DOCSLIB.ORG

Complex and Dynamic Chromosomal Rearrangements in a Family with Seemingly Non-Mendelian Inheritance of Dopa-Responsive Dystonia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Complex and Dynamic Chromosomal Rearrangements in a Family with Seemingly Non-Mendelian Inheritance of Dopa-Responsive Dystonia Supplementary Online Content Lohmann K, Redin C, Tönnies H, et al. Complex and dynamic chromosomal rearrangements in a family with seemingly non-mendelian inheritance of dopa-responsive dystonia. JAMA Neurol. Published online May 30, 2017. doi:10.1001/jamaneurol.2017.0666 eTable 1. Microsatellite markers and amplicons investigated to elucidate the size and location of the deletions on chromosome 14q eTable 2. Whole-genome sequencing metrics of patient II:3 eTable 3. Copy number variations and overlapping protein coding genes in unaffected and affected members of the family eTable 4. Genes disrupted by the breakpoints on chromosome 14q eFigure 1. Genotyping results in the family in the chromosome 14q22 region eFigure 2. Identified breakpoints in the chromosome 14 region This supplementary material has been provided by the authors to give readers additional information about their work. © 2017 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/29/2021 eTable 1. Microsatellite markers and amplicons investigated to elucidate the size and location of the deletions on chromosome 14q Number of deletion Number of Position Marshfield Start pos. Marker carriers by micro- deletion carriers by Primer F Primer R Size in bp (cM) (hg19) satellite analysis quantitative PCR D14S306 44.06cM 38328250 none none AAAGCTACATCCAAATTAGGTAG TGACAAAGAAACTAAAATGTCCC 204 D14S541 51.09cM 47626715 none none GGATGA GATTTGGGTGGG TTACCTCTTCCTCACTCATTTTC 168 D14S978 53.19cM 51913120 none none AATACATTGGCCCCAGAG GGCTACATGATGGACATTCAC 230 D14S589 54.24cM 53380346 none none ATATGACATTTTCAAACACAGAG CACTGCTCCACCTTCCTAAA 137 D14Skh10 n.a. 53393085 none n.a. CAGAAT GGCAGGCTTGGTAT CTGTACCTGGAGGATAACTGAAA 244 D14Skh11 n.a. 53474562 none n.a. AAGAAGGAAAAGGATGATACTG G AAGAAAATGGGAGGTACACAG 223 D14Skh12 n.a. 53510014 none n.a. CT TCAAAAGATAACAGATGCCGT TGGGTGACAGAGCTGGACA 175 D14Skh25 n.a. 53649630 3x del n.a. ATCCTTTAACAGAACCTTGGTAG CTTCCCACTTTCCTTTTATGA 196 D14Skh13 n.a. 53657770 3x del n.a. GCTGACTAATGTGTTTTTGTGC GGAACCTGGAAGTCATAGTAGC 232 D14S989 55.29cM 53705044 3x del n.a. TGGCTATAACTATGTGAGGCATT TCATTCCGGATCCAGG 179 D14S562 55.29cM 53950460 3x del n.a. AGTCCAGCA TGGATGACAGA TAAAACGCAGCTGATGGTGC 193 D14S139 55.82cM 53969464 3x del n.a. ATGGGAACTGTTCAAGTCTC GGTCTTCGTTCCAATAACCC 246 D14S1401 55.29cM 53971291 3x del n.a. GCTTGATTTTATTCTATTTCTGTCC TATTTGTTTACGCCCGCTAG 176 D14S587 55.82cM 54366827 3x del n.a. AAGAAGTTTATTTTTAAAAGCAA CGGTAACAAGTGCAGATTCC 270 D14S747 55.82cM 54567646 3x del n.a. ACAGACATA TCAGAGTCTCTGTG CATATTGTGGGACTTCTCCG 201 D14S281 55.82cM 55106450 3x del n.a. GAT GCTAGGGATGCCTGCTACT TGGCAGAATGTTAGACTGCTTCTT 173 D14S991 55.82cM 55224025 3x del n.a. CTATTGGAGGCAACCACAC ATTCTACATGATTCCTGGGAAG 159 GCH1-Gen n.a. 55308724 3x del n.a. n.a. n.a. n.a. D14S1190 n.a. 55309613 3x del n.a. CCTGAACGAGCACAGAATGA TAGACCACAAAGGAAACCGG 134 D14S1057 55.82cM 55367474 3x del 3x del CGATGCTGTGAAGTAAACCA CTTTGGAGGTCTAGGGCTTT 159 D14S276 56.36cM 55683016 3x del 3x del ACTGTTGCTAGATAATGCTTTACC AGCTCAGAATCTAGGCCCTA 105 D14S52 57.43 56225338 3x del 3x del TTACTCCCTGCAAAACAAAC GATGAATTTCAGAAATGGAG 84 D14Skh3 n.a. 56257316 3x del n.a. GAAGAGGAGGGGTGACAAAG TCCCCTGAGTCTGTCCTTATTC 233 D14Skh2 n.a. 56301849 3x del n.a. TAATGATAGGGAAAGGTGTGCC GCCAGGTGCCAGTCATCTC 265 D14Skh1 n.a. 56317838 not polymorph 3x del GAGAGCTGGGTGGATTTTTTTAC CTTGATGGGGTTTGTGGGTC 210 D14Skh16 n.a. 56320915 not polymorph 5x del CTCATTCACTGCTTCCTAACC AGAAGGAATGGTCAGAAGAGG 186 D14Skh22 n.a. 56333960 not polymorph 5x del TGGTTACCTATTTCATCTGGG AGAAGGAAATAAACAGCAGTAAT 321 D14Skh18 n.a. 56338007 not polymorph 5x del TTTTGTCTAACCCCTTCTTTG AACATGTTGAT TATTTGGCAC 150 D14S1150 n.a. 56344380 not polymorph 5x del GGATGGTTGGCTGTAGGAAGT TACTCTTCAGAGATGCATTGCC 99 D14S1064 57.43cM 56503572 5x del 5x del AGCTGGCTAGGAAATGC GGTAATAAGAGCCCCAGTG 130 © 2017 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/29/2021 D14S745 n.a. 56551682 5x del n.a. CCTGTAGGCAAATACTGTTGG AAGACCCTGGTGTCTCTTCC 116 D14S1056 57.98cM 56648462 5x del 5x del TGCTAAAAGCCCTATGCCTATG GCGTGCTACTGTTGTGTAATCTCT 194 D14S285 59.43cM 56974469 5x del n.a. GTGGGCAGAATTCTAACATG TGTC TGATAGAATACCTGAGAGA 114 D14Skh6 n.a. 56987709 5x del n.a. TCAAGGCTCTAAGTGGCTACC TG GTTTTCCATTCCTGAGTTAC 188 D14Skh26 n.a. 56988712 not polymorph none GCCATTTGTTATCTTCTTTTGAG GGTGGTGTGTGCCTGTAATC 203 D14Skh19 n.a. 56991920 not polymorph none ATTCCCTCCCACTGTTTGTAG AATGGACACTTTCTTTGAGCC 202 D14Skh4 n.a. 57002031 none n.a. TTCCTTACTCTCTTATTTCCCC TCTCAAACACCTGGACTCAAG 281 D14S66 59.43cM 57050681 none none CTTATAATCAACACCTGCCTTC TTTAGACTAGGGATGCAATCC 107 D14S980 60.43cM 57152567 none none CTGGGCAACAAGAGTGG GAAGCGGGACAATTCTCTAAG 160 D14S274 63.25cM 57659544 none none TGAACTTTGGGCACCCT TCTGACAAACCAGCAAATGA 124 D14S592 66.81cM 61396856 none none TTCCAGAGTATTTGCTTAAGAGG GCATTGTGGGATGAGGTATG 227 D14S1046 69.82cM 65183113 none none CATTTGGAGTTGAGTGGTTAGA CCTCTGTGGATTCTGGGA 215 D14S588 75.61cM 70220286 none none GCCGAAAGAAAGAAAAAAGG CGAATGCATACTTGCTGTTG 120 n.a.: not available; 3x del corresponds to Del1: deleted in II:2, III:4, III:5, i.e. part of the 3,355kb-deletion; 5x del corresponds to Del2: deleted in I:2, II:2, II:3, III:4, III:5, i.e. part of the 669kb-deletion © 2017 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/29/2021 eTable 2. Whole-genome sequencing metrics of patient II:3 Library Read Length (bp) 25 Total Read-Pairs 153,933,421 Percent Proper Pairs (%) 85.8 Pairwise Alignment Rate (%) 96.2 Chimera Rate (%) 10.5 Pairwise Duplication Rate (%) 2.9 Median Insert Size (bp) 1,880 Median Insert Size - 342 median absolute deviation (bp) Physical Coverage 80.1 © 2017 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/29/2021 eTable 3. Copy number variations and overlapping protein coding genes in unaffected and affected members of the family (according to Ensembl at http://www.ensembl.org) A) Protein coding genes within the 3,355-kb deletion region (Del1; chr14: 53632861-56987977). This deletion is present in affected individuals II:2, III:4, III:5. Position on chromosome Symbol Gene name OMIM gene OMIM disease 14 (hg19) 54416455- BMP4 bone morphogenetic protein 4 112262, functions throughout development in mesoderm 607932: microphthalmia with brain 54423554 induction, tooth development, limb formation, bone and digital anomalies (AD), induction, and fracture repair 600625: nonsyndromic cleft lip with or without cleft palate 54866612- CDKN3 Cyclin-dependent kinase inhibitor 3 123832, protein phosphatase; inhibits cell cycle progression n.a. 54886934 54893647- CNIH cornichon homolog (Drosophila) 611287, Upregulated during T-cell activation n.a. 54908148 54941209- GMFP Glia maturation factor, beta 601713, growth and differentiation factor in brain, n.a. 54955744 intracellular regulator of signal transduction pathways 54976587- CGRRF1 cell growth regulator with ring finger 606138, no specific functional information available n.a. 55005334 domain 1 55034330- SAMD4A sterile alpha motif domain containing 610747, Posttranscriptional regulator that binds to RNA n.a. 55260033 4A 55308724- GCH1 GTP cyclohydrolase 1 600225, catalyzes GTP, the first and rate-limiting step in 128230: dopa-responsive dystonia 55369542 tetrahydrobiopterin (BH4) biosynthesis (AD, AR) 233910: tetrahydrobiopterin (BH4)-deficient hyperphenylalaninemia (AR) 55405656- WDHD1 WD repeat and HMG-box DNA 608126, Described as DNA-binding protein involved in na. 55493819 binding protein 1 chromatin assembly, transcription, and replication 55493844- SOCS4 suppressor of cytokine signaling 4 605118, regulate cytokine and other signaling pathways n.a. 55516206 55518362- MAPK1IP1L mitogen-activated protein kinase 1 n.a. n.a. 55536912 interacting protein 1-like 55595935- LGALS3 lectin, galactoside-binding, soluble, 3 153619, galactose- and IgE-binding lectin secreted by n.a. 55612148 inflammatory macrophages 55614834- DLGAP5 discs, large (Drosophila) homolog- n.a. n.a. 55658396 associated protein 5 55738872- FBXO34 F-box protein 34 609104, protein-ubiquitin ligase n.a. 55820329 55833109- ATG14 Autophagy related 14 613515, essential autophagy-specific regulator of the class III n.a. 55878576 phosphatidylinositol 3-kinase (PI3K) complex, promotes © 2017 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/29/2021 membrane tethering of protein-free liposomes 55880930- TBPL2 TATA box binding protein like 2 608964, no specific functional information available n.a. 55907263 56046925- KTN1 kinectin 1 (kinesin receptor) 600381, microtubule-associated protein, large integral ER n.a. 56151302 membrane protein 56585093- PELI2 pellino E3 ubiquitin protein ligase 614798, intermediate component in the innate immune n.a. 56768031 family member 2 response signaling cascade AD: autosomal dominant, AR: autosomal recessive, n.a.: not available, ER: endoplasmatic reticulum B) Protein coding genes within the 669-kb deletion region (Del2; chr14: 56319271-56987977). This deletion is present in the unaffected individuals I:2, II:3. Position on chromosome 14 Symbol Gene name OMIM gene OMIM disease (hg19) 56585093- PELI2 pellino E3 ubiquitin protein ligase 614798, intermediate component in the innate immune n.a. 56768031 family member 2 response signaling cascade C) Protein coding genes within the 29-kb deletion region (Del3; chr14: 40377931-40407405). This deletion is present in all five investigated individuals. No gene in this
Load more

Recommended publications
  • Bioinformatics Identi Cation of Prognostic Factors Associated With
    Bioinformatics Identication of Prognostic Factors Associated with Breast Cancer Ying Wei Sichuan University https://orcid.org/0000-0001-8178-4705 Shipeng Zhang College of Pharmacy, North Sichuan Medical College Li Xiao West China School of Basic Medical Sciences and Forensic Medicine Jing Zou West China School of Basic Medical Sciences and Forensic Medicine Yingqing Fu West China School of Basic Medical Sciences and Forensic Medicine Yi Ye West China School of Basic Medical Sciences and Forensic Medicine Linchuan Liao ( [email protected] ) West China School of Basic Medical Sciences and Forensic Medicine https://orcid.org/0000-0003-3700-8471 Research Keywords: Breast cancer, Differentially expressed genes, miRNAs, Transcription factors, Bioinformatic analysis Posted Date: December 2nd, 2020 DOI: https://doi.org/10.21203/rs.3.rs-117477/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/23 Abstract Background: Breast cancer (BRCA) remains one of the most common forms of cancer and is the most prominent driver of cancer-related death among women. The mechanistic basis for BRCA, however, remains incompletely understood. In particular, the relationships between driver mutations and signaling pathways in BRCA are poorly characterized, making it dicult to identify reliable clinical biomarkers that can be employed in diagnostic, therapeutic, or prognostic contexts. Methods: First, we downloaded publically available BRCA datasets (GSE45827, GSE42568, and GSE61304) from the Gene Expression Omnibus (GEO) database. We then compared gene expression proles between tumor and control tissues in these datasets using Venn diagrams and the GEO2R analytical tool. We further explore the functional relevance of BRCA-associated differentially expressed genes (DEGs) via functional and pathway enrichment analyses using the DAVID tool, and we then constructed a protein-protein interaction network incorporating DEGs of interest using the Search Tool for the Retrieval of Interacting Genes (STRING) database.
    [Show full text]
  • Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice
    Loyola University Chicago Loyola eCommons Biology: Faculty Publications and Other Works Faculty Publications 2013 Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice Mihaela Palicev Gunter P. Wagner James P. Noonan Benedikt Hallgrimsson James M. Cheverud Loyola University Chicago, [email protected] Follow this and additional works at: https://ecommons.luc.edu/biology_facpubs Part of the Biology Commons Recommended Citation Palicev, M, GP Wagner, JP Noonan, B Hallgrimsson, and JM Cheverud. "Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice." Genome Biology and Evolution 5(10), 2013. This Article is brought to you for free and open access by the Faculty Publications at Loyola eCommons. It has been accepted for inclusion in Biology: Faculty Publications and Other Works by an authorized administrator of Loyola eCommons. For more information, please contact [email protected]. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 License. © Palicev et al., 2013. GBE Genomic Correlates of Relationship QTL Involved in Fore- versus Hind Limb Divergence in Mice Mihaela Pavlicev1,2,*, Gu¨ nter P. Wagner3, James P. Noonan4, Benedikt Hallgrı´msson5,and James M. Cheverud6 1Konrad Lorenz Institute for Evolution and Cognition Research, Altenberg, Austria 2Department of Pediatrics, Cincinnati Children‘s Hospital Medical Center, Cincinnati, Ohio 3Yale Systems Biology Institute and Department of Ecology and Evolutionary Biology, Yale University 4Department of Genetics, Yale University School of Medicine 5Department of Cell Biology and Anatomy, The McCaig Institute for Bone and Joint Health and the Alberta Children’s Hospital Research Institute for Child and Maternal Health, University of Calgary, Calgary, Canada 6Department of Anatomy and Neurobiology, Washington University *Corresponding author: E-mail: [email protected].
    [Show full text]
  • New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology
    Cancer Research and Treatment 2003;35(4):304-313 New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology Yong-Wan Kim, Ph.D.1, Min-Je Suh, M.S.1, Jin-Sik Bae, M.S.1, Su Mi Bae, M.S.1, Joo Hee Yoon, M.D.2, Soo Young Hur, M.D.2, Jae Hoon Kim, M.D.2, Duck Young Ro, M.D.2, Joon Mo Lee, M.D.2, Sung Eun Namkoong, M.D.2, Chong Kook Kim, Ph.D.3 and Woong Shick Ahn, M.D.2 1Catholic Research Institutes of Medical Science, 2Department of Obstetrics and Gynecology, College of Medicine, The Catholic University of Korea, Seoul; 3College of Pharmacy, Seoul National University, Seoul, Korea Purpose: This study utilized both mRNA differential significant genes of unknown function affected by the display and the Gene Ontology (GO) analysis to char- HPV-16-derived pathway. The GO analysis suggested that acterize the multiple interactions of a number of genes the cervical cancer cells underwent repression of the with gene expression profiles involved in the HPV-16- cancer-specific cell adhesive properties. Also, genes induced cervical carcinogenesis. belonging to DNA metabolism, such as DNA repair and Materials and Methods: mRNA differential displays, replication, were strongly down-regulated, whereas sig- with HPV-16 positive cervical cancer cell line (SiHa), and nificant increases were shown in the protein degradation normal human keratinocyte cell line (HaCaT) as a con- and synthesis. trol, were used. Each human gene has several biological Conclusion: The GO analysis can overcome the com- functions in the Gene Ontology; therefore, several func- plexity of the gene expression profile of the HPV-16- tions of each gene were chosen to establish a powerful associated pathway, identify several cancer-specific cel- cervical carcinogenesis pathway.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Transcriptional Control of Tissue-Resident Memory T Cell Generation
    Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2019 © 2019 Filip Cvetkovski All rights reserved ABSTRACT Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Tissue-resident memory T cells (TRM) are a non-circulating subset of memory that are maintained at sites of pathogen entry and mediate optimal protection against reinfection. Lung TRM can be generated in response to respiratory infection or vaccination, however, the molecular pathways involved in CD4+TRM establishment have not been defined. Here, we performed transcriptional profiling of influenza-specific lung CD4+TRM following influenza infection to identify pathways implicated in CD4+TRM generation and homeostasis. Lung CD4+TRM displayed a unique transcriptional profile distinct from spleen memory, including up-regulation of a gene network induced by the transcription factor IRF4, a known regulator of effector T cell differentiation. In addition, the gene expression profile of lung CD4+TRM was enriched in gene sets previously described in tissue-resident regulatory T cells. Up-regulation of immunomodulatory molecules such as CTLA-4, PD-1, and ICOS, suggested a potential regulatory role for CD4+TRM in tissues. Using loss-of-function genetic experiments in mice, we demonstrate that IRF4 is required for the generation of lung-localized pathogen-specific effector CD4+T cells during acute influenza infection. Influenza-specific IRF4−/− T cells failed to fully express CD44, and maintained high levels of CD62L compared to wild type, suggesting a defect in complete differentiation into lung-tropic effector T cells.
    [Show full text]
  • Suppression of Cytokine Signaling by SOCS3: Characterization of the Mode of Inhibition and the Basis of Its Specificity
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Immunity Article Suppression of Cytokine Signaling by SOCS3: Characterization of the Mode of Inhibition and the Basis of Its Specificity Jeffrey J. Babon,1,2,5,* Nadia J. Kershaw,1,3,5 James M. Murphy,1,2,5 Leila N. Varghese,1,2 Artem Laktyushin,1 Samuel N. Young,1 Isabelle S. Lucet,4 Raymond S. Norton,1,2,6 and Nicos A. Nicola1,2,* 1Walter and Eliza Hall Institute of Medical Research, 1G Royal Pde, Parkville, 3052, VIC, Australia 2The University of Melbourne, Royal Parade, Parkville, 3050, VIC, Australia 3Ludwig Institute for Cancer Research, Royal Pde, Parkville, 3050, VIC, Australia 4Monash University, Wellington Rd, Clayton, 3800, VIC, Australia 5These authors contributed equally to this work 6Present address: Monash Institute of Pharmaceutical Sciences, Monash University, Parkville 3052, Australia *Correspondence: [email protected] (J.J.B.), [email protected] (N.A.N.) DOI 10.1016/j.immuni.2011.12.015 SUMMARY Genetic deletion of each individual JAK leads to various immunological and hematopoietic defects; however, aberrant Janus kinases (JAKs) are key effectors in controlling activation of JAKs can be likewise pathological. Three myelopro- immune responses and maintaining hematopoiesis. liferative disorders (polycythemia vera, essential thrombocythe- SOCS3 (suppressor of cytokine signaling-3) is a mia, and primary myelofibrosis) are caused by a single point major regulator of JAK signaling and here we investi- mutation in JAK2 (JAK2V617F)(James et al., 2005; Levine et al., gate the molecular basis of its mechanism of action.
    [Show full text]
  • Estrogen Receptor Α Polymorphism in a Species with Alternative Behavioral Phenotypes
    Estrogen receptor α polymorphism in a species with alternative behavioral phenotypes Brent M. Hortona, William H. Hudsonb, Eric A. Ortlundb, Sandra Shirka, James W. Thomasc, Emily R. Youngd, Wendy M. Zinzow-Kramera, and Donna L. Maneya,1 aDepartment of Psychology, Emory University, Atlanta, GA 30322; bDepartment of Biochemistry, Emory University School of Medicine, Atlanta, GA 30322; cNIH Intramural Sequencing Center, National Human Genome Research Institute, National Institutes of Health, Rockville, MD 20852; and dDepartment of Biology, Georgia Institute of Technology, Atlanta, GA 30332 Edited by Ellen D. Ketterson, Indiana University, Bloomington, IN, and accepted by the Editorial Board December 5, 2013 (received for review September 12, 2013) The evolution of behavior relies on changes at the level of the (7, 8). Morph differences in behavior cannot be entirely explained genome; yet the ability to attribute a behavioral change to by these hormones, however, because the differences persist even a specific, naturally occurring genetic change is rare in vertebrates. when plasma levels are experimentally equalized (9). Individual In the white-throated sparrow (Zonotrichia albicollis), a chromo- variation in steroid-dependent behavior may be better explained somal polymorphism (ZAL2/2m) is known to segregate with a be- by neural sensitivity to the hormones, for example by variation in havioral phenotype. Individuals with the ZAL2m haplotype engage the distribution and abundance of steroid receptors (10, 11). in more territorial aggression and less parental behavior than indi- The gene encoding estrogen receptor α (ERα), estrogen re- m viduals without it. These behaviors are thought to be mediated by ceptor 1 (ESR1), has been captured by the ZAL2 rearrange- sensitivity to sex steroids, and the chromosomal rearrangement ment (3) and has therefore likely differentiated between the underlying the polymorphism has captured a prime candidate haplotypes.
    [Show full text]
  • S41467-020-18249-3.Pdf
    ARTICLE https://doi.org/10.1038/s41467-020-18249-3 OPEN Pharmacologically reversible zonation-dependent endothelial cell transcriptomic changes with neurodegenerative disease associations in the aged brain Lei Zhao1,2,17, Zhongqi Li 1,2,17, Joaquim S. L. Vong2,3,17, Xinyi Chen1,2, Hei-Ming Lai1,2,4,5,6, Leo Y. C. Yan1,2, Junzhe Huang1,2, Samuel K. H. Sy1,2,7, Xiaoyu Tian 8, Yu Huang 8, Ho Yin Edwin Chan5,9, Hon-Cheong So6,8, ✉ ✉ Wai-Lung Ng 10, Yamei Tang11, Wei-Jye Lin12,13, Vincent C. T. Mok1,5,6,14,15 &HoKo 1,2,4,5,6,8,14,16 1234567890():,; The molecular signatures of cells in the brain have been revealed in unprecedented detail, yet the ageing-associated genome-wide expression changes that may contribute to neurovas- cular dysfunction in neurodegenerative diseases remain elusive. Here, we report zonation- dependent transcriptomic changes in aged mouse brain endothelial cells (ECs), which pro- minently implicate altered immune/cytokine signaling in ECs of all vascular segments, and functional changes impacting the blood–brain barrier (BBB) and glucose/energy metabolism especially in capillary ECs (capECs). An overrepresentation of Alzheimer disease (AD) GWAS genes is evident among the human orthologs of the differentially expressed genes of aged capECs, while comparative analysis revealed a subset of concordantly downregulated, functionally important genes in human AD brains. Treatment with exenatide, a glucagon-like peptide-1 receptor agonist, strongly reverses aged mouse brain EC transcriptomic changes and BBB leakage, with associated attenuation of microglial priming. We thus revealed tran- scriptomic alterations underlying brain EC ageing that are complex yet pharmacologically reversible.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • RNA Editing at Baseline and Following Endoplasmic Reticulum Stress
    RNA Editing at Baseline and Following Endoplasmic Reticulum Stress By Allison Leigh Richards A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Human Genetics) in The University of Michigan 2015 Doctoral Committee: Professor Vivian G. Cheung, Chair Assistant Professor Santhi K. Ganesh Professor David Ginsburg Professor Daniel J. Klionsky Dedication To my father, mother, and Matt without whom I would never have made it ii Acknowledgements Thank you first and foremost to my dissertation mentor, Dr. Vivian Cheung. I have learned so much from you over the past several years including presentation skills such as never sighing and never saying “as you can see…” You have taught me how to think outside the box and how to create and explain my story to others. I would not be where I am today without your help and guidance. Thank you to the members of my dissertation committee (Drs. Santhi Ganesh, David Ginsburg and Daniel Klionsky) for all of your advice and support. I would also like to thank the entire Human Genetics Program, and especially JoAnn Sekiguchi and Karen Grahl, for welcoming me to the University of Michigan and making my transition so much easier. Thank you to Michael Boehnke and the Genome Science Training Program for supporting my work. A very special thank you to all of the members of the Cheung lab, past and present. Thank you to Xiaorong Wang for all of your help from the bench to advice on my career. Thank you to Zhengwei Zhu who has helped me immensely throughout my thesis even through my panic.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • AURKA, DLGAP5, TPX2, KIF11 and CKAP5: Five Specific Mitosis-Associated Genes Correlate with Poor Prognosis for Non-Small Cell Lung Cancer Patients
    INTERNATIONAL JOURNAL OF ONCOLOGY 50: 365-372, 2017 AURKA, DLGAP5, TPX2, KIF11 and CKAP5: Five specific mitosis-associated genes correlate with poor prognosis for non-small cell lung cancer patients MARC A. SCHNEIDER1,8, PETROS CHristopoulos2,8, THOMAS MULEY1,8, ARNE WartH5,8, URSULA KLINGMUELLER6,8,9, MICHAEL THOMAS2,8, FELIX J.F. HertH3,8, HENDRIK DIENEMANN4,8, NIKOLA S. MUELLER7,9, FABIAN THEIS7,9 and MICHAEL MEISTER1,8,9 1Translational Research Unit, 2Department of Thoracic Oncology, 3Department of Pneumology and Critical Care Medicine, and 4Department of Surgery, Thoraxklinik at University Hospital Heidelberg, Heidelberg; 5Institute of Pathology, University of Heidelberg, Heidelberg; 6Systems Biology of Signal Transduction, German Cancer Research Center, Heidelberg; 7Cellular Dynamics and Cell Patterning, Max Planck Institute of Biochemistry, Martinsried; 8Translational Lung Research Center Heidelberg (TLRC-H), Member of the German Center for Lung Research (DZL) Heidelberg; 9CancerSys network ‘LungSysII’, Heidelberg, Germany Received October 26, 2016; Accepted December 5, 2016 DOI: 10.3892/ijo.2017.3834 Abstract. The growth of a tumor depends to a certain extent genes AURKA, DLGAP5, TPX2, KIF11 and CKAP5 is asso- on an increase in mitotic events. Key steps during mitosis are ciated with the prognosis of NSCLC patients. the regulated assembly of the spindle apparatus and the sepa- ration of the sister chromatids. The microtubule-associated Introduction protein Aurora kinase A phosphorylates DLGAP5 in order to correctly segregate the chromatids. Its activity and recruitment Lung cancer is globally the leading cause of cancer-related to the spindle apparatus is regulated by TPX2. KIF11 and deaths (1). Non-small cell lung cancer (NSCLC), which accounts CKAP5 control the correct arrangement of the microtubules for more than 80% of all cases, is divided in adenocarcinoma and prevent their degradation.
    [Show full text]