Complex and Dynamic Chromosomal Rearrangements in a Family with Seemingly Non-Mendelian Inheritance of Dopa-Responsive Dystonia

Supplementary Online Content

Lohmann K, Redin C, Tönnies H, et al. Complex and dynamic chromosomal rearrangements in a family with seemingly non-mendelian inheritance of dopa-responsive dystonia. JAMA Neurol. Published online May 30, 2017. doi:10.1001/jamaneurol.2017.0666

eTable 1. Microsatellite markers and amplicons investigated to elucidate the size and location of the deletions on chromosome 14q eTable 2. Whole-genome sequencing metrics of patient II:3 eTable 3. Copy number variations and overlapping protein coding genes in unaffected and affected members of the family eTable 4. Genes disrupted by the breakpoints on chromosome 14q eFigure 1. Genotyping results in the family in the chromosome 14q22 region eFigure 2. Identified breakpoints in the chromosome 14 region

This supplementary material has been provided by the authors to give readers additional information about their work.

Downloaded From: https://jamanetwork.com/ on 09/29/2021 eTable 1. Microsatellite markers and amplicons investigated to elucidate the size and location of the deletions on chromosome 14q

Number of deletion Number of Position Marshfield Start pos. Marker carriers by micro- deletion carriers by Primer F Primer R Size in bp (cM) (hg19) satellite analysis quantitative PCR D14S306 44.06cM 38328250 none none AAAGCTACATCCAAATTAGGTAG TGACAAAGAAACTAAAATGTCCC 204 D14S541 51.09cM 47626715 none none GGATGA GATTTGGGTGGG TTACCTCTTCCTCACTCATTTTC 168 D14S978 53.19cM 51913120 none none AATACATTGGCCCCAGAG GGCTACATGATGGACATTCAC 230 D14S589 54.24cM 53380346 none none ATATGACATTTTCAAACACAGAG CACTGCTCCACCTTCCTAAA 137 D14Skh10 n.a. 53393085 none n.a. CAGAAT GGCAGGCTTGGTAT CTGTACCTGGAGGATAACTGAAA 244 D14Skh11 n.a. 53474562 none n.a. AAGAAGGAAAAGGATGATACTG G AAGAAAATGGGAGGTACACAG 223 D14Skh12 n.a. 53510014 none n.a. CT TCAAAAGATAACAGATGCCGT TGGGTGACAGAGCTGGACA 175 D14Skh25 n.a. 53649630 3x del n.a. ATCCTTTAACAGAACCTTGGTAG CTTCCCACTTTCCTTTTATGA 196 D14Skh13 n.a. 53657770 3x del n.a. GCTGACTAATGTGTTTTTGTGC GGAACCTGGAAGTCATAGTAGC 232 D14S989 55.29cM 53705044 3x del n.a. TGGCTATAACTATGTGAGGCATT TCATTCCGGATCCAGG 179 D14S562 55.29cM 53950460 3x del n.a. AGTCCAGCA TGGATGACAGA TAAAACGCAGCTGATGGTGC 193 D14S139 55.82cM 53969464 3x del n.a. ATGGGAACTGTTCAAGTCTC GGTCTTCGTTCCAATAACCC 246 D14S1401 55.29cM 53971291 3x del n.a. GCTTGATTTTATTCTATTTCTGTCC TATTTGTTTACGCCCGCTAG 176 D14S587 55.82cM 54366827 3x del n.a. AAGAAGTTTATTTTTAAAAGCAA CGGTAACAAGTGCAGATTCC 270 D14S747 55.82cM 54567646 3x del n.a. ACAGACATA TCAGAGTCTCTGTG CATATTGTGGGACTTCTCCG 201 D14S281 55.82cM 55106450 3x del n.a. GAT GCTAGGGATGCCTGCTACT TGGCAGAATGTTAGACTGCTTCTT 173 D14S991 55.82cM 55224025 3x del n.a. CTATTGGAGGCAACCACAC ATTCTACATGATTCCTGGGAAG 159 GCH1-Gen n.a. 55308724 3x del n.a. n.a. n.a. n.a. D14S1190 n.a. 55309613 3x del n.a. CCTGAACGAGCACAGAATGA TAGACCACAAAGGAAACCGG 134 D14S1057 55.82cM 55367474 3x del 3x del CGATGCTGTGAAGTAAACCA CTTTGGAGGTCTAGGGCTTT 159 D14S276 56.36cM 55683016 3x del 3x del ACTGTTGCTAGATAATGCTTTACC AGCTCAGAATCTAGGCCCTA 105 D14S52 57.43 56225338 3x del 3x del TTACTCCCTGCAAAACAAAC GATGAATTTCAGAAATGGAG 84 D14Skh3 n.a. 56257316 3x del n.a. GAAGAGGAGGGGTGACAAAG TCCCCTGAGTCTGTCCTTATTC 233 D14Skh2 n.a. 56301849 3x del n.a. TAATGATAGGGAAAGGTGTGCC GCCAGGTGCCAGTCATCTC 265 D14Skh1 n.a. 56317838 not polymorph 3x del GAGAGCTGGGTGGATTTTTTTAC CTTGATGGGGTTTGTGGGTC 210 D14Skh16 n.a. 56320915 not polymorph 5x del CTCATTCACTGCTTCCTAACC AGAAGGAATGGTCAGAAGAGG 186 D14Skh22 n.a. 56333960 not polymorph 5x del TGGTTACCTATTTCATCTGGG AGAAGGAAATAAACAGCAGTAAT 321 D14Skh18 n.a. 56338007 not polymorph 5x del TTTTGTCTAACCCCTTCTTTG AACATGTTGAT TATTTGGCAC 150 D14S1150 n.a. 56344380 not polymorph 5x del GGATGGTTGGCTGTAGGAAGT TACTCTTCAGAGATGCATTGCC 99 D14S1064 57.43cM 56503572 5x del 5x del AGCTGGCTAGGAAATGC GGTAATAAGAGCCCCAGTG 130

Downloaded From: https://jamanetwork.com/ on 09/29/2021 D14S745 n.a. 56551682 5x del n.a. CCTGTAGGCAAATACTGTTGG AAGACCCTGGTGTCTCTTCC 116 D14S1056 57.98cM 56648462 5x del 5x del TGCTAAAAGCCCTATGCCTATG GCGTGCTACTGTTGTGTAATCTCT 194 D14S285 59.43cM 56974469 5x del n.a. GTGGGCAGAATTCTAACATG TGTC TGATAGAATACCTGAGAGA 114 D14Skh6 n.a. 56987709 5x del n.a. TCAAGGCTCTAAGTGGCTACC TG GTTTTCCATTCCTGAGTTAC 188 D14Skh26 n.a. 56988712 not polymorph none GCCATTTGTTATCTTCTTTTGAG GGTGGTGTGTGCCTGTAATC 203 D14Skh19 n.a. 56991920 not polymorph none ATTCCCTCCCACTGTTTGTAG AATGGACACTTTCTTTGAGCC 202 D14Skh4 n.a. 57002031 none n.a. TTCCTTACTCTCTTATTTCCCC TCTCAAACACCTGGACTCAAG 281 D14S66 59.43cM 57050681 none none CTTATAATCAACACCTGCCTTC TTTAGACTAGGGATGCAATCC 107 D14S980 60.43cM 57152567 none none CTGGGCAACAAGAGTGG GAAGCGGGACAATTCTCTAAG 160 D14S274 63.25cM 57659544 none none TGAACTTTGGGCACCCT TCTGACAAACCAGCAAATGA 124 D14S592 66.81cM 61396856 none none TTCCAGAGTATTTGCTTAAGAGG GCATTGTGGGATGAGGTATG 227 D14S1046 69.82cM 65183113 none none CATTTGGAGTTGAGTGGTTAGA CCTCTGTGGATTCTGGGA 215 D14S588 75.61cM 70220286 none none GCCGAAAGAAAGAAAAAAGG CGAATGCATACTTGCTGTTG 120 n.a.: not available; 3x del corresponds to Del1: deleted in II:2, III:4, III:5, i.e. part of the 3,355kb-deletion; 5x del corresponds to Del2: deleted in I:2, II:2, II:3, III:4, III:5, i.e. part of the 669kb-deletion

Downloaded From: https://jamanetwork.com/ on 09/29/2021 eTable 2. Whole-genome sequencing metrics of patient II:3

Library Read Length (bp) 25 Total Read-Pairs 153,933,421 Percent Proper Pairs (%) 85.8 Pairwise Alignment Rate (%) 96.2 Chimera Rate (%) 10.5 Pairwise Duplication Rate (%) 2.9 Median Insert Size (bp) 1,880 Median Insert Size - 342 median absolute deviation (bp) Physical Coverage 80.1

Downloaded From: https://jamanetwork.com/ on 09/29/2021 eTable 3. Copy number variations and overlapping protein coding genes in unaffected and affected members of the family (according to Ensembl at http://www.ensembl.org) A) Protein coding genes within the 3,355-kb deletion region (Del1; chr14: 53632861-56987977). This deletion is present in affected individuals II:2, III:4, III:5.

Position on chromosome Symbol Gene name OMIM gene OMIM disease 14 (hg19) 54416455- BMP4 bone morphogenetic protein 4 112262, functions throughout development in mesoderm 607932: microphthalmia with brain 54423554 induction, tooth development, limb formation, bone and digital anomalies (AD), induction, and fracture repair 600625: nonsyndromic cleft lip with or without cleft palate 54866612- CDKN3 Cyclin-dependent kinase inhibitor 3 123832, protein phosphatase; inhibits cell cycle progression n.a. 54886934 54893647- CNIH cornichon homolog (Drosophila) 611287, Upregulated during T-cell activation n.a. 54908148 54941209- GMFP Glia maturation factor, beta 601713, growth and differentiation factor in brain, n.a. 54955744 intracellular regulator of signal transduction pathways 54976587- CGRRF1 cell growth regulator with ring finger 606138, no specific functional information available n.a. 55005334 domain 1 55034330- SAMD4A sterile alpha motif domain containing 610747, Posttranscriptional regulator that binds to RNA n.a. 55260033 4A 55308724- GCH1 GTP cyclohydrolase 1 600225, catalyzes GTP, the first and rate-limiting step in 128230: dopa-responsive dystonia 55369542 tetrahydrobiopterin (BH4) biosynthesis (AD, AR) 233910: tetrahydrobiopterin (BH4)-deficient hyperphenylalaninemia (AR) 55405656- WDHD1 WD repeat and HMG-box DNA 608126, Described as DNA-binding protein involved in na. 55493819 binding protein 1 chromatin assembly, transcription, and replication 55493844- SOCS4 suppressor of cytokine signaling 4 605118, regulate cytokine and other signaling pathways n.a. 55516206 55518362- MAPK1IP1L mitogen-activated protein kinase 1 n.a. n.a. 55536912 interacting protein 1-like 55595935- LGALS3 lectin, galactoside-binding, soluble, 3 153619, galactose- and IgE-binding lectin secreted by n.a. 55612148 inflammatory macrophages 55614834- DLGAP5 discs, large (Drosophila) homolog- n.a. n.a. 55658396 associated protein 5 55738872- FBXO34 F-box protein 34 609104, protein-ubiquitin ligase n.a. 55820329 55833109- ATG14 Autophagy related 14 613515, essential autophagy-specific regulator of the class III n.a. 55878576 phosphatidylinositol 3-kinase (PI3K) complex, promotes © 2017 American Medical Association. All rights reserved.

Downloaded From: https://jamanetwork.com/ on 09/29/2021 membrane

tethering of protein-free liposomes 55880930- TBPL2 TATA box binding protein like 2 608964, no specific functional information available n.a. 55907263 56046925- KTN1 kinectin 1 (kinesin receptor) 600381, microtubule-associated protein, large integral ER n.a. 56151302 membrane protein 56585093- PELI2 pellino E3 ubiquitin protein ligase 614798, intermediate component in the innate immune n.a. 56768031 family member 2 response signaling cascade AD: autosomal dominant, AR: autosomal recessive, n.a.: not available, ER: endoplasmatic reticulum

B) Protein coding genes within the 669-kb deletion region (Del2; chr14: 56319271-56987977). This deletion is present in the unaffected individuals I:2, II:3.

Position on

chromosome 14 Symbol Gene name OMIM gene OMIM disease (hg19)

56585093- PELI2 pellino E3 ubiquitin protein ligase 614798, intermediate component in the innate immune n.a. 56768031 family member 2 response signaling cascade

C) Protein coding genes within the 29-kb deletion region (Del3; chr14: 40377931-40407405). This deletion is present in all five investigated individuals. No gene in this region.

D) Protein coding genes within the 13-kb duplication region (Dupl2; chr14: 53619511-53,632,860). This duplication is present in unaffected individuals I:2, II:3.

Position on

chromosome 14 Symbol Gene name OMIM gene OMIM disease (hg19)

53503458- DDHD1 DDHD domain-containing protein 1 614603: lipase, catalyzes degradation of 609340: Spastic paraplegia 53620046 (partly) phosphatidic acid and attenuates cell (SPG28, AR) activation

E) Protein coding genes within the 328-kb deletion region (Dupl1; chr14: 53819947-54147632). This duplication is present in unaffected individuals I:2, II:3. No gene in this region.

Downloaded From: https://jamanetwork.com/ on 09/29/2021 eTable 4. Genes disrupted by the breakpoints on chromosome 14q

Repetitive Coordinate of sequence at Gene Symbol Gene name OMIM gene OMIM disease Present in breakpoint (hg19) breakpoint

40377930 MER5B (hAT- None n.a. n.a. n.a. Affected and unaffected Charlie carriers (I:2, II:3, II:2, III:4, III:5) family) 40407406 SINE (AluSq4) None n.a. n.a. n.a. Affected and unaffected carriers (I:2, II:3, II:2, III:4, III:5) 53619511 none DDHD1 DDHD domain- 614603: lipase, catalyzes 609340: Spastic paraplegia 28 Unaffected carriers (I:2, II:3) containing protein 1 degradation of phosphatidic (SPG28, AR) acid and attenuates cell activation 53632860 none None n.a. n.a. n.a. Affected and unaffected carriers (I:2, II:3, II:2, III:4, III:5) 53819947 none None n.a. n.a. n.a. Unaffected carriers (I:2, II:3) 54147632 LINE (L1PA5) None n.a. n.a. n.a. Unaffected carriers (I:2, II:3) 56319270 LINE (L2a) None n.a. n.a. n.a. Unaffected carriers (I:2, II:3) 56987978 LINE (L1PB3) BC037850 (uncharacterized gene, n.a. n.a. Affected and unaffected LOC101927690) carriers (I:2, II:3, II:2, III:4, III:5)

Downloaded From: https://jamanetwork.com/ on 09/29/2021

eFigure 1. Genotyping results in the family in the chromosome 14q22 region

The three-generation family is shown. Disease status is indicated by the filled quadrants according to the legend (black – definitely affected, gray – possibly affected, white – not reported). The presence of a deletion on chromosome 14q22 is indicated by Del1 (3,355del, including GCH1 and BMP4) or Del2 (669kb, downstream of GCH1/BMP4). To illustrate the two different deletions (del) on the allele with the chromosomal rearrangements (highlighted in red) by microsatellite markers, nine informative of a total of 42 genotyped markers have been selected. Individuals in the younger generations are shown as sex-unspecific diamonds to protect confidentiality of the family.

Downloaded From: https://jamanetwork.com/ on 09/29/2021

eFigure 2. Identified breakpoints in the chromosome 14 region

(A) Schematic representation of the complex chromosomal rearrangements on chromosome 14q in I:2 and II:3 as revealed by WGS analyses of large-insert libraries. There are four breakpoints (Bp1-Bp4) in the chromosome 14q21.1-22.3 region and two large deletions (29kb [highlighted in red], 669kb [highlighted in orange]) as well as two large duplications (13kb [highlighted in green], 328kb [highlighted in blue]). Orientation of the respective regions is shown by the arrow head. In addition, an inverted segment of 2.7Mb (including Dupl1 as well as the disease-linked genes GCH1 and BMP4; chr14:53619511-56319270) is also present and pointed out by the inverse orientation. Electropherograms of the sequences at the breakpoints are given and chromosomal positions (according to hg19) are provided.

(B) Schematic representation of the two deletions on chromosome 14q in II:2, III:4, and III:5. The inverted sequence including the disease-linked genes GCH1 and BMP4 as well as the duplicated sequences got deleted resulting in a fused breakpoint (Bp1/3) and an expansion of Del2 (669kb) to Del1 (3,355kb, highlighted in brown).

Downloaded From: https://jamanetwork.com/ on 09/29/2021