Functional Characterization of a Fungal Polyamine Oxidase Fvpo1 Jordan Lillian Baumbach Iowa State University

Masthead Logo

Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations

2018 Functional characterization of a fungal polyamine oxidase FvPO1 Jordan Lillian Baumbach Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Genetics Commons

Recommended Citation Baumbach, Jordan Lillian, "Functional characterization of a fungal polyamine oxidase FvPO1" (2018). Graduate Theses and Dissertations. 16913. https://lib.dr.iastate.edu/etd/16913

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected].

Functional characterization of a fungal polyamine oxidase FvPO1

Jordan Baumbach

A dissertation submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Major: Genetics

Program of Study Committee: Madan Bhattacharyya, Major Professor Silvia Cianzio Harry Horner Leonor Leandro Steven Whitham Bing Yang

The student author, whose presentation of the scholarship herein was approved by the program of study committee, is solely responsible for the content of this dissertation. The Graduate College will ensure this dissertation is globally accessible and will not permit alterations after a degree is conferred.

Iowa State University

Ames, Iowa

2018

TABLE OF CONTENTS

Page

LIST OF FIGURES ...... v

LIST OF TABLES ...... vi

NOMENCLATURE ...... vii

ACKNOWLEDGEMENTS ...... viii

ABSTRACT ...... ix

CHAPTER 1 GENERAL INTRODUCTION ...... 1

Thesis Organization ...... 3

CHAPTER 2 LITERATURE REVIEW ...... 4

Sudden death syndrome in soybeans ...... 4

Polyamines in plants ...... 16 Polyamine metabolism in plants ...... 16 Polyamine catabolism in plants ...... 17 Polyamines conjugates ...... 18 Function of polyamines in plants ...... 19 Polyamines and biotic stress ...... 21 Hydrogen peroxide and plant defense response ...... 23

Polyamines in Fungi ...... 26 Polyamine metabolism ...... 26 Polyamine catabolism ...... 27

Phenylacetic acid and plant-pathogen interactions ...... 30

iii

CHAPTER 3 IDENTIFICATION OF A FUNCTIONAL INFECTION-INDUCED FUSARIUM VIRGULIFORME POLYAMINE OXIDASE GENE, FVPO1 ...... 32

Abstract ...... 32

Introduction ...... 33

Methods...... 36 Phylogenetic analysis ...... 36 Strains and growth conditions ...... 37 Construction of gene replacement cassettes ...... 37 Fusarium virguliforme transformation ...... 38 Mutant growth phenotyping ...... 38 Infection phenotyping ...... 39

Results ...... 39 Phylogenetic analysis of FvPO1 ...... 39 Generation of FvPO1 deletion mutant and its complemented strain ...... 40 FvPO1 is a functional polyamine oxidase ...... 41 Phenotyping fvpo1 mutants ...... 42

Discussion ...... 43

References ...... 54

CHAPTER 4 EVALUATION OF TRANSGENIC SOYBEAN PLANTS EXPRESSING THE FUNGAL POLYAMINE OXIDASE GENE, FVPO1 ...... 59

Abstract ...... 59

Introduction ...... 59

Materials and Methods ...... 65 Gene constructs bacterial strains and plant materials...... 65 Field evaluation of transgenic soybean lines for possible resistance to F. virguliforme ...... 66 Responses of transgenic plants to F. virguliforme in growth chamber ...... 67 Semi-quantitative RT-PCR ...... 68 Responses of transgenic plants to Pseudomonas syringae pv. glycinea in growth chamber .... 68

Results ...... 69 Generation of transgenic soybean lines ...... 69 Responses of transgenic soybean lines carrying FvPO1 to F. virguliforme...... 70 iv

Responses of transgenic soybean lines carrying FvPO1 to Pseudomonas syringae pv. glycinea ...... 73

Discussion ...... 73

References ...... 83

CHAPTER 5 TRANSCRIPTOMIC STUDY OF THE SOYBEAN-FUSARIUM VIRGULIFORME FVPO1 KNOCKOUT MUTANT INTERACTION ...... 95

Abstract ...... 95

Introduction ...... 96

Methods...... 101 Fusarium virguliforme isolates ...... 101 RNA sequencing ...... 102 Phenylacetic acid growth assays ...... 102 Reverse transcription PCR ...... 103

Results ...... 104 Changes in gene expression in soybean following F. virguliforme infection ...... 104 Changes in transcript levels of the F. virguliforme genes following infection of soybean..... 106

Discussion ...... 107

References ...... 121

CHAPTER 6 GENERAL CONCLUSIONS ...... 129

REFERENCES ...... 135

LIST OF FIGURES

Page

Figure 3.1 Evolutionary relationships of fungal polyamine oxidases...... 50

Figure 3.2. Radial growth of Δfvpo1 mutant and its complemented isolate...... 51

Figure 3.3 Complementation of a Δfvpo1 mutant restores polyamine oxidase activity...... 52

Figure 3.4 FvPO1 is not essential for SDS development...... 53

Figure 4.1 T-DNA map and transformation confirmation...... 78

Figure 4.2 Disease index of transgenic plants in 2015 field trial...... 79

Figure 4.3 Disease index of transgenic plants in 2016 field trial...... 80

Figure 4.4 Transgenic plants expressing FvPO1 do not enhance resistance to F. virguliforme

under growth chamber conditions...... 81

Figure 5.1 Responses of etiolated hypocotyls to F. virguliforme...... 116

Figure 5.2 Distribution of soybean differentially expressed genes...... 117

Figure 5.3 Heat map of F. virguliforme phenylacetic acid metabolism pathway...... 118

Figure 5.4 Quantitative RT-PCR of F. virguliforme polyamine oxidase and PAA pathway

genes upregulated following infection of soybean roots...... 119

Figure 5.5 Radial growth reduction of Fusarium virguliforme in response to PAA...... 120 vi

LIST OF TABLES

Page

Table 3.1 Amino acid sequences used for construction of the fungal polyamine oxidase

phylogenetic tree...... 46

Table 3.2 Primers used in this study...... 49

Table 4.1 Primers used in this study ...... 77

Table 5.1 Soybean and F. virguliforme gene transcripts detected during RNA-sequencing in

each of the three experimental conditions...... 112

Table 5.2 Differentially expressed F. virguliforme genes q < 0.1 ...... 113

Table 5.3 Growth reduction on pda plates containing phenylacetic acid...... 114

Table 5.4 Primers used for QRT-PCR ...... 115

vii

NOMENCLATURE

FvPO1 Fusarium virguliforme polyamine oxidase gene 1

FvPO2 Fusarium virguliforme polyamine oxidase gene 2

SDS Sudden death syndrome

SCN Soybean cyst nematode

MAMP Microbe-associate molecular pattern

PAO Polyamine oxidase

DAO Diamine oxidase

ROS Reactive oxygen species

PDA Potato dextrose agar

DX Disease index

Psg Pseudomonas syringae pv glycinea

PsgR4 Pseudomonas syringae pv glycinea Race 4

PsgR4(avrB) Pseudomonas syringae pv glycinea Race 4 containing

avirulence gene avrB

PAA Phenylacetic acid

viii

ACKNOWLEDGEMENTS

I would like to thank my committee chair, Madan Bhattacharyya, and my committee members, Professors Silvia Cianzio, Leonor Leandro, Harry Horner, Steven Whitham and Bing

Yang, for their guidance and support throughout the course of this research.

I would also like to thank my fellow lab members and mentors, as well as the department faculty and staff for their assistance. I want to thank Alexander Luckew for sugestions and discussions, as well as editing assistance. I also would like to thank USDA NIFA-ELI for their support and funding of my research.

ABSTRACT

Soybean is an important source of protein and oil for both human and animal nutrition.

The United States is the world’s leading soybean producing nation. In 2016, the U.S. soybean production was valued over 40.9 billion dollars. Sudden death syndrome (SDS) of soybean is ranked as one of the top ten yield limiting diseases of soybean and is caused by the pathogen Fusarium virguliforme. Fusarium virguliforme is a soil-borne fungal pathogen, which infects soybean roots resulting in both root rot symptoms and foliar chlorosis and necrosis. To date there is no known single gene resistance to SDS, the resistance that has been found is complex and heavily influenced by the environment. To gain a better understanding of the role of fungal genes in SDS development, RNA-sequencing of F. virguliforme infected soybean roots was conducted. Many F. virguliforme genes involved in cell wall degradation as well as phytoalexin detoxification were up-regulated during infection. Interestingly, the fungus also increases expression of a fungal polyamine oxidase gene FvPO1. Little is known about the role of fungal polyamine oxidases. Therefore, knockout mutants and complemented mutants for FvPO1 gene were created.

Mutant studies confirmed the FvPO1 enzymes polyamine oxidase activity. The

Δfvpo1 mutant did not have altered growth, sporulation or soybean infection phenotypes.

Transgenic soybean plants expressing FvPO1 did not have altered defense response to either infection with F. virguliforme or to infection with the bacterial pathogen Pseudomonas syringae pv glycinea. Comparisons of the transcriptomes of soybeans inoculated with Δfvpo1 and the complimented Δfvpo1::FvPO1 mutant showed that the presence of FvPO1 does not alter the expression of soybean genes following F. virguliforme infection.

Interestingly, three fungal genes related to the metabolism of the secondary metabolite x phenylacetic acid were upregulated in the Δfvpo1 mutant fungus during infection. Phenylacetic acid has been suggested to play a role in induced systemic resistance in plants. When F. virguliforme was grown on media containing phenylacetic acid fungal growth was reduced. Δfvpo1 mutants do not have altered growth phenotype when compared to the wild type on the phenylacetic acid media. FvPO1 has increased expression during F. virguliforme infection of soybean roots but is not necessary for F. virguliforme to infect soybean or cause typical symptoms. FvPO1 is increased with addition of the polyamines spermine and spermidine to the media. Therefore, the increased expression of FvPO1 following infection may be due to the presence of plant polyamines and the pathogen may use plant polyamines as an additional nutrient source during infection. Based on transcriptomics study, FvPO1 expression appears to regulate the phenylacetic acid metabolism pathway. 1

CHAPTER 1 GENERAL INTRODUCTION

Soybean is an important source of nutrition for both oil and protein around the world. The

United States is the leading producer of soybeans followed closely by Brazil and then Argentina.

The Midwestern United States region is the largest soybean growing region and soybean exports are an important part of the economy in these states [1]. Biotic stresses from pathogens reduce the yield potential and the seed quality for farmers. Therefore, it is of utmost importance that soybean breeders, biologists, and plant pathologists are working together to provide solutions to prevent devastating losses.

Sudden death syndrome (SDS) is a soybean disease that usually ranks within the top five in potential biotic yield suppressors [2]. In years when conditions are right, it can cause dramatic yield losses. The fungus Fusarium virguliforme, which resides in the soil and lives on debris in the fields, causes the disease by infecting soybean roots and releasing toxins [3]. While there has been some progress with seed treatments, use of resistant cultivars is the best way to prevent losses due to SDS [4]. Recently, research has focused on mapping the soybean genome for regions associated with increased SDS resistance for breeding purposes. Unfortunately, no single genes have been identified that confer resistance to SDS, and it is unlikely that single gene resistance exists in the germplasm. Other research has looked to generating transgenic soybean lines to enhance SDS resistance. Arabidopsis, soybean, antibody and synthetic toxin-interacting peptide genes have been deployed to enhance SDS resistance [5-8]. An enhanced understanding of how F. virguliforme causes SDS will both aid in designing transgenic plants and in the development of seed treatments. 2

Fusarium virguliforme is the only Fusarium species in North America that causes SDS

[9]. In South America, the disease is caused by three additional Fusarium species [9, 10]. The genome of F. virguliforme has been sequenced and was found to contain multiple hydrolytic enzymes responsible for cell wall degradation [11, 12]. Investigations into F. virguliforme gene expression showed that F. virguliforme expresses many of the hydrolytic genes during the infection process along with genes responsible for detoxifying plant defense compounds [13].

Mutant studies of two fungal toxin genes, FvTox1 and FvNIS, have shown their involvement in causing foliar SDS [14-16]. Additionally, a knockout study has shown that a sugar non- fermenting gene FvSNF1 is involved in regulating the expression of certain cell wall degrading enzymes [17]. Knockout mutants were also used to show that the F. virguliforme gene FvSTR1 is involved in sporulation and virulence [18]. The characterization of more F. virguliforme genes will help provide insight into the mechanisms used by the pathogen to cause the disease as well as potential targets for SDS suppression.

The fungal polyamine oxidase gene FvPO1 was found to have increased expression during F. virguliforme infection of soybean roots [13]. There has been little research into the possible role of fungal polyamine oxidases in either fungal growth and regulation, or pathogen virulence. Polyamines are small molecules associated with cell functions including the stabilization of DNA, RNA and proteins 19-23]. In plants, polyamines have been shown to be involved in both biotic and abiotic stress responses [24-30]. The breakdown of polyamines results in the production of the free radical hydrogen peroxide [31]. Hydrogen peroxide plays a role in the programmed cell death (PCD) pathway, a response to pathogen attack, as well as callose formation and plant defense signaling [32-35]. Therefore, we hypothesized that expression of FvPO1 may increase hydrogen peroxide formation at the infection site, altering 3 plant defense response. To investigate the role of FvPO1, a knockout mutant and its complimented knockout mutant for FvPO1 were created and studied for differences in fungal growth and development. Then FvPO1 was expressed in transgenic soybean plants to determine if it can enhance host defense response. Finally, transcriptomes were studied to determine if there were any changes in the host or pathogen gene expression following infection of soybean with F. virguliforme, due to FvPO1 in F. virguliforme.

Thesis Organization

This dissertation is organized into six chapters. Chapter 1 includes a general introduction and goals of the research. A review on the published literature of the mechanisms used by F. virguliforme to cause sudden death syndrome in soybean, the involvement of polyamines and polyamine oxidases in the plant-pathogen interactions, the role of polyamines in fungi and the possible connection of phenylacetic acid with polyamines and the plant-pathogen interaction is presented in chapter 2. Chapter 3 presents the creation of a Δfvpo1 fungal mutant and its complemented isolate. Chapter 4 describes the analyses of transgenic soybean plants expressing

FvPO1 to determine if the enzyme can enhance SDS resistance in transgenic soybean lines.

Chapter 5 describes the changes in transcriptomes of both soybean and F. virguliforme following infection of soybean with the pathogen in response to FvPO1 gene knockout. Finally, chapter 6 includes general conclusions, limitations, and future directions of this study.

CHAPTER 2 LITERATURE REVIEW

Sudden death syndrome in soybeans

Soybean is one of the most important crops produced in the United States. Soybean is a source of oil and protein for both animal and human consumption. The United States is the world leader in soybean production, and in 2016 produced 4.3 billion bushels of soybeans with a value of 40.9 billion dollars [1]. Multiple pathogenic organisms such as nematodes, fungi, bacteria and insect pests threaten soybean yield. In 2015, the estimated total percent of yield suppressed from pathogen attacks was 11.7% [2]. One of the diseases responsible for soybean yield loss worldwide is sudden death syndrome (SDS). The fungal disease threatens yield in both North and South America including the countries of Brazil and Argentina, which are the second and third largest soybean producing nations. In 2016, Brazil and Argentina produced 108 and 55.5 million metric tons of soybeans respectively [1].

The disease is caused by four Fusarium species that include F. virguliforme, F. tucumaniae, F. brasiliense and F. crassistipitatum [3, 4]. All four species have been identified to cause SDS in South America [3, 4]. Fusarium virguliforme is the only known causal agent of

SDS that has been found in the United States [3]. In 2015, the estimated yield suppression from

SDS in the United States was 43.7 million bushels, and SDS was ranked as the third most yield limiting soybean disease [2].

The SDS disease was first discovered in Arkansas in 1971 [5]. Since then it has spread throughout the soybean growing regions of the United States and Canada [6-14]. SDS has also been reported in Brazil, Argentina, South Africa, Korea and Malaysia [4, 15-18]. Fusarium virguliforme is a soil borne pathogen. Infection of soybean roots starts early in the growing 5 season. Root rot symptoms include discoloration of the roots and necrosis leading to reduced root growth and root weight [5]. Root colonization can be seen as early as three days post inoculation under controlled greenhouse experiments and 35 days after planting in field experiments [19, 20]. Plant age at time of infection plays an important role in symptom development with younger plants showing increased disease symptoms and early colonization being important for the fungus to gain entry to the xylem [21]. Entry into the xylem may be necessary for the production of foliar symptoms as it was found that infected roots lacking xylem penetration by hyphae did not produce foliar disease [22]. The fungus remains in the root and crown while producing toxins that are responsible for the foliar symptoms. Foliar symptoms usually visible at reproductive stages R2-R5 which include interveinal chlorotic spots. As the disease progresses, the chlorotic spots merge and the interveinal regions become completely chlorotic with necrotic lesions forming on the outer edge of the leaves causing leaves to curl. In severe disease conditions, leaves drop, as well as causing flower and pod abortion [5].

Combating SDS is an active area of research. Environmental conditions such as moisture, temperature, light, and biotic interactions have important roles in disease development. In the northern hemisphere, increases in total precipitation and total number of days with precipitation are correlated with SDS outbreaks [23], especially during the month of June [24]. Weather- related stress such as flooding can affect SDS symptom development. Short-term flooding is beneficial for F. virguliforme infections while longer-term anaerobic conditions are detrimental to both the plant and the pathogen [25]. Temperature and its effect on SDS appears to be complex. Originally, it was thought that earlier planting is correlated with increased SDS severity. Colder temperatures and streaks of colder days may play a role in disease epidemics

[23]. Recent reports, however, suggest early planting is not always associated with increased 6

SDS and that high moisture in the early reproductive phase is important for foliar disease development [24]. Light has also been shown to play an important role in SDS foliar disease development. Degradation of the large subunit of Rubisco in the leaves of soybean plants exposed to F. virguliforme culture filtrate is light dependent [26]. Likewise, the F. virguliforme toxin FvTox1 requires light to cause foliar symptoms [27]. Soil conditions apart from moisture also play a role in SDS severity. Increased soil fertility may be a factor to increase the SDS severity [28]. The composition of the microbiome of the soil has an impact on SDS development, and along with moisture content may explain the patchiness of SDS symptoms seen in farmers’ fields. An investigation of the rhizosphere revealed that soil spots containing bacteria belonging to the taxa Actinomycetales, along with other proteobacteria, were associated with reduced SDS symptoms [29]. Members of this family include bacteria known to produce a broad range of antimicrobial compounds [29]. Likewise, presence of the certain fungi, including Fusarium oxysporum, Trichoderma and Purpureocilium, were correlated with reduced SDS severity [29].

These microbes may trigger the induced systemic resistance in the soybean root protecting it from the subsequent F. virguliforme attack. The interaction between F. virguliforme and soybean cyst nematode (SCN; Heterodera glycines) is suggested to be responsible for increased SDS symptoms in fields with high SCN incidence [28, 30-36]. SDS resistance QTL have been shown to co-segregate with the SCN resistance QTL in multiple mapping experiments [37-45]. The exact interaction between SCN and SDS is unknown. Hypotheses for the interaction include: (i)

SCN cysts harbor the F. virguliforme spores; (ii) SCN entry may aid the F. virguliforme infection; (iii) and the stress of SCN infection may deplete the plants ability to resist F. virguliforme. 7

Rotations with cotton, maize, sorghum and rice seem to have little to no impact on SDS development [5]. Fusarium virguliforme chlamydiospores can reside in infected root tissue, corn debris and in SCN cysts and eggs and, therefore, persist in fields for long periods [5, 46, 47].

Foliar fungicidal treatments are not effective as the fungus remains in the roots and crown of the soybean plant. Seed treatments have been tested for their ability to reduce SDS symptoms, most of which are not successful [48]. Treatments that include Fluopyram appear to help protect yield losses due to SDS, but this treatment is also reliant on environmental factors and soybean cultivars [49-51].

The best practices to avoid yield suppression involve coordinated efforts that include planting resistant varieties. There are no soybean varieties with complete resistance and there is no known single gene with major effect for SDS resistance. SDS resistance is complex and quantitative. Over 80 quantitative trait loci (QTL) govern SDS resistance [52]. Certain chromosomes appear to be hot spots for SDS foliar symptom resistance QTL including

Chromosome 18, Chromosome 6 and Chromosome 3 [38, 53-68]. While most of the SDS resistance research has been focused on foliar symptoms, there have also been loci identified which are associated with the root rot phenotype [38, 40, 55, 61, 62, 65, 68]. Breeding for SDS resistance has been difficult as environmental conditions play a large role in the development of the disease and expression of SDS resistance [64, 68, 69].

Since no single gene-encoded complete SDS resistance has been found in the soybean germplasm collection, there has been an effort to enhance SDS resistance through transgenic approaches. After the identification of FvTox1, transgenic soybean lines expressing a plant antibody against the F. virguliforme toxin FvTox1 produced less foliar chlorosis when compared to the transformation background [70]. Due to the regulatory restriction on expression of animal 8 antibodies, the FvTox1 transgenic plants cannot be used commercially. Therefore, synthetic

FvTox1-interacting peptides were created using M13 phage display. One of the peptides, which was confirmed to interact with FvTox1 through yeast two-hybrid and in vitro pull down experiments, seems to reduce foliar disease symptoms in soybean seedlings when fed with F. virguliforme culture filtrates [71]. The receptor-like kinase Rhg1-a/Rfs2, identified in a QTL located on soybean chromosome 18, enhanced resistance to both SDS and soybean cyst nematode (SCN), when expressed in transgenic plants [45]. Another approach in engineering

SDS resistance is to overexpress soybean gene GmARP1, which was found to be downregulated in soybean roots during F. virguliforme infection [72]. Use of the non-host resistance gene PSS1 from Arabidopsis thaliana in transgenic soybean plants has also been shown to enhance resistance to F. virguliforme [73]. Due to the connection between SCN and SDS, transgenic lines expressing soybean salicylic acid methyl transferase gene GmSAMT1, which enhance resistance to soybean cyst nematode H. glycines, may also be effective in reducing SDS [74, 75].

To identify novel sources of SDS resistance, researchers are looking into the soybean response to F. virguliforme to gain a better understanding of SDS development. Microarray investigations into resistant and susceptible cultivars fed with cell-free F. virguliforme culture filtrates containing fungal toxins found seven genes which had increased expression in the resistant leaves. Four of those genes are also induced upon hypersensitive response to inoculation with Pseudomonas syringae pv glycinea containing the avirulence gene avrB [76]. A proteomics investigation found increased prevalence of 13 proteins in resistant soybean varieties when compared to that of the non-infected varieties. These proteins include two stress-induced proteins, two pathogenesis-related proteins, two pectinesterase proteins, an induced by salicylic acid protein, and lipoxygenase [77]. Dirigent-like proteins were identified to have increased 9 prevalence in both the previously mentioned proteomic investigation and in a transcriptomic investigation of F. virguliforme differentially expressed soybean genes in a susceptible cultivar

[76, 72]. An investigation into changes in metabolites in roots, xylem sap and leaves found that there was little change in the identified metabolites in the plant root metabolome. There were increases in multiple metabolites in the leaf and xylem sap. Examination of the leaf metabolome of F. virguliforme infected plants found an increase in free fatty acids. These may be present from the breakdown of plant membranes due to fungal toxins [78]. Additionally, it was noted that there was a decrease in the intermediates of the TCA cycle in both the xylem sap and the leaves of infected soybean plants. An increase in salicylate was found in the leaves but not in the xylem sap or in the roots. Pipecolate was found to be increased in both the xylem sap and leaves of infected plants as well [78]. Pipecolate is a product of lysine catabolism and a plant immunity regulator, which is important in systemic acquired resistance [79-82].

The production of phytoalexins is an important component of the plant defense response to pathogens. Phytoalexins are low-molecular weight molecules that are produced in response to pathogen elicitors [83, 84]. The most common phytoalexins are derived from phenylalanine. The first step in phytoalexin biosynthesis is the production of cinnamate through the action of phenylalanine ammonia lyase (PAL) [85, 86]. Cinnamate is converted to p-coumarate through the action of cinnamate 4-hydoxylase. The p-coumarate is involved both in phytoalexin biosynthesis and in lignin biosynthesis. The p-coumarate is in turn converted to naringenin chalcone or naringenin by chalcone reductase and chalcone isomerase, respectively. Chalcone isomerase converts isoliquirtigenin to L-iquiritigenin. From L-iquirtigenin the isoflavones such as diadzein, genistein, formononetin and glyceollins are produced [85, 87]. Root metabolomics investigation in susceptible cultivar ‘Spencer’ showed increased levels of daidzein, daidzin, 10 coumestrol, formononetin, genistein, apigenin and afromosin in the xylem sap of infected plants

[78]. This increase in xylem sap levels was coupled with decreased levels in the roots of all of these flavonoids except for afromosin and apigenin [78]. Additionally, the levels of the L- iqurtigenin and iso-L-iquirtigenin were decreased in infected root tissues [78]. An earlier study looked at total isoflavones, daidzein and glyceollin content in infected ‘Spencer’ roots compared with partially-resistant plant introduction (PI) lines ‘PI 567374’ and ‘PI 520733.’ Here it was found that total isoflavones were increased in the resistant PI lines. Additionally, glyceollin had an approximately two-fold increase in the resistant lines [88]. There was an increase in PAL enzyme activity upon inoculation, but it did not seem to be highly significant between resistant and susceptible lines [88, 89]. Increased expression of genes in the phytoalexin pathway was observed in a resistant recombinant inbred line from a ‘Forrest’ and ‘Essex’ cross when compared to the highly susceptible ‘Essex’ variety. The most extreme of these increases was in the 4-coumarate CoA ligase gene Glyma.17G064600 [90]. In addition, they found much milder increases in two PAL genes, a chalcone isomerase, and chalcone flavone isomerase [90]. In subsequent work looking at a different resistant variety, PAL gene expression increased during infection with F. virguliforme and increases in PAL expression was associated with increased resistance to F. virguliforme. Similar results were seen with other phytoalexin biosynthetic genes

[76, 91]. Other soybean gene families with increased expression in response to F. virguliforme infection in susceptible cultivar ‘Essex’ include chitinases, F-box proteins, glutathione S- transferases, Kunitz family trypsin inhibitors, peroxidases, pectinesterases, RmlC-like cupins, serine/threonine kinases, and UDP-glucosyl transferases [78]. Investigations also looked at genes with repressed expression in soybean during infection. This included a group of clustered chitinase genes, a two ankyrin repeat proteins, two S-adenosyl-L-methionine dependent carboxyl 11 methyltransferase, wound induced proteins, cysteine protease and multiple proteins of unknown function [78]. Further work into the reason for the suppression of these soybean genes may shed more light onto their importance in infection. The down regulations of some of these genes may be a general plant stress response. In a transcriptomic investigation of Arabidopsis response to multiple stresses, 377 genes were down regulated in response to both Botrytis cinerea elicitor and cold stress. Additionally, 77 genes had repression in response to both B. cinerea elicitor and drought stress [92]. Expression of the Na+/H+ antiporter NHX2 was repressed under all the stress conditions tested [92]. Transcriptomic investigations of Arabidopsis with Fusarium oxysporum found that the majority of differentially expressed Arabidopsis genes were suppressed during infection. This included an ethylene response factor ERF72. Mutants of ERF72 were found to have enhanced resistance to F. oxysporum [93]. Gene expression suppression could also be a result of hormone cross talk as increases of the plant defense response hormone jasmonic acid can repress expression of salicylic acid related defense response genes such as PR-1 in

Arabidopsis [94]. Alternatively, some of these genes may be suppressed by the pathogen to weaken soybean response. This may occur through interference with the defense-signaling pathway, or through acting directly in gene expression repression. Both the HC-toxin produced by Cochliobolus carbonum and the Alternaria brassicicola toxin depudecin interfere with plant histone deacetylases and can suppress the expression of defense related genes [95 - 97]. Boytritis cinerea has been shown to repress Arabidopsis genes through the use of sRNA [98]. The

Bhattacharyya lab is currently investigating a group of the downregulated soybean genes for potential sources of SDS resistance.

Building better soybeans through transgenic approaches will benefit from a better understanding of how F. virguliforme causes both root rot and foliar SDS symptoms. Fusarium 12 virguliforme genome sequence contains many predicted plant cell wall degrading enzymes including 66 carbohydrate esterases, 292 glycoside hydrolases and 28 pectate lyases [99]. These proteins are able to break down the different carbohydrates, which make up the plant cell wall.

Changes in the F. virguliforme transcriptome during later infection stages show that multiple cell wall hydrolytic enzymes are highly induced during infection [100]. A sucrose non-fermenting protein kinase gene FvSNF1 was identified and mutated in F. virguliforme. Mutants had reduced expression of cell wall degrading enzymes as well as reduced pathogenicity in greenhouse experiments. These results suggest that FvSNF1 may be an important regulator of pathogenicity

[101]. Peptidases and proteinases were also among the most highly expressed enzymes during infection. This includes the extracellular elastinolytic metalloproteinase g14032 and the leucine aminopeptidase g12211 [100]. These proteins are deployed by the fungus to breakdown plant proteins and may act as effector proteins disabling plant defense response [102, 103]. Along with physical barrier degrading enzymes, F. virguliforme also has increased expression of genes for degrading host defense compounds, which show homology to known phytoalexin detoxification proteins, such as maackiain detoxification protein MAK1 from Nectria haematoccoca and pisatin demethylase protein FoPDA1 from Fusarium oxysporum f. sp. pisi

[100, 104, 105]. Fusarium virguliforme growth in media is inhibited by the addition of soybean phytoalexins. Addition of 75µM glyceollin to PDA media reduced F. virguliforme growth by up to 45% [88]. Other soybean phytoalexins, including coumestrol, daidzin, genistin, glycitin and glycitein also reduced the growth of F. virguliforme (growth reduction between 7 ± 1 and 16 ± 4 percent) [88]. Multiple genes with unknown functions were identified as having increased expression during infection [100]. The gene with the highest expression during infection was F. virguliforme gene g1309, which encodes a protein of unknown function with homology to 13 predicted proteins found in F. virguliforme’s close relative Nectria haematoccoca as well as

Neonectria ditissima [100]. This gene may be an interesting target for investigation. This gene may be a novel pathogenicity factor of F. virguliforme and will require functional characterization to understand its role SDS development.

Since F. virguliforme stays in the roots, the foliar symptoms in SDS are considered the result of fungal toxins. The toxins are thought to travel through the xylem sap to the leaves. In plants where the fungus fails to penetrate the xylem, visible root rot is present without foliar symptoms [22]. Fusarium virguliforme culture filtrates can produce foliar symptoms when fed into the cut soybean seedlings [106]. In the leaves of soybean plants which are exposed to the culture filtrate the large subunit of Rubisco was degraded, and free radicals were produced in a light-dependent manner [26]. This breakdown of Rubisco and the subsequent free radical production may be responsible for the cell death seen in symptomatic soybean leaves. It is still unknown what causes the degradation of Rubisco in the infected leaves. A 17 kDa proteinaceous toxin was reported to be produced in culture filtrates of F. virguliforme but a gene encoding this protein never has been identified [107]. FvTox1 is another proteinaceous toxin found in the culture filtrate from F. virguliforme [27]. Transgenic soybeans expressing antibodies raised against the FvTox1 protein have reduced foliar symptoms when inoculated with F. virguliforme.

[70]. Analysis of FvTox1 gene knockout mutants in the aggressive Mont-1 isolate confirmed that

FvTox1 is involved in foliar symptom development [108]. Eleven potential fungal effector proteins were identified from study of the F. virguliforme liquid culture transcriptome. These include FvNIS1, which through the use of soybean mosaic virus over-expression system, was able to induce the typical SDS foliar symptoms [109]. In addition, 12 transcribed polyketide synthase genes were identified. Polyketide synthases are a large and diverse group of proteins 14 responsible for the production of bioactive compounds. Some of these compounds have been harnessed for their potential medicinal value such as the antibiotic penicillin and the statin lovastatin. In Fusarium species, the product of polyketide synthase (PKS) gene Fum1 is well known for producing the mycotoxin fumonisin [110]. Citrin, fusaric acid and radicicol are three

F. virguliforme secondary metabolites produced by PKS enzymes that cause foliar symptoms such as wilting and chlorosis in soybean [109]. Five putative F. virguliforme toxins were identified in soybean xylem sap in a proteomics study of the F. virguliforme-infected susceptible soybean line [111]. One of these proteins, cerato-platanin protein, was also identified in both the

F. virguliforme culture filtrate proteomic analysis and transcriptome search for potential effector proteins [111, 109]. Cerato-platanins found in many fungal species can be elicitors of plant defense response leading to cell death [112]. Fusarium virguliforme may deploy this toxin to trigger the plant defense response and cause a plant cell death, which presumably benefits the pathogens necrotrophic growth. The proteomics investigation failed to detect the toxins FvTox1 or FvNIS1 in the xylem sap but was able to identify both proteins along with two additional cerato-platanin like proteins in the F. virguliforme culture filtrate [111]. Collectively, these results suggest that there is not a single toxin responsible for SDS symptoms but rather F. virguliforme is using multiple layers of toxic proteins and metabolites to cause foliar disease.

This matches well with the observed diverse and quantitative responses identified in the many

QTL and GWAS studies.

The genome of F. virguliforme has been sequenced and is available in a genome browser at http://fvgbrowse.agron.iastate.edu/. The genome was sequenced using the shotgun method from a single spore-isolated culture from the virulent Mont-1 strain. The genome revealed a predicted 14,845 genes, including 1,332 genes, which appear to be unique to F. virguliforme 15

[113]. Fusarium virguliforme is a close relative of the pea pathogen Nectria haematococca. The genome seems to be rich in protein tyrosine kinase, ankyrin repeat and heterokaryon incompatibility proteins when compared to other Fusarium species [113]. Phylogenetic analysis and molecular investigations of F. virguliforme show little variation within the genome [114 -

116]. The species has shown no sexual reproduction and identified isolates in North America only carry the MAT1-1 locus [117, 118]. While there is an overall lack of variation in the genome, variable supernumerary chromosome segments were detected between F. virguliforme isolates. The most variable and highly expressed of these regions contain DNA transposable elements [116]. These regions may provide F. virguliforme with the genetic variation to allow some isolates to be more aggressive than others. Of the predicted 14,845 F. virguliforme genes,

89 percent are expressed either in spores, culture filtrate or in soybean root infection [100].

Transcriptomic study of the Mont-1 strain during soybean-F. virguliforme interaction revealed

1,886 F. virguliforme genes that are induced at least two-fold during infection when compared to their expression levels in mycelia and germinating spores. Of those genes, 33 showed greater than 100-fold increased expression during soybean root infection [100]. A F. virguliforme straiatin gene, FvSTR1, was identified to be important for both vegetative development and virulence. Knockout mutants of FvSTR1 have reduced growth and conidia formation on PDA media [119]. Fusarium virguliforme has two polyamine oxidase genes. One of these polyamine oxidase genes (FvPO1) has increased expression during infection when compared to that in mycelia and germinating spores [100]. This suggests that polyamines may play a role in the F. virguliforme-soybean interaction. 16

Polyamines in plants

Polyamine metabolism in plants

Polyamines are small polycationic molecules. They are found throughout all kingdoms of life. The first identified polyamines (spermine and spermidine) were described in seminal fluids by Antonie van Leeuwenhoek in 1674 [120, 121]. These compounds were named after their identification source in 1888 and 1898. They were considered to have the ability to cure various diseases [120]. The structure of polyamines was not identified until 1924. In plants, polyamines are synthesized through two main pathways. The first, which is common with animals, fungi and bacteria, is based around the decarboxylation of ornithine through the activity of ornithine decarboxylase enzyme (ODC). The second mechanism, which is mainly used in plants and bacteria, involves the decarboxylation of arginine by arginine decarboxylase. The decarboxylation results in the production of agmatine, which is converted to N- carbamoylputrescine by N-carbamoyl putrescine amindohydrolase and then to putrescine by putrescine synthase [122]. From putrescine, the metabolism follows a single pathway, where s- adenosylmethionine decarboxylase (SAMDC) transfers an aminopropyl group from s- adenosylmethionine (SAM) as follows. This occurs first time through the action of spermidine synthase to produce spermidine and a second time to produce spermine by the spermine synthase enzyme [122]. The donation of SAM by SAMDC connects the polyamine biosynthesis pathway to the known defense responsive ethylene biosynthesis pathway. Inhibition of the polyamine synthesis pathway increases production of ethylene [123]. Another common plant polyamine is cadaverine, which is synthesized through lysine decarboxylation by lysine decarboxylase (LDC)

[124]. Longer and less common polyamines, which are found in plants, include caldine and thermospermine [125]. 17

Polyamine catabolism in plants

In plants, polyamines are broken down through amine oxidases. The diamine putrescine is broken down by diamine oxidases (DAO) that require copper cofactors. These enzymes have specificity towards diamines but can have some activity on the larger polyamines, spermidine and spermine [122]. The breakdown of putrescine by DAO enzymes results in the production of pyrroline, hydrogen peroxide and ammonia [126]. The larger polyamines spermidine and spermine are broken down by the activity of polyamine oxidases (PAOs) [122, 127]. The breakdown of spermine or spermidine by PAO enzymes results in 1,3-diaminopropane and 1-(3- aminopropyl) pyrroline, or 1,3-diaminopropane and pyrroline, respectively. This also results in the production of hydrogen peroxide [128]. The 1,3-diaminopropane can be converted into beta alanine and the pyrroline can be converted to gamma-aminobutyric acid (GABA) [122]. The

GABA has been associated with processes such as carbon influx into citric acid cycle, insect deterrence and cytosolic pH regulation [129]. Additionally, there is evidence to suggest that

GABA may act as a stress-signaling molecule [130, 131]. This method of polyamine catabolism is considered terminal catabolism since the larger polyamines are not broken down into the smaller polyamines but instead into different compounds. Originally, it was thought that terminal catabolism was the only type of polyamine catabolism in plants, but recently the mechanism for back conversion catabolism has been identified in Arabidopsis, rice, cotton and citrus [132-138].

In back conversion catabolism, spermine is broken down to spermidine, likewise spermidine is broken down to putrescine. The back-conversion pathway was identified in intracellular spaces such as the peroxisome and cytoplasm, where the terminal catabolism is prevalent in the apoplast

[127, 132, 139]. 18

Polyamines conjugates

Polyamines occur in multiple forms in nature; this includes free bases, conjugates and bound forms. The most common conjugated forms of polyamines are those that are linked to hydroxycinnamic acids (HCAA) [140]. The HCAA are thought to play a role in plant defense response to pathogens [141, 142]. In potato interaction with late blight pathogen, Phytophthora infestans, induction of HCAA production has been shown to be associated with the resistant phenotype [143]. Similarly, transgenic tomato plants overexpressing the tyramine N-

Hydroxycinnamoyltransferase gene involved in HCAA synthesis have increased HCAA levels as well as enhanced resistance to the bacterial pathogen Pseudomonas syringae [144]. The HCAAs are thought to play an important role enhancing physical and chemical barriers making the cell wall more resistant to penetration. In oats, certain HCAAs have been shown to exhibit antimicrobial activities and accumulate in leaves that are resistant to crown rust during infection

[126]. In the viral interaction of tobacco leaf discs with tobacco mosaic virus (TMV), it was shown that the HCAA caffeoylputrescine reduced lesion formation when applied to infected leaf discs [145]. HCAA such as p-coumaroylserotonin and feruloylserotonin are also reported to be antioxidants [146]. The HCAA may also be involved in the response to SDS. Soybean spermidine hydroxycinnamoyl transferase gene Glyma.10g119400 was found to be upregulated in soybean roots within five days after inoculation with F. virguliforme [78]. Polyamines can also be bound to macromolecules such as nucleic acids and proteins presumably to stabilize these molecules [147]. Apart from the metabolism, catabolism, and conjugation of polyamines, the levels of free polyamines can be changed based on their transport [126]. Not much is known about the transport of polyamines in plants, but it has been well studied in yeast and bacteria. In yeast, nine known proteins are involved in polyamine transport. TPO1, TPO2, TPO3 and TPO4, 19 which pump foreign molecules out from the cells, also recognize polyamines. Other proteins have been discovered in yeast, which transport polyamines to either the Golgi complex, vacuoles or cytoplasm [148]. In plants, polyamines appear to be localized to cell walls and the vacuoles with smaller pools in the mitochondria and chloroplasts [149-152]. The AtLAT1 encodes a stress induced polyamine transporter in Arabidopsis [153, 154]. Knockout mutants of AtLAT1 had increased stress resistance when exposed to oxidative stress [154]. Transgenic plants overexpressing AtLAT1 had increased sensitivity to polyamines, and the transporter appeared to have highest affinity for spermine followed by spermidine and relatively low affinity for putrescine [153]. Additional transporters have been identified in rice and Arabidopsis based on sequence analysis [155, 156]. All of the transporters identified fall into the LAT family of L-type amino acid transporters [154].

Function of polyamines in plants

The use of polyamine inhibitors greatly enhanced the identification of functions of polyamines in plants. Polyamines have been associated with various cellular and molecular activities including protein regulation, nucleic acid stabilization, as well as transcriptional and translational regulation [157-161]. This in turn regulates biological functions such as fruit growth and ripening, senescence, and reproductive organ development [162-168]. Polyamine accumulations have been found in response to abiotic stresses including: salinity, drought, heat,

UV, heavy metals, wounding and herbicide treatments [169-173]. It remains unclear how polyamines are involved in these responses. The mode of action may be linked to hormone signaling, as accumulation of putrescine and applications of putrescine have been associated with growth stimulation in plants [174-177]. The growth stimulation has been hypothesized to be a product of hormone signaling, senescence regulation or increased nitrogen availability. The 20 production of both spermidine and spermine require the donation of SAM through the action of

SAMDC. The SAM is also an important component of ethylene biosynthesis. Increased biosynthesis of spermine and spermidine can inhibit ethylene production and likewise inhibition of the polyamine metabolic enzymes ADC and ODC leads to increased ethylene levels [123,

178-181]. This antagonistic interaction of polyamines and ethylene may be part of the connection between polyamines and reduced senescence. Polyamine levels also appear to interact with abscisic acid (ABA). Exogenous application of ABA induces the movement of polyamines in the apoplast, where they undergo terminal catabolism by PAO enzymes [182]. It was noted that in the stress tolerant grape lines, polyamine movement and catabolism occurred coupled with increased expression of polyamine biosynthetic enzymes and restoration of polyamine homeostasis. In the sensitive lines, this did not occur [182]. Increased polyamine catabolism in the apoplast was linked to increased hydrogen peroxide production and stomatal closure [182].

Additionally, ABA deficient maize seedlings had reduced salt stress tolerance and reduction in polyamine biosynthesis. Addition of exogenous ABA or polyamines increased the dry weight of the stressed seedlings [183]. Investigation into UV stress in Arabidopsis suggested that both

ABA and ethylene play roles in regulating polyamines biosynthesis and catabolism [171].

Polyamine accumulation has been shown to delay senescence and maintain a juvenile state while increased polyamine catabolism is associated with induction of senescence [178]. Hydrogen peroxide is also involved in ABA dependent stomatal closure [184]. In Arabidopsis, it has been found that the hydrogen peroxide induced stomatal closure is derived from polyamine oxidase activity [185].

In dicots, diamine oxidases tend to be more highly expressed than polyamine oxidases

[132]. This has been noted in leguminous species including soybean seedlings [148]. The maize 21 and barley polyamine oxidases have been the most highly studied of the plant polyamine oxidases [132]. The polyamine oxidases in maize are tightly linked to the cell wall and are prevalent in tissues that are in involved in lignification and cell wall stiffening through secondary cell wall deposition [186]. There also has been a positive correlation between lignin peroxidase and polyamine oxidase localizations [187]. This supports the role of polyamines and polyamine oxidases in the strengthening of cell walls. Along with cell wall strengthening, polyamines and polyamine oxidases have been associated with light-induced inhibition of mesocotyl growth.

Exogenous application of auxin has been shown to decrease the light-induced expression of polyamine oxidase [132]. Polyamine oxidases in roots have been associated with the development of tracheary elements and root caps undergoing developmental programmed cell death [188]. Increased expression of polyamine biosynthetic enzymes SAMDC, ADC and SPDS have provided increased tolerance to different environmental stresses such as salt, cold and osmotic stresses [189]. Breakdown of apoplastic spermidine by polyamine oxidase was able to induce both salt stress response and programmed cell death [190]. One possible mechanism for the correlation of polyamine oxidase activity and stress tolerance may be through the breakdown of the larger polyamines spermine and spermidine, production of uncommon rare polyamines, and production of beta-alanine. In rice, it has been found in one case that increases in putrescine and spermidine are associated with the salt tolerance; in the other case, increases in spermine in addition to the other two polyamines was found to be associated with salt tolerance [191].

Polyamines and biotic stress

Plants encounter many microbe species including nematodes, fungi, bacteria and viruses, which they must defend against. To protect themselves, plants have multiple layers of defense.

The first layer of physical defense includes such characteristics as waxy cuticle, cell walls, and 22 stomatal closures. When microbes get past these barriers, plants rely on a highly evolved system to protect themselves from infection. To reduce pathogen spread, plants rely on recognition of microbes for responses including the production of microbial toxic chemicals such as phytoalexins, production of enzymes responsible for degradation of microbial proteins, callose deposition and programmed cell death. The involvement of polyamines in the plant-pathogen interaction is not clear; but there is plenty of evidence suggesting that polyamines are involved in the interaction. This involvement may vary by the type of interactions. Much of the original work in polyamines and their role in plant defense responses involved the interaction of plants with viruses. Increased accumulation of the polyamines putrescine and spermidine along with increases in the polyamine biosynthetic enzyme ornithine decarboxylase were observed in the hypersensitive response of tobacco to TMV [140, 192]. Further examinations of the increases in polyamines revealed that in TMV infected leaves there was no overall increase in spermine; but there was increased localization of spermine in the intercellular spaces, which are the sites of initial plant infection [193]. Polyamine levels and PAO expression increase in resistant tissues, which were infected with TMV and that inhibition of PAO by guazatine reduced the hypersensitive response [194]. Further experiments looking into the connection of polyamines and plant defense response show that spermine build up can activate pathogen-related (PR) proteins. This induction of PR proteins was independent of salicylic acid accumulation [193,

195]. These studies suggested an important role of spermine in the plant response to viral infection. Another plant-pathogen interaction that has shown the involvement of polyamines in the plant defense is the interaction of barley with the powdery mildew fungus. In this interaction, researchers found that there were increased levels of all polyamines during the host interaction with the fungal pathogen and the increased level of polyamines was accompanied by increases in 23 the activities of both the biosynthetic and catabolic enzymes [196]. In the interaction of chickpea with the fungal pathogen Ascochyta rabiei, researchers found that there was an increased activity of diamine oxidase enzyme responsible for the breakdown of putrescine in the resistant cultivar, when compared to the susceptible cultivar [197]. These changes in polyamine levels suggest an important involvement of polyamines and their biosynthetic and catabolic enzymes in host responses to the fungal pathogen.

Focus has been placed on the importance of the breakdown of these molecules and the byproduct of this breakdown, which is hydrogen peroxide [198]. Both diamine oxidase and polyamine oxidase, the two enzymes responsible for polyamine breakdown have been localized predominantly to plant cell wall and apoplastic space. This localization leads to the hypothesis that they are involved in the lignification of plant cell walls and involved in the formation of callose deposition during infection [197, 199]. It is also hypothesized that they are involved in triggering program cell death (PCD), which is involved in the hosts’ hypersensitive response to pathogens [200]. The interactions of TMV and tobacco, and barley and powdery mildew produce increased levels of polyamines during infection. However, in the interaction of sugarcane with

Ustilago scitaminea the levels of the polyamines putrescine and spermidine were found to be decreased while spermine was increased [201]. In the soybean- F. virguliforme interaction, the soybean spermidine synthase gene Glyma.02G033900 showed increased expression in a resistant

RIL as compared to the susceptible ‘Essex’ cultivar [90].

Hydrogen peroxide and plant defense response

Hydrogen peroxide homeostasis is highly regulated by cells. It is an important molecule in the plant cellular signaling as well as a toxic byproduct of cellular metabolism. Reactive oxygen species (ROS) burst and the production of hydrogen peroxide is one of the first reactions 24 in plants to pathogen attack. One of the well-known results of ROS burst is the hypersensitive response and cell death that follows [202-204]. ROS can interact with many different cellular components such as membrane lipids, proteins and DNA. Interaction of ROS with membrane lipids cause dissociation of lipids, reducing photosynthetic abilities of chloroplasts, and electrolytes leakage [205]. The damage to DNA and membranes can lead to PCD. In the biotrophic interaction, the PCD is a response that can limit the growth and spread of the pathogen through living tissues and is one of the ways in which hydrogen peroxide plays a role in the plant-pathogen interaction [206]. The OXI1 identified in Arabidopsis seems to regulate the hydrogen peroxide response during PCD. Mutation in OXI1 has enhanced susceptibility along with reduced activity in two stress-related mitogen-activated phosphate kinase (MAPK) genes

[207]. The MAPKs are important signaling molecules for responses to both biotic and abiotic stresses [207]. The MAKKK OMTK1 identified in alfalfa, is activated by hydrogen peroxide that results in the activation of the downstream MAPK, MMK3. The MMK3 can also be activated by ethylene and the presence of elicitors resulting in PCD [208]. In addition, signal transduction by

MAPK changes hydrogen peroxide levels that affect calcium ion fluctuations [209]. Altered calcium ion concentrations can lead to activation of calcium- and calmodulin-regulated proteins resulting in PCD, production of more hydrogen peroxide or activation of hydrogen peroxide scavenging catalase enzymes [210, 211]. It has been suggested that hydrogen peroxide has a direct antimicrobial effect on plant pathogens [212]. Due to the presence of antioxidant molecules such as peroxidases in soybean root cells, and the importance of hydrogen peroxide homeostasis, it is not likely that cellular hydrogen peroxide increases to levels high enough to be antimicrobial. The role of hydrogen peroxide acting as a direct antimicrobial in the plant-fungal interaction remains controversial [213-215]. In addition to the role of hydrogen peroxide as a 25 signaling molecule, it is also important for cell wall formation. Callose is known to be synthesized rapidly in response to microbial attack and is thought to slow pathogen attack providing time for the plant to mount a defense [216]. Callose deposition is correlated with the levels of hydrogen peroxide produced during pathogen attack as well as ABA levels [217]. In

French bean, known defense related proteins including extension-like hydroxyproline-rich glycoprotein and chitin-binding proline-rich glycoprotein are cross-linked with the cell wall during infection. This cross-linking occurs within 15 minutes of activation with MAMP trigger and is hydrogen peroxide dependent [218].

While the production of hydrogen peroxide during biotrophic pathogen infection has been linked to increased resistance, the role of hydrogen peroxide production during the necrotrophic interaction is a bit more complicated. In Arabidopsis, rapid cell death induction after infection leads to increased susceptibility to B. cinerea [219]. During this infection process, hydrogen peroxide production occurs in the infection sites and the surrounding uninfected areas suggesting a role of hydrogen peroxide in signaling [220]. Additional reports show that B. cinerea may benefit from plant-produced hydrogen peroxide that can induce the hypersensitive response and plant cell death [221-223]. Botrytis cinerea is also able to germinate and grow in relatively high concentrations of hydrogen peroxide [224]. The fungus produces two enzymes, ascorbic peroxidase and glutathione peroxidase, which are able to break down hydrogen peroxide [225]. Timing and intensity of hydrogen peroxide production may be key to deterring or aiding necrotrophic pathogens during plant infection. B. cinerea enhanced resistance tomato species; Lycopersicon sitiens shows a hyper-induction of hydrogen peroxide in epidermal cell wall four hours post inoculations. This hyper-induction was associated with cell wall protein 26 modification and crosslinking with phenolic compounds. Interestingly the L. sitiens enhanced resistance lines were also abscisic acid deficient [226].

Polyamines in Fungi

Polyamine metabolism

Polyamine biosynthesis in fungi is thought to be similar to polyamine biosynthesis mechanisms in animals [227]. Putrescine is produced from the decarboxylation of ornithine by the enzyme ornithine decarboxylase (ODC). It is the first enzyme in the polyamine biosynthesis pathway as well as a rate-limiting enzyme [228]. There is a feedback regulation of ODC by spermidine and spermine [229-232]. This regulation is through production of the antizyme.

Antizyme was first identified in animals, and later in yeast. In yeast, the levels of the antizyme are induced by the presence of spermidine [233]. The inhibition of ODC by the antizyme is reversible [234]. Arginine decarboxylation observed in plants [235, 236] has also been reported in fungal species but is not a main source of putrescine biosynthesis [237-240]. After the synthesis of putrescine, the polyamine biosynthesis pathway follows the same steps as plant polyamines. Putrescine is converted into spermidine through the addition of an aminopropyl group from the decarboxylation of s-adenosylmethionine through the action of s- adenosylmethionine decarboxylase [241]. Spermidine synthase transfers the aminopropyl group to putrescine. An additional aminopropyl group is decarboxylated and transferred to spermidine to produce spermine [241]. Many fungal species do not complete the last step and do not produce spermine [242, 243]. While spermine appears to be dispensable, spermidine and putrescine are necessary for fungal growth and survival [244]. Since polyamine metabolism differs in fungi and plants it has been an area of interest for control of phytopathogenic fungi [245]. The main target for these experiments has been ODC since it is the rate-limiting step in polyamine biosynthesis. 27

Plants are capable of producing putrescine through the ADC pathway and, therefore, could survive treatment that targets ODC. Chemicals screened for interrupting fungal polyamine metabolism include 1-aminooxy-3-aminopropane [246], difluoromethylornithine (DFMO) [247-

250], methylglyoxalbisguanylhydrazone (MGBG) [251], ethylmethylglyoxalbisguanylhydrazone

(EMGBG) [251]. In addition, inhibitors of polyamine biosynthesis are spermidine synthase inhibitor cyclohexylamines (CHA) [252] and the potential ADC inhibitor difluoromethylarginine

(DFMA) [253]. DFMO’s antifungal effects have been well investigated, and DFMO has been shown to effectively reduce fungal growth in some plant pathogenic fungi. Application of

DFMO has been shown to reduce disease severity for powdery mildew, and rust diseases in barley as well as Verticillium wilt [251]. The inhibitors MGBG and EMGBG have not been investigated to the same extent as DFMO but have shown effective growth inhibition of multiple fungal strains [251]. The sensitivity to these inhibitors appear to vary by fungal species examined. With the spermidine synthase inhibitor, CHA the only one of the fungi screened for growth reduction was significantly affected [251].

Polyamine transport has been well studied in fungi. In yeast, four polyamine excretory proteins are located on the plasma membrane (TPO1-4). Two of the TPO proteins were able to transport all three polyamines while the other two had specificity to spermine [254-256].

Additional polyamine transport proteins were identified that transport polyamines into the Golgi apparatus and into the vacuole [257, 258].

Polyamine catabolism

Polyamine hemostasis is important for proper cellular function. There are two known pathways for the catabolism of polyamines, back-conversion and terminal catabolism. In the back-conversion catabolism, the higher polyamines are broken down to their smaller units. The 28 process starts with the acetylation of the aminopropyl group of spermine or spermidine by a spermine or spermidine N1-acetyltransferase. This reaction produces N1-acetylspermine or spermidine. The acetylated products, N1-acetylspermine or spermidine, are then degraded by polyamine oxidase enzymes resulting in the production of spermidine or putrescine, respectively, along with 3-aminopropanol [259-265]. Putrescine can then be oxidized by diamine oxidase enzyme leading to the production of GABA or 2-pyrrolidone and 5-hydroxy-2-pyrrolidone.

Additionally, putrescine can be acetylated and oxidized by a monoamine oxidase resulting in the production of non-alpha-amino acids and gama-lactams [122].

Role of fungal polyamines

The polyamines putrescine and spermidine are present in all fungal species, whereas spermine is missing in some filamentous fungal species [242]. In Ustilago maydis, spermidine is vital for fungal growth and development [266]. Putrescine and spermidine have been shown to be important for cell growth and differentiation. Application of polyamine synthesis inhibitors inhibits activities including spore germination, sporulation, and appressorium development

[266]. The ODC is a key enzyme in the production of putrescine. Fungal mutants for ODC genes have been studied in U. maydis and Ganoderma lucidum. In G. lucidum, ODC-silenced fungal strains had increased presence of reactive oxygen species and were more sensitive to oxidative stress. Additionally, there was an increased production of the secondary metabolite ganoderic acid [267]. Single gene knockouts of fungal polyamine oxidase in U. maydis have normal growth and are able to infect maize normally [265]. Growth of the soybean pathogen

Colletotrichum truncatum was inhibited when putrescine biosynthesis was inhibited by the addition of DFMO [261]. Additionally, putrescine inhibition by DFMO also inhibited growth of

Rhizoctonia solani, B. cinerea, Sclerotina scletoriorum, Fusarium oxysporum and Cochliobolus 29 carbonum [247, 250, 251, 269]. While reduced putrescine biosynthesis can stall fungal growth, excessive polyamines are also detrimental to fungi. Application of spermidine to infection site of

Colletotrichum gleosporioides was able to inhibit germination and appressorium development.

This inhibition was overcome by exogenous application of calcium suggesting an interplay of calcium ion regulation and polyamines [270]. Likewise, appressorium formation in the rice pathogen Magnaporthe grisea is inhibited by the addition of putrescine, spermidine and spermine. In this example, the addition of cAMP was able to restore proper appressorium formation suggesting a role of cAMP in the appressorium formation downstream of polyamine regulation [271]. Polyamines are essential for growth as has been shown in Neurospora crassa,

Saccharomyces cerevisiae, Tapesia yallundae, Yarrowia lipolytica, and U. maydis. [244, 272-

274]. The Stagonospora nodorum and U. maydis ODC mutants have been shown to reduce virulence [265, 272, 275, 276]. Additionally, U. maydis mutants for spermidine synthase genes spe and SAMDC had reduced virulence [277].

Production of mycotoxins by Fusarium species appears to be affected by changes to polyamine homeostasis. Production of the mycotoxin deoxynivalenol (DON) is induced in the presence of the polyamine putrescine and the polyamine precursor ornithine [278]. Additionally, in the penicillin producing fungi, Penicillium chrysogenum and Acremonium chrysogenum spermidine causes an induction of the penicillin biosynthetic genes pcbAB, pcbC and penDE.

Additions of putrescine and spermine had no effects on the expression of penicillin biosynthetic genes [279]. Penicillium chrysogenum treated with spermidine had increased pigmentation [280].

It is also interesting that expression of the secondary metabolite biosynthesis regulator LaeA is increased in the presence of spermidine [281]. LaeA interacts with the velvet complex components and regulates expression of toxin and antibiotic biosynthesis. In Cochliobolus 30 heterostrophus the LaeA and velvet complex regulate T-toxin production and fungal virulence

[282]. In Fusarium species, they can regulate secondary metabolism, mycotoxin production and virulence [283-286]. Therefore, in filamentous fungi polyamine homeostasis may play an important role in regulation of the secondary metabolites and phytotoxic compounds production.

Phenylacetic acid and plant-pathogen interactions

Phenylacetic acid is an organic compound containing both a phenyl functional group and a carboxylic acid. Phenylacetic acid (PAA) is synthesized from phenylalanine [287]. In plants

PAA is an endogenous plant auxin, which regulates a similar, but distinct from the metabolic pathway regulated by auxin IAA [288]. Fungi also produce phenylacetic acid. In the plant pathogen R. solani, PAA production is important for infection [289-291]. The fungus has been shown to produce PAA and conjugated forms of PAA. Production of PAA by the pathogen and survival of tomato roots following infection was found to be negatively correlated [292]. This suggests that the PAA could play a role in helping to cause disease in tomato roots. How PAA aides in disease development is not known. The PAA may act as a building block for toxin production. In penicillin-producing fungi, PAA is one of the building blocks to penicillin production. The penicillin production appears to be regulated by the presence of 1,3 diamine- propane and spermidine. Addition of these amines in the culture media of P. chrysogenum resulted in increased penicillin production [281]. Both PAA and quinic acid share metabolic intermediate. Quinic acid has been found to be produced by fungi that live on dead and decomposing materials. Quinic acid induction reduces the amount of PAA produced [293]. This could be part of the mechanism switching from plant pathogen to saprophyte or may be a byproduct of that switch. 31

While PAA has been suggested to play a role in the toxic effect of fungal pathogens, it has also been suggested that in plants, it protects from fungal pathogens. The PAA is produced by beneficial bacteria during plant-microbe interactions triggering induced systemic resistance

[294]. Induced systemic resistance is a plant defense mechanism that detects microbe-produced compounds to induce a systemic resistance response. The mechanism is similar to the systemic acquired resistance pathway but is thought to work through jasmonic acid signaling pathway rather than the salicylic acid pathway [295]. Application of culture filtrate fractions containing

PAA or purified PAA was able to induce the ISR pathway in tomatoes [294, 296]. In addition,

PAA has its own antibiotic effect and fungal plant pathogens grown on plates containing PAA have reduced growth [294]. These results suggest that PAA has an important role in protecting plants from invading pathogens. In the interaction of the susceptible soybean cultivar ‘Spencer’ with F. virguliforme, the levels of phenylacetate were decreased in the infected root tissues when compared with the non-inoculated roots [78].

While PAA has been known to be both a plant hormone and a fungal product, the role of

PAA in the plant-pathogen interaction is still unclear. It appears that PAA may play multiple roles in the interaction and can be both used by fungal pathogens in the production of toxic compound or can be recognized and used by the plant to induce ISR. While there does not seem to be a direct connection between polyamines and phenylacetic acid, there may be an interaction in their roles in secondary metabolite production. The polyamine spermidine has been shown to increase secondary metabolites by regulating LaeA and PAA is a building block for penicillin in

P. chrysogenum. Therefore, these two chemicals may interact to regulate the production of secondary metabolites in Fusarium virguliforme as well. 32

CHAPTER 3 IDENTIFICATION OF A FUNCTIONAL INFECTION-INDUCED

FUSARIUM VIRGULIFORME POLYAMINE OXIDASE GENE, FVPO1

Abstract

Fusarium virguliforme is a soil borne fungal pathogen responsible for causing sudden death syndrome (SDS) in soybean. The disease produces both root rot symptoms as well as foliar chlorosis and necrosis leading to yield suppression. Currently, there are no known genes for resistance to SDS; therefore, an understanding of the mechanisms used by the fungus to cause the disease is an important step in sustaining soybean yields. Transcriptomic investigations showed that F. virguliforme increases expression of many cell wall degrading and phytoalexin detoxification enzymes during infection. In addition to these known infection-related genes, a polyamine oxidase gene (FvPO1) from F. virguliforme was identified to have increased expression during infection of soybean roots. Polyamine oxidases from fungi have not been well characterized for their role in disease development. Here I have investigated the role of FvPO1 in

F. virguliforme using knockout mutants created through homologous recombination. The FvPO1 protein was shown to be a functional polyamine oxidase and able to degrade both spermine and spermidine. Knockout mutants do not have any visible phenotypic differences from the wild type fungus and grow normally on potato dextrose agar media. Disease assays with the Δfvpo1 mutant did not show any reduced or increased disease symptoms. The F. virguliforme polyamine oxidase gene FvPO1 identified to be upregulated during infection is a functional polyamine oxidase gene and is not required for fungal growth, and disease development. 33

Introduction

Soybean is one of the most important crops produced in the United States of America.

Soybean is an important source of oil and protein for both animal and human consumption. The

United Stated has been the world leader in soybean production, and in 2016 produced 117.2 million metric tons of soybeans with a value of 40.9 billion dollars [1]. Multiple different pathogenic organisms such as nematodes, fungi, bacteria, and insect pests threaten soybean yield.

Estimated percent of soybean yield lost due to pathogen attack in 2015 was 11.7% [2]. One pathogen responsible for yield loss in soybean is Fusarium virguliforme, a filamentous fungal pathogen responsible for sudden death syndrome (SDS) in United States [3]. The disease also threatens important soybean producers in South America. Brazil and Argentina rank as the second and third largest soybean producing nations in 2016, producing 108 and 55.5 million metric tons of soybeans, respectively [1]. Sudden death syndrome is caused by four Fusarium species in Southern America; these include F. virguliforme, F. tucumaniae, F. brasiliense, F. crassistipitatum [4, 5]. In 2015, yield loss from SDS in the United States was estimated at 43.7 million bushels, and SDS was ranked third in soybean yield limiting diseases [2]. SDS was first discovered in Arkansas in 1971 [3] and has since spread throughout the soybean growing regions of the United States and into Canada [6].

Fusarium virguliforme is a soil pathogen that enters the roots and stays in the roots and crown of the plant [3]. The fungus produces foliar symptoms through the production of toxins that are responsible for foliar chlorosis and necrosis [7-9]. So far, multiple potential toxins have been identified in F. virguliforme. An unknown 17 kDa polypeptide toxin was identified in F. virguliforme cell free culture filtrate, but the gene responsible for the toxin production was never identified [7]. Another proteinaceous toxin identified in F. virguliforme is FvTox1 [8]. 34

Transgenic plants expressing antibodies against FvTox1 reduced foliar symptoms upon F. virguliforme inoculation [10]. Likewise, susceptible soybean cultivars inoculated with fungal knockout strains for FvTox1 showed reduced foliar symptoms and increased chlorophyll content when compared to plants inoculated with the wild type Mont-1 strains [11]. In addition to

FvTox1, multiple effector proteins, polyketide synthesis genes and secondary metabolites, which may be involved in the production of foliar disease, have been identified in the F. virguliforme genome [9]. One such effector is FvNIS1 that was able to produce interveinal chlorosis when expressed in soybean leaves [9].

The genome sequence of the F. virguliforme strain Mont-1 along with gene annotations is available at http://fvgbrowse.agron.iastate.edu [12]. This fungal genome sequence contains multiple predicted plant cell wall degrading enzymes including 66 carbohydrate esterases, 292 glycoside hydrolases and 28 pectate lyases [13]. Changes in the F. virguliforme transcriptome during later infection stages (at least 10 days after inoculation) show that multiple cell wall hydrolytic enzymes are highly induced during infection [14]. Along with the cell wall degrading enzymes, F. virguliforme also has increased expression of genes for degrading host defense compounds which show homology to known phytoalexin detoxification proteins such as maackiain detoxification protein MAK1 from Nectria haematoccoca and pisatin demethylase protein FoPDA1 from Fusarium oxysporum f. sp. pisi [15, 16]. Interestingly, this investigation also showed that a fungal polyamine oxidase gene (FvPO1) also had increased expression during

F. virguliforme infection of soybean roots. This polyamine oxidase gene had increased expression throughout the infection cycle from one-day post inoculation to ten-day post inoculation [14]. Nothing is currently known about the role of fungal polyamine oxidase genes during infection. 35

Polyamine oxidases are a class of enzymes that are responsible for the breakdown of the polyamines spermine and spermidine [17, 18]. Polyamines have been associated with various cellular activities including protein regulation, developmental regulation, nucleic acid stabilization, transcriptional and translational regulation, stress response and reactive oxygen species regulation [19-21]. The breakdown of polyamines by polyamine oxidases results in the production of hydrogen peroxide, an amine group, and oxygen [22, 23]. Both plant polyamine oxidases and hydrogen peroxide are known to be associated with the plant-pathogen interaction

[24-32]. Polyamine oxidases can produce reactive oxygen species (ROS) which are one of the earliest events in the plant hypersensitive response [33]. The ROS can interact with many different cellular components such as membrane lipids, proteins and DNA. Interaction with membrane lipids causes dissociation of lipids and can reduce photosynthetic abilities of chloroplasts resulting in leakage of electrolytes [34]. The damage to DNA and membranes can lead to cell death. In the biotrophic interaction, programmed cell death is a response that can limit the growth and spread of pathogens through living tissues, and is one of the ways in which hydrogen peroxide plays a role in the plant-pathogen interaction [35]. Hydrogen peroxide is important in plant cell wall development and in defense [36-38]. Production of hydrogen peroxide is needed for the production of callose deposition [39-41]. In French bean, known defense related proteins including extension-like, hydroxyproline-rich glycoprotein and chitin- binding, proline-rich glycoprotein are cross-linked with the cell wall during infection. This crosslinking is rapid; occurring within 15 minutes of activation with microbe-associated molecular pattern (MAMP) triggers and is hydrogen peroxide dependent [42]. During infection with the necrotrophic pathogen, Botrytis cinerea, hydrogen peroxide production occurs in the infection spots and the surrounding uninfected area suggesting a role for hydrogen peroxide in disease 36 signaling [43]. Additional reports show that B. cinerea growth is not restricted by the ROS burst and B. cinerea infection may benefit from plant production of hydrogen peroxide [44-46].

There has not been any evidence so far that the plant polyamine oxidase plays an important role in phytopathogen virulence. Investigations with the Ustilago maydis polyamine oxidase single knockout mutants show normal growth and were able to infect maize, but the extent of the infection was reduced [47]. Additionally, perturbation of polyamines effects sporulation and spore germination [48, 49]. Based on the known importance of both polyamine oxidase activities and hydrogen peroxide in the plant-pathogen interaction combined with the upregulation of the FvPO1 polyamine oxidase gene in F. virguliforme during infection of soybean, we developed and tested the hypothesis that the F. virguliforme polyamine oxidase FvPO1 plays a role in SDS disease development. Results gathered in this study indicate that it is unlikely that

FvPO1 plays any critical role in SDS disease development.

Methods

Phylogenetic analysis

For creating the fungal polyamine oxidase phylogenetic tree, amino acid sequences except FvPO1 (g6063) and FvPO2 (g12304) were obtained from NCBI database [12]. Accession numbers and references to the polyamine oxidase genes can be found in the Table 3.1.

Phylogenetic tree was constructed with MEGA 7 using the UPGMA method with bootstrapping at 1000 replicates. Polyamine oxidase sequence from the oomycete Phytophthora nicotianae was used as an outgroup. Alignment and domain identification was conducted using Simple Modular

Architecture Research Tool with PFAM domain and signal peptide settings (http://smart.embl- heidelberg.de/). 37

Strains and growth conditions

The virulent F. virguliforme Mont-1 strain was obtained as a single-spore isolate of F. virguliforme collected from Illinois in 1991. The isolate was maintained on Bilay medium (0.1%

KH2PO4 [wt/vol], 0.1% KNO3 [wt/vol], 0.05% MgSO4 [wt/vol], 0.05% KCl [wt/vol], 0.02% starch [wt/vol], 0.02% glucose [wt/vol], and 0.02% sucrose [wt/vol]). To produce the inoculum.

Mycelial plugs were then transferred to spore plates (1/3 strength PDA) and incubated at room temperature (24 ± 2°C) in darkness for 14 days.

Construction of gene replacement cassettes

Knockout Δfvpo1 mutants were created using the homologous recombination protocol described previously [11, 50]. PCR for FvPO1 and FvPO2 upstream and downstream fragments was conducted using Cx PFU Turbo Taq polymerase (Agilent Technologies, Santa Clara, CA) primers are listed in Table 3.2. The two PCR fragments were cloned into the pRF-HU2 binary vector using the USER enzyme mix (New England Biolabs, Inc, Ipswich, MA). The resultant plasmid was transformed into Agrobacterium tumefaciens EHA-105 strain. Positive EHA-105 colonies were grown overnight at 28°C in YEP medium (Cold Spring Harbor Protocol, 2006) amended with kanamycin sulfate (50 µg/mL) and rifampicin (25 µg/mL). For Δfvpo1 complementation, a fragment containing 3,594 bp, including the FvPO1 5’-end region, gene and

3’-end region, and the 1 kb fragment containing the FvPO1 3’-end sequence was amplified using the Cx PFU Turbo Taq polymerase. The fragments were cloned into the pRF-HU2 vector with the hygromycin-resistance gene replaced with the geneticin-resistance gene using the USER enzyme mix. The resulting plasmid was transformed into A. tumefaciens strain EHA-105 and positive colonies were selected and confirmed by conducting restriction digestion and gel analysis. 38

Fusarium virguliforme transformation

EHA105 cultures containing the positive cassettes were used to inoculate IMAS medium containing kanamycin sulfate (50 μg/μL) and grown until the OD600 was between 0.5 and 0.7.

The cultures were then mixed in a 1:1 ratio with F. virguliforme spore (either Mont-1 or Δfvpo1) at the concentration of 2 x 106 spores/mL. The mixture was then plated on black filter paper

(Whatman, GE Healthcare Bio-Sciences, Pittsburgh, PA) layered over IMAS plates. After 3 days of co-culture, the filter papers were transferred to DFM plates containing hygromycin (150

μg/mL) or geneticin (150 μg/mL) and cefotaxime (300 μg/mL). After 3-5 days on the DFM plates, the filters were moved to new DFM plates containing hygromycin (150 μg/mL) or geneticin (150 μg/mL) and cefotaxime (300 μg/mL).

Mutant growth phenotyping

Fungal growth was observed on PDA, and 1/3 PDA. Measurements of growth radius from the initial plug were recorded every two days for 11 days. Five technical replications were completed. Data were analyzed using R software.

Knockout mutant and complemented F. virguliforme isolates were checked for polyamine oxidase activity on polyamine oxidase activity (PA) minimal media (1% glucose

[wt/vol], 0.02% MgSO4 7H2O [wt/vol], 0.3% KH2PO4 [wt/vol], 0.1 mL Trace Elements) containing spermine (500 µM) or spermidine (690 µM) as the sole nitrogen source. For Petri dish assays, a plug of fungal growth was transferred from a culture grown on Bilay media (0.1%

KH2PO4 [w/v], 0.1% KNO3 [w/v], 0.05% MgSO4 [w/v], 0.05% KCl [w/v], 0.02% starch [w/v],

0.02% glucose [w/v], 0.02% sucrose [w/v] and 2% agar [w/v]) to the center of the Petri dish. The growth of the fungus was measured five days and eight days after transferring the fungal plug.

For growth analysis of the isolates generated from conidial spores, spores were harvested from 39

1/3 PDA media and diluted to 1 x 103 spores /mL in water. One hundred µL of spore suspensions were plated on PA plates containing spermine. Photographs of Δfvpo1 or Δfvpo1::FvPO1growth were analyzed using ImageJ software [51] to measure the fungal growth. The average area of fungal growth was calculated for five replications.

Infection phenotyping

To determine the responses of soybean to F. virguliforme isolates, ‘Williams 82’ seeds were soaked in a Petri dish containing 20 mLs of either water, or a spore solution (1x 106 spores per mL) from Δfvpo1 or Δfvpo1::FvPO1. The seeds were soaked for 1 h. After 1 h, the Petri dishes were drained, and the seeds were planted in Styrofoam cups containing wet coarse vermiculite. The seeds were germinated for 48 h and then watered every 24 h with 100 mL of water for the remainder of the experiment. For each cup, disease incidence based on the percent of plants showing disease and disease severity were scored three weeks after inoculation. Disease severity (DS) was calculated on a scale of one to nine, with one being mild yellowing and nine being completely dead plants. Disease incidence (DI) is calculated as the percent of plants showing foliar disease. Disease index was calculated as DI x DS / 9 [52]. Three weeks after inoculation, plants were uprooted and washed gently to remove the vermiculite. Root rot of each plant was scored as the percent of the root showing rot. Three biological replications were conducted. An ANOVA was conducted using R software and applied Tukey’s HSD to determine the significant difference between treatments.

Results

Phylogenetic analysis of FvPO1

Previously F. virguliforme genes with increased expression during soybean root infection were identified in a transcriptomic study conducted on soybean roots infected with F. 40 virguliforme. One of the F. virguliforme genes, which had greater than ten-fold up-regulation during infection when compared with spores and mycelia was the gene g6063 that encodes a polyamine oxidase (FvPO1) [14]. A phylogenetic tree was created for fungal polyamine oxidases of both fungal plant pathogens and fungi that are non-pathogenic to plants. FvPO1 was placed in a clade with polyamine oxidases from Fusarium species and with other plant pathogen species

(Figure 3.1A). A second Fusarium virguliforme polyamine oxidase FvPO2 (g12304) was placed in the same clade with FvPO1. At the amino acid level, FvPO2 has 65 percent identity with

FvPO1. Analysis of FvPO1 using Simple Modular Architecture Research Tool showed the presence of a signal peptide from the amino acid 1 to 22, a NAD binding domain spanning amino acids from 40 to 113 and an amino oxidase domain from amino acid 45 to 496 (Figure 3.1B).

FvPO2 has a signal peptide from amino acid 1 to 24, a NAD binding domain from amino acid 38 to 116 and two amino oxidase domains from amino acid 43 to 191 and from 208 to 479 (Figure

3.1B).

Generation of FvPO1 deletion mutant and its complemented strain

To confirm the role of FvPO1 in SDS disease development, Δfvpo1 knockout mutants and its complemented mutant strain were created in the aggressive F. virguliforme isolate Mont-

1 [53]. Homologous recombination vectors carrying a hygromycin resistance gene (hph) were recovered from the transformations [50]. We failed to recover any transformants for the FvPO2 knockout from either the Mont-1 background or the Δfvpo1 background. Both the Δfvpo1 and the Δfvpo1::FvPO1 had normal growth on PDA and 1/3 PDA plates (Figure 3.2); there was no statistical difference in the fungal growth on PDA plates from day 3 to day 11 among Mont-1,

Δfvpo1 and Δfvpo1::FvPO1 (ANOVA, p = 0.139). Additionally, Δfvpo1 was able to produce spores normally and it did not show any differences in spore germination. 41

FvPO1 is a functional polyamine oxidase

Polyamine oxidases break down the polyamines spermine and spermidine. In doing so, they release hydrogen peroxide and an amine group. The free amine group contains nitrogen and can be utilized by the fungus to support its growth, when nitrogen is absent in the media. To determine if the FvPO1 protein was able to break down both spermine and spermidine, fungal growth assays were conducted on PA media containing either spermine or spermidine as the sole nitrogen source. If the FvPO1 gene is functional, complemented mutant should be able to grow at an accelerated rate when compared to Δfvpo1. In the Δfvpo1::FvPO1 strain, there was significantly increased growth on both spermine and spermidine amended PA media when compared to the control plates without polyamines. This suggests that the fungal polyamine oxidase proteins are able to breakdown spermine and spermidine and use the amine groups as a nitrogen source. At five days after plating, the Δfvpo1mutant does not have significantly increased levels of growth on either PA medium when compared to the control plates without polyamines. This suggests that the polyamine oxidase function is reduced in the mutant.

However, eight days following plating there was a significant difference in growth of the

Δfvpo1mutant on PA plates containing either spermine or spermidine as compared to that on PA plates with no polyamines.

On the plates containing spermidine as the sole nitrogen source there appeared to be a reduction in radial growth in the Δfvpo1 mutant at both five days and eight days of growth when compared with that of the Δfvpo1::FvPO1; however, the differences between Δfvpo1 and

Δfvpo1::FvPO1 were not statistically significant (Tukey’s HSD, p = 0.103, and p = 0.300, respectively). On the contrary, when spermine was used as the nitrogen source in PA medium the differences in radial growth were significant at both five days and eight days after plating 42

(Tukey’s HSD, p = 0.003, and p < 0.001, respectively). These results suggest that FvPO2 or another enzyme(s) capable of degrading polyamines appears to have a reduced ability to metabolize spermine than spermidine (Figure 3.3 A). This agrees with our previously published microfluidic experiments showing reduced growth in Δfvpo1 and Δfvpo1::FvPO1 spores in liquid PA media containing spermine [50]. Transcriptomics study showed that FvPO2 has increased expression in mycelia than in germinating spores [14]. RT-PCR confirmed that germinating spores have reduced expression of FvPO2 compared with FvPO1 (Figure 3.3 D).

Therefore, radial-growth of colonies generated from germinating spores were measured on PA plates containing spermine as a sole nitrogen source. Growth area was measured for Δfvpo1 and

Δfvpo1::FvPO1 after five days of growth. As expected, retarded growth was observed in the

Δfvpo1 mutant since it cannot metabolize spermine as efficiently as Δfvpo1::FvPO1 (Figure 3.3

B and C). The growth results demonstrated conclusively that FvPO1 is a functional polyamine oxidase protein that can metabolize spermine to sustain its growth in nitrogen depleted PA medium.

Phenotyping fvpo1 mutants

Based on the increase in expression of FvPO1 during F. virguliforme infection of soybean roots, it was hypothesized that FvPO1 may play a pathogenicity function. To assess the role of the FvPO1 enzyme in pathogenicity, infection assays were conducted using conidial spores of the Δfvpo1 knockout mutant and Δfvpo1::FvPO1 complemented mutant. Both Δfvpo1 and Δfvpo1::FvPO1 isolates were able to cause root rot and foliar SDS symptoms in ‘Williams

82’ (Figure 3.4 A and B). Soybean plants inoculated with both Δfvpo1 and Δfvpo1::FvPO1 spores produced typical foliar SDS symptoms including interveinal chlorosis and necrosis along with leaf abortion in severely diseased plants. Three growth chamber experiments were 43 conducted. There was no significant difference in either foliar disease indices (Tukey’s HSD, p =

0.987) or root rot percentages (Tukey’s HSD, p = 0.951) between the Δfvpo1 and

Δfvpo1::FvPO1 isolates. Therefore, it was concluded that the FvPO1 gene is not required to cause either root rot or foliar SDS symptoms.

Discussion

Fusarium virguliforme is a devastating soybean pathogen. The fungus is a soil borne pathogen that infects root tissues and produces both root rot symptoms as well as foliar chlorosis and necrosis [3]. SDS resistance is a quantitative trait with many loci, each contributing small effect [6]. This correlates with the mode of disease development and gene expression [14, 54].

The fungus infects the roots early in plant growth, and its invasion of the xylem tissue is necessary for foliar disease development [54]. The fungus deploys an arsenal of both cell wall hydrolytic enzymes that degrade soybean roots, and produce toxic compounds, resulting in foliar symptoms [10, 13, 14]. Along with the increased expression of the genes encoding fungal hydrolytic enzymes and phytoalexin detoxification enzymes, increased expression of the polyamine oxidase gene FvPO1 was observed in the infected soybean root tissue [14]. FvPO1 expression is relatively constant between one day and ten days post inoculation [14].

Phylogenetic analysis of FvPO1 groups it with polyamine oxidase genes from other

Fusarium species. There is a second polyamine oxidase gene in F. virguliforme genome, FvPO2, which is 65% identical to FvPO1 at the amino acid level. Study of the knockout FvPO1 mutant showed that FvPO1 is not essential for fungal growth. The lack of transformation success for

FvPO2 suggests that either FvPO2 mutants are lethal or FvPO2 may reside in a genomic region with a very low recombination rate. 44

FvPO1 encodes a functional polyamine oxidase, which can breakdown both spermidine and spermine. While the fungal growth on media with spermine or spermidine as sole nitrogen source was reduced in the Δfvpo1 mutant, its growth was significantly increased in PA media amended with either spermine or spermidine as compared to that in PA medium with no polyamines. Therefore, it appears that FvPO2 can metabolize both spermine and spermidine to sustain its growth in the absence of FvPO1.

The Δfvpo1 growth on spermine plates is much less than that in the plates containing spermidine (Figure 3.3A). This observation may suggest that FvPO2 metabolizes spermidine more efficiently than spermine. Plants polyamine oxidase genes have been shown to play a role in plant-pathogen interactions [55]. While the exact role is not completely known, there is good evidence to suggest that the production of hydrogen peroxide from the breakdown of polyamines plays a role in activating defense responses [56]. There has not been a connection between the role of fungal polyamine oxidase genes and the plant-pathogen interaction. Due to the increased expression of FvPO1 during the infection of soybean roots we hypothesized that there may be an important role of FvPO1 in sudden death syndrome development. We failed to find significant differences in root rot or foliar SDS symptom development when plants were challenged with either Δfvpo1 knockout mutant or the Δfvpo1::FvPO1 complimented mutant. These results show that while FvPO1 is highly upregulated during soybean root infection, it is not necessary for disease development. This creates another question of why then is the fungus expressing so much of FvPO1 during its infection of soybean roots? While we failed to find a role for FvPO1 during infection, it does not mean that it does not have one. Firstly, the second polyamine oxidase enzyme FvPO2 could be complementing the missing FvPO1 function in the knockout fvpo1 mutant. Examination of FvPO2 expression during root infection with the mutant Δfvpo1 45 compared to the complemented Δfvpo1::FvPO1 strain will help us to know if there is increased expression of FvPO2 during infection.

Another explanation for the lack of difference may be due to the nature of the fungus itself. Based on both genome and transcriptome explorations of F. virguliforme, we find that F. virguliforme has increased expression of many genes that have similar functions [14]. During infection, at least 35 carbohydrate hydrolytic genes have at least tenfold increase in expression.

Fusarium virguliforme has multiple identified toxins along with many potential toxins including

FvTox1 and FvNIS [9, 10]. If FvPO1 has a specific role or it interacts with a specific substrate, the role of the enzyme may be overshadowed by the redundancy seen in both cell wall degradation enzymes and potential toxins. In other words, FvPO1 may have a minor pathogenicity role that was not resolved due to the other major players for SDS disease development. Lastly, it is observed that in germinating spores there is an increased expression of

FvPO1 in the presence of polyamines. Plants produce their own polyamines; and the spermine levels in young soybean roots are high compared with polyamines putrescine and spermidine levels in soybean roots [57]. The presence of the polyamines in the root tissue may be enough to trigger the expression of FvPO1. Therefore, the increased expression of FvPO1 may be due to the presence of plant polyamines during the infection process. The upregulation of FvPO1 could enhance the ability of F. virguliforme to metabolize the soybean polyamines to gather nitrogen for its nutrition during infection of soybean roots.

Table 3.1 Amino acid sequences used for construction of the fungal polyamine oxidase phylogenetic tree.

Accession number Species

G6063 (FvPO1) Fusarium virguliforme

G12304 (FvPO2) Fusarium virguliforme

XP_018250699.1 Fusarium oxysporum f. sp. lycopersici

XP_018759432.1 Fusarium verticillioides sp|P50264| (FMS1) Saccharomyces cerevisiae

KTB11801.1 Candida glabrata

KPA44601.1 Fusarium langsethiae

EPQ62526.1 Blumeria graminis f. sp. tritici

XP_022474031.1 Colletotrichum orchidophilum

XP_016590268.1 Sporothrix schenckii

KUI67530.1 Valsa mali

XP_020135301.1 Diplodia corticola

EGY21277.1 Verticillium dahliae

ELA25712.1 Colletotrichum gloeosporioides

KXH60641.1 Colletotrichum nymphaeae

KNG52793.1 Stemphylium lycopersici

EDU43676.1 Pyrenophora tritici-repentis

OWY58429.1 Alternaria alternata

KPI41316.1 Phialophora attae

EHY59701.1 Exophiala dermatitidis

XP_013264912.1 Exophiala aquamarina 47

Table 3.1 (continued)

XP_003176013.1 Nannizzia gypsea

OAL62670.1 Trichophyton rubrum

EEQ30114.1 Arthroderma otae

ENH64049.1 Fusarium oxysporum f. sp. cubense race 1

EXM17017.1 Fusarium oxysporum f. sp. vasinfectum

KNB12654.1 Fusarium oxysporum f. sp. lycopersici

KIL94046.1 Fusarium avenaceum

EWG52084.1 Fusarium verticillioides

KND87437.1 Tolypocladium ophioglossoides

KGQ03359.1 Beauveria bassiana

EXV06730.1 Metarhizium robertsii

OPB45744.1 Trichoderma guizhouense

XP_018143290.1 Pochonia chlamydosporia

XP_018181462.1 Purpureocillium lilacinum

OAQ66203.1 Pochonia chlamydosporia

KKO98843.1 Trichoderma harzianum

XP_018733839.1 Sugiyamaella lignohabitans

CCA40304.1 Komagataella phaffii

XP_002493159.1 Komagataella phaffii

XP_020543008.1 Pichia kudriavzevii

ONH68086.1 Cyberlindnera fabianii

CDO51331.1 Galactomyces candidum

XP_013933011.1 Ogataea parapolymorpha

OEJ92956.1 Hanseniaspora uvarum 48

Table 3.1 (continued)

XP_722661.1 Candida albicans

XP_020066819.1 Candida tanzawaensis

DAA09918.1 Saccharomyces cerevisiae

KQC41785.1 Saccharomyces sp. 'boulardii'

CRG83365.1 Talaromyces islandicus

XP_013331457.1 Rasamsonia emersonii

GAT29300.1 Aspergillus luchuensis

XP_015411829.1 Aspergillus nomius

XP_001259716.1 Aspergillus fischeri

GAQ03674.1 Aspergillus lentulus

GAO82605.1 Aspergillus udagawae

KOC12438.1 Aspergillus flavus

XP_001392310.2 Aspergillus niger

OOQ90331.1 Penicillium brasilianum

KMK59612.1 Aspergillus fumigatus

OKP13542.1 Penicillium subrubescens

GAA88800.1 Aspergillus kawachii

KUG00546.1 Phytophthora nicotianae

CBL29058.1 Ustilago maydis

Table 3. 2 Primers used in this study.

Primer Name Sequence

FvPO1-01 ggtcttaaugctggatatgctacattgcgaactc

FvPO1-02 ggcattaauggacgaggtgtgagagctggttcatc

FvPO1-03 ggacttaauggacctgcattgcgatgtatgattg

FvPO1-04 gggtttaauctcgcggacgtggagacatgtaagtg

FvPO1-02FL ggcattaaucagcttgaggcagccaccttcgtacacgatg

FvPO2-01 ggtcttaaugtgacgctatgcgtgctgggactcaag

FvPO2-02 ggcattaaugccgcatattgaacagggaccaaagag

FvPO2-03 ggacttaaucccaccgcgagagccgataaatgctag

FvPO2-04 gggtttssuccgacgtggtactcttgtctaccaaag g6063F ggtggtcgtatggctcttacagcaac g6063R cgtcgttccatgaagaacctcatac g12304F cgcgtatgataagaatggtgtcaag g12304R gccaaacgcccactcttcatggctc gapdh F ctacatgctcaagtacgactcttcc gapdh R gtggactcgacgacgtactc

Figure 3.1 Evolutionary relationships of fungal polyamine oxidases. (A) Amino acid sequences from 65 fungal polyamine oxidases were aligned to generate the phylogenetic tree. The evolutionary history was inferred using the UPGMA method [58]. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates were collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1,000 replicates) are shown next to the branches [59]. The evolutionary distances were computed using the Poisson correction method and are in the units of amino acid substitutions per site. There was a total of 133 positions in the final dataset with no gaps. Evolutionary analyses were conducted in MEGA7 [60]. Green markers show fungal species that are known to be plant pathogens. Accession numbers and fungal species names are presented in Table 3.1. (B) Structures of F. virguliforme FvPO1 and FvPO2 showing the secretory signal (red), the amino oxidase domain in both FvPO1 and FvPO2. FvPO2 has an NAD binding domain towards the N terminus predicted by the Simple Modular Architecture Research Tool (http://smart.embl-heidlberg.de/). 51

Figure 3.2. Radial growth of Δfvpo1 mutant and its complemented isolate. (A) Fungal strains were characterized for their growth on PDA media. Images of fungal plates from Mont-1, Δfvpo1 and Δfvpo1::FvPO1 isolates. Photos were taken of fungal growth on 1/3 PDA plates 4 weeks after being transfered. Photos were taken of fungal growth on PDA plates, used in B, 11 days after being transferred. Photos are representative four replicated plates. (B) Radial fungal growth on PDA plates was measured every two days over the course of 11 days. Error bars show the standard error of the mean, n = 4.

Figure 3.3 Complementation of a Δfvpo1 mutant restores polyamine oxidase activity. (A) Δfvpo1 and Δfvpo1::FvPO1 fungal plugs were grown on media containing no nitrogen (-), or spermidine (spd) and spermine (spm) as sole nitrogen sources. The radial growth was measured five days (5 d) and eight days (8 d) after transferring to the media. Error bars are standard error of the mean, n = 4. Means with different letters are statistically different within each time point (Tukey’s HSD p < 0.05). (B) Photographs of the growth differences of F. virguliforme on minimal media containing spermine as the sole nitrogen source. Increased growth can be seen between the Mont-1 and Δfvpo1::FvPO1 compared to Δfvpo1 (C) Growth of Δfvpo1 and Δfvpo1::FvPO1 spores on PA media. Error bars are the standard error of the mean, n = 6. (D) Reverse transcription-PCR showed that expression of FvPO1 is increased in germinating spores upon exposure to media containing spermidine (Spd) and spermine (Spm). FvPO2 did not have expression in any of the treatments in the germinating spores. Constitutively expressed gene gapdh was used as a loading control. 53

Figure 3.4 FvPO1 is not essential for SDS development. Soybean seeds were inoculated with spore suspensions of Δfvpo1 and fvpo1::FvPO1 or water and grown in vermiculite. Three seedlings were grown per cup. Three weeks after inoculation seedlings were scored for (A) root rot, and (B) foliar disease. (A) Root rot is presented as the average percent root rot per cup. Error bars are the standard error of the mean, n = 24. (B) Foliar symptoms are presented as disease index per cup [52]. Error bars show standard error of the mean, n = 24. Three experimental replications were conducted.

References

1. SoyStats: American Soybean Association http://soystats.com (2017) Accessed 19 March 2018. 2. Soybean Disease Loss Estimates From the United States and Ontario, Canada - 2015 http://cropprotectionnetwork.org/crop-loss-estimates/soybean-disease-loss-estimates- 2015 (2016) Accessed 19 March 2018. 3. Roy KW, Hershman DE, Rupe JC, Abney TS: Sudden death syndrome of soybean. Plant Disease 1997, 81(10):1100-1111. 4. Aoki T, O'Donnell K, Homma Y, Lattanzi AR: Sudden-death syndrome of soybean is caused by two morphologically and phylogenetically distinct species within the Fusarium solani species complex – F. virguliforme in North America and F. tucumaniae in South America. Mycologia 2003, 95(4):660-684. 5. Aoki T, Mercedes Scandiani M, O'Donnell K: Phenotypic, molecular phylogenetic, and pathogenetic characterization of Fusarium crassistipitatum sp nov., a novel soybean sudden death syndrome pathogen from Argentina and Brazil. Mycoscience 2012, 53(3):167-186. 6. Leandro LF, Tatalovic N, Luckew A: Soybean sudden death syndrome - advances in knowledge and disease management. CAB Reviews 2012, 7(53):1-14. 7. Jin H, Hartman GL, Nickell CD, Widholm JM: Characterization and purification of a phytotoxin produced by Fusarium solani, the causal agent of soybean sudden death syndrome. Phytopathology 1996, 86(3):277-282. 8. Brar HK, Swaminathan S, Bhattacharyya MK: The Fusarium virguliforme toxin FvTox1 causes foliar sudden death syndrome-like symptoms in soybean. Molecular Plant- Microbe Interactions. 2011, 24(10):1179-1188. 9. Chang H-X, Domier LL, Radwan O, Yendrek CR, Hudson ME, Hartman GL: Identification of multiple phytotoxins produced by Fusarium virguliforme including a phytotoxic effector (FvNIS1) associated with sudden death syndrome foliar symptoms. Molecular Plant-Microbe Interactions 2016, 29(2):96-108. 10. Brar HK, Bhattacharyya MK: Expression of a single-chain variable-fragment antibody against a Fusarium virguliforme toxin peptide enhances tolerance to sudden death syndrome in transgenic soybean plants. Molecular Plant-Microbe Interactions 2012, 25(6):817-824. 11. Pudake RN, Swaminathan S, Sahu BB, Leandro LF, Bhattacharyya MK: Investigation of the Fusarium virguliforme fvtox1 mutants revealed that the FvTox1 toxin is involved in foliar sudden death syndrome development in soybean. Current Genetics 2013, 59(3):107-117. 55

12. Srivastava SK, Huang X, Brar HK, Fakhoury AM, Bluhm BH, Bhattacharyya MK: The genome sequence of the fungal pathogen Fusarium virguliforme that cause sudden death syndrome in soybean. Plos One 2014, 9(1):e81832. 13. Chang H-X, Yendrek CR, Caetano-Anolles G, Hartman GL: Genomic characterization of plant cell wall degrading enzymes and in silico analysis of xylanses and polygalacturonases of Fusarium virguliforme. BMC Microbiology 2016, 16(1):147. 14. Sahu BB, Baumbach JL, Singh P, Srivastava SK, Yi X, Bhattacharyya MK: Investigation of the Fusarium virguliforme transcriptomes induced during infection of soybean roots suggests that enzymes with hydrolytic activities could play a major role in root necrosis. Plos One 2017, 12(1):e0169963. 15. Covert SF, Enkerli J, Miao VPW, VanEtten HD: A gene for maackiain detoxification from a dispensable chromosome of Nectria haematococca. Molecular and General Genetics 1996, 251(4):397-406. 16. Coleman JJ, Wasmann CC, Usami T, White GJ, Temporini ED, McCluskey K, VanEtten HD: Characterization of the gene encoding pisatin demethylase (FoPDA1) in Fusarium oxysporum. Molecular. Plant-Microbe Interactions. 2011, 24(12):1482-1491. 17. Walters D: Resistance to plant pathogens: possible roles for free polyamines and polyamine catabolism. New Phytologist 2003, 159(1):109-115. 18. Walters DR: Polyamines in plant-microbe interactions. Physiological and Molecular Plant Pathology 2000, 57(4):137-146. 19. Andronis EA, Moschou PN, Toumi I, Roubelakis-Angelakis KA: Peroxisomal polyamine oxidase and NADPH-oxidase cross-talk for ROS homeostasis which affects respiration rate in Arabidopsis thaliana. Frontiers in Plant Science 2014, 5(1):132. 20. Gill SS, Tuteja N: Polyamines and abiotic stress tolerance in plants. Plant Signaling & Behavior 2010, 5(1):26-33. 21. Liu J-H, Wang W, Wu H, Gong X, Moriguchi T: Polyamines function in stress tolerance: from synthesis to regulation. Frontiers in Plant Science 2015, 6:827. 22. Morgan DML: Polyamine oxidases - enzymes of unknown function? Biochemical Society Transactions 1998, 26(4):586-591. 23. Tabor CW, Tabor H: Polyamines. Annual Review of Biochemistry 1984, 53:749-790. 24. Kim S-H, Kim S-H, Yoo S-J, Min K-H, Nam S-H, Cho BH, Yang K-Y: Putrescine regulating by stress-responsive MAPK cascade contributes to bacterial pathogen defense in Arabidopsis. Biochemical and Biophysical Research Communications 2013, 437(4):502-508. 25. Alet AI, Sanchez DH, Cuevas JC, Del Valle S, Altabella T, Tiburcio AF, Marco F, Ferrando A, Espasandin FD, Gonzalez ME, Ruiz OE, Carrasco P: Putrescine 56

accumulation in Arabidopsis thaliana transgenic lines enhances tolerance to dehydration and freezing stress. Plant Signaling & Behavior 2011, 6(2):278-286. 26. Kim NH, Kim BS, Hwang BK: Pepper arginine decarboxylase is required for polyamine and gamma-aminobutyric acid signaling in cell death and defense response. Plant Physiology 2013,162(4):2067-2083. 27. Brauc S, De Vooght E, Claeys M, Geuns JMC, Hofte M, Angenon G: Overexpression of arginase in Arabidopsis thaliana influences defence responses against Botrytis cinerea. Plant Biology 2012, 14:39-45. 28. Onkokesung N, Gaquerel E, Kotkar H, Kaur H, Baldwin IT, Galis I: MYB8 Controls Inducible Phenolamide Levels by Activating Three Novel Hydroxycinnamoyl-Coenzyme A:Polyamine Transferases in Nicotiana attenuata. Plant Physiology 2012, 158(1):389- 407. 29. Sagor GHM, Liu T, Takahashi H, Niitsu M, Berberich T, Kusano T: Longer uncommon polyamines have a stronger defense gene-induction activity and a higher suppressing activity of Cucumber mosaic virus multiplication compared to that of spermine in Arabidopsis thaliana. Plant Cell Reports 2013, 32(9):1477-1488. 30. Pal M, Kovacs V, Vida G, Szalai G, Janda T: Changes induced by powdery mildew in the salicylic acid and polyamine contents and the antioxidant enzyme activities of wheat lines. European Journal of Plant Pathology 2013, 135(1):35-47. 31. Marina M, Maiale SJ, Rossi FR, Romero MF, Rivas EI, Garriz A, Ruiz OA, Pieckenstain FL: apoplastic polyamine oxidation plays different roles in local responses of tobacco to infection by the necrotrophic fungus Sclerotinia sclerotiorum and the biotrophic bacterium Pseudomonas viridiflava. Plant Physiology 2008, 147(4):2164-2178. 32. Marina M, Vera Sirera F, Rambla JL, Gonzalez ME, Blazquez MA, Carbonell J, Pieckenstain FL, Ruiz OA: Thermospermine catabolism increases Arabidopsis thaliana resistance to Pseudomonas viridiflava. Journal of Experimental Botany 2013, 64(5):1393-1402. 33. Yoda H, Hiroi Y, Sano H: Polyamine oxidase is one of the key elements for oxidative burst to induce programmed cell death in tobacco cultured cells. Plant Physiology 2006, 142(1):193-206. 34. Moschou PN, Roubelakis-Angelakis KA: Polyamines and programmed cell death. Journal of Experimental Botany 2014, 65(5):1285-1296. 35. O'Brien JA, Daudi A, Butt VS, Bolwell GP: Reactive oxygen species and their role in plant defence and cell wall metabolism. Planta 2012, 236(3):765-779. 36. Dunand C, Crevecoeur M, Penel C: Distribution of superoxide and hydrogen peroxide in Arabidopsis root and their influence on root development: possible interaction with peroxidases. New Phytologist 2007, 174(2):332-341. 57

37. Tsukagoshi H, Busch W, Benfey PN: Transcriptional regulation of ROS controls transition from proliferation to differentiation in the root. Cell 2010, 143(4):606-616. 38. Ivanchenko MG, den Os D, Monshausen GB, Dubrovsky JG, Bednarova A, Krishnan N: Auxin increases the hydrogen peroxide (H2O2) concentration in tomato (Solanum lycopersicum) root tips while inhibiting root growth. Annals of Botany 2013, 112(6):1107-1116. 39. Luna E, Pastor V, Robert J, Flors V, Mauch-Mani B, Ton J: Callose deposition: a multifaceted pant defense response. Molecular Plant-Microbe Interactions 2011, 24(2):183-193. 40. Thordal Christensen H, Zhang ZG, Wei YD, Collinge DB: Subcellular localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive response during the barley-powdery mildew interaction. Plant Journal 1997, 11(6):1187-1194. 41. Bestwick CS, Brown IR, Mansfield JW, Boher B, Nicole M, Essenberg M: Host reactions - Plants. Methods in Microbiology, 1998, 27:539-572. 42. Bradley DJ, Kjellbom P, Lamb CJ: Elicitor induced and wound induced oxidative crosslinking of a proline-rich plant-cell wall protein, a novel, rapid defense response. Cell 1992, 70(1):21-30 43. Simon UK, Polanschuetz LM, Koffler BE, Zechmann B: High resolution imaging of temporal and spatial changes of subcellular ascorbate, glutathione and H2O2 distribution during Botrytis cinerea Infection in Arabidopsis. Plos One 2013, 8(6): e65811. 44. Segmueller N, Kokkelink L, Giesbert S, Odinius D, van Kan J, Tudzynski P: NADPH oxidases are involved in differentiation and pathogenicity in Botrytis cinerea. Molecular Plant-Microbe Interactions 2008, 21(6):808-819. 45. Govrin EM, Levine A: The hypersensitive response facilitates plant infection by the necrotrophic pathogen Botrytis cinerea. Current Biology 2000, 10(13):751-757. 46. van Kan JAL: Licensed to kill: the lifestyle of a necrotrophic plant pathogen. Trends in Plant Science 2006, 11(5):247-253. 47. Valdes-Santiago L, Guzman-de-Pena D, Ruiz-Herrera J: Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants. Fems Yeast Research 2010, 10(7):928-940. 48. Sacramento AT, Garcia-Jimenez P, Alcazar R, Tiburcio AF, Robaina RR: Influence of polyamines on the sporulation of Grateloupia (Halymeniaceae, Rhodophyta). Journal of Phycology 2004, 40(5):887-894. 49. Garriz A, Dalmasso MC, Marina M, Rivas EI, Ruiz OA, Pieckenstain FL: Polyamine metabolism during the germination of Sclerotinia sclerotiorum ascospores and its relation with host infection. New Phytologist 2004, 161(3):847-854. 58

50. Marshall J, Qiao X, Baumbach J, Xie J, Dong L, Bhattacharyya MK: Microfluidic device enabled quantitative time-lapse microscopic-photography for phenotyping vegetative and reproductive phases in Fusarium virguliforme, which is pathogenic to soybean. Scientific Reports 2017, 7:44365. 51. Abramoff MD, Magalhaes PJ, Ram SJ: Image processing with ImageJ. Biophotonics Interenational 2004, 11(87): 36-42. 52. Njiti VN, Johnson JE, Torto TA, Gray LE, Lightfoot DA: Inoculum rate influences selection for field resistance to soybean sudden death syndrome in the greenhouse. Crop Science 2001, 41(6):1726-1731. 53. Gray LE, Achenbach LA: Severity of foliar symptoms and root and crown rot of soybean inoculated with various isolates and inoculum rates of Fusarium solani. Plant Disease 1996, 80(10):1197-1199. 54. Navi SS, and Yang, XB: Foliar symptom expression in association with early infection and xylem colonization by Fusarium virguliforme (formerly F. solani f. sp. glycines), the causal agent of soybean sudden death syndrome. Online. Plant Health Progress 2008, doi:10.1094/PHP-2008-0222-01-RS. 55. Takahashi Y: The Role of Polyamines in Plant Disease Resistance. Environment Control in Biology 2016, 54(1):17-21. 56. Yoda H, Fujimura K, Takahashi H, Munemura I, Uchimiya H, Sano H: Polyamines as a common source of hydrogen peroxide in host- and nonhost hypersensitive response during pathogen infection. Plant Molecular Biology 2009, 70(1-2):103-112. 57. Ohe M, Kobayashi M, Niitsu M, Bagni N, Matsuzaki S: Analysis of polyamine metabolism in soybean seedlings using N-15-labelled putrescine. Phytochemistry 2005, 66(5):523-528. 58. Sneath PHA, Sokal RR: Numerical Taxonomy: The principles and practice of numerical classification, vol. 537. San Franscisco: Freeman; 1973. 59. Zuckerkandl E, Pauling L: Evolutionary Divergence and convergence in proteins. Academic Press 1965, 1:97-166. 60. Kumar S, Stecher G, Tamura K: MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Molecular Biology and Evolution 2016, 33(7):1870- 1874.

CHAPTER 4 EVALUATION OF TRANSGENIC SOYBEAN PLANTS EXPRESSING THE FUNGAL POLYAMINE OXIDASE GENE, FVPO1

Jordan Baumbach, Micheline Ngaki, and Madan Bhattacharyya

Abstract

There is a constant battle between plant and microbial pathogens. To protect farmers from losses due to pathogen attack it is important for soybean breeders to develop new lines with enhanced disease resistance. The fungal pathogen Fusarium virguliforme is responsible for soybean yield suppression throughout North and South America. To date there are no soybean cultivars with complete resistance to F. virguliforme. Transgenic approaches are being used to facilitate the development of F. virguliforme resistant lines. In this study, we have developed transgenic soybeans expressing the fungal polyamine oxidase gene, FvPO1. Polyamine oxidases have been shown to be involved in the plant defense response. Therefore, we examined whether the FvPO1 transgenic plants could enhance resistance to both the root fungal pathogen responsible for sudden death syndrome, and the bacterial blight pathogen Pseudomonas syringae pv. glycines. In growth chamber experiments, there was no significant enhancement in resistance to F. virguliforme in the FvPO1 transgenic lines. Field trials remained inconclusive for the

FvPO1 transgenic plants’ ability to enhance resistance to F. virguliforme. The 2015 field results support an effect of the FvPO1 transgene on enhanced SDS resistance while the 2016 field results did not. FvPO1 transgenic plants did not show any enhanced resistance against the soybean bacterial blight pathogen, Pseudomonas syringae pv. glycinea either.

Introduction

Soybean is an important source of oil and protein for both animal and human consumption, and therefore is one of the most important crops grown world wide. The United 60

States and Brazil are leaders in soybean production. In 2016 the US and Brazil produced 117.2 and 108 million metric tons of soybeans respectively [1]. Soybean is constantly under pressure from yield limiting pathogens such as nematodes, fungi, bacteria. The estimated percent of US soybean yield lost to pathogens in 2015 was 11.7% [2]. In the Unites States and Canada,

Fusarium virguliforme is one of the most destructive soybean pathogens that causes sudden death syndrome (SDS) [3]. The disease is caused by three additional Fusarium species in South

America; these include F. tucumaniae, F. brasiliense, and F. crassistipitatum [4, 5]. In 2015

SDS was ranked third in soybean yield limiting diseases in the United States, and the soybean yield suppression from SDS was estimated to be at 43.7 million bushels [2].

SDS, first discovered in Arkansas in 1971 [3], has spread throughout the most soybean growing regions of the United States and into Canada [6]. SDS has also been identified in South

Africa, Korea, Malaysia, Argentina and Brazil [4, 5, 7-11]. Fusarium virguliforme infects and colonizes the roots of the soybean but does not spread to the above ground plant tissues [3].

Fusarium virguliforme produces both root rot and foliar symptoms, which include interveinal chlorosis and necrosis along with leaf and pod abortion [3, 12, 13]. The foliar symptoms are produced by F. virguliforme toxins that move through the xylem from roots, where the pathogen resides [14-17]. Multiple toxins have be identified from investigations of F.virguliforme culture filtrates. An unknown 17 kDa polypeptide toxin was identified from F.virguliforme culture filtrates; but the gene responsible for the toxin production was never identified [14]. FvTox1 is an additional F. virguliforme protein, which has been shown to cause foliar SDS-like symptomes

[15]. Transgenic soybeans expressing plant antibodies against FvTox1 were able to reduce foliar symptoms following feeding with F.virguliforme culture filtrates or inoculation with the pathogen [15]. Soybean plants infected with F. virguliforme FvTox1 knockout strains had 61 reduced foliar symptoms. Additional toxins must play a role in foliar disease development as

FvTox1 knockout strains still produced some foliar symptom [18]. Three additional candidate toxin proteins were identified in the xylem sap of infected soybeans, but their role in symptom development has not been tested [17]. Fusarium virguliforme FvNIS protein, when expressed in soybean leaves produces foliar symptoms. FvNIS along with multiple other potential effector proteins, and polyketide synthesis genes were discorvered in the F. virguliforme genome suggesting that the foliar disease symptoms are not produced by one single toxin, but the effect of multiple toxins [16]. Another fungal gene, FvSTR1, was identified to be responsible for sporulation, and mutations in FvSTR1 lead to reduced pathogenicity [19].

The genome sequence of F. virguliforme Mont-1 strain, with gene prediction and annotation, are available at http://fvgbrowse.agron.iastate.edu [20]. The genome contains many predicted plant cell wall degrading enzymes including 66 carbohydrate esterases, 292 glycoside hydrolases and 28 pectate lyases [21]. Investigation of the F. virguliforme transcriptomes revealed that during infection genes encoding many of the cell wall hydrolytic enzymes are highly induced during infection of soybean roots [22]. Fusarium virguliforme mutants of the protein kinase FvSNF1 have reduced virulence on soybean. FvSNF1 is thought to regulate the expression of the cell wall degrading enzymes [23]. Fusarium virguliforme also deploys multiple phytoalexin detoxification enzymes to defend itself against the soybean resistance mechanisms [22].

As of now, no single major gene for SDS resistance has been identified. Soybean SDS resistance is partial and encoded by a large number of quantitative trait loci (QTL) [24]. Certain chromosomes appear to be hot spots for SDS foliar resistance QTL. That include Chromosome

18, Chromosome 6 and Chromosome 3 [24-41]. While most of the research into SDS focuses on 62 foliar symptoms, there have also been loci identified which are associated with the root rot phenotype of the disease [27, 28, 34, 35, 38, 41, 42]. Breeding for SDS resistance has been difficult as environmental conditions play a large role in the development of the disease symptoms [37, 41, 43]. Environmental factors including soil moisture, light, and some other abiotic stresses; and interaction of the pathogen with soybean cyst nematode has been shown to be involved with SDS development in the field [3, 44-47]. As F. virguliforme remains in infected soybean roots and toxins are deployed to generate foliar SDS symptoms, application of foliar fungicides does not have any beneficial effect on reducing SDS. Published studies of seed treatments with certain fungicides and their efficacy in reducing SDS are now becoming available [48-51]. The majotiy of seed treatments have little effect on preventing SDS. One chemical of particular interest in seed treatments is fluopyram, which has been effective in reducing SDS severity in some trials [50, 51]. While there may be potential in applying seed treatments in the future, currenly the best approach to protect soybean from the yield suppression by SDS is through planting resistant soybean lines.

Since there has not been any complete SDS resistance identified among Plant

Introduction lines in the soybean germplasm collection, there has been an effort to enhance soybean SDS resistance through transgenic approaches. Transgenic lines expressing antibodies to the F. virguliforme toxin FvTox1 had reduced foliar chlorosis during F. virguliforme infection when compared to the transformation background [15]. The receptor like kinase Rhg1-a/Rfs2, identified from a QTL located on soybean chromosome 18, enhanced resistance to both SDS and soybean cyst nematode (SCN) when overexpressed in transgenic soybean plants [52]. Expression of bacterial NADP-specific glutamate dehydrogenase has been reported to prevent F. virguliforme infection in soybean [53]. Another approach to engineer SDS resistance was to 63 overexpress soybean gene GmARP1, which was found to be downregulated in soybean roots following F. virguliforme infection [54]. Use of the non-host resistance gene PSS1 from

Arabidopsis thaliana in transgenic soybean plants has also been shown to enhance resistance to

F. virguliforme [55].

Similar transgenic approaches have been used to combat other soybean pathogens. For example, increased expression of soybean salicylic acid methyl transferase gene GmSAMT1 to enhance resistance to soybean cyst nematode Heterodera glycines [56, 57]. Overexpression of the soybean isoflavone reductase gene GmIFR increased reactive oxygen species (ROS) production and the production of the phytoalexin glyceollin in transgenic lines, thus enhancing also resistance to Phytophthora sojae [58]. Additionally, resistance sources from microbial genes have been shown to enhance disease resistance in transgenic soybean plants. For example, enhanced resistance to the pathogens P. sojae and Cercospora sojina was engineered by the integration of a single copy of a harpin protein from tobacco wildfire pathogen, Pseudomonas syringae pv. tabaci, into soybean [59]. Recently a chitinase gene from Trichoderma asperellum was expressed in soybean to enhance resistance to Sclerotinia sclerotiorum. Transgenic soybean plants expressing the gene exhibited increased resistance to S. sclerotiorum and increased production of reactive oxygen species (ROS) including hydrogen peroxide [60].

Polyamine oxidases are a class of enzymes, which are responsible for the breakdown of the polyamines spermine and spermidine [61-64]. Polyamines have been associated with various cellular activities including protein regulation, developmental regulation, circadian rhythm, nucleic acid stabilization, transcriptional and translational regulation, stress response and reactive oxygen species regulation [64-81]. The breakdown of polyamines by polyamine oxidases results in the production of hydrogen peroxide, an amine group, and oxygen [64]. Many reports show 64 that plant polyamines, polyamine oxidases and hydrogen peroxide are involved in the plant- pathogen interaction [82-89]. Production of hydrogen peroxide is one of the earliest events in the plant hypersensitive response [90]. ROS can interact with many different cellular components such as membrane lipids, proteins and DNA. Interaction with membrane lipids causes dissociation of lipids and can reduce photosynthetic abilities of chloroplasts resulting in leakage of electrolytes [91]. The damage to DNA and membranes can lead to cell death. In the interaction between biotrophic pathogens and plants, programmed cell death (PCD) is a host response that can limit the growth and spread of the pathogens through living tissues. Induction of PCD is one of the ways in which hydrogen peroxide plays a role in the plant-pathogen interaction [92]. Hydrogen peroxide is important in plant cell wall development and in plant defense [92-94]. Production of hydrogen peroxide is involved in the deposition of callose, which is formed at the sites of pathogen attack [95-97]. In French bean, known defense related proteins including extension-like hydroxyproline-rich glycoprotein and chitin-binding proline-rich glycoprotein are cross-linked with the cell wall during infection. This cross-linking is rapid; occurring within 15 minutes of activation with microbe associated molecular pattern (MAMP) triggers and is hydrogen peroxide dependent [98].

The role of hydrogen peroxide in the necrotrophic plant-pathogen interaction appears to be more complex than that seen in hemi-biotrophic pathogens with an initial biotrophic phase such as P. sojae. During infection with the necrotrophic pathogen Botrytis cinerea, hydrogen peroxide production occurs at the infection site and the surrounding uninfected areas. The hydrogen peroxide formation in the surrounding uninfected tissues suggests that hydrogen peroxide may be playing a signaling role [99]. Additional reports show that B. cinerea may benefit from plant-produced hydrogen peroxide, which can induce the hypersensitive response 65 and plant cell death [100-102]. Botrytis cinerea is also able to germinate and grow in relatively high concentrations of hydrogen peroxide [103]. The fungus produces two enzymes, ascorbic peroxidase and glutathione peroxidase, which are able to break down the hydrogen peroxide molecules [104]. Timing and intensity of hydrogen peroxide production may be key to whether it deters or aids necrotrophic pathogens in plant infection. Tomato sitiens mutant line with hyper- induction of hydrogen peroxide in epidermal cell wall at four hours post inoculations exhibits enhanced B. cinerea resistance. This hyper-induction was associated with cell wall protein modification and crosslinking with phenolic compounds. Interestingly the sitiens line with enhanced B. cinerea resistance is abscisic acid deficient [105].

A transcriptomic study of F. virguliforme revealed increased expression of a fungal polyamine oxidase gene, FvPO1 during infection of soybean roots [22]. Due to the ability of polyamine oxidase genes to produce ROS and the importance of ROS in the plant defense responses, we test the hypothesis that whether expression of the fungal polyamine oxidase gene

FvPO1 in transgenic soybean lines can enhance resistance to soybean pathogens.

Materials and Methods

Gene constructs bacterial strains and plant materials

An infection inducible promoter (Prom1) from the soybean gene Glyma18g47390 (B.B.

Sahu and M.K. Bhattacharyya, unpublished) was identified and cloned from the genomic soybean DNA using CTAB extraction method [54]. Promoter sequence was amplified using primer pairs, Prom1F and Prom1R. The binary vector pTF102 was used to create the transgene

Prom1::FvPO1. CaMV 35S promoter was removed from pTF102 [106] by digesting with XbaI and was replaced with Prom1. A BstXI restriction site was added at the 3’ end of the promoter for cloning the FvPO1 gene. FvPO1 was amplified from F. virguliforme isolate Mont-1 genomic 66

DNA with primers FvPO1BstXIF and FvPO1BstXIR. The GUS gene and CaMV 35S terminator were removed by digesting with BstXI and HindIII. The CaMV 35S terminator was ligated back with the addition of a BstXI site at the 5’ end. [54]. The vector was then digested with BstXI and the FvPO1 sequence was ligated in (Figure 4.1 A). The binary plasmid construct was cloned into the Escherichia coli strain DH10B and sequenced to confirm the identity. Constructs were transformed into Agrobacteria tumefaciens strain EHA101 for plant transformation. The cultivar

‘Williams 82’ was transformed with the binary plasmid construct at the Plant Transformation

Facility, Iowa State University. R0 plants were grown in the greenhouse for generating R1 seeds.

All primers used for cloning can be found in Table 4.1.

Field evaluation of transgenic soybean lines for possible resistance to F. virguliforme

Field tests of transgenic soybean plants were carried out in the Hinds Research Farm,

Iowa State University located north of Ames, Iowa between June 11 and October 30, 2015 and

June 3 and October 30, 2016. During 2015, the field contained three FvPO1 transgenic events

(FvPO1-2, FvPO1-3 and FvPO1-6) as well as contained 200 total plots of either control lines or other transgenic events not discussed in this study. FvPO1 transgenic seeds for the 2015 field were harvested from transgenic plants grown in the Agronomy greenhouse at Iowa State

University. The 2016 field was designed using a random block design with five blocks. The field consisted 51 FvPO1 transgenic plots out of 2,236 total plots containing either control lines or other transgenic events. FvPO1 transgenic seeds for the 2016 field were harvested from the

2015 field trial. Each transgenic line carrying the FvPO1 transgene was grown in at least two replications along with the SDS resistant cultivars, ‘MN1606SP’ and ‘Ripley’, and the SDS susceptible line ‘Spencer’ and the transgene recipient line, ‘Williams 82’. Twenty-five seeds of individual genotypes were mixed with 15 mL of F. virguliforme NE305S inoculum grown on 67 sorghum grains and planted with a push planter. Plants were planted in three-foot plots, three feet between plots and 30-inch spacing between rows. At V2 or V3 plant1- to 2-trifoliate stage, all transgenic lines were sprayed with Liberty herbicide (glufosinate at a 250 mg/L concentration) mixed with 0.1% Tween 20 twice with an interval of two days. Plots were scored for SDS disease severity (DS) and disease incidence (DI) at R6 growth stage. Disease severity was scored based on a scale of 1 to 9, with 1 being mild chlorosis (less than 10%) and 9 being complete plant death. Disease incidence was recorded as the percentage of plants showing disease. Disease index (DX) was calculated as DI * DS / 9 [27].

Responses of transgenic plants to F. virguliforme in growth chamber

Fusarium virguliforme Mont-1 isolate was grown on 1/3 strength potato dextrose agar

(1/3 PDA) plates for three weeks. Inoculum was prepared on sorghum grains following a previously published method [107]. Briefly, sorghum meal was washed in distilled water and autoclaved twice. The cooled sorghum meal was inoculated with mycelial plugs of F. virguliforme grown on 1/3 PDA plates. The infected sorghum meal was grown for two weeks before being harvested and mixed with a 1:1 mixture of sand-soil at a 1:20 inoculum: sand-soil ratio. Three seeds of each soybean line were planted in a 237-mL Styrofoam cup containing the inoculation mixture. R2 seeds from the 2016 harvest were used for growth chamber inoculations.

The cups were then placed in growth chamber maintained at 22–24°C with a 16 h light and 8 h dark period. The light intensity was 300 μE/m2/s. The plants were watered daily. Cups were scored for disease severity based on a scale of 1 to 9, with 1 being mild chlorosis (less than 10%) and 9 being complete plant death. Disease incidence as the percentage of plants showing disease.

Disease index (DX) was calculated as DI * DS / 9 [27]. [27] Root samples were harvested and 68 frozen in liquid nitrogen for molecular characterization. Statistical analysis was conducted using

R software for ANOVA and a Tukey’s HSD [108, 109].

Semi-quantitative RT-PCR

Soybean root tissues were harvested from infected soybean plants and ground in a mortar and pestle. RNA was prepared using the Qiagen miRNeasy kit (Hilden, Germany) following manufacturer’s instructions. RNA was treated with Promega RQ1 DNase (Madison, WI) to remove any residual DNA contamination. First strand synthesis was conducted using Promega

M-MLV reverse transcriptase (Madison, WI) following manufacturer’s recommended protocol.

RT-PCR was conducted to look for expression of the bar gene in using primer pair barF and barR. Expression of the FvPO1 transgene was detected using the forward primer from FvPO1 transcript FvPO1F and a reverse primer from the start of the 35S terminator sequence

(35STermR) to avoid amplification of FvPO1 transcript from infecting F. virguliforme.

Amplification transcripts of F. virguliforme infection-induced gene encoding a maackiain detoxification-like protein (g14537) was used to confirm infection in root samples using primers

MDF and MDR. Amplification of soybean Elf1B was used as an internal control (Elf1BF and

Elf1BR). Primers for RT-PCR can be found in Table 4.1.

Responses of transgenic plants to Pseudomonas syringae pv. glycinea in growth chamber

Soybean plants were grown in the growth chamber in Sun Gro professional potting mix

(Sun Gro, Agawam, MA) for two weeks with watering done daily. Pseudomonas syringae pv. glycinea race 4 isolate (PsgR4) and P. syringae pv. glycinea race 4 isolate containing the avirulence gene, avrB [PsgR4(avrB)] were grown on King’s medium B [110] at 30oC for two days. Bacterial suspensions were prepared in 10 mM MgCl2 and diluted to an OD600 of 0.1. All bacterial suspensions were used immediately after preparation. Fourteen days after planting, 50 69

µL bacterial suspensions were injected into the abaxial side of unifoliate leaves according to

Ashfield et al. (1995) [111]. Plants were covered with a humidity dome. Three days after inoculation, leaf disks 1 cm in diameter were taken from each inoculated plant and ground in

10mM MgCl2. Serial dilutions were plated in tryptic soy agar containing rifampicin (100 µg/mL) and incubated in a 28°C incubator. Colony forming units (cfu) were counted two days after plating. The cfu per mm2 leaf tissue was calculated. Three experimental replications were conducted. Statistical analysis was conducted using R software for ANOVA and Tukey’s HSD

[108, 109].

Results

Generation of transgenic soybean lines

The fungal polyamine oxidase gene FvPO1 is induced in F. virguliforme during soybean root infection. The gene turns on as early as one day post inoculation and continues at a relatively steady expression level through at least ten days post inoculation [22]. Polyamine oxidase enzymes breakdown spermine and spermidine producing free amine groups along with the reactive oxygen species, hydrogen peroxide. Hydrogen peroxide formation has been linked to defense response in plants especially with biotrophic pathogens [98, 112]. Transgenic soybean lines were created to assess whether expression of FvPO1 could potentially deter pathogen growth and lead to enhanced disease resistance. A modified pTF102 vector carrying the infection inducible promoter (Prom1) from the soybean gene Glyma18g47390 (Bhattacharyya and Sahu, unpublished) was created for transgene expression (Figure 4.1A). This promoter was identified as being upregulated during infection of soybean roots with F. virguliforme. The infection inducible promoter, instead of a constitutive promoter such as CaMV 35 S, was used for FvPO1 expression to avoid any harmful effect of changes in polyamine homeostasis throughout the 70 plants prior to infection that could result from the use of a strong constitutive promoter. The modified vector was transformed into the soybean variety ‘Williams 82’ at the Plant

Transformation Facility at Iowa State University (PTFISU) [113]. Three independent transgenic events were produced from the transformation facility that were herbicide resistant and contained the FvPO1 gene (Figure 4.1B). The three events St217-2, St217-3 and St217-6 obtained from

PTFISU are termed FvPO1-2, FvPO1-3 and FvPO1-6, respectively.

Responses of transgenic soybean lines carrying FvPO1 to F. virguliforme.

Field trials were conducted in two consecutive years to determine the responses of the transgenic soybean lines to F. virguliforme NE305 isolate. During the first year of the field trials, three FvPO1 transgenic lines were planted (FvPO1-2, FvPO1-3, and FvPO1-6) in duplicate.

Transgenic plots were sprayed with Liberty herbicide to select for plants carrying the FvPO1 transgene. Two of the transgenic events (FvPO1-2 and FvPO1-3) had herbicide tolerant lines in both replications while the third event (FvPO1-6) only had herbicide tolerant plants in one replication. Foliar disease DX for individual plants was calculated for each transgenic line as well as the ‘Williams 82’ transformation background and the ‘MN1606SP’ resistant check. The average of the two replications with the standard deviation is presented in Figure 4.2. Since there were no herbicide resistant plants in the second replication of FvPO1-6, there is no standard error. Average DX appeared to be reduced in each of the three FvPO1 lines when compared to the ‘Williams 82’ transformation background. The ‘MN1606SP’ had a lower DX than was seen in the FvPO1 transgenic plants (Figure 4.2). Individual plants with the lowest foliar disease severity were harvested individually from each of the FvPO1-2 and FvPO1-3 transgenic lines for

2016 field screening. 71

A second field experiment consisting of five random blocks was conducted in 2016.

Seeds from individual FvPO1-2 and FvPO1-3 transgenic plants with the lowest foliar disease scores and the most seeds available from 2015 were plants in the 2016 field. Due to higher foliar disease index and low seed count, seeds from FvPO1-6 were not planted in the 2016 field. The transgenic soybean plants were evaluated for Liberty tolerance. Results of Liberty herbicide tolerance was used to identify two plots from FvPO1-2 that were identified as homozygous for

Liberty tolerance; all the FvPO1-3 plots were segregating for Liberty tolerance. The second block had low SDS foliar disease levels with the susceptible check failing to reach a disease index (DX) of over 10. Therefore, the data of that block was not used in the statistical analysis.

The first block produced the highest foliar symptoms with high an average DX of 38.0 in the susceptible check ‘Spencer’ and an average DX of 3.6 in the resistant check ‘Ripley’. Blocks 3 and 4 produced less symptoms than block 1 with ‘Spencer’ having and average DX of 12.2 and

30.0 respectively. The soybean plants in the fifth block did not produce SDS symptoms before natural senescence was visible and therefore SDS foliar scores were not taken for those plots.

ANOVA showed significant variation between the DX for block 1 and those in blocks 3 and 4, therefore block 1 was analyzed independently. There was no significant difference between the

FvPO1-2 plots segregating for Liberty tolerance and the homozygous plots (p = 0.96). Likewise, there was no significant difference between either the homozygous FvPO1-2 plots or the segregating FvPO1-2 plots and the ‘Williams 82’ transformation background (p = 0.52 and p =

0.99 respectively). The FvPO1-3 plots also did not have any significant differences in DX from

‘Williams 82’ (p = 0.99) (Figure 4.3 A). The ANOVA revealed that DX for blocks 3 and 4 were not significantly different and therefore those blocks were analyzed together. There was no significant difference between the FvPO1-2 homozygous plots when compared to the FvPO1-2 72 segregating plots (p = 0.55). There was however a significant difference between the ‘Williams

82’ lines and the transgenic FvPO1-2 and FvPO1-3 plots, with FvPO1-2 and FvPO1-3 having a higher foliar DX than the ‘Williams 82’ plots (p = 0.02, and 0.017 respectively) (Figure 4.3 B).

This difference is most likely attributed to the low disease scores in blocks 3 and 4 and there were many ‘Williams 82’ plots that escaped disease.

Growth chamber experiments were conducted to confirm the field results. Seeds from the two homozygous FvPO1-2 plots (FvPO1-2-2 and FvPO1-2-5) were harvested separately.

Seedlings were grown with inoculum from the F. virguliforme Mont-1 isolate. Foliar disease symptoms were scored four weeks after inoculation. Soybean cultivar ‘MN1606SP’ was used as a resistant check for the growth chamber screening, and ‘Spencer’ was the susceptible check.

Typical foliar SDS symptoms including interveinal chlorosis and leaf curl were identified in each of the lines tested. There were no significant differences in disease scores among the three experiments. In each experiment, ‘MN1606SP’ had reduced foliar symptoms compared to

‘Spencer’, ‘Williams 82’, FvPO1-2-2 or FvPO1-2-5 (p < 0.01). ‘Spencer’ failed to produce more severe symptoms than those seen in the ‘Williams 82’ plants. There was no significant difference observed between ‘Williams 82’ foliar symptoms and those observed in the FvPO1-2 transgenic plants. There did appear to be a trend though not significant towards reduced symptoms in the transgenic lines when ‘Williams 82’ was compared with FvPO1-2-2 and FvPO1-2-5 (p = 0.097, and p = 0.251, respectively) (Figure 4.4 A). A sample of the transgenic plants from each of the two lines were examined for expression of the FvPO1 transgene in the infected root tissues.

Transgene expression was detected in all the plants sampled in both homozygous lines (Figure

4.4 B). In addition, primers for the F. virguliforme infection-induced gene FvMD was run to confirm the occurrence of infection in the roots. 73

Responses of transgenic soybean lines carrying FvPO1 to Pseudomonas syringae pv. glycinea

The bacterial blight of soybean is caused by the bacterial pathogen Pseudomonas syringae pv. glycinea (Psg). Psg carrying the avirulence gene avrB elicits a resistant host response in those soybean lines that carry the corresponding resistance gene, RPG1-B [114, 115].

RPG1-B encodes a CC-NBS-LRR protein, which recognizes and provides resistance to avrB expressing bacteria [116]. Reactive oxygen species are important in orchestrating the hypersensitive response of plants in incompatible interactions [117-126]. Therefore, we tested the transgenic soybean lines expressing FvPO1 to see if the FvPO1 polyamine oxidase during infection could induce the host defense response. The transformation background for FvPO1,

‘Williams 82’, carries the RPG1-B allele. FvPO1-2-5 line homozygous for FvPO1 transgene integration and ‘Williams 82’ were screened for altered resistance to PsgR4, which does not contain the avrB gene, and PsgR4(avrB) containing the avrB gene.

In both the ‘Williams 82’ and the FvPO1 transgenic line, the PsgR4(avrB) strain had reduced symptoms and colony forming units (cfu) compared the PsgR4 strain (p < 0.001 and p <

0.001). There was no difference between FvPO1-2-5 and ‘Williams 82’ (p = 0.997) for resistance to the virulent PsgR4 isolate. Likewise, the FvPO1-2-5 plants defense response to the avirulent

PsgR4(avrB) was not significantly different from ‘Williams 82’ (p = 0.936) (Figure 4.5).

Therefore, it appears that the expression of FvPO1 in transgenic soybean lines did not alter the levels of resistance against the bacterial pathogen, Psg.

Discussion

Plants are in a continual battle with pathogenic microbes. To help secure soybean yields from losses due to pathogens, plant breeders and biologists are working to improve means to 74 help plants fight diseases. Transgenic soybean lines have been created to enhance resistance to multiple pathogens [15, 52-59]. Some of these transgenic approaches make use of microbial genes such as the expression of chitinase gene from Trichoderma asperellum, which induces soybean defense response and the production of reactive oxygen species [60]. In the current study, the soybean cultivar ‘Williams 82’ was transformed with the polyamine oxidase gene

FvPO1 from the fungal pathogen F. virguliforme. Polyamine oxidases enzymes break down the polyamines spermine and spermidine resulting in the production of hydrogen peroxide. The production of the reactive oxygen species hydrogen peroxide as well as changes in polyamine levels have been associated with plant defense response. Therefore, transgenic plants expressing

FvPO1 were tested for altered defense response to both a bacterial and a fungal soybean pathogen.

Hydrogen peroxide and polyamines have a role in the plant-pathogen interaction with necrotrophic pathogens. This role is not well defined; but in the characterized necrotrophic pathogen Botrytis cinerea the production of hydrogen peroxide during the hypersensitive response aids the pathogen to colonize the plants [102, 127]. A hyper-induction of hydrogen peroxide at four hours post inoculation in epidermal cell walls resulted in crosslinking of cell wall-associated proteins and phenolic compounds. This led to enhanced resistance in tomato to

B. cinerea [106]. Similarly, induction of defense response and reactive oxygen species in transgenic soybeans expressing a fungal chitinase was able to enhance resistance to Sclerotinia sclerotiorum [60]. Therefore, we wanted to see if FvPO1 transgenic soybean plants are able to enhance disease resistance to the fungal pathogen Fusarium virguliforme. Initial field trials with

FvPO1 transgenic lines were hopeful and we saw reduced foliar symptoms in some of the

FvPO1 plants. These plants were segregating for the FvPO1 transgene and therefore some of the 75 variation may have been due to FvPO1 copy number. In 2016 FvPO1-2 plots were identified which were homozygous for Liberty tolerance and transgene insertion. These lines along with the segregating FvPO1 lines failed to reduce foliar SDS symptoms compared to the ‘Williams

82’ transformation background. There was variation in SDS symptoms seen in the different blocks in the 2016 experiment with the most severe symptoms seen in block 1, which was planted four days earlier than blocks two, three and four. In the fields with lower DX, FvPO1 plants appeared to have increased foliar SDS when compared to the ‘Williams 82’. The reason for the higher foliar SDS in the FvPO1 plants in blocks three and four is unknown. One potential factor may be stress from Liberty herbicide application. With overall low disease levels in blocks

2, 3 and 4 the additional stress from Liberty herbicide applied to the transgenic and not to the

‘Williams 82’ or other control plants may have been enough stress to the plants to enhance susceptibility. In fields with greater disease, the herbicide treatment may have no effect because the pathogen is able to infect and colonize the control plants without problems.

Another explanation could be transgene silencing occurring in the fields. RT-PCR from the 2016 seeds used in growth chamber experiments show that there is transgene expression in both the FvPO1-2-2 and FvPO1-2-5 lines when inoculated with F. virguliforme, therefore transgene silencing does not appear to be a problem. Additionally, there were many ‘Williams

82’ plots planted in the 2016 field, therefore escapes in some of these plots may have skewed the

DX for ‘Williams 82’. In the growth chamber experiments there was no enhanced resistance observed in the FvPO1 transgenic plants as compared to the non-transgenic ‘Williams 82’ control. Together these results are inconclusive whether FvPO1 expression in soybean can enhance SDS resistance. If there was an effect on disease development, it was minimal. 76

Since biotrophic and necrotrophic pathogens can trigger different defense responses, we were interested to see if FvPO1 may affect soybeans response to biotrophic pathogens. Both a virulent and avirulent strain of the soybean bacterial blight pathogen Pseudomonas syringae pv. glycinea were used to test this hypothesis. Both ‘Williams 82’ and FvPO1 transgenic seedlings were susceptible to the virulent PsgR4 isolate. There was no statistical difference in the ability of the PsgR4 isolate to colonize FvPO1 transgenic soybean leaves when compared to the ‘Williams

82’. Likewise, FvPO1 transgenic seedlings did not show any altered resistance phenotypes compared to ‘Williams 82’ when inoculated with the avirulent PsgR4(avrB) isolate. Therefore, it appears that FvPO1 transgene expression has no impact on either the compatible or incompatible interaction of transgenic soybean plants with Psg. The reason for the lack of enhanced resistance may be from not having enough FvPO1 expression or hydrogen peroxide formation from expression of the FvPO1 gene in transgenic plants. The localization of FvPO1 may also play a role; we do not know where the enzyme would locate after expression and how long the enzyme would remain active in transgenic soybeans before being turned over. Measurements of hydrogen peroxide in infected and non-infected transgenic and non-transgenic plants would show whether expression of FvPO1 does increased hydrogen peroxide formation.

Table 4.1 Primers used in this study

Primer Name Primer Sequence

FvPO1bstxIF GAATTCCCATATATCTGGATGCGGGTTCCGTCTTCGCAACTCCTTG

FvPO1bstxIR GAATTCCCATATATCTGGTTAGACATCCAATGGCGTCGACCACCCG

Prom1F CATGCAATGCACTTCTAGATGTGGGAGTTTCAATGTG

Prom1R GAATTCTCTAGACTATCAAGTATTTCAACGTTATTCAAC

BarF CAGGAACCGCAGGAGTGGA

BarR CCAGAAACCCACGTCGTCATGCC

FvPO1F GGTGGTCGTATGGCTCTTACAGCAAC

35S Term R GTAGAGAGAGACTGGTGATTTTTG

MDF GGTCCAAAGATCTGATGGTTTTTCTG

MDR ATCTTTACCGCCTTTCTGTAAGC

Elf1BF CACACCGAAGAGGGCATCAAATC

Elf1BR CTCAACTGTCAAGCGTTCCTCAAC

Figure 4.1 T-DNA map and transformation confirmation. (A) T-DNA region of the binary vector modified from pTF102 [106] for expression of the FvPO1 gene under control of the soybean promoter Prom1. LB, left border; tVSP, soybean vegetative storage protein polyA signal; bar, Bialaphos resistance gene; TEV, Tobacco Etch Virus enhancer; p35S, Cauliflower Mosaic Virus 35S promoter region; t35S Cauliflower Mosaic Virus 35S polyA signal; FvPO1, Fusarium virguliforme gene FvPO1; Prom1, promoter region from soybean gene Glyma18g47390, RB, Right border. (B) PCR confirmation of FvPO1 and bar gene presence or absence in the three soybean transgenic events FvPO1-2, FvPO1-3, and FvPO1-6 and the transformation background ‘Williams 82’.

Figure 4.2 Disease index of transgenic plants in 2015 field trial. Transgenic lines were scored for field resistance in two consecutive years. (A) Average foliar disease index (DX) from field trial in 2015. Individual plants were scored for foliar disease severity (DS) on a scale of 1 – 9, and disease incidence (DI) as percent of plants showing foliar symptoms. Disease index was calculated from DS x DI / 9 [27]. Error bars represent the standard deviation of the DX. Two field replications were evaluated for FvPO1-2, FvPO1-6, ‘Williams 82’ and ‘MN1606SP’. * No plants survived in the second plot for FvPO1-6, therefore the DX is representative of one replication and there is no standard deviation. FvPO1-2, FvPO1-3 and FvPO1-6, are three independent FvPO1 transformation events; W82, transformation background ‘Williams 82’; MN, ‘MN1606SP’ is SDS resistant cultivar.

Figure 4.3 Disease index of transgenic plants in 2016 field trial. Transgenic lines were scored for foliar symptoms and disease index was calculated for each plot. Due to variation in DX between block 1 and blocks 3 and 4 average scores are presented separately. (A) Average DX calculated from disease severity and disease incidence in block 1 in 2016. (B) Average DX calculated from disease severity and disease incidence in blocks 3 and 4 in 2016. Error bars represent the standard error of the mean. ‘Ripley’, SDS partially resistant cultivar; FvPO1-2, FvPO1-3 are independent FvPO1 transformation events; ‘Williams 82’, transformation background; ‘Spencer’, SDS susceptible cultivar. * Significantly different from ‘Williams 82’ p < 0.05.

Figure 4.4 Transgenic plants expressing FvPO1 do not enhance resistance to F. virguliforme under growth chamber conditions. (A) Transgenic lines FvPO1-2-2 and FvPO1-2-5 were screened in inoculum made from infested sorghum meal mixed with sand: soil for foliar disease symptoms under growth chamber conditions. Error bars are standard error of the mean of three independent experiments. (B) Semi quantitative RT-PCR show expression of the FvPO1 transgene in transgenic lines inoculated with F. virguliforme. FvMD gene expression was used to confirm F. virguliforme infection in all plants. FvPO1, FvPO1 transgene expression; FvMD, a F. virguliforme infection-induced gene (g14537). GmElf1B, soybean constitutive expressed gene (Glyma.14G039100). ‘MN1606SP’, resistant cultivar; ‘Williams 82’, Non-transgenic transformation background; FvPO1-2-2, a homozygous FvPO1-2 R2 transgenic line; FvPo1-2-5, homozygous FvPO1-2 R2 transgenic line; ‘Spencer’, susceptible check. *, statistically significant at a p value < 0.05 when compared to ‘Williams 82’.

Figure 4.5 FvPO1 transgenic plants do not have altered resistance to Pseudomonas syringae pv. glycinea. FvPO1 transgenic soybean lines and ‘Williams 82’ control lines were inoculated with either Pseudomonas syringae pv. glycinea race four (PsgR4) or Pseudomonas syringae pv. glycinea race 4 carrying the avrB avirulence gene (PsgR4(avrB)). Three days post inoculation leaf disks were excised from inoculation site and ground on 10 mM MgCl2 and plated on tryptic soy agar plates. Bacterial colonies were counted for each sample and colony-forming units (cfu) per mm2 leaf tissue was calculated. Error bars are the standard error of the mean with n = 15, from three experimental replications.

References

4. Aoki T, O'Donnell K, Homma Y, Lattanzi AR: Sudden-death syndrome of soybean is caused by two morphologically and phylogenetically distinct species within the Fusarium solani species complex – F. virguliforme in North America and F. tucumaniae in South America. Mycologia 2003, 95(4):660-684.

5. Aoki T, Mercedes Scandiani M, O'Donnell K: Phenotypic, molecular phylogenetic, and pathogenetic characterization of Fusarium crassistipitatum sp nov., a novel soybean sudden death syndrome pathogen from Argentina and Brazil. Mycoscience 2012, 53(3):167-186.

6. Leandro LF, Tatalovic N, Luckew A: Soybean sudden death syndrome - advances in knowledge and disease management. CAB Reviews 2012, 7(053):1-14.

7. Tewoldemedhin YT, Lamprecht SC, Geldenhuys JJ, Kloppers FJ: First report of soybean sudden death syndrome caused by Fusarium virguliforme in South Africa. Plant Disease 2014, 98(4):569-569.

8. Lestari P, Sun S, Son H, Lee Y, Lee S: Isolation and characterization of Fusarium solani causing soybean sudden death syndrome in Korea. Journal of Microbiology, Biotechnology and Food Sciences 2016, 6(3):950-955.

9. Khosrow C, Baharuddin S, Latiffah Z: Fusarium virguliforme, a soybean sudden death syndrome fungus in Malaysian soil. Australasian Plant Disease Notes 2014, 9(1):128-128.

10. Scandiani MM, Aoki T, Luque AG, Carmona MA, O'Donnell K: First report of sexual reproduction by the soybean sudden death syndrome pathogen Fusarium tucumaniae in Nature. Plant Disease 2010, 94(12):1411-1416.

11. Aoki T, O'Donnell K, Scandiani MM: Sudden death syndrome of soybean in South America is caused by four species of Fusarium: Fusarium brasiliense sp nov., F. cuneirostrum sp nov., F. tucumaniae, and F. virguliforme. Mycoscience 2005, 46:162- 183. 84

12. Rupe JC: frequency and pathogenicity of Fusarium solani recovered from soybeans with sudden-death syndrome. Plant Disease 1989, 73(7):581-584.

13. Roy KW, Lawrence GW, Hodges HH, McLean KS, Killebrew JF: sudden-death syndrome of soybean – Fusarium solani as incitant and relation of Heterodera glycines to disease severity. Phytopathology 1989, 79(2):191-197.

14. Jin H, Hartman GL, Nickell CD, Widholm JM: Characterization and purification of a phytotoxin produced by Fusarium solani, the causal agent of soybean sudden death syndrome. Phytopathology 1996, 86(3):277-282.

15. Brar HK, Bhattacharyya MK: Expression of a single-chain variable-fragment antibody against a Fusarium virguliforme toxin peptide enhances tolerance to sudden death syndrome in transgenic soybean plants. Molecular Plant-Microbe Interactions 2012, 25(6):817-824.

16. Chang H-X, Domier LL, Radwan O, Yendrek CR, Hudson ME, Hartman GL: Identification of multiple phytotoxins produced by Fusarium virguliforme including a phytotoxic effector (FvNIS1) associated with sudden death syndrome foliar symptoms. Molecular Plant-Microbe Interactions 2016, 29(2):96-108.

17. Abeysekara NS, Bhattacharyya MK: Analyses of the xylem sap proteomes identified candidate Fusarium virguliforme proteinacious toxins. Plos One 2014, 9(5):e93667

18. Pudake RN, Swaminathan S, Sahu BB, Leandro LF, Bhattacharyya MK: Investigation of the Fusarium virguliforme fvtox1 mutants revealed that the FvTox1 toxin is involved in foliar sudden death syndrome development in soybean. Current Genetics 2013, 59(3):107- 117.

19. Islam KT, Bond JP, Fakhoury AM: FvSTR1, a striatin orthologue in Fusarium virguliforme, is required for asexual development and virulence. Applied Microbiology and Biotechnology 2017, 101(16):6431-6445.

20. Srivastava SK, Huang X, Brar HK, Fakhoury AM, Bluhm BH, Bhattacharyya MK: The genome sequence of the fungal pathogen Fusarium virguliforme that cause sudden death syndrome in soybean. Plos One 2014, 9(1):e81832.

21. Chang H-X, Yendrek CR, Caetano-Anolles G, Hartman GL: Genomic characterization of plant cell wall degrading enzymes and in silico analysis of xylanses and polygalacturonases of Fusarium virguliforme. BMC Microbiology 2016, 16:147.

22. Sahu BB, Baumbach JL, Singh P, Srivastava SK, Yi X, Bhattacharyya MK: Investigation of the Fusarium virguliforme transcriptomes induced during infection of soybean roots 85

suggests that enzymes with hydrolytic activities could play a major role in root necrosis. Plos One 2017, 12(1):e0169963.

23. Islam KT, Bond JP, Fakhoury AM: FvSNF1, the sucrose non-fermenting protein kinase gene of Fusarium virguliforme, is required for cell-wall-degrading enzymes expression and sudden death syndrome development in soybean. Current Genetics 2017, 63(4):723-738.

24. Swaminathan S, Abeysekara NS, Liu M, Cianzio SR, Bhattacharyya MK: Quantitative trait loci underlying host responses of soybean to Fusarium virguliforme toxins that cause foliar sudden death syndrome. Theoretical and Applied Genetics 2016, 129(3):495-506.

25. Chang SJC, Doubler TW, Kilo V, Suttner R, Klein J, Schmidt ME, Gibson PT, Lightfoot DA: Two additional loci underlying durable field resistance to soybean sudden death syndrome (SDS). Crop Science 1996, 36(6):1684-1688.

26. Hnetkovsky N, Chang SJC, Doubler TW, Gibson PT, Lightfoot DA: Genetic mapping of loci underlying field resistance to soybean sudden death syndrome (SDS). Crop Science 1996, 36(2):393-400.

27. Njiti VN, Doubler TW, Suttner RJ, Gray LE, Gibson PT, Lightfoot DA: Resistance to soybean sudden death syndrome and root colonization by Fusarium solani f. sp. glycine in near-isogenic lines. Crop Science 1998, 38(2):472-477.

28. Prabhu RR, Njiti VN, Bell-Johnson B, Johnson JE, Schmidt ME, Klein JH, Lightfoot DA: Selecting soybean cultivars for dual resistance to soybean cyst nematode and sudden death syndrome using two DNA markers. Crop Science 1999, 39(4):982-987.

29. Iqbal MJ, Meksem K, Njiti VN, Kassem MA, Lightfoot DA: Microsatellite markers identify three additional quantitative trait loci for resistance to soybean sudden-death syndrome (SDS) in Essex × Forrest RILs. Theoretical and Applied Genetics 2001, 102(2):187-192.

30. Njiti VN, Meksem K, Iqbal MJ, Johnson JE, Kassem MA, Zobrist KF, Kilo VY, Lightfoot DA: Common loci underlie field resistance to soybean sudden death syndrome in Forrest, Pyramid, Essex, and Douglas. Theoretical and Applied Genetics 2002, 104(2-3):294-300.

31. Kassem MA, Meksem K, Kang CH, Njiti VN, Kilo V, Wood AJ, Lightfoot DA: Loci underlying resistance to manganese toxicity mapped in a soybean recombinant inbred line population of 'Essex' x 'Forrest'. Plant and Soil 2004, 260(1-2):197-204.

32. Kassem MA, Shultz J, Meksem K, Cho Y, Wood AJ, Iqbal MJ, Lightfoot DA: An updated 'Essex' by 'Forrest' linkage map and first composite interval map of QTL underlying six soybean traits. Theoretical and Applied Genetics 2006, 113(6):1015-1026. 86

33. Njiti VN, Lightfoot DA: Genetic analysis infers Dt loci underlie resistance to Fusarium solani f. sp glycines in indeterminate soybeans. Canadian Journal of Plant Science 2006, 86(1):83-90.

34. Kazi S, Shultz J, Afzal J, Johnson J, Njiti VN, Lightfoot DA: Separate loci underlie resistance to root infection and leaf scorch during soybean sudden death syndrome. Theoretical and Applied Genetics 2008, 116(7):967-977.

35. Yuan J, Njiti VN, Meksem K, Iqbal MJ, Triwitayakorn K, Kassem MA, Davis GT, Schmidt ME, Lightfoot DA: Quantitative trait loci in two soybean recombinant inbred line populations segregating for yield and disease resistance. Crop Science 2002, 42(1):271- 277.

36. Wen Z, Tan R, Yuan J, Bales C, Du W, Zhang S, Chilvers MI, Schmidt C, Song Q, Cregan PB, Wang D: Genome-wide association mapping of quantitative resistance to sudden death syndrome in soybean. BMC Genomics 2014, 15:809.

37. Anderson J, Akond M, Kassem MA, Meksem K, Kantartzi SK: Quantitative trait loci underlying resistance to sudden death syndrome (SDS) in MD96-5722 by ‘Spencer’ recombinant inbred line population of soybean. 3 Biotech 2015, 5(2):203-210.

38. Bao Y, Kurle JE, Anderson G, Young ND: Association mapping and genomic prediction for resistance to sudden death syndrome in early maturing soybean germplasm. Molecular Breeding 2015, 35(6):128.

39. Zhang J, Singh A, Mueller DS, Singh AK: Genome-wide association and epistasis studies unravel the genetic architecture of sudden death syndrome resistance in soybean. Plant Journal 2015, 84(6):1124-1136.

40. Swaminathan S, Abeysekara NS, Liu M, Cianzio SR, Bhattacharyya MK: Quantitative trait loci underlying host responses of soybean to Fusarium virguliforme toxins that cause foliar sudden death syndrome. Theoretical and Applied Genetics 2016, 129(3):495-506.

41. Luckew AS, Swaminathan S, Leandro LF, Orf JH, Cianzio SR: 'MN1606SP' by 'Spencer' filial soybean population reveals novel quantitative trait loci and interactions among loci conditioning SDS resistance. Theoretical and Applied Genetics 2017, 130(10):2139-2149.

42. Meksem K, Doubler TW, Chancharoenchai K, Njiti VN, Chang SJC, Arelli APR, Cregan PE, Gray LE, Gibson PT, Lightfoot DA: Clustering among loci underlying soybean resistance to Fusarium solani, SDS and SCN in near-isogenic lines. Theoretical and Applied Genetics 1999, 99(7-8):1131-1142. 87

43. Sanitchon J, Vanavichit A, Chanprame S, Toojinda T, Triwitayakorn K, Njiti VN, Srinives P: Identification of simple sequence repeat markers linked to sudden death syndrome resistance in soybean. ScienceAsia 2004, 30(2):205-209.

44. Farias Neto ALd, Hartman GL, Pedersen WL, Li SX, Bollero GA, Diers BW: Irrigation and inoculation treatments that increase the severity of soybean sudden death syndrome in the field. Crop Science 2006, 46(6):2547-2554.

45. Rupe JC, Sabbe WE, Robbins RT, Gbur EE: Soil and plant factors associated with sudden- death syndrome of soybean. Journal of Production Agriculture 1993, 6(2):218-221.

46. Rupe JC, Gbur EE: effect of plant-age, maturity group, and the environment on disease progress of sudden-death syndrome of soybean. Plant Disease 1995, 79(2):139-143.

47. Njiti VN, Johnson JE, Torto TA, Gray LE, Lightfoot DA: Inoculum rate influences selection for field resistance to soybean sudden death syndrome in the greenhouse. Crop Science 2001, 41(6):1726-1731.

48. Weems JD, Haudenshield JS, Bond JP, Hartman GL, Ames KA, Bradley CA: Effect of fungicide seed treatments on Fusarium virguliforme infection of soybean and development of sudden death syndrome. Canadian Journal of Plant Pathology 2015, 37(4):435-447.

49. Gaspar AP, Mueller DS, Wise KA, Chilvers MI, Tenuta AU, Conley SP: Response of broad-spectrum and target-specific seed treatments and seeding rate on soybean seed yield, profitability, and economic risk. Crop Science 2017, 57(4):2251-2262.

50. Kandel YR, Wise KA, Bradley CA, Chilvers MI, Tenuta AU, Mueller DS: Fungicide and cultivar effects on sudden death syndrome and yield of soybean. Plant Disease 2016, 100(7):1339-1350.

51. Wang J, Bradley CA, Stenzel O, Pedersen DK, Reuter-Carlson U, Chilvers MI: Baseline sensitivity of Fusarium virguliforme to Fluopyram fungicide. Plant Disease 2017, 101(4):576-582.

52. Srour A, Afzal AJ, Blahut-Beatty L, Hemmati N, Simmonds DH, Li W, Liu M, Town CD, Sharma H, Arelli P, Lightfoot DA: The receptor like kinase at Rhg1-a/Rfs2 caused pleiotropic resistance to sudden death syndrome and soybean cyst nematode as a transgene by altering signaling responses. BMC Genomics 2012, 13:368

53. Fakhoury AM, Lightfoot DA: Reducing aflatoxin accumulation in crop plant e.g. maize, by selecting crop plant line susceptible to infection with Aspergillus flavus and transforming plant with DNA encoding bacterial NADP-specific glutamate dehydrogenase enzyme. In.: Univ Southern Illinois. 88

54. Ngaki MN, Wang B, Sahu BB, Srivastava SK, Farooqi MS, Kambakam S, Swaminathan S, Bhattacharyya MK: Tanscriptomic study of the soybean-Fusarium virguliforme interaction revealed a novel ankyrin-repeat containing defense gene, expression of whose during infection led to enhanced resistance to the fungal pathogen in transgenic soybean plants. Plos One 2016, 11(10):e0163106

55. Wang B, Sumit R, Sahu BB, Ngaki MN, Srivastava SK, Yang Y, Swaminathan S, Bhattacharyya MK: An Arabidopsis glycine-rich plasma membrane protein enhances disease resistance in soybean. Plant physiology 2017, 176(1):865-878.

56. Lin J, Mazarei M, Zhao N, Zhu JJ, Zhuang X, Liu W, Pantalone VR, Arelli PR, Stewart CN, Jr., Chen F: Overexpression of a soybean salicylic acid methyltransferase gene confers resistance to soybean cyst nematode. Plant Biotechnology Journal 2013, 11(9):1135-1145.

57. Lin J, Mazarei M, Zhao N, Hatcher CN, Wuddineh WA, Rudis M, Tschaplinski TJ, Pantalone VR, Arelli PR, Hewezi T, Feng C, Stewart CN: Transgenic soybean overexpressing GmSAMT1 exhibits resistance to multiple-HG types of soybean cyst nematode Heterodera glycines. Plant Biotechnology Journal 2016, 14(11):2100-2109.

58. Cheng Q, Li N, Dong L, Zhang D, Fan S, Jiang L, Wang X, Xu P, Zhang S: Overexpression of soybean isoflavone reductase (GmIFR) enhances resistance to Phytophthora sojae in soybean. Frontiers in Plant Science 2015, 6:1024.

59. Yu M, Wang P, Song Y, Feng YQ, Qu J, Rong J, Zhang M, Zhang Z: Genetic stability and disease resistance analysis of Hrpzpsta gene in transgenic soybean lines. In., vol. 6. Journal of Plant Studies: Canadian Center of Science and Education; 2017: 45-54.

60. Zhang F, Ruan X, Wang X, Liu Z, Hu L, Li C: Overexpression of a chitinase gene from Trichoderma asperellum increases disease resistance in transgenic soybean. Applied Biochemistry and Biotechnology 2016, 180(8):1542-1558.

61. Walters DR: Polyamines in plant-microbe interactions. Physiological and Molecular Plant Pathology 2000, 57(4):137-146.

62. Tabor CW, Tabor H: Polyamines. Annual Review of Biochemistry 1984, 53:749-790.

63. Morgan DML: Polyamine oxidases - enzymes of unknown function? Biochemical Society Transactions 1998, 26(4):586-591.

64. Terui Y, Akiyama M, Sakamoto A, Tomitori H, Yamamoto K, Ishihama A, Igarashi K, Kashiwagi K: Increase in cell viability by polyamines through stimulation of the synthesis of ppGpp regulatory protein and omega protein of RNA polymerase in Escherichia coli. International Journal of Biochemistry & Cell Biology 2012, 44(2):412-422. 89

65. Pollard KJ, Samuels ML, Crowley KA, Hansen JC, Peterson CL: Functional interaction between GCN5 and polyamines: a new role for core histone acetylation. Embo Journal 1999, 18(20):5622-5633.

66. Guo X, Rao JN, Liu L, Zou TT, Keledjian KM, Boneva D, Marasa BS, Wang JY: Polyamines are necessary for synthesis and stability of occludin protein in intestinal epithelial cells. American Journal of Physiology-Gastrointestinal and Liver Physiology 2005, 288(6):G1159-G1169.

67. Wang L, Li PCH: Flexible microarray construction and fast DNA hybridization conducted on a microfluidic chip for greenhouse plant fungal pathogen detection. Journal of Agricultural and Food Chemistry 2007, 55(26):10509-10516.

68. Lee SB, Park JH, Kaevel J, Sramkova M, Weigert R, Park MH: The effect of hypusine modification on the intracellular localization of eIF5A. Biochemical and Biophysical Research Communications 2009, 383(4):497-502.

69. Thomas T, Thomas TJ: Polyamines in cell growth and cell death: molecular mechanisms and therapeutic applications. Cellular and Molecular Life Sciences 2001, 58(2):244-258.

70. Katz AM, Tolokh IS, Pabit SA, Baker N, Onufriev AV, Pollack L: Spermine condenses DNA, but not RNA duplexes. Biophysical Journal 2017, 112(1):22-30.

71. Zwighaft Z, Aviram R, Shalev M, Rousso-Noori L, Kraut-Cohen J, Golik M, Brandis A, Reinke H, Aharoni A, Kahana C, Asher G: Circadian clock control by polyamine levels through a mechanism that declines with age. Cell Metabolism 2015, 22(5):874-885.

72. Andronis EA, Moschou PN, Toumi I, Roubelakis-Angelakis KA: Peroxisomal polyamine oxidase and NADPH-oxidase cross-talk for ROS homeostasis which affects respiration rate in Arabidopsis thaliana. Frontiers in Plant Science 2014, 5.

73. Gill SS, Tuteja N: Polyamines and abiotic stress tolerance in plants. Plant signaling & behavior 2010, 5(1):26-33.

74. Liu J-H, Wang W, Wu H, Gong X, Moriguchi T: Polyamines function in stress tolerance: from synthesis to regulation. Frontiers in Plant Science 2015, 6:827.

75. Kim S-H, Kim S-H, Yoo S-J, Min K-H, Nam S-H, Cho BH, Yang K-Y: Putrescine regulating by stress-responsive MAPK cascade contributes to bacterial pathogen defense in Arabidopsis. Biochemical and Biophysical Research Communications 2013, 437(4):502-508.

76. Basu HS, Marton LJ: The interaction of spermine and pentamines with DNA. Biochemical Journal 1987, 244(1):243-246. 90

77. Valdes-Santiago L, Ruiz-Herrera J: Stress and polyamine metabolism in fungi. Frontiers in Chemistry 2013, 1:42.

78. Tkachenko AG, Nesterova LY: Polyamines as modulators of gene expression under oxidative stress in Escherichia coli. Biochemistry-Moscow 2003, 68(8):850-856.

79. Jung IL, Kim IG: Polyamines and glutamate decarboxylase-based acid resistance in Escherichia coli. Journal of Biological Chemistry 2003, 278(25):22846-22852.

80. Valdes-Santiago L, Guzman-de-Pena D, Ruiz-Herrera J: Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants. Fems Yeast Research 2010, 10(7):928-940.

81. Balasundaram D, Tabor CW, Tabor H: Oxygen-toxicity in a polyamine-depleted spe2- delta mutant of Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences 1993, 90(10):4693-4697.

82. Wojtasik W, Kulma A, Namysl K, Preisner M, Szopa J: Polyamine metabolism in flax in response to treatment with pathogenic and non-pathogenic Fusarium strains. Frontiers in Plant Science 2015, 6:291.

83. Walters D: Resistance to plant pathogens: possible roles for free polyamines and polyamine catabolism. New Phytologist 2003, 159(1):109-115.

84. Minocha R, Majumdar R, Minocha SC: Polyamines and abiotic stress in plants: a complex relationship. Frontiers in Plant Science 2014, 5:175.

85. Lou Y-R, Bor M, Yan J, Preuss AS, Jander G: Arabidopsis NATA1 acetylates putrescine and decreases defense-related hydrogen peroxide accumulation. Plant Physiology 2016, 171(2):1443-1455.

86. Brauc S, De Vooght E, Claeys M, Geuns JMC, Hofte M, Angenon G: Overexpression of arginase in Arabidopsis thaliana influences defence responses against Botrytis cinerea. Plant Biology 2012, 14:39-45.

87. Cona A, Rea G, Angelini R, Federico R, Tavladoraki P: Functions of amine oxidases in plant development and defence. Trends in Plant Science 2006, 11(2):80-88.

88. Cowley T, Walters DR: Polyamine metabolism in barley reacting hypersensitively to the powdery mildew fungus Blumeria graminis f. sp hordei. Plant Cell and Environment 2002, 25(3):461-468.

89. Montilla-Bascon G, Rubiales D, Prats E: Changes in polyamine profile in host and non- host oat-powdery mildew interactions. Phytochemistry Letters 2014, 8:207-212. 91

90. Yoda H, Hiroi Y, Sano H: Polyamine oxidase is one of the key elements for oxidative burst to induce programmed cell death in tobacco cultured cells. Plant Physiology 2006, 142(1):193-206.

91. Moschou PN, Roubelakis-Angelakis KA: Polyamines and programmed cell death. Journal of Experimental Botany 2014, 65(5):1285-1296.

92. O'Brien JA, Daudi A, Butt VS, Bolwell GP: Reactive oxygen species and their role in plant defence and cell wall metabolism. Planta 2012, 236(3):765-779.

93. Dunand C, Crevecoeur M, Penel C: Distribution of superoxide and hydrogen peroxide in Arabidopsis root and their influence on root development: possible interaction with peroxidases. New Phytologist 2007, 174(2):332-341.

94. Tsukagoshi H, Busch W, Benfey PN: Transcriptional Regulation of ROS Controls Transition from Proliferation to Differentiation in the Root. Cell 2010, 143(4):606-616.

95. Ivanchenko MG, den Os D, Monshausen GB, Dubrovsky JG, Bednarova A, Krishnan N: Auxin increases the hydrogen peroxide (H2O2) concentration in tomato (Solanum lycopersicum) root tips while inhibiting root growth. Annals of Botany 2013, 112(6):1107- 1116.

96. Luna E, Pastor V, Robert J, Flors V, Mauch-Mani B, Ton J: Callose deposition: a multifaceted plant defense response. Molecular Plant-Microbe Interactions 2011, 24(2):183-193.

97. Thordal-Christensen H, Zhang ZG, Wei YD, Collinge DB: Subcellular localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive response during the barley-powdery mildew interaction. Plant Journal 1997, 11(6):1187-1194.

98. Bestwick CS, Brown IR, Mansfield JW, Boher B, Nicole M, Essenberg M: Host reactions - Plants. Methods in Microbiology 1998, 27:539-572.

99. Bradley DJ, Kjellbom P, Lamb CJ: Elicitor induced and wound induced oxidative crosslinking of a proline-rich plant-cell wall protein, a novel, rapid defense response. Cell 1992, 70(1):21-30

100. Segmueller N, Kokkelink L, Giesbert S, Odinius D, van Kan J, Tudzynski P: NADPH Oxidases are involved in differentiation and pathogenicity in Botrytis cinerea. Molecular Plant-Microbe Interactions 2008, 21(6):808-819.

101. Govrin EM, Levine A: The hypersensitive response facilitates plant infection by the necrotrophic pathogen Botrytis cinerea. Current Biology 2000, 10(13):751-757. 92

102. van Kan JAL: Licensed to kill: the lifestyle of a necrotrophic plant pathogen. Trends in Plant Science 2006, 11(5):247-253.

103. Gil-ad NL, Mayer AM: Evidence for rapid breakdown of hydrogen peroxide by Botrytis cinerea. Fems Microbiology Letters 1999, 176(2):455-461.

104. Gil-ad NL, Bar-Nun N, Noy T, Mayer AM: Enzymes of Botrytis cinerea capable of breaking down hydrogen peroxide. Fems Microbiology Letters 2000, 190(1):121-126.

105. Asselbergh B, Curvers K, Franca SC, Audenaert K, Vuylsteke M, Van Breusegem F, Hoefte M: Resistance to Botrytis cinerea in sitiens, an abscisic acid-deficient tomato mutant, involves timely production of hydrogen peroxide and cell wall modifications in the epidermis. Plant Physiology 2007, 144(4):1863-1877.

106. Frame BR, Shou HX, Chikwamba RK, Zhang ZY, Xiang CB, Fonger TM, Pegg SEK, Li BC, Nettleton DS, Pei DQ, Wang K: Agrobacterium tumefaciens-mediated transformation of maize embryos using a standard binary vector system. Plant Physiology 2002, 129(1):13-22.

107. Luckew AS, Cianzio SR, Leandro LF: Screening method for distinguishing soybean resistance to Fusarium virguliforme in resistant x resistant crosses. Crop Science 2012, 52(5):2215-2223.

108. R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing. Retrieved from http://www.R-project.org.

109. Tukey J: Multiple comparisons. Journal of American Statistical Association 1953, 48(263):624-625.

110. King EO, Ward MK, Raney DE: Two simple media for the demonstration of pycocyanin and fluorescin. Journal of Laboratory and Clinical Medicine 1954, 44:301-307.

111. Ashfield T, Keen NT, Buzzell RI, Innes RW: Soybean resistance genes specific for different Pseudomonas syringae avirulence genes are allelic, or closely linked, at the Rpg1 locus. Genetics 1995, 141(4):1597-1604.

112. Vanacker H, Carver TLW, Foyer CH: Early H2O2 accumulation in mesophyll cells leads to induction of glutathione during the hyper-sensitive response in the barley-powdery mildew interaction. Plant Physiology 2000, 123(4):1289-1300.

113. Luth D, Warnberg K, Wang K: Soybean [ Glycine max (L.) Merr.]. In: Agrobacterium Protocols: Volume 1. vol. 1223: Springer Protocols; 2014: 275-284. 93

114. Staskawicz B, Dahlbeck D, Keen N, Napoli C: Molecular characterization of cloned avirulence genes from race-0 and race-1 of Pseudomonas syringae pv glycinea. Journal of Bacteriology 1987, 169(12):5789-5794.

115. Keen NT, Buzzell RI: New disease resistance genes in soybean against Pseudomonas syringae pv glycinea - evidence that one of them interacts with a bacterial elicitor. Theoretical and Applied Genetics 1991, 81(1):133-138.

116. Bisgrove SR, Simonich MT, Smith NM, Sattler A, Innes RW: A disease resistance gene in Arabidopsis with specificity for 2 different pathogen avirulence genes. Plant Cell 1994, 6(7):927-933.

117. Torres MA, Jones JDG, Dangl JL: Reactive oxygen species signaling in response to pathogens. Plant Physiology 2006, 141(2):373-378.

118. Angel Torres M: ROS in biotic interactions. Physiologia Plantarum 2010, 138(4):414-429.

119. Kobayashi M, Yoshioka M, Asai S, Nomura H, Kuchimura K, Mori H, Doke N, Yoshioka H: StCDPK5 confers resistance to late blight pathogen but increases susceptibility to early blight pathogen in potato via reactive oxygen species burst. New Phytologist 2012, 196(1):223-237.

120. Asai S, Yoshioka M, Nomura H, Tone C, Nakajima K, Nakane E, Doke N, Yoshioka H: A plastidic glucose-6-phosphate dehydrogenase is responsible for hypersensitive response cell death and reactive oxygen species production. Journal of General Plant Pathology 2011, 77(3):152-162.

121. Asai S, Mase K, Yoshioka H: A key enzyme for flavin synthesis is required for nitric oxide and reactive oxygen species production in disease resistance. Plant Journal 2010, 62(6):911-924.

122. Yoshioka H, Asai S, Yoshioka M, Kobayashi M: Molecular mechanisms of generation for nitric oxide and reactive oxygen species, and role of the radical burst in plant immunity. Molecules and Cells 2009, 28(4):321-329.

123. Asai S, Ohta K, Yoshioka H: MAPK signaling regulates nitric oxide and NADPH oxidase- dependent oxidative bursts in Nicotiana benthamiana. Plant Cell 2008, 20(5):1390-1406.

124. Collins NC, Thordal-Christensen H, Lipka V, Bau S, Kombrink E, Qiu JL, Huckelhoven R, Stein M, Freialdenhoven A, Somerville SC, Schulze-Lefert P: SNARE-protein- mediated disease resistance at the plant cell wall. Nature 2003, 425(6961):973-977.

125. Durrant WE, Dong X: Systemic acquired resistance. Annual Review of Phytopathology 2004, 42:185-209. 94

126. Levine A, Tenhaken R, Dixon R, Lamb C: H2O2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response. Cell 1994, 79(4):583-593.

127. Shetty NP, Mehrabi R, Lutken H, Haldrup A, Kema GHJ, Collinge DB, Jorgensen HJL: Role of hydrogen peroxide during the interaction between the hemibiotrophic fungal pathogen Septoria tritici and wheat. New Phytologist 2007, 174(3):637-647.

CHAPTER 5 TRANSCRIPTOMIC STUDY OF THE SOYBEAN-FUSARIUM

VIRGULIFORME FVPO1 KNOCKOUT MUTANT INTERACTION

Abstract

Fungal pathogens are a major source of potenetial yield supression for soybean growers.

The fungus Fusarium virguliforme is a pathogen responsible for the soybean disease sudden death syndrome. The interaction between F. virguliforme and soybean is complex and environmental factors play a major role in disease development. Understanding of the mechanisims used by F. virguliforme may help in the development of seed treatments, transgenic lines or generating new cultivars. In this study an RNA sequencing approach was used to understand the role of a fungal polyamine oxidase gene FvPO1 during the early stage of soybean infection. Previous work showed that FvPO1 had increased transcript levels in infected soybean roots compared to the levels in germinating spores and mycelia. As early as 18 hours after inoculation of soybean with F. virguliforme spores, soybean mounts a defense response as seen by an increase in transcription of certain soybean genes classified as defense responsive genes.

There is an increase in transcription of genes associated with both jasmonic acid and ethylene pathways along with genes involved in phytoalexin biosynthesis. It was also identified that in the

Δfvpo1 mutant there was an increased expression of the fungal genes encoding enzymes of the phenylacetic acid pathway. A direct connection between phenylacetic acid and polyamines has not been shown before. Both phenylacetic acid and polyamines are both involved in penicillin production in Penicillium chrysogenum. Our results suggest that FvPO1 may regulate secondary metabolite production in Fusarium virguliforme. While there was increased expression of these phenylacetic acid pathway genes, there was no apparent changes in the fungal ability to grow on medium containing phenylacetic acid. 96

Introduction

Soybean, a source of oil and protein for both animal and human consumption, is one of the most important crops grown in the United States. The United Stated is the world leader in soybean production, and in 2016 produced 117.2 million metric tons of soybeans with a value of

40.9 Billion dollars [1]. Soybean yield is threatened by multiple pathogenic organisms such as nematodes, fungi, bacteria, and insect pests. In 2015 the estimated total yield supression from diseases was 11.7% of the total estimated yield [2]. One pathogen responsible for yield supression in soybean is Fusarium virguliforme, a filmentous fungal pathogen responsible for sudden death syndrome (SDS) in the United States [3]. The disease also threatens South

American countries which are also important soybean producers. In 2016, Brazil and Argentina were the second and third largest soybean producing nations producing 108 and 55.5 million meteric tons of soybeans, respectively [1]. The disease is caused by four Fusarium species in

Southern America, these include F. virguliforme, F. tucumaniae, F. brasiliense, F. crassistipitatum [4, 5]. In 2015 the yield loss from SDS in the United States was 43.7 million bushels, and SDS was ranked as the third yield limiting disease [2]. SDS was first discovered in

Arkansas in 1971 and has since spread throughout the soybean growing regions of the United

States and into Canada [6-13]. SDS has also been identified in other soybean growing countries including: Brazil, Argentina, South Africa, Korea and Malaysia [5, 14-18].

Fusarium virguliforme is a soil pathogen which enters and stays in the roots and crown of the infected plant [3]. The fungus stays in the roots and the foliar SDS symptoms are the result of toxins produced by the pathogen [19-21]. The toxins are thought to travel through the xylem sap to the leaves. In plants where the fungus fails to penetrate into the xylem, root rot is present without foliar symptoms [22]. These toxins include the proteinaceous toxins FvTox1 and 97

FvNIS1 which have each been shown to contribute to foliar symptom development [20, 21, 23,

24]. In addition, the expression of 12 transcribed polyketide synthase genes have been identified in F. virguliforme liquid cultures. Polyketide synthases are a large and diverse group of proteins reponsible for the production of secondary metabolites. Some of these compounds such as the antibiotic penicillin and the statin lovastatin have been harnessed for their potential medicinal value. In Fusarium, the product of polyketide synthases (PKS) gene Fum1 is well known for producing the mycotoxin fumonisin [25]. Citrin, fusaric acid and radicicol are three fungal secondary metabolites, produced by PKSs, which were identified in F. virguliforme cultures and produce foliar wilting and chlorosis in soybean [21].

Sequencing of the F. virguliforme genome revealed a predicted 14,845 genes including

1,332 genes which appear to be unique to F. virguliforme [26]. The F. virguliforme straiatin gene, FvSTR1, was shown to be important for both vegetative growth and virulence. Knockout mutants of FvSTR1 have reduced growth and conidia formation on PDA medium [27]. Fusarium virguliforme expresses many predicted plant cell wall degrading enzymes including 66 carbohydrate esterases, 292 glycoside hydrolases and 28 pectate lyases [28]. These proteins are able to break down the different carbohydrates, which make up the plant cell wall. Changes in the F. virguliforme transcriptome during later infection stages show that multiple cell wall hydrolytic enzymes are highly induced during infection [29]. A sucrose non-fermenting protein kinase gene FvSNF1 was identified and mutated in F. virguliforme. Mutants had reduced expression of cell wall degrading enzymes as well as reduced pathogenicity in greenhouse experiments. These results suggest that FvSNF1 may be an important regulator of pathogenicity in F. virguliforme [30]. Transcriptomic study of the F. virguliforme Mont-1 strain during soybean-F. virguliforme interaction revealed 1,886 F. virguliforme genes that are induced at least 98 two-fold during infection when compared with their expression levels in mycelia and germinating spores. Of those genes, 33 had greater than 100-fold increased expression during soybean root infection [29]. Peptidases and proteinases were also among the most highly expressed enzymes during infection. This includes the extracellular elastinolytic metalloproteinase gene, g14032 and the leucine aminopeptidase gene, g12211 [29]. These proteins are deployed by the fungus to degrade plant defense proteins, and may act as effectors, disabling plant defense response [31, 32]. Along with physical barrier degrading enzymes, F. virguliforme also has increased expression of genes for degrading host defense compounds, which show high homology to genes encoding known phytoalexin detoxification proteins, such as maackiain detoxification protein MAK1 from Nectria haematoccoca and pisatin demethylase protein FoPDA1 from Fusarium oxysporum f. sp. pisi [33, 34]. Among the genes with increased expression during soybean root infection was a fungal polyamine oxidase gene, FvPO1.

Polyamines are small molecules that are found throughout nature. The three common polyamines are putrescine, spermidine and spermine. Reduced putrescine biosynthesis can retard fungal growth, while excessive polyamines can be toxic to fungi. Application of spermidine to infection site of Colletotrichum gleosporioides was able to inhibit germination and appressorium development. This inhibition was overcome by exogenous application of calcium suggesting an interplay of calcium ion regulation and polyamines [35]. Likewise, appressorium formation in the rice pathogen Magnaporthe grisea is inhibited by the addition of putrescine, spermidine and spermine. In this example, the addition of cAMP was able to restore proper appressorium formation therefore suggesting a role for cAMP in the appressorium development [36].

Polyamines are essential for growth as has been shown in Neurospora crassa, Saccharomyces cerevisiae, Tapesia yallundae, Yarrowia lipolytica, and Ustilago maydis. [37-40]. Stagonospora 99 nodorum and U. maydis mutants for the polyamine biosynthesis enzyme ornithine decarboxylase have reduced virulence [37, 41-43]. Production of mycotoxins by Fusarium species may be affected by changes in polyamine homeostasis. Production of the mycotoxin deoxynivalenol

(DON) is induced in the presence of the polyamine putrescine and the polyamine precursor ornithine [44]. In the penicillin producing fungi Penicillium chrysogenum and Acremonium chrysogenum, spermidine causes an increase in the expression of the penicillin biosynthetic genes pcbAB, pcbC and penDE. Additions of putrescine and spermine did not have the same effect on expression of these genes [45]. Penicillium chrysogenum treated with spermidine also develops increased pigmentation [46]. It is also interesting that expression of the secondary metabolite biosynthesis regulator LaeA is increased in the presence of spermidine [47]. LaeA interacts with the velvet complex components and regulates expression of toxin and antibiotic biosynthesis. In Cochliobolus heterostrophus, the LaeA and velvet complex regulate T-toxin production and fungal virulence [48]. In Fusarium species, LaeA and the velvet complex can regulate secondary metabolism, mycotoxin production and virulence [49-52]. Therefore, in filamentous fungi the polyamines homeostasis may play an important role in regulation of the production of secondary metabolites and phytotoxic compounds. Phenylacetic acid is an organic compound containing both a phenyl functional group and a carboxylic acid. Phenylacetic acid

(PAA) is synthesized from phenylalanine [53]. In the plant pathogen Rhizoctonia solani, PAA production is an important component of infection [54-56]. There is a negative correlation between R. solani production of PAA and the survival of infected tomato roots [57]. This suggests that the PAA has a role in virulence. The mode of action for PAA induced virulence has not been established, but PAA may act as a building block for toxin production. In penicillin producing fungi, PAA is a precursor to penicillin production. While PAA has been suggested to 100 play a role in fungal pathogenicity, it has also been suggested to play a role in protecting plants from fungal pathogens. Beneficial bacteria produce PAA during their interactions with plants triggering induced systemic resistance (ISR) [58]. ISR is a plant defense mechanism that detects microbe-produced compounds and induces a systemic resistance response. The mechanism is similar to the systemic acquired resistance pathway but is thought to work through jasmonic acid signaling pathway rather than the salicylic acid pathway [59]. Application of culture filtrate fractions containing PAA or purified PAA can induce the ISR pathway in tomatoes challenged with Fusarium oxysporum [58, 60]. In addition, PAA has an antibiotic effect capable of reducing fungal growth [58]. Thus, PAA has a role in protecting plants from invading pathogens. In the interaction of F. virguliforme with the susceptible cultivar ‘Spencer’, the levels of phenylacetate, the conjugate base of PAA, were decreased in the infected root tissues when compared with the uninoculated roots. Likewise, there was a mild increase in phenylacetate levels in the leaves of infected plants [61].

In this study, the transcriptomes of both soybean and F. virguliforme Δfvpo1 mutant knockout mutant and its complemented Δfvpo1::FvPO1 mutant were investigated for changes in gene expression. There were no significant changes in soybean gene expression following infection with the Δfvpo1 mutant and the complemented Δfvpo1 mutant. RNA-sequencing at 18 hours post inoculation in this study provides insight into early responses of soybean to F. virguliforme inoculation. At 18 hours post inoculation with F. virguliforme spores, there was increased transcription of soybean defense-related genes including genes regulated by the plant defense hormones, jasmonic acid and ethylene. Additionally, there were significant changes in soybean secondary metabolites including genes involved in the production of phytoalexins.

Changes in expression of F. virguliforme genes involved in the phenylacetic acid metabolism 101 were significantly induced in the Δfvpo1 mutant as compared to the complemented Δfvpo1 mutant. This change however did not alter the ability of the fungus to grow on plates containing

PAA.

Methods

Fusarium virguliforme isolates

Fusarium virguliforme Δfvpo1and Δfvpo1::FvPO1strains were maintained on Bilay medium (0.1% KH2PO4 [w/v], 0.1% KNO3 [w/v], 0.05% MgSO4 [w/v], 0.05% KCl [w/v], 0.02% starch [w/v], 0.02% glucose [w/v], 0.02% sucrose [w/v] and 2% agar [w/v]) containing 150

µg/mL hygromycin or geneticin respectively. Before inoculation, cultures were grown on potato dextrose agar (PDA) at room temperature (24 ± 2°C) in darkness for 14 days.

Infection protocol

Etiolated ‘Williams 82’ seedlings were grown for seven days in dark condition as described earlier [62]. Spores from Δfvpo1and Δfvpo1::FvPO1 were harvested after two weeks of growth on 1/3 strength PDA plates. Hypocotyls were inoculated with four 10 µL droplets of conidial spore suspensions (1 x 106 spores per mL) or treated with four 10 µL water droplets. The inoculated seedlings were covered with Saran wrap and incubated in room condition. Tissues from 20 hypocotyls for each treatment were harvested 18 h post inoculation or water treatment and frozen in liquid nitrogen. The experiment was completed in triplicate. Total RNA samples were prepared using the Qiagen miRNeasy kit (Hilden, Germany) following manufacturers protocol. cDNA library preparation and sequencing of cDNAs were completed at the DNA

Facility, Iowa State University. 102

RNA sequencing

Sequence quality was assessed using FastQC (v 0.10.1) for all samples. The single end reads were then mapped against the GSNAP indexed reference genome Glycine max (build 275, v2.0) downloaded from Phytozome [63]. GSNAP (v 2014-01-21) [64] was used to map the transcript reads using the default parameters and allowing maximum of 5 mismatches and splice sites. HTSeq (v 0.6.0) [65] was used to generate raw read counts from each sample for each gene feature using uniquely mapped reads and the known Glycine max annotations. Counts for each sample were merged using an AWK script and differential gene expression analyses (DGE) was carried out using QuasiSeq (v 1.0-4) [66]. Upper quartile normalization was performed on combined raw counts allowing inter comparisons between libraries. The outcomes of DGE were expressed as Log2 fold change and are considered significant if the False Discovery Rate (FDR) is less than 0.05. Expression levels are presented as reads per kilobase of transcript per million mapper reads (RPKM). Three comparisons were performed (water vs. Δfvpo1, water vs.

Δfvpo1::FvPO1and Δfvpo1 vs. Δfvpo1::FvPO1). Similar analyses were also performed after mapping the reads to F. virguliforme genome to identify the differentially expressed genes in the pathogen upon infection of soybean [26]. Blast2GO was used to categorize the DGE genes based on biological functions [67]. MapMan software [68, 69] was used to create the pathway maps for genes upregulated during infection of soybean with DGE levels greater than two-fold and q <

0.01.

Phenylacetic acid growth assays

To measure the toxic effect of phenylacetic acid on the fungal strains plate assays were conducted. The 1/3 strength PDA plates were amended with either ethanol, 10 mM, 2 mM, 1 mM or 0.5 mM phenylacetic acid. 10 µL drops of spore suspensions containing either Mont-1 103 wild type, Δfvpo1, or Δfvpo1::FvPO1 spores at a concentration of 1 x 105 spores per mL were placed in the center of the 1/3 strength PDA plates. Fungal diameters were measured for each of the treatment 7 d after inoculation. Eleven biological replications were used to calculate the average radial growth rates. The average percent of growth suppression by phenylacetic acid

(PAA) was calculated by dividing the treatment radial growth by the corresponding radial growth of the isolates on control ethanol amended plates.

Reverse transcription PCR

RNA samples were treated with the Promega RQ1 RNase free DNase (Madison, WI) to remove any possible DNA contamination. Complimentary DNAs were prepared from 2.5 µg

RNA in a 25 µL reaction using the Promega MMLV reverse transcriptase (Madison, WI) following manufacturer's instructions as follows. cDNA molecules were diluted in RNase and

DNase free water to a final concentration of 50 ng/µL. Primers for qRT-PCR can be found in

Table 4. qRT PCR was conducted using Promega GO-Taq qPCR master mix with 2 µL of diluted cDNA molecules in a 10 µL reaction (Madison, WI) samples in a Stratagene Mx3000 thermocycler (San Diego, California). Standard curve was used to calculate primer efficiency using serial dilution of a known amount of cDNA. A graph was created for each primer with the

Ct values on the Y axis and the dilution concentration on the X axis. The slope of the best-fit line was used to calculate efficiency using the following formula Efficiency = 10(-1/slope) x 100 [70].

Primers with efficiency less than 95% were redesigned and new primer efficiency was calculated. Three biological replications were conducted, each with three technical replications per plate. Data was analyzed according to the ΔΔct method [71]. Relative expression of each of the F. virguliforme genes were standardized to the F. virguliforme GAPDH gene g2029. Relative expression of FvPO1, FvPO2, homogentisate 1,2-dioxygenase (g5268) and phenylacetate 2- 104 hydroxylase (g9815) in the Δfvpo1-infected roots is presented based of the expression in the

Δfvpo1::FvPO1-infected roots, therefore gene expression in Δfvpo1::FvPO1 for each gene is shown as 1.

Results

Eighteen hours post inoculations was usedselected as the target time to study the gene expression differences for investigating the molecular lesions in the soybean-F. virguliforme interaction caused by the knockout mutation in the FvPO1 gene. Eighteen hours was chosen for sampling because it was the earliest timepoint where discoloration could be identified from infection of soybean hypocotyls. To gather sufficient amounts of infected tissues for the transcriptomic study at an early stage of the soybean-F. virguliforme interaction, etiolated seedlings were infected with conidial spore suspensions (1 x 106 spores/mL). Host response to F. virguliforme in infected etiolated hypocotyl tissues was seen as reddish coloration of the infection sites as early as 18 h post inoculation (Figure 5.1).

Changes in gene expression in soybean following F. virguliforme infection

Transcripts for over 86% of the soybean genes were detected during transcript sequencing. Differential expression was considered significant if there was at least two-fold change in RPKM expression levels between treatments with a q-value less than 0.01.

Comparison of RPKM for soybean gene in Δfvpo1::FvPO1 inoculated soybean hypocotyls compared with the water inoculated exhibited 1,369 soybean genes that showed significantly increased expression. GO term search was conducted on the genes which showed increased expression levels in the F. virguliforme-inoculated plants as compared to the mock inoculated plants. Categorization of up-regulated soybean genes in GO terms for biological functions included oxidation-reduction, stress response, phosphorylation, transcription, defense response, 105 and membrane transport (Figure 5.2 A). Additionally, genes involved in the flavonoid biosynthetic pathway were upregulated during this early time point. These results showed that the soybean is already mounting a defense response to the fungus at 18 h post inoculation and that flavonoid defense compounds were being made at this early stage. Thirty-six soybean genes were down regulated after 18 h. The biological classifications for these genes include cell wall organization, secondary metabolite biosynthesis, oxidation-reduction, fatty acid biosynthesis

(Figure 5.2).

MapMan analysis was run on the differentially expressed soybean genes. Many of the genes are distributed in biotic stress responses including pathways for the plant defense hormones, jasmonic acid and ethylene. MapMan analysis also assigned many of the differentially expressed genes to secondary metabolite biosynthesis pathways (Figure 5.2 B). These results demonstrate that at 18 h post inoculation soybean is mounting a defense response consisting of jasmonic acid and ethylene signaling along with the production of phytoalexins. Most of the differentially expressed jasmonic acid and ethylene pathway genes had increased expression in the infected samples. Interestingly one of the downregulated genes is Glyma.07G034900, which encodes a linoleate lipoxygenase that metabolizes octadecatrienoic acid to 13(S)-HPOT, a precursor for the plant hormone jasmonic acid for defense signaling [72, 73].

Comparisons of soybean gene expression between Δfvpo1 and Δfvpo1::FvPO1 found that there were no genes differentially expressed with a q value that was significant (q > 0.9).

Therefore it appears that 18 h post inoculation with F. virguliforme spores FvPO1 does not have an influence on soybean gene expression. 106

Changes in transcript levels of the F. virguliforme genes following infection of soybean

Comparison of the RPKM for F. virguliforme transcripts between Δfvpo1 and

Δfvpo1::FvPO1 strains identified ten genes that showed differential transcript levels following infection of soybean (q < 0.1) (Table 5.2). Analysis of these for possible KEGG pathways [74] placed three of the genes in the phenylacetic acid (PAA) metabolism pathway (Figure 5.3).

These genes include phenylacetate 2-hydroxylase (g9815), homogentisate-dioxygenase (g5268), and fumarylacetoacetate hydrolase (g11845). These genes have increased expression in the

Δfvpo1 compared to the Δfvpo1::FvPO1 during infection of etiolated soybean hypocotyls. The

RNA sequencing was conducted in etiolated hypocotyls, but F. virguliforme infects soybean root tissues. Therefore, qRT-PCR was conducted on infected soybean roots two days after inoculation

(Figure 5.4). Soybean seeds were soaked in F. virguliforme spores for 1 hour and then planted in vermiculite. After two days, the roots were sampled and harvested. qPCR on two-day old infected soybean roots results agree with the trend of increased expression levels of the PAA metabolic genes in fvpo1 infected roots as compared to that in the complemented Δfvpo1 mutant, but the increase is not significant at p < 0.05 as was observed in the etiolated hypocotyls (Figure

5.4). Fusarium virguliforme gene expression, in roots and inoculated seedlings, may vary and a time course investigation should be completed to confirm the similar gene expression patterns in soybean roots.

Phenylacetic acid reduced F. virguliforme growth

Phenylacetic acid has been shown to have antifungal affects and may be produced by the plant or beneficial bacteria to restrict pathogen growth [58]. It is also suggested that PAA plays a signaling role in induced systemic resistance (ISR) response [58, 60]. Therefore, we hypothesized that FvPO1 may be involved in controlling the metabolism of phenylacetic acid 107 during infection. Fungal growth assays on plates containing PAA at 10 mM, 2 mM, 1 mM and

0.5 mM concentrations were conducted. There was complete inhibition of fungal growth on PDA plates containing 10 mM PAA. At 2 mM PAA concentrations, the growth reduction for all three strains was close to 30% when compared to growth on PDA plates without PAA (Table 5.3,

Figure 5.5). Growth reduction in all in the Δfvpo1 strain was comparable to the growth reduction in Mont-1 (p = 0.30) and Δfvpo1::FvPO1 and Δfvpo1 (p = 0.23) (Figure 5.5). It appears that although lack of FvPO1 enhances the expression of enzymes in the PAA metabolic pathway including, phenylacetate-2 hydroxylase, homogentisate 1,2-dioxygenase, it did not enhance the ability of the F. virgulforme fvpo1 mutant to grow in PAA ammended PDA plates (Figure 5.5).

Discussion

Understanding the F. virguliforme-soybean interaction is the key for developing management practices to protect soybean from losses due to SDS. An enhanced understanding of the interaction can aid in breeding resistant cultivars, developing transgenic lines with enhanced

SDS resistance and developing treatments to prevent F. virguliforme infection. The interaction appears to be complex with more than 80 QTL identified to contribute to disease resistance [75].

The interaction of F. virguliforme-soybean interaction with other soil microbes especially soybean cyst nematode increases the complexity of the SDS disease development [75-83].

Additionally there is a heavy environmental affect on disease development [84, 85]. An understanding of fungal pathogenicity mechanisms is expected to better manage the SDS disease.

Transcriptomic investigation of F. virguliforme genes expressed during infection showed that F. virguliforme uses many different cell wall degrading enzymes during infection [28, 29].

FvSNF1 has been suggested to have a role of regulating some of the cell wall degrading enzymes 108

[30]. Additionally FvSTR1 is responsible for proper asexual spore production and is necessary for virulence [27]. The proteinaceous toxins FvNIS1 and FvTox1 both contribute to the production of foliar SDS symptoms [20, 21, 23, 24].

The polyamine oxidase gene FvPO1 has increased expression during soybean root infection when compared to germinating spore or mycelia expression [29]. The role of polyamine oxidases in fungal virulence have not been well studied. In Ustilago maydis, polyamine oxidase is not required for normal growth, spore formation or virulence, but the fungus shows restricted growth when grown on media with spermidine as a sole nitrogen source

[41]. The Δfvpo1 mutants have a similar phenotype on plates with spermine as the sole nitrogen source. There was no noticible change in growth, spore formation or virulence between the mutant and complimented mutant [Chapter 3]. Therefore, the question remained why was there increased expression of FvPO1 during soybean root infection? In this study we looked at changes in the transcriptomes of both soybean and F.virguliforme in response to mutation in the

FvPO1 gene. Polyamine oxidases break down the polyamines spermine and spermidine. This breakdown results in the production of hydrogen peroxide. Due to the important role of hydrogen peroxide in the plant defense response, it was hypothesized that the FvPO1 enzyme may produce hydrogen peroxide during infection and alter the soybean defense response. Transcriptomic investigation did not show significant changes in soybean gene expression due to FvPO1 presence, suggesting that it is unlikely that FvPO1 plays a role in altering soybean defense mechanisms.

The soybean transcriptomic investigation however did reveal that soybean is mounting a defense to F. virguliforme infection as early as 18 h post inoculation of etiolated hypocotyls.

This defense response involved transcriptional changes in defense response genes including 109 those involved in the phytoalexin biosynthesis. Expression changes of genes regulated by jasmonic acid and ethylene hormones are also induced following F. virguliforme infection. There was not much change in the transcription of genes regulated by the salicylic acid signaling pathway as would be expected in response to biotrophic pathogens. Instead, it appears that soybean utilizes the ethylene and jasmonic acid defense response pathways that are commonly associated with necrotrophic pathogen response.

Although there were no significant changes in the transcriptome of soybean in response to the expression of FvPO1, we did observe changes in expression of ten F. virguliforme genes due to mutation in FvPO1. There was increased expression of three genes involved in fungal phenylacetic acid (PAA) metabolism in the Δfvpo1 mutant during infection. PAA has been associated both with pathogen virulence and with induced systemic response (ISR) during plant microbe interactions [54-60, 86]. In the penicillin producing fungus Penicillium chrysogenum,

PAA is a building block for the production of penicillin [47]. Interestingly penicillin production appears to be regulated by the presence of the diamine 1,3 diaminpropane and the polyamine spermidine [47]. This suggests that polyamines and polyamine oxidases may play a role in controlling the production of fungal secondary metabolites.

Further work characterizing changes in secondary metabolites related to the PAA pathway in Δfvpo1 mutants compared with Δfvpo1::FvPO1 may provide additional insight into the role of FvPO1. There is a possibility that FvPO1 regulates secondary metabolite production.

The FvPO1 enzyme breaks down both spermine and spermidine and regulates the levels of polyamines in the fungal cell. When FvPO1 is absent, there may be increased levels of spermine and spermidine present in the cells. If polyamine levels regulate secondary metabolite production 110 in F. virguliforme as has been seen with penicillin regulation in P. chrysogenum [47], then

FvPO1 may have an important role regulating secondary metabolite production.

Other genes with differential expression between the Δfvpo1 and Δfvpo1::FvPO1 strains include a major facilitator superfamily protein (MFS) (g8619). This is a large family of proteins responsible for the movement of small molecules across membranes. It is unknown what specific molecules this gene is responsible for transporting. A few MFS genes have been studied in pathogenic fungi for their ability to resist fungicides [87]. Likewise, it is possible that this may be a polyamine transporter, as the polyamine transporters TPO1 in yeast encodes a MFS protein

[88]. Likewise, penT from Penicillium chrysogenum which is involved in penicillin production encodes a MFS transporter [89]. Expression of penT was increased in the presence of PAA and knockout mutants for penT had reduced penicillin production [r89]. Characterization of the MFS g8619 would need to be completed to confirm association with polyamines or the PAA pathway.

Additionally, two genes encoding proteins with unknown functions had increased expression in

Δfvpo1 when compared to Δfvpo1::FvPO1.

Four F. virguliforme genes had increased expression in the Δfvpo1::FvPO1 when compared to the Δfvpo1. This includes a gene encoding an acetyltransferase (GNAT family) protein (g11576). The role of this gene is unknown but could be involved in secondary metabolite production. In Aspergillus nidulans a GNAT acetyltransferase is required for induction of orsellinic acid during fungal-bacterial interaction as well as regulating secondary metabolite production [90, 91]. Additional characterization would need to be completed to know if g11576 is involved in secondary metabolite production. Another secondary metabolite related gene that is differentially expressed is g6043, which predicted to encode a fusarubin cluster- dehydrogenase. Fusarubins are polyketide synthesized secondary metabolites that are involved in 111 pigmentation in Fusarium fujikuroi perithecia [92]. Additionally, two genes located next to each other encoding a gene of unknown function (g5266) and an E1-E2 ATPase (g5265) have increased expression in Δfvpo1::FvPO1. Consideration of the differentially genes examined together supports the conclusion that FvPO1 has a role in secondary metabolite production. The polyamine levels of the cells may play a role in controlling which secondary metabolites are being produced in the fungal cells. It would be interesting to investigate changes in secondary metabolite regulation in response to different levels of polyamines and polyamine inhibitors to see if polyamines levels are regulating the expression of these enzymes.

112

Table 5.1 Soybean and F. virguliforme gene transcripts detected during RNA-sequencing in each of the three experimental conditions.

Experimental Soybean Percent F. virguliforme Percent of Condition Genes of Total genes Detected Total Soybean Detected Soybean Genes Genes

Water 40,180 86.5% - -

Δfvpo1 40,324 86.9% 8,361 56.3%

Δfvpo1::FvPO1 40,359 86.9% 8,333 56.1%

113

Table 5.2 Differentially expressed F. virguliforme genes q < 0.1

Gene Annotation Gene RPKM RPKM Q value number1 Δfvpo1::FvPO12 Δfvpo12

Phenylacetate 2- g9815 1 ± 0.3 46 ± 11.1 1.68E-07 hydroxylase

Homogentisate 1,2- g5268 3 ± 1.5 50 ± 7.4 2.55E-06 dioxygenase

Major Facilitator g8619 1 ± 1.0 17 ± 3.9 0.003 Superfamily

Unknown g13712 0 ± 0.0 8 ± 1.5 0.008

Acetyltransferase g11576 31 ± 16.4 3 ± 2.7 0.029 (GNAT) family

Fusarubin cluster- g6043 54 ± 15.4 15 ± 5.9 0.035 dehydrogenase

Unknown g10086 2 ± 1.5 13 ± 2.2 0.038

Unknown g5266 350 ± 82.7 118 ± 35.1 0.044

E1-E2 ATPase g5265 693 ± 151.8 262 ± 65.3 0.065

Fumarylacetoacetate g11845 11 ± 2.0 36 ± 3.0 0.084 (FAA) hydrolase family

1 Gene numbers according to Fusarium virguliforme genome browser [26] 2 RPKM ± standard error of mean

114

Table 5.3 Growth reduction on PDA plates containing phenylacetic acid. Two experimental replications, n = 11.

Strain Growth Reduction (%)

0.5 mM PAA 1 mM PAA 2 mM PAA

Mont-1 3.7 ± 3.9 11.4 ± 4.2 29.4 ± 2.4

Δfvpo1 6.7 ± 3.0 15.1 ± 2.5 30.6 ± 2.4

Δfvpo1::FvPO1 4.3 ± 1.3 14.0 ± 3.9 31.9 ± 2.5

Ten µL spore suspension (1 x 105 spores/mL) were plated in the center of PDA plates amended with PAA. The growth percent reduction was calculated based on the growth on plates not containg PAA.

115

Table 5.4 Primers used for qRT-PCR

Target Gene Primer Sequence

FvPO1 G6063-F CCCTGAGCCGATTGACTTTAT

G6063-R ACCACCTGAAGAATGTGGTTAG

FvPO2 G12304-2F GGAGACGTGGAAGGAGATTTAG

G12304-2R TCTCGGGTACATGAATGAAGTG

Homogentisate 1,2- G5268-5F CAGCTGCGCATTCATGTTT dioxygenase

G5268-5R CTCTCCTCGTTATATCCCTCCT

Phenylacetate 2-hydroxylase G9815-1F CGCGTCGTCTTTGTCAATTC

G9815-1R ACGCAAGAGAGGGACATAATC

FvGADPH G2029-4F CAACACCAACTCCTCCATCTT

G2029-4R CAGGAGACCAGCTTGACAAA

Fumarylacetoacetate G11845-1F CCCGGCATCAAGAACGATAA

G11845-1R AGGTCCACCTCCAGATCAATA

116

Figure 5.1 Responses of etiolated hypocotyls to F. virguliforme. (A) Seven-day old soybean etiolated seedlings immediately after inoculations. (B) Close up view of water inoculated seedlings 18 h post inoculation. (C) Close up of Δfvpo1::FvPO1 inoculated seedlings 18 h post inoculation. Faint red/orange discoloration can be seen around the inoculation site. (D) Close up view of the Δfvpo1 inoculation 18 h post inoculation. Faint red/orange color can be seen around the inoculation site 117

Figure 5.2 Distribution of soybean differentially expressed genes. (A) Soybean genes with at least two-fold increased expression (q < 0.01) 18 h post F. virguliforme inoculation fall into 12 major biological process categories based on Blast2GO analysis [67]. (B) MapMan [68, 69] analysis of soybean differentially expressed genes for biotic stress response. Genes in the dark grey (in the center of the figure) are more strongly related with biotic stress response, genes in light grey are more putative defense response genes. Heat map depicts fold change versus the water inoculated plants with dark blue squares having the greatest increase in expression and red squares having decreased expression during infection. 118

Figure 5.3 Heat map of F. virguliforme phenylacetic acid metabolism pathway. Figure 5.3 Increased expression in three F. virguliforme genes involved in phenylacetic acid metabolism in the Δfvpo1. The heat map shows the fold change between the Δfvpo1 and the Δfvpo1::FvPO1 infection for F. virguliforme genes predicted to be in the PAA metabolism pathway. F. virguliforme gene numbers are located to the left of the bars and correspond to those in [26]. The PAA pathway is based off of KEGG pathway analysis [74].

119

Figure 5.4 Quantitative RT-PCR of F. virguliforme polyamine oxidase and PAA pathway genes upregulated following infection of soybean roots. Root samples were harvested two days after inoculation with F. virguliforme spores. Quantitative RT- PCR (qRT-PCR) was performed for the two F. virguliforme polyamine oxidase genes FvPO1 (g6063), FvPO2 (g12304); and two genes in the PAA pathway found to be upregulated in the Δfvpo1 mutant, Homogentisate 1,2-dioxygenase (g5268) and Phenylacetate 2-hydroxylase (g9815). The Fusarium virguliforme gene GAPDH (g2029) was used as an interal control. Relative gene expression levels in the Δfvpo1 mutant were determined in proportion to the corresponding leves in the Δfvpo1::FvPO1 which is defined as 1. Error bars are the standard error of thr mean of three independent biological samples n = 3. * = statistically significant at p < 0.05.

120

Figure 5.5 Radial growth reduction of Fusarium virguliforme in response to PAA. Ten µL drops of spores diltued in water to a final concentration of 1 x 106 spores/mL of Mont-1, Δfvpo1 and Δfvpo1::FvPO1 were grown on PDA plates amended with either ethanol or varying concentrations of PAA dissolved in ethanol. Plates were grown for 7 d and growth diameter Average growth diameter is presented from two independent experiments error bars are the standard error of the mean, n = 11. Samples with different letters are statistically different based on an ANOVA with a Tukey’s HSD at a p value < 0.05.

121

References

1. SoyStats: American Soybean Association http://soystats.com (2017) Accessed 19 March 2018. 2. Soybean Disease Loss Estimates From the United States and Ontario, Canada - 2015 http://cropprotectionnetwork.org/crop-loss-estimates/soybean-disease-loss-estimates- 2015 (2016) Accessed 19 March 2018. 3. Roy KW, Hershman DE, Rupe JC, Abney TS: Sudden death syndrome of soybean. Plant Disease 1997, 81(10):1100-1111. 4. Aoki T, O'Donnell K, Homma Y, Lattanzi AR: Sudden-death syndrome of soybean is caused by two morphologically and phylogenetically distinct species within the Fusarium solani species complex – F. virguliforme in North America and F. tucumaniae in South America. Mycologia 2003, 95(4):660-684. 5. Aoki T, O'Donnell K, Scandiani MM: Sudden death syndrome of soybean in South America iscaused by four species of Fusarium: Fusarium brasiliense sp nov., F. cuneirostrum sp nov., F. tucumaniae, and F. virguliforme. Mycoscience 2005, 46(3):162- 183. 6. Roy KW, Lawrence GW, Hodges HH, McLean KS, Killebrew JF: Sudden death syndrome of soybean Fusarium solani as incitant and relation of Heterodera glycines to disease severity. Phytopathology 1989, 79(2):191-197. 7. Rupe JC: Frequency and pathogenicity of Fusarium solani recovered from soybeans with sudden death syndrome. Plant Disease 1989, 73(7):581-584. 8. Yang XB, Rizvi SSA: First report of sudden death syndrome of soybean in Iowa. Plant Disease 1994, 78(8):830. 9. Anderson TR, Tenuta AU: First report of Fusarium solani f. sp. glycines causing sudden death syndrome of soybean in Canada. Plant Disease 1998, 82(4):448. 10. Kurle JE, Gould SL, Lewandowski SM, Li S, Yang XB: First report of sudden death syndrome (Fusarium solani f. sp. glycines) of soybean in Minnesota. Plant Disease 2003, 87(4):449. 11. Bernstein ER, Atallah ZK, Koval NC, Hudelson BD, Grau CR: First report of sudden death syndrome of soybean in Wisconsin. Plant Disease 2007, 91(9):1201. 12. Chilvers MI, Brown-Rytlewski DE: First report and confirmed distribution of soybean sudden death syndrome caused by Fusarium virguliforme in Southern Michigan. Plant Disease 2010, 94(9):1164. 13. Tande C, Hadi B, Chowdhury R, Subramanian S, Byamukama E: First report of sudden death syndrome of soybean caused by Fusarium virguliforme in South Dakota. Plant Disease 2014, 98(7):1012. 122

14. Aoki T, Mercedes Scandiani M, O'Donnell K: Phenotypic, molecular phylogenetic, and pathogenetic characterization of Fusarium crassistipitatum sp nov., a novel soybean sudden death syndrome pathogen from Argentina and Brazil. Mycoscience 2012, 53(3):167-186. 15. Mercedes Scandiani M, Anibal Carmona M, Graciela Luque A, da Silva Matos K, Lenzi L, Norma Formento A, Valeria Martinez C, Raquel Ferri M, Lo Piccolo M, Tartabini M Alvarez D, Sautua F: Isolation, identification and yield losses associated with sudden death syndrome in soybeans in Argentina. Tropical Plant Pathology 2012, 37(5):358- 362. 16. Tewoldemedhin YT, Lamprecht SC, Geldenhuys JJ, Kloppers FJ: First report of soybean sudden death syndrome caused by Fusarium virguliforme in South Africa. Plant Disease 2014, 98(4):569. 17. Lestari P, Sun S, Son H, Lee Y, Lee S: Isolation and characterization of Fusarium solani causing soybean sudden death syndrome in Korea. Journal of Microbiology, Biotechnology and Food Sciences 2016, 6(3):950-955. 18. Khosrow C, Baharuddin S, Latiffah Z: Fusarium virguliforme, a soybean sudden death syndrome fungus in Malaysian soil. Australasian Plant Disease Notes 2014, 9(1):128. 19. Jin H, Hartman GL, Nickell CD, Widholm JM: Characterization and purification of a phytotoxin produced by Fusarium solani, the causal agent of soybean sudden death syndrome. Phytopathology 1996, 86(3):277-282. 20. Brar HK, Bhattacharyya MK: Expression of a single chain variable fragment antibody against a Fusarium virguliforme toxin peptide enhances tolerance to sudden death syndrome in transgenic soybean plants. Molecular Plant-Microbe Interactions 2012, 25(6):817-824. 21. Chang H-X, Domier LL, Radwan O, Yendrek CR, Hudson ME, Hartman GL: Identification of multiple phytotoxins produced by Fusarium virguliforme including a phytotoxic effector (FvNIS1) associated with sudden death syndrome foliar symptoms. Molecular Plant-Microbe Interactions 2016, 29(2):96-108. 22. Navi SS, and Yang, X. B. : Foliar symptom expression in association with early infection and xylem colonization by Fusarium virguliforme (formerly F. solani f. sp. glycines), the causal agent of soybean sudden death syndrome. Online. Plant Health Progress 2008, doi:10.1094/PHP-2008-0222-01-RS. 23. Brar HK, Swaminathan S, Bhattacharyya MK: The Fusarium virguliforme toxin FvTox1 causes foliar sudden death syndrome-like symptoms in soybean. Molecular Plant- Microbe Interactions 2011, 24(10):1179-1188. 24. Pudake RN, Swaminathan S, Sahu BB, Leandro LF, Bhattacharyya MK: Investigation of the Fusarium virguliforme fvtox1 mutants revealed that the FvTox1 toxin is involved in foliar sudden death syndrome development in soybean. Current Genetics 2013, 59(3):107-117. 123

25. Proctor RH, Desjardins AE, Plattner RD: Biosynthetic and genetic relationships of B- series fumonisins produced by Gibberella fujikuroi mating population A. Natural Toxins 1999, 7(6):251-258. 26. Srivastava SK, Huang X, Brar HK, Fakhoury AM, Bluhm BH, Bhattacharyya MK: The genome sequence of the fungal pathogen Fusarium virguliforme that cause sudden death syndrome in soybean. Plos One 2014, 9(1):e81832. 27. Islam KT, Bond JP, Fakhoury AM: FvSTR1, a striatin orthologue in Fusarium virguliforme, is required for asexual development and virulence. Applied Microbiology and Biotechnology 2017, 101(16):6431-6445. 28. Chang H-X, Yendrek CR, Caetano-Anolles G, Hartman GL: Genomic characterization of plant cell wall degrading enzymes and in silico analysis of xylanses and polygalacturonases of Fusarium virguliforme. BMC Microbiology 2016, 16:147 29. Sahu BB, Baumbach JL, Singh P, Srivastava SK, Yi X, Bhattacharyya MK: Investigation of the Fusarium virguliforme transcriptomes induced during infection of soybean roots suggests that enzymes with hydrolytic activities could play a major role in root necrosis. Plos One 2017, 12(1):e0169963 30. Islam KT, Bond JP, Fakhoury AM: FvSNF1, the sucrose non-fermenting protein kinase gene of Fusarium virguliforme, is required for cell-wall-degrading enzymes expression and sudden death syndrome development in soybean. Current Genetics 2017, 63(4):723- 738. 31. Sanz-Martin JM, Ramon Pacheco-Arjona J, Bello-Rico V, Vargas WA, Monod M, Diaz- Minguez JM, Thon MR, Sukno SA: A highly conserved metalloprotease effector enhances virulence in the maize anthracnose fungus Colletotrichum graminicola. Molecular Plant Pathology 2016, 17(7):1048-1062. 32. Jashni MK, Dols IHM, Iida Y, Boeren S, Beenen HG, Mehrabi R, Collemare J, de Wit PJGM: Synergistic action of a metalloprotease and a serine protease from Fusarium oxysporum f. sp lycopersici cleaves chitin-binding tomato chitinases, reduces their antifungal activity, and enhances fungal virulence. Molecular Plant-Microbe Interactions 2015, 28(9):996-1008. 33. Covert SF, Enkerli J, Miao VPW, VanEtten HD: A gene for maackiain detoxification from a dispensable chromosome of Nectria haematococca. Molecular and General Genetics 1996, 251(4):397-406. 34. Coleman JJ, Wasmann CC, Usami T, White GJ, Temporini ED, McCluskey K, VanEtten HD: Characterization of the gene encoding pisatin demethylase (FoPDA1) in Fusarium oxysporum. Molecular Plant-Microbe Interactions 2011, 24(12):1482-1491. 35. Ahn IP, Kim S, Choi WB, Lee YH: Calcium restores prepenetration morphogenesis abolished by polyamines in Colletotrichum gloeosporioides infecting red pepper. Fems Microbiology Letters 2003, 227(2):237-241. 124

36. Choi WB, Kang SH, Lee YW, Lee YH: Cyclic AMP restores appressorium formation inhibited by polyamines in Magnaporthe grisea. Phytopathology 1998, 88(1):58-62. 37. Guevara-Olvera L, Xoconostle-Cazares B, Ruiz-Herrera J: Cloning and disruption of the ornithine decarboxylase gene of Ustilago maydis: Evidence for a role of polyamines in its dimorphic transition. Microbiology-Uk 1997, 143:2237-2245. 38. Valdes-Santiago L, Cervantes-Chavez JA, Ruiz-Herrera J: Ustilago maydis spermidine synthase is encoded by a chimeric gene, required for morphogenesis, and indispensable for survival in the host. Fems Yeast Research 2009, 9(6):923-935. 39. Paulus TJ, Kiyono P, Davis RH: Polyamine deficient Neurospora crassa mutants and synthesis of cadaverine. Journal of Bacteriology 1982, 152(1):291-297. 40. Balasundaram D, Tabor CW, Tabor H: Oxygen toxicity in a polyamine depleted spe2 delta mutant of Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences of the United States of America 1993, 90(10):4693-4697. 41. Valdes-Santiago L, Guzman-de-Pena D, Ruiz-Herrera J: Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants. Fems Yeast Research 2010, 10(7):928-940. 42. Vuohelainen S, Pirinen E, Cerrada-Gimenez M, Keinanen TA, Uimari A, Pietila M, Khomutov AR, Janne J, Alhonen L: Spermidine is indispensable in differentiation of 3T3-L1 fibroblasts to adipocytes. Journal of Cellular and Molecular Medicine 2010, 14(6B):1683-1692. 43. Mueller E, Bailey A, Corran A, Michael AJ, Bowyer P: Ornithine decarboxylase knockout in Tapesia yallundae abolishes infection plaque formation in vitro but does not reduce virulence toward wheat. Molecular Plant-Microbe Interactions 2001, 14(11):1303-1311. 44. Gardiner DM, Kazan K, Manners JM: Nutrient profiling reveals potent inducers of trichothecene biosynthesis in Fusarium graminearum. Fungal Genetics and Biology 2009, 46(8):604-613. 45. Martin J, Garcia-Estrada C, Rumbero A, Recio E, Albillos SM, Ullan RV, Martin J-F: Characterization of an autoinducer of penicillin biosynthesis in Penicillium chrysogenum. Applied and Environmental Microbiology 2011, 77(16):5688-5696. 46. Martin J, Garcia-Estrada C, Kosalkova K, Ullan RV, Albillos SM, Martin J-F: The inducers 1,3-diaminopropane and spermidine produce a drastic increase in the expression of the penicillin biosynthetic genes for prolonged time, mediated by the LaeA regulator. Fungal Genetics and Biology 2012, 49(12):1004-1013. 47. Martin JF: Key role of LaeA and velvet complex proteins on expression of beta-lactam and PR-toxin genes in Penicillium chrysogenum: cross-talk regulation of secondary metabolite pathways. Journal of Industrial Microbiology & Biotechnology 2017, 44(4- 5):525-535. 125

48. Moschou PN, Wu J, Cona A, Tavladoraki P, Angelini R, Roubelakis-Angelakis KA: The polyamines and their catabolic products are significant players in the turnover of nitrogenous molecules in plants. Journal of Experimental Botany 2012, 63(14):5003- 5015. 49. Lopez-Berges MS, Hera C, Sulyok M, Schaefer K, Capilla J, Guarro J, Di Pietro A: The velvet complex governs mycotoxin production and virulence of Fusarium oxysporum on plant and mammalian hosts. Molecular Microbiology 2013, 87(1):49-65. 50. Jiang JH, Yun YZ, Liu Y, Ma ZH: FgVelB is associated with vegetative differentiation, secondary metabolism and virulence in Fusarium graminearum. Fungal Genetics and Biology 2012, 49(8):653-662. 51. Kim HK, Lee S, Jo SM, McCormick SP, Butchko RAE, Proctor RH, Yun SH: Functional roles of FgLaeA in controlling secondary metabolism, sexual development, and virulence in Fusarium graminearum. Plos One 2013, 8(7):e68441. 52. Brown DW, Butchko RAE, Busman M, Proctor RH: Identification of gene clusters associated with fusaric acid, fusarin, and perithecial pigment production in Fusarium verticillioides. Fungal Genetics and Biology 2012, 49(7):521-532. 53. Lamas-Maceiras M, Vaca I, Rodriguez E, Casqueiro J, Martin JF: Amplification and disruption of the phenylacetyl-CoA ligase gene of Penicillium chrysogenum encoding an aryl-capping enzyme that supplies phenylacetic acid to the isopenicillin N- acyltransferase. Biochemical Journal 2006, 395:147-155. 54. Aoki H, Sassa T, Tamura T: Phytotoxic metabolites of Rhizoctonia solani. Nature 1963, 200(4906):575. 55. Frank JA, Francis SK: Effect of a Rhizoctonia solani phytotoxin on potatoes. Canadian Journal of Botany-Revue Canadienne De Botanique 1976, 54(22):2536-2540. 56. Mandava NB, Orellana RG, Warthen JD, Worley JF, Dutky SR, Finegold H, Weathington BC: Phytotoxins in Rhizoctonia solani: Isolation and biological activity of m-hydroxy- and m-methoxyphenylacetic acids. Journal of Agricultural and Food Chemistry 1980, 28(1):71-75. 57. Bartz FE, Glassbrook NJ, Danehower DA, Cubeta MA: Elucidating the role of the phenylacetic acid metabolic complex in the pathogenic activity of Rhizoctonia solani anastomosis group 3. Mycologia 2012, 104(4):793-803. 58. Sumayo M, Hahm M-S, Ghim S-Y: Determinants of Plant Growth-promoting Ochrobactrum lupini KUDC1013 involved in induction of systemic resistance against Pectobacterium carotovorum subsp carotovorum in tobacco leaves. Plant Pathology Journal 2013, 29(2):174-181. 59. Choudhary DK, Prakash A, Johri BN: Induced systemic resistance (ISR) in plants: mechanism of action. Indian Journal of Microbiology 2007, 47(4):289-297. 126

60. Akram W, Anjum T, Ali B: Phenylacetic acid Is ISR determinant produced by Bacillus fortis IAGS162, which involves extensive re-modulation in metabolomics of tomato to protect against Fusarium wilt. Frontiers in Plant Science 2016, 7:498. 61. Abeysekara NS, Swaminathan S, Desai N, Guo L, Bhattacharyya MK: The plant immunity inducer pipecolic acid accumulates in the xylem sap and leaves of soybean seedlings following Fusarium virguliforme infection. Plant Science 2016, 243:105-114. 62. Ward EWB, Lazarovits G, Unwin CH, Buzzell RI: Hypocotyl reactions and glyceollin in soybeans inoculated with zoospores of Phytophthora megasperma var sojae. Phytopathology 1979, 69(9):951-955. 63. Schmutz J, Cannon SB, Schlueter J, Ma J, Mitros T, Nelson W, Hyten DL, Song Q, Thelen JJ, Cheng J et al: Genome sequence of the palaeopolyploid soybean. Nature 2010, 463(7278):178-183. 64. Wu TD, Watanabe CK: GMAP: a genomic mapping and alignment program for mRNA and EST sequences. Bioinformatics 2005, 21(9):1859-1875. 65. Anders S, Pyl P, Huber W: HTSeq - A Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31(2):166-169. 66. Lund S, Nettleton D, McCarthy DJ, Smyth GK: Detecting differntial expression in RNA- sequence data using quasi-likelihood with shrunken dispersion estimates. Statistical Application in Genetics and Molecular Biology 2012, 11(5):1544-6115. 67. Conesa A, Götz S, García-Gómez JM, Terol J, Talón M, Robles M: Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 2005, 21(18):3674-3676. 68. Thimm O, Blasing O, Gibon Y, Nagel A, Meyer S, Kruger P, Selbig J, Muller LA, Rhee SY, Stitt M: MAPMAN: a user-driven tool to display genomics data sets onto diagrams of metabolic pathways and other biological processes. Plant Journal 2004, 37(6):914- 939. 69. Usadel B, Nagel A, Thimm O, Redestig H, Blaesing OE, Palacios-Rojas N, Selbig J, Hannemann J, Piques MC, Steinhauser D,Scheible WR, Gibon Y, Morcuende R, Weicht D, Meyer S, Stitt M:Extension of the visualization tool MapMan to allow statistical analysis of arrays, display of coresponding genes, and comparison with known responses. Plant Physiology 2005, 138(3):1195-1204. 70. Rasmussen R: Quantification on the LightCycler. In Meuer S, Wittwer C, Nakagawara K, editors. Rapid Cycle Real-time PCR, Methods and Applications. Heidelberg: Springer Press; 2001. 21-34 71. Schmittgen TD, Livak KJ: Analyzing real-time PCR data by the comparative C-T method. Nature Protocols 2008, 3(6):1101-1108. 127

72. Peng YL, Shirano Y, Ohta H, Hibino T, Tanaka K, Shibata D: A novel lipoxygenase from rice: primary structure and specific expression upon incompatible infection with rice blast fungus. Journal of Biological Chemistry 1994, 269(5):3755-3761. 73. Ramirez AM, Yang T, Bouwmeester HJ, Jongsma MA: A trichome-specific linoleate lipoxygenase expressed during pyrethrin biosynthesis in Pyrethrum. Lipids 2013, 48(10):1005-1015. 74. Kanehisa M, Furumichi M, Tanabe M, Sato Y, Morishima K: KEGG: new perspectives on genomes, pathways, disease and drugs. Nucelic Acid Research 2017, 45(D1):D353- D361. 75. Chang H-X, Roth MG, Wang D, Cianzio SR, Lightfoot DA, Hartman GL, Chilvers MI: Integration of sudden death syndrome resistance loci in the soybean genome. Theoretical and Applied Genetics 2018, 131(4):757-773. 76. Hershman DE, Hendrix JW, Stuckey RE, Bachi PR, Henson G: Influence of planting date and cultivar on soybean sudden-death syndrome in Kentucky. Plant Disease 1990, 74(10):761-766. 77. Rupe JC, Sabbe WE, Robbins RT, Gbur EE: Soil and plant factors associated with sudden death syndrome of soybean. Journal of Production Agriculture 1993, 6(2):218- 221. 78. Scherm H, Yang XB, Lundeen P: Soil variables associated with sudden death syndrome in soybean fields in Iowa. Plant Disease 1998, 82(10):1152-1157. 79. Xing LJ, Westphal A: Interaction of Fusarium solani f. sp glycines and Heterodera glycines in sudden death syndrome of soybean. Phytopathology 2006, 96(7):763-770. 80. Gao X, Jackson TA, Hartman GL, Niblack TL: Interactions between the soybean cyst nematode and Fusarium solani f. sp glycines based on greenhouse factorial experiments. Phytopathology 2006, 96(12):1409-1415. 81. Xing L, Westphal A: Synergism in the interaction of Fusarium virguliforme with Heterodera glycines in sudden death syndrome of soybean. Journal of Plant Diseases and Protection 2013, 120(5-6):209-217. 82. Marburger D, Conley S, Esker P, MacGuidwin A, Smith D: Relationship between Fusarium virguliforme and Heterodera glycines in commercial soybean fields in Wisconsin. Plant Health Progress 2014, PHP-RS-13-0107. 83. Kandel YR, Wise KA, Bradley CA, Chilvers MI, Byrne AM, Tenuta AU, Faghihi J, Wiggs SN, Mueller DS: Effect of soybean cyst nematode resistance source and seed treatment on population densities of Heterodera glycines, sudden death syndrome, and yield of soybean. Plant Disease 2017, 101(12):2137-2143. 84. Abdelsamad NA, Baumbach J, Bhattacharyya MK, Leandro LF: Soybean sudden death syndrome caused by Fusarium virguliforme is impaired by prolonged flooding and anaerobic conditions. Plant Disease 2017, 101(5):712-719. 128

85. Leandro LFS, Robertson AE, Mueller DS, Yang X-B: Climatic and environmental trends observed during epidemic and non-epidemic years of soybean sudden death syndrome in Iowa. Online. Plant Health Progress 2013, doi:10.1094/PHP-2013-0529-01-RS. 86. Kandel YR, Wise KA, Bradley CA, Tenuta AU, Mueller DS: Effect of planting date, seed treatment, and cultivar on plant population, sudden death syndrome, and yield of soybean. Plant Disease 2016, 100(8):1735-1743. 87. Costa C, Dias PJ, Sa-Correia, I Teixeira MC: MFS multidrug transporters in pathogenic fungi: do they have real clinical impact? Frontiers in Physiology 2014 5:197. 88. Uemura T, Tachihara K, Tomitori H, Kashiwagi K, Igarashi K: Characteristics of the polyamine transporter TPO1 and regulation of its activity and cellular localization by phosphorylation. Journal of Biological Chemistry 2005, 280(10):9646-9652. 89. Yang J, Xinxin X, Gang L: Amplification of an MFS transporter encoding gene penT significantly stimulates penicillin production and enhances sensitivity of Penicillium chrysogenum to phenylacetic acid. Journal of Genetics and Genomics 2012, 39:593-602 90. Nuetzmann HW, Fischer J, Scherlach K, Hertweck C, Brakhage AA: Distinct amino acids of histone H3 control secondary metabolism in Aspergillus nidulans. Applied and Environmental Microbiology 2013, 79(19):6102-6109. 91. Nuetzmann HW, Reyes-Dominguez Y, Scherlach K, Schroeckh V, Horn F, Gacek A, Schumann J, Hertweck C, Strauss J, Brakhage AA: Bacteria-induced natural product formation in the fungus Aspergillus nidulans requires Saga/Ada-mediated histone acetylation. Proceedings of the National Academy of Science 2011, 108(34):14282- 14287. 92. Studt L, Wiemann P, Kleigrewe K, Humpf HU, Tudzynski, B. Biosynthesis of Fusarubins account for pigmentation of Fusarium fujikuroi perithecia. Applied and Environmental Microbiology 2012, 78(12):4468-4480.

129

CHAPTER 6 GENERAL CONCLUSIONS

Soybean production is an important to the economic growth and stability of the United

States and especially the Midwestern part of the U.S. Soybean potential yields are suppressed by pest and pathogen attack. Therefore, it is important to understand how these pathogens cause diseases to help prevent economic losses in soybean.

Fusarium virguliforme is a fungal pathogen responsible for sudden death syndrome

(SDS) in soybean [9]. SDS is one of the leading yield limiting disease of soybean. The fungus infects soybean root system causing root rot and produces toxins that cause foliar disease [3].

The SDS resistance is partial and encoded by many QTL each contributing small effects [36, 37].

Therefore, an increased understanding of how F. virguliforme causes the disease is an important step in preventing losses due to SDS.

In this dissertation, I have characterized the F. virguliforme polyamine oxidase gene,

FvPO1. Investigation of the Δfvpo1 knockout mutant revealed that FvPO1 is not vital for fungal growth and development, or to cause SDS. The knockout mutant Δfvpo1 has reduced growth on media containing the polyamine spermine as the sole nitrogen source confirming that FvPO1 encodes a functional polyamine oxidase (Figure 3.3). It can break down spermine and spermidine to release the nitrogen for its growth and development. It was also found that while

FvPO1 has increased expression during soybean root infection this expression is not necessary to cause root rot or foliar symptoms (Figure 3.4). Knockout experiments for the second polyamine oxidase gene FvPO2 were attempted but these experiments were not successful. The lack of successful knockout of FvPO2 may indicate that FvPO2 may be a vital gene and its presence may be essential for spore germination and growth. Another possibility may be that there is 130 reduced recombination in the region containing FvPO2 necessary for homologous recombination-based gene knockout. RNAi experiments silencing FvPO2 in the Δfvpo1 background could help understand if FvPO2 is vital for F. virguliforme growth and development.

A system for RNAi would have to be developed in F. virguliforme, which up to date has not yet been developed.

Polyamine oxidases play a role in plant defense response to pathogens [38]. While the mechanisms for how polyamines and polyamine oxidases are involved remains unknown. It is suggested that, is either through a signaling cascade, through cell death or by enhancing callose deposition at infection sites [19-33]. Due to the role of polyamine oxidases in disease resistance, transgenic soybean plants expressing FvPO1 were created. These plants were screened for altered disease resistance response to F. virguliforme in both the growth chamber and field conditions. Field experiments have contradicting results with the 2015 field experiment suggesting that there may be enhanced resistance in the FvPO1 transgenic plants, while the 2016 field showed there was no enhanced disease resistance (Figure 4.2 and 4.3). Growth chamber experiments agree with the 2016 field results and found no enhanced SDS resistance in the

FvPO1 plants (Figure 4.3 and 4.4). Since SDS symptom development is highly dependent on environment [39-40], environmental factors may have played a role in the differences in foliar symptoms between the 2015 and 2016 fields. Likewise, seed storage conditions can also play a role in the susceptibility of the plants. In the 2015 season, all of the FvPO1 transgenic seeds were gathered from plants grown in the greenhouse where the 2016 FvPO1 transgenic seeds came from the 2015 field. Likewise, in growth chamber experiments both transgenic seeds and

‘Williams 82’ seeds came from the field experiments. FvPO1 transgenic plants were also screened for their ability to alter defense response to the biotrophic pathogen Pseudomonas 131 syringae pv. glycinea. FvPO1 transgenic soybeans showed no altered defense response to either the virulent or the avirulent bacteria (Figure 4.5). While these experiments show that FvPO1 expression does not provide consistently enhanced resistance to either F. virguliforme or

Pseudomonas syringae pv glycinea, we failed to show why it does not provide resistance. The initial hypothesis that increased expression of FvPO1 would increase hydrogen peroxide formation was not tested. Quantification of hydrogen peroxide in the FvPO1 transgenic plants during infection and compared to the transformation background ‘Williams 82’ will determine if there is increased hydrogen peroxide formation in the transgenic lines. In addition, localization and timing of hydrogen peroxide burst are both important in defense response. Microscopy looking at where hydrogen peroxide is produced and how quickly it is induced after infection may be helpful in accessing the way the FvPO1 plants failed to enhance resistance

In order to better elucidate the role of FvPO1 during the F. virguliforme-soybean interaction, transcriptomes of the etiolated soybean hypocotyls inoculated with either Δfvpo1 or the complimented Δfvpo1::FvPO1 were investigated. Based on the transcriptomic data, there was no change in the soybean gene expression in response to the absence of FvPO1 gene in the

Δfvpo1 mutant. The inoculation method for this study involved the inoculation of the hypocotyls of etiolated dark grown seedlings. Therefore, infection occurred in tissues and under conditions that it does not occur in nature. Soybean response to F. virguliforme infection may be different in roots compared to hypocotyls. Additionally, daylight cycles have an important influence on gene expression therefore using dark grown seedlings may have decreased the expression of some defense response gene and masked any differences which may have been present between the

Δfvpo1::FvPO1 and the Δfvpo1 response [41, 42]. 132

This study nonetheless, still presents a picture of early soybean gene expression response to inoculation with F. virguliforme. The data show that there was increased expression of genes associated with the plant defense hormones jasmonic acid and ethylene (Figure 5.2). These hormones are associated with plant response to necrotrophic pathogens and thought to work antagonistically with salicylic acid defense hormone pathway that is characteristic of the host responses to biotrophic pathogens [43, 44]. There was also an increase in the expression of genes that are involved in the secondary metabolite biosynthesis including phytoalexins (Figure 5.2).

The production of phytoalexins and other antifungal compounds appears to be an important component of the soybean response to F. virguliforme. ‘Williams 82’ considered for this study is less susceptible to SDS than the ‘Spencer’ and ‘Essex’ cultivars that have been previously used for gene expression, metabolome and proteome investigations into the responses of soybean to F. virguliforme [45-50].

When the F. virguliforme transcriptome was investigated, it was found that there was increased expression of three genes in the phenylacetic acid metabolism pathway. Quantitative reverse transcription PCR showed a trend supporting the sequencing results, but the trend was not significant at the threshold of p < 0.05 (Figure 5.4). Replication of the infection assay with additional samples and a time course investigation of the roots may provide significant results.

Phenylacetic acid (PAA) has been shown to have antifungal activities [51], and was found to reduce F. virguliforme mycelial growth in both the Δfvpo1 mutant and complimented strains equally (Table 5.3, Figure 5.5). PAA produced by biocontrol bacteria has been shown to protect plants from infection by triggering induced systemic resistance (ISR) [51-53]. ISR increases plant’s defense response and is thought to act through jasmonic and ethylene signaling [51]. The connection between FvPO1 and PAA is interesting and warrants more investigation. 133

Metabolomics investigations looking for changes in PAA and related compounds between the

Δfvpo1 and Δfvpo1::FvPO1 strains may help shed light on the role of FvPO1. The connection between PAA and bacterial biocontrol suggest that FvPO1 is/may not be involved in the interaction with soybean but may be involved in interaction of F. virguliforme with the soil microbiome. An interesting avenue of investigation may be to study the microbiome of the soybean root rhizosphere following inoculation with the Δfvpo1 mutant and its complemented isolate. Additionally, both PAA and the polyamine spermidine have been connected to the penicillin production in Penicillium chrysogenum [54, 55]. The Δfvpo1 mutant may accumulate increased levels of spermidine in their cells. In P. chrysogenum spermine was able to induce penicillin production [54]. Likewise, increased spermidine levels in F. virguliforme may alter secondary metabolite biosynthesis. Changes in the transcript levels of secondary metabolite related genes between the mutant and complemented fungus support this hypothesis. Additional insight into these changes and the role of polyamines and in controlling secondary metabolite production may present interesting results.

In conclusion, the research presented here show that FvPO1 is a functional polyamine oxidase gene that is not required for fungal growth or virulence. Expression of FvPO1 in transgenic plants does not enhance resistance to the biotrophic pathogen Pseudomonas syringae pv. glycinea or consistently reduce symptoms of SDS due to F. virguliforme infection. The absence of FvPO1 in the Δfvpo1 genome during infection does not alter the expression levels of soybean defense responses genes during infection. RNA-sequencing results suggest that FvPO1 expression regulates the PAA metabolism pathway. The qRT-PCR results showed a trend supporting the RNA-sequencing results but were not statistically significant. Additional investigations into these results would be needed to confirm the role of FvPO1 in regulating 134

PAA. The association between FvPO1 and phenylacetic acid may be an interesting research avenue to pursue.

135

REFERENCES

1. SoyStats: American Soybean Association http://soystats.com (2017) Accessed 19 March 2018. 2. Soybean Disease Loss Estimates From the United States and Ontario, Canada - 2015 http://cropprotectionnetwork.org/crop-loss-estimates/soybean-disease-loss-estimates- 2015 (2016) Accessed 19 March 2018. 3. Aoki T, O'Donnell K, Homma Y, Lattanzi AR: Sudden-death syndrome of soybean is caused by two morphologically and phylogenetically distinct species within the Fusarium solani species complex F. virguliforme in North America and F. tucumaniae in South America. Mycologia 2003, 95(4):660-684. 4. Aoki T, Mercedes Scandiani M, O'Donnell K: Phenotypic, molecular phylogenetic, and pathogenetic characterization of Fusarium crassistipitatum sp nov., a novel soybean sudden death syndrome pathogen from Argentina and Brazil. Mycoscience 2012, 53(3):167-186. 5. Roy KW, Hershman DE, Rupe JC, Abney TS: Sudden Death Syndrome of Soybean. Plant Disease 1997, 81(10):1100-1111. 6. Roy KW, Lawrence GW, Hodges HH, McLean KS, Killebrew JF: Sudden death syndrome of soybean Fusarium solani as incitant and relation of Heterodera glycines to disease severity. Phytopathology 1989, 79(2):191-197. 7. Rupe JC: Frequency and pathogenicity of Fusarium solani recovered from soybeans with sudden death syndrome. Plant Disease 1989, 73(7):581-584. 8. Yang XB, Rizvi SSA: First report of sudden death syndrome of soybean in Iowa. Plant Disease 1994, 78(8):830-830. 9. Anderson TR, Tenuta AU: First report of Fusarium solani f. sp. glycines causing sudden death syndrome of soybean in Canada. Plant Disease 1998, 82(4):448-448. 10. Kurle JE, Gould SL, Lewandowski SM, Li S, Yang XB: First report of sudden death syndrome (Fusarium solani f. sp. glycines) of soybean in Minnesota. Plant Disease 2003, 87(4):449-449. 11. Bernstein ER, Atallah ZK, Koval NC, Hudelson BD, Grau CR: First report of sudden death syndrome of soybean in Wisconsin. Plant Disease 2007, 91(9):1201-1201. 12. Chilvers MI, Brown-Rytlewski DE: First report and confirmed distribution of soybean Sudden death syndrome caused by Fusarium virguliforme in southern Michigan. Plant Disease 2010, 94(9):1164-1164. 13. Tande C, Hadi B, Chowdhury R, Subramanian S, Byamukama E: First report of sudden death syndrome of soybean caused by Fusarium virguliforme in South Dakota. Plant Disease 2014, 98(7):1012-1012. 136

14. Aoki T, O'Donnell K, Scandiani MM: Sudden death syndrome of soybean in South America is caused by four species of Fusarium: Fusarium brasiliense sp nov., F. cuneirostrum sp nov., F. tucumaniae, and F. virguliforme. Mycoscience 2005, 46:162- 183. 15. Mercedes Scandiani M, Anibal Carmona M, Graciela Luque A, da Silva Matos K, Lenzi L, Norma Formento A, Valeria Martinez C, Raquel Ferri M, Lo Piccolo M, Tartabini M, Alvarez D, Sautua F: Isolation, identification and yield losses associated with sudden death syndrome in soybeans in Argentina. Tropical Plant Pathology 2012, 37(5):358- 362. 16. Tewoldemedhin YT, Lamprecht SC, Geldenhuys JJ, Kloppers FJ: First report of soybean sudden death syndrome caused by Fusarium virguliforme in South Africa. Plant Disease 2014, 98(4):569-569. 17. Lestari P, Sun S, Son H, Lee Y, Lee S: Isolation and characterization of Fusarium solani causing soybean sudden death syndrome in Korea. Journal of Microbiology, Biotechnology and Food Sciences 2016, 6(3):950-955. 18. Khosrow C, Baharuddin S, Latiffah Z: Fusarium virguliforme, a soybean sudden death syndrome fungus in Malaysian soil. Australasian Plant Disease Notes 2014, 9(1):128- 128. 19. Huang YH, Hartman GL: Reaction of selected soybean genotypes to isolates of Fusarium solani f. sp. glycines and their culture filtrates. Plant Disease 1998, 82(9):999-1002. 20. Luo Y, Myers O, Lightfoot DA, Schmidt ME: Root colonization of soybean cultivars in the field by Fusarium solani f. sp glycines. Plant Disease 1999, 83(12):1155-1159. 21. Gongora-Canul CC, Leandro LFS: Effect of soil temperature and plant age at time of inoculation on progress of root rot and foliar symptoms of soybean sudden death syndrome. Plant Disease 2011, 95(4):436-440. 22. Navi SS, and Yang, X. B.: Foliar symptom expression in association with early infection and xylem colonization by Fusarium virguliforme (formerly F. solani f. sp. glycines), the causal agent of soybean sudden death syndrome. Online. Plant Health Progress 2008, doi:10.1094/PHP-2008-0222-01-RS. 23. Leandro LFS, Robertson AE, Mueller DS, Yang X-B: Climatic and environmental trends observed during epidemic and non-epidemic years of soybean sudden death syndrome in Iowa. Online. Plant Health Progress 2013, doi:10.1094/PHP-2013-0529-01-RS. 24. Kandel YR, Wise KA, Bradley CA, Tenuta AU, Mueller DS: Effect of planting date, seed treatment, and cultivar on plant population, sudden death syndrome, and yield of soybean. Plant Disease 2016, 100(8):1735-1743. 25. Abdelsamad NA, Baumbach J, Bhattacharyya MK, Leandro LF: Soybean sudden death syndrome caused by Fusarium virguliforme is impaired by prolonged flooding and anaerobic conditions. Plant Disease 2017, 101(5):712-719. 137

26. Ji J, Scott MP, Bhattacharyya MK: Light is essential for degradation of ribulose-1.5- bisphosphate carboxylase-oxygenase large subunit during sudden death syndrome development in soybean. Plant Biology 2006, 8(5):597-605. 27. Brar HK, Swaminathan S, Bhattacharyya MK: The Fusarium virguliforme toxin FvTox1 causes foliar sudden death syndrome-like symptoms in soybean. Molecular Plant- Microbe Interact. 2011, 24(10):1179-1188. 28. Scherm H, Yang XB, Lundeen P: Soil variables associated with sudden death syndrome in soybean fields in Iowa. Plant Disease 1998, 82(10):1152-1157. 29. Srour A, Gibson D, Leandro L, Malvick D, Bond J, Fakhoury A: Unraveling microbial and edaphic factors affecting the development of sudden death syndrome in soybean. Phytobiomes 2017, 1:91-101. 30. Gao X, Jackson TA, Hartman GL, Niblack TL: Interactions between the soybean cyst nematode and Fusarium solani f. sp glycines based on greenhouse factorial experiments. Phytopathology 2006, 96(12):1409-1415. 31. Hershman DE, Hendrix JW, Stuckey RE, Bachi PR, Henson G: Influence of planting date and cultivar on soybean sudden-death syndrome in Kentucky. Plant Disease 1990, 74(10):761-766. 32. Rupe JC, Sabbe WE, Robbins RT, Gbur EE: Soil and plant factors associated with sudden death syndrome of soybean. Journal of Production Agriculture 1993, 6(2):218- 221. 33. Xing LJ, Westphal A: Interaction of Fusarium solani f. sp glycines and Heterodera glycines in sudden death syndrome of soybean. Phytopathology 2006, 96(7):763-770. 34. Xing L, Westphal A: Synergism in the interaction of Fusarium virguliforme with Heterodera glycines in sudden death syndrome of soybean. Journal of Plant Diseases and Protection 2013, 120(5-6):209-217. 35. Marburger D, Conley S, Esker P, MacGuidwin A, Smith D: Relationship between Fusarium virguliforme and Heterodera glycines in commercial soybean fields in Wisconsin. Plant Health Progress 2014, PHP-RS-13-0107. 36. Kandel YR, Wise KA, Bradley CA, Chilvers MI, Byrne AM, Tenuta AU, Faghihi J, Wiggs SN, Mueller DS: Effect of soybean cyst nematode resistance source and seed treatment on population densities of Heterodera glycines, sudden death syndrome, and yield of soybean. Plant Disease 2017, 101(12):2137-2143. 37. Chang SJC, Doubler TW, Kilo VY, AbuThredeih J, Prabhu R, Freire V, Suttner R, Klein J, Schmidt ME, Gibson PT, Lightfoot, DA: Association of loci underlying field resistance to soybean sudden death syndrome (SDS) and cyst nematode (SCN) race 3. Crop Science 1997, 37(3):965-971. 138

38. Prabhu RR, Njiti VN, Bell-Johnson B, Johnson JE, Schmidt ME, Klein JH, Lightfoot DA: Selecting soybean cultivars for dual resistance to soybean cyst nematode and sudden death syndrome using two DNA markers. Crop Science 1999, 39(4):982-987. 39. Cianzio SR, Lundeen P, Gebhart G, Rivera-Velez N, Bhattacharyya MK, Swaminathan S: Registration of AR11SDS soybean germplasm resistant to sudden death syndrome, soybean cyst nematode, and with moderate iron deficiency chlorosis scores. Journal of Plant Registrations 2016, 10(2):177-188. 40. Meksem K, Doubler TW, Chancharoenchai K, Njiti VN, Chang SJC, Arelli APR, Cregan PE, Gray LE, Gibson PT, Lightfoot DA: Clustering among loci underlying soybean resistance to Fusarium solani, SDS and SCN in near-isogenic lines. Theoretical and Applied Genetics 1999, 99(7-8):1131-1142. 41. Njiti VN, Shenaut MA, Suttner RJ, Schmidt ME, Gibson PT: Soybean response to sudden death syndrome: Inheritance influenced by cyst nematode resistance in Pyramid x Douglas progenies. Crop Science 1996, 36(5):1165-1170. 42. Yuan J, Njiti VN, Meksem K, Iqbal MJ, Triwitayakorn K, Kassem MA, Davis GT, Schmidt ME, Lightfoot DA: Quantitative trait loci in two soybean recombinant inbred line populations segregating for yield and disease resistance. Crop Science 2002, 42(1):271-277. 43. Kantartzi SK, Klein J, III, Schmidt M: Registration of 'Saluki 4411' soybean with resistance to sudden death syndrome and HG type 0 (Race 3) soybean cyst nematode. Journal of Plant Registrations 2012, 6(3):298-301. 44. Cianzio SR, Bhattacharyya MK, Swaminathan S, Westgate GM, Gebhart G, Rivera- Velez N, Lundeen P, Van der Molen K, Pruski TI: Registration of AR10SDS soybean germplasm partially resistant to sudden death syndrome and resistant to soybean cyst nematode. Journal of Plant Registrations 2014, 8(2):200-210. 45. Srour A, Afzal AJ, Blahut-Beatty L, Hemmati N, Simmonds DH, Li W, Liu M, Town CD, Sharma H, Arelli P, Lightfoot DA: The receptor like kinase at Rhg1-a/Rfs2 caused pleiotropic resistance to sudden death syndrome and soybean cyst nematode as a transgene by altering signaling responses. BMC Genomics 2012, 13:368 46. Cho JH, Rupe JC, Cummings MS, Gbur EE: Isolation and identification of Fusarium solani f. sp glycines from soil on modified Nash and Snyder's medium. Plant Disease 2001, 85(3):256-260. 47. Huang YH, Hartman GL: A semi-selective medium for detecting Fusarium solani, the causal organism of soybean sudden death syndrome. Phytopathology 1996, 86(11 SUPPL.):S12-S12. 48. Weems JD, Haudenshield JS, Bond JP, Hartman GL, Ames KA, Bradley CA: Effect of fungicide seed treatments on Fusarium virguliforme infection of soybean and development of sudden death syndrome. Canadian Journal of Plant Pathology 2015, 37(4):435-447. 139

49. Kandel YR, Wise KA, Bradley CA, Chilvers MI, Tenuta AU, Mueller DS: Fungicide and cultivar effects on sudden death syndrome and yield of soybean. Plant Disease 2016, 100(7):1339-1350. 50. Gaspar AP, Mitchell PD, Conley SP: Economic risk and profitability of soybean fungicide and insecticide seed treatments at reduced seeding rates. Crop Science 2015, 55(2):924-933. 51. Gaspar AP, Mueller DS, Wise KA, Chilvers MI, Tenuta AU, Conley SP: Response of broad spectrum and target specific seed treatments and seeding rate on soybean seed yield, profitability, and economic risk. Crop Science 2017, 57(4):2251-2262. 52 Chang HX, Roth MG, Wang D, Cianzio SR, Lightfoot DA, Hartman GL, Chilvers MI: Integration of sudden death resistance loci in the soybean genome. Theoretical and Applied Genetics 2018, https://doi.org/10.1007/s00122-018-3063-0 53. Chang SJC, Doubler TW, Kilo V, Suttner R, Klein J, Schmidt ME, Gibson PT, Lightfoot DA: Two additional loci underlying durable field resistance to soybean sudden death syndrome (SDS). Crop Science 1996, 36(6):1684-1688. 54. Hnetkovsky N, Chang SJC, Doubler TW, Gibson PT, Lightfoot DA: Genetic mapping of loci underlying field resistance to soybean sudden death syndrome (SDS). Crop Science 1996, 36(2):393-400. 55. Njiti VN, Doubler TW, Suttner RJ, Gray LE, Gibson PT, Lightfoot DA: Resistance to soybean sudden death syndrome and root colonization by Fusarium solani f. sp. glycine in near-isogenic lines. Crop Science 1998, 38(2):472-477. 56. Iqbal MJ, Meksem K, Njiti VN, Kassem MA, Lightfoot DA: Microsatellite markers identify three additional quantitative trait loci for resistance to soybean sudden-death syndrome (SDS) in Essex × Forrest RILs. TAG Theoretical and Applied Genetics 2001, 102(2):187-192. 57. Njiti VN, Meksem K, Iqbal MJ, Johnson JE, Kassem MA, Zobrist KF, Kilo VY, Lightfoot DA: Common loci underlie field resistance to soybean sudden death syndrome in Forrest, Pyramid, Essex, and Douglas. Theoretical and Applied Genetics 2002, 104(2- 3):294-300. 58. Kassem MA, Meksem K, Kang CH, Njiti VN, Kilo V, Wood AJ, Lightfoot DA: Loci underlying resistance to manganese toxicity mapped in a soybean recombinant inbred line population of 'Essex' x 'Forrest'. Plant and Soil 2004, 260(1-2):197-204. 59. Kassem MA, Shultz J, Meksem K, Cho Y, Wood AJ, Iqbal MJ, Lightfoot DA: An updated 'Essex' by 'Forrest' linkage map and first composite interval map of QTL underlying six soybean traits. Theoretical and Applied Genetics 2006, 113(6):1015-1026. 60. Njiti VN, Lightfoot DA: Genetic analysis infers Dt loci underlie resistance to Fusarium solani f. sp glycines in indeterminate soybeans. Canadian Journal of Plant Science 2006, 86(1):83-90. 140

61. Kazi S, Shultz J, Afzal J, Johnson J, Njiti VN, Lightfoot DA: Separate loci underlie resistance to root infection and leaf scorch during soybean sudden death syndrome. Theoretical and Applied Genetics 2008, 116(7):967-977. 62. Jian S, Wen Z, Li H, Yuan D, Li J, Zhang H, Ye Y, Lu W: Identification of QTLs for glycinin (US) and beta-conglycinin (7S) fractions of seed storage protein in soybean by association mapping. Acta Agronomica Sinica 2012, 38(5):820-828. 63. Wen Z, Tan R, Yuan J, Bales C, Du W, Zhang S, Chilvers MI, Schmidt C, Song Q, Cregan PB, Wang D: Genome-wide association mapping of quantitative resistance to sudden death syndrome in soybean. BMC Genomics 2014, 15:809 64. Anderson J, Akond M, Kassem MA, Meksem K, Kantartzi SK: Quantitative trait loci underlying resistance to sudden death syndrome (SDS) in MD96-5722 by ‘Spencer’ recombinant inbred line population of soybean. 3 Biotech 2015, 5(2):203-210. 65. Bao Y, Kurle JE, Anderson G, Young ND: Association mapping and genomic prediction for resistance to sudden death syndrome in early maturing soybean germplasm. Molecular Breeding 2015, 35(6):128. 66. Zhang J, Singh A, Mueller DS, Singh AK: Genome-wide association and epistasis studies unravel the genetic architecture of sudden death syndrome resistance in soybean. Plant Journal 2015, 84(6):1124-1136. 67. Swaminathan S, Abeysekara NS, Liu M, Cianzio SR, Bhattacharyya MK: Quantitative trait loci underlying host responses of soybean to Fusarium virguliforme toxins that cause foliar sudden death syndrome. Theoretical and Applied Genetics 2016, 129(3):495-506. 68. Luckew AS, Swaminathan S, Leandro LF, Orf JH, Cianzio SR: 'MN1606SP' by 'Spencer' filial soybean population reveals novel quantitative trait loci and interactions among loci conditioning SDS resistance. Theoretical and Applied Genetics 2017, 130(10):2139- 2149. 69. Sanitchon J, Vanavichit A, Chanprame S, Toojinda T, Triwitayakorn K, Njiti VN, Srinives P: Identification of simple sequence repeat markers linked to sudden death syndrome resistance in soybean. ScienceAsia 2004, 30(2):205-209. 70. Brar HK, Bhattacharyya MK: Expression of a single-chain variable-fragment antibody against a Fusarium virguliforme toxin peptide enhances tolerance to sudden death syndrome in transgenic soybean plants. Molecular Plant-Microbe Interactions 2012, 25(6):817-824. 71. Wang B, Swaminathan S, Bhattacharyya MK: Identification of Fusarium virguliforme FvTox1 interacting synthetic peptides for enhancing foliar sudden death syndrome resistance in soybean. Plos One 2015, 10(12):e0145156 72 Ngaki MN, Wang B, Sahu BB, Srivastava SK, Farooqi MS, Kambakam S, Swaminathan S, Bhattacharyya MK: Tanscriptomic study of the soybean-Fusarium virguliforme interaction revealed a novel ankyrin-repeat containing defense gene, expression of whose 141

during infection led to enhanced resistance to the fungal pathogen in transgenic soybean plants. Plos One 2016, 11(10):e0163106 73. Wang B, Sumit R, Sahu BB, Ngaki MN, Srivastava SK, Yang Y, Swaminathan S, Bhattacharyya MK: An Arabidopsis glycine-rich plasma membrane protein enhances disease resistance in soybean. Plant Physiology 2017, 176(1):865-878. 74. Lin J, Mazarei M, Zhao N, Zhu JJ, Zhuang X, Liu W, Pantalone VR, Arelli PR, Stewart CN, Jr., Chen F: Overexpression of a soybean salicylic acid methyltransferase gene confers resistance to soybean cyst nematode. Plant Biotechnology Journal 2013, 11(9):1135-1145. 75. Lin J, Mazarei M, Zhao N, Hatcher CN, Wuddineh WA, Rudis M, Tschaplinski TJ, Pantalone VR, Arelli PR, Hewezi T, Chen F, Stewart CN: Transgenic soybean overexpressing GmSAMT1 exhibits resistance to multiple-HG types of soybean cyst nematode Heterodera glycines. Plant Biotechnology Journal 2016, 14(11):2100-2109. 76. Radwan O, Li M, Calla B, Li S, Hartman GL, Clough SJ: Effect of Fusarium virguliforme phytotoxin on soybean gene expression suggests a role in multidimensional defence. Molecular Plant Pathology 2013, 14(3):293-307. 77. Iqbal MJ, Majeed M, Humayun M, Lightfoot DA, Afzal AJ: Proteomic profiling and the predicted interactome of host proteins in compatible and incompatible interactions between soybean and Fusarium virguliforme. Applied Biochemistry and Biotechnology 2016, 180(8):1657-1674. 78. Abeysekara NS, Swaminathan S, Desai N, Guo L, Bhattacharyya MK: The plant immunity inducer pipecolic acid accumulates in the xylem sap and leaves of soybean seedlings following Fusarium virguliforme infection. Plant Science 2016, 243:105-114. 79. Zeier J: New insights into the regulation of plant immunity by amino acid metabolic pathways. Plant Cell and Environment 2013, 36(12):2085-2103. 80. Shah J, Zeier J: Long-distance communication and signal amplification in systemic acquired resistance. Frontiers in Plant Science 2013, 4:30 81. Vogel-Adghough D, Navarova ESH, Zeier J: Pipecolic acid enhances resistance to bacterial infection and primes salicylic acid and nicotine accumulation in tobacco. Plant Signaling & Behavior 2013, 8(11):e26366 82. Navarova H, Bernsdorff F, Doering A-C, Zeier J: Pipecolic acid, an endogenous mediator of defense amplification and priming, is a critical regulator of inducible plant immunity. Plant Cell 2012, 24(12):5123-5141. 83. Zahringer U, Ebel J, Grisebach H: Induction of phytoalexin synthesis in soybean - elicitor-induced increase in enzyme-activities of flavonoid biosynthesis and incorporation of mevalonate into glyceollin. Archives of Biochemistry and Biophysics 1978, 188(2):450-455. 142

84. Welle R, Grisebach H: Phytoalexin synthesis in soybean cells - elicitor induction of reductase involved in biosynthesis of 6'-deoxychalcone. Archives of Biochemistry and Biophysics 1989, 272(1):97-102. 85. Zahringer U, Ebel J, Kreuzaler F, Grisebach H: Biosynthesis of elicitor-induced phytoalexin, glyceollin in soybean (Glycine max). Hoppe-Seylers Zeitschrift Fur Physiologische Chemie 1977, 358(10):1303-1304. 86. Banks SW, Dewick PM: Biosynthesis of the 6a-hydroxypterocarpan phytoalexin pisatin in Pisum sativum. Phytochemistry 1982, 21(9):2235-2242. 87. Biggs DR, Welle R, Grisebach H: Intracellular-localization of prenyltransferases of isoflavonoid phytoalexin biosynthesis in bean and soybean. Planta 1990, 181(2):244-248. 88. Lozovaya VV, Lygin AV, Zernova OV, Li SX, Hartman GL, Widholm JM: Isoflavonoid accumulation in soybean hairy roots upon treatment with Fusarium solani. Plant Physiology and Biochemistry 2004, 42(7-8):671-679. 89. Lozovaya VV, Lygin AV, Li S, Hartman GL, Widhohn JM: Biochemical response of soybean roots to Fusarium solani f. sp glycines infection. Crop Science 2004, 44(3):819- 826. 90. Iqbal M, Yaegashi S, Ahsan R, Shopinski K, Lightfoot D: Root response to Fusarium solani f. sp. glycines: temporal accumulation of transcripts in partially resistant and susceptible soybean. Theoretical Applied Genetics 2005, 110(8):1429-1438. 91. Radwan O, Liu Y, Clough SJ: Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome. Molecular Plant- Microbe Interactions 2011, 24(8):958-972. 92. Sham A, Al-Azzawi A, Al-Ameri S, Al-Mahmoud B, Awwad F, Al-Rawashdeh A, Iratni R, AbuQamar S: Transcriptome anaylsis reveals genes commonly induced by Botrytis cinereal infection, cold drought and oxidative stresses in Arabidopsis. Plos One 2014, 9(11):e113718. 93. Chen YC, Wong CL, Muzzi F, Vlaardingerbroek I, Kidd BN, Schenk PM: Root defense analysis against Fusarium oxysporum reveals new regulators to confer resistance. Scientific Reports 2017, 4:5584 94. Rao MV, Lee H, Creelman RA, Mullet JE, Davis KR: Jasmonic acid signaling modulates ozone-induced hypersensitive cell death. Plant Cell 2000, 12(9):1633-1646. 95. Brosch G, Ramsom R, Lechner T, Walton JD, Loidl P: Inhibition of maize histone deacetylases by HC toxin, the host selective toxin of Cocliobolus carbonum. Plant Cell 1995, 7(11):1941-1950. 96. Ransom RF, Walton JD: Histone hyperacetylation in maize in response to treatment with HC-toxin or infection by the filamentous fungus Cochliobolus carbonum. Plant Physiology 1997, 115(3):1021-1027. 143

97. Privalsky ML: Depudecin makes a debut. Proceedings of the National Academy of Sciences of the United States of America 1998, 95(7):3335-3337 98. Weiberg A, Wang M, Lin F-M, Zhao H, Zhang Z, Kaloshian I, Huang H-D, Jin H: Fungal small RNAs suppress plant immunity by hijacking host RNA interference pathways. Science 2013, 342(6154):118-123. 99. Chang H-X, Yendrek CR, Caetano-Anolles G, Hartman GL: Genomic characterization of plant cell wall degrading enzymes and in silico analysis of xylanses and polygalacturonases of Fusarium virguliforme. BMC Microbiology 2016, 16:147 100. Sahu BB, Baumbach JL, Singh P, Srivastava SK, Yi X, Bhattacharyya MK: Investigation of the Fusarium virguliforme transcriptomes induced during infection of soybean roots suggests that enzymes with hydrolytic activities could play a major role in root necrosis. Plos One 2017, 12(1):e0169963 101. Islam KT, Bond JP, Fakhoury AM: FvSNF1, the sucrose non-fermenting protein kinase gene of Fusarium virguliforme, is required for cell-wall-degrading enzymes expression and sudden death syndrome development in soybean. Current Genetics 2017, 63(4):723- 738. 102. Sanz-Martin JM, Ramon Pacheco-Arjona J, Bello-Rico V, Vargas WA, Monod M, Diaz- Minguez JM, Thon MR, Sukno SA: A highly conserved metalloprotease effector enhances virulence in the maize anthracnose fungus Colletotrichum graminicola. Molecular Plant Pathology 2016, 17(7):1048-1062. 103. Jashni MK, Dols IHM, Iida Y, Boeren S, Beenen HG, Mehrabi R, Collemare J, de Wit PJGM: Synergistic action of a metalloprotease and a serine protease from Fusarium oxysporum f. sp lycopersici cleaves chitin-binding tomato chitinases, reduces their antifungal activity, and enhances fungal virulence. Molecular Plant-Microbe Interactions 2015, 28(9):996-1008. 104. Covert SF, Enkerli J, Miao VPW, VanEtten HD: A gene for maackiain detoxification from a dispensable chromosome of Nectria haematococca. Molecular and General Genetics 1996, 251(4):397-406. 105. Coleman JJ, Wasmann CC, Usami T, White GJ, Temporini ED, McCluskey K, VanEtten HD: Characterization of the gene encoding pisatin demethylase (FoPDA1) in Fusarium oxysporum. Mol. Plant-Microbe Interact. 2011, 24(12):1482-1491. 106. Li S, Hartman GL, Widholm JM: Viability staining of soybean suspension-cultured cells and a seedling stem cutting assay to evaluate phytotoxicity of Fusarium solani f. sp. glycines culture filtrates. Plant Cell Reports 1999, 18(5):375-380. 107. Jin H, Hartman GL, Nickell CD, Widholm JM: Characterization and purification of a phytotoxin produced by Fusarium solani, the causal agent of soybean sudden death syndrome. Phytopathology 1996, 86(3):277-282. 144

108. Pudake RN, Swaminathan S, Sahu BB, Leandro LF, Bhattacharyya MK: Investigation of the Fusarium virguliforme fvtox1 mutants revealed that the FvTox1 toxin is involved in foliar sudden death syndrome development in soybean. Current Genetics 2013, 59(3):107-117. 109. Chang H-X, Domier LL, Radwan O, Yendrek CR, Hudson ME, Hartman GL: Identification of multiple phytotoxins produced by Fusarium virguliforme including a phytotoxic effector (FvNIS1) associated with sudden death syndrome foliar symptoms. Molecular Plant-Microbe Interactions 2016, 29(2):96-108. 110. Proctor RH, Desjardins AE, Plattner RD: Biosynthetic and genetic relationships of B- series fumonisins produced by Gibberella fujikuroi mating population A. Natural Toxins 1999, 7(6):251-258. 111. Abeysekara NS, Bhattacharyya MK: Analyses of the xylem sap proteomes identified candidate Fusarium virguliforme proteinacious toxins. Plos One 2014, 9(5):e93667 112. Pazzagli L, Seidl-Seiboth V, Barsottini M, Vargas WA, Scala A, Mukherjee PK: Cerato- platanins: Elicitors and effectors. Plant Science 2014, 228:79-87. 113. Srivastava SK, Huang X, Brar HK, Fakhoury AM, Bluhm BH, Bhattacharyya MK: The genome sequence of the fungal pathogen Fusarium virguliforme that cause sudden death syndrome in soybean. Plos One 2014, 9(1):e81832 114. O'Donnell K, Sink S, Mercedes Scandiani M, Luque A, Colletto A, Biasoli M, Lenzi L, Salas G, Gonzalez V, Daniel Ploper L, Formento N, Pioli RN, Aoki T, Yang XB, Sarver BAJ: Soybean sudden death syndrome species diversity within North and South America revealed by multilocus genotyping. Phytopathology 2010, 100(1):58-71. 115. Mbofung GYC, Harrington TC, Steimel JT, Navi SS, Yang XB, Leandro LF: Genetic structure and variation in aggressiveness in Fusarium virguliforme in the Midwest United States. Canadian Journal of Plant Pathology 2012, 34(1):83-97. 116. Huang X, Das A, Sahu BB, Srivastava SK, Leandro LF, O'Donnell K, Bhattacharyya MK: Identification of highly variable supernumerary chromosome segments in an asexual pathogen. Plos One 2016, 11(6):e0158183 117. Covert SF, Aoki T, O'Donnell K, Starkey D, Holliday A, Geiser DM, Cheung F, Town C, Strom A, Juba J, Scandiani M, Yang XB: Sexual reproduction in the soybean sudden death syndrome pathogen Fusarium tucumaniae. Fungal Genetics and Biology 2007, 44(8):799-807. 118. Hughes TJ, O'Donnell K, Sink S, Rooney AP, Mercedes Scandiani M, Luque A, Bhattacharyya MK, Huang X: Genetic architecture and evolution of the mating type locus in fusaria that cause soybean sudden death syndrome and bean root rot. Mycologia 2014, 106(4):686-697. 145

119. Islam KT, Bond JP, Fakhoury AM: FvSTR1, a striatin orthologue in Fusarium virguliforme, is required for asexual development and virulence. Applied Microbiology and Biotechnology 2017, 101(16):6431-6445. 120. Bachrach U: The early history of polyamine research. Plant Physiology and Biochemistry 2010, 48(7):490-495. 121. Tabor CW, Tabor H: Polyamines. Annual Review of Biochemistry 1984, 53:749-790. 122. Smith TA: Polyamines. Annual Review of Plant Physiology and Plant Molecular Biology 1985, 36:117-143. 123. Roberts DR, Walker MA, Thompson JE, Duubroff EB: The effects of inhibitors of polyamine and ethylene biosynthesis on senescence, ethylene production and polyamine metabolism in cut carnations. Plant Physiology 1983, 72:169-169. 124. Schoofs G, Teichmann S, Hartmann T, Wink M: Lysine decarboxylase in plants and its integration in quinolizidine alkaloid biosynthesis. Phytochemistry 1983, 22(1):65-69. 125. Phillips G, Kuehn G: Uncommon polyamines in plants and other organisms. In. Boca Raton, FL: Biochemistry and Physiology of the Polyamines in Plants 1991:121-136. 126. Walters DR: Polyamines and plant disease. Phytochemistry 2003, 64(1):97-107. 127. Federico R, Angelini R, Cogoni A, Floris G: Enzymatic methods for the quantification of polyamines using plant amine oxidases. Biochemie Und Physiologie Der Pflanzen 1991, 187(2):113-119. 128. Smith TA: Purification and properties of polyamine oxidase of barley plants. Phytochemistry 1972, 11(3):899-910. 129. Bouche N, Fromm H: GABA in plants: just a metabolite? Trends in Plant Science 2004, 9(3):110-115. 130. Roberts MR: Does GABA Act as a Signal in Plants? Hints from Molecular Studies. Plant Signaling & Behavior 2007, 2(5):408-409. 131. Bown AW, Shelp BJ: Plant GABA: Not Just a Metabolite. Trends in Plant Science 2016, 21(10):811-813. 132. Cona A, Rea G, Angelini R, Federico R, Tavladoraki P: Functions of amine oxidases in plant development and defence. Trends in Plant Science 2006, 11(2):80-88. 133. Kamada-Nobusada T, Hayashi M, Fukazawa M, Sakakibara H, Nishimura M: A putative peroxisomal polyamine oxidase, AtPAO4, is involved in polyamine catabolism in Arabidopsis thaliana. Plant and Cell Physiology 2008, 49(9):1272-1282. 134. Ahou A, Martignago D, Alabdallah O, Tavazza R, Stano P, Macone A, Pivato M, Masi A, Rambla JL, Vera-Sirera F, Angelini R, Federico R, Tavladoraki P: A plant spermine oxidase/dehydrogenase regulated by the proteasome and polyamines. Journal of Experimental Botany 2014, 65(6):1585-1603. 146

135. Ono Y, Kim DW, Watanabe K, Sasaki A, Niitsu M, Berberich T, Kusano T, Takahashi Y: Constitutively and highly expressed Oryza sativa polyamine oxidases localize in peroxisomes and catalyze polyamine back conversion. Amino Acids 2012, 42(2-3):867- 876. 136. Liu TB, Kim DW, Niitsu M, Berberich T, Kusano T: Oryza sativa polyamine oxidase 1 back-converts tetraamines, spermine and thermospermine, to spermidine. Plant Cell Reports 2014, 33(1):143-151. 137. Mo H, Wang X, Zhang Y, Zhang G, Zhang J, Ma Z: Cotton polyamine oxidase is required for spermine and camalexin signalling in the defence response to Verticillium dahliae. Plant Journal 2015, 83(6):962-975. 138. Wang W, Liu JH: Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis). Gene 2015, 555(2):421-429. 139. Moschou PN, Paschalidis KA, Roubelakis-Angelakis KA: Plant polyamine catabolism: The state of the art. Plant signaling & behavior 2008, 3(12):1061-1066. 140. Negrel J, Vallee JC, Martin C: Ornithine decarboxylase activity and the hypersensitive reaction to tobacco mosaic-virus in Nicotiana tabacum. Phytochemistry 1984, 23(12):2747-2751. 141. von Roepenack-Lahaye E, Newman MA, Schornack S, Hammond-Kosack KE, Lahaye T, Jones JDG, Daniels MJ, Dow JM: p-coumaroylnoradrenaline, a novel plant metabolite implicated in tomato defense against pathogens. Journal of Biological Chemistry 2003, 278(44):43373-43383. 142. Hahlbrock K, Scheel D: Physiology and molecular-biology of phenylpropanoid metabolism. Annual Review of Plant Physiology and Plant Molecular Biology 1989, 40:347-369. 143. Yogendra KN, Pushpa D, Mosa KA, Kushalappa AC, Murphy A, Mosquera T: Quantitative resistance in potato leaves to late blight associated with induced hydroxycinnamic acid amides. Functional & Integrative Genomics 2014, 14(2):285-298. 144. Campos L, Lison P, Pilar Lopez-Gresa M, Rodrigo I, Zacares L, Conejero V, Maria Belles J: Transgenic tomato plants overexpressing tyramine N- hydroxycinnamoyltransferase exhibit elevated hydroxycinnamic acid amide levels and enhanced resistance to Pseudomonas syringae. Molecular Plant-Microbe Interactions 2014, 27(10):1159-1169. 145. Cabanne F, Martintanguy J, Perdrizet E, Vallee JC, Grenet L, Prevost J, Martin C: Presence of polyamine-linked phenol compounds in leaves of healthy Nicotiana tabacum var xanthi nc - appearance is contemporary with floral induction of plant. Comptes Rendus Hebdomadaires Des Seances De L Academie Des Sciences Serie D 1976, 282(22):1959 147

146. Zhang HL, Nagatsu A, Sakakibara J: Novel antioxidants from safflower (Carthamus tinctorius L.) oil cake. Chemical & Pharmaceutical Bulletin 1996, 44(4):874-876. 147. Gill SS, Tuteja N: Polyamines and abiotic stress tolerance in plants. Plant signaling & behavior 2010, 5(1):26-33. 148. Kusano T, Berberich T, Tateda C, Takahashi Y: Polyamines: essential factors for growth and survival. Planta 2008, 228(3):367-381. 149. Edreva A: Polyamines in plants. Bulgarian Journal of Plant Physiology 1996, 22(1- 2):73-101. 150. Wipf D, Ludewig U, Tegeder M, Rentsch D, Koch W, Frommer WB: Conservation of amino acid transporters in fungi, plants and animals. Trends in Biochemical Sciences 2002, 27(3):139-147. 151. Goldberg R, Perdrizet E: Ratio of free to bound polyamines during maturation in mung- bean hypocotyl cells. Planta 1984, 161(6):531-535. 152. Torrigiani P, Serafinifracassini D, Biondi S, Bagni N: Evidence for the subcellular- localization of polyamines and their biosynthetic-enzymes in plant-cells. Journal of Plant Physiology 1986, 124(1-2):23-29. 153. Fujita M, Fujita Y, Iuchi S, Yamada K, Kobayashi Y, Urano K, Kobayashi M, Yamaguchi-Shinozaki K, Shinozaki K: Natural variation in a polyamine transporter determines paraquat tolerance in Arabidopsis. Proceedings of the National Academy of Sciences 2012, 109(16):6343-6347. 154. Fujita M, Shinozaki K: Identification of polyamine transporters in plants: paraquat transport provides crucial clues. Plant and Cell Physiology 2014, 55(5):855-861. 155. Mulangi V, Phuntumart V, Aouida M, Ramotar D, Morris P: Functional analysis of OsPUT1, a rice polyamine uptake transporter. Planta 2012, 235(1):1-11. 156. Mulangi V, Chibucos MC, Phuntumart V, Morris PF: Kinetic and phylogenetic analysis of plant polyamine uptake transporters. Planta 2012, 236(4):1261-1273. 157. Terui Y, Akiyama M, Sakamoto A, Tomitori H, Yamamoto K, Ishihama A, Igarashi K, Kashiwagi K: Increase in cell viability by polyamines through stimulation of the synthesis of ppGpp regulatory protein and omega protein of RNA polymerase in Escherichia coli. International Journal of Biochemistry & Cell Biology 2012, 44(2):412- 422. 158. Pollard KJ, Samuels ML, Crowley KA, Hansen JC, Peterson CL: Functional interaction between GCN5 and polyamines: a new role for core histone acetylation. EMBO Journal 1999, 18(20):5622-5633. 159. Guo X, Rao JN, Liu L, Zou TT, Keledjian KM, Boneva D, Marasa BS, Wang JY: Polyamines are necessary for synthesis and stability of occludin protein in intestinal 148

epithelial cells. American Journal of Physiology-Gastrointestinal and Liver Physiology 2005, 288(6):G1159-G1169. 160. Lee SB, Park JH, Kaevel J, Sramkova M, Weigert R, Park MH: The effect of hypusine modification on the intracellular localization of eIF5A. Biochemical and Biophysical Research Communications 2009, 383(4):497-502. 161. Katz AM, Tolokh IS, Pabit SA, Baker N, Onufriev AV, Pollack L: Spermine condenses DNA, but not RNA duplexes. Biophysical Journal 2017, 112(1):22-30. 162. Egeacortines M, Cohen E, Arad S, Bagni N, Mizrahi Y: Polyamine levels in pollinated and auxin-induced fruit of tomato (Lycopersicon esculentum) during development. Physiologia Plantarum 1993, 87(1):14-20. 163. Feng H, Chen Q, Feng J, Zhang J, Yang X, Zuo J: Functional characterization of the arabidopsis eukaryotic translation initiation factor 5A-2 that plays a crucial role in plant growth and development by regulating cell division, cell growth, and cell death. Plant Physiology 2007, 144(3):1531-1545. 164. Sawhney RK, Shekhawat NS, Galston AW: Polyamine levels as related to growth, differentiation and senescence in protoplast-derived cultures of Vigna aconitifolia and Avena sativa. Plant Growth Regulation 1985, 3:329-337. 165. Sood S, Nagar PK: The effect of polyamines on leaf senescence in two diverse rose species. Plant Growth Regulation 2003, 39(2):155-160. 166. Wada N, Shinozaki M, Iwamura H: Flower induction by polyamines and related- compounds in seedlings of morning-glory (Pharbitis nil cv. kidachi). Plant and Cell Physiology 1994, 35(3):469-472. 167. Applewhite PB, Kaur-Sawhney R, Galston AW: A role for spermidine in the bolting and flowering of Arabidopsis. Physiologia Plantarum 2000, 108(3):314-320. 168. Tiburcio AF, Figueras X, Claparols I, Santos M, Torne JM: Polyamines and aging: Effect of polyamine biosynthetic inhibitors on plant regeneration in Maize callus cultured in vitro. Plant Aging 1990, 186:277-284. 169. Bouchereau A, Aziz A, Larher F, Martin-Tanguy J: Polyamines and environmental challenges: recent development. Plant Science 1999, 140(2):103-125. 170. Alcazar R, Marco F, Cuevas JC, Patron M, Ferrando A, Carrasco P, Tiburcio AF, Altabella T: Involvement of polyamines in plant response to abiotic stress. Biotechnology Letters 2006, 28(23):1867-1876. 171. Prudnikova ON, Rakitina TY, Karyagin VV, Vlasov PV, Rakitin VY: Involvement of ethylene in UV-B induced changes in polyamine content in Arabidopsis thaliana plants. Russian Journal of Plant Physiology 2016, 63(5):604-608. 172. Groppa MD, Rosales EP, Lannone MF, Benavides MP: Nitric oxide, polyamines and Cd- induced phytotoxicity in wheat roots. Phytochemistry 2008, 69(14):2609-2615. 149

173. Groppa MD, Zawoznik MS, Tomaro ML, Benavides MP: Inhibition of root growth and polyamine metabolism in sunflower (Helianthus annuus) seedlings under cadmium and copper stress. Biological Trace Element Research 2008, 126(1-3):246-256. 174. Bagni N, Serafinifracassini D: Involvement of polyamines in the mechanism of break of dormancy in Helianthus tuberosus. Bulletin De La Societe Botanique De France- Actualites Botaniques 1985, 132(1):119-125. 175. Oshmarina VI, Shevyakova NI, Shamina ZB: Dynamics of free amino-acids and amides in Nicotiana sylvestris cell-culture at different concentrations of putrescine in the medium. Soviet Plant Physiology 1982, 29(4):477-481. 176. Mirza JI, Bagni N: Effects of exogenous polyamines and difluoromethylornithine on seed-germination and root-growth of Arabidopsis thaliana. Plant Growth Regulation 1991, 10(2):163-168. 177. Nassar AH, El-Tarabily KA, Sivasithamparam K: Growth promotion of bean (Phaseolus vulgaris L.) by a polyamine-producing isolate of Streptomyces griseoluteus. Plant Growth Regulation 2003, 40(2):97-106. 178. Pandey S, Ranade SA, Nagar PK, Kumar N: Role of polyamines and ethylene as modulators of plant senescence. Journal of Biosciences 2000, 25(3):291-299. 179. Nambeesan S, AbuQamar S, Laluk K, Mattoo AK, Mickelbart MV, Ferruzzi MG, Mengiste T, Handa AK: Polyamines attenuate ethylene-mediated defense responses to abrogate resistance to Botrytis cinerea in tomato. Plant Physiology 2012, 158(2):1034- 1045. 180. Locke JM, Bryce JH, Morris PC: Contrasting effects of ethylene perception and biosynthesis inhibitors on germination and seedling growth of barley (Hordeum vulgare L.). Journal of Experimental Botany 2000, 51(352):1843-1849. 181. Palavan N, Goren R, Galston AW: Effects of some growth-regulators on polyamine biosynthetic-enzymes in etiolated pea-seedlings. Plant and Cell Physiology 1984, 25(4):541-546. 182. Konstantinos PA, Imene T, Panagiotis MN, Roubelakis-Angelakis KA: ABA-dependent amine oxidases-derived H2O2 affects stomata conductance. Plant Signaling & Behavior 2010, 5(9):1153-1156. 183. Liu J, Jiang MY, Zhou YF, Liu YL: Production of polyamines is enhanced by endogenous abscisic acid in maize seedlings subjected to salt stress. Journal of Integrative Plant Biology 2005, 47(11):1326-1334. 184. Neill S, Desikan R, Hancock J: Hydrogen peroxide signalling. Current Opinion in Plant Biology 2002, 5(5):388-395. 185. Hou Z-h, Liu G-h, Hou L-x, Wang L-x, Liu X: Regulatory function of polyamine oxidase-generated hydrogen peroxide in ethylene-induced stomatal closure in Arabidopsis thaliana. Journal of Integrative Agriculture 2013, 12(2):251-262. 150

186. Angelini R, Federico R, Bonfante P: Maize polyamine oxidase - antibody-production and ultrasound localization. Journal of Plant Physiology 1995, 145(5-6):686-692. 187. Cona A, Moreno S, Cenci F, Federico R, Angelini R: Cellular re-distribution of flavin- containing polyamine oxidase in differentiating root and mesocotyl of Zea mays L. seedlings. Planta 2005, 221(2):265-276. 188. Moller SG, McPherson MJ: Developmental expression and biochemical analysis of the Arabidopsis atao1 gene encoding an H2O2-generating diamine oxidase. Plant Journal 1998, 13(6):781-791.

189. Guo Z, Tan J, Zhuo C, Wang C, Xiang B, Wang Z: Abscisic acid, H2O2 and nitric oxide interactions mediated cold-induced S-adenosylmethionine synthetase in Medicago sativa subsp falcata that confers cold tolerance through up-regulating polyamine oxidation. Plant Biotechnology Journal 2014, 12(5):601-612. 190. Moschou PN, Delis ID, Paschalidis KA, Roubelakis-Angelakis KA: Transgenic tobacco plants overexpressing polyamine oxidase are not able to cope with oxidative burst generated by abiotic factors. Physiologia Plantarum 2008, 133(2):140-156. 191. Do PT, Drechsel O, Heyer AG, Hincha DK, Zuther E: Changes in free polyamine levels, expression of polyamine biosynthesis genes, and performance of rice cultivars under salt stress: a comparison with responses to drought. Frontiers in Plant Science 2014, 5:182. 192. Torrigiani P, Rabiti AL, Bortolotti C, Betti L, Marani F, Canova A, Bagni N: Polyamine synthesis and accumulation in the hypersensitive response to TMV in Nicotiana tabacum. New Phytologist 1997, 135(3):467-473. 193. Yamakawa H, Kamada H, Satoh M, Ohashi Y: Spermine is a salicylate-independent endogenous inducer for both tobacco acidic pathogenesis-related proteins and resistance against tobacco mosaic virus infection. Plant Physiology 1998, 118(4):1213-1222. 194. Yoda H, Yamaguchi Y, Sano H: Induction of hypersensitive cell death by hydrogen peroxide produced through polyamine degradation in tobacco plants. Plant Physiology 2003, 132(4):1973-1981. 195. Takahashi Y, Berberich T, Miyazaki A, Seo S, Ohashi Y, Kusano T: Spermine signalling in tobacco: activation of mitogen-activated protein kinases by spermine is mediated through mitochondrial dysfunction. Plant Journal 2003, 36(6):820-829. 196. Cowley T, Walters DR: Polyamine metabolism in barley reacting hypersensitively to the powdery mildew fungus Blumeria graminis f. sp hordei. Plant Cell and Environment 2002, 25(3):461-468. 197. Angelini R, Bragaloni M, Federico R, Infantino A, Portapuglia A: Involvement of polyamines, diamine oxidase and peroxidase in resistance of chickpea to Ascochyta rabiei. Journal of Plant Physiology 1993, 142(6):704-709. 198. Walters DR: Polyamines in plant-microbe interactions. Physiological and Molecular Plant Pathology 2000, 57(4):137-146. 151

199. Federico R, Ercolini L, Laurenzi M, Angelini R: Oxidation of acetylpolyamines by maize-polyamine oxidase. Phytochemistry 1996, 43(2):339-341.

200. Levine A, Tenhaken R, Dixon R, Lamb C: H2O2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response. Cell 1994, 79(4):583-593. 201. Legaz ME, de Armas R, Pinon D, Vicente C: Relationships between phenolics- conjugated polyamines and sensitivity of sugarcane to smut (Ustilago scitaminea). Journal of Experimental Botany 1998, 49(327):1723-1728. 202. Apel K, Hirt H: Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annual Review of Plant Biology 2004, 55:373-399. 203. Gechev TS, Van Breusegem F, Stone JM, Denev I, Laloi C: Reactive oxygen species as signals that modulate plant stress responses and programmed cell death. Bioessays 2006, 28(11):1091-1101. 204. Baus F, Gire V, Fisher D, Piette J, Dulic V: Permanent cell cycle exit in G(2) phase after DNA damage in normal human fibroblasts. EMBO Journal 2003, 22(15):3992-4002. 205. Moschou PN, Roubelakis-Angelakis KA: Polyamines and programmed cell death. Journal of Experimental Botany 2014, 65(5):1285-1296. 206. O'Brien JA, Daudi A, Butt VS, Bolwell GP: Reactive oxygen species and their role in plant defence and cell wall metabolism. Planta 2012, 236(3):765-779. 207. Rentel MC, Lecourieux D, Ouaked F, Usher SL, Petersen L, Okamoto H, Knight H, Peck SC, Grierson CS, Hirt H, Knight MR: OXI1 kinase is necessary for oxidative burst- mediated signalling in Arabidopsis. Nature 2004, 427(6977):858-861. 208. Nakagami H, Kiegerl S, Hirt H: OMTK1, a novel MAPKKK, channels oxidative stress signaling through direct MAPK interaction. Journal of Biological Chemistry 2004, 279(26):26959-26966. 209. Rentel MC, Knight MR: Oxidative stress-induced calcium signaling in Arabidopsis. Plant Physiology 2004, 135(3):1471-1479. 210. Harding SA, Oh SH, Roberts DM: Transgenic tobacco expressing a foreign calmodulin gene shows an enhanced production of active oxygen species. Embo Journal 1997, 16(6):1137-1144. 211. Yang T, Poovaiah BW: Hydrogen peroxide homeostasis: Activation of plant catalase by calcium/calmodulin. Proceedings of the National Academy of Sciences 2002, 99(6):4097- 4102. 212. Peng M, Kuc J: Peroxidase generated hydrogen peroxide as a source of antifungal activity in vitro and on tobacco leaf disks. Phytopathology 1992, 82(6):696-699. 213. Chai HB, Doke N: Systemic activation of oxygen generating reaction superoxide dismutase and peroxidase in potato plants in relation to induction of systemic resistance 152

to Phytophthora infestans. Annals of the Phytopathological Society of Japan 1987, 53(5):585-590. 214. Li N, Venkatesan MI, Miguel A, Kaplan R, Gujuluva C, Alam J, Nel A: Induction of heme oxygenase-1 expression in macrophages by diesel exhaust particle chemicals and quinones via the antioxidant-responsive element. Journal of Immunology 2000, 165(6):3393-3401. 215. El Hassouni M, Chambost JP, Expert D, Van Gijsegem F, Barras F: The minimal gene set member msrA, encoding peptide methionine sulfoxide reductase, is a virulence determinant of the plant pathogen Erwinia chrysanthemi. Proceedings of the National Academy of Sciences 1999, 96(3):887-892. 216. Bestwick CS, Brown IR, Mansfield JW, Boher B, Nicole M, Essenberg M: Host reactions - Plants. Methods in Microbiology, 1998, 27:539-572. 217. Luna E, Pastor V, Robert J, Flors V, Mauch-Mani B, Ton J: Callose deposition: a multifaceted plant defense response. Molecular Plant-Microbe Interactions 2011, 24(2):183-193. 218. Bradley DJ, Kjellbom P, Lamb CJ: Elicitor induced and wound induced oxidative crosslinking of a proline-rich plant-cell wall protein, a novel, rapid defense response. Cell 1992, 70(1):21-30 219. van Baarlen P, Woltering EJ, Staats M, van Kan JAL: Histochemical and genetic analysis of host and non-host interactions of Arabidopsis with three Botrytis species: an important role for cell death control. Molecular Plant Pathology 2007, 8(1):41-54. 220. Simon UK, Polanschuetz LM, Koffler BE, Zechmann B: High resolution imaging of temporal and spatial changes of subcellular ascorbate, glutathione and H2O2 distribution during Botrytis cinerea Infection in Arabidopsis. Plos One 2013, 8(6):e65811. 221. Segmueller N, Kokkelink L, Giesbert S, Odinius D, van Kan J, Tudzynski P: NADPH Oxidases are involved in differentiation and pathogenicity in Botrytis cinerea. Molecular Plant-Microbe Interactions 2008, 21(6):808-819. 222. Govrin EM, Levine A: The hypersensitive response facilitates plant infection by the necrotrophic pathogen Botrytis cinerea. Current Biology 2000, 10(13):751-757. 223. van Kan JAL: Licensed to kill: the lifestyle of a necrotrophic plant pathogen. Trends in Plant Science 2006, 11(5):247-253. 224. Gil-ad NL, Mayer AM: Evidence for rapid breakdown of hydrogen peroxide by Botrytis cinerea. FEMS Microbiology Letters 1999, 176(2):455-461. 225. Gil-ad NL, Bar-Nun N, Noy T, Mayer AM: Enzymes of Botrytis cinerea capable of breaking down hydrogen peroxide. FEMS Microbiology Letters 2000, 190(1):121-126. 226. Asselbergh B, Curvers K, Franca SC, Audenaert K, Vuylsteke M, Van Breusegem F, Hoefte M: Resistance to Botrytis cinerea in sitiens, an abscisic acid-deficient tomato 153

mutant, involves timely production of hydrogen peroxide and cell wall modifications in the epidermis. Plant Physiology 2007, 144(4):1863-1877. 227. Ruiz-Herrera J: Polyamines, DNA Methylation and Fungal Differentiation. Critical Reviews in Microbiology 2008, 20(2):143-150 228. Hoyt MA, Broun M, Davis RH: Polyamine regulation of ornithine decarboxylase synthesis in Neurospora crassa. Molecular and Cellular Biology 2000, 20(8):2760-2773. 229. Mitchell JLA, Carter DD, Rybski JA: Control of ornithine decarboxylase activity in physarum by polyamines. European Journal of Biochemistry 1978, 92(2):325-331. 230. Davis RH, Barnett GR, Ristow JL: Polyamine pools and the control of ornithine decarboxylase activity. Advances in experimental medicine and biology 1988, 250:627- 632. 231. Davis RH, Morris DR, Coffino P: Sequestered end-products and enzyme regulation - the case of ornithine decarboxylase. Microbiological Reviews 1992, 56(2):280-290. 232. Poulin R, Coward JK, Lakanen JR, Pegg AE: Enhancement of the spermidine uptake system and lethal effects of spermidine overaccumulation in ornithine decarboxylase- overproducing l1210 cells under hyposmotic stress. Journal of Biological Chemistry 1993, 268(7):4690-4698. 233. Ivanov IP, Rohrwasser A, Terreros DA, Gesteland RF, Atkins JF: Discovery of a spermatogenesis stage-specific ornithine decarboxylase antizyme: Antizyme 3. Proceedings of the National Academy of Sciences 2000, 97(9):4808-4813. 234. Chattopadhyay MK, Fernandez C, Sharma D, McPhie P, Masison DC: Yeast ornithine decarboxylase and antizyme form a 1:1 complex in vitro: purification and characterization of the inhibitory complex. Biochemical and Biophysical Research Communications 2011, 406(2):177-182. 235. Alcazar R, Planas J, Saxena T, Zarza X, Bortolotti C, Cuevas J, Bitrian M, Tiburcio AF, Altabella T: Putrescine accumulation confers drought tolerance in transgenic Arabidopsis plants over-expressing the homologous arginine decarboxylase 2 gene. Plant Physiology and Biochemistry 2010, 48(7):547-552. 236. Gupta K, Dey A, Gupta B: Plant polyamines in abiotic stress responses. Acta Physiologiae Plantarum 2013, 35(7):2015-2036. 237. Khan AJ, Minocha SC: Polyamine biosynthetic-enzymes and the effect of their inhibition on the growth of some phytopathogenic fungi. Plant and Cell Physiology 1989, 30(5):655-663. 238. Sannazzaro AI, Alvarez CL, Menendez AB, Pieckenstain FL, Alberto EO, Ruiz OA: Ornithine and arginine decarboxylase activities and effect of some polyamine biosynthesis inhibitors on Gigaspora rosea germinating spores. FEMS Microbiology Letters 2004, 230(1):115-121. 154

239. Fornale S, Sarjala T, Bagni N: Endogenous polyamine content and metabolism in the ectomycorrhizal fungus Paxillus involutus. New Phytologist 1999, 143(3):581-587. 240. Zarb J, Walters D: The effect of the polyamine biosynthesis inhibitor dfmo on the ectomycorrhizal fungus Paxillus involutus. Letters in Applied Microbiology 1994, 18(1):5-7. 241. Valdes-Santiago L, Ruiz-Herrera J: Stress and polyamine metabolism in fungi. Frontiers in Chemistry 2013, 1:42. 242. Nickerson KW, Dunkle LD, Vanetten JL: Absence of spermine in filamentous fungi. Journal of Bacteriology 1977, 129(1):173-176. 243. Pegg AE, Michael AJ: Spermine synthase. Cellular and Molecular Life Sciences 2010, 67(1):113-121. 244. Valdes-Santiago L, Cervantes-Chavez JA, Ruiz-Herrera J: Ustilago maydis spermidine synthase is encoded by a chimeric gene, required for morphogenesis, and indispensable for survival in the host. FEMS Yeast Research 2009, 9(6):923-935. 245. Walters DR, Mackintosh CA: Control of plant disease by perturbation of fungal polyamine metabolism. Physiologia Plantarum 1997, 100(3):689-695. 246. Garriz A, Dalmasso MC, Pieckenstain FL, Ruiz OA: The putrescine analogue 1- aminooxy-3-aminopropane perturbs polyamine metabolism in the phytopathogenic fungus Sclerotinia sclerotiorum. Archives of Microbiology 2003, 180(3):169-175. 247. Rajam MV, Weinstein LH, Galston AW: Prevention of a plant-disease by specific- inhibition of fungal polyamine biosynthesis. Proceedings of the National Academy of Sciences 1985, 82(20):6874-6878. 248. Birecka H, Garraway MO, Baumann RJ, McCann PP: Inhibition of ornithine decarboxylase and growth of the fungus Helminthosporium maydis. Plant Physiology 1986, 80(3):798-800. 249. Walters DR: The effects of a polyamine biosynthesis inhibitor on infection of Vicia faba l by the rust fungus, Uromyces viciae fabae (pers) schroet. New Phytologist 1986, 104(4):613-619. 250. West HM, Walters DR: Effects of polyamine biosynthesis inhibitors on growth of Pyrenophora teres, Gaeumannomyces graminis, Fusarium culmorum and Septoria nodorum invitro. Mycological Research 1989, 92:453-457. 251. Walters DR: Inhibition of polyamine biosynthesis in fungi. Mycological Research 1995, 99:129-139. 252. Mackintosh CA, Walters DR: Growth and polyamine metabolism in Pyrenophora avenae exposed to cyclohexylamine and norspermidine. Amino Acids 1997, 13(3-4):347-354. 155

253. El Ghachtouli N, Paynot M, MartinTanguy J, Morandi D, Gianinazzi S: Effect of polyamines and polyamine biosynthesis inhibitors on spore germination and hyphal growth of Glomus mosseae. Mycological Research 1996, 100:597-600. 254. Tomitori H, Kashiwagi K, Sakata K, Kakinuma Y, Igarashi K: Identification of a gene for a polyamine transport protein in yeast. Journal of Biological Chemistry 1999, 274(6):3265-3267. 255. Tomitori H, Kashiwagi K, Asakawa T, Kakinuma Y, Michael AJ, Igarashi K: Multiple polyamine transport systems on the vacuolar membrane in yeast. Biochemical Journal 2001, 353:681-688. 256. Uemura T, Tachihara K, Tomitori H, Kashiwagi K, Igarashi K: Characteristics of the polyamine transporter TPO1 and regulation of its activity and cellular localization by phosphorylation. Journal of Biological Chemistry 2005, 280(10):9646-9652. 257. Uemura T, Tomonari Y, Kashiwagi K, Igarashi K: Uptake of GABA and putrescine by UGA4 on the vacuolar membrane in Saccharomyces cerevisiae. Biochemical and Biophysical Research Communications 2004, 315(4):1082-1087. 258. Tachihara K, Uemura T, Kashiwagi K, Igarashi K: Excretion of putrescine and spermidine by the protein encoded by YKL174c (TPO5) in Saccharomyces cerevisiae. Journal of Biological Chemistry 2005, 280(13):12637-12642. 259. Large PJ: Enzymes and pathways of polyamine breakdown in microorganisms. FEMS Microbiology Letters 1992, 88(3-4):249-262. 260. Yamada H, Isobe K, Tani Y: Polyamine oxidase of fungi .1. oxidation of polyamines by fungal enzymes. Agricultural and Biological Chemistry 1980, 44(10):2469-2476. 261. Chattopadhyay MK, Tabor CW, Tabor H: Spermidine but not spermine is essential for hypusine biosynthesis and growth in Saccharomyces cerevisiae: Spermine is converted to spermidine in vivo by the FMS1-amine oxidase. Proceedings of the National Academy of Sciences 2003, 100(24):13869-13874. 262. Landry J, Sternglanz R: Yeast Fms1 is a FAD-utilizing polyamine oxidase. Biochemical and Biophysical Research Communications 2003, 303(3):771-776. 263. Liu BS, Sutton A, Sternglanz R: A yeast polyamine acetyltransferase. Journal of Biological Chemistry 2005, 280(17):16659-16664. 264. Huang QQ, Liu Q, Hao Q: Crystal structures of fmsl and its complex with spermine reveal substrate specificity. Journal of Molecular Biology 2005, 348(4):951-959. 265. Valdes-Santiago L, Guzman-de-Pena D, Ruiz-Herrera J: Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants. Fems Yeast Research 2010, 10(7):928-940. 156

266. Valdes-Santiago L, Cervantes-Chavez JA, Leon-Ramirez CG, Ruiz-Herrera J: Polyamine metabolism in fungi with emphasis on phytopathogenic species. Journal of Amino Acids 2012, 2012:837932-837932. 267. Wu C-G, Tian J-L, Liu R, Cao P-F, Zhang T-J, Ren A, Shi L, Zhao M-W: Ornithine decarboxylase-mediated production of putrescine influences ganoderic acid biosynthesis by regulating reactive oxygen species in Ganoderma lucidum. Applied and Environmental Microbiology 2017, 83(20):e01289-17 268. Gamarnik A, Frydman RB, Barreto D: Prevention of infection of soybean seeds by Colletotrichum trumcatum by polyamine biosynthesis inhibitors. Phytopathology 1994, 84(12):1445-1448. 269. Pieckenstain FL, Garriz A, Chornomaz EM, Sanchez DH, Ruiz OA: The effect of polyamine biosynthesis inhibition on growth and differentiation of the phytopathogenic fungus Sclerotinia sclerotiorum. Antonie Van Leeuwenhoek International Journal of General and Molecular Microbiology 2001, 80(3-4):245-253. 270. Ahn IP, Kim S, Choi WB, Lee YH: Calcium restores prepenetration morphogenesis abolished by polyamines in Colletotrichum gloeosporioides infecting red pepper. Fems Microbiology Letters 2003, 227(2):237-241. 271. Choi WB, Kang SH, Lee YW, Lee YH: Cyclic AMP restores appressorium formation inhibited by polyamines in Magnaporthe grisea. Phytopathology 1998, 88(1):58-62. 272. Guevara Olvera L, Xoconostle Cazares B, Ruiz Herrera J: Cloning and disruption of the ornithine decarboxylase gene of Ustilago maydis: Evidence for a role of polyamines in its dimorphic transition. Microbiology-Uk 1997, 143:2237-2245. 273. Paulus TJ, Kiyono P, Davis RH: Polyamine-deficient Neurospora crassa mutants and synthesis of cadaverine. Journal of Bacteriology 1982, 152(1):291-297. 274. Balasundaram D, Tabor CW, Tabor H: Oxygen-toxicity in a polyamine-depleted spe2- delta mutant of Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences of the United States of America 1993, 90(10):4693-4697. 275. Vuohelainen S, Pirinen E, Cerrada-Gimenez M, Keinanen TA, Uimari A, Pietila M, Khomutov AR, Janne J, Alhonen L: Spermidine is indispensable in differentiation of 3T3-L1 fibroblasts to adipocytes. Journal of Cellular and Molecular Medicine 2010, 14(6B):1683-1692. 276. Mueller E, Bailey A, Corran A, Michael AJ, Bowyer P: Ornithine decarboxylase knockout in Tapesia yallundae abolishes infection plaque formation in vitro but does not reduce virulence toward wheat. Molecular Plant-Microbe Interactions 2001, 14(11):1303-1311. 277. Jimenez-Bremont JF, Ruiz-Herrera J, Dominguez A: Disruption of gene YlODC reveals absolute requirement of polyamines for mycelial development in Yarrowia lipolytica. Fems Yeast Research 2001, 1(3):195-204. 157

278. Gardiner DM, Kazan K, Manners JM: Nutrient profiling reveals potent inducers of trichothecene biosynthesis in Fusarium graminearum. Fungal Genetics and Biology 2009, 46(8):604-613. 279. Martin J, Garcia-Estrada C, Rumbero A, Recio E, Albillos SM, Ullan RV, Martin J-F: Characterization of an autoinducer of penicillin biosynthesis in Penicillium chrysogenum. Applied and Environmental Microbiology 2011, 77(16):5688-5696. 280. Martin J, Garcia-Estrada C, Kosalkova K, Ullan RV, Albillos SM, Martin J-F: The inducers 1,3-diaminopropane and spermidine produce a drastic increase in the expression of the penicillin biosynthetic genes for prolonged time, mediated by the LaeA regulator. Fungal Genetics and Biology 2012, 49(12):1004-1013. 281. Martin JF: Key role of LaeA and velvet complex proteins on expression of beta-lactam and PR-toxin genes in Penicillium chrysogenum: cross-talk regulation of secondary metabolite pathways. Journal of Industrial Microbiology & Biotechnology 2017, 44(4- 5):525-535. 282. Moschou PN, Wu J, Cona A, Tavladoraki P, Angelini R, Roubelakis-Angelakis KA: The polyamines and their catabolic products are significant players in the turnover of nitrogenous molecules in plants. Journal of Experimental Botany 2012, 63(14):5003- 5015. 283. Lopez-Berges MS, Hera C, Sulyok M, Schaefer K, Capilla J, Guarro J, Di Pietro A: The velvet complex governs mycotoxin production and virulence of Fusarium oxysporum on plant and mammalian hosts. Molecular Microbiology 2013, 87(1):49-65. 284. Jiang JH, Yun YZ, Liu Y, Ma ZH: FgVELB is associated with vegetative differentiation, secondary metabolism and virulence in Fusarium graminearum. Fungal Genetics and Biology 2012, 49(8):653-662. 285. Kim HK, Lee S, Jo SM, McCormick SP, Butchko RAE, Proctor RH, Yun SH: Functional roles of FgLaeA in controlling secondary metabolism, sexual development, and virulence in Fusarium graminearum. Plos One 2013, 8(7)e68441. 286. Brown DW, Butchko RAE, Busman M, Proctor RH: Identification of gene clusters associated with fusaric acid, fusarin, and perithecial pigment production in Fusarium verticillioides. Fungal Genetics and Biology 2012, 49(7):521-532. 287. Lamas-Maceiras M, Vaca I, Rodriguez E, Casqueiro J, Martin JF: Amplification and disruption of the phenylacetyl-CoA ligase gene of Penicillium chrysogenum encoding an aryl-capping enzyme that supplies phenylacetic acid to the isopenicillin N- acyltransferase. Biochemical Journal 2006, 395:147-155. 288. Cook SD, Ross JJ: The auxins, IAA and PAA, are synthesized by similar steps catalyzed by different enzymes. Plant Signaling & Behavior 2016, 11(11):e1250993. 289. Aoki H, Sassa T, Tamura T: Phytotoxic metabolites of Rhizoctonia solani. Nature 1963, 200(4906):575. 158

290. Frank JA, Francis SK: Effect of a Rhizoctonia solani phytotoxin on potatoes. Canadian Journal of Botany-Revue Canadienne De Botanique 1976, 54(22):2536-2540. 291. Mandava NB, Orellana RG, Warthen JD, Worley JF, Dutky SR, Finegold H, Weathington BC: Phytotoxins in Rhizoctonia solani: Isolation and biological activity of meta-hydroxy-phenylacetic and meta-methoxyphenylacetic acids. Journal of Agricultural and Food Chemistry 1980, 28(1):71-75. 292. Bartz FE, Glassbrook NJ, Danehower DA, Cubeta MA: Elucidating the role of the phenylacetic acid metabolic complex in the pathogenic activity of Rhizoctonia solani anastomosis group 3. Mycologia 2012, 104(4):793-803. 293. Bartz FE, Glassbrook NJ, Danehower DA, Cubeta MA: Modulation of the phenylacetic acid metabolic complex by quinic acid alters the disease-causing activity of Rhizoctonia solani on tomato. Phytochemistry 2013, 89:47-52. 294. Sumayo M, Hahm M-S, Ghim S-Y: Determinants of Plant Growth-promoting Ochrobactrum lupini KUDC1013 Involved in Induction of Systemic Resistance against Pectobacterium carotovorum subsp carotovorum in tobacco leaves. Plant Pathology Journal 2013, 29(2):174-181. 295. Choudhary DK, Prakash A, Johri BN: Induced systemic resistance (ISR) in plants: mechanism of action. Indian Journal of Microbiology 2007, 47(4):289-297. 296. Akram W, Anjum T, Ali B: Phenylacetic acid is ISR determinant produced by Bacillus fortis IAGS162, which involves extensive re-modulation in metabolomics of tomato to protect against Fusarium Wilt. Frontiers in Plant Science 2016, 7:498. 1.