL020C:BRE1/YDL074C:RAD57/YDR004 process -10 W:RAD55/YDR076W:SAC3/YDR159W:RAD9/YDR217C:XRS2/YDR369C:RAD51/Y ER095W:RAD24/YER173W:CTF8/YHR191C:CSM2/YIL132C:RTT101/YJL047C:SIC 1/YLR079W:TOP3/YLR234W:MMS22/YLR320W:TSA1/YML028W:RAD10/YML095C :CSM3/YMR048W:CTF18/YMR078C:MRE11/YMR224C:TOF1/YNL273W:SIN3/YOL 004W:ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W:CLB5/YPR120C:CTF4/ YPR135W 50789 regulation 4.11E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 of -10 C:BRE1/YDL074C:VPS41/YDR080W:UBC13/YDR092W:RAD9/YDR217C:RTR1/YE biological R139C:CHD1/YER164W:RAD24/YER173W:STE2/YFL026W:RAD54/YGL163C:RTT process 107/YHR154W:MPH1/YIR002C:RTT101/YJL047C:CTK1/YKL139W:RTT109/YLL00 2W:BRE2/YLR015W:RAD5/YLR032W:SIC1/YLR079W:TOP3/YLR234W:YAP1/YML 007W:TSA1/YML028W:CAC2/YML102W:CSM3/YMR048W:SKY1/YMR216C:MRE1 1/YMR224C:SAP30/YMR263W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W: HST1/YOL068C:HST3/YOR025W:DIA2/YOR080W:ELG1/YOR144C:RAD17/YOR36 8W:BEM4/YPL161C:DDC1/YPL194W:RLF2/YPR018W:CLB5/YPR120C:MMS1/YPR1 64W:HDA3/YPR179C 48519 negative 4.20E SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:RAD9/YDR217 regulation -10 C:RAD24/YER173W:RTT107/YHR154W:MPH1/YIR002C:RTT101/YJL047C:RTT10 of 9/YLL002W:BRE2/YLR015W:SIC1/YLR079W:TSA1/YML028W:CAC2/YML102W:C biological SM3/YMR048W:SAP30/YMR263W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL00 process 4W:HST1/YOL068C:HST3/YOR025W:ELG1/YOR144C:RAD17/YOR368W:DDC1/Y PL194W:RLF2/YPR018W:MMS1/YPR164W:HDA3/YPR179C 16043 cellular 5.99E TEL1/YBL088C:SWD3/YBR175W:SNF5/YBR289W:DCC1/YCL016C:MRC1/YCL061 component -10 C:NHP10/YDL002C:SLX5/YDL013W:SIR2/YDL042C:RAD59/YDL059C:BRE1/YDL0 organizatio 74C:RAD57/YDR004W:RAD55/YDR076W:VPS41/YDR080W:UBC13/YDR092W:SA n C3/YDR159W:XRS2/YDR369C:THO1/YER063W:RAD51/YER095W:SLX8/YER116C :CHD1/YER164W:IES1/YFL013C:STE2/YFL026W:RAD54/YGL163C:RTF1/YGL244 W:RRM3/YHR031C:CTF8/YHR191C:SKN7/YHR206W:RTT101/YJL047C:NUP133/Y KR082W:RTT109/YLL002W:BRE2/YLR015W:RAD5/YLR032W:EST1/YLR233C:TOP 3/YLR234W:MMS22/YLR320W:CAC2/YML102W:CSM3/YMR048W:CTF18/YMR078 C:SKY1/YMR216C:SAP30/YMR263W:HDA1/YNL021W:SIW14/YNL032W:TOF1/YN L273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:ELG1/YOR144C:BEM4/ YPL161C:RLF2/YPR018W:CLB5/YPR120C:CTF4/YPR135W:HDA3/YPR179C 7049 cell cycle 1.30E DCC1/YCL016C:MRC1/YCL061C:RPN4/YDL020C:BRE1/YDL074C:RAD57/YDR004 -09 W:RAD55/YDR076W:SAC3/YDR159W:RAD9/YDR217C:XRS2/YDR369C:RAD51/Y ER095W:RAD24/YER173W:CTF8/YHR191C:CSM2/YIL132C:RTT101/YJL047C:SIC 1/YLR079W:TOP3/YLR234W:MMS22/YLR320W:TSA1/YML028W:RAD10/YML095C :CSM3/YMR048W:CTF18/YMR078C:MRE11/YMR224C:TOF1/YNL273W:SIN3/YOL 004W:ELG1/YOR144C:RAD17/YOR368W:DDC1/YPL194W:CLB5/YPR120C:CTF4/ YPR135W 51052 regulation 1.76E MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042C:MPH1/YIR002C:TOP3/YLR234W: of DNA -09 CSM3/YMR048W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:DIA2/YOR080 metabolic W:ELG1/YOR144C:CLB5/YPR120C process 6325 chromatin 1.79E TEL1/YBL088C:SWD3/YBR175W:SNF5/YBR289W:NHP10/YDL002C:SIR2/YDL042 organizatio -09 C:BRE1/YDL074C:CHD1/YER164W:IES1/YFL013C:RAD54/YGL163C:RTF1/YGL24 n 4W:RTT109/YLL002W:BRE2/YLR015W:CAC2/YML102W:SAP30/YMR263W:HDA1/ YNL021W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:RLF2/YPR018W:HDA 3/YPR179C 16568 chromatin 3.96E TEL1/YBL088C:SWD3/YBR175W:SNF5/YBR289W:NHP10/YDL002C:SIR2/YDL042 modificatio -09 C:BRE1/YDL074C:CHD1/YER164W:IES1/YFL013C:RAD54/YGL163C:RTF1/YGL24 n 4W:RTT109/YLL002W:BRE2/YLR015W:SAP30/YMR263W:HDA1/YNL021W:SIN3/ YOL004W:HST1/YOL068C:HST3/YOR025W:HDA3/YPR179C 19219 regulation 9.34E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 of -09 C:BRE1/YDL074C:RAD9/YDR217C:RTR1/YER139C:CHD1/YER164W:MPH1/YIR00

105

nucleobase 2C:CTK1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:TOP3/YLR234W:YAP1/YM , L007W:CAC2/YML102W:CSM3/YMR048W:MRE11/YMR224C:SAP30/YMR263W:H nucleoside, DA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W nucleotide :DIA2/YOR080W:ELG1/YOR144C:RLF2/YPR018W:CLB5/YPR120C:HDA3/YPR179 and nucleic C acid metabolic process 51171 regulation 1.08E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 of nitrogen -08 C:BRE1/YDL074C:RAD9/YDR217C:RTR1/YER139C:CHD1/YER164W:MPH1/YIR00 compound 2C:CTK1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:TOP3/YLR234W:YAP1/YM metabolic L007W:CAC2/YML102W:CSM3/YMR048W:MRE11/YMR224C:SAP30/YMR263W:H process DA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W :DIA2/YOR080W:ELG1/YOR144C:RLF2/YPR018W:CLB5/YPR120C:HDA3/YPR179 C 31570 DNA 1.24E MRC1/YCL061C:BRE1/YDL074C:RAD9/YDR217C:RAD24/YER173W:TSA1/YML02 integrity -08 8W:CSM3/YMR048W:TOF1/YNL273W:RAD17/YOR368W:DDC1/YPL194W checkpoint 71840 cellular 1.86E TEL1/YBL088C:SWD3/YBR175W:SNF5/YBR289W:DCC1/YCL016C:MRC1/YCL061 component -08 C:NHP10/YDL002C:SLX5/YDL013W:SIR2/YDL042C:RAD59/YDL059C:BRE1/YDL0 organizatio 74C:RAD57/YDR004W:RAD55/YDR076W:VPS41/YDR080W:UBC13/YDR092W:SA n or C3/YDR159W:XRS2/YDR369C:THO1/YER063W:RAD51/YER095W:SLX8/YER116C biogenesis :CHD1/YER164W:IES1/YFL013C:STE2/YFL026W:RAD54/YGL163C:RTF1/YGL244 W:RRM3/YHR031C:CTF8/YHR191C:SKN7/YHR206W:RTT101/YJL047C:NUP133/Y KR082W:RTT109/YLL002W:BRE2/YLR015W:RAD5/YLR032W:EST1/YLR233C:TOP 3/YLR234W:MMS22/YLR320W:CAC2/YML102W:CSM3/YMR048W:CTF18/YMR078 C:SKY1/YMR216C:SAP30/YMR263W:HDA1/YNL021W:SIW14/YNL032W:TOF1/YN L273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:ELG1/YOR144C:BEM4/ YPL161C:RLF2/YPR018W:CLB5/YPR120C:CTF4/YPR135W:HDA3/YPR179C 60255 regulation 1.05E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 of -07 C:BRE1/YDL074C:RAD9/YDR217C:RTR1/YER139C:CHD1/YER164W:MPH1/YIR00 macromole 2C:CTK1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:TOP3/YLR234W:YAP1/YM cule L007W:TSA1/YML028W:CAC2/YML102W:CSM3/YMR048W:MRE11/YMR224C:SAP metabolic 30/YMR263W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C: process HST3/YOR025W:DIA2/YOR080W:ELG1/YOR144C:RLF2/YPR018W:CLB5/YPR120 C:HDA3/YPR179C 9987 cellular 1.12E TEL1/YBL088C:UBC4/YBR082C:SWD3/YBR175W:SNF5/YBR289W:DCC1/YCL016 process -07 C:MRC1/YCL061C:NHP10/YDL002C:SLX5/YDL013W:RPN4/YDL020C:SIR2/YDL04 2C:RAD59/YDL059C:BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR076W:VPS41 /YDR080W:UBC13/YDR092W:SAC3/YDR159W:RAD9/YDR217C:XRS2/YDR369C: YND1/YER005W:FCY21/YER060W:THO1/YER063W:RAD51/YER095W:SLX8/YER1 16C:RTR1/YER139C:CHD1/YER164W:RAD24/YER173W:IES1/YFL013C:STE2/YFL 026W:GUP1/YGL084C:RAD54/YGL163C:RTF1/YGL244W:UPF3/YGR072W:RRM3/ YHR031C:RTT107/YHR154W:THP2/YHR167W:CTF8/YHR191C:SKN7/YHR206W:C SM2/YIL132C:SUC2/YIL162W:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C :YKL069W:CTK1/YKL139W:NUP133/YKR082W:RTT109/YLL002W:BRE2/YLR015 W:RAD5/YLR032W:SHM2/YLR058C:SIC1/YLR079W:SLX4/YLR135W:RNH203/YL R154C:EST1/YLR233C:TOP3/YLR234W:MMS22/YLR320W:YAP1/YML007W:TSA1/ YML028W:MFT1/YML062C:RAD10/YML095C:CAC2/YML102W:CSM3/YMR048W:C TF18/YMR078C:SKY1/YMR216C:MRE11/YMR224C:SAP30/YMR263W:SCS7/YMR2 72C:HDA1/YNL021W:SIW14/YNL032W:COG6/YNL041C:TEX1/YNL253W:TOF1/Y NL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:DIA2/YOR080W:ELG1 /YOR144C:RAD17/YOR368W:BEM4/YPL161C:DDC1/YPL194W:RLF2/YPR018W:C LB5/YPR120C:CTF4/YPR135W:MMS1/YPR164W:HDA3/YPR179C 7064 mitotic 1.18E DCC1/YCL016C:MRC1/YCL061C:CTF8/YHR191C:TOP3/YLR234W:CSM3/YMR048 sister -07 W:CTF18/YMR078C:TOF1/YNL273W:ELG1/YOR144C:CTF4/YPR135W chromatid cohesion 42592 homeostati 1.70E TEL1/YBL088C:SWD3/YBR175W:MRC1/YCL061C:SLX5/YDL013W:RAD59/YDL05 c process -07 9C:RAD57/YDR004W:UBC13/YDR092W:XRS2/YDR369C:RAD51/YER095W:SLX8/ YER116C:RAD54/YGL163C:BRE2/YLR015W:RAD5/YLR032W:EST1/YLR233C:TOP 3/YLR234W:TSA1/YML028W:SKY1/YMR216C:ELG1/YOR144C 45005 maintenan 2.57E MRC1/YCL061C:RTT101/YJL047C:MMS22/YLR320W:CSM3/YMR048W:TOF1/YNL ce of -07 273W:MMS1/YPR164W fidelity involved in DNA-

106

dependent DNA replication 19222 regulation 4.17E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 of -07 C:BRE1/YDL074C:RAD9/YDR217C:RTR1/YER139C:CHD1/YER164W:RAD54/YGL1 metabolic 63C:MPH1/YIR002C:CTK1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:SIC1/YL process R079W:TOP3/YLR234W:YAP1/YML007W:TSA1/YML028W:CAC2/YML102W:CSM3 /YMR048W:MRE11/YMR224C:SAP30/YMR263W:HDA1/YNL021W:TOF1/YNL273W :SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:DIA2/YOR080W:ELG1/YOR14 4C:RLF2/YPR018W:CLB5/YPR120C:HDA3/YPR179C 31323 regulation 6.03E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 of cellular -07 C:BRE1/YDL074C:RAD9/YDR217C:RTR1/YER139C:CHD1/YER164W:MPH1/YIR00 metabolic 2C:CTK1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:SIC1/YLR079W:TOP3/YLR process 234W:YAP1/YML007W:TSA1/YML028W:CAC2/YML102W:CSM3/YMR048W:MRE1 1/YMR224C:SAP30/YMR263W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W: HST1/YOL068C:HST3/YOR025W:DIA2/YOR080W:ELG1/YOR144C:RLF2/YPR018 W:CLB5/YPR120C:HDA3/YPR179C 278 mitotic cell 6.13E DCC1/YCL016C:MRC1/YCL061C:RPN4/YDL020C:BRE1/YDL074C:SAC3/YDR159W cycle -07 :RAD9/YDR217C:CTF8/YHR191C:RTT101/YJL047C:SIC1/YLR079W:TOP3/YLR23 4W:CSM3/YMR048W:CTF18/YMR078C:TOF1/YNL273W:SIN3/YOL004W:ELG1/YO R144C:DDC1/YPL194W:CLB5/YPR120C:CTF4/YPR135W 80090 regulation 6.47E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 of primary -07 C:BRE1/YDL074C:RAD9/YDR217C:RTR1/YER139C:CHD1/YER164W:MPH1/YIR00 metabolic 2C:CTK1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:TOP3/YLR234W:YAP1/YM process L007W:TSA1/YML028W:CAC2/YML102W:CSM3/YMR048W:MRE11/YMR224C:SAP 30/YMR263W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C: HST3/YOR025W:DIA2/YOR080W:ELG1/YOR144C:RLF2/YPR018W:CLB5/YPR120 C:HDA3/YPR179C 6350 transcriptio 6.96E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 n -07 C:BRE1/YDL074C:RAD9/YDR217C:THO1/YER063W:RTR1/YER139C:CHD1/YER16 4W:RTF1/YGL244W:THP2/YHR167W:SKN7/YHR206W:CTK1/YKL139W:RTT109/Y LL002W:BRE2/YLR015W:YAP1/YML007W:MFT1/YML062C:CAC2/YML102W:MRE1 1/YMR224C:SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/YOL068C: HST3/YOR025W:RLF2/YPR018W:HDA3/YPR179C 44249 cellular 8.45E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 biosyntheti -07 C:BRE1/YDL074C:RAD9/YDR217C:YND1/YER005W:THO1/YER063W:RTR1/YER1 c process 39C:CHD1/YER164W:GUP1/YGL084C:RTF1/YGL244W:RRM3/YHR031C:THP2/YH R167W:SKN7/YHR206W:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C:CTK1 /YKL139W:RTT109/YLL002W:BRE2/YLR015W:SLX4/YLR135W:RNH203/YLR154C :EST1/YLR233C:TOP3/YLR234W:MMS22/YLR320W:YAP1/YML007W:TSA1/YML02 8W:MFT1/YML062C:CAC2/YML102W:CSM3/YMR048W:MRE11/YMR224C:SAP30/ YMR263W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST 3/YOR025W:DIA2/YOR080W:ELG1/YOR144C:RLF2/YPR018W:CLB5/YPR120C:CT F4/YPR135W:MMS1/YPR164W:HDA3/YPR179C 10556 regulation 9.59E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 of -07 C:BRE1/YDL074C:RAD9/YDR217C:RTR1/YER139C:CHD1/YER164W:CTK1/YKL13 macromole 9W:RTT109/YLL002W:BRE2/YLR015W:YAP1/YML007W:TSA1/YML028W:CAC2/Y cule ML102W:CSM3/YMR048W:MRE11/YMR224C:SAP30/YMR263W:HDA1/YNL021W: biosyntheti TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:DIA2/YOR080 c process W:RLF2/YPR018W:CLB5/YPR120C:HDA3/YPR179C 20001 regulation 9.59E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 12 of cellular -07 C:BRE1/YDL074C:RAD9/YDR217C:RTR1/YER139C:CHD1/YER164W:CTK1/YKL13 macromole 9W:RTT109/YLL002W:BRE2/YLR015W:YAP1/YML007W:TSA1/YML028W:CAC2/Y cule ML102W:CSM3/YMR048W:MRE11/YMR224C:SAP30/YMR263W:HDA1/YNL021W: biosyntheti TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:DIA2/YOR080 c process W:RLF2/YPR018W:CLB5/YPR120C:HDA3/YPR179C 7062 sister 1.01E DCC1/YCL016C:MRC1/YCL061C:CTF8/YHR191C:TOP3/YLR234W:CSM3/YMR048 chromatid -06 W:CTF18/YMR078C:TOF1/YNL273W:ELG1/YOR144C:CTF4/YPR135W cohesion 9058 biosyntheti 1.81E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 c process -06 C:BRE1/YDL074C:RAD9/YDR217C:YND1/YER005W:THO1/YER063W:RTR1/YER1 39C:CHD1/YER164W:GUP1/YGL084C:RTF1/YGL244W:RRM3/YHR031C:THP2/YH R167W:SKN7/YHR206W:MPH1/YIR002C:RTT101/YJL047C:POL32/YJR043C:CTK1 /YKL139W:RTT109/YLL002W:BRE2/YLR015W:SLX4/YLR135W:RNH203/YLR154C :EST1/YLR233C:TOP3/YLR234W:MMS22/YLR320W:YAP1/YML007W:TSA1/YML02 8W:MFT1/YML062C:CAC2/YML102W:CSM3/YMR048W:MRE11/YMR224C:SAP30/ YMR263W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST

107

3/YOR025W:DIA2/YOR080W:ELG1/YOR144C:RLF2/YPR018W:CLB5/YPR120C:CT F4/YPR135W:MMS1/YPR164W:HDA3/YPR179C 45934 negative 1.93E SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:MPH1/YIR002C regulation -06 :BRE2/YLR015W:CAC2/YML102W:CSM3/YMR048W:SAP30/YMR263W:HDA1/YNL of 021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:ELG1/Y nucleobase OR144C:RLF2/YPR018W:HDA3/YPR179C , nucleoside, nucleotide and nucleic acid metabolic process 51172 negative 1.93E SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:MPH1/YIR002C regulation -06 :BRE2/YLR015W:CAC2/YML102W:CSM3/YMR048W:SAP30/YMR263W:HDA1/YNL of nitrogen 021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:ELG1/Y compound OR144C:RLF2/YPR018W:HDA3/YPR179C metabolic process 51053 negative 2.29E MRC1/YCL061C:SIR2/YDL042C:MPH1/YIR002C:CSM3/YMR048W:TOF1/YNL273 regulation -06 W:HST1/YOL068C:ELG1/YOR144C of DNA metabolic process 16070 RNA 2.46E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074 metabolic -06 C:SAC3/YDR159W:RAD9/YDR217C:THO1/YER063W:RTR1/YER139C:CHD1/YER1 process 64W:RTF1/YGL244W:UPF3/YGR072W:THP2/YHR167W:RTT101/YJL047C:POL32/ YJR043C:CTK1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:RNH203/YLR154C: YAP1/YML007W:MFT1/YML062C:CAC2/YML102W:SKY1/YMR216C:MRE11/YMR22 4C:SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/YOL068C:HST3/YO R025W:RLF2/YPR018W:MMS1/YPR164W:HDA3/YPR179C 32774 RNA 2.54E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074 biosyntheti -06 C:RAD9/YDR217C:THO1/YER063W:RTR1/YER139C:CHD1/YER164W:RTF1/YGL2 c process 44W:THP2/YHR167W:CTK1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:YAP1/Y ML007W:MFT1/YML062C:CAC2/YML102W:MRE11/YMR224C:SAP30/YMR263W:H DA1/YNL021W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:RLF2/YPR018W :HDA3/YPR179C 6351 transcriptio 2.54E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074 n, DNA- -06 C:RAD9/YDR217C:THO1/YER063W:RTR1/YER139C:CHD1/YER164W:RTF1/YGL2 dependent 44W:THP2/YHR167W:CTK1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:YAP1/Y ML007W:MFT1/YML062C:CAC2/YML102W:MRE11/YMR224C:SAP30/YMR263W:H DA1/YNL021W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:RLF2/YPR018W :HDA3/YPR179C 31326 regulation 2.89E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 of cellular -06 C:BRE1/YDL074C:RAD9/YDR217C:RTR1/YER139C:CHD1/YER164W:CTK1/YKL13 biosyntheti 9W:RTT109/YLL002W:BRE2/YLR015W:YAP1/YML007W:TSA1/YML028W:CAC2/Y c process ML102W:CSM3/YMR048W:MRE11/YMR224C:SAP30/YMR263W:HDA1/YNL021W: TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:DIA2/YOR080 W:RLF2/YPR018W:CLB5/YPR120C:HDA3/YPR179C 9889 regulation 3.07E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 of -06 C:BRE1/YDL074C:RAD9/YDR217C:RTR1/YER139C:CHD1/YER164W:CTK1/YKL13 biosyntheti 9W:RTT109/YLL002W:BRE2/YLR015W:YAP1/YML007W:TSA1/YML028W:CAC2/Y c process ML102W:CSM3/YMR048W:MRE11/YMR224C:SAP30/YMR263W:HDA1/YNL021W: TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:DIA2/YOR080 W:RLF2/YPR018W:CLB5/YPR120C:HDA3/YPR179C 16458 gene 3.36E SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:BRE2/YLR015 silencing -06 W:CAC2/YML102W:SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/YO L068C:HST3/YOR025W:RLF2/YPR018W:HDA3/YPR179C 16569 covalent 4.89E TEL1/YBL088C:SWD3/YBR175W:BRE1/YDL074C:RTF1/YGL244W:RTT109/YLL00 chromatin -06 2W:BRE2/YLR015W:SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/Y modificatio OL068C:HST3/YOR025W:HDA3/YPR179C n 16570 histone 4.89E TEL1/YBL088C:SWD3/YBR175W:BRE1/YDL074C:RTF1/YGL244W:RTT109/YLL00 modificatio -06 2W:BRE2/YLR015W:SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/Y n OL068C:HST3/YOR025W:HDA3/YPR179C 7059 chromoso 4.89E DCC1/YCL016C:MRC1/YCL061C:CTF8/YHR191C:CSM2/YIL132C:TOP3/YLR234W: me -06 MMS22/YLR320W:CSM3/YMR048W:CTF18/YMR078C:TOF1/YNL273W:ELG1/YOR

108

segregatio 144C:CTF4/YPR135W:HDA3/YPR179C n 31324 negative 6.97E SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:MPH1/YIR002C regulation -06 :BRE2/YLR015W:SIC1/YLR079W:CAC2/YML102W:CSM3/YMR048W:SAP30/YMR2 of cellular 63W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YO metabolic R025W:ELG1/YOR144C:RLF2/YPR018W:HDA3/YPR179C process 43687 post- 7.32E TEL1/YBL088C:UBC4/YBR082C:SWD3/YBR175W:SLX5/YDL013W:BRE1/YDL074 translation -06 C:UBC13/YDR092W:SLX8/YER116C:RTR1/YER139C:RTF1/YGL244W:UPF3/YGR0 al protein 72W:CTK1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:RAD5/YLR032W:SKY1/Y modificatio MR216C:SAP30/YMR263W:HDA1/YNL021W:SIW14/YNL032W:SIN3/YOL004W:H n ST1/YOL068C:HST3/YOR025W:DIA2/YOR080W:HDA3/YPR179C 42770 DNA 7.39E MRC1/YCL061C:BRE1/YDL074C:RAD9/YDR217C:RAD24/YER173W:TSA1/YML02 damage -06 8W:RAD17/YOR368W:DDC1/YPL194W response, signal transductio n 77 DNA 7.39E MRC1/YCL061C:BRE1/YDL074C:RAD9/YDR217C:RAD24/YER173W:TSA1/YML02 damage -06 8W:RAD17/YOR368W:DDC1/YPL194W checkpoint 819 sister 7.94E DCC1/YCL016C:MRC1/YCL061C:CTF8/YHR191C:TOP3/YLR234W:MMS22/YLR320 chromatid -06 W:CSM3/YMR048W:CTF18/YMR078C:TOF1/YNL273W:ELG1/YOR144C:CTF4/YPR segregatio 135W n 726 non- 8.39E SIR2/YDL042C:RAD59/YDL059C:XRS2/YDR369C:RTT109/YLL002W:SLX4/YLR13 recombinat -06 5W:RAD10/YML095C:MRE11/YMR224C:SIN3/YOL004W ional repair 9892 negative 1.00E SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:MPH1/YIR002C regulation -05 :BRE2/YLR015W:SIC1/YLR079W:CAC2/YML102W:CSM3/YMR048W:SAP30/YMR2 of 63W:HDA1/YNL021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YO metabolic R025W:ELG1/YOR144C:RLF2/YPR018W:HDA3/YPR179C process 10605 negative 1.63E SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:MPH1/YIR002C regulation -05 :BRE2/YLR015W:CAC2/YML102W:CSM3/YMR048W:SAP30/YMR263W:HDA1/YNL of 021W:TOF1/YNL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:ELG1/Y macromole OR144C:RLF2/YPR018W:HDA3/YPR179C cule metabolic process 7067 mitosis 2.77E DCC1/YCL016C:MRC1/YCL061C:SAC3/YDR159W:CTF8/YHR191C:RTT101/YJL04 -05 7C:TOP3/YLR234W:CSM3/YMR048W:CTF18/YMR078C:TOF1/YNL273W:ELG1/YO R144C:CTF4/YPR135W 40029 regulation 2.92E SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:BRE2/YLR015 of gene -05 W:CAC2/YML102W:SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/YO expression L068C:HST3/YOR025W:RLF2/YPR018W , epigenetic 45814 negative 2.92E SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:BRE2/YLR015 regulation -05 W:CAC2/YML102W:SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/YO of gene L068C:HST3/YOR025W:RLF2/YPR018W expression , epigenetic 6342 chromatin 2.92E SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:BRE2/YLR015 silencing -05 W:CAC2/YML102W:SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/YO L068C:HST3/YOR025W:RLF2/YPR018W 280 nuclear 3.28E DCC1/YCL016C:MRC1/YCL061C:SAC3/YDR159W:CTF8/YHR191C:RTT101/YJL04 division -05 7C:TOP3/YLR234W:CSM3/YMR048W:CTF18/YMR078C:TOF1/YNL273W:ELG1/YO R144C:CTF4/YPR135W 6464 protein 3.98E TEL1/YBL088C:UBC4/YBR082C:SWD3/YBR175W:SLX5/YDL013W:BRE1/YDL074 modificatio -05 C:UBC13/YDR092W:YND1/YER005W:SLX8/YER116C:RTR1/YER139C:GUP1/YGL0 n process 84C:RTF1/YGL244W:UPF3/YGR072W:CTK1/YKL139W:RTT109/YLL002W:BRE2/Y LR015W:RAD5/YLR032W:SKY1/YMR216C:SAP30/YMR263W:HDA1/YNL021W:SI W14/YNL032W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:DIA2/YOR080 W:HDA3/YPR179C

109

70 mitotic 5.94E DCC1/YCL016C:MRC1/YCL061C:CTF8/YHR191C:TOP3/YLR234W:CSM3/YMR048 sister -05 W:CTF18/YMR078C:TOF1/YNL273W:ELG1/YOR144C:CTF4/YPR135W chromatid segregatio n 45449 regulation 6.74E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 of -05 C:BRE1/YDL074C:RAD9/YDR217C:RTR1/YER139C:CHD1/YER164W:CTK1/YKL13 transcriptio 9W:RTT109/YLL002W:BRE2/YLR015W:YAP1/YML007W:CAC2/YML102W:MRE11/ n YMR224C:SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/YOL068C:HS T3/YOR025W:RLF2/YPR018W:HDA3/YPR179C 6275 regulation 6.88E MRC1/YCL061C:SIR2/YDL042C:CSM3/YMR048W:TOF1/YNL273W:SIN3/YOL004 of DNA -05 W:DIA2/YOR080W:CLB5/YPR120C replication 51327 M phase of 8.83E BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:RAD51/YER meiotic cell -05 095W:RAD24/YER173W:CSM2/YIL132C:TOP3/YLR234W:MMS22/YLR320W:RAD cycle 10/YML095C:CSM3/YMR048W:MRE11/YMR224C:RAD17/YOR368W:DDC1/YPL19 4W 7126 meiosis 8.83E BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:RAD51/YER -05 095W:RAD24/YER173W:CSM2/YIL132C:TOP3/YLR234W:MMS22/YLR320W:RAD 10/YML095C:CSM3/YMR048W:MRE11/YMR224C:RAD17/YOR368W:DDC1/YPL19 4W 6355 regulation 9.19E SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074 of -05 C:RAD9/YDR217C:RTR1/YER139C:CHD1/YER164W:CTK1/YKL139W:RTT109/YLL transcriptio 002W:BRE2/YLR015W:YAP1/YML007W:CAC2/YML102W:MRE11/YMR224C:SAP3 n, DNA- 0/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:R dependent LF2/YPR018W:HDA3/YPR179C 10526 negative 9.75E RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS1/Y regulation -05 PR164W of transpositi on, RNA- mediated 10529 negative 9.75E RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS1/Y regulation -05 PR164W of transpositi on 727 double- 9.75E RAD59/YDL059C:XRS2/YDR369C:POL32/YJR043C:MRE11/YMR224C:CTF4/YPR1 strand -05 35W break repair via break- induced replication 51321 meiotic cell 0.000 BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:RAD51/YER cycle 11 095W:RAD24/YER173W:CSM2/YIL132C:TOP3/YLR234W:MMS22/YLR320W:RAD 10/YML095C:CSM3/YMR048W:MRE11/YMR224C:RAD17/YOR368W:DDC1/YPL19 4W 48285 organelle 0.000 DCC1/YCL016C:MRC1/YCL061C:SAC3/YDR159W:CTF8/YHR191C:RTT101/YJL04 fission 12 7C:TOP3/YLR234W:CSM3/YMR048W:CTF18/YMR078C:TOF1/YNL273W:ELG1/YO R144C:CTF4/YPR135W 51252 regulation 0.000 SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074 of RNA 13 C:RAD9/YDR217C:RTR1/YER139C:CHD1/YER164W:CTK1/YKL139W:RTT109/YLL metabolic 002W:BRE2/YLR015W:YAP1/YML007W:CAC2/YML102W:MRE11/YMR224C:SAP3 process 0/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:R LF2/YPR018W:HDA3/YPR179C 10558 negative 0.000 SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:BRE2/YLR015 regulation 15 W:CAC2/YML102W:CSM3/YMR048W:SAP30/YMR263W:HDA1/YNL021W:TOF1/Y of NL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:RLF2/YPR018W:HDA3 macromole /YPR179C cule biosyntheti c process 20001 negative 0.000 SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:BRE2/YLR015 13 regulation 15 W:CAC2/YML102W:CSM3/YMR048W:SAP30/YMR263W:HDA1/YNL021W:TOF1/Y of cellular NL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:RLF2/YPR018W:HDA3

110

macromole /YPR179C cule biosyntheti c process 6348 chromatin 0.000 SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:BRE2/YLR015 silencing at 17 W:SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST3/YOR025W telomere 87 M phase of 0.000 DCC1/YCL016C:MRC1/YCL061C:SAC3/YDR159W:CTF8/YHR191C:RTT101/YJL04 mitotic cell 18 7C:TOP3/YLR234W:CSM3/YMR048W:CTF18/YMR078C:TOF1/YNL273W:ELG1/YO cycle R144C:CTF4/YPR135W 65008 regulation 0.000 TEL1/YBL088C:SWD3/YBR175W:MRC1/YCL061C:SLX5/YDL013W:RAD59/YDL05 of 18 9C:RAD57/YDR004W:UBC13/YDR092W:XRS2/YDR369C:RAD51/YER095W:SLX8/ biological YER116C:RAD54/YGL163C:SKN7/YHR206W:CTK1/YKL139W:BRE2/YLR015W:RA quality D5/YLR032W:EST1/YLR233C:TOP3/YLR234W:TSA1/YML028W:SKY1/YMR216C:E LG1/YOR144C 71156 regulation 0.000 MRC1/YCL061C:BRE1/YDL074C:RAD9/YDR217C:RAD24/YER173W:TSA1/YML02 of cell 21 8W:CSM3/YMR048W:TOF1/YNL273W:RAD17/YOR368W:DDC1/YPL194W cycle arrest 75 cell cycle 0.000 MRC1/YCL061C:BRE1/YDL074C:RAD9/YDR217C:RAD24/YER173W:TSA1/YML02 checkpoint 21 8W:CSM3/YMR048W:TOF1/YNL273W:RAD17/YOR368W:DDC1/YPL194W 10468 regulation 0.000 SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 of gene 29 C:BRE1/YDL074C:RAD9/YDR217C:RTR1/YER139C:CHD1/YER164W:CTK1/YKL13 expression 9W:RTT109/YLL002W:BRE2/YLR015W:YAP1/YML007W:TSA1/YML028W:CAC2/Y ML102W:MRE11/YMR224C:SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:H ST1/YOL068C:HST3/YOR025W:RLF2/YPR018W:HDA3/YPR179C 43412 macromole 0.000 TEL1/YBL088C:UBC4/YBR082C:SWD3/YBR175W:SLX5/YDL013W:BRE1/YDL074 cule 37 C:UBC13/YDR092W:YND1/YER005W:SLX8/YER116C:RTR1/YER139C:GUP1/YGL0 modificatio 84C:RTF1/YGL244W:UPF3/YGR072W:CTK1/YKL139W:RTT109/YLL002W:BRE2/Y n LR015W:RAD5/YLR032W:SKY1/YMR216C:SAP30/YMR263W:HDA1/YNL021W:SI W14/YNL032W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:DIA2/YOR080 W:HDA3/YPR179C 31327 negative 0.000 SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:BRE2/YLR015 regulation 39 W:CAC2/YML102W:CSM3/YMR048W:SAP30/YMR263W:HDA1/YNL021W:TOF1/Y of cellular NL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:RLF2/YPR018W:HDA3 biosyntheti /YPR179C c process 9890 negative 0.000 SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:BRE2/YLR015 regulation 39 W:CAC2/YML102W:CSM3/YMR048W:SAP30/YMR263W:HDA1/YNL021W:TOF1/Y of NL273W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR025W:RLF2/YPR018W:HDA3 biosyntheti /YPR179C c process 7050 cell cycle 0.000 MRC1/YCL061C:BRE1/YDL074C:RAD9/YDR217C:RAD24/YER173W:TSA1/YML02 arrest 43 8W:CSM3/YMR048W:TOF1/YNL273W:RAD17/YOR368W:DDC1/YPL194W 45786 negative 0.000 MRC1/YCL061C:BRE1/YDL074C:RAD9/YDR217C:RAD24/YER173W:TSA1/YML02 regulation 51 8W:CSM3/YMR048W:TOF1/YNL273W:RAD17/YOR368W:DDC1/YPL194W of cell cycle 7127 meiosis I 0.000 BRE1/YDL074C:RAD57/YDR004W:RAD55/YDR076W:XRS2/YDR369C:RAD51/YER 8 095W:RAD24/YER173W:TOP3/YLR234W:RAD10/YML095C:MRE11/YMR224C:RA D17/YOR368W 6312 mitotic 0.001 RAD59/YDL059C:RAD57/YDR004W:RAD51/YER095W:RAD54/YGL163C:SLX4/YL recombinat 03 R135W:RAD10/YML095C:HST1/YOL068C ion 45892 negative 0.001 SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:BRE2/YLR015 regulation 04 W:CAC2/YML102W:SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/YO of L068C:HST3/YOR025W:RLF2/YPR018W:HDA3/YPR179C transcriptio n, DNA- dependent 51253 negative 0.001 SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:BRE2/YLR015 regulation 04 W:CAC2/YML102W:SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/YO of RNA L068C:HST3/YOR025W:RLF2/YPR018W:HDA3/YPR179C metabolic process 16567 protein 0.001 UBC4/YBR082C:SLX5/YDL013W:BRE1/YDL074C:UBC13/YDR092W:SLX8/YER116

111

ubiquitinati 15 C:RTF1/YGL244W:UPF3/YGR072W:RAD5/YLR032W:DIA2/YOR080W on 30491 heterodupl 0.001 RAD57/YDR004W:RAD55/YDR076W:RAD51/YER095W:RAD54/YGL163C ex 29 formation 31573 intra-S 0.001 MRC1/YCL061C:BRE1/YDL074C:RAD9/YDR217C:DDC1/YPL194W DNA 29 damage checkpoint 8156 negative 0.001 MRC1/YCL061C:SIR2/YDL042C:CSM3/YMR048W:TOF1/YNL273W regulation 29 of DNA replication 10525 regulation 0.001 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS1/Y of 29 PR164W transpositi on, RNA- mediated 10528 regulation 0.001 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS1/Y of 29 PR164W transpositi on 10564 regulation 0.001 MRC1/YCL061C:BRE1/YDL074C:RAD9/YDR217C:RAD24/YER173W:RTT101/YJL0 of cell 3 47C:TSA1/YML028W:CSM3/YMR048W:TOF1/YNL273W:RAD17/YOR368W:DDC1/ cycle YPL194W:CLB5/YPR120C process 16481 negative 0.001 SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:BRE2/YLR015 regulation 62 W:CAC2/YML102W:SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/YO of L068C:HST3/YOR025W:RLF2/YPR018W:HDA3/YPR179C transcriptio n 10629 negative 0.002 SWD3/YBR175W:MRC1/YCL061C:SIR2/YDL042C:BRE1/YDL074C:BRE2/YLR015 regulation 08 W:CAC2/YML102W:SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/YO of gene L068C:HST3/YOR025W:RLF2/YPR018W:HDA3/YPR179C expression 722 telomere 0.002 RAD59/YDL059C:RAD57/YDR004W:RAD51/YER095W:RAD54/YGL163C maintenan 95 ce via recombinat ion 51726 regulation 0.003 MRC1/YCL061C:BRE1/YDL074C:RAD9/YDR217C:RAD24/YER173W:RTT101/YJL0 of cell 09 47C:SIC1/YLR079W:TSA1/YML028W:CSM3/YMR048W:TOF1/YNL273W:RAD17/Y cycle OR368W:DDC1/YPL194W:CLB5/YPR120C 31297 replication 0.004 RTT101/YJL047C:MMS22/YLR320W:MMS1/YPR164W fork 24 processing 32297 negative 0.004 MRC1/YCL061C:CSM3/YMR048W:TOF1/YNL273W regulation 24 of DNA- dependent DNA replication initiation 76 DNA 0.004 MRC1/YCL061C:CSM3/YMR048W:TOF1/YNL273W replication 24 checkpoint 10467 gene 0.005 SWD3/YBR175W:SNF5/YBR289W:MRC1/YCL061C:RPN4/YDL020C:SIR2/YDL042 expression 52 C:BRE1/YDL074C:VPS41/YDR080W:SAC3/YDR159W:RAD9/YDR217C:THO1/YER 063W:RTR1/YER139C:CHD1/YER164W:RTF1/YGL244W:THP2/YHR167W:SKN7/Y HR206W:CTK1/YKL139W:RTT109/YLL002W:BRE2/YLR015W:YAP1/YML007W:TS A1/YML028W:MFT1/YML062C:CAC2/YML102W:SKY1/YMR216C:MRE11/YMR224C :SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR0 25W:RLF2/YPR018W:HDA3/YPR179C 16575 histone 0.006 SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR02 deacetylati 09 5W:HDA3/YPR179C on

112

18 regulation 0.006 SIR2/YDL042C:MPH1/YIR002C:TOP3/YLR234W:HST1/YOL068C:ELG1/YOR144C of DNA 63 recombinat ion 32196 transpositi 0.006 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS1/Y on 63 PR164W 32197 transpositi 0.006 RTT107/YHR154W:RTT101/YJL047C:RTT109/YLL002W:ELG1/YOR144C:MMS1/Y on, RNA- 63 PR164W mediated 6476 protein 0.007 SAP30/YMR263W:HDA1/YNL021W:SIN3/YOL004W:HST1/YOL068C:HST3/YOR02 amino acid 69 5W:HDA3/YPR179C deacetylati on 32446 protein 0.008 UBC4/YBR082C:SLX5/YDL013W:BRE1/YDL074C:UBC13/YDR092W:SLX8/YER116 modificatio 33 C:RTF1/YGL244W:UPF3/YGR072W:RAD5/YLR032W:DIA2/YOR080W n by small protein conjugatio n

113

GO term enrichment for single mutant screen of essential genes

GOID GO_term P- Gene(s) annotated to the term value 6260 DNA 4.13E RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL102W:CDC9/YDL16 replication -09 4C:CDC13/YDL220C:PSF1/YDR013W:DBF4/YDR052C:STN1/YDR082W:MCM3/YE L032W:DNA2/YHR164C:MCM10/YIL150C:PRI1/YIR008C:CDC6/YJL194W:TAH11/ YJR046W:RFC2/YJR068W:PRI2/YKL045W:ORC3/YLL004W:CDC45/YLR103C:MCM 5/YLR274W:POL1/YNL102W:POL2/YNL262W:RFC4/YOL094C 6261 DNA- 1.15E RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL102W:CDC9/YDL16 dependent -08 4C:PSF1/YDR013W:DBF4/YDR052C:MCM3/YEL032W:DNA2/YHR164C:MCM10/YI DNA L150C:PRI1/YIR008C:CDC6/YJL194W:TAH11/YJR046W:RFC2/YJR068W:PRI2/YK replication L045W:ORC3/YLL004W:CDC45/YLR103C:MCM5/YLR274W:POL1/YNL102W:POL2 /YNL262W:RFC4/YOL094C 6259 DNA 7.26E RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL102W:NSE4/YDL10 metabolic -08 5W:CDC9/YDL164C:CDC13/YDL220C:PSF1/YDR013W:DBF4/YDR052C:STN1/YD process R082W:CDC1/YDR182W:NSE3/YDR288W:MMS21/YEL019C:MCM3/YEL032W:KR E29/YER038C:DNA2/YHR164C:MCM10/YIL150C:PRI1/YIR008C:CDC6/YJL194W: TAH11/YJR046W:RFC2/YJR068W:PRI2/YKL045W:ORC3/YLL004W:NSE1/YLR007 W:CDC45/YLR103C:MCM5/YLR274W:POL1/YNL102W:POL2/YNL262W:RFC4/YOL 094C 22616 DNA 2.35E RFC5/YBR087W:MCM7/YBR202W:POL3/YDL102W:CDC9/YDL164C:MCM3/YEL03 strand -07 2W:DNA2/YHR164C:MCM10/YIL150C:PRI1/YIR008C:RFC2/YJR068W:PRI2/YKL0 elongation 45W:POL1/YNL102W:POL2/YNL262W:RFC4/YOL094C 6271 DNA 2.35E RFC5/YBR087W:MCM7/YBR202W:POL3/YDL102W:CDC9/YDL164C:MCM3/YEL03 strand -07 2W:DNA2/YHR164C:MCM10/YIL150C:PRI1/YIR008C:RFC2/YJR068W:PRI2/YKL0 elongation 45W:POL1/YNL102W:POL2/YNL262W:RFC4/YOL094C involved in DNA replication 6281 DNA repair 5.04E RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL102W:NSE4/YDL10 -07 5W:CDC9/YDL164C:PSF1/YDR013W:CDC1/YDR182W:NSE3/YDR288W:MMS21/Y EL019C:MCM3/YEL032W:KRE29/YER038C:DNA2/YHR164C:MCM10/YIL150C:TAH 11/YJR046W:RFC2/YJR068W:PRI2/YKL045W:NSE1/YLR007W:CDC45/YLR103C: MCM5/YLR274W:POL1/YNL102W:POL2/YNL262W:RFC4/YOL094C 6974 response 1.90E RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL102W:NSE4/YDL10 to DNA -06 5W:CDC9/YDL164C:PSF1/YDR013W:CDC1/YDR182W:NSE3/YDR288W:MMS21/Y damage EL019C:MCM3/YEL032W:KRE29/YER038C:DNA2/YHR164C:MCM10/YIL150C:TAH stimulus 11/YJR046W:RFC2/YJR068W:PRI2/YKL045W:NSE1/YLR007W:CDC45/YLR103C: MCM5/YLR274W:POL1/YNL102W:POL2/YNL262W:RFC4/YOL094C 33554 cellular 2.26E RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL102W:NSE4/YDL10 response -06 5W:CDC9/YDL164C:PSF1/YDR013W:SEC7/YDR170C:CDC1/YDR182W:NSE3/YD to stress R288W:MMS21/YEL019C:MCM3/YEL032W:KRE29/YER038C:YPT1/YFL038C:DNA 2/YHR164C:MCM10/YIL150C:TAH11/YJR046W:RFC2/YJR068W:PRI2/YKL045W:N SE1/YLR007W:CDC45/YLR103C:MCM5/YLR274W:POL1/YNL102W:POL2/YNL262 W:RFC4/YOL094C 6950 response 6.78E RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL102W:NSE4/YDL10 to stress -06 5W:CDC9/YDL164C:PSF1/YDR013W:SEC7/YDR170C:CDC1/YDR182W:NSE3/YD R288W:MMS21/YEL019C:MCM3/YEL032W:KRE29/YER038C:YPT1/YFL038C:DNA 2/YHR164C:MCM10/YIL150C:TAH11/YJR046W:RFC2/YJR068W:PRI2/YKL045W:N SE1/YLR007W:CDC45/YLR103C:MCM5/YLR274W:POL1/YNL102W:POL2/YNL262 W:RFC4/YOL094C 6270 DNA- 1.35E MCM7/YBR202W:CDC7/YDL017W:DBF4/YDR052C:MCM3/YEL032W:MCM10/YIL1 dependent -05 50C:PRI1/YIR008C:CDC6/YJL194W:TAH11/YJR046W:PRI2/YKL045W:ORC3/YLL0 DNA 04W:CDC45/YLR103C:MCM5/YLR274W:POL1/YNL102W replication initiation 51716 cellular 3.60E RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL102W:NSE4/YDL10 response -05 5W:CDC9/YDL164C:PSF1/YDR013W:SEC7/YDR170C:CDC1/YDR182W:NSE3/YD to stimulus R288W:MMS21/YEL019C:MCM3/YEL032W:KRE29/YER038C:YPT1/YFL038C:DNA 2/YHR164C:MCM10/YIL150C:TAH11/YJR046W:RFC2/YJR068W:PRI2/YKL045W:N SE1/YLR007W:CDC45/YLR103C:MCM5/YLR274W:POL1/YNL102W:POL2/YNL262 W:RFC4/YOL094C

114

727 double- 8.94E MCM7/YBR202W:CDC7/YDL017W:PSF1/YDR013W:MCM3/YEL032W:MCM10/YIL1 strand -05 50C:TAH11/YJR046W:CDC45/YLR103C:MCM5/YLR274W break repair via break- induced replication 50896 response 0.000 RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL102W:NSE4/YDL10 to stimulus 21 5W:CDC9/YDL164C:PSF1/YDR013W:SEC7/YDR170C:CDC1/YDR182W:NSE3/YD R288W:MMS21/YEL019C:MCM3/YEL032W:KRE29/YER038C:YPT1/YFL038C:DNA 2/YHR164C:MCM10/YIL150C:TAH11/YJR046W:RFC2/YJR068W:PRI2/YKL045W:N SE1/YLR007W:CDC45/YLR103C:MCM5/YLR274W:POL1/YNL102W:POL2/YNL262 W:RFC4/YOL094C 16050 vesicle 0.000 CDC48/YDL126C:SEC1/YDR164C:SEC5/YDR166C:SLY1/YDR189W:SEC4/YFL005 organizatio 74 W:YPT1/YFL038C:SEC6/YIL068C:EXO70/YJL085W:SEC10/YLR166C:VTI1/YMR19 n 7C:UFE1/YOR075W:SEC16/YPL085W:SEC8/YPR055W:SEC23/YPR181C 6267 pre- 0.002 MCM7/YBR202W:MCM3/YEL032W:CDC6/YJL194W:TAH11/YJR046W:ORC3/YLL00 replicative 9 4W:CDC45/YLR103C:MCM5/YLR274W complex assembly 724 double- 0.003 MCM7/YBR202W:CDC7/YDL017W:PSF1/YDR013W:MCM3/YEL032W:MCM10/YIL1 strand 62 50C:TAH11/YJR046W:CDC45/YLR103C:MCM5/YLR274W break repair via homologou s recombinat ion 725 recombinat 0.008 MCM7/YBR202W:CDC7/YDL017W:PSF1/YDR013W:MCM3/YEL032W:MCM10/YIL1 ional repair 49 50C:TAH11/YJR046W:CDC45/YLR103C:MCM5/YLR274W 6906 vesicle 0.009 CDC48/YDL126C:SEC1/YDR164C:SEC5/YDR166C:SLY1/YDR189W:SEC4/YFL005 fusion 24 W:SEC6/YIL068C:EXO70/YJL085W:SEC10/YLR166C:VTI1/YMR197C:UFE1/YOR0 75W:SEC8/YPR055W

115

GO term enrichment for single mutant screen of essential genes in the presence of phleomcyin

GOID GO_term P- Gene(s) annotated to the term value 6890 retrograde 0.000 COP1/YDL145C:SLY1/YDR189W:YPT1/YFL038C:RET2/YFR051C:USE1/YGL098W: vesicle- 16 TIP20/YGL145W:BET1/YIL004C:SEC22/YLR268W:SEC39/YLR440C:UFE1/YOR07 mediated 5W:RET3/YPL010W transport, Golgi to ER 48193 Golgi 0.000 COP1/YDL145C:SEC31/YDL195W:SEC7/YDR170C:SLY1/YDR189W:SEC26/YDR2 vesicle 99 38C:YPT1/YFL038C:RET2/YFR051C:USE1/YGL098W:TIP20/YGL145W:COG2/YGR transport 120C:YIP1/YGR172C:BET1/YIL004C:SEC22/YLR268W:SEC39/YLR440C:VTI1/YM R197C:UFE1/YOR075W:RET3/YPL010W:SEC16/YPL085W:SEC23/YPR181C 6888 ER to Golgi 0.001 COP1/YDL145C:SEC31/YDL195W:SEC7/YDR170C:SLY1/YDR189W:SEC26/YDR2 vesicle- 21 38C:YPT1/YFL038C:RET2/YFR051C:COG2/YGR120C:YIP1/YGR172C:BET1/YIL00 mediated 4C:SEC22/YLR268W:SEC16/YPL085W:SEC23/YPR181C transport

116

GO term enrichment for sgs1Δ mutant screen of essential genes

GOID GO_term P- Gene(s) annotated to the term value 6260 DNA 1.37E RFC5/YBR087W:CDC7/YDL017W:POL3/YDL102W:CDC9/YDL164C:CDC13/YDL22 replication -08 0C:PSF1/YDR013W:DBF4/YDR052C:STN1/YDR082W:MCM3/YEL032W:DNA2/YH R164C:MCM10/YIL150C:PRI1/YIR008C:DPB11/YJL090C:CDC6/YJL194W:TAH11/ YJR046W:RFC2/YJR068W:ORC3/YLL004W:CDC45/YLR103C:CLF1/YLR117C:MCM 5/YLR274W:POL1/YNL102W:POL2/YNL262W:RFC4/YOL094C 6261 DNA- 3.42E RFC5/YBR087W:CDC7/YDL017W:POL3/YDL102W:CDC9/YDL164C:PSF1/YDR013 dependent -08 W:DBF4/YDR052C:MCM3/YEL032W:DNA2/YHR164C:MCM10/YIL150C:PRI1/YIR0 DNA 08C:DPB11/YJL090C:CDC6/YJL194W:TAH11/YJR046W:RFC2/YJR068W:ORC3/YL replication L004W:CDC45/YLR103C:CLF1/YLR117C:MCM5/YLR274W:POL1/YNL102W:POL2/ YNL262W:RFC4/YOL094C 6259 DNA 4.78E RFC5/YBR087W:CDC7/YDL017W:POL3/YDL102W:NSE4/YDL105W:CDC9/YDL164 metabolic -08 C:CDC13/YDL220C:PSF1/YDR013W:DBF4/YDR052C:STN1/YDR082W:CDC1/YDR process 182W:NSE3/YDR288W:TFB1/YDR311W:MCM3/YEL032W:KRE29/YER038C:DNA2 /YHR164C:MCM10/YIL150C:PRI1/YIR008C:DPB11/YJL090C:CDC6/YJL194W:TAH 11/YJR046W:RFC2/YJR068W:ORC3/YLL004W:SSL1/YLR005W:NSE1/YLR007W:C DC45/YLR103C:CLF1/YLR117C:MCM5/YLR274W:POL1/YNL102W:POL2/YNL262W :RFC4/YOL094C 6281 DNA repair 1.57E RFC5/YBR087W:CDC7/YDL017W:POL3/YDL102W:NSE4/YDL105W:CDC9/YDL164 -06 C:PSF1/YDR013W:CDC1/YDR182W:NSE3/YDR288W:TFB1/YDR311W:MCM3/YEL 032W:KRE29/YER038C:DNA2/YHR164C:MCM10/YIL150C:DPB11/YJL090C:TAH1 1/YJR046W:RFC2/YJR068W:SSL1/YLR005W:NSE1/YLR007W:CDC45/YLR103C:M CM5/YLR274W:POL1/YNL102W:POL2/YNL262W:RFC4/YOL094C 6974 response 5.83E RFC5/YBR087W:CDC7/YDL017W:POL3/YDL102W:NSE4/YDL105W:CDC9/YDL164 to DNA -06 C:PSF1/YDR013W:CDC1/YDR182W:NSE3/YDR288W:TFB1/YDR311W:MCM3/YEL damage 032W:KRE29/YER038C:DNA2/YHR164C:MCM10/YIL150C:DPB11/YJL090C:TAH1 stimulus 1/YJR046W:RFC2/YJR068W:SSL1/YLR005W:NSE1/YLR007W:CDC45/YLR103C:M CM5/YLR274W:POL1/YNL102W:POL2/YNL262W:RFC4/YOL094C 22616 DNA 9.86E RFC5/YBR087W:POL3/YDL102W:CDC9/YDL164C:MCM3/YEL032W:DNA2/YHR16 strand -06 4C:MCM10/YIL150C:PRI1/YIR008C:DPB11/YJL090C:RFC2/YJR068W:POL1/YNL1 elongation 02W:POL2/YNL262W:RFC4/YOL094C 6271 DNA 0.000 RFC5/YBR087W:POL3/YDL102W:CDC9/YDL164C:MCM3/YEL032W:DNA2/YHR16 strand 0098 4C:MCM10/YIL150C:PRI1/YIR008C:DPB11/YJL090C:RFC2/YJR068W:POL1/YNL1 elongation 6 02W:POL2/YNL262W:RFC4/YOL094C involved in DNA replication 6270 DNA- 0.000 CDC7/YDL017W:DBF4/YDR052C:MCM3/YEL032W:MCM10/YIL150C:PRI1/YIR008 dependent 0258 C:DPB11/YJL090C:CDC6/YJL194W:TAH11/YJR046W:ORC3/YLL004W:CDC45/YLR DNA 103C:CLF1/YLR117C:MCM5/YLR274W:POL1/YNL102W replication initiation 33554 cellular 0.000 RFC5/YBR087W:CDC7/YDL017W:POL3/YDL102W:NSE4/YDL105W:CDC9/YDL164 response 0433 C:PSF1/YDR013W:CDC1/YDR182W:NSE3/YDR288W:TFB1/YDR311W:MCM3/YEL to stress 032W:KRE29/YER038C:YPT1/YFL038C:DNA2/YHR164C:MCM10/YIL150C:DPB11/ YJL090C:TAH11/YJR046W:RFC2/YJR068W:SSL1/YLR005W:NSE1/YLR007W:CDC 45/YLR103C:MCM5/YLR274W:POL1/YNL102W:POL2/YNL262W:RFC4/YOL094C 6950 response 0.000 RFC5/YBR087W:CDC7/YDL017W:POL3/YDL102W:NSE4/YDL105W:CDC9/YDL164 to stress 12 C:PSF1/YDR013W:CDC1/YDR182W:NSE3/YDR288W:TFB1/YDR311W:MCM3/YEL 032W:KRE29/YER038C:YPT1/YFL038C:DNA2/YHR164C:MCM10/YIL150C:DPB11/ YJL090C:TAH11/YJR046W:RFC2/YJR068W:SSL1/YLR005W:NSE1/YLR007W:CDC 45/YLR103C:MCM5/YLR274W:POL1/YNL102W:POL2/YNL262W:RFC4/YOL094C 727 double- 0.000 CDC7/YDL017W:PSF1/YDR013W:MCM3/YEL032W:MCM10/YIL150C:DPB11/YJL0 strand 13 90C:TAH11/YJR046W:CDC45/YLR103C:MCM5/YLR274W break repair via break- induced replication 51716 cellular 0.000 RFC5/YBR087W:CDC7/YDL017W:POL3/YDL102W:NSE4/YDL105W:CDC9/YDL164

117

response 54 C:PSF1/YDR013W:CDC1/YDR182W:NSE3/YDR288W:TFB1/YDR311W:MCM3/YEL to stimulus 032W:KRE29/YER038C:YPT1/YFL038C:DNA2/YHR164C:MCM10/YIL150C:DPB11/ YJL090C:TAH11/YJR046W:RFC2/YJR068W:SSL1/YLR005W:NSE1/YLR007W:CDC 45/YLR103C:MCM5/YLR274W:POL1/YNL102W:POL2/YNL262W:RFC4/YOL094C 16050 vesicle 0.001 CDC48/YDL126C:SEC31/YDL195W:SEC1/YDR164C:SEC5/YDR166C:SLY1/YDR18 organizatio 41 9W:SEC4/YFL005W:YPT1/YFL038C:SEC15/YGL233W:SEC6/YIL068C:SEC10/YLR n 166C:VTI1/YMR197C:UFE1/YOR075W:SEC16/YPL085W:SEC8/YPR055W 50896 response 0.002 RFC5/YBR087W:CDC7/YDL017W:POL3/YDL102W:NSE4/YDL105W:CDC9/YDL164 to stimulus 72 C:PSF1/YDR013W:CDC1/YDR182W:NSE3/YDR288W:TFB1/YDR311W:MCM3/YEL 032W:KRE29/YER038C:YPT1/YFL038C:DNA2/YHR164C:MCM10/YIL150C:DPB11/ YJL090C:TAH11/YJR046W:RFC2/YJR068W:SSL1/YLR005W:NSE1/YLR007W:CDC 45/YLR103C:MCM5/YLR274W:POL1/YNL102W:POL2/YNL262W:RFC4/YOL094C 724 double- 0.005 CDC7/YDL017W:PSF1/YDR013W:MCM3/YEL032W:MCM10/YIL150C:DPB11/YJL0 strand 34 90C:TAH11/YJR046W:CDC45/YLR103C:MCM5/YLR274W break repair via homologou s recombinat ion 48193 Golgi 0.006 SEC31/YDL195W:SEC5/YDR166C:SLY1/YDR189W:SEC26/YDR238C:SEC4/YFL00 vesicle 33 5W:YPT1/YFL038C:TIP20/YGL145W:SEC15/YGL233W:COG2/YGR120C:BET1/YIL transport 004C:SEC6/YIL068C:SEC10/YLR166C:SEC39/YLR440C:VTI1/YMR197C:UFE1/YO R075W:SEC16/YPL085W:SEC8/YPR055W

118

GO term enrichment for yku80Δ mutant screen of essential genes

GOID GO_term P- Gene(s) annotated to the term value 6260 DNA 6.30E POL12/YBL035C:RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL10 replication -11 2W:CDC9/YDL164C:CDC13/YDL220C:DBF4/YDR052C:STN1/YDR082W:MCM3/YE L032W:MCM10/YIL150C:PRI1/YIR008C:DPB11/YJL090C:CDC6/YJL194W:POL31/ YJR006W:TAH11/YJR046W:RFC2/YJR068W:PRI2/YKL045W:ORC3/YLL004W:CDC 45/YLR103C:MCM5/YLR274W:POL1/YNL102W:RFC4/YOL094C 6261 DNA- 2.67E POL12/YBL035C:RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL10 dependent -10 2W:CDC9/YDL164C:DBF4/YDR052C:MCM3/YEL032W:MCM10/YIL150C:PRI1/YIR DNA 008C:DPB11/YJL090C:CDC6/YJL194W:POL31/YJR006W:TAH11/YJR046W:RFC2/ replication YJR068W:PRI2/YKL045W:ORC3/YLL004W:CDC45/YLR103C:MCM5/YLR274W:PO L1/YNL102W:RFC4/YOL094C 22616 DNA 6.17E POL12/YBL035C:RFC5/YBR087W:MCM7/YBR202W:POL3/YDL102W:CDC9/YDL16 strand -10 4C:MCM3/YEL032W:MCM10/YIL150C:PRI1/YIR008C:DPB11/YJL090C:POL31/YJR elongation 006W:RFC2/YJR068W:PRI2/YKL045W:POL1/YNL102W:RFC4/YOL094C 6271 DNA 6.17E POL12/YBL035C:RFC5/YBR087W:MCM7/YBR202W:POL3/YDL102W:CDC9/YDL16 strand -10 4C:MCM3/YEL032W:MCM10/YIL150C:PRI1/YIR008C:DPB11/YJL090C:POL31/YJR elongation 006W:RFC2/YJR068W:PRI2/YKL045W:POL1/YNL102W:RFC4/YOL094C involved in DNA replication 6270 DNA- 3.15E POL12/YBL035C:MCM7/YBR202W:CDC7/YDL017W:DBF4/YDR052C:MCM3/YEL03 dependent -09 2W:MCM10/YIL150C:PRI1/YIR008C:DPB11/YJL090C:CDC6/YJL194W:TAH11/YJR DNA 046W:PRI2/YKL045W:ORC3/YLL004W:CDC45/YLR103C:MCM5/YLR274W:POL1/ replication YNL102W initiation 6259 DNA 2.19E POL12/YBL035C:RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL10 metabolic -07 2W:NSE4/YDL105W:CDC9/YDL164C:CDC13/YDL220C:DBF4/YDR052C:STN1/YD process R082W:MMS21/YEL019C:MCM3/YEL032W:KRE29/YER038C:MCM10/YIL150C:PRI 1/YIR008C:DPB11/YJL090C:CDC6/YJL194W:POL31/YJR006W:TAH11/YJR046W: RFC2/YJR068W:PRI2/YKL045W:ORC3/YLL004W:CDC45/YLR103C:MCM5/YLR274 W:POL1/YNL102W:RFC4/YOL094C 727 double- 2.25E MCM7/YBR202W:CDC7/YDL017W:MCM3/YEL032W:MCM10/YIL150C:DPB11/YJL0 strand -05 90C:TAH11/YJR046W:CDC45/YLR103C:MCM5/YLR274W break repair via break- induced replication 6281 DNA repair 4.42E RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL102W:NSE4/YDL10 -05 5W:CDC9/YDL164C:MMS21/YEL019C:MCM3/YEL032W:KRE29/YER038C:MCM10/ YIL150C:DPB11/YJL090C:POL31/YJR006W:TAH11/YJR046W:RFC2/YJR068W:PRI 2/YKL045W:CDC45/YLR103C:MCM5/YLR274W:POL1/YNL102W:RFC4/YOL094C 6974 response 0.000 RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL102W:NSE4/YDL10 to DNA 12 5W:CDC9/YDL164C:MMS21/YEL019C:MCM3/YEL032W:KRE29/YER038C:MCM10/ damage YIL150C:DPB11/YJL090C:POL31/YJR006W:TAH11/YJR046W:RFC2/YJR068W:PRI stimulus 2/YKL045W:CDC45/YLR103C:MCM5/YLR274W:POL1/YNL102W:RFC4/YOL094C 6273 lagging 0.000 POL12/YBL035C:POL3/YDL102W:CDC9/YDL164C:PRI1/YIR008C:DPB11/YJL090C strand 35 :POL31/YJR006W:PRI2/YKL045W:POL1/YNL102W elongation 33554 cellular 0.000 SEC18/YBR080C:RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL10 response 44 2W:NSE4/YDL105W:CDC9/YDL164C:MMS21/YEL019C:MCM3/YEL032W:KRE29/Y to stress ER038C:MCM10/YIL150C:DPB11/YJL090C:POL31/YJR006W:TAH11/YJR046W:RF C2/YJR068W:PRI2/YKL045W:CDC45/YLR103C:MCM5/YLR274W:POL1/YNL102W: RFC4/YOL094C 6267 pre- 0.000 MCM7/YBR202W:MCM3/YEL032W:CDC6/YJL194W:TAH11/YJR046W:ORC3/YLL00 replicative 89 4W:CDC45/YLR103C:MCM5/YLR274W complex assembly 724 double- 0.000 MCM7/YBR202W:CDC7/YDL017W:MCM3/YEL032W:MCM10/YIL150C:DPB11/YJL0 strand 96 90C:TAH11/YJR046W:CDC45/YLR103C:MCM5/YLR274W

119

break repair via homologou s recombinat ion 6950 response 0.000 SEC18/YBR080C:RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL10 to stress 98 2W:NSE4/YDL105W:CDC9/YDL164C:MMS21/YEL019C:MCM3/YEL032W:KRE29/Y ER038C:MCM10/YIL150C:DPB11/YJL090C:POL31/YJR006W:TAH11/YJR046W:RF C2/YJR068W:PRI2/YKL045W:CDC45/YLR103C:MCM5/YLR274W:POL1/YNL102W: RFC4/YOL094C 725 recombinat 0.002 MCM7/YBR202W:CDC7/YDL017W:MCM3/YEL032W:MCM10/YIL150C:DPB11/YJL0 ional repair 29 90C:TAH11/YJR046W:CDC45/YLR103C:MCM5/YLR274W 51716 cellular 0.003 SEC18/YBR080C:RFC5/YBR087W:MCM7/YBR202W:CDC7/YDL017W:POL3/YDL10 response 34 2W:NSE4/YDL105W:CDC9/YDL164C:MMS21/YEL019C:MCM3/YEL032W:KRE29/Y to stimulus ER038C:MCM10/YIL150C:DPB11/YJL090C:POL31/YJR006W:TAH11/YJR046W:RF C2/YJR068W:PRI2/YKL045W:CDC45/YLR103C:MCM5/YLR274W:POL1/YNL102W: RFC4/YOL094C 48519 negative 0.003 MCM7/YBR202W:CDC7/YDL017W:DBF4/YDR052C:STN1/YDR082W:MCM3/YEL03 regulation 52 2W:MCM10/YIL150C:DPB11/YJL090C:CDC6/YJL194W:RFC2/YJR068W:ORC3/YLL of 004W:CDC45/YLR103C:MCM5/YLR274W:GSP1/YLR293C biological process 48523 negative 0.003 MCM7/YBR202W:CDC7/YDL017W:DBF4/YDR052C:STN1/YDR082W:MCM3/YEL03 regulation 52 2W:MCM10/YIL150C:DPB11/YJL090C:CDC6/YJL194W:RFC2/YJR068W:ORC3/YLL of cellular 004W:CDC45/YLR103C:MCM5/YLR274W:GSP1/YLR293C process 6348 chromatin 0.004 MCM7/YBR202W:CDC7/YDL017W:MCM3/YEL032W:MCM10/YIL150C:CDC6/YJL1 silencing at 92 94W:CDC45/YLR103C:MCM5/YLR274W:GSP1/YLR293C telomere 16458 gene 0.005 MCM7/YBR202W:CDC7/YDL017W:MCM3/YEL032W:MCM10/YIL150C:CDC6/YJL1 silencing 66 94W:ORC3/YLL004W:CDC45/YLR103C:MCM5/YLR274W:GSP1/YLR293C 40029 regulation 0.005 MCM7/YBR202W:CDC7/YDL017W:MCM3/YEL032W:MCM10/YIL150C:CDC6/YJL1 of gene 66 94W:ORC3/YLL004W:CDC45/YLR103C:MCM5/YLR274W:GSP1/YLR293C expression , epigenetic 45814 negative 0.005 MCM7/YBR202W:CDC7/YDL017W:MCM3/YEL032W:MCM10/YIL150C:CDC6/YJL1 regulation 66 94W:ORC3/YLL004W:CDC45/YLR103C:MCM5/YLR274W:GSP1/YLR293C of gene expression , epigenetic 6310 DNA 0.005 MCM7/YBR202W:CDC7/YDL017W:CDC9/YDL164C:MCM3/YEL032W:MCM10/YIL1 recombinat 66 50C:DPB11/YJL090C:TAH11/YJR046W:CDC45/YLR103C:MCM5/YLR274W ion 6342 chromatin 0.005 MCM7/YBR202W:CDC7/YDL017W:MCM3/YEL032W:MCM10/YIL150C:CDC6/YJL1 silencing 66 94W:ORC3/YLL004W:CDC45/YLR103C:MCM5/YLR274W:GSP1/YLR293C 10558 negative 0.006 MCM7/YBR202W:CDC7/YDL017W:STN1/YDR082W:MCM3/YEL032W:MCM10/YIL regulation 77 150C:DPB11/YJL090C:CDC6/YJL194W:ORC3/YLL004W:CDC45/YLR103C:MCM5/ of YLR274W:GSP1/YLR293C macromole cule biosyntheti c process 10605 negative 0.006 MCM7/YBR202W:CDC7/YDL017W:STN1/YDR082W:MCM3/YEL032W:MCM10/YIL regulation 77 150C:DPB11/YJL090C:CDC6/YJL194W:ORC3/YLL004W:CDC45/YLR103C:MCM5/ of YLR274W:GSP1/YLR293C macromole cule metabolic process 20001 negative 0.006 MCM7/YBR202W:CDC7/YDL017W:STN1/YDR082W:MCM3/YEL032W:MCM10/YIL 13 regulation 77 150C:DPB11/YJL090C:CDC6/YJL194W:ORC3/YLL004W:CDC45/YLR103C:MCM5/ of cellular YLR274W:GSP1/YLR293C macromole

120

cule biosyntheti c process 31324 negative 0.006 MCM7/YBR202W:CDC7/YDL017W:STN1/YDR082W:MCM3/YEL032W:MCM10/YIL regulation 77 150C:DPB11/YJL090C:CDC6/YJL194W:ORC3/YLL004W:CDC45/YLR103C:MCM5/ of cellular YLR274W:GSP1/YLR293C metabolic process 31327 negative 0.006 MCM7/YBR202W:CDC7/YDL017W:STN1/YDR082W:MCM3/YEL032W:MCM10/YIL regulation 77 150C:DPB11/YJL090C:CDC6/YJL194W:ORC3/YLL004W:CDC45/YLR103C:MCM5/ of cellular YLR274W:GSP1/YLR293C biosyntheti c process 45934 negative 0.006 MCM7/YBR202W:CDC7/YDL017W:STN1/YDR082W:MCM3/YEL032W:MCM10/YIL regulation 77 150C:DPB11/YJL090C:CDC6/YJL194W:ORC3/YLL004W:CDC45/YLR103C:MCM5/ of YLR274W:GSP1/YLR293C nucleobase , nucleoside, nucleotide and nucleic acid metabolic process 51172 negative 0.006 MCM7/YBR202W:CDC7/YDL017W:STN1/YDR082W:MCM3/YEL032W:MCM10/YIL regulation 77 150C:DPB11/YJL090C:CDC6/YJL194W:ORC3/YLL004W:CDC45/YLR103C:MCM5/ of nitrogen YLR274W:GSP1/YLR293C compound metabolic process 9890 negative 0.006 MCM7/YBR202W:CDC7/YDL017W:STN1/YDR082W:MCM3/YEL032W:MCM10/YIL regulation 77 150C:DPB11/YJL090C:CDC6/YJL194W:ORC3/YLL004W:CDC45/YLR103C:MCM5/ of YLR274W:GSP1/YLR293C biosyntheti c process 9892 negative 0.006 MCM7/YBR202W:CDC7/YDL017W:STN1/YDR082W:MCM3/YEL032W:MCM10/YIL regulation 77 150C:DPB11/YJL090C:CDC6/YJL194W:ORC3/YLL004W:CDC45/YLR103C:MCM5/ of YLR274W:GSP1/YLR293C metabolic process 6272 leading 0.007 RFC5/YBR087W:POL3/YDL102W:DPB11/YJL090C:POL31/YJR006W:RFC2/YJR068 strand 28 W:RFC4/YOL094C elongation 6298 mismatch 0.007 RFC5/YBR087W:POL3/YDL102W:DPB11/YJL090C:POL31/YJR006W:RFC2/YJR068 repair 28 W:RFC4/YOL094C