Cross-Species Genomics Identifies TAF12, NFYC, and RAD54L As Choroid Plexus Carcinoma Oncogenes

Article

Cross-Species Genomics Identiﬁes TAF12, NFYC, and RAD54L as Choroid Plexus Carcinoma Oncogenes

Graphical Abstract Authors Yiai Tong, Diana Merino, ..., David Malkin, Richard J. Gilbertson

In Brief With the development of a choroid plexus carcinoma (CPC) mouse model and integrating cross-species genomic and functional analyses, Tong et al. identify TAF12, NFYC, and RAD54L as oncogenes in human and mouse CPC that are required to initiate and maintain the disease.

Highlights Accession Numbers d TAF12, NFYC, and RAD54L identiﬁed as CPC oncogenes GSE60899 d CPC arises from post-mitotic, differentiated choroid plexus epithelium d Dysregulation of DNA metabolism is a critical requirement for CPC development d CPC mouse model to study the biology and treatment of this aggressive disease

Tong et al., 2015, Cancer Cell 27, 712–727 May 11, 2015 ª2015 Elsevier Inc. http://dx.doi.org/10.1016/j.ccell.2015.04.005 Cancer Cell Article

Cross-Species Genomics Identiﬁes TAF12, NFYC, and RAD54L as Choroid Plexus Carcinoma Oncogenes

Yiai Tong,1 Diana Merino,5 Birgit Nimmervoll,1 Kirti Gupta,2 Yong-Dong Wang,3 David Finkelstein,3 James Dalton,2 David W. Ellison,2 Xiaotu Ma,3 Jinghui Zhang,3 David Malkin,5,6 and Richard J. Gilbertson1,4,* 1Department of Developmental Neurobiology 2Department of Pathology 3Department of Computational Biology 4Department of Oncology St Jude Children’s Research Hospital, 262 Danny Thomas Place, Memphis, TN 38105, USA 5Genetics and Genome Biology Program 6Division of Hematology/Oncology The Hospital for Sick Children, Department of Medical Biophysics, University of Toronto, Toronto, ON M5G 1X8, Canada *Correspondence: [email protected] http://dx.doi.org/10.1016/j.ccell.2015.04.005

SUMMARY

Choroid plexus carcinomas (CPCs) are poorly understood and frequently lethal brain tumors with few treatment options. Using a mouse model of the disease and a large cohort of human CPCs, we performed a cross- species, genome-wide search for oncogenes within syntenic regions of chromosome gain. TAF12, NFYC, and RAD54L co-located on human chromosome 1p32-35.3 and mouse chromosome 4qD1-D3 were identi- ﬁed as oncogenes that are gained in tumors in both species and required for disease initiation and progression. TAF12 and NFYC are transcription factors that regulate the epigenome, whereas RAD54L plays a central role in DNA repair. Our data identify a group of concurrently gained oncogenes that cooperate in the formation of CPC and reveal potential avenues for therapy.

INTRODUCTION silencing technologies have discovered TSGs within large deletions (Scuoppo et al., 2012; Xue et al., 2012; Zender et al., Various genetic alterations activate oncogenes or delete tumor 2008); but approaches to screen the oncogenic capacity suppressor genes (TSGs) in cancer. Recurrent mutations that of genes located within large regions of gain are less well disrupt the same gene can be highly informative, pinpointing developed. oncogenic alterations that may serve as therapeutic targets Choroid plexus carcinomas (CPCs) are highly malignant brain (Baselga et al., 1996; Druker et al., 2001; Flaherty et al., 2010). tumors that are characterized by gains of chromosomes 1, 2, 4, However, focal alterations are relatively infrequent in many can- 7, 12, 14, 19, 20, and 21, and numerous autosomal losses (Pau- cers, particularly those arising in children (Alexandrov et al., lus and Brandner, 2007; Rickert et al., 2002; Ruland et al., 2014). 2013; Zhang et al., 2012). Rather, these tumors contain large The great majority of CPCs are diagnosed in children aged less DNA copy number alterations (CNAs) that presumably drive than 3 years, two-thirds of whom die within 5 years (Wrede the overexpression of oncogenes or delete TSGs (Chen et al., et al., 2009). Efforts to identify more effective treatments of 2014; Downing et al., 2012; Johnson et al., 2010; Wu et al., CPC have been hindered by poor understanding of its pathogen- 2012). These CNAs are often chromosomal in scale, making it esis. Germline alterations of TP53, and possibly hSNF5/INI1, difﬁcult to identify which genes are driving transformation. RNA predispose to CPC in humans (Garber et al., 1991; Malkin

Signiﬁcance

Few recurrent point mutations or focal amplifications have been identified in whole genome sequencing studies of pediatric cancers. Rather, these tumors contain large chromosomal alterations encompassing tens to thousands of genes, rendering the identification of oncogenes difficult. Choroid plexus carcinomas (CPC) frequently gain chromosome 1 that encodes 2,100 genes. Using a combination of cross-species genomics and in vivo functional studies, we identified a syntenic fragment of chromosome 1p that is gained early in mouse CPC development, and that contains three oncogenes—Taf12, Nfyc, and Rad54l—required to initiate and progress the disease. This approach holds promise to pinpoint oncogenes within large regions of chromosomal gain and the associated dysregulated pathways that might serve as therapeutic targets.

712 Cancer Cell 27, 712–727, May 11, 2015 ª2015 Elsevier Inc. et al., 1990; Olivier et al., 2003; Se´ e´ venet et al., 1999; Tinat et al., 2005). Furthermore, gene set enrichment analysis (GSEA) iden- 2009) and ablation of Tp53 and/or Rb function causes CPCs in tified ‘‘Markers of Choroid Plexus’’ as the most enriched of mice (Brinster et al., 1984; Sa´ enz Robles et al., 1994). Deletion 4,293 gene sets in CPCs relative to mouse medulloblastoma, of PTEN has also been implicated in CPC, but the oncogenes brainstem and cerebellum (Figure 1Q; Table S1). Among the that drive this cancer have not been identified (Morigaki et al., choroid plexus derived tissues, CPCs were more closely related 2012; Rickert et al., 2002; Ruland et al., 2014). The goal of our to embryonic than adult choroid. Thus our mouse CPCs reca- study was to identify CPC oncogenes within large regions of pitulate the histological and ultrastructural features of the hu- chromosome gain. man disease and express an embryonic choroid plexus-like transcriptome. RESULTS Chromosome 1p31.3-ter Encodes Candidate CPC Tp53, Rb, and Pten Suppress CPC Oncogenes To better understand the cellular and molecular origin of CPC, we To identify genetic alterations that drive CPC, we used Affymetrix first developed a mouse model of the disease (Figure 1). Using in 6.0 DNA SNP microarrays to catalog CNAs in human choroid utero electroporation, we introduced Cre Recombinase into the plexus papillomas (CPPs, n = 32) and human CPCs (n = 23; Table hindbrain choroid plexus epithelium (CPE) of embryonic day (E) S2). We also performed microarray comparative genomic hy- 12.5 mice carrying various conditional alleles. At postnatal day bridization (aCGH) of 47 Tp53flx/flx; Rbflx/flx; Ptenflx/flx; ROSAYFP (P) 0, efficient recombination was evident in the CPE of mice car- mouse CPCs, including 12 primary tumors and serial secondary rying the ROSA-yellow fluorescence protein (ROSAYFP) lineage (n = 20) and tertiary (n = 15) orthotopic transplants of these tu- tracing allele (Figures 1A and 1B). YFP+ CPE cells expressing mors. Additionally, we sequenced the whole genomes (WGS) Transthyretin (Ttr), a marker of mature CPE (Harms et al., 1991), of four human CPCs and matched normal blood (>98% of the tu- were retained by adult RosaYFP mice that had been electropo- mor genome and >91% of the normal genome had 20-fold rated in utero with Cre Recombinase; but these mice never devel- coverage with high-quality sequence reads; see Supplemental oped tumors (total mice n = 7, Figures 1C–1E). In stark contrast, Experimental Procedures). No recurrent, single nucleotide varia- electroporation of Cre Recombinase into the hindbrain CPE of tions, insertion/deletions, or focal CNAs (less than 5 genes) were Tp53flx/flx; Rbflx/flx; Ptenflx/flx; ROSAYFP E12.5 embryos resulted identified in the four human CPCs subject to WGS, although one in CPCs within 220 days of postnatal life (penetrance, 38% [n = of these cases had extensive chromothripsis of chromosomes 1 26/69]; Figures 1F–1O). All tumors were YFP+, confirming their and 19 in the absence of a mutation in TP53 (Tables S3, S4, S5, origin from in utero Cre-recombined cells (Figures 1F and 1G). S6, and S7; Supplemental Experimental Procedures). However, Mouse CPCs recapitulated the morphology (admixed papillary as expected, human CPCs contained numerous, recurrent, and syncytial architecture and pleomorphic epithelioid cytology chromosomal gains and losses (Figure 2A). Similar non-random [Figure 1H]); differentiation state (relative decrease in Ttr chromosomal alterations were observed in mouse tumors, sug- expression and expression of cytokeratin 8 [Figures 1I and 1J]); gesting large CNAs are a primary oncogenic driver of CPC proliferation (high Ki67 and BrDU labeling index [Figure 1K]), (Figure 2B). and ultrastructural features (microvilli, intracellular tight junc- Because both human and mouse CPCs contained recurrent tions, and extensive basal membrane folding [Figures 1L and chromosomal CNAs, we looked for syntenic chromosome 1M]) of the human disease. Allele specific polymerase chain reac- fragments that were gained in tumors in both species since tions confirmed the deletion of Tp53, Rb, and Pten from these these might be enriched for oncogenes. Whereas 61% (n = tumors but not adjacent normal tissue (Figure 1N). 14/23) of human CPCs gained at least one whole copy Tp53 and Rb, but not Pten, have previously been shown to of chromosome 1 (encoding 2,100 genes), only one syntenic suppress CPC (Brinster et al., 1984; Sa´ enz Robles et al., 1994). fragment of chromosome 1 was gained in mouse CPCs (encod- Therefore, to better assess the role of Pten as a CPC TSG, we ing 671 genes; mouse chromosome 4qC6-qE2 [94,608,732- performed tumor surveillance studies of Tp53flx/flx; Rbflx/flx; 155,608,945]; syntenic with human chromosome 1p31.3-ter ROSAYFP (n = 68), Tp53flx;flx; Ptenflx/flx; ROSAYFP (n = 36) and [895,967- 67,594,220]; Figure 2C). Gain of 4qC6-qE2 was seen Rbflx;flx; Ptenflx/flx; ROSAYFP (n = 24) mice electroporated with in 50% (n = 6/12) of mouse CPCs and was retained through Cre Recombinase at E12.5. Only 10% (n = 7/68) of Tp53flx/flx; secondary and tertiary serial tumor transplants (Figure 2C). Rbflx/flx; ROSAYFP and no Tp53flx;flx; Ptenflx/flx; ROSAYFP or Only 3% (n = 1/32) of the more benign human CPPs gained chro- Rbflx;flx; Ptenflx/flx; ROSAYFP mice developed CPCs (Figure 1O). mosome 1. Thus human chromosome 1p31.3-ter / mouse chro- Thus, in our model, loss of both Tp53 and Rb is required to mosome 4qC6-qE2 (hereon, chr1p31.3-ter/4qC6-qE2) may generate CPC, and neither of these deletions can be substituted harbor oncogenes that drive aggressive choroid plexus tumors. by loss of Pten. However, deletion of Pten together with loss of Notably, gain of chr1p31.3-ter/4qC6-qE2 may be associated Tp53 and Rb significantly increases tumor penetrance. with dysfunctional TP53 since our mouse model is Tp53 null To further characterize our model, we compared the gene and chromosome 1 gain was significantly associated with expression profiles of Tp53flx/flx; Rbflx/flx; Ptenflx/flx; ROSAYFP mutant TP53 in human CPCs (Fisher’s Exact, p < 0.05; Figure 3; CPCs with those of other mouse hindbrain tumors and tissues Table S2). Similar analyses of other autosomal gains in human (Figure 1P). The transcriptomes of CPC and normal adult and CPCs including chromosomes 7 and 12 that are among the embryonic choroid plexuses co-clustered separately from most commonly gained chromosomes in the disease (Rickert those of medulloblastoma and normal embryonic and/or adult et al., 2002), failed to identify additional syntenic gains (Figures brainstem and cerebellum (Gibson et al., 2010; Uziel et al., 2D and 2E).

Cancer Cell 27, 712–727, May 11, 2015 ª2015 Elsevier Inc. 713 RosaYFP YFP : DAPI H & E Transthyretin receptor (Ttr) Tp53 Rb Pten A B cerebellum C D E N NT NT NT

IV WT WT choroid choroid plexus plexus WT brainstem normal P0 P0 4 mo 4 mo choroid plexus Tp53flx/flx ;Rbflx/flx ;Pten53flx/flx ; RosaYFP RC RC FGHIYFP normal cerebellum choroid RC cerebrum

choroid plexus carcinoma O 100 brainstem choroid plexus carcinoma Ttr 80

microvilli ival JKLMBrdU v 60

desmosomes

cent sur 40 r Rbflx/flx ;Ptenflx/flx (n=24)

Pe Tp53flx/flx ;Ptenflx/flx (n=36) p<0.0001 20 Tp53flx/flx ;Rbflx/flx (n=68) Tp53flx/flx ;Rbflx/flx ;Ptenflx/flx (n=69) tight jnc 0 folded BM 0 50 100 150 200 250 300 Ck8 Ki67 Time [postnatal days]

P eCB-3 aCP-2 aCP-3 aCP-4 eCB-1 eCB-2 eCB-4 eCP-3 aCP-1 eCP-1 eCP-2 CPC-5 CPC-1 CPC-2 CPC-3 CPC-4 CPC-6 CPC-7 CPC-8 CPC-9 eLRL-2 eLRL-1 eLRL-3 eLRL-4 CPC-11 CPC-10 CPC-12 CPC-13 P7 CB-1 P7 CB-2 P7 CB-3 P7 CB-4 P7 DBS-3 P7 DBS-2 P7 DBS-4 P7 DBS-1 SHH MB-2 SHH MB-1 SHH MB-4 SHH MB-5 SHH MB-6 SHH MB-3 SHH MB-7 SHH MB-8 WNT MB-1 WNT WNT MB-2 WNT WNT MB-3 WNT MB-4 WNT

tumor E16.5 tissue P7 tissue Adult tissue gene expression -30 3

Z-score

Q 0.8 Lein choroid plexus markers 0.7 NES=3.15 0.6 FDR Q <0.0001 0.5 0.4 0.3 0.2 0.1 enrichment score 0.0

0.2 CPC (positively correlated)

0.1 zero cross at 9993 0

-1 non-CPC (negatively correlated) -2 ranked list metric (signal2noise)

(legend on next page) 714 Cancer Cell 27, 712–727, May 11, 2015 ª2015 Elsevier Inc. To further resolve which of the 671 genes on chr1p31.3-ter/ 0.0005 Mann Whitney, relative to controls; Figures 4A and 4B). 4qC6-qE2 might be oncogenes, we integrated the copy In addition, significant DNA DSBs and gain of 4qC6-qE2 were number and expression of this region in human and mouse now detected in YFP+ CPE (both p < 0.05, Mann-Whitney; Fig- tumors to identify genes that were both gained and overex- ures 4A, 4C, and 4D). Interestingly, while high levels of aberrant pressed (Figure 3). Twenty-six percent of genes (n = 176/671) proliferation and gain of 4qC6-qE2 persisted in fully formed on human chromosome 1p31.3-ter were significantly overex- CPCs, DSBs were not detected in tumors (Figures 4B–4D). pressed in human tumors that gained this region (n = 9), relative Together, these data confirm that mouse CPCs develop from to those in which it was balanced or deleted (tumors, n = 25; mutated CPE and that gain of 4qC6-qE2 is a relatively early event log ratio R 2, p < 0.05 with Bonferonni correction). Mouse in the disease process, coinciding with choroid plexus hyperpla- CPCs that gained 4qC6-qE2 (n = 15) overexpressed 11% of sia and suggesting this region may contain oncogenes that play genes (n = 64/579 Affymetrix 430 microarray) in this region rela- a role in tumor initiation. tive to balanced mouse tumors (n = 5) and normal mouse choroid plexus (n = 7; log ratio R 2, p < 0.05 with Bonferonni Taf12, Nfyc and Rad54l Promote Aberrant Proliferation correction). Comparison of these human and mouse data re- of the Developing Choroid Plexus vealed a common set of 21 genes on chr1p31.3-ter/4qC6- Because gain of 4qC6-qE2 is an early event in CPC develop- qE2 that were both gained and overexpressed in human and ment, we reasoned that developing choroid plexus would be mouse CPCs, pinpointing these as ‘‘lead candidate’’ onco- an appropriate context in which to screen the transforming po- genes (Figure 3). tential of our 21 lead candidate oncogenes. To do this, we tested the capacity of each candidate to drive dysplasia and prolifera- Gain of Chromosome 4qC6-qE2 Is an Early Event in CPC tion of early postnatal CPE that is normally a single layer of Tumorigenesis post-mitotic cuboidal epithelium (Lehtinen et al., 2013). Plasmids Cancers accumulate genetic alterations sequentially, suggesting expressing green fluorescence protein (GFP) and a single lead these defects play temporally distinct roles during transforma- candidate oncogene each were co-electroporated into the hind- tion. Therefore, to enable appropriate investigation of our 21 brain CPE of separate cohorts of E12.5 embryos (five or more lead candidate oncogenes, we first determined when 4qC6- embryos/candidate, total n = 107 embryos; Figure 5A). Prolifer- qE2 is gained during mouse CPC development (Figure 4). ating CPE cells were labeled at E19.5 by maternal injection of Tp53flx/flx; Rbflx/flx; Ptenflx/flx; ROSAYFP mice were electroporated BrdU. The proportion of targeted and proliferating (GFP+/ in utero with Cre Recombinase exactly as described above. Mice BrdU+), relative to targeted but non-proliferating (GFP+/BrdUÀ), were then killed at P0, P21, or P35 two hours following injection CPE cells was calculated at P0. Five control mice were electro- with BrdU and their hindbrains subject to histologic study (four or porated with empty vector-GFP. more mice per time point). GFP+ cells were detected in all electroporated mice. Fewer One week following electroporation (P0), small areas of than 0.5% of electroporated (GFP+) CPE cells were proliferating dysplastic YFP+ CPE were visible in which the epithelium lost (BrdU+) in embryos that were electroporated with control its monolayer organization and decreased its expression of Ttr. plasmid or 13 of 21 lead candidate oncogenes (Figures 5A– However, significant proliferation (BrdU incorporation), DNA 5C). Expression of five other candidates (Cdc20, Stmn1, double strand breaks (DSB; gH2ax staining) and gain of 4qC6- Atp6v0b, Clspn, and Mier1) was associated with proliferation in qE2 (fluorescence in situ hybridization [FISH]) were not detected 0.5%–2% of GFP+ cells but did not alter choroid plexus (Figures 4A–4D). Three weeks later (P21), the amount of morphology (Figures 5B and 5C). In marked contrast, Taf12, dysplastic YFP+/TtrÀ CPE had clearly increased and significant Nfyc, and Rad54l induced CPE dysplasia and proliferation similar numbers of aberrantly proliferating YFP+/BrdU+ CPE were now to that observed following 4qC6-qE2 gain in Cre-electroporated detected relative to control mice (p < 0.05 Mann-Whitney; Fig- Tp53flx/flx; Rbflx/flx; Ptenflx/flx; ROSAYFP mice (compare Figures 4A ures 4A and 4B); however, neither DNA double stand breaks and 5B). Both Taf12 (23.2% ± 8.4SE BrdU+YFP+, p < 0.005 nor 4qC6-qE2 gain were apparent. By 6 weeks post-electropo- Mann-Whitney) and Nfyc (4.0% ± 2.0SE BrdU+YFP+, p < 0.05 ration (P35), the choroid plexus had undergone a dramatic Mann-Whitney) induced significant levels of CPE proliferation change: large regions of hyperplastic CPE were now visible, in relative to control transduced cells. Notably, we observed a which 20% ± 2.4SE of YFP+ CPE were proliferating (BrdU+,p< worse prognosis among patients whose CPCs expressed

Figure 1. A Mouse Model of CPC (A and B) Expression of the recombined ROSAYFP fluorescent lineage tracing allele in whole (A) and microscopic (B) preparations of postnatal day (P) 0 hindbrain choroid plexus following in utero electroporation with Cre-recombinase at embryonic day (E) 12.5 (scale bar represents 50 mm). (C–E) Recombined (C), but histologically normal (D) and Ttr+ (E) choroid plexus persisting in adult CPE (scale bar represents 15 mm). (F–M) In utero electroporation of the hindbrain choroid plexus of Tp53flx/flx; Rbflx/flx; Ptenflx/flx; ROSAYFP E12.5 embryos generated large YFP+ tumors (F and G) that recapitulate the histology (H); reduced Ttr (I) and increased Cytokeratin 8 (J) expression; high proliferation rate (K); and ultrastructural features (L and M) of human CPC (scale bar in F–K represents 20 mm; L and M, 2 mm). (N) Polymerase chain reactions of recombined (RC) alleles in mouse CPC (T) and intact (WT) alleles in normal tissue (N). (O) Kaplan-Meier survival curves of E12.5 mice harboring the indicate alleles that were Cre-electroporated in utero. (P) Unsupervised hierarchical clustering of gene expression profiles of mouse: CPC; E12.5 and adult CPE (eCP and aCP); WNT and Sonic Hedgehog (SHH) medulloblastomas; P7 dorsal brainstem (P7 DBS); P7 cerebellum (P7 CB); E12.5 cerebellum (eCB); and E12.5 lower rhombic lip (eLRL). (Q) GSEA of ‘‘Lein choroid plexus markers’’ in CPC reporting normalized enrichment score (NES) and the false discovery rate (FDR) Q value. See also Table S1.

Cancer Cell 27, 712–727, May 11, 2015 ª2015 Elsevier Inc. 715 A human choroid plexus tumor DNA profiles B mouse choroid plexus carcinoma DNA profiles papillomas carcinomas primary tumor secondary implant tertiary implant 1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 chromosome 9 chromosome 9 10 10 11 11 12 12 13 13 14 14 15 16 15 17 16 18 19 17 20 18 21 22 19

mouse syntenic human tumor DNA profiles C D tumor DNA profiles

papilloma carcinoma primary 1’ implant 2’ implant 5 mouse syntenic 6 human tumor DNA profiles 12 tumor DNA profiles 6 9 13 papilloma carcinoma primary 2’ implant 3’ implant 11 5

5 4 6 5 qC6-qE2 12 human chromosome 7 6 3 6 5 5 3 12

mouse syntenic E human tumor DNA profiles tumor DNA profiles

papilloma carcinoma primary 1’ implant 2’ implant 3 6 human chromosome 1

1 15

11 human chromosome 12 8 13 1

DNA copy number 5 <0.52 >5

Figure 2. Cross-Species Analysis of Syntenic Chromosomal Gains in Human and Mouse CPC (A and B) Heatmaps of genomewide DNA copy number alterations in human CPPs and CPCs (A) and mouse CPCs (B). (C–E) Heatmaps of the copy number of chromosome 1 (C), 7 (D), and 12 (E) in human CPPs and CPCs (left in each ﬁgure) and the corresponding syntenic regions in mouse CPCs (right in each ﬁgure). See also Tables S2, S3, S4, S5, S6, and S7. relatively high levels of RAD54L (Figure S1). Therefore, in light of Taf12, Nfyc, and Rad54l Maintain CPC these data, we selected Taf12, Nfyc, and Rad54l for further study Next, we tested whether Taf12, Nfyc, and/or Rad54l are required as potential CPC oncogenes. to maintain CPC cells both in vitro and in vivo. To ablate the

716 Cancer Cell 27, 712–727, May 11, 2015 ª2015 Elsevier Inc. Figure 3. A Common Set of 21 Syntenic Genes Gained and Overexpressed on 1p31.3-ter in Human and 4qC6-qE2 in Mouse, CPC Top: heat maps of human chromosome 1 copy number in 34 human CPCs and CPPs (left), and mouse chromosome 4qC6-qE2 in 27 mouse CPCs and normal choroid (right). Middle: TP53 status and tissue type of each sample. Bottom: heat maps reporting the expression of 21 copy-number driven orthologs located on human chromosome 1p31.3-ter in the 34 human tumors (left) and 27 mouse CPCs and normal choroid (right). Dotted lines demarcate the results of independent microarray probes for each human and mouse ortholog. Gene symbols are shown on the right. See also Figure S1.

cells also survived longer than control animals (n = 5, median survival 29 days, p = 0.05 log rank). Thus, expression of Taf12, Nfyc, and Rad54l appears to support optimal growth of CPC cells, supporting the notion that they are oncogenes.

Taf12, Nfyc, and Rad54l Are Required to Initiate CPC Because gain of 4qC6-qE2 coincided with the onset of severe hyperplasia in expression of these candidate oncogenes, we generated three our mouse model (Figure 4), we next tested whether the expres- shRNA-green fluorescence protein (GFP) lentiviruses against sion of our candidates is required to initiate CPC. Cre Recombi- each candidate. We also generated mismatch-control shRNAs nase was electroporated into the hindbrain choroid plexus of (controlshRNA) for Taf12, Nfyc, and Rad54l (one per candidate) E12.5 Tp53flx/flx; Rbflx/flx; Ptenflx/flx; ROSAYFP mouse embryos in which five bases of each shRNA sequence were mutated to exactly as described above, but this time we simultaneously in- reduce target homology. Finally, shRNAs targeting two ‘‘control’’ jected the IV ventricle of these embryos with either Taf12shRNA genes (Pqlc2 and Mier1) on chr1p31.3-ter/4qC6-qE2 that did not (n = 6 mice) NfycshRNA (n = 13 mice), Rad54lshRNA (n = 10 mice) induce dysplasia or aberrant proliferation of developing CPE or controlshRNA (n = 12 mice) lentivirus. Remarkably, whereas were also generated (Figure 5C). 42% (n = 5/12) of Cre-electroporated mice injected with con- Greater than 90% of mouse primary CPC cells were transduced trolshRNA developed CPCs, injection of either Taf12shRNA or following exposure to lentiviruses in vitro, resulting in R50% NfycshRNA lentiviruses completely abolished CPC development knockdown of the corresponding target gene relative to con- and only 10% (n = 1/10) of mice receiving Rad54lshRNA lentivi- trolshRNA transduced cells (Figure 6A). Ablation of either ruses developed tumors (p < 0.05 log rank; Figure 6E). To Rad54lshRNA or Taf12shRNA induced significant Caspase 3/7 activity confirm that the choroid plexus of mice injected with active in mouse CPC cells and dramatically reduced the survival of these shRNAs underwent Cre-recombination and viral transduction, cells in culture relative to controlshRNA, Pqlc2shRNA,orMier1shRNA we reviewed the hindbrains of these animals after R100 days. transduced cells (Figures 6B and 6C). In contrast, knockdown of Several of these mice contained hyperplastic but histologically Nfyc did not affect apoptosis or survival of CPC cells in vitro. benign choroid plexus masses containing numerous YFP+ To test if Taf12, Nfyc, and Rad54l maintain CPC cells in vivo, (Cre-recombined) and GFP+ (shRNA transduced) cells (Fig- we transduced primary CPC cells with Taf12shRNA, NfycshRNA, ure 6F), suggesting that expression of shRNAs had arrested Rad54lshRNA, or controlshRNA and transplanted them orthotopi- CPC development. These data provide compelling evidence cally into the hindbrains of immunocompromised mice (Fig- that expression of Taf12, Nfyc,orRad54l is critical for the initia- ure 6D). In agreement with our in vitro data, the median survival tion of CPC. of mice harboring Taf12shRNA (n = 6, median survival 34 days) or Rad54lshRNA (n = 8, median survival 55.5 days) transduced CPC Upregulation of Taf12, Nfyc, and Rad54l Drives CPC cells was significantly longer than mice injected with controlshRNA Having shown that loss of Taf12, Nfyc,andRad54l expression transduced CPC cells (n = 19, median survival 19 days; p < 0.005 markedly impairs CPC initiation and maintenance, we conducted log rank; Figure 6D). Mice harboring NfycshRNA transduced CPC two sets of experiments to test whether overexpression of these

Cancer Cell 27, 712–727, May 11, 2015 ª2015 Elsevier Inc. 717 A

Figure 4. Serial Analysis of Choroid Plexus Transformation in Mice (A) In utero electroporation of the hindbrain choroid plexus of Tp53flx/flx; Rbflx/flx; Ptenflx/flx; ROSAYFP E12.5 embryos resulted in progressive expansion of YFP+ choroid plexus (top row, scale bar represents 50 mm) that displayed: dysplasia (second row, hematoxylin and eosin [H&E]; dotted line and arrows indicate disruption of normal single layer epithelium; scale bar represents 10 mm); loss of Ttr expression (third row, in situ hybridization; scale bar represents 20 mm) and increasing proliferation (fourth row, nuclear BrdU incorporation marked with arrows [note dotted line encompasses same region in P0 H&E stain]; scale bar represents 10 mm); accumulation of DNA DSB (gH2ax stain marked with arrows; scale bar represents 10 mm); and gain of 4qC6-qE2 (note two separate FISH probes used targeting Stmn1 and Cdca8 relative to control Baat at 4qB1). (B–D) Graphs to the right report the quantification of BrdU incorporation (B), gH2ax stain (C), and gain of 4qC6-qE2 (D) in recombined (YFP+) cells. Error bars represent mean ± SE. Mann Whitney, *p < 0.05, ***p < 0.0005. genes might promote disease initiation and/or progression. First, Ptenflx/flx; ROSAYFP E12.5 embryos. The tumor-free survival of we tested if IV ventricular co-injections of Taf12-cop(c)GFP, Nfyc- Cre-electroporated and lentivirus injected mice was significantly cGFP,andRad54l-cGFP expressing lentiviruses (1.67 3 105 len- reduced relative to that of mice that were Cre-electroporated tiviral particles each per mouse, total = 5 3 105 particles) alters alone (Figure 7A; log rank p < 0.05). Mice that were injected CPC disease course in Cre-electroporated Tp53flx/flx; Rbflx/flx; with Taf12-cGFP, Nfyc-cGFP,andRad54l-cGFP lentiviruses but

718 Cancer Cell 27, 712–727, May 11, 2015 ª2015 Elsevier Inc. A

Figure 5. Functional In Utero Assessment of 1p31.3-ter/4qC6-qE2 Candidate CPC Oncogenes (A) E12.5 choroid plexus was co-electroporated with plasmids encoding candidate and GFP to identify electroporated cells. Gels below show seven examples of 21 reverse-transcriptase (RT) PCR results of cells transfected with control plasmid or oncogene candidates with or without RT. (B) Sections from each animal were analyzed both for morphological change (top, H&E) and proliferation of electroporated cells (bottom, BrdU+/GFP+; scale bar represents 10 mm). Only Taf12, Nfyc, and Rad54l demonstrated dysplasia and aberrant proliferation relative to the other 18 candidates, Pgd shown as an example. (C) Graph reporting the percentage of electroporated (GFP+) and proliferating choroid plexus epithelium cells. Error bars represent mean ± SE. *p < 0.05, **p < 0.005, Mann-Whitney.

Cancer Cell 27, 712–727, May 11, 2015 ª2015 Elsevier Inc. 719 A BC

D E

Figure 6. Taf12, Nfyc, and Rad54l Are Required to Initiate and Maintain CPC in Mice (A) Reverse-transcriptase PCR of CPC cells transduced with control or gene targeted shRNA lentivirus. (B) In vitro survival of CPC cells transduced with the indicated shRNA lentivirus. ***p < 0.0005, relative to controlshRNA cells. Error bars represent mean ± SE. (C) Caspase 3/7 assays of control and shRNA-transduced CPC cells. Error bars represent mean ± SE. *p < 0.05, relative to controlshRNA cells. (D) Kaplan-Meyer survival curves of mice implanted with CPC cells transduced with the indicated shRNA lentiviruses. *p < 0.05, **p < 0.005, ***p < 0.0005, Log- Rank relative to controlshRNA mice. (E) Kaplan-Meyer survival curves of Tp53flx/flx; Rbflx/flx; Ptenflx/flx; ROSAYFP mice electroporated at E12.5 with Cre-recombinase and simultaneously injected in the hindbrain with the indicated shRNA (p < 0.05, log-rank comparison of the three survival curves). (F) Morphology (H&E), lentiviral transduction (GFP), and Cre-recombination (RosaYFP) of hyperplastic choroid plexus mass in adult Tp53flx/flx; Rbflx/flx; Ptenflx/flx; ROSAYFP mouse electroporated at E12.5 with Cre-recombinase and simultaneously injected in the hindbrain with Taf1shRNA (scale bar represents 20 mm). were not Cre-electroporated contained numerous cGFP+ CPE As a further test of whether upregulation of Taf12, Nfyc, and cells but did not develop CPCs (total mice n = 7, median follow Rad54l can cooperate with TSG deletion to drive CPC, we gener- up 374 days; Figure 7A). Thus, increased expression of Taf12, ated a variant of our mouse model in which we titrated the Nfyc,andRad54l significantly accelerates CPC development in amount of Tp53, Rb, and Pten deletion using a Cre Recombi- Tp53, Rb, Pten deleted CPE, but is not sufficient to initiate the dis- nase-cGFP (Cre-cGFP) lentivirus. In utero injection of 5.0 3 105 ease. These data are compatible with the observation that 4qC6- Cre-eGFP lentiviral particles into the IV ventricle of E12.5 qE2 is gained following deletion of Tp53, Rb, Pten, but precedes Tp53flx/flx; Rbflx/flx; Ptenflx/flx; ROSAYFP mice resulted in highly CPE transformation (Figures 4A and 4D). penetrant YFP+ (recombined) cGFP+ (lentiviral transduced)

720 Cancer Cell 27, 712–727, May 11, 2015 ª2015 Elsevier Inc. CPCs (86%, n = 6/7; Figures 7B and 7C). In contrast, injection of 0.4 mM AZ-20 that inhibited their growth by 90%, increased the just 1.25 3 105 Cre-cGFP lentiviral particles yielded no tumors; induction of DNA DSB in these cells >3-fold after only 6 hours; although these mice did retain YFP+/cGFP+ co-expressing however, this concentration of AZ-20 had no impact on ependy- CPE cells and some developed hindbrain choroid plexus hyper- moma cell proliferation or DSB formation (Figures 8C and 8D). plasia (n = 8, median follow up 381 days; Figures 7B and 7C). Importantly, although sensitivity to ATR inhibitors may vary Thus, lentiviral delivery of Cre-recombinase serves as a titratable with basal levels of replicative stress; CPC cells proliferated alternate to electroporation for inducing CPCs in our model slightly slower that ependymoma cells (doubling time 25.7 hr ± system. 1.2SD CPC versus 19.6 hr ± 1.7SD ependymoma) and no signif- Because 1.253x105 Cre-cGFP viral particles failed to icant difference in replication stress was detected between un- generate CPCs in E12.5 Tp53flx/flx; Rbflx/flx; Ptenflx/flx; ROSAYFP treated CPC and ependymoma cells (Figure 8D). These data mouse embryos, we tested if concurrent delivery of Taf12- support the hypothesis that gain of TAF12, NFYC, and RAD54L cGFP, Nfyc-cGFP, and Rad54l-cGFP lentiviruses might coop- on chr1p31.3-ter/4qC6-qE2 promotes aberrant DNA mainte- erate with this level of recombination to promote tumorigenesis. nance and repair during CPC formation and suggest that inhibi- Seventy-five percent (n = 9/12) of E12.5 Tp53flx/flx; Rbflx/flx; tion of this activity may have therapeutic potential. Ptenflx/flx; ROSAYFP mouse embryos injected with 1.25x105 Cre-eGFP lentiviral particles and an equal mix of Taf12-cGFP, DISCUSSION Nfyc-cGFP, and Rad54l-cGFP (3.75 3 105 particles) developed YFP+/cGFP+ CPCs (total viral particles 5.0 3 105 per mouse; Fig- Using a combination of cross-species genomics and in vivo ures 7B and 7C). In situ hybridization and immunofluorescence mouse modeling, we describe a mouse model of CPC; demon- analysis of these tumors confirmed high-level co-expression of strate that postnatal CPE from which TSGs have been deleted Taf12, Nfyc, and Rad54l (Figure 7E). To control for the possibility in utero can generate these tumors; identify three oncogenes— that high viral titers (5 3 105 particles) are non-specifically trans- TAF12, NFYC, and RAD54L—that are required to initiate and forming, we repeated our experiments but this time co-injected maintain the disease; and implicate upregulation of DNA mainte- 1.25 3 105 Cre-cGFP lentiviral particles with 3.75 3 105 particles nance and repair as a critical requirement for CPC formation. of a single candidate (Taf12-cGFP, total viral particles 5 3 105 How might concurrent gain of TAF12, NFYC, and RAD54L per mouse). These mice also developed CPC, but at a signifi- contribute to CPC formation? Both TAF12 and NFYC are his- cantly lower penetrance than animals receiving all three onco- tone-fold domain containing transcription factors (Bieniossek gene candidates (22%, n = 2/9; Figure 7C). Similar experiments et al., 2013; Nardini et al., 2013). TAF12 recruits GADD45, and showed that Taf12, Nfyc, and Rad54l can also drive CPC in thereby the nucleotide excision repair machinery, to the pro- postnatal choroid plexus (Figure 7D). Together with our cross- moter of active genes, removing methylated cytosines and main- species genomic and in vivo gene knockdown studies, these taining a hypomethylated active state (Schmitz et al., 2009). data comprehensively validate Taf12, Nfyc, and Rad54l as Transcriptional regulation by TAF12 is thought to contribute to CPC oncogenes and support the notion that concurrent gain of transformation, possibly by promoting an invasive phenotype these three genes on chr1p31.3-ter/4qC6-qE2 cooperates with (Voulgari et al., 2008). NFYC is also engaged in chromatin re- deletion of Tp53, Rb, and Pten in the initiation and progression modeling, establishing permissive chromatin modifications at of CPC. CCAAT promoters, including those of cell cycle regulators (Be- natti et al., 2011; Nardini et al., 2013). Deletion of NFYC or the Aberrant DNA Metabolism Is a Significant Feature related gene NFYB, halts cell cycle progression, predominantly of CPC by causing a G2/M arrest (Benatti et al., 2011). Thus, upregula- TAF12, NFYC and RAD54L are key regulators of DNA meta- tion of TAF12 and NFYC might promote an aberrant epigenome bolism, suggesting that dysregulation of DNA maintenance during CPE transformation, maintaining or re-activating the and/or repair are necessary for CPC formation (Benatti et al., expression of proto-oncogenes that are normally silenced in 2011; Nardini et al., 2013; Schmitz et al., 2009; Wright and Heyer, post-mitotic, postnatal choroid plexus. This notion is supported 2014). As a first step to test this, we used GSEA to compare the by our observation that the CPC transcriptome most closely transcriptomes of mouse E12.5 CPE with those of daughter matches embryonic CPE. RAD54L plays a central role in homol- CPCs, and measured the sensitivity of CPC cells to two separate ogous recombination in which damaged DNA—particularly inhibitors of the ataxia telangiectasia and Rad3-related protein DSBs—are repaired by copying an intact homologous sequence (ATR) kinase that regulates DNA repair, including DSBs (Somyajit (Wright and Heyer, 2014). Loss of Rad54l from Tp53 and LigIV et al., 2013). In keeping with our hypothesis, numerous gene sets null cells results in the accumulation of DSBs, severe chromo- that maintain the integrity of the genome and epigenome were somal defects, and failed cell proliferation (Mills et al., 2004). significantly upregulated in CPC (Figures 8A and 8B; Table S1). Therefore, upregulation of RAD54L may be required for CPE to As expected, Rad54l was the most upregulated homologous tolerate the severe genotoxic stress that is associated with repair gene (Figure 8B). Notably, DNA replication and repair rampant proliferation in the context of accumulating chromo- gene sets were also enriched in human CPCs that are diploid somal insults. Our observations that Tp53/Rb/Pten null CPE for chromosome 1, suggesting dysregulation of these cell func- accumulate DSBs that apparently resolve following the gain of tions are a general feature of CPC (Table S8). 4qC6-qE2, and that CPC transcriptomes are markedly enriched Finally, CPC cells proved remarkably sensitive to ATR inhibi- for DNA repair genes, supports this concept. tors in vitro relative to cells from an unrelated mouse brain tumor In light of our data, we propose a hypothesis for the develop- model of ependymoma (Figure 8C). Exposure of CPC cells to ment of CPC; particularly in patients with germline mutations in

Cancer Cell 27, 712–727, May 11, 2015 ª2015 Elsevier Inc. 721 A

C E

Figure 7. Taf12, Nfyc, and Rad54l Expression Promote CPC in Mice (A) Kaplan-Meyer survival curves of Tp53flx/flx; Rbflx/flx; Ptenflx/flx ; ROSAYFP mice injected in the hindbrain at E12.5 with Taf12-, Nfyc-, and Rad54l-expressing lentiviruses following sham (no Cre) or Cre-electroporation (Cre). Survival of Cre-electroporated mice not receiving lentivirus is also shown (Cre only).

(legend continued on next page)

722 Cancer Cell 27, 712–727, May 11, 2015 ª2015 Elsevier Inc. TP53 (Figure 8E). We propose that the loss of TP53 (and poten- mani et al., 2003; Currle et al., 2005; Huang et al., 2009; Hunter tially RB and PTEN) from CPE results in the accumulation of ge- and Dymecki, 2007; Lehtinen et al., 2013) and fully differentiated, netic and epigenetic changes that disrupt terminal differentiation post-mitotic, Ttr+ progeny that populate the CPE. Our serial his- and senescence. Early in postnatal life, these aberrantly prolifer- tologic review of Cre-recombined CPE revealed multiple sto- ating CPE cells develop increasingly abnormal genomes leading chastic regions of proliferative and dysplastic CPE sandwiched to genotoxic crisis. While most of these cells undergo cell death, between otherwise normal regions of mature CPE, favoring presumably through TP53-independent mechanisms, a fraction mature, post-mitotic CPE as the origin of tumors. acquire aberrant DNA repair and epigenome remodelling capac- Finally, our syntenic mapping approach holds promise to iden- ity, including gain of TAF12, NFYC, and RAD54L. This enables tify oncogenes located within large regions of chromosomal gain them to tolerate an aberrant but stable genome and drive further in other cancers. Indeed, emerging evidence suggests that large transformation. The advantage afforded by these genes pro- CNAs characteristic of other pediatric solid tumors are replicated vides a selective pressure for retention of chr1p31.3-ter/4qC6- when these tumors develop in other species (Chen et al., 2013; qE2 gain. These mutant CPE cells go on to form CPCs that Frappart et al., 2009). Similar studies of syntenic regions of can tolerate the recurrent and extensive chromosome changes loss coupled with RNA silencing technologies could be applied associated with the disease. Thus, the concurrent gain of to discover TSGs (Scuoppo et al., 2012; Xue et al., 2012; Zender TAF12, NFYC, and RAD54L may serve to model an aberrant epi- et al., 2008). genome that promotes a proliferative, and relatively undifferenti- ated state (TAF12 and NFYC) while tolerating genotoxic stress EXPERIMENTAL PROCEDURES (RAD54L). Interestingly, recent data indicate that CPCs that do not gain chromosome 1 retain both copies of this chromosome Mouse Tumorigenesis Studies in an otherwise hypodiploid genome (Merino et al., 2014). All in vivo experiments were performed in accordance with protocols that were reviewed and approved by the St. Jude Children’s Research Hospital Animal Thus, absolute or relative gain of this chromosome might be Care and Usage Committee. Mice harboring conditional floxed alleles of required for CPC development. Tp53, Rb, Pten, and ROSAYFP (Chow et al., 2011) were housed and studied Our demonstration that increased expression of Taf12, Nfyc, under St. Jude IACUC approved protocols. The choroid plexuses of E12.5 and Rad54l induce dysplasia and aberrant proliferation in other- mouse embryos were electroporated in utero using pcDNA3.1 plasmids en- wise wild-type CPE, support the notion that these are CPC coding Cre-Recombinase, GFP, and/or candidate oncogenes exactly as we oncogenes. However, the dependency of transforming cells described previously (Gibson et al., 2010). Electroporation was performed us- on aberrant DNA repair may also occur in the context of non- ing a CUY-21 electroporator (Nepa Gene Do.) with five 50-ms pulses of 50 V with 950-ms intervals. Actively proliferating CPE and CPC cells were labeled oncogene addiction (Luo et al., 2009). Thus, CPCs might be in vivo by injection of 0.1mg/kg bromodeoxyuridine (BrdU, Sigma-Aldrich) 2 ‘‘addicted’’ to RAD54L, and/or the targets of TAF12 and NFYC hours prior to killing the animals. Lentiviruses encoding the cDNA of Cre- chromatin remodelling, as non-oncogenes. Regardless of the Recombinase, Taf12, Rad54l,orNfyc, or shRNAs targeting these genes (three underlying mechanism, validation of aberrant DNA repair as a shRNAs per gene designed using http://dharmacon.gelifesciences.com) were requirement for CPC formation and maintence could lead to cloned into lentiviruses, packaged, titrated and injected in utero into the em- new therapies, because inhibition of DNA repair enzymes bryonic IV ventricle exactly as we described previously (Robinson et al., 2012). Mismatch control shRNAs were generated by mutating five bases within should result in intolerable DNA damage. Precedent for this the 21-mer sequence of each shRNA. Orthotopic implants of CPCs were approach exists in the addiction of BRCA2 mutant cells to the generated by injecting the hindbrains of 5- to 6-week-old female CD1 nude DNA repair enzyme PARP1 and our demonstration that CPC mice (http://www.criver.com) with 5 3 106 CPC cells transduced with control cells are sensitive to ATR inhibitors (Sakai et al., 2008). As well or shRNA-lentivirus suspended in 10 ml Matrigel. CPC cells were injected into as suggesting potential drug targets within DNA repair path- IV ventricle through cisterna magna using Hamilton syringe. ways, our data show that inhibitors of phosphatidylinositol- 4,5-bisphosphate 3-kinase (PI3K) signaling (suppressed by Immunohistochemistry and In Situ Hybridization PTEN) might also serve as new CPC treatments. However, Formalin fixed and paraffin embedded mouse CPCs (or for ATR inhibitor studies, cytospins of cultured CPC cells) were stained with standard immunohistochem- translating these and other potential new therapies to the clinic ical approaches using rabbit polyclonal antibodies to Ki67 (Vector Labs), Phos- for CPC has proved immensely challenging since fewer than 50 pho-Histone H2A.XSer139 (Cell signaling), GFP (Invitrogen), copGFP (Evrogen); or children are diagnosed with this disease in the United States mouse monoclonal antibodies to BrdU (Sigma-Aldrich), Taf12, Nfyc, or Rad54l each year (CBTRUS, 2006; Paulus and Brandner, 2007). There- (Abcam). For immunofluorescence staining, second antibodies were conju- fore, rigorous preclinical studies using our faithful model of CPC gated with either Alexa488 or Alexa 594 and sections mounted with Vectashield could help discover, triage and prioritize potential new therapies mounting medium containing DAPI (Vector Laboratories). In situ hybridization (ISH) was performed using standard approaches for clinical trial. and probes generated using the open reading frames of Taf12 (cDNA clone Our model also provides a useful system to study the origin of MGC:30438 IMAGE:3493047), Nfyc (cDNA clone MGC:28940 IMAGE: CPC. There are at least two candidate cells of origin of CPC: CPE 4009737), Rad54l (cDNA clone MGC:13963 IMAGE:3987790), and Ttr (generous progenitors located near the anterior lower rhombic lip (Awatra- gift of Dr. Edwin Monuki, IMAGE clone 1078224, accession Number AA822938).

(B) Left: macroscopic, direct YFP fluorescence of the hindbrains of adult Tp53flx/flx; Rbflx/flx; Ptenflx/flx; ROSAYFP mice receiving hindbrain injections of the indicated lentivirus at E12.5. Right: images of H&E-stained or immunofluorescence-stained sections of the corresponding hindbrain, left (scale bars represent 50 mm). (C and D) Kaplan-Meyer survival curves of Tp53flx/flx; Rbflx/flx; Ptenflx/flx; ROSAYFP mice injected in the hindbrain at E12.5 (C) or P1 (D) with the indicated lentiviruses. Statistics report the log-rank comparison of the survival curves. (E) In situ hybridization (top and middle) and immunofluorescence (bottom) of Taf12, Nfyc, and Rad54l expression in CPCs induced by lentiviral injection. All scale bars represent 50 mm.

Cancer Cell 27, 712–727, May 11, 2015 ª2015 Elsevier Inc. 723 A B E12.5 choroid plexus carcinoma CPE Kauffmann DNA repair genes Rad54l 0.5 Rad51 NES=2.55 Rpa2 0.4 Rad51c FDR Q <0.0001 Eme1 genes=212 Rad54b 0.3 Mre11a Pold1 0.2 Brca2 Pold2 0.1 Bpa1 enrichment score Xrcc2 0.0 Nbn Rad50 Xrcc3 Rpa3 Top3a Blm CPC (positively correlated) Pold4 0.2 Mus81 NES=2.34 Rad51b FDR Q <0.0001 0.1 Ssbp1 zero cross at 9861 gene expression 0 shem1 Rad52 +30 -3 -1 Rad51d E12.5 CPE (negatively correlated) Kegg Homologous Recombination Pold3 -2 Top3b Z-score ranked list metric (signal2noise)

C E 100- normal choroid plexus AZ-20 epithelium 80-

Tp53 Rb/Pten 60- 0.11μM 2.3μM ( ) deletion 40- dysplastic choroid plexus

percent activity 20- epithelium

0- ? additional epigenetic/genetic 0.001 0.010.1 1 10 concentration [μM] alterations

100- VE-821 dysplastic & proliferative 80- choroid plexus epithelium 60- 0.13μM 40- ‘genotoxic failure to activate crisis’ aberrant DNA repair 20- percent activity and/or an aberrant NA epigenome 0- 0.001 0.010.1 1 10 oncogene and ‘non- concentration [μM] oncogene’ addiction including gain of RAD54L CPC ‘Failed’ transformation Ependymoma TAF12, NFYC D

40 CPC DNA damage & Ependymoma chromosomal polyploidy SE *** 30 ? additional epigenetic/genetic alterations stable ‘aberrant’ genome 20 chromosome instability H2ax positive nuclei+

γ 10 choroid plexus carcinoma ‘stable’ aberrant genome percent 0 aberrant DNA repair aberrant DNA 0 0.5 6 24 48 aberrant proliferation Time post treatment AZ-20 [hours]

Figure 8. DNA Repair Is Upregulated in CPC (A) GSEA of ‘‘Kauffmann DNA Repair Gene’’ set in CPC versus E12.5 CPE. (B) Heat map reporting the GSEA of the ‘‘Kegg Homologous Repair Gene’’ set in CPC versus E12.5 CPE. (C) Growth inhibition assays of mouse CPC and ependymoma (Johnson et al., 2010) cells following 72 hr exposure to the ATR inhibitors AZ-20 and VE-821. Error bars represent mean ± SE. (D) Quantiﬁcation of DNA DSBs in the CPC and ependymoma cells shown in C, both before (time 0) and at the indicated times following exposure to 0.4 mM AZ-20. Error bars represent mean ± SE. See also Table S8.

724 Cancer Cell 27, 712–727, May 11, 2015 ª2015 Elsevier Inc. Dual-color fluorescence in situ hybridization (FISH) to estimate DNA copy AUTHOR CONTRIBUTIONS number was performed on 5 mm paraffin-embedded tissue sections with BAC clones encoding Baat, Cdca8, and Stmn1 (BACPAC Resources). Probes Y.T. conducted the great majority of the in vivo mouse work and mouse tumor were labeled with either AlexaFluor-488 or AlexaFluor-555 fluorochromes and studies. D.M. completed the great majority of the human genomic studies that nuclei were counterstained with DAPI (Vector Laboratories). were supervised by D. Malkin. B.N. was responsible for the CPC tumor serial transfer experiment. K.G. and D.W.E. performed all neuropathological reviews RNA and DNA Microarray Analysis of CPCs. Y.-D.W. and D.F. contributed to the mouse genomic studies. J.D. Human CPCs and CPPs and associated clinical data were collected from in- contributed to the FISH analyses. X.M. completed the next generation stitutions in Canada, USA, Brazil, Israel, and Germany in accordance with sequencing assays and analyses. R.J.G. conceived and supervised the entire each institution’s Research Ethics Board. Informed consent was obtained research project including the cross-species genomics analyses. All authors from the parents/legal guardians of all patients. In addition, the research con- participated in the preparation of the manuscript. ducted using these samples was reviewed by St. Jude Children’s Research Hospital Institutional Review Board and/or were appropriate the Hospital for ACKNOWLEDGMENTS Sick Children’s Research Ethics Board. DNA was isolated from both human and mouse tumors and tissues using standard phenol-chloroform. RNA was This work was supported by grants from the NIH (R01CA129541, isolated using TRIzol (Invitrogen). Gene expression profiles of human and P01CA96832, and P30CA021765 to R.J.G.), the Department of Defense mouse RNAs were generated using GeneChip Human Exon 1.0ST and (W81XWH-10-1-0674), and by the American Lebanese Syrian Associated 430v2 microarrays, respectively (Affymetrix). Gene expression data were Charities. We are grateful to the staff of the Hartwell Center for Bioinformatics normalized and analyzed to detected significantly differentially expressed and Biotechnology, the Cell and Tissue Imaging Shared Resource, and the genes exactly as described previously (Parker et al., 2014). ARC at St Jude Children’s Research Hospital for technical assistance. Human and mouse DNA samples were hybridized to Genome-Wide Human SNP Array 6.0 (Affymetrix) and the Mouse Genome CGH 244K (Agilent), Received: September 19, 2014 respectively. Human gene copy number was inferred using Partek Genomics Revised: November 16, 2014 Suite 6.5 and genomic segmentation algorithm (Partek). Segmented regions Accepted: April 10, 2015 were those significantly different from neighboring regions (p < 0.001) and Published: May 11, 2015 contained 10 or more probes, with a signal to noise ratio of 0.3. Mouse aCGH tumor data were compared to a common control as reference DNA REFERENCES and the circular binary segmentation algorithm [1] implemented in the DNAcopy package from Bioconductor used to identify copy number alter- Alexandrov, L.B., Nik-Zainal, S., Wedge, D.C., Aparicio, S.A.J.R., Behjati, ations for each tumor sample. Aberrant segments contained at least five S., Biankin, A.V., Bignell, G.R., Bolli, N., Borg, A., Børresen-Dale, A.-L., À probes with a mean log2 ratio greater than 0.3 or less than 0.3. et al.; Australian Pancreatic Cancer Genome Initiative; ICGC Breast Cancer Consortium; ICGC MMML-Seq Consortium; ICGC PedBrain Whole Genome Sequencing Data Analysis (2013). Signatures of mutational processes in human cancer. Nature 500, Detection of somatic single nucleotide variations (SNVs), indels, structural var- 415–421. iations and focal copy number changes from whole genome sequencing Awatramani, R., Soriano, P., Rodriguez, C., Mai, J.J., and Dymecki, S.M. (WGS) was performed as previously described and are described in detail in (2003). Cryptic boundaries in roof plate and choroid plexus identified by inter- the Supplemental Experimental Procedures (Parker et al., 2014). sectional gene activation. Nat. Genet. 35, 70–75.

Cell Culture Baselga, J., Tripathy, D., Mendelsohn, J., Baughman, S., Benz, C.C., Dantis, Fresh, primary, CPC tumor tissue was dissected from the IV ventricle of mice, L., Sklarin, N.T., Seidman, A.D., Hudis, C.A., Moore, J., et al. (1996). Phase II minced and disaggregated using hyaluronidase (Atlanta Biologicals) and colla- study of weekly intravenous recombinant humanized anti-p185HER2 mono- genase type IV (Invitrogen). Disaggregated cells were filtered through a 40 mm clonal antibody in patients with HER2/neu-overexpressing metastatic breast cell strainer and transduced with control or shRNA-lentiviruses. The prolifera- cancer. J. Clin. Oncol. 14, 737–744. tion of single cell suspensions cultured in neurobasal medium, in the presence Benatti, P., Dolfini, D., Vigano` , A., Ravo, M., Weisz, A., and Imbriano, C. (2011). or absence of the indicated concentration of ATR inhibitors was recorded Specific inhibition of NF-Y subunits triggers different cell proliferation defects. using CellTiter-Glo as described (Gibson et al., 2010). Apoptosis was assessed Nucleic Acids Res. 39, 5356–5368. in single cell suspensions using the CaspaseGlo assay (see Supplemental Bieniossek, C., Papai, G., Schaffitzel, C., Garzoni, F., Chaillet, M., Scheer, E., Experimental Procedures). Papadopoulos, P., Tora, L., Schultz, P., and Berger, I. (2013). The architecture of human general transcription factor TFIID core complex. Nature 493, Quantitative Reverse Transcriptase PCR 699–702. Total cDNA was generated from cells and analyzed using qRT-PCR and stan- Brinster, R.L., Chen, H.Y., Messing, A., van Dyke, T., Levine, A.J., and Palmiter, dard approaches. Primers pairs used in assays included TAF12 (AGCCATCT R.D. (1984). Transgenic mice harboring SV40 T-antigen genes develop char- CATCCTTGGATTTTT: ACGACCAAAATGCTCTTCCTACA), NFYC (AGGAC acteristic brain tumors. Cell 37, 367–379. AGATCCAGACACTTGCTAC: GATTGGCTGACTGAATAAACATGG), Rad54l (CCTGGTGAAGAACTGGTACAATG: ATGACCAGTCCAACATTTCCTTT) and CBTRUS (2006). Statistical Report: Primary Brain Tumors in the United States, Gapdh (AGGTCGGTGTGAACGGATTTG: TGTAGACCATGTAGTTGAGGTCA). 1995-1999 (Central Brain Tumor Registry of the United States). Chen, E.Y., Dobrinski, K.P., Brown, K.H., Clagg, R., Edelman, E., Ignatius, ACCESSION NUMBERS M.S., Chen, J.Y., Brockmann, J., Nielsen, G.P., Ramaswamy, S., et al. (2013). Cross-species array comparative genomic hybridization identifies The accession number for the WGS data reported in this paper is European novel oncogenic events in zebrafish and human embryonal rhabdomyosar- Bioinformatics Institute EGAS00001000961. Human and mouse RNA and coma. PLoS Genet. 9, e1003727. DNA microarray data are available from GEO (GSE60899). Chen, X., Bahrami, A., Pappo, A., Easton, J., Dalton, J., Hedlund, E., Ellison, D., Shurtleff, S., Wu, G., Wei, L., et al.; St. Jude Children’s Research Hospital– SUPPLEMENTAL INFORMATION Washington University Pediatric Cancer Genome Project (2014). Recurrent somatic structural variations contribute to tumorigenesis in pediatric osteosar- Supplemental Information includes Supplemental Experimental Procedures, coma. Cell Rep. 7, 104–112. one figure, and eight tables and can be found with this article online at Chow, L.M., Endersby, R., Zhu, X., Rankin, S., Qu, C., Zhang, J., Broniscer, A., http://dx.doi.org/10.1016/j.ccell.2015.04.005. Ellison, D.W., and Baker, S.J. (2011). Cooperativity within and among Pten,

Cancer Cell 27, 712–727, May 11, 2015 ª2015 Elsevier Inc. 725 p53, and Rb pathways induces high-grade astrocytoma in adult brain. Cancer specific transcription factor NF-Y displays histone-like DNA binding and H2B- Cell 19, 305–316. like ubiquitination. Cell 152, 132–143. Currle, D.S., Cheng, X., Hsu, C.M., and Monuki, E.S. (2005). Direct and indirect Olivier, M., Goldgar, D.E., Sodha, N., Ohgaki, H., Kleihues, P., Hainaut, P., and roles of CNS dorsal midline cells in choroid plexus epithelia formation. Eeles, R.A. (2003). Li-Fraumeni and related syndromes: correlation between Development 132, 3549–3559. tumor type, family structure, and TP53 genotype. Cancer Res. 63, 6643–6650. Downing, J.R., Wilson, R.K., Zhang, J., Mardis, E.R., Pui, C.H., Ding, L., Ley, Parker, M., Mohankumar, K.M., Punchihewa, C., Weinlich, R., Dalton, J.D., Li, T.J., and Evans, W.E. (2012). The pediatric cancer genome project. Nat. Y., Lee, R., Tatevossian, R.G., Phoenix, T.N., Thiruvenkatam, R., et al. (2014). Genet. 44, 619–622. C11orf95-RELA fusions drive oncogenic NF-kB signalling in ependymoma. Druker, B.J., Talpaz, M., Resta, D.J., Peng, B., Buchdunger, E., Ford, J.M., Nature 506, 451–455. Lydon, N.B., Kantarjian, H., Capdeville, R., Ohno-Jones, S., and Sawyers, Paulus, W., and Brandner, S. (2007). Choroid plexus tumours. In WHO C.L. (2001). Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine Classification of Tumours of the Central Nervous System Lyon, D.N. Louis, kinase in chronic myeloid leukemia. N. Engl. J. Med. 344, 1031–1037. H. Ohgaki, O.D. Wiestler, and W.K. Cavenee, eds. (IARC Press), pp. 81–85. Flaherty, K.T., Puzanov, I., Kim, K.B., Ribas, A., McArthur, G.A., Sosman, J.A., Rickert, C.H., Wiestler, O.D., and Paulus, W. (2002). Chromosomal imbalances O’Dwyer, P.J., Lee, R.J., Grippo, J.F., Nolop, K., and Chapman, P.B. (2010). in choroid plexus tumors. Am. J. Pathol. 160, 1105–1113. Inhibition of mutated, activated BRAF in metastatic melanoma. N. Engl. J. Robinson, G., Parker, M., Kranenburg, T.A., Lu, C., Chen, X., Ding, L., Phoenix, Med. 363, 809–819. T.N., Hedlund, E., Wei, L., Zhu, X., et al. (2012). Novel mutations target distinct Frappart, P.-O., Lee, Y., Russell, H.R., Chalhoub, N., Wang, Y.-D., Orii, K.E., subgroups of medulloblastoma. Nature 488, 43–48. Zhao, J., Kondo, N., Baker, S.J., and McKinnon, P.J. (2009). Recurrent Ruland, V., Hartung, S., Kordes, U., Wolff, J.E., Paulus, W., and Hasselblatt, M. genomic alterations characterize medulloblastoma arising from DNA double- (2014). Choroid plexus carcinomas are characterized by complex chromo- strand break repair deficiency. Proc. Natl. Acad. Sci. USA 106, 1880–1885. somal alterations related to patient age and prognosis. Genes Chromosomes Garber, J.E., Goldstein, A.M., Kantor, A.F., Dreyfus, M.G., Fraumeni, J.F., Jr., Cancer 53, 373–380. and Li, F.P. (1991). Follow-up study of twenty-four families with Li-Fraumeni Sa´ enz Robles, M.T., Symonds, H., Chen, J., and Van Dyke, T. (1994). Induction syndrome. Cancer Res. 51, 6094–6097. versus progression of brain tumor development: differential functions for the Gibson, P., Tong, Y., Robinson, G., Thompson, M.C., Currle, D.S., Eden, C., pRB- and p53-targeting domains of simian virus 40 T antigen. Mol. Cell. Kranenburg, T.A., Hogg, T., Poppleton, H., Martin, J., et al. (2010). Subtypes Biol. 14, 2686–2698. of medulloblastoma have distinct developmental origins. Nature 468, 1095– Sakai, W., Swisher, E.M., Karlan, B.Y., Agarwal, M.K., Higgins, J., Friedman, 1099. C., Villegas, E., Jacquemont, C., Farrugia, D.J., Couch, F.J., et al. (2008). Harms, P.J., Tu, G.F., Richardson, S.J., Aldred, A.R., Jaworowski, A., and Secondary mutations as a mechanism of cisplatin resistance in BRCA2- Schreiber, G. (1991). Transthyretin (prealbumin) gene expression in choroid mutated cancers. Nature 451, 1116–1120. plexus is strongly conserved during evolution of vertebrates. Comp. Schmitz, K.-M., Schmitt, N., Hoffmann-Rohrer, U., Scha¨ fer, A., Grummt, I., and Biochem. Physiol. B 99, 239–249. Mayer, C. (2009). TAF12 recruits Gadd45a and the nucleotide excision repair Huang, X., Ketova, T., Fleming, J.T., Wang, H., Dey, S.K., Litingtung, Y., and complex to the promoter of rRNA genes leading to active DNA demethylation. Chiang, C. (2009). Sonic hedgehog signaling regulates a novel epithelial pro- Mol. Cell 33, 344–353. genitor domain of the hindbrain choroid plexus. Development 136, 2535–2543. Scuoppo, C., Miething, C., Lindqvist, L., Reyes, J., Ruse, C., Appelmann, I., Hunter, N.L., and Dymecki, S.M. (2007). Molecularly and temporally separable Yoon, S., Krasnitz, A., Teruya-Feldstein, J., Pappin, D., et al. (2012). A tumour lineages form the hindbrain roof plate and contribute differentially to the suppressor network relying on the polyamine-hypusine axis. Nature 487, choroid plexus. Development 134, 3449–3460. 244–248. Johnson, R.A., Wright, K.D., Poppleton, H., Mohankumar, K.M., Finkelstein, Se´ e´ venet, N., Sheridan, E., Amram, D., Schneider, P., Handgretinger, R., and D., Pounds, S.B., Rand, V., Leary, S.E., White, E., Eden, C., et al. (2010). Delattre, O. (1999). Constitutional mutations of the hSNF5/INI1 gene predis- Cross-species genomics matches driver mutations and cell compartments pose to a variety of cancers. Am. J. Hum. Genet. 65, 1342–1348. to model ependymoma. Nature 466, 632–636. Somyajit, K., Basavaraju, S., Scully, R., and Nagaraju, G. (2013). ATM- and Lehtinen, M.K., Bjornsson, C.S., Dymecki, S.M., Gilbertson, R.J., Holtzman, ATR-mediated phosphorylation of XRCC3 regulates DNA double-strand D.M., and Monuki, E.S. (2013). The choroid plexus and cerebrospinal fluid: break-induced checkpoint activation and repair. Mol. Cell. Biol. 33, 1830– emerging roles in development, disease, and therapy. J. Neurosci. 33, 1844. 17553–17559. Tinat, J., Bougeard, G., Baert-Desurmont, S., Vasseur, S., Martin, C., Luo, J., Solimini, N.L., and Elledge, S.J. (2009). Principles of cancer therapy: Bouvignies, E., Caron, O., Bressac-de Paillerets, B., Berthet, P., Dugast, C., oncogene and non-oncogene addiction. Cell 136, 823–837. et al. (2009). 2009 version of the Chompret criteria for Li Fraumeni syndrome. Malkin, D., Li, F.P., Strong, L.C., Fraumeni, J.F., Jr., Nelson, C.E., Kim, D.H., J. Clin. Oncol. 27, e108–109, author reply e110. Kassel, J., Gryka, M.A., Bischoff, F.Z., Tainsky, M.A., et al. (1990). Germ line Uziel, T., Zindy, F., Xie, S., Lee, Y., Forget, A., Magdaleno, S., Rehg, J.E., p53 mutations in a familial syndrome of breast cancer, sarcomas, and other Calabrese, C., Solecki, D., Eberhart, C.G., et al. (2005). The tumor suppressors neoplasms. Science 250, 1233–1238. Ink4c and p53 collaborate independently with Patched to suppress medullo- Merino, D.M., Shlien, A., Villani, A., Pienkowska, M., Mack, S.C., Ramaswamy, blastoma formation. Genes Dev. 19, 2656–2667. V., Shih, D.J., Tatevossian, R., Novokmet, A., Choufani, S., et al. (2014). Voulgari, A., Voskou, S., Tora, L., Davidson, I., Sasazuki, T., Shirasawa, S., and Molecular characterization of choroid plexus tumors reveals novel clinically Pintzas, A. (2008). TATA box-binding protein-associated factor 12 is important relevant subgroups. Clin. Cancer Res. for RAS-induced transformation properties of colorectal cancer cells. Mol. Mills, K.D., Ferguson, D.O., Essers, J., Eckersdorff, M., Kanaar, R., and Alt, Cancer Res. 6, 1071–1083. F.W. (2004). Rad54 and DNA Ligase IV cooperate to maintain mammalian Wrede, B., Hasselblatt, M., Peters, O., Thall, P.F., Kutluk, T., Moghrabi, A., chromatid stability. Genes Dev. 18, 1283–1292. Mahajan, A., Rutkowski, S., Diez, B., Wang, X., et al. (2009). Atypical choroid Morigaki, R., Pooh, K.-H., Shouno, K., Taniguchi, H., Endo, S., and Nakagawa, plexus papilloma: clinical experience in the CPT-SIOP-2000 study. Y. (2012). Choroid plexus papilloma in a girl with hypomelanosis of Ito. J. Neurooncol. 95, 383–392. J Neurosurg Pediatr 10, 182–185. Wright, W.D., and Heyer, W.D. (2014). Rad54 functions as a heteroduplex DNA Nardini, M., Gnesutta, N., Donati, G., Gatta, R., Forni, C., Fossati, A., Vonrhein, pump modulated by its DNA substrates and Rad51 during D loop formation. C., Moras, D., Romier, C., Bolognesi, M., and Mantovani, R. (2013). Sequence- Mol. Cell 53, 420–432.

726 Cancer Cell 27, 712–727, May 11, 2015 ª2015 Elsevier Inc. Wu, G., Broniscer, A., McEachron, T.A., Lu, C., Paugh, B.S., Becksfort, J., Qu, Zender, L., Xue, W., Zuber, J., Semighini, C.P., Krasnitz, A., Ma, B., Zender, P., C., Ding, L., Huether, R., Parker, M., et al. (2012). Somatic histone H3 alter- Kubicka, S., Luk, J.M., Schirmacher, P., et al. (2008). An oncogenomics-based ations in pediatric diffuse intrinsic pontine gliomas and non-brainstem glio- in vivo RNAi screen identiﬁes tumor suppressors in liver cancer. Cell 135, blastomas. Nat. Genet. 44, 251–253. 852–864. Xue, W., Kitzing, T., Roessler, S., Zuber, J., Krasnitz, A., Schultz, N., Revill, K., Zhang, J., Ding, L., Holmfeldt, L., Wu, G., Heatley, S.L., Payne-Turner, D., Weissmueller, S., Rappaport, A.R., Simon, J., et al. (2012). A cluster of coop- Easton, J., Chen, X., Wang, J., Rusch, M., et al. (2012). The genetic basis erating tumor-suppressor gene candidates in chromosomal deletions. Proc. of early T-cell precursor acute lymphoblastic leukaemia. Nature 481, Natl. Acad. Sci. USA 109, 8212–8217. 157–163.

Cancer Cell 27, 712–727, May 11, 2015 ª2015 Elsevier Inc. 727