DOCSLIB.ORG

In Vitro Processing of Glutamyl Endopeptidase Proenzymes from Enterococcus Faecalis and Importance of N-Terminal Residue in Enzyme Catalysis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
In Vitro Processing of Glutamyl Endopeptidase Proenzymes from Enterococcus Faecalis and Importance of N-Terminal Residue in Enzyme Catalysis Advances in Biochemistry 2013; 1(5): 73-80 Published online December 30, 2013 (http://www.sciencepublishinggroup.com/j/ab) doi: 10.11648/j.ab.20130105.11 In vitro processing of glutamyl endopeptidase proenzymes from Enterococcus faecalis and importance of N-terminal residue in enzyme catalysis Shakh M. A. Rouf 1, 2, *, Y. Ohara-Nemoto 1, T. Ono 1, Y. Shimoyama 3, S. Kimura 3, T. K. Nemoto 1 1Department of Oral Molecular Biology, Courses of Medical and Dental Science, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki 852-8588, Japan 2Department of Applied Nutrition & Food Technology, Islamic University, Kushtia-7003, Bangladesh 3Division of Molecular Microbiology, Iwate Medical University, Yahaba-cho 028-3694, Japan Email address: [email protected] (S. M. A. Rouf) To cite this article: Shakh M. A. Rouf, Y. Ohara-Nemoto, T. Ono, Y. Shimoyama, S. Kimura, T. K. Nemoto. In Vitro Processing of Glutamyl Endopeptidase Proenzymes from Enterococcus faecalis and Importance of N-terminal Residue in Enzyme Catalysis. Advances in Biochemistry. Vol. 1, No. 5, 2013, pp. 73-80. doi: 10.11648/j.ab.20130105.11 Abstract: Glutamyl endopeptidase from Enterococcus faecalis, designated SprE, is one of the important virulence factors secreted as zymogen. In the present study we expressed recombinant SprE proenzyme (pro-SprE) in Escherichia coli and investigated the in vitro processing to mature SprE. It was found that trypsin could efficiently produce the active form of SprE with the N-terminus Ser 1 through cleavage between Arg -1 and Ser 1 bond, which was subsequently auto-degraded into inactive species through the cleavage at the Glu 6-Asp 7 and Glu 11 -Val 12 bonds. Although thermolysin could produce SprE with the N-terminus Leu 2, but possessed no proteolytic activity. In contrast to the absolute requirement of the N-terminal Val 1 in staphylococcal glutamyl endopeptidases, the N-terminal Ser 1 of mature SprE could be substituted by other amino acids despite that Ser showed the maximal activity. Substitution of penultimate Leu 2 of SprE to Val 2 also reduced the activity to 40% of the wild type. Taken together, we conclude that pro-SprE was converted to mature form with the N-terminus Ser 1 by a protease with specificity of trypsin and the length of the N-terminal region rather than specific residue is absolutely required for enzyme activity. Keywords: Glutamyl Endopeptidase, Proenzyme Processing, Spre, Enterococcus faecalis , Gluv8 studies have been undertaken to investigate the possible role 1. Introduction of gelatinase and serine proteases in the disease processes Enterococcus faecalis is a gram-positive cocci and caused by E. faecalis and they were found to contribute to common inhabitant of human gastrointestinal and the pathogenesis through biofilm formation, facilitating genitourinary tract [1]. It causes a wide variety of diseases bacterial invasions, degradation of immune peptides in human, infecting the urinary tract, endocardium, abdomen, required for host response [7, 8, 9,10]. Gelatinase (GelE) biliary tract, burn wounds and indwelling foreign devices [2]. and serine protease (SprE) expressed in E. faecalis were In dentistry, E. faecalis has been associated with caries reported to be important for enterococcal virulence in mouse lesions, chronic periodontitis, recurrent root canal infection peritonitis model [11]. Previous studies also indicated that and persistent apical periodontitis [3, 4]. Candidate the presence of extracellular proteases, GelE and SprE, in virulence factors of E. faecalis include: cytolysin and the E. faecalis raised mortality in animal models [12, 13]. proteolytic enzyme (gelatinase and serine protease), Glutamyl endopeptidase (EC 3.4.21.19) from adhesions (aggregation substance, enterococci surface Staphylococcus aureus V8 strain (GluV8) is a serine protein or Esp, collagen adhesion protein or Ace, antigen A protease with unique substrate specificity to Glu-X and or EfaA) and capsular and cellular wall polysaccharides [2, Asp-X with the higher preference to the former [14,15]. This 5]. Serine protease, gelatinase and collagen-binding protein family protease from E. faecalis SprE, which has been (Ace) facilitate E. faecalis bind to dentin [6]. Several shown to contribute to pathogenesis in animal models [16, 11, 17]. Kawalec et al. [18] purified several isoforms of 74 Shakh M. A. Rouf et al.: In Vitro Processing of Glutamyl Endopeptidase Proenzymes from Enterococcus faecalis and Importance of N-terminal Residue in Enzyme Catalysis mature SprE, starting with N-terminal Ser 1and Leu 2 from Ac-Thr-Val-Ala-Asp-MCA (TVAD-MCA), wild-type E. faecalis OG1RF (TX4002) and a Z-Ala-Ala-Asn-MCA (AAN-MCA) and gelatinase-null mutant TX5264, among which SrpE starting Boc-Gln-Ala-Arg-MCA (QAR-MCA)from the Peptide with Ser 1was super active. Moreover, they suspected the Institute Inc. (Osaka, Japan);Leu-Asp-MCA (LD-MCA) and instability of active SprE (Ser 1-SprE form) apparently due to Z-Leu-Leu-Gln-MCA (LLQ-MCA), synthesized by Thermo auto-degradation. Fisher Scientific (Ulm, Germany); thermolysin from SprE shows sequence homology with GluV8 (27% Bacillus thermoproteolyticusrokko, trypsin procine pancreas, identity, 49% similarity) [19] and that from S. epidermidis bovine serum albumin (BSA), were from Sigma-Aldrich (St. (GluSE) (26% identity, 49% similarity) [20]. It has been Louis, MO, USA); and gelatin from the NacalaiTesque. Inc. reported that the proenzyme of GluV8 is processed by a (Osaka, Japan). thermolysin-family metalloprotease, aureolysin in vivo [21,22]. The prosequence of Staphylococcal GluV8-family 2.2. Expression Vector for the Expression of SprE protease was reported to sequentially remove to shorter The SprE gene was amplified by PCR using KOD Plus proenzymes in an autocatalytic manner by cleaving at Glu-X DNA polymerase and chromosomal DNA (0.1 µg) of E. and Gln-X in the prosegment and finally matured by -1 1 faecalis NCTC 775 as template. The synthetic aureolysin at N-terminal Asn -Val [23, 24]. Consistently oligonucleotides primers recombinant GluV8 expressed in E. coli was efficiently (5’-ATGGATCC AAAAAGTTCTCCATACGAAAAATTA processed to mature GluV8 by thermolysin in vitro [25]. 1 G-3') and Val is conserved at the N-termini of mature glutamyl (5’-GTGGATCC CGCTGCAGGCACAGCGGATAAACG- endopeptidases from Staphylococcus epidermidis [26, 27], 3') containing Bam HI sites (underlined) were designed on Staphylococcal warneri [28], Staphylococcal cohnii and the basis of the DNA sequence of SprE (GeneBank Staphylococcal caprae [29]. accession no. Z12296), used for SprE gene amplification. The N-terminus amino acid residue of mature PCR-amplified 0.8-kb fragment (without stop codon) was GluV8-family endopeptidases was found to be critical for cleaved with Bam HI, and then inserted into the Bam HI site maturation by aureolysin and for the stabilization of mature of pQE60 to yield pQE60-SprE expression vector. structure resistant to further processing at the Val 1-Ile 2 and Ile 2-Leu 3 bonds [25]. Furthermore, Val 1 is directly involved 2.3. Expression and Purification of Recombinant in the protease activity itself, because Val 1 cannot be Proteases substituted by other amino acids, even if the processing was correctly mediated with Arg -1-X1-substituted forms by In order to minimize the modification in the N-terminal trypsin (X=Ala, Phe, Gly and Ser) [25]. Exceptionally, the preprosequence of SprE, the expression vector pQE60 that Val 1 substitution to Leu 1 could partially (30%) retained encoded an affinity tag, [Gly-Ser-Arg-Ser-(His) 6] at the proteolytic activity of the wild type, further indicating the C-terminus was used (Fig. 1A). In addition Gly-Gly-Ser 1 derived from the vector was present between 1st-Met and significance of Val for the protease activity [29]. Sequence nd alignment indicates that Val 1 of GluV8 corresponds to Leu1 2 2 -Lys of the N-terminal prepropeptide. Escherichia coli of SprE, whereas it has been reported that SprE with XL1-blue was transformed with the pQE60-SprE expression N-terminal Leu 2 (Leu 2-SprE) had a significantly negligible plasmids. C-terminal His 6-tagged recombinant proteins activity compared to that with N-terminal Ser 1 [18]. were expressed and purified as described previously Moreover, the processing mechanism of pro-SprE still [25].Protein concentrations were determined by the remains unknown. Therefore, we here investigated the in bicinchoninic acid method using BSA as the standard vitro processing of pro-SprE expressed in E coli and (Pierce, Rockford, IL, USA). Purified proteins were stored addressed the roles of N-terminal amino acids in the enzyme at -80 ˚C until used. catalysis. 2.4. Amino Acid Numbering and In Vitro Mutagenesis 2. Materials and Methods The N-terminal Ser of the active SprE was numbered as the first amino acid residue (Ser1). In vitro mutagenesis was 2.1. Materials performed as reported previously [30] by PCR with mutated primer(s) to substitute 3 amino acids in the prosequence The materials used and their sources were as follow: (Glu -15 Ser, Glu -14 Lys, Glu -8Ile, designated as SprE-mut), 4 expression vector pQE60, from Qiagen Inc. (Chatsworth, amino acids in the mature region (Glu11Gln, Glu6Gln, CA, USA); low-molecular-weight markers, from GE Ser1Thr/Ala/Val and Leu2Val), and an essential Ser 180 to Ala. Healthcare (Buchinghamshire, England); restriction All mutations were confirmed by DNA sequencing. enzymes and DNA-modifying enzymes, from Nippon Gene (Tokyo, Japan); KOD Plus DNA polymerase, from Toyobo 2.5. SDS-PAGE and Zymography (Tokyo, Japan); Talon metal-affinity resin, from Clontech Laboratories Inc. (Palo Alto, CA, USA); Recombinant proteins (1 µg) were separated by Z-Leu-Leu-Glu-MCA (LLE-MCA), SDS-PAGE at a polyacrylamide concentration of 12.5% (w/v), and then stained with Coomassie Brilliant Blue Advances in Biochemistry 2013; 1(5): 73-80 75 (CBB). Band intensities wer quantified with Image J or thermolysin, expected that may induce processing at software [31].
Load more

Recommended publications
  • The Role of Streptococcal and Staphylococcal Exotoxins and Proteases in Human Necrotizing Soft Tissue Infections
    toxins Review The Role of Streptococcal and Staphylococcal Exotoxins and Proteases in Human Necrotizing Soft Tissue Infections Patience Shumba 1, Srikanth Mairpady Shambat 2 and Nikolai Siemens 1,* 1 Center for Functional Genomics of Microbes, Department of Molecular Genetics and Infection Biology, University of Greifswald, D-17489 Greifswald, Germany; [email protected] 2 Division of Infectious Diseases and Hospital Epidemiology, University Hospital Zurich, University of Zurich, CH-8091 Zurich, Switzerland; [email protected] * Correspondence: [email protected]; Tel.: +49-3834-420-5711 Received: 20 May 2019; Accepted: 10 June 2019; Published: 11 June 2019 Abstract: Necrotizing soft tissue infections (NSTIs) are critical clinical conditions characterized by extensive necrosis of any layer of the soft tissue and systemic toxicity. Group A streptococci (GAS) and Staphylococcus aureus are two major pathogens associated with monomicrobial NSTIs. In the tissue environment, both Gram-positive bacteria secrete a variety of molecules, including pore-forming exotoxins, superantigens, and proteases with cytolytic and immunomodulatory functions. The present review summarizes the current knowledge about streptococcal and staphylococcal toxins in NSTIs with a special focus on their contribution to disease progression, tissue pathology, and immune evasion strategies. Keywords: Streptococcus pyogenes; group A streptococcus; Staphylococcus aureus; skin infections; necrotizing soft tissue infections; pore-forming toxins; superantigens; immunomodulatory proteases; immune responses Key Contribution: Group A streptococcal and Staphylococcus aureus toxins manipulate host physiological and immunological responses to promote disease severity and progression. 1. Introduction Necrotizing soft tissue infections (NSTIs) are rare and represent a more severe rapidly progressing form of soft tissue infections that account for significant morbidity and mortality [1].
    [Show full text]
  • Chymotrypsin: a Serine Protease Reaction Mechanism Step
    CHEM464/Medh,J.D. Catalytic Strategies Chymotrypsin: A serine protease • Covalent catalysis: temporary covalent modification of reactive • Hydrolyzes peptide bonds on the carboxyl side of group on enzyme active site Tyr, Phe, Trp, Met, Leu • Acid-Base catalysis: A molecule other than water is proton • Since peptide bond is highly unreactive, a strong donor or acceptor (nucleophilic or electrophilic attack) nucleophile is required for its hydrolysis • Metal ion catalysis: Involvement of metal ion in catalysis. A metal ion is an electrophile and (i) may stabilize a negative • Catalytic strategy is covalent modification and charge on an intermediate; (ii) by attracting electrons from acid-base catalysis water, renders water more acidic (prone to loose a proton); (iii) • Contains catalytic triad of Ser, His and Asp. Ser is may bind to substrate and reduce activation energy a nucleophile and participates in covalent • Catalysis by approximation: In reactions requiring more than modification, His is a proton acceptor (base), Asp one substrate, the enzyme facilitates their interaction by serving stabilizes His (and active site) by electrostatic as an adapter that increases proximity of the substrates to each interactions other Reaction Mechanism Step-wise reaction • Hydrolysis by chymotrypsin is a 2-step process • Enzyme active site is stabilized by ionic interactions • Step 1: serine reacts with substrate to form covalent between Asp and His and H-bond between His and Ser. ES complex • In the presence of a substrate, His accepts a proton from • Step 2: release of products from ES complex and Ser, Ser makes a nucleophilic attack on the peptide’s regeneration of enzyme carbonyl C converting its geometry to tetrahedral.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2016/0346364 A1 BRUNS Et Al
    US 2016.0346364A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2016/0346364 A1 BRUNS et al. (43) Pub. Date: Dec. 1, 2016 (54) MEDICAMENT AND METHOD FOR (52) U.S. Cl. TREATING INNATE IMMUNE RESPONSE CPC ........... A61K 38/488 (2013.01); A61K 38/482 DISEASES (2013.01); C12Y 304/23019 (2013.01); C12Y 304/21026 (2013.01); C12Y 304/23018 (71) Applicant: DSM IPASSETS B.V., Heerlen (NL) (2013.01); A61K 9/0053 (2013.01); C12N 9/62 (2013.01); A23L 29/06 (2016.08); A2ID 8/042 (72) Inventors: Maaike Johanna BRUINS, Kaiseraugst (2013.01); A23L 5/25 (2016.08); A23V (CH); Luppo EDENS, Kaiseraugst 2002/00 (2013.01) (CH); Lenneke NAN, Kaiseraugst (CH) (57) ABSTRACT (21) Appl. No.: 15/101,630 This invention relates to a medicament or a dietary Supple (22) PCT Filed: Dec. 11, 2014 ment comprising the Aspergillus niger aspergilloglutamic peptidase that is capable of hydrolyzing plant food allergens, (86). PCT No.: PCT/EP2014/077355 and more particularly, alpha-amylase/trypsin inhibitors, thereby treating diseases due to an innate immune response S 371 (c)(1), in humans, and/or allowing to delay the onset of said (2) Date: Jun. 3, 2016 diseases. The present invention relates to the discovery that (30) Foreign Application Priority Data the Aspergillus niger aspergilloglutamic peptidase is capable of hydrolyzing alpha-amylase/trypsin inhibitors that are Dec. 11, 2013 (EP) .................................. 13196580.8 present in wheat and related cereals said inhibitors being strong inducers of innate immune response. Furthermore, Publication Classification the present invention relates to a method for hydrolyzing alpha-amylase/trypsin inhibitors comprising incubating a (51) Int.
    [Show full text]
  • Role of Extracellular Proteases in Biofilm Disruption of Gram Positive
    e Engine ym er z in n g E Mukherji, et al., Enz Eng 2015, 4:1 Enzyme Engineering DOI: 10.4172/2329-6674.1000126 ISSN: 2329-6674 Review Article Open Access Role of Extracellular Proteases in Biofilm Disruption of Gram Positive Bacteria with Special Emphasis on Staphylococcus aureus Biofilms Mukherji R, Patil A and Prabhune A* Division of Biochemical Sciences, CSIR-National Chemical Laboratory, Pune, India *Corresponding author: Asmita Prabhune, Division of Biochemical Sciences, CSIR-National Chemical Laboratory, Pune 411008, India, Tel: 91-020-25902239; Fax: 91-020-25902648; E-mail: [email protected] Rec date: December 28, 2014, Acc date: January 12, 2015, Pub date: January 15, 2015 Copyright: © 2015 Mukherji R, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract Bacterial biofilms are multicellular structures akin to citadels which have individual bacterial cells embedded within a matrix of a self-synthesized polymeric or proteinaceous material. Since biofilms can establish themselves on both biotic and abiotic surfaces and that bacteria residing in these complex molecular structures are much more resistant to antimicrobial agents than their planktonic equivalents, makes these entities a medical and economic nuisance. Of late, several strategies have been investigated that intend to provide a sustainable solution to treat this problem. More recently role of extracellular proteases in disruption of already established bacterial biofilms and in prevention of biofilm formation itself has been demonstrated. The present review aims to collectively highlight the role of bacterial extracellular proteases in biofilm disruption of Gram positive bacteria.
    [Show full text]
  • Mediate Immune Evasion Aureolysin Cleaves Complement C3 To
    Staphylococcus aureus Metalloprotease Aureolysin Cleaves Complement C3 To Mediate Immune Evasion This information is current as Alexander J. Laarman, Maartje Ruyken, Cheryl L. Malone, of September 29, 2021. Jos A. G. van Strijp, Alexander R. Horswill and Suzan H. M. Rooijakkers J Immunol 2011; 186:6445-6453; Prepublished online 18 April 2011; doi: 10.4049/jimmunol.1002948 Downloaded from http://www.jimmunol.org/content/186/11/6445 Supplementary http://www.jimmunol.org/content/suppl/2011/04/18/jimmunol.100294 Material 8.DC1 http://www.jimmunol.org/ References This article cites 56 articles, 13 of which you can access for free at: http://www.jimmunol.org/content/186/11/6445.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 29, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Staphylococcus aureus Metalloprotease Aureolysin Cleaves Complement C3 To Mediate Immune Evasion Alexander J.
    [Show full text]
  • NS3 Protease from Flavivirus As a Target for Designing Antiviral Inhibitors Against Dengue Virus
    Genetics and Molecular Biology, 33, 2, 214-219 (2010) Copyright © 2010, Sociedade Brasileira de Genética. Printed in Brazil www.sbg.org.br Review Article NS3 protease from flavivirus as a target for designing antiviral inhibitors against dengue virus Satheesh Natarajan Department of Biochemistry, Faculty of Medicine, University of Malaya, Kuala Lumpur, Malayasia. Abstract The development of novel therapeutic agents is essential for combating the increasing number of cases of dengue fever in endemic countries and among a large number of travelers from non-endemic countries. The dengue virus has three structural proteins and seven non-structural (NS) proteins. NS3 is a multifunctional protein with an N-terminal protease domain (NS3pro) that is responsible for proteolytic processing of the viral polyprotein, and a C-terminal region that contains an RNA triphosphatase, RNA helicase and RNA-stimulated NTPase domain that are essential for RNA replication. The serine protease domain of NS3 plays a central role in the replicative cycle of den- gue virus. This review discusses the recent structural and biological studies on the NS2B-NS3 protease-helicase and considers the prospects for the development of small molecules as antiviral drugs to target this fascinating, multifunctional protein. Key words: antiviral inhibitor, drug discovery, multifunctional protein, NS3, protease. Received: March 4, 2009; Accepted: November 1, 2009. Introduction seven non-structural proteins involved in viral replication The genus Flavivirus in the family Flaviviridae con- and maturation (Henchal and Putnak, 1990; Kautner et al., tains a large number of viral pathogens that cause severe 1996). The virus-encoded protease complex NS2B-NS3 is morbidity and mortality in humans and animals (Bancroft, responsible for cleaving the NS2A/NS2B, NS2B/NS3, 1996).
    [Show full text]
  • Serine Proteases with Altered Sensitivity to Activity-Modulating
    (19) & (11) EP 2 045 321 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 08.04.2009 Bulletin 2009/15 C12N 9/00 (2006.01) C12N 15/00 (2006.01) C12Q 1/37 (2006.01) (21) Application number: 09150549.5 (22) Date of filing: 26.05.2006 (84) Designated Contracting States: • Haupts, Ulrich AT BE BG CH CY CZ DE DK EE ES FI FR GB GR 51519 Odenthal (DE) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • Coco, Wayne SK TR 50737 Köln (DE) •Tebbe, Jan (30) Priority: 27.05.2005 EP 05104543 50733 Köln (DE) • Votsmeier, Christian (62) Document number(s) of the earlier application(s) in 50259 Pulheim (DE) accordance with Art. 76 EPC: • Scheidig, Andreas 06763303.2 / 1 883 696 50823 Köln (DE) (71) Applicant: Direvo Biotech AG (74) Representative: von Kreisler Selting Werner 50829 Köln (DE) Patentanwälte P.O. Box 10 22 41 (72) Inventors: 50462 Köln (DE) • Koltermann, André 82057 Icking (DE) Remarks: • Kettling, Ulrich This application was filed on 14-01-2009 as a 81477 München (DE) divisional application to the application mentioned under INID code 62. (54) Serine proteases with altered sensitivity to activity-modulating substances (57) The present invention provides variants of ser- screening of the library in the presence of one or several ine proteases of the S1 class with altered sensitivity to activity-modulating substances, selection of variants with one or more activity-modulating substances. A method altered sensitivity to one or several activity-modulating for the generation of such proteases is disclosed, com- substances and isolation of those polynucleotide se- prising the provision of a protease library encoding poly- quences that encode for the selected variants.
    [Show full text]
  • S. Aureus-Serine Protease-Like Protein B (Splb) Activates PAR2 and Induces Endothelial Barrier Dysfunction
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.30.424670; this version posted January 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. S. aureus-serine protease-like protein B (SplB) activates PAR2 and induces endothelial barrier dysfunction Arundhasa Chandrabalan1, Pierre E Thibeault1, Stefanie Deinhardt-Emmer2, Maria Nordengrün3, Jawad Iqbal3, Daniel M Mrochen3, Laura A Mittmann4, 5, Bishwas Chamling6, 7, Christoph A Reichel4, 5, Rithwik Ramachandran1, Barbara M Bröker3, Murty N Darisipudi3 1Department of Physiology and Pharmacology, Schulich School of Medicine and Dentistry, University of Western Ontario, London, Ontario, Canada 2Section of Experimental Virology, Institute of Medical Microbiology, University Hospital Jena, Jena, Germany 3Department of Immunology, Institute of Immunology and Transfusion Medicine, University Medicine Greifswald, Greifswald, Germany 4Department of Otorhinolaryngology, University Hospital, Ludwig-Maximilians-University Munich, Munich, Germany 5Walter Brendel Centre of Experimental Medicine, University Hospital, Ludwig-Maximilians- University Munich, Munich, Germany 6Department of Cardiology, Internal Medicine B, University Medicine Greifswald, Greifswald, Germany 7DZHK (German Centre for Cardiovascular Research), Partner Site Greifswald, Germany *Correspondence: Dr. V.S. Narayana Murty Darisipudi [email protected] Address: Department of Immunology Institute of Immunology and Transfusion Medicine University Medicine Greifswald F. Sauerbruchstr. DZ 7 17475 Greifswald, Germany Keywords: Staphylococcus aureus, SplB, endothelial damage, proteinase-activated receptor 2, PAR2, G-protein-coupled receptors, cytokines Running title: SplB mediates endothelial inflammation via PAR2 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.30.424670; this version posted January 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Human Elastase 1: Evidence for Expression in the Skin and the Identi®Cation of a Frequent Frameshift Polymorphism
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Human Elastase 1: Evidence for Expression in the Skin and the Identi®cation of a Frequent Frameshift Polymorphism Ulvi Talas, John Dunlop,1 Sahera Khalaf , Irene M. Leigh, and David P. Kelsell Center for Cutaneous Research, St. Bartholomew's and the Royal London School of Medicine and Dentistry, Whitechapel, London, U.K. Human pancreatic elastase 1 is a serine protease individuals with/without the keratoderma revealed a which maps to the chromosomal region 12q13 close sequence variant, which would result in a premature to a locus for an autosomal dominant skin disease, truncation of the protein. This sequence variant, diffuse nonepidermolytic palmoplantar keratoderma, however, did not segregate with the skin disease and, and was investigated as a possible candidate gene for indeed, was found to occur at a relatively high fre- this disorder. Expression of two elastase inhibitors, quency in the population. Individuals homozygous ela®n and SLPI, has been related to several hyper- for the variant do not have any obvious skin proliferative skin conditions. elastase 1 is functionally abnormalities. Based on the analysis of the secondary silent in the human pancreas but elastase 1 expres- structure of the translated putative protein, the sion at the mRNA level was detected in human truncation is unlikely to result in knock-out of the cultured primary keratinocytes. Antibody staining elastase, but may cause destabilization of the localized the protein to the basal cell layer of the enzyme±inhibitor complex. Key words: ela®n/keratino- human epidermis at a number of sites includingthe cyte/protein truncation/serine protease.
    [Show full text]
  • IL-33 Is Processed Into Mature Bioactive Forms by Neutrophil Elastase and Cathepsin G
    IL-33 is processed into mature bioactive forms by neutrophil elastase and cathepsin G Emma Lefrançais, Stephane Roga, Violette Gautier, Anne Gonzalez-de-Peredo, Bernard Monsarrat, Jean-Philippe Girard1,2, and Corinne Cayrol1,2 Centre National de la Recherche Scientifique, Institut de Pharmacologie et de Biologie Structurale, F-31077 Toulouse, France; Université de Toulouse, Université Paul Sabatier, Institut de Pharmacologie et de Biologie Structurale, F-31077 Toulouse, France Edited* by Charles A. Dinarello, University of Colorado Denver, Aurora, CO, and approved December 19, 2011 (received for review October 3, 2011) Interleukin-33 (IL-33) (NF-HEV) is a chromatin-associated nuclear activity (4). However, we (23) and others (24–26) demonstrated cytokine from the IL-1 family, which has been linked to important that full-length IL-33 is biologically active and that processing of diseases, including asthma, rheumatoid arthritis, ulcerative colitis, IL-33 by caspases results in its inactivation, rather than its activa- and cardiovascular diseases. IL-33 signals through the ST2 receptor tion. Further analyses revealed that IL-33 is constitutively and drives cytokine production in type 2 innate lymphoid cells (ILCs) expressed to high levels in the nuclei of endothelial and epithelial (natural helper cells, nuocytes), T-helper (Th)2 lymphocytes, mast cells in vivo (27) and that it can be released in the extracellular cells, basophils, eosinophils, invariant natural killer T (iNKT), and space after cellular damage (23, 24). IL-33 was, thus, proposed (23, natural killer (NK) cells. We and others recently reported that, unlike 24, 27) to function as an endogenous danger signal or alarmin, IL-1β and IL-18, full-length IL-33 is biologically active independently similar to IL-1α and high-mobility group box 1 protein (HMGB1) of caspase-1 cleavage and that processing by caspases results in IL-33 (28–32), to alert cells of the innate immune system of tissue inactivation.
    [Show full text]
  • Serine Protease (Chymotrypsin) from Nocardiopsis Prasina Expressed in Bacillus Licheniformis
    SERINE PROTEASE (CHYMOTRYPSIN) FROM NOCARDIOPSIS PRASINA EXPRESSED IN BACILLUS LICHENIFORMIS Chemical and Technical Assessment Prepared by Jannavi R. Srinivasan, Ph.D., Reviewed by Dr. Inge Meyland, Ph. D. 1. Summary This Chemical and Technical Assessment (CTA) summarizes data and information on the serine protease with chymotrypsin specificity from Nocardiopsis prasina expressed in Bacillus Licheniformis enzyme preparation submitted to the Joint FAO/WHO Expert Committee on Food Additives (JECFA) by Novozymes A/S in a dossier dated November 25, 2011 (Novozymes, 2011)a. In this CTA, the expression ‘serine protease (chymotrypsin)’ is used when referring to the serine protease with chymotrypsin specificity enzyme and its amino acid sequence, whereas the expression ‘serine protease (chymotrypsin) enzyme preparation’ is used when referring to the enzyme preparation. This document also discusses published information relevant to serine protease (chymotrypsin), the B. licheniformis production organism, and the N. prasina organism that is the source for the serine protease (chymotrypsin) gene. Serine protease (chymotrypsin) catalyses the hydrolysis of peptide bonds in a protein, preferably at the carboxyl end of Tyr (Tyr-X), Phe (Phe-X), Trp (Trp-X), when X is not proline. It also catalyses the hydrolysis of peptide bonds at the carboxyl end of other amino acids, primarily Met and Leu, albeit at a slower rate. It is intended for use in the production of hydrolysed animal and vegetable proteins including casein, whey, soy isolate, soy concentrate, wheat gluten and corn gluten. These hydrolysed proteins will be used for various applications as ingredients in food, protein-fortified food, and beverages. The serine protease (chymotrypsin) enzyme preparation is expected to be inactivated during food processing.
    [Show full text]
  • Trypsin-Like Proteases and Their Role in Muco-Obstructive Lung Diseases
    International Journal of Molecular Sciences Review Trypsin-Like Proteases and Their Role in Muco-Obstructive Lung Diseases Emma L. Carroll 1,†, Mariarca Bailo 2,†, James A. Reihill 1 , Anne Crilly 2 , John C. Lockhart 2, Gary J. Litherland 2, Fionnuala T. Lundy 3 , Lorcan P. McGarvey 3, Mark A. Hollywood 4 and S. Lorraine Martin 1,* 1 School of Pharmacy, Queen’s University, Belfast BT9 7BL, UK; [email protected] (E.L.C.); [email protected] (J.A.R.) 2 Institute for Biomedical and Environmental Health Research, School of Health and Life Sciences, University of the West of Scotland, Paisley PA1 2BE, UK; [email protected] (M.B.); [email protected] (A.C.); [email protected] (J.C.L.); [email protected] (G.J.L.) 3 Wellcome-Wolfson Institute for Experimental Medicine, School of Medicine, Dentistry and Biomedical Sciences, Queen’s University, Belfast BT9 7BL, UK; [email protected] (F.T.L.); [email protected] (L.P.M.) 4 Smooth Muscle Research Centre, Dundalk Institute of Technology, A91 HRK2 Dundalk, Ireland; [email protected] * Correspondence: [email protected] † These authors contributed equally to this work. Abstract: Trypsin-like proteases (TLPs) belong to a family of serine enzymes with primary substrate specificities for the basic residues, lysine and arginine, in the P1 position. Whilst initially perceived as soluble enzymes that are extracellularly secreted, a number of novel TLPs that are anchored in the cell membrane have since been discovered. Muco-obstructive lung diseases (MucOLDs) are Citation: Carroll, E.L.; Bailo, M.; characterised by the accumulation of hyper-concentrated mucus in the small airways, leading to Reihill, J.A.; Crilly, A.; Lockhart, J.C.; Litherland, G.J.; Lundy, F.T.; persistent inflammation, infection and dysregulated protease activity.
    [Show full text]