Advances in Biochemistry 2013; 1(5): 73-80 Published online December 30, 2013 (http://www.sciencepublishinggroup.com/j/ab) doi: 10.11648/j.ab.20130105.11 In vitro processing of glutamyl endopeptidase proenzymes from Enterococcus faecalis and importance of N-terminal residue in enzyme catalysis Shakh M. A. Rouf 1, 2, *, Y. Ohara-Nemoto 1, T. Ono 1, Y. Shimoyama 3, S. Kimura 3, T. K. Nemoto 1 1Department of Oral Molecular Biology, Courses of Medical and Dental Science, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki 852-8588, Japan 2Department of Applied Nutrition & Food Technology, Islamic University, Kushtia-7003, Bangladesh 3Division of Molecular Microbiology, Iwate Medical University, Yahaba-cho 028-3694, Japan Email address: [email protected] (S. M. A. Rouf) To cite this article: Shakh M. A. Rouf, Y. Ohara-Nemoto, T. Ono, Y. Shimoyama, S. Kimura, T. K. Nemoto. In Vitro Processing of Glutamyl Endopeptidase Proenzymes from Enterococcus faecalis and Importance of N-terminal Residue in Enzyme Catalysis. Advances in Biochemistry. Vol. 1, No. 5, 2013, pp. 73-80. doi: 10.11648/j.ab.20130105.11 Abstract: Glutamyl endopeptidase from Enterococcus faecalis, designated SprE, is one of the important virulence factors secreted as zymogen. In the present study we expressed recombinant SprE proenzyme (pro-SprE) in Escherichia coli and investigated the in vitro processing to mature SprE. It was found that trypsin could efficiently produce the active form of SprE with the N-terminus Ser 1 through cleavage between Arg -1 and Ser 1 bond, which was subsequently auto-degraded into inactive species through the cleavage at the Glu 6-Asp 7 and Glu 11 -Val 12 bonds. Although thermolysin could produce SprE with the N-terminus Leu 2, but possessed no proteolytic activity. In contrast to the absolute requirement of the N-terminal Val 1 in staphylococcal glutamyl endopeptidases, the N-terminal Ser 1 of mature SprE could be substituted by other amino acids despite that Ser showed the maximal activity. Substitution of penultimate Leu 2 of SprE to Val 2 also reduced the activity to 40% of the wild type. Taken together, we conclude that pro-SprE was converted to mature form with the N-terminus Ser 1 by a protease with specificity of trypsin and the length of the N-terminal region rather than specific residue is absolutely required for enzyme activity. Keywords: Glutamyl Endopeptidase, Proenzyme Processing, Spre, Enterococcus faecalis , Gluv8 studies have been undertaken to investigate the possible role 1. Introduction of gelatinase and serine proteases in the disease processes Enterococcus faecalis is a gram-positive cocci and caused by E. faecalis and they were found to contribute to common inhabitant of human gastrointestinal and the pathogenesis through biofilm formation, facilitating genitourinary tract [1]. It causes a wide variety of diseases bacterial invasions, degradation of immune peptides in human, infecting the urinary tract, endocardium, abdomen, required for host response [7, 8, 9,10]. Gelatinase (GelE) biliary tract, burn wounds and indwelling foreign devices [2]. and serine protease (SprE) expressed in E. faecalis were In dentistry, E. faecalis has been associated with caries reported to be important for enterococcal virulence in mouse lesions, chronic periodontitis, recurrent root canal infection peritonitis model [11]. Previous studies also indicated that and persistent apical periodontitis [3, 4]. Candidate the presence of extracellular proteases, GelE and SprE, in virulence factors of E. faecalis include: cytolysin and the E. faecalis raised mortality in animal models [12, 13]. proteolytic enzyme (gelatinase and serine protease), Glutamyl endopeptidase (EC 3.4.21.19) from adhesions (aggregation substance, enterococci surface Staphylococcus aureus V8 strain (GluV8) is a serine protein or Esp, collagen adhesion protein or Ace, antigen A protease with unique substrate specificity to Glu-X and or EfaA) and capsular and cellular wall polysaccharides [2, Asp-X with the higher preference to the former [14,15]. This 5]. Serine protease, gelatinase and collagen-binding protein family protease from E. faecalis SprE, which has been (Ace) facilitate E. faecalis bind to dentin [6]. Several shown to contribute to pathogenesis in animal models [16, 11, 17]. Kawalec et al. [18] purified several isoforms of 74 Shakh M. A. Rouf et al.: In Vitro Processing of Glutamyl Endopeptidase Proenzymes from Enterococcus faecalis and Importance of N-terminal Residue in Enzyme Catalysis mature SprE, starting with N-terminal Ser 1and Leu 2 from Ac-Thr-Val-Ala-Asp-MCA (TVAD-MCA), wild-type E. faecalis OG1RF (TX4002) and a Z-Ala-Ala-Asn-MCA (AAN-MCA) and gelatinase-null mutant TX5264, among which SrpE starting Boc-Gln-Ala-Arg-MCA (QAR-MCA)from the Peptide with Ser 1was super active. Moreover, they suspected the Institute Inc. (Osaka, Japan);Leu-Asp-MCA (LD-MCA) and instability of active SprE (Ser 1-SprE form) apparently due to Z-Leu-Leu-Gln-MCA (LLQ-MCA), synthesized by Thermo auto-degradation. Fisher Scientific (Ulm, Germany); thermolysin from SprE shows sequence homology with GluV8 (27% Bacillus thermoproteolyticusrokko, trypsin procine pancreas, identity, 49% similarity) [19] and that from S. epidermidis bovine serum albumin (BSA), were from Sigma-Aldrich (St. (GluSE) (26% identity, 49% similarity) [20]. It has been Louis, MO, USA); and gelatin from the NacalaiTesque. Inc. reported that the proenzyme of GluV8 is processed by a (Osaka, Japan). thermolysin-family metalloprotease, aureolysin in vivo [21,22]. The prosequence of Staphylococcal GluV8-family 2.2. Expression Vector for the Expression of SprE protease was reported to sequentially remove to shorter The SprE gene was amplified by PCR using KOD Plus proenzymes in an autocatalytic manner by cleaving at Glu-X DNA polymerase and chromosomal DNA (0.1 µg) of E. and Gln-X in the prosegment and finally matured by -1 1 faecalis NCTC 775 as template. The synthetic aureolysin at N-terminal Asn -Val [23, 24]. Consistently oligonucleotides primers recombinant GluV8 expressed in E. coli was efficiently (5’-ATGGATCC AAAAAGTTCTCCATACGAAAAATTA processed to mature GluV8 by thermolysin in vitro [25]. 1 G-3') and Val is conserved at the N-termini of mature glutamyl (5’-GTGGATCC CGCTGCAGGCACAGCGGATAAACG- endopeptidases from Staphylococcus epidermidis [26, 27], 3') containing Bam HI sites (underlined) were designed on Staphylococcal warneri [28], Staphylococcal cohnii and the basis of the DNA sequence of SprE (GeneBank Staphylococcal caprae [29]. accession no. Z12296), used for SprE gene amplification. The N-terminus amino acid residue of mature PCR-amplified 0.8-kb fragment (without stop codon) was GluV8-family endopeptidases was found to be critical for cleaved with Bam HI, and then inserted into the Bam HI site maturation by aureolysin and for the stabilization of mature of pQE60 to yield pQE60-SprE expression vector. structure resistant to further processing at the Val 1-Ile 2 and Ile 2-Leu 3 bonds [25]. Furthermore, Val 1 is directly involved 2.3. Expression and Purification of Recombinant in the protease activity itself, because Val 1 cannot be Proteases substituted by other amino acids, even if the processing was correctly mediated with Arg -1-X1-substituted forms by In order to minimize the modification in the N-terminal trypsin (X=Ala, Phe, Gly and Ser) [25]. Exceptionally, the preprosequence of SprE, the expression vector pQE60 that Val 1 substitution to Leu 1 could partially (30%) retained encoded an affinity tag, [Gly-Ser-Arg-Ser-(His) 6] at the proteolytic activity of the wild type, further indicating the C-terminus was used (Fig. 1A). In addition Gly-Gly-Ser 1 derived from the vector was present between 1st-Met and significance of Val for the protease activity [29]. Sequence nd alignment indicates that Val 1 of GluV8 corresponds to Leu1 2 2 -Lys of the N-terminal prepropeptide. Escherichia coli of SprE, whereas it has been reported that SprE with XL1-blue was transformed with the pQE60-SprE expression N-terminal Leu 2 (Leu 2-SprE) had a significantly negligible plasmids. C-terminal His 6-tagged recombinant proteins activity compared to that with N-terminal Ser 1 [18]. were expressed and purified as described previously Moreover, the processing mechanism of pro-SprE still [25].Protein concentrations were determined by the remains unknown. Therefore, we here investigated the in bicinchoninic acid method using BSA as the standard vitro processing of pro-SprE expressed in E coli and (Pierce, Rockford, IL, USA). Purified proteins were stored addressed the roles of N-terminal amino acids in the enzyme at -80 ˚C until used. catalysis. 2.4. Amino Acid Numbering and In Vitro Mutagenesis 2. Materials and Methods The N-terminal Ser of the active SprE was numbered as the first amino acid residue (Ser1). In vitro mutagenesis was 2.1. Materials performed as reported previously [30] by PCR with mutated primer(s) to substitute 3 amino acids in the prosequence The materials used and their sources were as follow: (Glu -15 Ser, Glu -14 Lys, Glu -8Ile, designated as SprE-mut), 4 expression vector pQE60, from Qiagen Inc. (Chatsworth, amino acids in the mature region (Glu11Gln, Glu6Gln, CA, USA); low-molecular-weight markers, from GE Ser1Thr/Ala/Val and Leu2Val), and an essential Ser 180 to Ala. Healthcare (Buchinghamshire, England); restriction All mutations were confirmed by DNA sequencing. enzymes and DNA-modifying enzymes, from Nippon Gene (Tokyo, Japan); KOD Plus DNA polymerase, from Toyobo 2.5. SDS-PAGE and Zymography (Tokyo, Japan); Talon metal-affinity resin, from Clontech Laboratories Inc. (Palo Alto, CA, USA); Recombinant proteins (1 µg) were separated by Z-Leu-Leu-Glu-MCA (LLE-MCA), SDS-PAGE at a polyacrylamide concentration of 12.5% (w/v), and then stained with Coomassie Brilliant Blue Advances in Biochemistry 2013; 1(5): 73-80 75 (CBB). Band intensities wer quantified with Image J or thermolysin, expected that may induce processing at software [31].