Molecular aspects of temperature regulation of sunflower seed dormancy Qiong Xia
To cite this version:
Qiong Xia. Molecular aspects of temperature regulation of sunflower seed dormancy. Vegetal Biology. Université Pierre et Marie Curie - Paris VI, 2016. English. NNT : 2016PA066629. tel-01884405
HAL Id: tel-01884405 https://tel.archives-ouvertes.fr/tel-01884405 Submitted on 1 Oct 2018
HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés.
Université Pierre et Marie Curie
Ecole Doctorale Complexité du vivant (ED515) Biologie des Semences, UMR7622
Molecular aspects of temperature regulation of sunflower seed dormancy
Mécanismes moléculaires de la régulation de la dormance des graines de tournesol par la température
Par Qiong XIA
Thèse de doctorat de Physiologie Végétale
Présentée et soutenue publiquement le 29 septembre 2016
Devant un jury composé de :
M. Carol Pierre Professeur, UPMC Président M. Bassel George Professeur, Université de Birmingham Rapporteur M. Grappin Philippe Maître de conférences, Agrocampus-ouest Rapporteur M. Gakière Bertrand Maître de conférences, Paris-Saclay Examinateur
Mme Bouteau Hayat Professeur, UPMC Directeur de thèse M. Meimoun Patrice Maître de conférences, UPMC Co-encadrant de thèse
Acknowledgments
There are a number of people without whom this thesis might not have been written, and to whom I am greatly indebted.
First of all, I would like to express my sincere gratitude to my supervisors Prof. Hayat Bouteau and Dr. Patrice Meimoun for their patience, motivation, and immense knowledge. Their guidance helped me in all the time of research and writing of this thesis. Both of them not only gave me the careful guidance and critical thinking in my studies, but also meticulous care for my life in France. I would like to thank them for encouraging my research and for allowing me to grow as a research scientist. I could not have imagined having a better advisor and mentor for my Ph.D study.
Second, I would like to express the deepest appreciation to Prof. Francoise Corbineau and Prof. Christophe Bailly. Thanks Prof. Christophe Bailly provided me an opportunity to join this team and admitting me in the lab, quickly replied my email for PhD position application and gave me access to the laboratory and research facilities. Special thanks to Prof. Francoise Corbineau, she gives me a lot of brilliant comments and suggestions during my research and help to read this thesis manuscripts, her serious scientific attitude, rigorous academic spirit, and enthusiasm towards work deeply infect and inspire me.
To the respected members of the jury: Dr. Pierre Carol, Dr. George Bassel, Dr. Philippe Grappin, Dr. Bertrand Gakière, thank you very much for accepting the invitation for my thesis defense and spending much time in reviewing my thesis. I would also like to thank the rest of my thesis committee, Dr. Loic Rajjou and Dr. Jeffrey Leung, for their insightful comments and encouragement, but also for the hard question which incented me to widen my research from various perspectives.
My sincere thanks goes to our collaborators: the team of Dr. Loic Rajjou, Dr. Yves Gibon and Dr. Eiji Nambara, who providing valuable assistance in this work. I also want to thanks Dr. Luis Lopez-Molina, Dr. Eiji Nambara and Dr. Chao Wen S for kindly providing anti-bodies for our research. Thanks the other teams in the “Institut de Biologie Paris Seine” for giving me access to use the UV monitor, Typhoon 8600 scanner and vibratome.
1 I would like to express my appreciation and thanks to the other members of our team. To Dr. Juliette Leymarie, Dr. Emmanuel Baudouin, Dr. Juliette Puyaubert and Dr. Emmanuel Gendreau, thanks for helping me to answer some technical questions, stimulating discussions and encouragement during my experiment. To my present and past: Marine, Marie, Clémence, Guillaume and Isabelle, thanks for the fun we had in our office in the spare time. I also want to thank the other labmates: Elodie, Elissa, Ewa, Linda, Agathe, Maha, Francoise. All of them accompanied and helped me overcome every difficulty I encountered in these four years. I can never forget the warm and friendly atmosphere of the entire seed biology group and the “vodka time” we ever enjoyed, they bringing me closer to the Paris and for their permanent joviality which made me feel like at home. I wish everybody all the best and good luck in the future!
I would like to acknowledge the financial support of china scholarship council for the four years of my PhD.
I am indebted to my Chinese friends in Paris, Yongjin, Kejun, Teng, Lin and Xiguang, I will never forget the help in my hard time during my life in Paris. I would also like to thank all of my friends who supported me and incanted me to strive towards my goal.
Last but not the least, a special thanks to my family. Words cannot express how grateful I am to my mother-in law, father-in-law, my mother, father, and brother and for all of the sacrifices that you have made on my behalf. At the end I would like express appreciation to my beloved and supportive husband Jun, who is always by my side when time I needed him most and helped me a lot. And my lovable baby, Mingche, who served as my inspiration to pursue this undertaking, I would like to dedicate this to her.
2 List of abbreviations
ABA Abscisic Acid
ABPP Activity-Based Protein Profiling
ABI5 ABA-Insensitive 5
AIB α-Aminoisobutyric Acid
AOA Amino-Oxyacetic Acid
ACC 1-Aminocyclopropane-1-carboxylic acid
ACO ACC oxidase
ADH Alcohol Dehydrogenase
AlaT Alanine Transaminase
ATP Adenosine Triphosphate
CIA Isoamyl Alcohol Solution
D Dormant
DAPI 4’,6-Diamidino-2-Phenylindole
DW Dry Weight
EDTA Ethylenediaminetetraacetic acid
ET Ethylene
FBP Fructose-Bisphosphate Aldolase
FW Fresh Weight
GA Gibberellic Acid
GAPDH Glyceraldehyde 3-Phosphate Dehydrogenase
HSP Heat Shock Protein
LEA protein Late Embryogenesis Abundant protein
3 MDA Malondialdehyde
MDH Malate Dehydrogenase
NCED 9-cis-epoxycarotenoid dioxygenase
GC-MS Gas Chromatography–Mass Spectrometry
ND Non Dormant
NaAc Sodium Acetate
NAD Nicotinamide Adenine Dinucleotide
NADP Nicotinamide Adenine Dinucleotide Phosphate
PAC Paclobutrazol
PBS Phosphate-buffered saline
PGM Phosphoglucomutase
PGK Phosphoglycerate Kinase
PTMs Post-Translational Modifications
PPP pentose phosphate pathway
RGA Repressor of GA1-3
RGL2 RGA-LIKE 1
SD Standard deviation
SDS sodium dodecyl sulfate
TCA Tricarboxylic acid
UGPase UDP-Glucose Pyrophosphorylase
UPS Ubiquitin-proteasome system
4 Contents
ACKNOWLEDGMENTS ...... 1
LIST OF ABBREVIATIONS ...... 3
CONTENTS ...... 5
CHAPTER 1 INTRODUCTION ...... 7
I SEED DEVELOPMENT AND COMPOSITION ...... 9
II DORMANCY AND CONTROL OF GERMINATION ...... 10
III CELLULAR EVENTS DURING GERMINATION ...... 13
IV HORMONAL REGULATION OF SEED DORMANCY AND GERMINATION ...... 19
V THE EFFECT OF TEMPERATURE IN SEED DORMANCY AND GERMINATION ...... 25
VI DORMANCY IN SUNFLOWER SEED ...... 32
OBJECTIVES OF THE THESIS ...... 35
CHAPTER 2 INTEGRATING PROTEOMICS AND ENZYMATIC PROFILING TO DECIPHER SEED METABOLISM AFFECTED BY TEMPERATURE IN SEED DORMANCY AND GERMINATION .... 37
INTRODUCTION ...... 39
MATERIALS AND METHODS ...... 40
RESULTS ...... 43
DISCUSSION ...... 46
REFERENCES ...... 48
CHAPTER 3 REGULATION OF DORMANCY IN SUNFLOWER BY TEMPERATURE AND AFTER- RIPENING: EFFECTS ON ABSCISIC ACID, GIBBERELLINS AND ETHYLENE ...... 65
INTRODUCTION ...... 67
MATERIALS AND METHODS ...... 70
RESULTS ...... 72
DISCUSSION ...... 75
REFERENCES ...... 86
CHAPTER 4 GENERAL CONCLUSION ...... 95
REFERENCES ...... 99
5 ANNEXES ...... 115
ANNEXE 1 ONE WAY TO ACHIEVE GERMINATION: COMMON MOLECULAR MECHANISM OF ETHYLENE AND
AFTER-RIPENING ...... 115
ANNEXE 2 DETERMINATION OF PROTEIN CARBONYLATION AND PROTEASOME ACTIVITY IN SEEDS ...... 143
ANNEXE 3 ETHYLENE, A KEY FACTOR IN THE REGULATION OF SEED DORMANCY ...... 153
6
Chapter 1 Introduction
7 In higher plants, the new individuals are generated by sexual reproduction. The physiological and biochemical features of the seed containing the embryo as the new plant in miniature, determine the subsequent plant survival. Thus, the seeds act a critical role in the plant life cycle by enabling the dispersal and survival of the species. In nature, most organisms live in unpredictable environments and typically experience conditions that are suboptimal for growth and reproduction. A very common response for some organisms to environmental stresses is to enter a reversible state of reduced metabolic activity, quiescence or dormancy. By doing so, these organisms can drastically lower their energetic expenditures and evade unfavourable conditions that would otherwise reduce the fitness of the population. Moreover, even plants have evolved many ways to disperse their offspring by dispersing their seeds, unlike animals, they are limited in their ability to seek out favourable conditions for survival and growth. Seed dormancy is an adaptive trait that enables seeds to overcome periods that are unfavourable for seedling establishments. It is defined as the inability of seeds to germinate under apparently favourable conditions so that to ensure that seed can germinate at the most appropriate moment (Finch-Savage and Leubner-Metzger, 2006; Bentsink and Koornneef, 2008). Indeed, the lack of dormancy at harvest in many cultivars of wheat results in the adverse effects of pre-harvest-sprouted wheat grains on end-product quality and led to serious worldwide economic losses (Bewley and Black 1994; Gubler et al., 2005; Rodrigez et al., 2015). Moreover, seed dormancy allows the germination at the appropriate moment of environmental cues for seedlings establishment. Therefore, seed dormancy is important for plant ecology and agriculture. Dormancy is induced during seed development and is maintained during the late maturation phase in many species, which prevents pre-harvest sprouting. The transition from seed dormancy to germination is a complex process, it is influenced by some internal factors and multiple environmental factors such as light, temperature and humidity (Finkelstein et al., 2008). Among all these environmental factors, temperature is a primary factor in seasonal changes affecting seed dormancy status (Bewley et al., 2013; Footitt et al., 2013). Moreover, plants will be subjected to wide fluctuations of temperature with the global warming, which may significantly affect crops and ecosystems worldwide (Long and Ort, 2010; Franks et al., 2014). Therefore, it is acute to investigate the mechanism of seeds response to temperature under climate change scenarios and their impacts on dormancy and germination.
8
I Seed development and composition
Seed development in higher plants begins with a double fertilization process that occurs within the ovule and ends with a maturated seed primed to become the next plant generation (Goldberg et al., 1997). The major events that occur during seed development are shown in Fig. 1. Embryo development can be divided up into two phases, the first or “embryogenesis” involves cell divisions associated with morphogenetic events which form the basic cellular pattern for the development of the shoot-root organs and the primary tissue layers, and it also programs the regions of meristematic tissue formation.
Fig. 1. A generalized overview of seed development and stages of the life cycle. OV, unfertilized ovule; Postfertilization, also called proembryo, this stage involved in terminal and basal cell differentiation, formation of suspensor and embryo proper; Globular-heart transition, differentiation of major tissue-type primordia at this stage, including establishment of radial (tissue-type) axis, visible appearance of shoot-root, hypocotyl-radicle development and differentiation of root meristem; Organ expansion and maturation, enlargement of cotyledons and axis by cell division and expansion before seed maturation, and following seed maturation storage reserves such as RNA, proteins and lipids are accumulated, and then after maturation involve in loss of water (dehydration) and dormancy status formed to inhibit precocious germination. Schematic adapted from le et al. (2010), developmental events were modified from Goldberg et al. (1994).
Following the cell division arrest at the end of the embryo growth phase, the seed enters the second phase, which is called “maturation phase”, this process involves cell growth and the storage of reserves, such as proteins, starch and oils, required as 'food and energy supply'
9 during germination and seedling growth (Goldberg et al., 1994; Holdsworth et al., 2008). It is also associated with a decrease in water content which reaches around 40-55 % FW at the end. The seeds enter then, into a metabolically quiescent state related to dehydration after dry maturation, which represents the normal terminal event in the development process of orthodox seeds. Genetic studies in Arabidopsis have identified genes that provide new insight into molecular event underlying plant development (Le et al., 2010). Dormancy process is initiated during seed maturation and reached a maximum in harvest-ripe seeds (Karssen et al., 1983; Ooms et al., 1993; Raz et al., 2001). Seeds may remain in this dry dormant state from several days to many years and still retain their viability.
II Dormancy and control of germination
An internationally hierarchical system of classification for seed dormancy has been proposed by Baskin and Baskin (2004). The system has divided dormancy into five classes: (1) is physiological dormancy (PD), which contains three depth levels: deep, intermediate and non- deep. Moreover, depending on the PD depth level, dormancy can be released by different stratification treatments or GA treatment; (2) morphological dormancy (MD), which caused by a delay of embryo development; (3) morphophysiological dormancy (MPD), it is a combinational dormancy (PD + MD); (4) physical dormancy (PY) is due to the existing of water- impermeable layers of palisade cells in the seed coat and it also can be released by mechanical or chemical scarification; and (5) combinational dormancy (PY + PD). However, inside all of these classifications, PD (non-deep level) is the most common kind of dormancy because it occurs in part of gymnosperms and in all major clades of angiosperms, and depending on the species, the dormancy alleviation correlated with stratification, scarification, a period of dry storage (after-ripening) or gibberellins (GAs) treatment. Recently, the works by Finch-Savage and Leubner-Metzger (2006) and Cadman et al. (2006) have provided insight into the molecular mechanisms of non-deep PD. Two terms of physiological seed dormancy have been distinguished; the intrinsic molecular mechanisms determined by seed components, namely embryo and coat dormancy. The latter corresponds to the case when the intact seed is dormant but the isolated embryo can germinate normally, therefore, the seed coat enclosing the embryo exerts a constraint that the embryo cannot overcome. By contrast, embryo dormancy is characterized by the inability of the embryo itself to germinate normally after
10
removal of the seed coat. Sunflower seeds are characterized by an embryo covered by seed- coats and a pericarp easily removable, this can help us to deeply investigate the mechanism of embryo dormancy and eliminate the influence of coat dormancy.
The first dormancy and germination loci identified by mutations in Arabidopsis included those acting in GA and abscisic acid (ABA) biosynthesis and perception (Koornneef and Van der Veen, 1980; Koornneef et al., 1982). The molecular analyses and cloning of genes that affect dormancy and/or germination were published from the early 1990s, including ABSCISIC ACID INSENSITIVE 3 (ABI3), DIHYDROFLAVONOL-4-REDUCTASE (DFR; TT3), CHALCONE ISOMERASE (CHI; TT5) and FUSCA3 (FUS3) (Giraudat et al., 1992; Bäumlein et al., 1994; Shirley et al., 1995). Recently, Bentsink and Koornneef. (2008) have concluded the works by the first high- throughput, large scale-omics studies investigating seed dormancy and germination, including transcriptomics (Nakabayashi et al., 2005; Cadman et al., 2006; Finch-Savage et al., 2007; Carrera et al., 2008; Bassel et al., 2008), proteomics (Rajjou et al., 2004; Chibani et al., 2006) and metabolomics (Fait et al., 2006). These new approaches and derived data sets provide an unprecedented level of detail concerning genome expression associated with germination potential, which suggest that RNA translation or post-translation are the major levels of control for germination completion, by contrast, transcriptome changes might reflect alteration in dormancy status or enhancement of germination vigor and effects on post- germination functions that relate to seedling growth. When compared mutant and wild-type seeds, or the influence of developmental state (dormant and after-ripened) and environment on genome expression, similar observations of changes in gene expression have been made at the transcriptome level in all cases (Holdsworth et al., 2008). The comparison of dormant and after-ripened seeds during imbibition show large increase in RNAs encoding proteins associated with RNA translation, protein degradation and cell wall modification. The temporal analysis of germination shows that expression of these gene groups increases rapidly, within 1–3 h of imbibition (Nakabayashi et al., 2005). By contrast, the expression of genes which encoding functions associated with late seed maturation are increased in imbibed dormant seeds (Cadman et al., 2006; Carrera et al., 2008). Similar changes are also observed at the proteome level (Gallardo et al., 2002; Rajjou et al., 2004; Chibani et al., 2006). Moreover, Fait et al. (2006) conclude that seed maturation was associated with a significant reduction of most sugars, organic acids and amino acids, suggesting their incorporation into storage reserves.
11 Furthermore, it appeared that the transition from reserve accumulation to seed desiccation was associated with a major metabolic switch, resulting in the accumulation of distinct sugars, organic acids, nitrogen-rich amino acids, and shikimate-derived metabolites.
Fig. 2. Relationship between dormancy and germination. The control of germination exists at the state of seed dormancy and the operation of environmental factors such as light, temperature and air humidity effect both dormancy and germination. The diagram is from Bewley and Black (1985).
Control of seed germination and growth is crucial to the survival of the next generation, there are several critical determinants for the transitions from dormancy to germination and from germination to growth (Fig. 2). At dispersal, the quiescent mature seed, when it encounters favourable environmental conditions, which can include light of a given wavelength, sufficient water availability, optimal temperatures, and adequate oxygen, germination after releases of dormancy and commences germination. Visible evidence of the completion of germination is usually radicle protrusion and elongation (Bewley and Black, 1994; Bewley, 1997). Some seeds must be exposed to environmental cues, such as periods of warm-dry conditions (after- ripening), moist chilling, or even smoke, to release dormancy (Stephen et al., 1986; Egerton- Warburton, 1998) (Fig. 2). The dormancy status reduces during after-ripening, consequently, seeds are able to complete germination in wide range of environmental conditions. After- ripening largely depends on environmental conditions during seed storage and germination conditions (Donohue et al., 2005), while seed covering structures, moisture and temperature are the main factors to decide the speed of after-ripening (Manz et al., 2005). However, these primary dormant seeds may enter into a second stage of dormancy, called secondary dormancy, during imbibition if the environmental conditions are unfavourable for germination (Fig. 2, Bewley and Black, 1994; Kermode, 2005). Secondary dormancy is a safety mechanism that is implemented from the seed being exposed to adverse conditions once it
12
falls from plant and function in imbibed seeds, it can be induced by anachronistic environmental conditions such as too low or high temperature, hypoxia and prolonged exposure to darkness or light (Khan and Karssen, 1980; Leymarie et al., 2008; Hoang et al., 2013 a, b, 2014).
During storage, seed moisture contents should be maintained above a threshold value. A very high or too low air humidity affects the after-ripening. This threshold moisture content is species-specific, it requests lower value in oilseeds compared to starchy seeds because the oilseed contains less bound water when equilibrated at any given relative humidity (Leubner- Metzger, 2005). Bazin et al. (2011) has investigated the combination of temperature and relative humidity effect on dormancy release in sunflower seeds during dry after-ripening. This study demonstrated that the rate of dormancy alleviation depends on the interaction between temperature and embryo moisture content (MC), the rate of dormancy alleviation at low MC being was faster at a low temperature because it is associated with negative activation energy. By contrast, the rate of dormancy alleviation at high MC increased with temperature, and this positive correlation is dependent on biochemical processes (Fig. 3).
Fig. 3. The effect of the environment factors on after-ripening. Sunflower seed germination after storage at variable temperatures and relative humidities for 3 weeks. Germination was performed with embryo imbibed at 10 °C after 7 days (d). From Bazin et al. (2011).
III Cellular events during germination
The dehydrated state of mature seed helps to withstand drought and extreme temperatures. Germination begins with water uptake by the dry seed during imbibition and ends with the
13 embryonic axis or radicle elongation (Finch-Savage and Leubner-Metzger, 2006). During this process, a sequence of cellular events is initiated following seed water uptake which ultimately leads to emergence of the radicle and complete germination successfully. Metabolism commences in the seeds as soon as their cells are hydrated. Respiration and protein synthesis have been recorded within minutes of imbibition, using components conserved in the dry seed (Black et al., 2006; Galland et al., 2014). This is followed by synthesis of RNA, and DNA repair and synthesis. Numerous enzymes are either activated or de novo synthesized during germination, including lipases, proteinases, phosphatases, hydrolases, calmodulin, carboxypeptidases and others that appear to be particularly associated with this process (Mayer and Poljakoff-Mayber, 1982; Bewley and Black, 1985; Cocucci and Negrini, 1991; Washio and Ishikawa, 1994).
III.1. Seed water uptake
Water uptake by a mature dry seed has been defined as triphasic (Fig. 4). Phase I is a rapid initial uptake, imbibition is probably very fast into the peripheral cells of the seed and small tissues such as radicle. Metabolism can be activated from this phase within minutes of imbibition. The phase I is followed by a plateau (phase II), also called germination sensu stricto, both of dormant and non-dormant seeds are metabolically active during this phase, and for non-dormant seeds, the major metabolic events that take place at this time is the preparation for radicle emergence. A further increase in water uptake in the phase III occurs only after the embryonic axes elongation. The dormant seeds are blocked in entering this phase because they cannot complete the germination process (Bewley, 1997). The duration of each of these phases depends on several factors, including inherent properties of the seed such as seed size, seed coat permeability and genotypes, and also some environment factors such as temperature, and the moisture content and composition of medium (Bewley and Black, 1985).
14
Fig. 4. Triphasic pattern of water uptake and time course of major events involved in germination and subsequent postgermination. The time for events to be completed varies from several hours to many weeks, depending on the plant species and germination conditions. Red dot line represents seed that cannot complete germination and enter into Phase III, Green arrow marks the time of occurrence of the first signs of radicle protrusion. Adapted from Bewley (1997).
Before imbibition, dry seeds have a low moisture content, 5 to 12%, depending on the species. This low moisture content contributes to a remarkably low rate of metabolism. Marked changes in metabolism occur as soon as the seed imbibes (Copeland and McDonald, 2001). As the dry seed starts to take up water during phase I, influx of water into the cells lead to temporary structural perturbations, especially on membranes accompanied by a massive leakage of cellular solutes and low molecular weight metabolites including ions, sugars and amino acid into the surrounding imbibition solution (Powell and Matthews, 1978). This is a transition symptomatic of the membrane phospholipid components from the gel phase achieved by drying during seed maturation, to the normal and hydrated liquid-crystalline state (Crowe and Crowe, 1992). However, in order to deal with the damage imposed during dehydration, storage and rehydration, seeds activate a series of repair mechanisms during imbibition (Fig. 4), which include membrane repair and therefore the membranes return to more stable configuration and solute leakage is curtailed within a short time of rehydration. Dry seeds contain mRNAs stored during maturation, also called long-lived transcripts to indicate that they survived desiccation (Rajjou et al., 2004). Over 10 000 different stored
15 mRNAs have been identified in transcriptome analyses of Arabidopsis (Nakabayashi et al., 2005; Kimura and Nambara, 2010; Okamoto et al., 2010). Similar numbers were found in barley and rice (Howell et al., 2009; Sreenivasulu et al., 2010). More transcripts (about 32 000) have been showed in sunflower (Meimoun et al., 2014). It has shown that important transcript and protein changes are happening in ‘dry’ seeds during storage and that these changes might be targeted to release dormancy as seeds after-ripe (Holdsworth et al., 2008). The dry seed transcriptome mirrors the process of seed maturation as well as prepares the seed for the following germination (Weitbrecht et al., 2011). As showed by Kimura and Nambara. (2010), the major portions of the dry seed transcriptomes are very similar between the non-dormant and the dormant seeds, and the majority of stored mRNAs are of the LEA (‘late embryogenesis abundant’) group or transcripts of storage proteins. Meimoun et al., (2014) also showed that there is no significant difference between D and ND at dry state in sunflower seeds. Weitbrecht et al. (2011) has reviewed the massive transcriptome changes occur very early upon imbibition, which are regulated by ambient temperature, light conditions, and plant hormones.
III.2. Respiration
Upon imbibition, the rise in water content induces a parallel rise in the rate of metabolism including respiration and O2 consumption. One of the first change upon imbibition is the resumption of respiratory activity, which can be detected within minutes. Three respiration pathways operate in a seed during germination: the glycolysis, the pentose phosphate pathway (PPP) and the citric acid cycle (TCA cycle or Krebs’s cycle). They produce key intermediates in metabolism and energy in the form of adenosine triphosphate (ATP), and reducing power in the form of reduced pyridine nucleotides, the nicotine adenine dinucleotides (NADH and NADPH) (Côme and Corbineau, 1990; Black et al., 2006). Both of the glycolytic and PPP are restored during the phase I. Enzymes of the TCA cycle and the terminal oxidases are usually present in the dry seed and become activated or are resynthesized when oxygen is high enough in internal structures (Nicolas and Aldasoro, 1979; Salon et al., 1988). Germinating seeds frequently produce ethanol in many species (Morohashi and Shimokoriyama, 1972). This is often the result of an internal deficiency in oxygen that is caused by restrictions to gaseous diffusion by the structures that surround the seed and by the dense
16
internal structure of most seeds. This oxygen deficiency may result in more pyruvate production than used for activities of the TCA cycle and electron transport chain. Application of inhibitors of respiration can break dormancy in several kinds of seeds including sunflower, lettuce, rice and barley (Côme and Corbineau, 1990; Bewley and Black, 1994). It has been demonstrated that cyanide and malonate, which can inhibit terminal oxidation and the citric acid cycle in the mitochondria, the glycolysis inhibitor, fluoride, and electron acceptors such as nitrate, nitrite and methylene blue can break seed dormancy of sunflower and Arabidopsis (Oracz et al., 2007; Arc et al., 2013). Consequently, the concept of the pentose phosphate pathway playing a unique role in dormancy breaking arises largely from these studies. Thus, the system is established as dormant seeds are deficient in an alternative oxygen-requiring process essential for germination, which is depleted of oxygen because of its lower affinity for this gas than the cytochrome pathway of respiration, so inhibitors of glycolysis, citric acid cycle and terminal oxidation reactions of the mitochondrial electron transport chain can broke dormancy by activating pentose phosphate pathway, suggested as the alternative oxygen- requiring process essential for germination (Fig. 5).
Fig. 5. The pentose phosphate pathway and dormancy breakage. The consumption of oxygen by conventional respiration is blocked by the inhibitors, and oxygen then become available for other processes, meanwhile, the pentose phosphate pathway requires oxygen for the oxidation of reduced NADP (NADPH). From Bewley and Black (1985).
III.3. RNA and protein synthesis
Enzyme activation begins during Phases I and II of imbibition. Phase II which can vary widely in duration, is characterized by a stabilized water and oxygen uptake. The seed undergoes many processes essential for germination following Phase II of water uptake, including a
17 sequential translation of mRNA related with antioxidant mechanisms, cell detoxification, protein fate, energy, and amino acids metabolism occurs (Copeland and McDonald, 2001; Galland and Rajjou, 2015). Proteomic approaches unveiled the main importance of protein synthesis during seed imbibition in order to meet the increasing demand for proteins for seedling growth (Rajjou et al., 2004; Kimura and Nambara, 2010). Dry mature seeds contain a large number of mRNA species, supposed to be ready for protein synthesis upon imbibition. Transcription inhibitor did not prevent seed germination suggesting that transcription is not strictly requested for seed germination (Rajjou et al., 2004). Our previous studies have demonstrated that sunflower seed dormancy release by after-ripening is associated with oxidation of specific subsets of stored mRNAs and differential accumulation of polysome- associated mRNAs but not related to transcriptomic changes, the translatome differs between germinating and non-germinating sunflower embryos (Bazin et al., 2011; Meimoun et al., 2014; Layat et al., 2014). In agreement with this, Basbouss-Serhal et al. (2015) show that there is no correlation between transcriptome and translatome in Arabidopsis, and that germination regulation is translational implying a selective and dynamic recruitment of messenger RNAs to polysomes in both dormant and nondormant seeds. By contrast, seed proteome appears quite unique and diverse when compared to other plant developmental stages. Seed proteins encompass several functional classes from primary and secondary metabolism to structural and antimicrobial defence. Recent studies unravelled the crucial importance of protein PTMs in seed dormancy. Proteomic investigations have highlighted that seed proteins are subjected to a large number of posttranslational modifications (PTMs), which may affect protein functions including localization, complex formation, stability and activity (Arc et al., 2011). Oxidative damages can occur due to reactive oxygen and nitrogen species produced by non- enzymatic reactions in the dry state. These reactive species can affect proteins by the oxidation of their amino acids in a post-translational manner. Furthermore, ABA and GA signaling elements seem to rely on several PTMs such as protein phosphorylation or ubiquitination (Arc et al., 2011; Rajjou et al., 2012). Before entering to Phase III of water uptake, proteins involved in protein degradation and nitrogen remobilization are neosynthetized in preparation for the seedling growth. Therefore, it can be assumed that mRNA translation and protein PTMs constitute the main levels of control for germination completion. These processes are highly regulated in plants and represent rapid and efficient way to cope with environmental variations (Galland and Rajjou, 2015).
18
IV Hormonal regulation of seed dormancy and germination
The plant hormones are crucial signaling molecules that coordinate the regulation of seed dormancy and germination. Hormonal regulation may be a highly conserved mechanism of seed dormancy among seed plants (Nonogaki, 2014). ABA is a positive regulator of dormancy induction and maintenance, while GA release dormancy and promote the completion of germination by counteracting the effects of ABA (Bewley and Black, 1994). The balance of ABA and GA levels and sensitivity is a major regulator of dormancy status; environmental signals regulate this balance by modifying the expression of biosynthetic and catabolic enzymes to determine seed dormancy or germination outcomes (Fig. 6). Mediators of environmental and hormonal response include both positive and negative regulators. The net result is a slightly heterogeneous response, thereby providing more temporal options for successful germination (Finkelstein et al., 2008).
Fig. 6. Model for the regulation of dormancy and germination by abscisic acid (ABA) and gibberellins (GA) in response to the environment. ABA synthesis and signaling (GA catabolism) dominate the dormant maintains, whereas GA synthesis and signaling (ABA catabolism) dominate the transition to germination. The complex interplay among hormone synthesis, degradation and sensitivities in response to ambient environmental conditions can result in dormancy cycling. Adapted from Finch-Savage and Leubner-Metzger (2006).
19 IV.1. ABA metabolism and signaling
ABA plays a prominent role in seed dormancy maintaining (Hilhorst, 1995; Kermode, 2005). Since the discovery of ABA in the early 1960s, many efforts have been devoted to understanding of ABA regulation (Xiong and Zhu, 2003). During seed development, ABA is known to initiate the embryo maturation, synthesis of storage reserves and late embryogenesis-abundant (LEA) proteins, and initiation of seed dormancy (Phillips et al., 1997). The level of ABA is determined by the rate of biosynthesis and catabolism. Key genes for the enzymes in the ABA biosynthesis and catabolism pathways have been identified through genetic and biochemical studies (Fig. 7a). In higher plant, ABA is formed by the cleavage of a C40 carotenoid precursor, xanthophylls, which are produced in plastids from C5 precursors (Ruiz-Sola and Rodrïguez-Concepción, 2012), followed by a two-step conversion of the intermediate xanthoxin to ABA via ABA-aldehyde (Xiong and Zhu, 2003). The first step that is more specific to the ABA biosynthesis pathway is the epoxidation of zeaxanthin and antheraxanthin to violaxanthin, which occurs in plastids. This step is catalyzed by a zeaxanthin epoxidase (ZEP), whose molecular identity was first revealed in tobacco (Marin et al., 1996), and it encoded by the ABA1 gene in Arabidopsis (Audran et al., 2001; Xiong et al., 2002). Violaxanthin is then converted into neoxanthin by neoxanthin synthase (NSY), which is likely encoded by the Arabidopsis ABA4 gene (Dall’Osto et al., 2007; North et al., 2007). The aba4 mutant exhibits no obvious dormancy phenotype due to the formation of cis-violaxanthin by an alternate pathway (North et al., 2007). After a series of structural modifications, violaxanthin is converted to 9-cis-epoxycarotenoid. The ZmNCED (9-cis-epoxycarotenoid dioxygenase, NCED) gene, which was isolated using the maize vp14 mutant, catalyzes the oxidative cleavage of the major epoxycarotenoid 9-cis-neoxanthin yields a C15 intermediate, xanthoxin (Tan et al., 1997; Schwartz et al., 1997). In Arabidopsis, this gene family is composed of nine members, while five of them (NCED2, NCED3, NCED5, NCED6, and NCED9) encode xanthoxin-producing enzymes (Iuchi et al., 2001; Toh et al., 2008). This step was considered as the first committed step in the ABA biosynthesis pathway. Then, xanthoxin is exported to the cytosol and converted to ABA through a two-step reaction via ABA-aldehyde. A short-chain alcohol dehydrogenase/reductase (SDR) encoded by the AtABA2 gene catalyzes the first step of this reaction and generates ABA aldehyde (Rook et al., 2001; Cheng et al., 2002; Gonzalez- Guzman et al., 2002). ABA aldehyde oxidase (AAO) catalyzes the last step in the biosynthesis
20
pathway. Meanwhile, ABA inactivation is a crucial mechanism to fine-tune ABA level, which occurs by either oxidation or conjugation. The 8′-hydroxylation of ABA is catalyzed by the CYP707A subfamily of P450 monooxygenases (Kushiro et al., 2004; Saito et al., 2004). In addition, ABA can be conjugated with glucose to form the ABA-glucose ester (ABA-GE) catalyzed by an ABA glucosyltransferase. In Arabidopsis, only UGT71B6 exhibits a selective glucosylation activity toward the natural enantiomer (+)-ABA (Lim et al., 2005; Priest et al., 2006). Subsequent hydrolysis of conjugates constitutes an alternative pathway for ABA production in response to dehydration stress. Two glucosidases BG1 and BG2, localizing respectively in the endoplasmic reticulum or the vacuole, have been identified (Lee et al., 2006; Xu et al., 2012; Arc et al., 2013).
Fig.7. Metabolism pathways of three major hormones in regulating seed dormancy and germination. (a) ABA metabolism pathway; (b) GAs metabolism pathway; (c) Ethylene metabolism pathway, also called ‘Yang cycle’. (a) and (b) from Weitbrecht et al. (2011); (c) from Arc et al. (2013).
ABA perception and signaling pathway occur through a central signaling module (Fig. 8), which is based on the interaction of PYR/PYL/RCAR-type ABA receptors with protein Phosphatase 2Cs (PP2Cs) and SNF1-related protein kinase 2 (SnRK2s). In this model, the PP2Cs act as negative regulators, while SnRK2s act as positive regulators of downstream signaling (Park et al., 2009; Ma et al., 2009). This establishing a double-negative regulatory system, whereby ABA-bound PYR/RCARs inhibit PP2C activity and PP2Cs inactivate SnRK2s (Park et al., 2009; Umezawa et al., 2009; Vlad et al., 2009). Thus, in the absence of ABA, the PP2Cs are active and then repress SnRK2s activity and downstream signaling. By contrast, in the presence of ABA,
21 the receptor PYR/RCARs regulate and inhibit phosphatase activity of PP2Cs to allow SnRK2s activation and phosphorylation of target proteins. The ABI1 and ABI2 genes were identified as ABA-insensitive mutants and encode paralogous PP2Cs (Hirayama and Shinozaki, 2007). The abi1-1 and abi2-1 mutations are dominant and exhibit ABA insensitivity in various tissues and at various developmental stages (Leung and Giraudat, 1998; Beaudoin et al., 2000; Schweighofer et al., 2004). In Arabidopsis, loss-of-function of alleles of ABI1 leads to an ABA- hypersensitive response which indicates that the ABI1 is a negative regulator of ABA response (Gosti et al., 1999). As the critical role of ABA mediates seed dormancy induction, ABA- INSENSITIVE 5 (ABI5) was identified through genetic screening of ABA-insensitive for germination, it acts as the final common repressor of germination in response to changes in ABA and GA levels (Finkelstein et al., 2002; Piskurewicz et al., 2008). In addition to ABI5, three AREB/ABF-type bZIP proteins, AREB3, AtbZIP67/AtDPBF2 and EEL, are expressed in the nuclei of developing seeds and play important roles in seed development (Bensmihen et al., 2002, 2005).
Fig. 8. The core ABA signaling pathway. Recent progress in understanding early ABA signal transduction has led to the construction of a PYR/RCAR–PP2C–SnRK2 signal transduction model. In the absence of ABA, PP2Cs inhibit protein kinase (SnRK2) activity through removal of activating phosphates. ABA is bound by intracellular PYR/PYL dimers, which dissociate to form ABA receptor–PP2C complexes. Complex formation therefore inhibits the activity of the PP2C in an ABA-dependent manner, allowing activation of SnRK2s. Directly from Hubbard et al. (2010).
22
IV.2. GA metabolism and signaling
GAs are important during the early and the late phase of germination and counteract the ABA inhibition by regulating both of ABA metabolism and signaling (Ogawa et al., 2003). The GA metabolism pathway in plants has been studied for a long time, and a number of genes encoding the enzymes involved in this pathway have been identified (Frigerio et al, 2006). Bioactive GAs control diverse aspects of plant growth and development, including seed germination, stem elongation, leaf expansion, and flower and seed development. Though a hundred GAs identified from plants, only few such as GA1 and GA4 among them, are thought to function as bioactive hormones (Yamaguchi, 2008). The concentration of bioactive GAs in a given plant tissue are determined by the rates of their synthesis and deactivation. GAs are biosynthesized from geranyl diphosphate, a common C20 precursor for diterpenoids. GAs biosynthesis involves ent-copalyl diphosphate synthase (CPS), ent-kaurene synthase (KS), ent- kaurene oxidase (KO), ent-kaurenoic acid oxidase (KAO), GA 20-oxidase (GA20ox), GA 3- oxidase (GA3ox), and GA 2-oxidase (GA2ox) (Hedden and Phillips, 2000; Yamaguchi, 2008). Among them, GA20ox and GA3ox are the major key regulatory enzymes for GA biosynthesis, while GA2 ox mediates GA degradation (Fig. 7b). Moreover, like ABA, GAs also can be converted into conjugates in plants (Schneider et al., 1992; Schneider and Schliemann, 1994). Conjugation of GAs to glucose occurs either through a hydroxyl group of GA to give a GA-O- glucosyl ether or via the 6-carboxyl group to give a GA-glucosyl ester. Although the formation of these GA conjugates may also serve to deactivate GAs, it remains unclear whether GA conjugations play any regulatory role in the control of bioactive GAs levels (Yamaguchi, 2008).
During last decades, key components of the GA signaling pathway including the GA receptor GIBBERELLIN INSENSITIVE DWARF1 (GID1), the DELLA growth inhibitors (DELLAs) and the F- box proteins SLEEPY1 (SLY1), SNEEZY (SNZ) have been identified (Davière and Achard, 2013). The current model (Fig. 9) based on GA signal promoting DELLA degradation to overcome DELLA-mediated seed development and growth restraint (Harberd, 2003; Achard and Genschik, 2009). GA signaling is inhibited by the action of the DELLA transcriptional regulators in the absence of GA. Five DELLA protein have been identified in Arabidopsis, REPRESSOR of GA1-3 (RGA), GIBBERELLIC ACID-INSENSITIVE (GAI), RGA-LIKE 1 (RGL1), RGL2 and RGL3, with RGL2 playing a predominant role in inhibition of seed germination (Gazzarrini and Tsai, 2015). GA binds to the GID1 receptor and causes a conformational change that promotes GID1
23 binding to DELLA. GID1–DELLA complex can trigger DELLA degradation or inactivation to activate GA-responsive genes expression (Sun, 2011; Davière and Achard, 2013). Because DELLAs did not contain DNA-binding domains, so they rely on interactions with other transcriptional regulators to mediate GA responses by inhibiting their activity or DNA-binding capacity. However, DELLAs also act as transactivation factors and can induce GID expression directly, by this way to regulate GA biosynthesis positively (Zentella et al., 2007).
Fig. 9. Model of GA signaling pathway. GA action is repressed by DELLA protein when GA is absent. However, in the presence of GA, it bands to the GID1 receptor, then the GID1–GA complex interacts with the DELLA and TVHYNP motifs of the DELLA protein, resulting in the recognition of DELLA protein by the SCFGID2/SLY1 complex (consisting of Skp1, Cullin, F-box protein, and Rbx1). After DELLA protein polyubiquitinated by the SCFGID2/SLY1 complex, DELLA protein is degraded through the 26S proteasome pathway, and as a consequence GA action is activated. This consecutive reaction is predicted to occur in the nucleus. Adapted from Hirano et al. (2008).
IV.3. Ethylene metabolism and signaling
Ethylene plays an important role during the late phase of germination; it counteracts the ABA inhibition by interfering with ABA signaling (Linkies et al., 2009). Our previous studies have showed that sunflower seed is highly sensitive to ethylene during their dormancy alleviation and germination (Corbineau et al., 1990; Oracz et al., 2008). In higher plants, ethylene is produced from methionine through the Yang cycle (Fig. 7c) (Yang and Hoffman 1984; Lin et al. 2009). S-adenosyl-methionine (S-AdoMet) and 1-aminocyclopropane-1-carboxylic acid (ACC) are the main intermediates (Yang and Hoffman, 1984; Wang et al., 2002). The first step of ethylene biosynthesis is the conversion of S-adenosyl-methionine (SAM) to 1- aminocyclopropane-1-carboxylic acid (ACC), catalyzed by ACC synthase (ACS). The by-product being 5′-methylthioadenosine (MTA) is recycled back to methionine through the Yang cycle
24
(Yang and Hoffman, 1984; Kende, 1993). The last step is the conversion of ACC to the bioactive ethylene by ACC oxidase (ACO). Both ACS and ACO are encoded by a multigene family. ACO as the enzyme that mediates the final rate-limiting step in ethylene biosynthesis, it controls ethylene production in vivo and has fundamental contribution during seed germination (Kucera et al., 2005; Matilla and Matilla-Vázquez, 2008; Linkies et al., 2009). Accumulation of ACO and enhanced ethylene production are correlated to seed germination of several species (Chiwocha et al., 2005; Hermann et al., 2007; Leubner-Metzger et al., 1998; Petruzzelli et al., 2000; Linkies et al., 2009). The levels of ACO transcripts have been shown to be regulated by ethylene itself and other phytohormones (Lin et al., 2009).
As a gaseous hormone, ethylene readily diffuses across the plasma membrane. Five ethylene receptors ETHYLENE-RESPONSE 1 and 2 (ETR1, ETR2), ETHYLENE-RESPONSE SENSOR 1 and 2 (ERS1, ERS2) and ETHYLENE-INSENSITIVE 4 (EIN4) have been identified in Arabidopsis. All of these receptors are localized in the endoplasmic reticulum (ER) membrane and negatively regulate ethylene signaling through activation of CONSTITUTIVE TRIPLE RESPONSE 1 (CTR1). CTR1 encodes a Raf-like mitogen-activated protein kinase kinase kinase (MAPKKK). In the absence of ethylene, MAPKKK represses ethylene signaling by phosphorylating and inactivating the ER membrane protein EIN2. EIN3 and EIN3-like (EIL) are the transcription factors that act as positive regulators of the ethylene signaling pathway, they are degraded to prevent the transcription of ethylene-responsive genes (Gazzarrini and Tsai, 2015). By contrast, in the presence of ethylene, ethylene binding to the receptors causes their inactivation, the subsequent CTR1 inhibition that results in EIN2 C-terminal domain cleavage and migration to the nucleus, where it stabilizes EIN3/EILs (Merchante et al., 2013). Then, EIN3/EILs bind to the promoter of ethylene target genes, including the ethylene response factors (ERFs) to trigger ethylene response. Meanwhile, they attenuate the ethylene response in a feedback loop by inducing ETR1 and CTR1 expression (Chang et al., 2013).
V The effect of temperature in seed dormancy and germination
Plants can show remarkable responses to small changes in temperature. Previous studies have demonstrated that plants sense temperature by cellular responses. Thus, alterations in cellular equilibrium triggered by temperature changes, including membrane fluidity, protein conformation, cytoskeleton depolymerization, and metabolic reactions, act as networked
25 thermostats to sense heat and cold (Fig. 10) (Penfield, 2008; Ruelland and Zachowski, 2010). Seeds can sense temperature accurately. For example, seed germination in lettuce seeds is strongly inhibited by the transition from 32°C to 33°C, a mere 1°C rise (Argyris et al., 2005). Temperature can act on seed germination directly or indirectly by affecting dormancy and viability. Each specie has a temperature range for germination which can be characterized by the minimum and the maximum temperatures below and above which the seeds cannot germinate. Temperature is a highly important factor affecting seed germination because it has a strong influence on all biochemical reactions. In addition, temperature not only controls the germination rate but also dormancy release. Dry after-ripening and stratification, both of which are the gradual loss of dormancy in dry seeds, is temperature determined. Moreover, secondary dormancy is induced by relatively low or high temperatures in mature seeds according to species. Oat (Avena sativa) and barley (Hordeum vulgare) acquire secondary dormancy after thermoinhibition, they fail to germinate even after transfer to an optimal temperature (Corbineau et al., 1993; Leymarie et al., 2008; Hoang et al., 2013a and b, 2014).
Fig. 10. Schematic representation of the temperature ranges of the major characterized plant responses to ambient temperature. Temperature compensation refers to the circadian clock. From Penfield (2008).
V.1. Temperature action on dormancy release
Since dormancy reduces the range of external conditions under which germination can occur, removal of dormancy by after-ripening increases the temperature range over which seeds can germinate. Release from dormancy results in a widening of these conditions. As showed in Fig.
26
11 (a), freshly harvested seeds of cereals (oat) are dormant because they germinate poorly at 20°C or higher temperature, but they germinate well at lower temperature, the thermal optimum being around 10°C. A few months of after-ripening breaks their dormancy, thus their germination rate is enhanced at all temperatures (the temperature ranging extend from 0-10 to 0-35°C (Fig. 11a). By contrast, dormant sunflower seeds germinate much better at 20-30°C than at lower temperatures. Its temperature rang extended to 5-40°C after a dry storage at 20°C for 6 months (Fig. 11b). Previous data suggested that the inability of dormant seeds to germinate at relatively high temperatures may result from the presence in the seed coats of high amounts of phenolic compounds, the polyphenol oxidase-mediated oxidation of which limits the flux of oxygen reaching the embryo, and the higher the temperature the greater this limitation. Therefore, it has been assumed that the inability to germinate at the higher temperatures results principally from both of the coat-imposed and embryo dormancy, whereas poor germination at temperature below 25°C mainly results from embryo dormancy (Corbineau et al., 1990). Dry storage improves germination at temperatures ranging from 5 to 40°C by eliminating both coat-imposed and embryo dormancy.
Fig. 11. Temperature regulation of seed dormancy release and germination in oat (a) and sunflower (b). (a) Influence of temperature on the germination percentages obtained after 7 days of freshly harvested (dormant) Avena sativa (cv Moyencourt) seeds (●), and with seeds stored dry at 20°C for 3 weeks (○), 2 months ( ), 6 months (□) and 12 months ( ). All seeds germinate at temperature below 10°C, but the germination rate was reduced and 100% germination was not obtained within 7 days (not shown in the figure). (b) Germination percentages obtained after 7 days of freshly harvested (dormant) Helianthus annuus (cv Mirasol) seeds (●) and with seeds stored dry at 20°C for 1 month (○), 2 months ( ) and 6 months (□). (a) and (b) are adapted from Corbineau et al. (1993) and Corbineau et al. (1990), respectively.
27 V.2. Temperature action on germination rates
The effect of temperature on dormancy breaking differs between dry and imbibed seeds. Perhaps the most extreme cases of dormancy breaking by temperature in dry seeds are seen in the actions of fire on the coats of hard, water-impermeable seeds. But the dry seeds more commonly may experience gradual dormancy through dry after-ripening, and moreover, this process which is enhanced as temperature increases, is most obvious in species with short life cycles whose seeds often exhibit shallow dormancy, an attribute that allows rapid after ripening in warm summers enabling the production of more than one generation a season (Black et al., 2006). Sensitivity to temperature is correlated with depth of dormancy and is critical for winter and summer annuals to determine when they germinate. Seeds have an intrinsic upper limit temperature for germination, which is determined by environmental and genetic factors (Baskin and Baskin, 1998). In imbibed mature seeds, dormancy is frequently broken by a relatively low temperature (chilling) or in some species by warm temperatures.
A thermal time approach can be used to normalize the time for germination at different sub- optimal temperatures. The thermal time (ƟT (g)) for completion of germination at temperature T of percentage g of the seed population is calculated according to the equation
ƟT (g) = (T – Tb) tg, where Tb is the minimum or base temperature that permits radicle protrusion, and tg is the time to completion of germination of percentage g of the seed population. In general, Tb is considered to be equal for all the seeds; the thermal time is then constant for a given percentage of germination. Figure 12(a) shows that there exists a linear relationship between germination rate (i.e. 1/tg) for a specific germination percentage g and the temperature, but the thermal time increases with increasing percentage of germination. At supra-optimal temperatures, germination rate decreases linearly with temperature, but unlike Tb, the ceiling or maximum temperature allowing germination Tc varies in a normal distribution among individual seeds, resulting in a series of parallel lines with different intercepts on the temperature axis (Tc (g)). There exists a positive linear relationship between the germination rate and temperature up to the thermal optimum, and a linear negative relationship at higher temperature (Covell et al., 1986; Roberts, 1988; Black et al., 2006).
The time course of germination is usually represented by germination curves which correspond to the evolution of cumulated germination percentages over time, sometimes using a thermo gradient bar and measuring the time to reach 50% germination (t50). As 28
showed in Fig. 12(b), the t50 is about 30 h for dormant sunflower seeds imbibed at 25°C, and about 45h and 96h when at 20°C and 15°C respectively, which is in agreement with the concept mentioned above, the rate of germination (reciprocal of the time taken to germinate) shows a positive linear relation between the base temperature and the optimum temperature. Once seeds have lost dormancy, this positive relationship still exists, but all the germination rates are increased at these several temperatures (Fig. 12c).
Fig. 12. The influence of temperature on seed germination rates. (a) Relationships of germination rates for specific percentages (1/tg) to germination temperature (theoretical curves). Tb, base (minimum) temperature allowing germination; Tc (g), ceiling (maximum) temperature alowing germination of percentage g (10, 50 or
90%) in the seed population; ƟT (g), thermal time to completion of germination of percentage g (10, 50 or 90%) in the seed population. From Bradford, K.J. (1995), adapted from Black et al. (2006); (b) Germination of dormant sunflower embryos (i.e. naked seeds without pericarp) at various temperatures; (c) After 2 months of dry storage, sunflower seed dormancy is released and became non-dormant, the curve showed the germination rate of non- dormant embryos at various temperature. (b) and (c) from Oracz et al. (2007).
V.3. Temperature action on cellular events
Metabolism is governed by the activity of enzymes and enzymatic activities are temperature dependent. This is result in both changes in catalytic rate (Arrhenius’ law) and to the unfolding/inactivation of enzymes (Ruelland and Zachowsk, 2010). Both temperature downshift and temperature up shift can lead to protein unfolding (Pastore et al., 2007). The temperature effect on metabolic reactions also can be due to the temperature dependent protein conformation changed. Therefore, temperature switches on enzyme activities to 29 regulate cell metabolism. Moreover, the state of cell membranes in relation to dormancy has received special attention. The conformation of membrane-embedded proteins could be affected by changes of membrane fluidity (Ruelland and Zachowsk, 2010). During imbibition, events that are known to occur in seed response to temperature are phase transitions of cell membranes, which undergo a sudden change from crystalline or gel phase at lower temperature to a fluid, liquid-crystalline phase at higher temperatures (Vigh et al., 2007). Many properties of membrane are altered when this happens, possibly with profound effects on the physiology of the cells, which could interfere with processes necessary for germination. In addition, leakage of amino acids from seeds, such as lettuce exhibiting thermoinhibition, occurs at the same temperature at which dormancy is expressed (Fig. 12) and a crude membrane fraction from temperature-sensitive seeds shows phase transition, all these supposed that high temperature (up to 25°C) induced dormancy may in reality be connected with membrane changes (Black et al., 2006).
Fig. 12. Temperature effect on dormancy and amino acid leakage. In this batch of lettuce seeds (cv. Grand Rapids) there is a sharp drop in the percentage of germinated seeds in darkness beginning at 25-30°C. At these temperatures, amino acid leakage from the seed shows a sharp rise suggesting that a change in permeability of the plasma membrane of at least some embryo cells has occurred. From Hendricks and Taylorson (1979).
V.4. The crosstalk between temperature and hormonal dependent germination
Many reports have reviewed seed dormancy and germination, recently (Nambara et al., 2010; Weitbrecht et al., 2011; Graeber et al., 2012; Linkies and Leubner-Metzger 2012; Rajjou et al., 2012; Arc et al., 2013), however, relatively little is known about the mechanisms of how seeds
30
sense temperature and transduce that signal into internal developmental events controlling germination (Wigge, 2013; Penfield and MacGregor, 2014).
Hormonal regulation is a critical internal factor and highly conserved mechanism of seed dormancy and germination among plant species. Light has been demonstrated to control seed dormancy through hormone metabolism and signal transduction (Seo et al., 2009). ABA biosynthesis is an absolute requirement for cold acclimatization and for acquired thermotolerance at high temperatures (Gilmour and Thomashow, 1991; Larkindale and Vierling, 2005). The endogenous ABA present in dry seeds rapidly declines when seeds are imbibed under favorable conditions such as optimum temperature and light requirements. In contrast, the endogenous ABA contents generally decline initially followed by accumulation and maintenance of elevated levels in dormant seeds or non-dormant seeds imbibed at a supra-optimal temperature (Argyris et al., 2008; Huo et al., 2013; Toh et al., 2008). It is also known that low temperatures induce ABA catabolism in seeds (Bewley, 1997; Finch-Savage et al., 2007). Morover, the application of ABA biosynthesis inhibitors (e.g., fluridone) can relieve the inhibition of seed germination by thermoinhibition (Yoshioka et al., 1998; Gonai et al., 2004; Argyris et al., 2008; Toh et al., 2008). All these results demonstrate the ABA involvement in response to temperature. In the other hand, temperature regulates the levels of GA- metabolizing genes in some species, such as GA3ox1 and GA20ox1 in Arabidopsis seeds when imbibed at lower temperatures (Yamauchi et al. 2004), while suppresses the expression of GA3ox and GA20ox genes in Arabidopsis and lettuce at high temperature (Gonai et al., 2004; Argyris et al., 2008; Toh et al., 2008; Huo et al., 2013). Increased levels of bioactive GAs are produced after a germination-promoting low-temperature treatment of Arabidopsis seeds, and this is mediated by upregulation of GA3ox gene expression, and concomitant downregulation of GA2ox (Yamauchi et al., 2004). Application of ethylene or its biosynthetic precursor ACC can rescue seed dormancy from thermoinhibition in lettuce, chickpea (Cicer arietinum), sunflower (Helianthus annuus) and tomato (Corbineau et al., 1988; Saini et al., 1989; Gallardo et al., 1991; Dutta and Bradford, 1994; Nascimento et al., 2000; Kepczynska et al., 2006). In addition, carrot (Daucus carota) seeds have a positive correlation among genotypes between the ethylene production and their capacity for germination at high temperatures (Nascimento et al., 2008), suggesting that ethylene biosynthesis is involved in regulation of temperature across different species. Furthermore, thermoinhibition in
31 marigold (Tagetes minuta) seeds was alleviated by a combination of treatments that reduced ABA levels and increased ethylene levels, although ethylene alone was less effective (Taylor et al., 2005), which imply that there exist an interaction between ABA and ethylene in response to temperature.
VI Dormancy in Sunflower seed
Sunflower (Helianthus annuus L.) is one of the most important oilseed crops in the world. It represents a major renewable resource for food (oil), feed (meal), and green energy. France is a major sunflower producer (1.7Mt/year, 1st European producer) and sunflower production contributes significantly to the French economy. French breeders are ranked first in terms of sunflower seed production. Rapid and homogenous emergence and stand establishment are critical factors for sunflower production. Sunflower seeds provide an excellent system for studying dormancy because they are deeply dormant at harvest, and this dormancy is progressively lost during dry storage (Corbineau et al., 1990). Otherwise, sunflower seed has a small and simple forms, with one fruit containing a single seed and the seed envelops consists of the ovary wall (pericarp) and testa (Fig. 13a). Sunflower embryo is composed of two primary organ systems: the axis and cotyledon (Fig.13b). Both of these two organs have distinct developmental fates; the axis corresponds to the hypocotyl-radicle region of the embryo. It contains the shoot and root meristems, which will grow into the mature plant after seed germination (Fig.13c). The cotyledon, as a terminally differentiated organ, is involved in reserves supply for subsequent seed germination and seedling growth before photosynthetically active phase.
In order to fill the shortage of the study of seed dormancy/germination in sunflower, our group has contributed for a large part. The physiological dormancy concerns both of seed coat- and embryo in Sunflower. As described in Corbineau et al. (1990), the inability of freshly sunflower seed to germinate at high temperatures (25 to 40°C) resulted principally from a seed coat-imposed dormancy, whereas poor germination at temperatures below 25 °C was mainly due to an embryo dormancy. However, this embryo-imposed dormancy can be overcome during after-ripening or by applying exogenous ethylene. Unlike in Arabidopsis, exogenous GA has a limited effect on the stimulation of germination of dormant sunflower
32
seeds, while the antagonistic interaction between ABA and ethylene play a critical role (Corbineau et al., 1990; Oracz et al., 2008; Arc et al., 2013; El-Maarouf-Bouteau et al., 2015).
Fig. 13. Structure of sunflower seed. (a) Sunflower fruit, which is composed of an embryo surrounded by covering seed coat derived from the walls of the ovule; (b) Sunflower seed dissection after removal of the fruit pericarp. the plumule made up of two embryonic leaves and a terminal (apical) bud, the two embryonic leaves will become the first true leaves of the seedling, and the terminal bud contains the meristem at which later growth of the stem takes place; two cotyledons involved in food supplying for the germinating seedling; hypocotyl and radicle, which will grow into the part of the stem below the first node and primary root respectively. (c) The patterning of the sunflower embryonic axis. c, Cortex; p, pericycle; rc, root cap; qc, quiescent center; lrc, lateral root cap; v, vascular. Most cell division occurs in the meristem and subsequent growth depends upon cell enlargement, the embryonic axis containing the embryonic root and shoot meristems, which would give rise of the whole plant. Adapted from Oracz et al. (2009).
Despite the huge progress that has been made the last decade owing to the emergence of the -omics approaches, the molecular mechanisms regulating seed germination and dormancy are far from being resolved. For example, how a dormant seed acquires the ability to germinate during dry after-ripening or imbibition in optimal temperature is unknown. Reactive oxygen species (ROS) have been proposed to be key players in sunflower seed dormancy and germination (Oracz et al., 2007; Bailly et al., 2008; El-Maarouf-Bouteau and Bailly, 2008; El- Maarouf-Bouteau et al., 2015). In fact, ROS-generating compound, methylviologen, and respiration inhibitor hydrogen cyanide (HCN) can alleviate sunflower embryo dormancy during imbibition. Moreover, sunflower seed dry after-ripening is associated with ROS accumulation, which induces selective protein oxidation in anhydrobiosis (Oracz et al., 2007, 2008). Bazin et al. (2011) also reported that mRNA oxidation occurs during sunflower seed dry after-ripening, which highlights a potential mechanism of seed dormancy alleviation in which targeted mRNA oxidation can fine-tune the cell signaling pathway that controls germination by targeting mRNA decay and by regulating selective translation. Both of these studies clearly document that non-enzymatic processes leading to selective translation and selective protein
33 degradation are probably key events occurring during after-ripening (El-Maarouf-Bouteau et al., 2013).
In sunflower, after-ripening is not associated with transcriptomic changes, as no significant difference in transcripts has been recorded in comparison between dormant and non- dormant dry seeds (Meimoun et al., 2014). Imbibed dormant (D) and non-dormant (ND) seeds and ABA and ethylene (ET) treated seeds were compared at the transcriptomic but also the metabolic level. Transcriptomic and metabolomic were used to compare germinating seeds (ND and D/ET) and non-germinating seeds (D and ND/ABA). Interestingly, the high similarity showed in ND and D/ET transcriptome suggesting ethylene involvement in dormancy alleviation in sunflower. Moreover, a large number of genes were altered oppositely in germinating as compared to non-germinating seeds, most of them were involved in ABA or ET signaling, cell wall, redox metabolism, oxidation, transport or cell signaling (Xia et al., annexe 1). Metabolic changes associated to germination capacity occurred at 24 h, no change recorded at 3 or 15 h of imbibition. Metabolic change concerned only hexoses (glucose, fructose and xylose) (Xia et al., annexe 1). These results showed that after-ripening, ET and ABA treatment induced comparable underlying mechanism in seed dormancy regulation. Metabolomic studies shows that sugar metabolism and cell wall are likely to be the target of such hormone action.
Translatome analysis was performed to highlight differential accumulation of polysome- associated mRNAs between dormant and non-dormant imbibed seeds. 194 polysome- associated transcripts were specifically found in non-dormant but only 47 in dormant embryos after 15 h of imbibition, which represents the time point at which the association of transcripts with polysomes reached a maximum. In addition, the proteins corresponding to the polysomal mRNAs in non-dormant embryos appeared to be very pertinent for germination and were involved mainly in transport, regulation of transcription or cell wall modifications (Layat et al., 2014). Given the gap that could exist between transcriptome and translatome, it is important to characterize the proteome change, proteins being the effectors of metabolism change that trigger germination process. In fact, central metabolism related proteins has been shown to be regulated at the transcriptomic level or by oxidation. Nevertheless, little is known about seed metabolism change in dormancy alleviation and germination.
34
Objectives of the thesis
The objectives of this work were to characterize sunflower seed proteome change in order to complete the analysis of seed dormancy regulation. Moreover, targeted enzyme activity of major enzymes involved in central metabolism has been analyzed to integrate a supplemental level of regulation, such as post-translational modifications. We aimed to decipher such molecular events involved in the transduction of temperature signal, the most important environmental factor inducing dormancy breaking. In order to reveal the molecular mechanisms of temperature induced germination, two temperatures, 10°C and 20°C, which represent the non-permissive and permissive temperature for dormant sunflower seed germination, respectively, have been selected. The results obtained will presented in the second chapter of results of the manuscript.
The substantial influence of the environment factors is always mediated by the internal factors such as phytohormones. Thus, in the third chapter we investigate the cellular and molecular events of hormonal regulation in seed dormancy release by temperature as compared to after-ripening process, to achieve a higher level of cell signaling integration of temperature and hormone metabolism and signaling.
35
Chapter 2 Integrating proteomics and enzymatic profiling to decipher seed metabolism affected by temperature in seed dormancy and germination
Qiong Xia1, Gwendal Cueff2, Loïc Rajjou2, Duyen Prodhomme3,4, Yves Gibon3,4, Christophe Bailly1, Françoise Corbineau1, Patrice Meimoun1*, Hayat El-Maarouf-Bouteau1*§
1- Sorbonne Universités, UPMC Univ Paris 06, CNRS, Biologie du développement Paris Seine - Institut de Biologie Paris Seine (LBD - IBPS), 75005 Paris, France.
2- Institut Jean-Pierre Bourgin (UMR1318 INRA – AgroParisTech), Institut National de la Recherche Agronomique, Saclay Plant Science, Versailles, France
3- UMR1332 Biologie du Fruit et Pathologie, Université de Bordeaux, Institut National de la Recherche Agronomique, Villenave d'Ornon, France
4- Plateforme Métabolome, Centre Génomique Fonctionnelle Bordeaux, Villenave d’Ornon, France
§ Corresponding author: El-Maarouf-Bouteau H ([email protected])
*authors that participate equally to the work
Running title: Metabolism of seed germination
37
Summary
• Temperature is an important environmental factor affecting seed dormancy and
germination. The mechanism by which temperature induces germination is however
still unclear.
• Proteomic study has been performed in dormant sunflower seeds during imbibition at
permissive and non-permissive temperatures for germination, 20 and 10°C,
respectively. Proteomic study was completed by polysome and proteasome activity
assessment and enzymatic profiling on several altered proteins mainly involved in
metabolism and energy.
• Results showed that 20°C treatment induced the activation of both protein synthesis
and degradation processes, the latter being probably more active to tip the balance
towards a decrease in protein abundance. Proteasome activity was associated to the
germination sensu stricto while other processes such as proteases were associated to
the post-germination. Interestingly, enzymatic profiles showed that TCA cycle and
glycolysis were more active in non-germinating seeds in phase I of the germination
sensu stricto.
• Enzymatic activity data allowed clarifying seed metabolism affected by temperature
over imbibition time. Enzymatic profiling seems to be necessary to gain insights into
molecular networks controlling seed dormancy and germination.
Key words: Enzymatic Profiling, Germination, Metabolism, Proteomics, Seed Dormancy,
Temperature
38
Introduction
Seed germination represents a key sensitive growth stage in plant establishment. The germination process is initiated by imbibition, called phase I; phase II, corresponds to the end of water uptake and phase III starts by radicle protrusion (Bewley & Black 1994). Based on physiology of seeds and seedlings, phase I and II are characterized as germination sensu stricto, and phase III as post-germination. Seed dormancy, defined as the inability of seeds to germinate under apparently favorable conditions, allows seed germination at the most appropriate moment for plant development (Finch-Savage & Leubner-Metzger 2006). Dormancy breaking is accomplished by diverse mechanisms triggered by environmental factors such as temperature, light, oxygen and water. Although the importance of these factors in dormancy breaking has been largely identified in various plant species, the components of their transduction pathway and the final effect on metabolism are still unknown.
Temperature affects the rate of dormancy loss and the pattern of dormancy change in moist seeds (Roberts 1988). The investigation of temperature action on dormancy alleviation is ecologically relevant to approximate natural conditions and to assess the effect of global warming. In the last decades, efforts have been placed in the understanding of the effect of after-ripening, a dry storage period, or stratification on dormancy alleviation. A number of high-throughput, large scale-omics studies have been performed to gain insight into molecular networks of seed dormancy and germination. They include analyses of seed transcriptomics (Nakabayashi et al. 2005; Cadman et al. 2006; Finch-Savage et al. 2007; Carrera et al. 2008, Meimoun et al. 2014; Layat et al. 2014), proteomics (Gallardo et al. 2001, 2002; Job et al. 2005; Chibani et al. 2006; Oracz et al. 2007) and metabolomics (Fait et al. 2006). These studies pointed out the importance of the groups of storage proteins, stress response and detoxification in dormant state and energy, amino acid metabolism, folding and mRNA and protein metabolism in non-dormant state. However, they did not allow the understanding of metabolic change responsible for germination potential. Wang et al. (2015) have shown, by analyzing proteomic studies, that energy production is mainly activated in phase II during germination in several species and also during dormancy breaking by exogenous nitrate or
39
stratification in Arabidopsis seeds (Arc et al. 2012). Galland et al. (2014) showed that members of energy category have been identified in de novo synthetized proteins. They also highlight the importance of post-translational modifications (PTMs) in proteome change as viewed by 2D-PAGE. Indeed, central metabolism pathways of rice seed germination were significantly modulated by lysine acetylation and succinylation (He et al. 2016). Enzyme activity can provide integrated information about gene expression and PTMs (Gibon et al. 2004). Recently, the combination of high-throughput methods has greatly advanced our knowledge about developmental processes such as multilevel studies integrating transcriptomics and metabolomics to gain insights into the biochemical program that controls soybean seed development and its regulatory networks (Li et al. 2015). Transcriptomic and enzyme profiles coupling allowed the investigation of the correlation between metabolites and transcripts in Arabidopsis rosettes (Gibon et al. 2006). A more integrative study using transcriptomics, proteomics and metabolomics revealed multiple ethylene-associated events during tomato ripening (Osorio et al. 2011).
In this study, we integrated proteomic and enzyme profiling to investigate major cell metabolism affected by temperature in seed dormancy alleviation and germination in sunflower seeds. Dormant seeds were analyzed, during three imbibition time points (one in phase I and two in phase II of germination sensu stricto), comparing the action of two temperatures 10°C and 20°C, which can inhibit and promote germination, respectively.
Materials and Methods
Plant material and Germination test
Sunflower (Helianthus annuus cv LG5665) seeds were harvested in 2012 in the south of France (Drôme) and provided by Limagrain. Dormant seeds were stored at −30°C until use to maintain their dormancy after harvest. Germination tests were performed with seeds without pericarp (embryos) in darkness, in 9-cm petri dishes (30 seeds per dish and three replicates) on a layer of cotton wool moistened with deionized water at 10°C or 20°C. An embryo was considered as germinated when the radicle had elongated to 2 to 3 mm. Biochemical analyses were made on axes (embryos without cotyledons) from seeds imbibed during 6, 15 and 24 h. Table 1 showed that 6 h allowed about 60% of water uptake which increased to almost 70 % and
40
remained stable up to 24 h. At 20°C, water content was higher at 24 h, but not significantly as shown by standard deviation suggesting however, that some seeds began their water uptake to exit the phase II. These times were chosen in order to study the changes that operate in phase I (6 h), phase II (15 h) and the end of phase II (24 h) of germination.
Total Soluble Protein Extraction and Two-Dimensional Gel Electrophoresis
Total soluble protein extract preparation from embryonic axes of imbibed seeds and subsequent separation by two-dimensional (2D) electrophoresis were carried out as previously described by Görg et al. (1987) and Job et al. (2005).
Protein Staining and 2D Gel Analysis
2D gels staining and analysis were performed according to Arc et al. (2012). Spot detection and quantification were achieved by the software Progenesis SameSpot (v3.2, NonLinear Dynamics). The spot volume ratios between the different conditions were calculated using the average spot normalized volume of the three biological replicates.
Spot Selection and protein identification
According to Arc et al. (2012), the SameSpot software was used to perform a one-way ANOVA for the selection of differentially abundant spots with a maximum fold change higher than 1.5 and a p-value lower than 0.05. Protein Identification was performed using the MASCOT (http://www.matrixscience.com; Matrix Science) with a peptide mass tolerance of ± 0.2 Da, one missed cleavage and cysteine carbamidomethylation and methionine oxidation allowed. Spots of interest were excised from silver-stained 2D gels, digested with trypsin and identified by LC–MS/MS. Database search was performed using XTandem and XTandem Pipeline (http://pappso.inra.fr/bioinfo/xtandempipeline/).
Polysome Fractionation Assays
Polysomes were fractionated by sucrose density gradient centrifugation as described previously (Davies & Abe 1995, Layat et al. 2014). Approximately 160 mg fresh weight axes were pulverized in liquid nitrogen with a mortar and pestle. The resulting frozen powder was homogenized in 2 ml of polysome extraction buffer (200 mM Tris-HCl, pH 9.0; 200 mM KCl; 25
41
−1 −1 mM EGTA, pH 8.3; 36 mM MgCl2; 5 mM DTT; 50 mg ml cycloheximide; 50 mg ml chloramphenicol; 0.5 mg ml−1 heparin; 1% [v/v] Triton X; 100% [v/v] Tween; 20% [w/v] Brij; 35% [v/v] polyoxyethylene and 1% [w/v] deoxycholic acid) and centrifuged at 13,400 g for 20 min at 4°C. The supernatant was passed through a shredder column (Qiagen) to remove remaining cell debris. 1.2 ml purified extract was loaded on 4.2 ml of a 15-60 % sucrose density gradient and ultracentrifuged at 38,400 g for 2.5 h at 4°C. The gradient was collected from the bottom using a peristaltic pump with simultaneous recording of absorbance profiles at 254 nm using a UV monitor.
Proteasome Activity Profiling
Proteins were extracted by grinding 15 axes with 1.5 ml of 50 mM TRIS buffer (pH 7.4) and cleared by centrifugation (10 min at 16 000 g). The supernatant was filtred through a 0,22 µm filter (allsciences, http://www.allsciences.com/) to remove remaining cell debris. Labeling was done by incubating 15 µg protein in 1 μM MV151 (Verdoes et al. 2006) for 6 h. The labeled proteins separated on 12% SDS gels were visualized by in-gel fluorescence scanning using a Typhoon 8600 scanner (GE Healthcare Life Sciences, http://www.gelifesciences.com) with excitation and emission at 532 and 580 nm, respectively. Fluorescent signals were quantified with Image J.
Determination of Protein-bound Carbonyls
Carbonyl contents in soluble protein extracts from 15 axes of each sample were quantified by reaction with dinitrophenylhydrazine (DNPH) according to Wehr et al. (2013). 1 mg proteins were reacted with 500 μl of 0.2% DNPH (in 2 M HCl) or 2 M HCl (control) for 15 min at 25 °C. For each determination, three replicates and their respective blanks were used. Proteins were precipitated with 20% (w/v) TCA, centrifuged, and washed three times with ethanol/ethyl acetate (1:1 (v/v)). The protein pellets were finally dissolved in 6 M guanidine hydrochloride 500 mM KCl buffer (pH 2.5). Carbonyl was measured at 370 nm and protein at 276 nm. Carbonyl content was calculated using a molar absorption coefficient of 22,000 m−1 cm−1.
42
MDA Content
Malondialdehyde (MDA) content was determined according to Hagege et al. (1990). 10 axes were ground in 5 ml distilled water and homogenized with an equal volume of 0.5% (w/v) 2- thiobarbituric acid in 20 % (w/v) trichloroacetic acid. The homogenate was incubated for 30 min at 95°C in a water bath and then cooled quickly on ice and centrifuged at 16,000 g for 30 min. The supernatant was used for MDA determination by calculating the difference in absorbance at 532 and 600 nm using an extinction coefficient of 155 mM-1 cm-1. Results are expressed as nmol MDA /g DW and represent the mean of four replicates ± SD.
Enzyme Activity Measurements
Proteins were extracted from embryonic axes of imbibed seeds (10 mg FW) and enzyme activities were assayed using a robotized platform as described in (Steinhauser et al. 2010 and Biais et al. 2014). Enzyme activity results are expressed as nmol per mg of total protein per min.
Results
Effect of temperature on seed germination
Dormancy reduces the range of external conditions under which seed germination can occur. In sunflower, it has been reported in previous studies that dormant seeds are not able to germinate at low temperature (Corbineau et al. 1990; Oracz et al. 2007). In this study, we assessed the germination of dormant embryos in darkness at 10°C and 20°C, which are poor and suboptimal temperature for germination, respectively. As shown in Figure 1, the germination rate reached only 10% after 7 days of imbibition at 10°C, whereas nearly 96% of dormant seeds were able to germinate after 7 days at 20°C.
Changes of protein abundance of temperature-induced sunflower seed germination
To explore changes in the proteome during temperature regulation of germination, we performed 2D protein patterns of total soluble proteins from dormant embryos after 6, 15 and 24 h of imbibition at 10°C and 20°C. After samples comparison by image analysis with the Progenesis SameSpot software (Arc et al. 2012), 170 significant differentially accumulated 43
protein spots have been selected based on Anova statistical analysis at a p-value < 0.05 for fold change up to 1.5. Interestingly, few changes in protein abundance have been recorded at 6 or 15 h (phase I and II of germination sensu stricto) comparing to 24 h of imbibition (the end of phase II of germination sensu stricto, Fig. 2 (a), (b) and (c)). Only 12 spots were more abundant and 4 spots less abundant in embryos at 20°C comparing to 10°C after 6 h of imbibition. After 15 h, 8 and 25 spots were more or less abundant, respectively, in embryos at 20°C compared to 10°C. Conversely, we note important change after 24 h of imbibition, 19 and 102 spots were more or less abundant, respectively, in embryos at 20°C compared to 10°C. It is important to note that the major change at this time point is the decrease of protein abundance at the temperature which permits germination (Fig. 2 (d)). It could be due to increased protein synthesis at 10°C and/or increased protein degradation at 20°C. To answer this question, polysome profiles, protein oxidation and degradation have been investigated.
Protein synthesis and degradation assessment
Because major changes in protein abundance were observed between 15 and 24 h imbibition time point, they were chosen for polysome profile analysis in dormant embryos at 10°C and 20°C (Fig. 3 (a) and (b)). The overall polysome profile showed a significant increase at 20°C compared to 10°C. The decrease of 60/80S at 20°C also reveals the recruitment of RNAs to form polysomes. Polysome fraction was more important at 24 h comparing to 15 h in both conditions of temperature. These results suggest that protein synthesis is activated during seed imbibition, being more active at 20°C comparing to 10°C.
Proteasome activity was also assessed at 10°C and 20°C by using activity-based protein profiling (ABPP). The proteasome inhibitor, MV151 was chosen as the activity-based probe, which also contains a Bodipy fluorescent group for fluorescent imaging (Verdoes et al. 2006). As shown in figure 3 (c), the proteasome activity detected in seeds imbibed at 20°C is increased by 3 folds compared to 10°C at 6 and 15 h of imbibition. The proteasome activity decreased drastically after 24 h at 20°C while it remained stable at 10°C. To complete these data, the level of protein carbonylation was investigated during imbibition at 10°C and 20°C. Figure 3 (d) shows that during the phase I and II (from 0 to 15 h of imbibition), there is no difference in carbonyl content between 10°C and 20°C. By the end of phase II (after 24 h of imbibition), a significant increase of carbonyl amount was noted at 20°C compared to 10°C. In addition, the
44
lipid peroxidation product, malondialdehyde (MDA), which is known to react with lysine residues to form carbonyl derivatives (Burcham & Kuhan, 1996; Liu & Wang, 2005), has been detected under the same conditions. Interestingly, MDA content increased between 15 and 24 h of imbibition at 20°C (Fig. 3(e)). In sum, these results showed that 20°C induced the activation of both protein synthesis and degradation processes, the latter being probably more active tipping the balance towards a decrease in protein abundance.
Ontological classification of the altered proteins in proteome analysis
To explore the function of the altered proteome, we have selected and sequenced the altered spots. Spots selection was based on statistical test of SameSpots Stats software using 80-90% as relevant threshold. 95 spots corresponding to the most marked changes during imbibition were selected to be sequenced and identified by MS/MS. They included 16, 28, and 51 spots changed at 6, 15 and 24 h, respectively. Therefore, 94 spots were successfully assigned to proteins that were then categorized in ontological classes based on MapMan software analysis and the ontological classification of Bevan et al. (1998) (Fig. 4 & Table S1).
Ontological classification of the differentially expressed proteins showed that proteins related to metabolism and energy were represented since 6 h of imbibition suggesting that they could represent an early level of regulation. They were more-abundant at 6 h while they were less- abundant at 15 and 24 h at 20°C. Proteolysis related proteins were more represented in down regulated proteins at 20°C. Stress response and detoxification functional categories are represented at the three imbibition times, particularly at 15 h (Fig. 4). Seed storage proteins correspond to a high proportion of down-regulated proteins at 15 and 24 h at 20°C (Fig. 4).
Changes in enzyme activities related to altered proteins involved in central metabolism
To explore in deep seed metabolism, enzymatic profiling has been performed on 10 enzymes involved in sucrose metabolism, glycolysis, Perl’s pathway and TCA cycle. The analyzed enzymes are part of the metabolic pathways in which proteomic analysis shows protein abundance changes between 10°C and 20°C at 6 and 24 h (Table S1). Figure 5 shows that, at the exception of UDP-Glc pyrophosphorylase (UGPase, EC 2.7.7.9), all enzymes had higher activities at 10°C compared to 20°C after 6h of imbibition. At 15 h, most activities were comparable between the two treatments due to an increase of enzymatic activities at 20°C.
45
At 24 h, several activities such as malate dehydrogenase (MDH, EC 1.1.1.82), fructose- bisphosphate aldolase (FBP, EC 4.1.2.13), aconitase (EC 4.2.1.3) and alcohol dehydrogenase (ADH, EC 1.1.1.1), became higher at 20°C. The comparison between proteome change and enzyme activity showed low concordance, as GAPDH and PGK increased in abundance at 20°C but they showed high activity at 10°C at 6 h (fig. 5 and table S1). The opposite was observed for ADH and FBP Aldolase at 24h. Enolase, UGPase, AlaT, PGK and PGM decreased in abundance at 20°C at 24 h but there was no change in their activity comparing to 10°C. Aconitase and MDH abundance and activities increased both at 24 h at 20°C.
Discussion
Germination occurs when dormancy-breaking is followed by exposure to suitable conditions of embryo growth. Temperature regulation of germination can occur at the level of gene transcription, protein synthesis or post-translational modification. The involvement of gene transcription in seed germination is debated as it has been shown that seed contains all RNA species needed for germination, ready to be used upon imbibition (Rajjou et al. 2004). We have also shown that in sunflower seeds at dry state, almost all RNA species exist in germinating and non-germinating seeds (Meimoun et al. 2014) and RNA oxidation could be a determinant post-transcriptional regulation in seed germination (Bazin et al. 2011). Proteins being the result of the translation of genes expressed de novo or stored transcripts, we investigate proteome change in dormant embryos imbibed at 10°C and 20°C. The main trend in protein change was a significant decrease at 20°C as compared to 10°C (Fig. 2 (d)). Polysome profiling and proteasome assessment showed that 20°C activates both protein synthesis and degradation processes. Previous data have suggested that polysomes are absent in dry seeds, but rapidly increase when cells become hydrated (Bewley 1997, Layat et al. 2014). Several proteins related to protein translation have been identified in the present proteome analysis, such as eIF5A (Eukaryotic translation initiation factor 5A; n°3899), Poly (A)-binding proteins (n° 1604, n°1476) and Ribosomal proteins (n° 1030; n° 3716, table S1). Previous proteomic studies showed that seed germination is associated with a dynamic regulation of protein synthesis in rice and wheat (Sano et al. 2012; Gao et al. 2013). It may be noted that disulfide isomerase (table S1, n°2138), which is involved in the synthesis and deposition of storage proteins (Kim et al. 2012) and accumulated in developing seeds of Arabidopsis (Hajduch et al.
46
2010), M. truncatula (Gallardo et al. 2003) and Agrostis grass species (Xu & Huang 2008), decreased in abundance during imbibition. This suggests that enzymes that have served in seed development stage are degraded during germination. Accordingly, seed storage proteins (SSP) are highly represented in less abundant proteins at 15 and 24 h at 20°C (table S1). This is consistent with the activation of protein degradation processes at the phase II of germination which prepares to elongation. SSP degradation is known to be due to proteases activity (Shutov & Vaintraub 1987). Since we have shown that proteasome activity was high in the phase I of germination and decreased by the end of phase II (24 h, Fig. 3), we can suggest that proteasome is important in the phase I and that other degradation processes, such as those involving proteases, take place in phase II to prepare for elongation. In fact, several proteinases such as aspartic proteinase and carboxypeptidases were found to target storage protein breakdown in seeds (Muntz et al. 2001). It is worth noting that the increase in abundance of the 26S proteasome component RPT5A could be related to the highest proteasome activity at 20°C (n°1985, n°2004; Fig 3(c)). Numerous metabolic enzymes such as PPDK, GADPH, PGK, enloase, IDH, FBP-aldolase, ADH and ALDH are known to be targeted to ubiquitinylation (Igawa et al. 2009; Saracco et al. 2009; Maor et al. 2007; Manzano et al. 2008). This suggests importance of the ubiquitin (Ub)-proteasome pathway in temperature-induced seed germination. A number of these proteins, such as Enolase, UGPase, FBP aldolase, GAPDH, IDH and ADH translation factor elongation factor 1-gamma (n°e75 & e215) and several molecular chaperones such as protein disulfide isomerase (n°2138) and alpha/beta- Hydrolases superfamily protein (n°1091, Table S1) characterized in our proteomic analysis were shown to be carbonylated during germination of Arabidopsis and sunflower seeds (Job et al. 2005; Oracz et al. 2007).
Enzyme profiling was also performed to clarify seed metabolism regulation during imbibition at 10°C and 20°C. UGPase, PGM, FBP-Aldolase, Enolase, GAPDH, PGK, AlaAT, ADH, MDH and Aconitase activities were assessed during imbibition. The low concordance between protein content and enzyme activity observed for a set of enzymes could be due to PTMs such as carbonylation, S-nitrosylation and glycosylation which supposed to be involved in the regulation of seed germination (Berger et al. 1996; Job et al. 2005; Bethke et al. 2006; Oracz et al. 2007; Zhao et al. 2007). Phosphorylation-dephosphorylation may represent another PTM playing an important role in seeds as UGPase, PGM, enloase, MDH, FBP-Aldolase, GADPH
47
and PGK have been revealed as putative phosphoproteins in developing Arabidopsis, rice and Brassica seeds (Agrawal & Thelen 2006; Irar et al. 2006; Han et al. 2014).
According to enzyme activity results, the phase I (6 h) is characterized by a lower activity of enzymes involved in glycolysis and TCA cycle and sucrose synthesis in germinating seeds (imbibed at 20°C, fig. 6). It has been demonstrated that respiratory inhibitors such as cyanide can release sunflower seeds dormancy (Oracz et al. 2008, 2009). Inhibitors of glycolysis, TCA cycle and terminal oxidation reactions of the mitochondrial electron transport chain can break dormancy probably by activating the pentose phosphate pathway (Bewley & Black 1994). In agreement with this hypothesis, our data provide the evidence that temperature can promote dormancy break by decreasing glycolysis and TCA cycle and increasing sucrose metabolism. Moreover, our data also suggest that the regulation of these enzymes could occur at the post- translational level. Further investigation of the PTMs regulation of the glycolysis, TCA, pentose phosphate and sucrose metabolism related enzymes seems to be relevant to address the question of seed dormancy release. This study point out also the importance of the integration of proteomic and enzymatic activity studies. The investigation at the level of the enzyme activity seems to be relevant in the understanding of metabolic regulation in seed dormancy and germination. More importance should be given to such aspects in the future in combination with –omics analysis to decipher signaling networks induced by environmental factors on seed metabolism towards germination.
Aknowledgment
Authors thank Dr Bobby Florea (Laboratories Einsteinweg, Leiden Institute of Chemistry) for providing MV151 probe. The PHD Qiong Xia was funded by China Scholarship Council and this work has been supported by Ecoseed (KBBE project). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
Agrawal G.K. & Thelen J.J. (2006) Large scale identification and quantitative profiling of phosphoproteins expressed during seed filling in oilseed rape. Mol Cell Proteomics, 5, 2044-2059.
48
Arc E., Chibani K., Grappin P., Jullien M., Godin B., Cueff G., Valot B., Balliau T., Job D. & Rajjou L. (2012) Cold stratification and exogenous nitrates entail similar functional proteome adjustments during Arabidopsis seed dormancy release. J Proteome Res, 11, 5418- 5432.
Bazin J., Langlade N., Vincourt P., Arribat S., Balzergue S., El-Maarouf-Bouteau H. & Bailly C. (2011) Targeted mRNA oxidation regulates sunflower seed dormancy alleviation during dry after-ripening. Plant Cell, 23, 2196-2208.
Berger S., Menudier A., Julien R. & Karamanos Y. (1996) Regulation of De-N-Glycosylation Enzymes in Germinating Radish Seeds. Plant Physiol, 112, 259-264.
Bethke P.C., Libourel I.G. & Jones R.L. (2006) Nitric oxide reduces seed dormancy in Arabidopsis. J Exp Bot, 57, 517-526.
Bevan M., Bancroft I., Bent E., Love K., Goodman H., Dean C., Bergkamp R., Dirkse W., Van Staveren M., Stiekema W., Drost L., Ridley P., Hudson S.A., Patel K., Murphy G., Piffanelli P., Wedler H., Wedler E., Wambutt R., Weitzenegger T., Pohl T.M., Terryn N., Gielen J., Villarroel R., De Clerck R., Van Montagu M., Lecharny A., Auborg S., Gy I., Kreis M., Lao N., Kavanagh T., Hempel S., Kotter P., Entian K.D., Rieger M., Schaeffer M., Funk B., Mueller-Auer S., Silvey M., James R., Montfort A., Pons A., Puigdomenech P., Douka A., Voukelatou E., Milioni D., Hatzopoulos P., Piravandi E., Obermaier B., Hilbert H., Dusterhoft A., Moores T., Jones J.D., Eneva T., Palme K., Benes V., Rechman S., Ansorge W., Cooke R., Berger C., Delseny M., Voet M., Volckaert G., Mewes H.W., Klosterman S., Schueller C. & Chalwatzis N. (1998) Analysis of 1.9 Mb of contiguous sequence from chromosome 4 of Arabidopsis thaliana. Nature, 391, 485-488.
Bewley J.D. (1997) Seed Germination and Dormancy. Plant Cell, 9, 1055-1066.
Bewley J.D. & Black M. (1994) Seeds. In: Seeds, pp. 1-33. Springer US.
Biais B., Benard C., Beauvoit B., Colombie S., Prodhomme D., Menard G., Bernillon S., Gehl B., Gautier H., Ballias P., Mazat J.P., Sweetlove L., Genard M. & Gibon Y. (2014) Remarkable reproducibility of enzyme activity profiles in tomato fruits grown under contrasting environments provides a roadmap for studies of fruit metabolism. Plant Physiol, 164, 1204-1221.
49
Burcham P.C. & Kuhan Y.T. (1996) Introduction of carbonyl groups into proteins by the lipid peroxidation product, malondialdehyde. Biochem Biophys Res Commun, 220, 996- 1001.
Cadman C.S., Toorop P.E., Hilhorst H.W. & Finch-Savage W.E. (2006) Gene expression profiles of Arabidopsis Cvi seeds during dormancy cycling indicate a common underlying dormancy control mechanism. Plant J, 46, 805-822.
Carrera E., Holman T., Medhurst A., Dietrich D., Footitt S., Theodoulou F.L. & Holdsworth M.J. (2008) Seed after-ripening is a discrete developmental pathway associated with specific gene networks in Arabidopsis. Plant J, 53, 214-224.
Chibani K., Ali-Rachedi S., Job C., Job D., Jullien M. & Grappin P. (2006) Proteomic analysis of seed dormancy in Arabidopsis. Plant Physiol, 142, 1493-1510.
Corbineau F., Bagniol S. & Come D. (1990) Sunflower (Helianthus-annuus L) seed dormancy and its regulation by ethylene. Israel Journal of Botany, 39, 313-325.
Davies E. & Abe S. (1995) Chapter 15 Methods for Isolation and Analysis of Polyribosomes. In: Methods in Cell Biology (eds D.P.B. David W. Galbraith & J.B. Hans), pp. 209-222. Academic Press.
Fait A., Angelovici R., Less H., Ohad I., Urbanczyk-Wochniak E., Fernie A.R. & Galili G. (2006) Arabidopsis seed development and germination is associated with temporally distinct metabolic switches. Plant Physiol, 142, 839-854.
Finch-Savage W.E., Cadman C.S., Toorop P.E., Lynn J.R. & Hilhorst H.W. (2007) Seed dormancy release in Arabidopsis Cvi by dry after-ripening, low temperature, nitrate and light shows common quantitative patterns of gene expression directed by environmentally specific sensing. Plant J, 51, 60-78.
Finch-Savage W.E. & Leubner-Metzger G. (2006) Seed dormancy and the control of germination. In: New Phytol, pp. 501-523.
Galland M., Huguet R., Arc E., Cueff G., Job D. & Rajjou L. (2014) Dynamic proteomics emphasizes the importance of selective mRNA translation and protein turnover during Arabidopsis seed germination. Mol Cell Proteomics, 13, 252-268.
50
Gallardo K., Job C., Groot S.P., Puype M., Demol H., Vandekerckhove J. & Job D. (2001) Proteomic analysis of arabidopsis seed germination and priming. Plant Physiol, 126, 835-848.
Gallardo K., Job C., Groot S.P., Puype M., Demol H., Vandekerckhove J. & Job D. (2002) Proteomics of Arabidopsis seed germination. A comparative study of wild-type and gibberellin-deficient seeds. Plant Physiol, 129, 823-837.
Gallardo K., Le Signor C., Vandekerckhove J., Thompson R.D. & Burstin J. (2003) Proteomics of Medicago truncatula seed development establishes the time frame of diverse metabolic processes related to reserve accumulation. Plant Physiol, 133, 664-682.
Gao F., Rampitsch C., Chitnis V.R., Humphreys G.D., Jordan M.C. & Ayele B.T. (2013) Integrated analysis of seed proteome and mRNA oxidation reveals distinct post-transcriptional features regulating dormancy in wheat (Triticum aestivum L.). Plant Biotechnol J, 11, 921-932.
Gibon Y., Blaesing O.E., Hannemann J., Carillo P., Hohne M., Hendriks J.H., Palacios N., Cross J., Selbig J. & Stitt M. (2004) A Robot-based platform to measure multiple enzyme activities in Arabidopsis using a set of cycling assays: comparison of changes of enzyme activities and transcript levels during diurnal cycles and in prolonged darkness. Plant Cell, 16, 3304-3325.
Gibon Y., Usadel B., Blaesing O.E., Kamlage B., Hoehne M., Trethewey R. & Stitt M. (2006) Integration of metabolite with transcript and enzyme activity profiling during diurnal cycles in Arabidopsis rosettes. Genome Biol, 7, R76.
Hagege, D., Nouvelot, A., Boucaud, J. & Gaspar, T. (1990) Malondialdehyde titration with thiobarbiturate in plant extracts: Avoidance of pigment interference. Phytochem. Anal, 1, 86–89.
Hajduch M., Hearne L.B., Miernyk J.A., Casteel J.E., Joshi T., Agrawal G.K., Song Z., Zhou M., Xu D. & Thelen J.J. (2010) Systems analysis of seed filling in Arabidopsis: using general linear modeling to assess concordance of transcript and protein expression. Plant Physiol, 152, 2078-2087.
51
Han C., Yang P., Sakata K. & Komatsu S. (2014) Quantitative proteomics reveals the role of protein phosphorylation in rice embryos during early stages of germination. J Proteome Res, 13, 1766-1782.
He D., Wang Q., Li M., Damaris R.N., Yi X., Cheng Z. & Yang P. (2016) Global Proteome Analyses of Lysine Acetylation and Succinylation Reveal the Widespread Involvement of both Modification in Metabolism in the Embryo of Germinating Rice Seed. J Proteome Res, 15, 879-890.
Igawa T., Fujiwara M., Takahashi H., Sawasaki T., Endo Y., Seki M., Shinozaki K., Fukao Y. & Yanagawa Y. (2009) Isolation and identification of ubiquitin-related proteins from Arabidopsis seedlings. J Exp Bot, 60, 3067-3073.
Irar S., Oliveira E., Pages M. & Goday A. (2006) Towards the identification of late-embryogenic- abundant phosphoproteome in Arabidopsis by 2-DE and MS. Proteomics, 6 Suppl 1, S175-185.
Job C., Rajjou L., Lovigny Y., Belghazi M. & Job D. (2005) Patterns of protein oxidation in Arabidopsis seeds and during germination. Plant Physiol, 138, 790-802.
Kim Y.J., Yeu S.Y., Park B.S., Koh H.J., Song J.T. & Seo H.S. (2012) Protein disulfide isomerase- like protein 1-1 controls endosperm development through regulation of the amount and composition of seed proteins in rice. PLoS One, 7, e44493.
Layat E., Leymarie J., El-Maarouf-Bouteau H., Caius J., Langlade N. & Bailly C. (2014) Translatome profiling in dormant and nondormant sunflower (Helianthus annuus) seeds highlights post-transcriptional regulation of germination. New Phytol, 204, 864- 872.
Li L., Hur M., Lee J.Y., Zhou W., Song Z., Ransom N., Demirkale C.Y., Nettleton D., Westgate M., Arendsee Z., Iyer V., Shanks J., Nikolau B. & Wurtele E.S. (2015) A systems biology approach toward understanding seed composition in soybean. BMC Genomics, 16 Suppl 3, S9.
Liu W. & Wang J.Y. (2005) Modifications of protein by polyunsaturated fatty acid ester peroxidation products. Biochim Biophys Acta, 1752, 93-98.
52
Manzano C., Abraham Z., Lopez-Torrejon G. & Del Pozo J.C. (2008) Identification of ubiquitinated proteins in Arabidopsis. Plant Mol Biol, 68, 145-158.
Maor R., Jones A., Nuhse T.S., Studholme D.J., Peck S.C. & Shirasu K. (2007) Multidimensional protein identification technology (MudPIT) analysis of ubiquitinated proteins in plants. Mol Cell Proteomics, 6, 601-610.
Meimoun P., Mordret E., Langlade N.B., Balzergue S., Arribat S., Bailly C. & El-Maarouf- Bouteau H. (2014) Is gene transcription involved in seed dry after-ripening? PLoS One, 9, e86442.
Muntz K., Belozersky M.A., Dunaevsky Y.E., Schlereth A. & Tiedemann J. (2001) Stored proteinases and the initiation of storage protein mobilization in seeds during germination and seedling growth. J Exp Bot, 52, 1741-1752.
Nakabayashi K., Okamoto M., Koshiba T., Kamiya Y. & Nambara E. (2005) Genome-wide profiling of stored mRNA in Arabidopsis thaliana seed germination: epigenetic and genetic regulation of transcription in seed. Plant J, 41, 697-709.
Oracz K., El-Maarouf Bouteau H., Farrant J.M., Cooper K., Belghazi M., Job C., Job D., Corbineau F. & Bailly C. (2007) ROS production and protein oxidation as a novel mechanism for seed dormancy alleviation. Plant J, 50, 452-465.
Oracz K., El-Maarouf-Bouteau H., Bogatek R., Corbineau F. & Bailly C. (2008) Release of sunflower seed dormancy by cyanide: cross-talk with ethylene signalling pathway. J Exp Bot, 59, 2241-2251.
Oracz K., El-Maarouf-Bouteau H., Kranner I., Bogatek R., Corbineau F. & Bailly C. (2009) The mechanisms involved in seed dormancy alleviation by hydrogen cyanide unravel the role of reactive oxygen species as key factors of cellular signaling during germination. Plant Physiol, 150, 494-505.
Osorio S., Alba R., Damasceno C.M., Lopez-Casado G., Lohse M., Zanor M.I., Tohge T., Usadel B., Rose J.K., Fei Z., Giovannoni J.J. & Fernie A.R. (2011) Systems biology of tomato fruit development: combined transcript, protein, and metabolite analysis of tomato transcription factor (nor, rin) and ethylene receptor (Nr) mutants reveals novel regulatory interactions. Plant Physiol, 157, 405-425.
53
Rajjou L., Gallardo K., Debeaujon I., Vandekerckhove J., Job C. & Job D. (2004) The effect of alpha-amanitin on the Arabidopsis seed proteome highlights the distinct roles of stored and neosynthesized mRNAs during germination. Plant Physiol, 134, 1598-1613.
Roberts E.H. (1988) Temperature and seed germination. Symp Soc Exp Biol, 42, 109-132.
Sano N., Permana H., Kumada R., Shinozaki Y., Tanabata T., Yamada T., Hirasawa T. & Kanekatsu M. (2012) Proteomic analysis of embryonic proteins synthesized from long- lived mRNAs during germination of rice seeds. Plant Cell Physiol, 53, 687-698.
Saracco S.A., Hansson M., Scalf M., Walker J.M., Smith L.M. & Vierstra R.D. (2009) Tandem affinity purification and mass spectrometric analysis of ubiquitylated proteins in Arabidopsis. Plant J, 59, 344-358.
Shutov A.D. & Vaintraub I.A. (1987) Degradation of storage proteins in germinating-seeds. Phytochemistry, 26, 1557-1566.
Steinhauser M.C., Steinhauser D., Koehl K., Carrari F., Gibon Y., Fernie A.R. & Stitt M. (2010) Enzyme activity profiles during fruit development in tomato cultivars and Solanum pennellii. Plant Physiol, 153, 80-98.
Verdoes M., Florea B.I., Menendez-Benito V., Maynard C.J., Witte M.D., van der Linden W.A., van den Nieuwendijk A.M., Hofmann T., Berkers C.R., van Leeuwen F.W., Groothuis T.A., Leeuwenburgh M.A., Ovaa H., Neefjes J.J., Filippov D.V., van der Marel G.A., Dantuma N.P. & Overkleeft H.S. (2006) A fluorescent broad-spectrum proteasome inhibitor for labeling proteasomes in vitro and in vivo. Chem Biol, 13, 1217-1226.
Wang W.Q., Liu S.J., Song S.Q. & Moller I.M. (2015) Proteomics of seed development, desiccation tolerance, germination and vigor. Plant Physiol Biochem, 86, 1-15.
Wehr N.B. & Levine R.L. (2013) Quantification of protein carbonylation. Methods Mol Biol, 965, 265-281.
Xu C. & Huang B. (2008) Root proteomic responses to heat stress in two Agrostis grass species contrasting in heat tolerance. J Exp Bot, 59, 4183-4194.
Zhao M.G., Tian Q.Y. & Zhang W.H. (2007) Nitric oxide synthase-dependent nitric oxide production is associated with salt tolerance in Arabidopsis. Plant Physiol, 144, 206-217.
54
Table 1. Water content (% of DW) in dormant embryo axes during imbibition at 10°C and 20°C. Data are means of five replicates ± SD
Incubate Imbibition time (h) temperature 0 6 15 24
10°C 5.86 ± 1.9 58.7 ± 2.6 68.1 ± 2.2 69 ± 5.2
20°C 5.86 ± 1.9 62 ± 5.89 70 ± 4.71 89,5 ± 12.68
Figure Legends
Figure 1. Germination curves of sunflower seeds under different temperatures. Dormant embryos were imbibed with distilled water at 10°C and 20°C in darkness, an embryo was considered as germinated when the radicle had elongated to 2 to 3 mm. Data are means of three replicates ± SD.
Figure 2. Proteome analysis for dormant seeds imbibed at 10°C and 20°C. The position of the spots which showed more abundance on 2D gels of dormant seeds at 10°C (red zones) or 20°C (green zones) is represented for 6 (a), 15 (b) and 24 h (c). Clusters of protein accumulation patterns established by applying the correlation analysis module of SameSpot software for spot selection for each time point. (d) Represents the general trend of all the 170 differentially abundant protein spots. Each line corresponds to a spot and each point corresponds to the spot normalized volume of one biological replicate in the given condition.
Figure 3. Analysis of polysome and proteasome profiles at 10°C and 20°C. (a) and (b) Comparison of the polysome profiles obtained from seeds imbibed after 15 and 24 h, respectively, dashed line represents D at 10°C and continuous line D at 20°C; (c) Quantification of activity-based protein profiling (ABPP) at 6, 15 and 24 h imbibition time points; (d) Change in protein carbonylation at 6, 15 and 24 h imbibition time points. Data are means ± SD from three independent biological replicates; (e) MDA quantification in D at 10 and 20°C during imbibition for 6, 15 and 24 h, Data are means ± SD from four independent biological replicates.
55
Figure 4. Ontological classification of protein abundance changes at 20°C. More or less- abundant proteins at 20°C compared with 10°C at 6, 15 and 24 h of imbibition. Proteins were classified according to the classification established by Bevan et al. (1998).
Figure 5. Specific activities of 10 enzymes of central energy/metabolism. Activities are expressed as nmoles per minute per mg of total proteins ± SD (n = 9). UGPase, UDP-glucose pyrophosphorylase; PGM, Phosphoglucomutase; FBP-Aldolase, Fructose-bisphosphate aldolase; Enolase; NAD-MDH, NAD-malate dehydrogenase; Aconitase; NAD-GAPDH, NAD- glyceraldehyde 3-phosphate dehydrogenase; NADP-GAPDH, NADP-glyceraldehyde 3- phosphate dehydrogenase; PGK, phosphoglycerate kinase; AlaAT, alanine aminotransferase; ADH, alcohol dehydrogenase.
Figure 6, Activity change of central metabolism during germination sensu stricto. The evolution of enzyme activities in sunflower dormant seeds during temperature induced germination (20°C) was represented by a grayscale, black being the highest activity. UGPase, UDP-glucose pyrophosphorylase; PGM, Phosphoglucomutase; FBP-Aldolase, Fructose- bisphosphate aldolase; Enolase; MDH, malate dehydrogenase; Aconitase; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; PGK, phosphoglycerate kinase.
56
Figure 1.
Figure 2.
57
Figure 3.
Figure 4.
58
Figure 5.
Figure 6.
59
Supporting Information
Table S1: Protein spots displaying change in abundance induced by temperature on dormant seeds. Spot n°: spot number on proteome reference maps. Protein name: identification by BLASTP. MW Th (kDa): theoretical molecular weight; MW Exp (kDa): experimental molecular weight, pI Th: theoretical isoelectric point, pI Exp: experimental isoelectric point, ANOVA p-values obtained with the Progenesis SameSpot software (NonLinear
Dynamics) when comparing the indicated groups of biological replicates.
Protein Spots Displaying an Increased Abundance Following Temperature-induced Dormancy Release
Spot MW(kDa)&pI Anova Time Accession Protein name n° MWTh MWExp pITh pIExp (p) Stress response and detoxification-related proteins 3766 P30693 Heat shock protein 17.6 kDa 17,56 18,60 5,25 4,9 3,3E-02 Metabolism 2573 Q84VQ7 Alpha-galactosidase 47,12 44,60 5,9 5,9 6,0E-03 2941 Q8W3X8 RmlC-like cupins superfamily protein 81,59 31,50 5,02 4,18 3,8E-02 Glutamine amidotransferase-like superfamily e100 A7P1Y5 46,99 47,10 7,95 5,3 3,1E-02 protein Energy Pyruvate, phosphate dikinase, chloroplast 6h 760 Q42736 104,6 98,50 5,94 5,1 4,5E-02 precursor e153 Q6RUQ2 Glyceraldehyde 3-phosphate dehydrogenase 36,62 43,20 7,06 6,51 3,3E-02 1229 A1Y2J9 Phosphoglycerate kinase 42,3 93,00 5,82 5,57 1,0E-03 NADH-ubiquinone oxidoreductase 75 kDa 1194 Q43644 79,97 90,80 5,87 5,63 2,0E-03 subunit, mitochondrial precursor Transporters e734 P18260 F1 ATPase [Helianthus annuus] 55,49 61,80 6,02 5,69 4,8E-02 miscellaneous e268 A7Q9J9 Protein of unknown function (DUF1264) 27,29 30,80 6,7 5,6 4,7E-02
metabolism 1241 A8QKE9 Phenylalanine ammonia-lyase 77,77 77,90 6,07 5,79 7,0E-03 energy Pyruvate, phosphate dikinase, chloroplast 15h e652 Q42736 104,6 53,00 5,94 4,74 3,0E-03 precursor mRNA metabolism 1604 Q9M6E6 Poly(A)-binding protein 71,16 64,00 7,61 6,08 2,6E-02 protein synthesis
60
LOS1 | Ribosomal protein S5/Elongation 1030 A7PWR8 93,89 93,90 6,16 5,9 4,5E-02 factor G/III/V family protein Cell structure and growth 2227 A0FH76 EBP1 42,82 43,10 6,26 5,98 6,0E-03 Proteolysis 1985 Q9AYS9 RPT5A, Regulatory Particle triple-A ATPase 5A 47,48 58,80 4,91 4,75 2,2E-02 2004 Q9AYS9 RPT5A, Regulatory Particle triple-A ATPase 5A 47,48 58,70 4,91 4,81 7,0E-03 Protein folding and stability FKBP-type peptidyl-prolyl cis-trans isomerase 1315 A7R822 62,91 81,50 5,23 4,85 5,0E-03 family protein
Stress response and detoxification-related proteins Aluminium induced protein with YGL and 3134 A7P1J2 27,62 30,40 5,65 5,42 9,0E-03 LRDR motifs metabolism 1518 Q9LM03 Methionine synthase 84,67 68,00 5,93 5,66 7,00E-02 energy 1334 Q9M6B3 Malate dehydrogenase 36,88 70,00 8,79 5,94 1,6E-02 992 A7P0Q1 Aconitase 98,15 93,80 6,36 5,79 3,4E-02 mRNA metabolism 1476 Q9AT32 Poly(A)-binding protein 71,93 70,00 6,94 6,45 3,1E-02 protein synthesis 24h 3716 A7P6L8 PGY2 | Ribosomal protein L6 family 21,97 20,90 10,2 9,5 6,0E-03 Transporters KAB1, KV-BETA1 | potassium channel beta 2778 A7NXT0 36,54 41,90 6,97 6,04 2,1E-02 subunit 1 Cell structure and growth 889 A7QVD5 SKU5 | Cupredoxin superfamily protein 65,64 95,50 9,46 6,78 4,0E-02 Seed storage protein 4957 Q9AUD0 7S globulin 67,07 16,60 7,55 8,05 2,0E-03 3403 Q9SE84 Legumin-like protein 52,74 23,20 6,8 5,37 5,8E-04 3009 Q9SE84 Legumin-like protein 52,74 36,00 6,8 5,86 3,0E-03 3134 Q2XSW6 11S globulin isoform 4 52,68 30,40 8.20 5,42 9,0E-03 Protein Spots Displaying an decreased Abundance Following Temperature-induced Dormancy Release
Spot MW(kDa)&pI Anova Time Accession Protein name n° MWTh MWExp pITh pIExp (p) Stress response and detoxification-related proteins DSI-1VOC - dessication-induced 1VOC 6h 4366 A7NZ40 15,39 17,20 6,68 5,71 1,9E-02 superfamily protein Metabolism
61
Adenine nucleotide alpha hydrolases-like e35 A7Q8P6 17,78 18,30 6,93 5,62 2,1E-02 superfamily protein Protein synthesis 3899 Q9SC12 Eukaryotic translation initiation factor 5A 17,27 19,60 5,6 5,34 4,1E-02 Seed storage protein 11S globulin seed storage protein G3 e15 P19084 55,69 30,50 8,22 5,94 9,0E-03 precursor (Helianthinin-G3)
Stress response and detoxification-related proteins NAD(P)-linked oxidoreductase superfamily e664 A7QFG4 39,65 41,80 7,62 5,55 1,2E-02 protein NAD(P)-linked oxidoreductase superfamily 2715 A7QFG4 39,65 41,50 7,62 5,68 5,3E-02 protein 3852 A3FPF4 Thioredoxin-dependent peroxidase 17,51 18,20 5,34 5,1 2,6E-02 Metabolism Adenine nucleotide alpha hydrolases-like 3912 A7P396 17,33 17,80 5,71 5 4,0E-03 superfamily 2493 Q8W1A0 Cysteine synthase 34,27 43,50 5.69 5,02 4,0E-03 Glutamine--fructose-6-phosphate e42 A2C554 70,11 63,50 6,44 4,78 4,6E-02 aminotransferase [isomerizing] e648b Q8W3X8 RmlC-like cupins superfamily protein 81,59 25,50 5,02 5,58 3,0E-03 e648c Q8W3X8 RmlC-like cupins superfamily protein 81,59 24,00 5,02 5,58 3,0E-03 Proteolysis 2700 Q9SSZ1 Aspartic proteinase 55,33 40,80 5,78 5,32 3,0E-03 e345 A7PRY6 alpha/beta-Hydrolases superfamily protein 37,2 39,80 5,41 5,52 1,3E-02
15h Protein folding and stability PIMT1 | protein-l-isoaspartate 3273 Q42539 24,61 28,50 5.47 5,77 1,1E-02 methyltransferase 1 2138 A9CPA7 Protein disulfide isomerase family 47,65 57,50 5,41 5,41 3,1E-02 Cell structure and growth e36 Q5KTS8 ECP31 protein 26,18 57,50 4,79 4,6 1,5E-02 Seed storage protein e664 Q9SE84 Legumin-like protein 52,74 41,80 6,8 5,55 1,2E-02 e648a Q2XSW6 11S globulin isoform 4 52,68 27,00 8,2 5,58 3,0E-03 e648b Q9SE84 Legumin-like protein 52,74 25,50 6,8 5,58 3,0E-03 e354a Q2XSW6 Legumin-like protein 52,74 26,00 6,8 5,86 8,0E-03 e354b Q2XSW6 11S globulin isoform 4 52,68 26,00 8,2 5,88 8,0E-03 3342 Q9SE84 Legumin-like protein 52,74 25,50 6,8 5,5 2,3E-02 e667 Q9SE84 Legumin-like protein 52,74 41,50 6,8 5,57 6,6E-04 e369a Q9SE84 Legumin-like protein 52,74 20,60 6,8 5,49 2,0E-02 e369b P19084 11S globulin seed storage protein G3 55,69 20,30 8,22 5,49 2,0E-02 3545 P19084 11S globulin seed storage protein G3 55,69 19,60 8,22 5,25 3,2E-02
62
3779 P19084 11S globulin seed storage protein G3 55,69 19,60 5,8 8.22 2,8E-02 e340 P19084 11S globulin seed storage protein G3 55,69 18,90 8,22 5,33 3,1E-02 2715 Q9SE84 Legumin-like protein 52,74 41,50 6,8 5,68 5,3E-02 e358 A1E0W1 7S globulin 56,73 41,80 8,22 5 3,7E-02
Stress response and detoxification-related proteins 3355 Q15CJ5 Glutathione peroxidase 21,98 26,00 6,58 6,13 2,0E-03 Metabolism Gamma aminobutyrate transaminase 1, e603 Q84P54 56,75 60,20 7,65 5,86 2,2E-04 mitochondrial 1802a A7P6B0 ALAAT2 | alanine aminotransferase 2 61,03 61,50 6,88 5,22 8,4E-04 2171 A7QV99 Glycine cleavage T-protein family 43,53 55,00 6,69 5,25 1,0E-02 1802b Q19TV8 UDP-glucose pyrophosphorylase 52,06 61,00 6,69 5,22 8,4E-04 e292 Q1AFF6 Aldehyde dehydrogenase 58,53 61,50 8,04 5,56 1,0E-03 e663 P25141 Alcohol dehydrogenase 41,57 46,00 6,19 5,62 1,0E-03 Energy e831 Q2WFK8 Fructose-bisphosphate aldolase 38,16 44,00 6,47 5,96 3,0E-03 2691 Q43130 Enolase 48,35 43,90 5,62 6,06 8,0E-03 1802a Q43130 Enolase 48,35 61,50 5,62 5,22 8,4E-04 1802b Q43130 Enolase 48,35 61,00 5,62 5,22 8,4E-04 2701 Q6RUQ2 Glyceraldehyde 3-phosphate dehydrogenase 36,62 43,50 7,06 6,4 4,0E-03 2382 A1Y2J9 Phosphoglycerate kinase 42,3 48,00 5,82 5,57 5,4E-04 1692 Q9M4G4 Phosphoglucomutase, cytoplasmic 63,47 64,50 6,01 5,6 8,0E-03 24h 6-phosphogluconate dehydrogenase, e76 O22111 56,37 56,50 5,55 5,55 2,0E-03 decarboxylating 1917 A7NVV2 mtLPD2 | lipoamide dehydrogenase 2 53,99 62,00 7,04 5,95 8,0E-03 2332 Q2WFI2 Isocitrate dehydrogenase [NADP] 46,63 50,80 6.35 5,7 3,0E-03 Protein folding and stability 1348 A7QS95 MTHSC70-2, HSC70-5 | mitochondrial HSC70 72,99 70,00 5,45 5,2 8,0E-03 1740 A7PW56 TCP-1/cpn60 chaperonin family protein 58,94 63,50 5,01 5,25 2,0E-03 Protein synthesis e75 Q9FUM1 Elongation factor 1-gamma 47,99 54,00 6,11 5,53 2,0E-03 e215 Q9FUM1 Elongation factor 1-gamma 47,99 55,00 6,11 5,62 5,9E-05 Proteolysis 1962 Q9XH61 Serine carboxypeptidase 55,97 58,00 4,98 4,47 2,0E-03 e683 Q9XH61 Serine carboxypeptidase 55,97 56,00 4,98 4,6 3,0E-03 ATP-dependent Clp protease ATP-binding e266 P31542 102,2 31,20 5,86 5,59 7,0E-03 subunit clpA homolog CD4B, chloroplastic 3111 Q9SSZ1 Aspartic proteinase 55,33 32,50 5,78 5,75 3,0E-03 e296 Q9SSZ1 Aspartic proteinase 55,33 33,80 5,78 5,59 6,0E-03 e633 Q9SSZ1 Aspartic proteinase 55,33 40,80 5,78 4,48 7,0E-03
63
e566 Q38M52 Proteasome subunit alpha type 25,67 30,50 5,36 5,02 1,0E-02 1091 A7NTQ5 alpha/beta-Hydrolases superfamily protein 81,3 90,00 5,51 5,16 3,0E-03 Cell structure and growth e536 Q7XZJ2 Actin 41,71 52,00 5,31 5,16 5,0E-03 Seed storage protein e624 Q9SE84 Legumin-like protein 52,74 23,80 6,8 5,67 1,1E-02 e555 Q9SE84 Legumin-like protein 52,74 25,80 6,8 5,66 5,0E-03 2726 Q2XSW6 11S globulin isoform 4 52,68 37,00 8,2 4,9 3,0E-03 2749 Q2XSW6 11S globulin isoform 4 52,68 36,00 8,2 5,02 9,0E-03 2332 Q9AUD0 7S globulin 67,07 50,80 7,55 5,7 3,0E-03 2221 Q9AUD0 7S globulin 67,07 55,10 7,55 5,7 6,6E-04 2082 Q9AUD0 7S globulin 67,07 60,20 7,55 5,92 4,0E-03 845 Q9AUD0 7S globulin 67,07 96,00 7,55 5,42 4,0E-03 e603 Q9AUD0 7S globulin 67,07 60,20 7,55 5,86 2,2E-04 e215 Q9AUD0 7S globulin 67,07 55,00 7,55 5,62 5,9E-05 e596 Q9AUD0 7S globulin 67,07 60,20 7,55 5,72 4,1E-04 e76 Q9AUD0 7S globulin 67,07 56,50 7,55 5,55 4,1E-04 e633 A1E0W1 7S globulin 67,07 40,80 7,55 4,48 3,0E-03 miscellaneous e270 A7Q9J9 Protein of unknown function (DUF1264) 27,29 30,00 6,7 5,6 7,0E-03
64
Chapter 3 Regulation of dormancy in sunflower by temperature and after-ripening: effects on abscisic acid, gibberellins and ethylene
Qiong Xia 1, Patrice Meimoun 1, Ayako, Nambara 2, Christophe Bailly 1, Eiji Nambara 2, Hayat El-Maarouf- Bouteau 1*
1 Sorbonne Universités, UPMC Univ Paris 06, CNRS, Biologie du développement Paris Seine - Institut de Biologie Paris Seine (LBD - IBPS), 75005 Paris, France.
2 Department of Cell and Systems Biology, University of Toronto, Toronto, ON M5S 3B2, Canada.
*Corresponding author: El-Maarouf- Bouteau H ([email protected])
65
Abstract
Temperature is the primary factor that affects seed dormancy and germination. However, the molecular mechanism that underlies its effect on dormancy alleviation remained largely unknown. In this study, we investigate hormone involvement in temperature induced dormancy alleviation. Hormonal response to temperature was compared to that of after- ripening. Dormant (D) sunflower seeds cannot germinate at 10°C but fully germinate at 20°C. After-ripened seeds become non-dormant (ND), i.e. able to germinate at 10°C. We showed that after-ripening is mediated by a decline in both ABA content and sensitivity while ABA content is increased in D seeds treated at 10 or 20°C, suggesting that ABA decrease is not a prerequisite for temperature induced dormancy alleviation. GA and ethylene contents were in accordance with germination potential of the three conditions (D 10°C, D 20°C and ND 10°C). Transcripts analysis of the key genes involved in ABA metabolism and signaling and GA and ethylene metabolism revealed similar expression regulation in germinating seeds (D 20°C and ND 10°C), at the exception of some genes involved in ABA synthesis. However, the most important hormone regulation was found in their localization which was different between non-germinating seeds (D 10°C) and germinating ones (D 20°C and ND 10°C), at level of the seed compartments but also seed cell. Our results reveal the importance of hormone trafficking in the cell and their regulation in specialized tissue such as the meristem in dormancy alleviation and germination.
Key words: ABA, After-Ripening, Ethylene, GA, Temperature
66
Introduction
Seed dormancy and germination are complex adaptive traits of higher plants, it is determined by a combination of the degree of dormancy and environmental factors (temperature, light, and oxygen availability) (Bewley 1997; Koornneef et al., 2002). Temperature is a primary factor regulating seed dormancy and germination. At harvest, dry seeds are dormant and may experience gradual dormancy loss through a dry after-ripening. After-ripening is a time and environment regulated process occurring in the dry seed, as the process by which these dormant seeds become non-dormant, it determines the germination potential of seeds (Probert, 2000; Finch-Savage and Leubner-Metzger, 2006). As dormancy reduces the range of external conditions under which germination can occur, removal of dormancy by after- ripening enlarges the temperature range under which seeds can germinate. The freshly harvested mature seeds of sunflower (Helianthus annuus L.) are regards as being deeply dormant because they germinate poorly at 10°C or lower temperature, but they germinate well at higher temperature, the thermal optimum being around 25°C. A few months of after- ripening in dry storage breaks their dormancy, seeds become able to germinate at temperature ranging from 20 - 30 to 5 - 40°C, and their germination rate is enhanced at all temperatures (Corbineau et al., 1990).
The mechanism of endogenous plant hormonal regulation is likely to be highly conserved in seed dormancy and germination process. Many of the environment factor controlled responses are mediated via the regulation of hormonal levels and/or signal transduction (Heggie and Halliday, 2005). Genetic and physiological studies have shown the important roles of the plant hormones abscisic acid (ABA) and gibberellins (GAs), ABA is a positive regulator of dormancy while GAs release dormancy and promote the completion of germination by counteracting the effects of ABA (Koornneef et al., 2002). Alterations in the ABA biosynthetic pathway can greatly influence seed dormancy and germination (Holdsworth et al. 2008; Martinez-Andujar et al. 2011; Nambara et al. 2010), several key genes/enzymes have been characterized in its biosynthesis and catabolism (Nambara et al. 2010). In Arabidopsis, mutations of ABA biosynthetic genes, including ZEP/ABA1 (Koornneef et al. 1982), NCEDs (Frey et al. 2012; Lefebvre et al. 2006), ABA2/GIN1/SDR1 (Gonzalez-Guzman et al. 2002; Leon-
67
Kloosterziel et al. 1996), result in reduced dormancy, whereas overexpression of ABA biosynthetic enzymes enhances dormancy (Lin et al. 2007; Martinez-Andujar et al. 2011). Mutant of the CYP707A2, the gene that encodes the enzyme catalyzing ABA catabolism, presents a strong seed dormancy phenotype (Kushiro et al. 2004; Okamoto et al. 2006). By contrast, loss of function in gibberellic acid (GA) biosynthetic genes such as ent-Copalyl diphosphate synthase (CPS/GA1), ent-kaurene synthase (KS/GA2), ent-kaurene oxidase (KO/GA3) and gibberellin-3-oxidases (GA3ox1 and GA3ox2) are caused to fail germination (Koornneef and van der Veen 1980; Mitchum et al. 2006; Yamauchi et al. 2004). Moreover, the signaling pathways of ABA and GA are interconnected at several levels. A basic domain/leucine zipper transcription factor ABI5 (ABA-INSENSITIVE 5) acts as key regulator in ABA signaling, while DELLA protein RGL2 (RGA-LIKE2), which repress germination, is considered to be the main negative regulating factor of GA signaling (Lee et al., 2002; Tyler et al., 2004). ABA induces ABI5 expression to repress germination, and GA promotes seed germination by enhancing the proteasome-mediated destruction of RGL2. Experimental evidence has provided that decrease in endogenous GA content leads to an increase in ABA synthesis through a stabilized RGL2, meanwhile, the transcript and protein levels of both of ABI5 and RGL2 are induced by an increased endogenous ABA content. The low expression of ABI5 in sleepy1 mutant counteracting the effect of the overaccumulated RGL2 to induce seed germination, which given a notion that ABI5 acts as the final common repressor of germination in response to changes in ABA and GA levels (Piskurewicz et al., 2008). In addition, other hormones such as ethylene and brassinosteroids, which both influence the ABA–GA balance by counteracting ABA effects, promote germination (Kucera et al., 2005). In sunflower, ethylene strongly stimulates the germination of dormant seeds while GA and cold stratification have less effect on the breaking of sunflower seed dormancy, meanwhile, ABA were also found to inhibit germination of seeds in this species (Corbineau et al., 1988, 1990).
There is evidence linking hormonal changes with dormancy breaking. A decline in ABA content, decreased sensitivity to ABA and increased sensitivity to GA are involved in the after- ripening mediated transition from the dormant to the non-dormant state of many species (Hilhorst et al., 1995; Li and Foley, 1997; Debeaujon and Koornneef, 2000; Grappin et al., 2000). ABA content decreases during after-ripening in dormant seeds of tomato (Groot and Karssen, 1992) and Nicotiana plumbaginifolia (Grappin et al., 2000). Exogenous GA supply can
68
substitute for the after-ripening requirement in many species, and after-ripening mediated dormancy release is correlated with a GA requirement (Jana et al., 1979; Leubner-Metzger, 2002). Otherwise, ethylene and its immediate precursor (1-aminocyclopropane-1-carboxylic acid, (ACC)) completely break seed dormancy and improve seed germination (Corbineau et al., 1990).
The links between temperature and hormones also have been demonstrated. Plant hormones, particularly ABA, GA and ethylene, are known to be involved in regulating thermoinhibition of germination (Huo and Bradford, 2015). A decrease in ABA content is suppressed and de novo ABA biosynthesis is required during lettuce (Lactuca sativa) seeds imbibition at supraoptimal temperature (Yoshioka et al., 1998), but this thermoinhibition could be alleviated by application of ABA biosynthesis inhibitor like fluridone (Argyris et al. 2008; Gonai et al. 2004; Toh et al. 2008). Since GA is generally required for seed germination, alleviation of thermoinhibition by exogenous GA has been reported on several plant species (Madakadze et al., 1993; Dutta and Bradford, 1994; Gonai et al., 2004). In Arabidopsis, the expression of GA biosynthetic genes GA3ox and GA20ox can be suppressed by thermoinhibition while they were induced by lower temperatures (Toh et al., 2008; Yamauchi et al., 2004). On the other hand, ethylene promotes seed germination in many species (Arc et al., 2013; Corbineau et al., 2014), it is also known that application of ethylene or ACC, the ethylene precursor, can relieve the thermoinhibition in lettuce, chickpea (Cicer arietinum), sunflower and tomato seeds (Corbineau et al., 1988; Dutta and Bradford, 1994; Gallardo et al., 1991; Kepczynska et al., 2006). All of these reports suggest that ABA, GA and ethylene are involved in the regulation of seed germination by temperature, but how these hormones mediate the optimal temperature signal during dormancy release remains unknown.
Although the phytohormones involved in dormancy and germination have been largely identified, the questions about their mechanisms of interaction by external factors and how dormancy is broken under different condition, are more elusive. This paper describes the effects of ABA, GA and ethylene during seed dormancy release in sunflower by temperature and after-ripening. The effect of temperature was investigated in dormant (D) seeds imbibed at 10°C (D 10°C) (suboptimal temperature for germination) and D seeds imbibed at 20°C (D 20°C) (temperature permitting the germination of dormant seeds). After-ripening has been applied by dry storage at 20°C during 3 months of D seeds to become non dormant (ND), able
69
to germinate at 10°C (ND 10°C). Dormancy loss by an optimal imbibition temperature and after-ripening were studied, during the germination sensu stricto phase, at the level of hormone regulation, by hormone quantification, gene expression analysis of key actors in hormone metabolism and signaling and spatial localization of hormone action in sunflower embryos.
Materials and methods
Plant material
Sunflower (Helianthus annuus cv LG5662) seeds were produced in open fields in the south of France by Valgrain (26740 Les Tourrettes, France) in 2013 and 2014. Dormant seeds were stored at −20°C until use to maintain their dormancy after harvest, and non-dormant seeds were obtained by release dormancy at 20°C and 75% relative humidity for 3 months.
Germination tests and hormones treatment
Germination tests and hormone treatments were performed with naked seeds (seeds without pericarp) imbibed on a layer of cotton wool moistened with deionized water or with various solutions (100 µM ABA, 10 µM fluridone, 100 µM GA3, 100 µM PAC, 1 mM AOA, 1 mM AIB) in 9 cm Petri dishes under darkness at 10°C or 20°C. Treatment with ethylene was carried out by placing Petri dishes in a tightly closed glass jar continuously in the presence of 100 ppm gaseous ethylene. An embryo was considered as germinated when the radicle had elongated to 2 to 3 mm. The results presented were obtained with 30 seeds per dish and three replicates.
Quantification of GA and ABA
GA and ABA were extracted from 15 embryonic axes of imbibed seeds (100 mg DW). The purification and measurement were performed by GC-MS based analysis as described in Okamoto et al. (2009). Results are expressed as ng /g DW and represent the mean of three replicates ± SD.
70
Quantification of ethylene
To measure the ethylene production, 5 naked seeds were placed in 10 ml flasks containing 200 μl ACC solution (1 mM). Flasks were tightly closed with serum caps and placed at 10°C and 20 °C respectively. After 3 or 6 h, 1 ml gas sample was taken from each flask and injected into a gas chromatograph (Hewlett Packard 5890 series II) equipped with a flame ionization detector and an activated alumina column for ethylene determination. Results are the means of five measurements ± SD and are expressed as nl ethylene h−1 per seed.
Total RNA extraction
Total RNA was extracted by an improved procedure according to Onate-Sanchez and Vicente- Carbajosa (2008). Fifteen isolated embryonic axes were ground to a fine powder in liquid nitrogen, and then transferred to a cooled 2 ml tube which contain 550 µl of extraction buffer (0.4 M LiCl, 0.2 M Tris pH 8, 25 mM EDTA, 1% (v/v) SDS) and 550 µl of chloroform. Suspensions was vortexed for 2 min and centrifuged for 5 min at 13 000 rpm. The supernatant was transferred to a new 2 ml tube and 500 µl of phenol were added. After using vortex thoroughly, 200 µl of chloroform/ CIA 24:1 was added and extract was centrifuged for 5 min at 13000 rpm. Then 1 volume of 4 M LiCl was added in the supernatant and mixed. After precipitation at 4°C for overnight and centrifugation for 45 min at 13000 rpm, the pellet was dissolved in 250 µl Milli-Q water and precipitated once again with 25 µl 2.5 M NaAc and 500 µl ethanol. After washing the pellet with 70% EtOH three times, RNA was resuspended in 100µl Milli-Q water after air-dry.
Design of primers and real-time qRT-PCR analysis
The oligonucleotide primer sets used for real-time qPCR analysis were designed on the basis of sunflower gene sequences (https://www.heliagene.org). ACO primers were tacked from Oracz et al. (2008).
Two µg total RNA was reverse-transcribed and amplified, and the relative expression was calculated with three reference genes as described by Layat et al. (2014). All the genes used and the related heliagene accession number, amplified probe length and primer sequences are listed in Supplemental Table S1.
71
Immunolocalization of ABI5, RGL2, ACO and ABA
For immunolocalization studies, sections at a thickness of 25 μm were obtained by using vibratome (LEICA, VT 1200S) from 15 h imbibed seeds, and then were fixed overnight at 8% (w/v) paraformaldehyde in 0.1 M PBS (pH 7.4). To allow fixation of ABA in situ (De Diego et al., 2013), all sections were fixed for 24 h with 3% (w/v) paraformaldehyde in 4% (w/v) 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (Sigma-Aldrich Co., St Louis, MO, USA) diluted in PBS at 4 °C. After fixation step, the sections were transferred to the normal goat serum diluted to 1:30 in PBST (PBS containing 0.1% (v/v) Tween 20) for 20 min. They were washed in PBST and incubated overnight at 4 °C with the 1:200 dilution primary antibodies (anti-ABI5 provided by Dr Luis Lopez-Molina, Depart. of Plant Biology, University of Geneva, Switzerland; anti-RGL2 was supplied by Dr Eiji Nambara, Department of Cell and Systems Biology, University of Toronto, Canada; and anti-ACO was obtained from Dr Chao Wen S, USDA-ARS, Fargo, ND, 58102, USA; Anti-ABA was purchased from Agrisera AB (AS09 446)). After washing three times in PBST for 10 min, sections were incubated with Alexa 488 conjugated anti-rabbit secondary antibody (Molecular Probes, Invitrogen, Germany) for 1 h in darkness. Then, the sections were washed three times for 10 min in PBST and were observed with a fluorescence Zeiss microscope (excitation filter 450–490 nm). Nucleus were visualized with DAPI co-staining.
Results
Seed responsiveness to exogenous GA, ABA, Ethylene and their inhibitors upon dormancy release by temperature or after-ripening treatments
We analyzed germination responses upon treatment with exogenous GA and its biosynthesis inhibitor paclobutrazol (PAC). As showed in Figure 1, dormant seeds are sensitive to GA as germination percentage increased from 10 to 50 % at 10°C. At 20°C, GA effect appears less important, probably due to the fact that dormant seeds germinate at higher percentage. PAC has a negative effect on the germination of D seeds at 20°C but not on ND ones at 10°C (Fig. 1b, c). Figure 1 showed also that dormant seeds are sensitive to exogenous ABA as germination percentage at 10 and 20°C was reduced to 0. ND seeds seem to be less sensitive as ABA reduced germination percentage only by 40% (Fig. 1). The same sensitivity has been observed with fluridone treatment (Fig. 1). The effects of ethylene and the inhibitors of its
72
biosynthesis have also been analyzed. Ethylene induces a complete dormancy release (Fig. 1a, b). It is worth to note that the ACC oxidase (ACO) inhibitor, α-aminoisobutyric acid (AIB), strongly prevents seed germination at 20°C but the ACC synthase activity inhibitor amino- oxyacetic acid (AOA) was less efficient (Fig. 1b).
Temperature and after-ripening effects on hormones contents
To explore changes in endogenous hormones during temperature-induced dormancy alleviation and after-ripening, ABA, GA and ethylene were quantified in axes isolated from D 10°C, ND 10°C and D 20°C. Five imbibition time points were chosen for quantification, 0, 3, 6, 15 and 24 h (the latter imbibition time was not analyzed for D 20°C as 30% of the seed population germinate (Fig. 1b). GA1 is the main active GA component in sunflower embryo axes, it was accumulated in D seeds since 6 h but increased more significantly at 15 and 24 h
(phase II, Fig. 2a). GA1 content was higher in germinating seeds, at 15 h for D 20°C and at 24 h for ND 10°C (Fig. 2a). GA20, the GA1 precursor, did not show significant differences between germinating and non-germinating seeds but its content decreased at 24 h of imbibition (Fig. 2b). ABA content was about 7.2 to 7.5 ng g−1 DW in the embryos of dry seeds, and there was no significant change during the phase I (3 and 6 h). ABA content increased at 24 h for D 10°C while it decreased for non-dormant seeds (Fig. 2c). Surprisingly, ABA content increased markedly at 15 h of imbibition for D 20°C even the seeds can germinate. Ethylene measurement showed a slight increase in dormant seeds at 20°C after 6 h of imbibition while no change was noted at 10°C for both D and ND seeds (Table 1).
Temperature and after-ripening affect gene expression of hormone metabolism and signaling
To elucidate the molecular basis of hormone involvement in temperature as compared to after-ripening regulation of germination, we investigated the gene expression of key enzymes of ABA metabolism and signaling and GA and ethylene metabolism.
Four ABA biosynthesis related genes (HaNCED2, HaNCED4, HaABA2 and HaABA1) have been analyzed during imbibition of D 10°C, D 20°C and ND 10°C (Fig. 3a). HaABA1 gene expression did not show significant change in any condition. HaNED2 showed significant increase only in D 10°C at 3 and 6 h. The most drastic increase in gene expression concerns HaNCED4 and
73
HaABA2, more importantly in D 10 and 20°C than in ND 10°C. Interestingly, in D 20°C, HaABA2 was more induced than HaNED4 in the contrary to D 10°C (Fig. 3a). Concerning ABA oxidation related genes, HaCYP707A2 did not show significant change while HaCYP707A1, HaCYP707A3 gene expressions was up regulated in the three conditions (Fig. 3b). For HaCYP707A1, the increase occurred since 3 h in all conditions but at a lesser manner for ND 10°C. More importantly, at 6 h, its gene expression decreased in D 20°C while it increased by about 3 times in D 10°C and ND 10°C (Fig. 3b). HaCYP707A3 seems to be important in D 20°C as it was induced since 3 h. The three genes were down regulated at 15 h (Fig. 3b). The expression of seven genes (HaSnRKs1, HaSnRKs2, HaHAB1, HaHAB2, HaABI2, HaABI3, HaABI5), involved in ABA signaling pathway has also been analyzed (Fig. 3c). Their corresponding expression level is too low compared to that of metabolism related genes. Considering a threshold change fold of 2, HaSnRK2s1 and HaABI2 were up regulated in D 20°C during imbibition. They were increased also at 6 h and more importantly at 15 h in D 10°C and ND 10°C (Fig. 3c).
HaGA3ox1 and HaGA2ox, corresponding to GA3-oxidases (GA3ox) and GA2-oxidases (GA2ox) involved in synthesis and degradation of bioactive GAs respectively, both showed an increased gene expression in the different conditions during imbibition (Fig. 3d). This increase occurred since 3 h in D and 6 h for ND seeds. Gene expression remains stable for HaGA2ox during imbibition but decreased at 15 h for HaGA3ox1 in D 20°C, while it increases gradually during imbibition for D and ND at 10°C, except at 15 h in D 10°C for HaGA2ox. However, it is noted that the level of expression of HaGA3ox1 was higher (about 8 fold) than that of HaGA2ox (Fig. 3d). HaACO transcripts amount increased significantly at 3 h in D 20°C (Fig. 3d). Subsequent increase occurred in D and ND at 10°C at 6 h to reach a comparable level to that of D 20°C. At 15 h, HaACO gene expression decreased more importantly in D 20°C than in D and ND 10°C.
All these results suggest that the time course of gene expression is important in hormone interaction and subsequent signaling. To explore if there is also a special control of hormone action, we investigate the immunolocalization of ABA, GA and ethylene related proteins.
Immunolocalization for ABA, ABI5, RGL2 and ACO
A spatial localization of hormones regulators were studied by immunocytolocalization, using antibodies anti-ABA, ABI5, RGL2 and ACO as probes. As the major change in hormone contents occurred at 15 h, immunolocalization have been performed at this time point in our three
74
conditions. As showed in Figure 4, ABA is mainly localized in the nucleus of cells in the axis (Fig. 4a), the meristem (Fig. 4b) and cotyledon (data not shown) of D 10°C, while it is localized in the cytoplasm in the seeds that can germinate (D 20°C and ND 10°C). ABI5 was only observed in nucleus for the whole section of D 10°C (as shown for the axis in the Fig. 4c) and in both of the nucleus and the cytosol for D 20°C, however, less fluorescence has been observed in the nucleus. In ND 10°C, its major localization was observed in the cytoplasm (Fig. 4c). RGL2 exhibits similar pattern of localization as for ABI5 (Fig. 4c, d). ACO, unlike ABI5 and RGL2, is localized in the cytoplasm, but interestingly, it was undetected in the meristem of D 10°C (Fig. 4e, f).
Discussion
Regulation of ABA response by temperature and after-ripening in dormancy alleviation
Since ABA is well known to be responsible for dormancy induction and maintenance, the capacity of seed to germinate is normally associated with a low amount of ABA. As demonstrated by previous studies in several species, the endogenous ABA content rapidly declines upon imbibition in ND and D seeds during the early phase of germination, this decrease continues in ND seeds while subsequent de novo ABA synthesis in the imbibed D seeds occurs leading to the higher ABA content required for dormancy maintenance (Chiwocha et al., 2005; Nakabayashi et al., 2005; Hermann et al., 2007; Linkies et al., 2009; Preston et al., 2009, Nambara et al., 2010). Accordingly, a decrease in ABA content was observed in D and ND seeds till 15 h of imbibition when a high level of ABA content was recorded in D seeds at 10°C (Fig. 2c). Surprisingly, at 20°C, ABA content increases also in D seeds even they are able to germinate. Moreover, exogenous ABA did not drastically reduce ND seed germination at 10°C but completely inhibit the germination of D 20°C. These results suggest that dormant seeds are sensitive to ABA, whatever the temperature applied, allowing germination or not. Thus after-ripening increase germination potential by a decrease in ABA content and sensitivity.
Endogenous ABA concentrations are regulated through the coordinated action of numerous genes involved in ABA metabolism (Nambara and Marion-Poll, 2005). Several key
75
genes/enzymes have been characterized for their roles during this process. NCEDs and CYP707As are the key regulatory enzymes for ABA biosynthesis and degradation, respectively (Schwartz et al., 1997; Kushiro et al., 2004; Saito et al., 2004; Weitbrecht et al., 2011). NCEDs and CYP707As are encoded by multigene families, and differential combination of these members determines the ABA contents that contribute to tissue- and environment specific regulation (Seo et al., 2006; Toh et al., 2008). NCED9, NCED5 and NCED2 are involved in the inhibition of Arabidopsis germination at high temperatures (Toh et al., 2008), and NCED4 expression is required for thermoinhibition of lettuce seeds as it plays role in plant response to elevated temperature (Huo et al., 2013). Moreover, HvABA8’OH-1, HvNCED1 and HvNCED2 play key role to regulate endogenous ABA at transcriptional level in barley (Millar et al., 2006; Chono et al., 2006), whereas a down regulation of HvABA8’OH-1 expression and an up regulation of HvNCED 1 and HvNCED2 are correlated with the secondary dormancy due to high temperature (Hoang et al., 2013).In the current study, expressions of HaNCED2 and HaNCED4 are induced upon earlier time of imbibition in D seeds suggesting that they play major roles in ABA biosynthesis in dormancy in sunflower (Fig. 3a). In agreement with previous studies, HaNCED4 is induced by elevated temperature as it increased immediately when seeds are imbibed at 20°C compared to 10°C. In addition, HaABA2, which encodes an enzyme catalyzing the last two steps in ABA biosynthesis, was also up-regulated in D 20°C indicating that it is induced by temperature (Fig. 3a). The higher expression of this key enzyme may explain the increase in ABA content for D seeds in general and at 20°C in particular. Indeed, HaNCED4 was induced more importantly in D 10°C especially at 6 h, suggesting that temperature and after-ripening may use different genes to regulate ABA content. Genes involved in ABA degradation show also different gene expression pattern when comparing after-ripening (comparison between D and ND at 10°C) and temperature effect (comparison between D at 10°C and D at 20°C). Transcripts of CYP707A1 and CYP707A3 were induced upon imbibition for all conditions (Fig. 3b). CYP707A2 was up-regulated in the early phase of imbibition (3-6 h) in D 20°C and then down regulated after 15 h of imbibition, while it was up- regulated in D 10°C and ND 10°C at 15h. Reverse-genetic studies show that CYP707A2 plays a key role in the rapid decrease in ABA levels prior to seed germination, whereas CYP707A1 and CYP707A3 might be triggered by germination events rather than a prerequisite for germination (Okamoto et al., 2006). These results suggest that, the lower level of ABA in after- ripened seeds (ND 10°C) could be due to the low level of genes involved in ABA synthesis at 3
76
and 6 h and the higher level of CYP707A at 15 h compared to D 10°C and D 20°C. It is important to note that genes involved in ABA degradation were induced in D 20°C since 3h which can be important in hormonal balance between ABA and the other hormones.
Recently, genetic and molecular analyses revealed many important regulators for ABA signaling. The major ABA signaling for ABA-dependent gene expression including AREB/ABF regulon, SnRK2 protein kinase, group A (or clade A), 2C-type protein phosphatases (PP2Cs) and ABA receptors have been proposed (Nakashima and Yamaguchi-Shinozaki, 2013). In our study, no significant difference was observed during the early stage of imbibition, but after 15 h, the expression of PP2Cs, HaHAB1 and HaHAB2 genes were induced in ND 10°C, which is in accordance with the decrease of sensitivity to exogenous ABA as they act as negative regulator of ABA signaling (Saez et al., 2004). Plant basic leucine zipper (bZIP) transcription factor ABI5 has been revealed to be a key regulator in the ABA signaling pathway controlling seed dormancy and germination. In the current study, no change in its transcripts level has been revealed, neither by after-ripening or temperature (Fig. 3c). ABI5, as an ABA responsive transcription factor, is localized in nuclear and mainly expressed in the seed germination stage (Yu et al., 2015). Interestingly, our cytological analysis showed that ABI5 is detected in all condition but localized only in the nucleus for D 10°C while it is localized mainly in the cytoplasm but also in the nucleus for ND 10°C and D 20°C (Fig. 4c). Recent study has shown that ABI5 can shuttle between the cytosol and nucleus, and cytoplasmic degradation prevents nuclear accumulation of ABI5 so as to prohibit ABA signaling (Liu and Stone, 2013). Our results confirm this phenomenon by the nuclear accumulation of ABI5 in dormant seeds at 10°C, the decline of ABI5 in the nucleus in favor of the cytoplasm observed in D 20°C and the exclusive localization of ABI5 in the cytosol in ND 10°C which suggests the activation of ABI5 degradation. Moreover, the degradation of ABI5 is dependent on the ubiquitin proteasome system (UPS) (Lopez-Molina et al., 2002 Brocard et al., 2002). A higher proteasome activity has been observed in dormant seeds imbibed at 20°C compared to 10°C after 15 h which can corroborate the instability of ABI5 in response to temperature (Xia et al., chapter 2). It has been demonstrated that ABI5 is regulated at the transcriptional and the translational levels by endogenous and environmental factors (Antoni et al., 2011; Wang et al., 2015). Based on our results, ABI5 does not seem to be regulated at the transcriptional level in sunflower but
77
at the post-translational level, probably by oxidation and/or ubiquitination. ABI5 degradation can explain the decrease in sensitivity to ABA observed in ND 10°C.
Regulation of GA response by temperature and after-ripening in dormancy alleviation
ABA is a positive regulator of dormancy while GAs release dormancy and promote the completion of germination by counteracting the effects of ABA (Bewley and Black, 1994). The antagonistic function between ABA and GAs in seed has been extensively reviewed (Nicolas et al., 1997; Lorenzo et al., 2001; Takeru et al., 2003; Gonai et al., 2004; Toh et al., 2008). To date, the change of endogenous ABA level can be induced by thermoinhibition while there was no significant temperature-dependent change in endogenous GA contents (Toh et al., 2008). In contrast to this, GA showed temperature-induced increase in sunflower, but not
ABA, during temperature promotion of germination, as GA1 was induced by the increase of temperature, which from 10°C to 20°C (Fig. 2a). GA3ox and GA2ox involved in synthesis and degradation, respectively showed significant change in expression level at 3 h for D 20°C and 15 h for ND that is high at 10°C, synthesis being induced several folds more than degradation to tip the balance to GA1 increased content observed at 6 and 15 h (Figs 2a & 3d). Thus, after- ripening treatment involves a network increased GA biosynthesis, which together with ABA degradation described above, resulting in low ABA/GA ratio.
Moreover, GA promotes seed germination by enhancing the proteasome-mediated destruction of RGL2 (for RGA-LIKE2), a key DELLA factor repressing germination (Lee et al., 2002). As showed in Figure 4, the localization of RGL2 target in the same cellular components as ABI5 under the different conditions. A previous study has demonstrated that RGL2 inhibits seed germination by stimulating ABA synthesis and ABI5 activity in Arabidopsis (Piskurewicz et al., 2008). As decreased GA synthesis leads to an increase in endogenous ABA content via stabilized RGL2, by contrast, increased endogenous ABA synthesis is necessary to elevate not only RNA and protein levels of ABI5 but also those of RGL2. Our result agree with this notion and propose that RGL2 together with ABI5 act as the final common repressor of germination in response to changes in ABA and GA levels.
78
Regulation of ethylene response by temperature and after-ripening in dormancy alleviation
The hormonal balance between ABA and GA has been shown to act as an integrator of environmental cues to maintain dormancy or activate germination. However, ethylene, as an important gaseous plant hormone, alleviates dormancy and promotes germination in sunflower seeds (Corbineau et al., 1988; Corbineau et al., 1990) and many other species (Corbineau et al., 2014). Ethylene or its precursor (ACC) influences the ABA-GA balance by counteracting ABA effects and promoting germination (Ghassemian et al., 2000; Brady and McCourt, 2003; Kucera et al., 2005; Arc et al., 2013; Corbineau et al., 2014). In the current study, the dormant seeds are more sensitive to ethylene than to GA or fluridone (ABA inhibitor) (Figs 1a & b). In contrast, compared to after-ripened seeds, dormant seeds imbibed at 20°C exhibit high responsiveness to AIB (the ACO inhibitor), which propose that ethylene play an important role in temperature dependent germination.
Ethylene production is higher in ND compared to D seeds (Esashi, 1991; Kepczynski and Kepczynska, 1997; Matilla, 2000), and is positively correlated with the germination rate of non-dormant pea seeds (Gorecki et al., 1991). However, the major peak of ethylene production coincides with the completion of germination even ethylene production happened very early during imbibition and before radicle protrusion (Kucera et al., 2005; Linkies et al., 2009). Our previous studies have confirmed the occurrence of an ethylene peak upon radicle protrusion in sunflower seeds (El-Maarouf-Bouteau et al., 2014). In this study, we show that ethylene can be detected at very low level only in D 20°C (0.067 ± 0.013 nl h-1 per seed) but not in D 10°C and ND 10°C after 6 h of imbibition. In fact, the amount of ethylene production could be too low to be detected before radicle protrusion. Accordingly, the gene expression of ACO, which converts ACC to ethylene (Peiser et al., 1984), was induced at 3 h in D 20°C (Fig. 3d). All these data indicate that ethylene biosynthesis is stimulated to improve seed dormancy alleviation and germination at 20°C.
In addition, as showed in Figures 4e & f, the immunolocalization of ACO, unlike ABI5 and RGL2, is predominantly present in the cytoplasm for all the three conditions, whereas cytosolic ACO constitutively expressed in the meristematic cells of the germinating seeds (D 20°C and ND 10°C) but not in the non-germinating seeds (D 10°C). The localization study of ACO has been reported in other species such as leafy spurge (Euphorbia esula) and Douglas fir (Hudgins et
79
al., 2006; Chao et al., 2013). However, very little is known about the temporal and spatial patterns of the expression of ACO in seeds. Our study provides a deeply proof for temporal and spatial regulation of ethylene production in temperature and after-ripening- induced dormancy alleviation.
Temperature and after-ripening pathways to induce dormancy alleviation
To date, after-ripening mediated release of seed dormancy is correlated with a decline in ABA content, decreased sensitivity to ABA and an increased GA content. However, for temperature dependent manners, no information was available. We showed in the present study that decreased ABA content is not a prerequisite for temperature-induced germination in sunflower. However, both of the processes of temperature and after-ripening appear to be associated with increased in GA and ethylene content but also localization of ethylene signal in the meristematic zone. The decrease of sensitivity to ABA in after-ripened seeds was more important than in temperature treated seeds due probably to a more active ABI5 degradation showed by its cytological localization.
Given these new findings, seed dormancy release is often correlated with changes in seed hormone content and signaling pathway, the balance between (Ethylene + GA) / ABA is the predominant factor in sunflower seed dormancy alleviation and germination. The spatial and time course of hormone production and signaling expression is of high importance in the dormancy maintenance or germination.
Table 1. Ethylene emission by D and ND sunflower embryos imbibed on 1 mM ACC for 3 and 6 h at 10°C or 20°C; nd, non-detectable. Values are means of three replicates ± standard deviation.
-1 Seeds imbibed in 1mM ACC C2H4 (nl h per seed) D 10°C nd 3h D 20°C nd ND 10°C nd D 10°C nd 6h D 20°C 0.067 ± 0.013 ND 10°C nd
80
Figure Legends
Fig. 1. Germination of naked sunflower seeds on water or in the presence of ABA and its inhibitor fluridone, GA and its inhibitor pacolobatrazol (PAC), gaseous ethylene and its inhibitors α-aminoisobutyric acid (AIB) and amino-oxyacetic acid (AOA). (a) Dormant seeds incubated at 10°C; (b) Dormant seeds incubated at 20°C and (c) Non-dormant seeds incubated at 10°C. Values are means of three replicates ± standard deviation.
Fig. 2. GA and ABA content in dormant (D) and non-dormant (ND) axes isolated from sunflower seeds incubated on water at 10°C and 20°C. (a) Endogenous content of bioactive GA1; (b)
Quantification of GA20, the precursor of GA1; (c) Endogenous content of ABA. Values are means of three replicates ± standard deviation.
Fig. 3. Transcript expression of genes involved in the hormone (ABA, GA and ethylene) metabolism and ABA signaling in axes isolated from dormant (D) and non-dormant (ND) sunflower embryos during imbibition (0, 3, 6, 15 h) at 10°C and 20°C. Line (a), (b) and (c) present the transcript expression of genes involved in ABA biosynthesis, degradation and signaling, respectively; (d) Expression of genes involve in GA and ethylene metabolism. Data from real-time RT-PCR are expressed in arbitrary units, and are means of three biological replicates ± standard deviation.
Fig. 4. Immunolocalization of ABA, and protein ABI5, RGL2 and ACO in sunflower seeds. Sections were prepared from naked seeds imbibed after 15 h on water. Green label indicates the interaction of different antibodies and their antigen. (a), (b), (c) ABA observed in axis and meristem and ABI5 in axis, respectively; (d) RGL2 observed in axis; (e) , (f) ACO observed in axis and meristem, respectively; (g) blue label shows the nuclei that were stained with DAPI (4',6-diamidino-2-phenylindole) and green label indicates the distribution of ABI5 in axis, and merged image also showed below; (f) negative control, as the sections observed under the red fluorescence.
81
Figure. 1
Figure. 2
82
Figure. 3
83
Figure. 4
84
Supporting Information
Table S1. Sequences of primers used for qRT-PCR experiments. Heliagene accession number for each gene was determined by https://www.heliagene.org and the sequence of primer by Primer6. ACO primers were tacked from Oracz et al. (2008). The internal standard gene primers, EFR, Tubulin and S19, are derived from Layat et al. (2014).
Name of Heliagene Accession Amplification H. annnus number product size (bp) Primer sequences L. gene HaABA1 Ha412v1r1_12g018480 133 F: AGGTGCTCCTGACTCGGTACTT R: CCTGCTTGGAGACTCGGTTCAT HaNCED1 Ha412v1r1_16g013610 88 F: GGAGACCCACCGCCTTGTTCAA R: CACACCGAAGTGACCGTGAAGC HaNCED2 Ha412v1r1_15g037960 147 F: TGGAGACGCCGACTATGGTTCA R: CGCCGAAACGTGACACCTTCT HaNCED4 Ha412v1r1_08g038660 110 F: TGCGAAAGACGAGTCCGAGATG R: GAGCCACCATCACCACCGTATC HaABA2 Ha412v1r1_14g011620 146 F: GCTGCTCGTGCCATGATTCCA R: AGCTCTGCGGCCACATTCTTG HaCYP707A1 Ha412v1r1_17g006190 181 F: GATTCGCTTCGGTCGTTGGAA R: CGGGAAGGTTAATCGGCATCG HaCYP707A2 Ha412v1r1_05g007770 84 F: GCAAAGATGGTGTTGGTGAGTG R: GGCTTCTGGGCCGATCATCT HaCYP707A3 Ha412v1r1_06g014700 161 F: CGATGAAGGCGAGGAAAGAGC R: GCAGCGAATATGACACCGATGA HaHAB1 Ha412v1r1_09g045480 88 F: TGTTGAGGACGTGCCGATTGA R: TTCCGCCATTACAGACGCCTT HaHAB2 Ha412v1r1_10g062350 85 F: CCATTCCCAAGGAACTCTCTCG R: AGCTTCCTCTTTCTTGGCAACA HaABI2 Ha412v1r1_09g001950 86 F: GGAGGATGTACCGCCGGAAGTT R: GAACCGCCATGACCGTCGTAA HaSnRKs-1 Ha412v1r1_15g036900 119 F: ACAGTCGGTACACCAGCATACA R: TAGCCGCCAATGAGCATGATGT HaSnRKs-2 Ha412v1r1_12g044140 135 F: CGTCATGCTTGTTGGTGGCTAT R: AGGTGGCGACATTCAGGTGAT HaABI3 Ha412v1r1_15g006390 93 F: TGGAGGGAACTGGGTGTACTGG R: AACGGTCACAGGACGGAACAG HaABI5 Ha412v1r1_00g108760 148 F: CACCAACAGCCAAGCAATGACA R: CAGGCGGAGCATTCGGATGAT HaGA3ox1 Ha412v1r1_10g044740 93 F: TCCTGATCCTGACCGAGCCATG R: GCCTGGAGTCCACTTGTGTTGT HaGA2ox Ha412v1r1_10g051610 75 F: ACTTTGGAGGACCACCATTGAA R: ACAAGCTGTCTTCTTCCCTTTC HaACO L 29405 124 F: GAAGTGTATGGAGCAGAGGTTT R: GTTGGAGGTAGGGCGATG HaEF1 F: TCTCCACTCCTCCAACAC R: CTCAATCACTCGCTACACC HaTubulin F: GGCGTCTACCTTCATTGGT R: TCCATCTCATCCATTCCTTC HaS19 F: CTGTCTTTGCCGATTTCTCA R: GCTCTGTTCTTTCTTTCCTTGA
85
References
Antoni, R., Rodriguez, L., Gonzalez-Guzman, M., Pizzio, G.A. and Rodriguez, P.L. (2011) News on ABA transport, protein degradation, and ABFs/WRKYs in ABA signaling. Current opinion in plant biology, 14, 547-553. Arc, E., Sechet, J., Corbineau, F., Rajjou, L. and Marion-Poll, A. (2013) ABA crosstalk with ethylene and nitric oxide in seed dormancy and germination. Frontiers in plant science, 4, 63. Argyris, J., Dahal, P., Hayashi, E., Still, D.W. and Bradford, K.J. (2008) Genetic variation for lettuce seed thermoinhibition is associated with temperature-sensitive expression of abscisic Acid, gibberellin, and ethylene biosynthesis, metabolism, and response genes. Plant physiology, 148, 926-947. Bewley, J.D. (1997) Seed Germination and Dormancy. The Plant cell, 9, 1055-1066. Bewley, J.D. and Black, M. (1994) Seeds. In Seeds: Springer US, pp. 1-33. Brady, S.M. and McCourt, P. (2003) Hormone Cross-Talk in Seed Dormancy. Journal of Plant Growth Regulation, 22, 25-31. Brocard, I.M., Lynch, T.J. and Finkelstein, R.R. (2002) Regulation and role of the Arabidopsis abscisic acid-insensitive 5 gene in abscisic acid, sugar, and stress response. Plant physiology, 129, 1533-1543. Chao, W.S., Serpe, M., Suttle, J.C. and Jia, Y. (2013) Increase in ACC oxidase levels and activities during paradormancy release of leafy spurge (Euphorbia esula) buds. Planta, 238, 205- 215. Chiwocha, S.D., Cutler, A.J., Abrams, S.R., Ambrose, S.J., Yang, J., Ross, A.R. and Kermode, A.R. (2005) The etr1-2 mutation in Arabidopsis thaliana affects the abscisic acid, auxin, cytokinin and gibberellin metabolic pathways during maintenance of seed dormancy, moist-chilling and germination. The Plant journal: for cell and molecular biology, 42, 35-48. Chono, M., Honda, I., Shinoda, S., Kushiro, T., Kamiya, Y., Nambara, E., Kawakami, N., Kaneko, S. and Watanabe, Y. (2006) Field studies on the regulation of abscisic acid content and germinability during grain development of barley: molecular and chemical analysis of pre-harvest sprouting. Journal of experimental botany, 57, 2421-2434.
86
Corbineau, F., Bagniol, S. and Come, D. (1990) Sunflower (Helianthus-annuus L) seed dormancy and its regulation by ethylene. Israel Journal of Botany, 39, 313-325. Corbineau, F., Rudnicki, R.M. and Côme, D. (1988) Induction of secondary dormancy in sunflower seeds by high temperature. Possible involvement of ethylene biosynthesis. Physiologia plantarum, 73, 368-373. Corbineau, F., Xia, Q., Bailly, C. and El-Maarouf-Bouteau, H. (2014) Ethylene, a key factor in the regulation of seed dormancy. Frontiers in plant science, 5, 539. Debeaujon, I. and Koornneef, M. (2000) Gibberellin requirement for Arabidopsis seed germination is determined both by testa characteristics and embryonic abscisic acid. Plant physiology, 122, 415-424. Dutta, S. and Bradford, K.J. (1994) Water relations of lettuce seed thermoinhibition. II. Ethylene and endosperm effects on base water potential. Seed Sci. Res., 4, 11-18. El-Maarouf-Bouteau, H., Sajjad, Y., Bazin, J., Langlade, N., Cristescu, S.M., Balzergue, S., Baudouin, E. and Bailly, C. (2015) Reactive oxygen species, abscisic acid and ethylene interact to regulate sunflower seed germination. Plant, cell & environment, 38, 364- 374. Finch-Savage, W.E. and Leubner-Metzger, G. (2006) Seed dormancy and the control of germination. The New phytologist, 171, 501-523. Esashi, Y. (1991) Ethylene and seed germination. In The Plant Hormone Ethylene (Mattoo, A.K. and Suttle, J.C. eds), pp. 133–157. Frey, A., Effroy, D., Lefebvre, V., Seo, M., Perreau, F., Berger, A., Sechet, J., To, A., North, H.M. and Marion-Poll, A. (2012) Epoxycarotenoid cleavage by NCED5 fine-tunes ABA accumulation and affects seed dormancy and drought tolerance with other NCED family members. The Plant journal: for cell and molecular biology, 70, 501-512. Gallardo, M., Delgado Mdel, M., Sanchez-Calle, I.M. and Matilla, A.J. (1991) Ethylene Production and 1-Aminocyclopropane-1-Carboxylic Acid Conjugation in Thermoinhibited Cicer arietinum L. Seeds. Plant physiology, 97, 122-127. Ghassemian, M., Nambara, E., Cutler, S., Kawaide, H., Kamiya, Y. and McCourt, P. (2000) Regulation of abscisic acid signaling by the ethylene response pathway in Arabidopsis. The Plant cell, 12, 1117-1126. Gonai, T., Kawahara, S., Tougou, M., Satoh, S., Hashiba, T., Hirai, N., Kawaide, H., Kamiya, Y. and Yoshioka, T. (2004) Abscisic acid in the thermoinhibition of lettuce seed
87
germination and enhancement of its catabolism by gibberellin. Journal of experimental botany, 55, 111-118. Gonai, T., Kawahara, S., Tougou, M., Satoh, S., Hashiba, T., Hirai, N., Kawaide, H., Kamiya, Y. and Yoshioka, T. (2004) Abscisic acid in the thermoinhibition of lettuce seed germination and enhancement of its catabolism by gibberellin. Journal of experimental botany, 55, 111-118. Gonzalez-Guzman, M., Apostolova, N., Belles, J.M., Barrero, J.M., Piqueras, P., Ponce, M.R., Micol, J.L., Serrano, R. and Rodriguez, P.L. (2002) The short-chain alcohol dehydrogenase ABA2 catalyzes the conversion of xanthoxin to abscisic aldehyde. The Plant cell, 14, 1833-1846. Grappin, P., Bouinot, D., Sotta, B., Miginiac, E. and Jullien, M. (2000) Control of seed dormancy in Nicotiana plumbaginifolia: post-imbibition abscisic acid synthesis imposes dormancy maintenance. Planta, 210, 279-285. Groot, S.P. and Karssen, C.M. (1992) Dormancy and Germination of Abscisic Acid-Deficient Tomato Seeds: Studies with the sitiens Mutant. Plant physiology, 99, 952-958. Heggie, L. and Halliday, K.J. (2005) The highs and lows of plant life: temperature and light interactions in development. The International journal of developmental biology, 49, 675-687. Hermann, K., Meinhard, J., Dobrev, P., Linkies, A., Pesek, B., Hess, B., Machackova, I., Fischer, U. and Leubner-Metzger, G. (2007) 1-Aminocyclopropane-1-carboxylic acid and abscisic acid during the germination of sugar beet (Beta vulgaris L.): a comparative study of fruits and seeds. Journal of experimental botany, 58, 3047-3060. Hilhorst, R., Sergeeva, M., Heering, D., Rietveld, P., Fijneman, P., Wolbert, R.B.G., Dekker, M. and Bijsterbosch, B.H. (1995) Protein extration from an aqueous phase into a reversed micellar phase: Effect of water content and reversed micellar composition. Biotechnology and Bioengineering, 46, 375-387. Hoang, H.H., Bailly, C., Corbineau, F. and Leymarie, J. (2013) Induction of secondary dormancy by hypoxia in barley grains and its hormonal regulation. Journal of experimental botany, 64, 2017-2025. Holdsworth, M.J., Bentsink, L. and Soppe, W.J. (2008) Molecular networks regulating Arabidopsis seed maturation, after-ripening, dormancy and germination. The New phytologist, 179, 33-54.
88
Holdsworth, M.J., Finch-Savage, W.E., Grappin, P. and Job, D. (2008) Post-genomics dissection of seed dormancy and germination. Trends in plant science, 13, 7-13. Hudgins, J.W., Ralph, S.G., Franceschi, V.R. and Bohlmann, J. (2006) Ethylene in induced conifer defense: cDNA cloning, protein expression, and cellular and subcellular localization of 1-aminocyclopropane-1-carboxylate oxidase in resin duct and phenolic parenchyma cells. Planta, 224, 865-877. Huo, H. and Bradford, K.J. (2015) Molecular and Hormonal Regulation of Thermoinhibition of Seed Germination. Advances in Plant Dormancy, 3. Huo, H., Dahal, P., Kunusoth, K., McCallum, C.M. and Bradford, K.J. (2013) Expression of 9-cis- EPOXYCAROTENOID DIOXYGENASE4 is essential for thermoinhibition of lettuce seed germination but not for seed development or stress tolerance. The Plant cell, 25, 884- 900. Jana, S., Acharya, S.N. and Naylor, J.M. (1979) Dormancy studies in seed of Avena fatua. 10. On the inheritance of germination behaviour. Canadian Journal of Botany, 57, 1663- 1667. KeÇpczyński, J. and KeÇpczyńska, E. (1997) Ethylene in seed dormancy and germination. Physiologia plantarum, 101, 720-726. Koornneef, M., Bentsink, L. and Hilhorst, H. (2002) Seed dormancy and germination. Current opinion in plant biology, 5, 33-36. Koornneef, M., Jorna, M.L., Brinkhorst-van der Swan, D.L. and Karssen, C.M. (1982) The isolation of abscisic acid (ABA) deficient mutants by selection of induced revertants in non-germinating gibberellin sensitive lines of Arabidopsis thaliana (L.) heynh. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik, 61, 385-393. Koornneef, M. and van der Veen, J.H. (1980) Induction and analysis of gibberellin sensitive mutants in Arabidopsis thaliana (L.) heynh. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik, 58, 257-263. Kpczyska, E., Pikna-Grochala, J. and Kpczyski, J. (2006) Hormonal regulation of tomato seed germination at a supraoptimal temperature. Acta Physiologiae Plantarum, 28, 225- 231. Kucera, B., Cohn, M.A. and Leubner-Metzger, G. (2005) Plant hormone interactions during seed dormancy release and germination. Seed Sci. Res., 15, 281-307.
89
Kushiro, T., Okamoto, M., Nakabayashi, K., Yamagishi, K., Kitamura, S., Asami, T., Hirai, N., Koshiba, T., Kamiya, Y. and Nambara, E. (2004) The Arabidopsis cytochrome P450 CYP707A encodes ABA 8'-hydroxylases: key enzymes in ABA catabolism. The EMBO journal, 23, 1647-1656. Layat, E., Leymarie, J., El-Maarouf-Bouteau, H., Caius, J., Langlade, N. and Bailly, C. (2014) Translatome profiling in dormant and nondormant sunflower (Helianthus annuus) seeds highlights post-transcriptional regulation of germination. The New phytologist, 204, 864-872. Lee, S., Cheng, H., King, K.E., Wang, W., He, Y., Hussain, A., Lo, J., Harberd, N.P. and Peng, J. (2002) Gibberellin regulates Arabidopsis seed germination via RGL2, a GAI/RGA-like gene whose expression is up-regulated following imbibition. Genes & development, 16, 646-658. Lefebvre, V., North, H., Frey, A., Sotta, B., Seo, M., Okamoto, M., Nambara, E. and Marion-Poll, A. (2006) Functional analysis of Arabidopsis NCED6 and NCED9 genes indicates that ABA synthesized in the endosperm is involved in the induction of seed dormancy. The Plant journal: for cell and molecular biology, 45, 309-319. Leon-Kloosterziel, K.M., Gil, M.A., Ruijs, G.J., Jacobsen, S.E., Olszewski, N.E., Schwartz, S.H., Zeevaart, J.A. and Koornneef, M. (1996) Isolation and characterization of abscisic acid- deficient Arabidopsis mutants at two new loci. The Plant journal: for cell and molecular biology, 10, 655-661. Leubner-Metzger, G. (2002) Seed after-ripening and over-expression of class I beta-1,3- glucanase confer maternal effects on tobacco testa rupture and dormancy release. Planta, 215, 959-968. Li, B. and Foley, M.E. (1997) Genetic and molecular control of seed dormancy. Trends in plant science, 2, 384-389. Linkies, A., Muller, K., Morris, K., Tureckova, V., Wenk, M., Cadman, C.S., Corbineau, F., Strnad, M., Lynn, J.R., Finch-Savage, W.E. and Leubner-Metzger, G. (2009) Ethylene interacts with abscisic acid to regulate endosperm rupture during germination: a comparative approach using Lepidium sativum and Arabidopsis thaliana. The Plant cell, 21, 3803- 3822.
90
Liu, H. and Stone, S.L. (2013) Cytoplasmic degradation of the Arabidopsis transcription factor abscisic acid insensitive 5 is mediated by the RING-type E3 ligase KEEP ON GOING. The Journal of biological chemistry, 288, 20267-20279. Lopez-Molina, L., Mongrand, S., McLachlin, D.T., Chait, B.T. and Chua, N.H. (2002) ABI5 acts downstream of ABI3 to execute an ABA-dependent growth arrest during germination. The Plant journal: for cell and molecular biology, 32, 317-328. Lorenzo, O., Rodriguez, D., Nicolas, G., Rodriguez, P.L. and Nicolas, C. (2001) A new protein phosphatase 2C (FsPP2C1) induced by abscisic acid is specifically expressed in dormant beechnut seeds. Plant physiology, 125, 1949-1956. Madakadze, R., Chirco, E.M. and Khan, A.A. (1993) Seed-germination of 3 flower species following matriconditioning under various environments. Journal of the American Society for Horticultural Science, 118, 330-334. Martinez-Andujar, C., Ordiz, M.I., Huang, Z., Nonogaki, M., Beachy, R.N. and Nonogaki, H. (2011) Induction of 9-cis-epoxycarotenoid dioxygenase in Arabidopsis thaliana seeds enhances seed dormancy. Proceedings of the National Academy of Sciences of the United States of America, 108, 17225-17229. Matilla A. J. (2000). Ethylene in seed formation and germination. Seed Sci. Res. 10 111–126 Millar, A.A., Jacobsen, J.V., Ross, J.J., Helliwell, C.A., Poole, A.T., Scofield, G., Reid, J.B. and Gubler, F. (2006) Seed dormancy and ABA metabolism in Arabidopsis and barley: the role of ABA 8'-hydroxylase. The Plant journal: for cell and molecular biology, 45, 942- 954. Mitchum, M.G., Yamaguchi, S., Hanada, A., Kuwahara, A., Yoshioka, Y., Kato, T., Tabata, S., Kamiya, Y. and Sun, T.P. (2006) Distinct and overlapping roles of two gibberellin 3- oxidases in Arabidopsis development. The Plant journal: for cell and molecular biology, 45, 804-818. Nakabayashi, K., Okamoto, M., Koshiba, T., Kamiya, Y. and Nambara, E. (2005) Genome-wide profiling of stored mRNA in Arabidopsis thaliana seed germination: epigenetic and genetic regulation of transcription in seed. The Plant journal: for cell and molecular biology, 41, 697-709. Nakashima, K., Fujita, Y., Kanamori, N., Katagiri, T., Umezawa, T., Kidokoro, S., Maruyama, K., Yoshida, T., Ishiyama, K., Kobayashi, M., Shinozaki, K. and Yamaguchi-Shinozaki, K. (2009) Three Arabidopsis SnRK2 protein kinases, SRK2D/SnRK2.2,
91
SRK2E/SnRK2.6/OST1 and SRK2I/SnRK2.3, involved in ABA signaling are essential for the control of seed development and dormancy. Plant & cell physiology, 50, 1345- 1363. Nakashima, K. and Yamaguchi-Shinozaki, K. (2013) ABA signaling in stress-response and seed development. Plant cell reports, 32, 959-970. Nambara, E. and Marion-Poll, A. (2005) Abscisic acid biosynthesis and catabolism. Annual review of plant biology, 56, 165-185. Nambara, E., Okamoto, M., Tatematsu, K., Yano, R., Seo, M. and Kamiya, Y. (2010) Abscisic acid and the control of seed dormancy and germination. Seed Sci. Res., 20, 55. Nicolas, C., Rodriguez, D., Poulsen, F., Eriksen, E.N. and Nicolas, G. (1997) The expression of an abscisic acid-responsive glycine-rich protein coincides with the level of seed dormancy in Fagus sylvatica. Plant & cell physiology, 38, 1303-1310. Okamoto, M., Hanada, A., Kamiya, Y., Yamaguchi, S. and Nambara, E. (2009) Measurement of abscisic acid and gibberellins by gas chromatography/mass spectrometry. Methods in molecular biology, 495, 53-60. Okamoto, M., Kuwahara, A., Seo, M., Kushiro, T., Asami, T., Hirai, N., Kamiya, Y., Koshiba, T. and Nambara, E. (2006) CYP707A1 and CYP707A2, which encode abscisic acid 8'- hydroxylases, are indispensable for proper control of seed dormancy and germination in Arabidopsis. Plant physiology, 141, 97-107. Onate-Sanchez, L. and Vicente-Carbajosa, J. (2008) DNA-free RNA isolation protocols for Arabidopsis thaliana, including seeds and siliques. BMC research notes, 1, 93. Oracz, K., El-Maarouf-Bouteau, H., Bogatek, R., Corbineau, F. and Bailly, C. (2008) Release of sunflower seed dormancy by cyanide: cross-talk with ethylene signalling pathway. Journal of experimental botany, 59, 2241-2251. Peiser, G.D., Wang, T.T., Hoffman, N.E., Yang, S.F., Liu, H.W. and Walsh, C.T. (1984) Formation of cyanide from carbon 1 of 1-aminocyclopropane-1-carboxylic acid during its conversion to ethylene. Proceedings of the National Academy of Sciences of the United States of America, 81, 3059-3063. Piskurewicz, U., Jikumaru, Y., Kinoshita, N., Nambara, E., Kamiya, Y. and Lopez-Molina, L. (2008) The gibberellic acid signaling repressor RGL2 inhibits Arabidopsis seed germination by stimulating abscisic acid synthesis and ABI5 activity. The Plant cell, 20, 2729-2745.
92
Preston, J., Tatematsu, K., Kanno, Y., Hobo, T., Kimura, M., Jikumaru, Y., Yano, R., Kamiya, Y. and Nambara, E. (2009) Temporal expression patterns of hormone metabolism genes during imbibition of Arabidopsis thaliana seeds: a comparative study on dormant and non-dormant accessions. Plant & cell physiology, 50, 1786-1800. Probert, R.J. (2000) The role of temperature in the regulation of seed dormancy and germination. In Seeds: the ecology of regeneration in plant communities. (Fenner, M. ed), pp. 261. Saez, A., Apostolova, N., Gonzalez-Guzman, M., Gonzalez-Garcia, M.P., Nicolas, C., Lorenzo, O. and Rodriguez, P.L. (2004) Gain-of-function and loss-of-function phenotypes of the protein phosphatase 2C HAB1 reveal its role as a negative regulator of abscisic acid signalling. The Plant journal: for cell and molecular biology, 37, 354-369. Saito, S., Hirai, N., Matsumoto, C., Ohigashi, H., Ohta, D., Sakata, K. and Mizutani, M. (2004) Arabidopsis CYP707As encode (+)-abscisic acid 8'-hydroxylase, a key enzyme in the oxidative catabolism of abscisic acid. Plant physiology, 134, 1439-1449. Schwartz, S.H., Tan, B.C., Gage, D.A., Zeevaart, J.A. and McCarty, D.R. (1997) Specific oxidative cleavage of carotenoids by VP14 of maize. Science, 276, 1872-1874. Seo, M., Hanada, A., Kuwahara, A., Endo, A., Okamoto, M., Yamauchi, Y., North, H., Marion- Poll, A., Sun, T.P., Koshiba, T., Kamiya, Y., Yamaguchi, S. and Nambara, E. (2006) Regulation of hormone metabolism in Arabidopsis seeds: phytochrome regulation of abscisic acid metabolism and abscisic acid regulation of gibberellin metabolism. The Plant journal: for cell and molecular biology, 48, 354-366. Toh, S., Imamura, A., Watanabe, A., Nakabayashi, K., Okamoto, M., Jikumaru, Y., Hanada, A., Aso, Y., Ishiyama, K., Tamura, N., Iuchi, S., Kobayashi, M., Yamaguchi, S., Kamiya, Y., Nambara, E. and Kawakami, N. (2008) High temperature-induced abscisic acid biosynthesis and its role in the inhibition of gibberellin action in Arabidopsis seeds. Plant physiology, 146, 1368-1385. Tyler, L., Thomas, S.G., Hu, J., Dill, A., Alonso, J.M., Ecker, J.R. and Sun, T.P. (2004) Della proteins and gibberellin-regulated seed germination and floral development in Arabidopsis. Plant physiology, 135, 1008-1019. Wang, Z., Ji, H., Yuan, B., Wang, S., Su, C., Yao, B., Zhao, H. and Li, X. (2015) ABA signalling is fine-tuned by antagonistic HAB1 variants. Nature communications, 6, 8138.
93
Weitbrecht, K., Muller, K. and Leubner-Metzger, G. (2011) First off the mark: early seed germination. Journal of experimental botany, 62, 3289-3309. Yamauchi, Y., Ogawa, M., Kuwahara, A., Hanada, A., Kamiya, Y. and Yamaguchi, S. (2004) Activation of gibberellin biosynthesis and response pathways by low temperature during imbibition of Arabidopsis thaliana seeds. The Plant cell, 16, 367-378. Yoshioka, T., Endo, T. and Satoh, S. (1998) Restoration of Seed Germination at Supraoptimal Temperatures by Fluridone, an Inhibitor of Abscisic Acid Biosynthesis. Plant and Cell Physiology, 39, 307-312. Yu, F., Wu, Y. and Xie, Q. (2015) Precise protein post-translational modifications modulate ABI5 activity. Trends in plant science, 20, 569-575.
94
Chapter 4 General Conclusion
Dormancy and germination are very complex traits. Temperature is an important environmental factor affecting seed dormancy and germination, however, the mechanism by which it operates is still largely unclear. The present work gives novel insights into the regulation of temperature in seed biology and reveals molecular mechanisms of crosstalk between temperature and hormones during seed dormancy and germination.
Several large-scale-omics including transcriptomic, proteomic, and metabolomic methods were used to investigate the mechanisms involved in seed germination (Holdsworth et al., 2008). With huge available data of genome information and the development of mass spectrometry (MS) technology, proteomics is exerting great influence in analyzing the dynamic of diverse biological processes. Proteins have numerous biological functions, they met increasing demand for the events of protein synthesis and modification concomitant with germination and seedling growth. In the first part of the current study, we decipher seed metabolism affected by the germination of seeds response to temperature by integrating proteomics and enzymatic profiling. Proteomic analysis highlight the change of proteins including universal stress proteins (USP), late embryogenesis abundant (LEA) proteins, which are accumulated during seed development, they can also be regarded as having a role in response to ROS and redox change upon imbibition differently in dormant and after-ripened seeds (Oracz et al., 2007). Seed storage proteins or proteases were detected in relation to protein metabolism activation. At last, several key enzymes of central metabolism were characterized showing that there is a regulation of TCA cycle, glycolysis and pentose phosphate pathway activities, which can explain the change in sugar observed in metabolomics study between D and ND. These pathways provide the energy for cell elongation but also all the co-factors and intermediates for biological reactions, such as PTMs and reserves or hormones metabolism. Indeed, enzymatic profiles demonstrate that there has no correlation between protein abundance and activities of these enzymes, suggesting that PTMs such as oxidation, ubiquitination and phosphorylation play a critical role in temperature dependent germination potential. PTMs as a critical role has to be considered, by regulating the mobilization of reserves such as central carbon metabolism pathways which is relevant to address the question of seed dormancy release and supply the energy for subsequent
95
germination events. Proteomic study was completed by polysome and proteasome activity assessment and enzymatic profiling on several altered proteins mainly involved in metabolism and energy. The absorbance profile of ribosome complexes obtained from dormant embryonic axes imbibed for 15 h and 24 h at 10°C and 20°C showed that a suitable higher temperature was associated with a less amount of ribosomal subunits (40S and 60S), 80S monosomes and a marked increase in polysome level, indicating the recruitment of RNAs to polysomes and initiating de novo proteins prerequisite for seed germination. A higher content of protein oxidation and proteasome activities were also recorded at 20°C. All these events are likely to be related to hormone metabolism regulation showed in our analysis. Hormone involvement in seed dormancy and germination was the most characterized and conserved mechanism among plant species. For a better understanding of temperature effect on hormones we used after-ripening, as the well described process, to compare hormone regulation in our study. We showed, for the first time, molecular and cellular events of ABA, GA, ethylene regulation induced by temperature in sunflower. Considering the deep embryo dormancy of sunflower, hormonal change recorded was in accordance of that described in other species, which reinforces hormonal pattern in this process. In fact, after-ripening results in a decrease in endogenous ABA level and embryo sensitivity to exogenous ABA, and in an increase in GA sensitivity and content. By contrast, temperature did not induce ABA decrease but endogenous GA and ethylene increase. Low amount of ethylene was first detected in the seeds imbibed at a suitable temperature, while it was undetectable in after-ripened seeds. The increase in ACO transcripts in germinating seeds in the early time of imbibition was in accordance of ethylene production. Our cytological study showed that ACO localized in meristematic zone in germinating seeds suggesting that ethylene is targeted in this limited zone which can explain the low amount of ethylene measured in sunflower or other species before germination and growth occurred. ABA action seems also to be targeted but at the level of cell compartment. ABA and ABI5 mainly localized in nucleus for non-germinating seeds and in cytosol for germinating seeds, all of these also indicating that the compartmentation/decompartmentation was already observed in seeds during germination. Moreover, we showed a selective recruitment of ABA synthesis genes by temperature as HaABA2 was highly induced while HaNCED2 and HaNCED4 predominate for after-ripening. These results point out the importance of the so called hormone sensitivity which can include
96
degradation speed, redirection or perception at the level of cell or seed compartment. Attention should be paid in the future to cytological characterization of seed germination.
To date, no relationship has been described between environment, hormones and seed metabolism in seed germination process. To address this question, a perspective hypothetic model based on our results is proposed in Figure 14. Temperature acts via induced PTMs to regulate central carbon metabolism activated by imbibition. PTMs can be intensified by co- factors like NAD or gluthation intermediates which regulate proteins involved in gene transcription, protein synthesis and degradation via the proteasome, hormone metabolism, perception and trafficking and cell wall modification.
Fig. 14. Hypothetic model showing temperature regulation of sunflower seed germination.
This study reactivates old debates about the involvement of central metabolism pathways in seed dormancy breaking. Moreover, we provide novel findings about the importance of hormone trafficking in the cell and their regulation in specialized tissue during seed germination, which would open a new area in their underlying mechanism in seed biology.
Our work suggesting that more attention should be paid to PTMs and their influence on central metabolism in the investigation of seed dormancy. It has been shown that enzymes involved in central metabolism are targets of several PTMs such as phosphorylation or sulfoxidation. Oxidative PTMs, particularly reversible ones such as methionine or thiol oxidation, seem to be relevant in metabolism regulation, given the importance of ROS in sunflower. The relationship between hormones and seed metabolism and their effect on cell
97
wall, which permit germination by elongation, is of high importance. Such integrative investigations are now needed to understand seed dormancy as a whole. Analyses at the level of seed compartments are also needed to refine seed responses described in the literature. The exploring of cell metabolism regulation or hormone networks in general would be help us to understand the complex developmental process of seed dormancy and germination.
98
References
Achard, P. and Genschik, P. (2009) Releasing the brakes of plant growth: how GAs shutdown DELLA proteins. Journal of experimental botany, 60, 1085-1092. Arc, E., Galland, M., Cueff, G., Godin, B., Lounifi, I., Job, D. and Rajjou, L. (2011) Reboot the system thanks to protein post-translational modifications and proteome diversity: How quiescent seeds restart their metabolism to prepare seedling establishment. Proteomics, 11, 1606-1618. Arc, E., Sechet, J., Corbineau, F., Rajjou, L. and Marion-Poll, A. (2013) ABA crosstalk with ethylene and nitric oxide in seed dormancy and germination. Frontiers in plant science, 4, 63. Argyris, J., Dahal, P., Hayashi, E., Still, D.W. and Bradford, K.J. (2008) Genetic variation for lettuce seed thermoinhibition is associated with temperature-sensitive expression of abscisic Acid, gibberellin, and ethylene biosynthesis, metabolism, and response genes. Plant physiology, 148, 926-947. Argyris, J., Truco, M.J., Ochoa, O., Knapp, S.J., Still, D.W., Lenssen, G.M., Schut, J.W., Michelmore, R.W. and Bradford, K.J. (2005) Quantitative trait loci associated with seed and seedling traits in Lactuca. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik, 111, 1365-1376. Audran, C., Liotenberg, S., Gonneau, M., North, H., Frey, A., Tap-Waksman, K., Vartanian, N. and Marion-Poll, A. (2001) Localisation and expression of zeaxanthin epoxidase mRNA in Arabidopsis in response to drought stress and during seed development. Functional Plant Biology, 28, 1161-1173. Bailly, C., El-Maarouf-Bouteau, H. and Corbineau, F. (2008) From intracellular signaling networks to cell death: the dual role of reactive oxygen species in seed physiology. Comptes rendus biologies, 331, 806-814. Basbouss-Serhal, I., Soubigou-Taconnat, L., Bailly, C. and Leymarie, J. (2015) Germination Potential of Dormant and Nondormant Arabidopsis Seeds Is Driven by Distinct Recruitment of Messenger RNAs to Polysomes. Plant physiology, 168, 1049-1065. Baskin, C.C. and Baskin, J.M. (1998) Chapter 12 - Biogeographical and Evolutionary Aspects of Seed Dormancy. In Seeds. San Diego: Academic Press, pp. 559-613.
99
Baskin, J.M. and Baskin, C.C. (2004) A classification system for seed dormancy. Seed Sci. Res., 14, 1-16. Bassel, G.W., Fung, P., Chow, T.F., Foong, J.A., Provart, N.J. and Cutler, S.R. (2008) Elucidating the germination transcriptional program using small molecules. Plant physiology, 147, 143-155. Baumlein, H., Misera, S., Luerssen, H., Kolle, K., Horstmann, C., Wobus, U. and Muller, A.J. (1994) The FUS3 gene of Arabidopsis-thaliana is a regulator of gene-expression during late embryogenesis. Plant J., 6, 379-387. Bazin, J., Batlla, D., Dussert, S., El-Maarouf-Bouteau, H. and Bailly, C. (2011) Role of relative humidity, temperature, and water status in dormancy alleviation of sunflower seeds during dry after-ripening. Journal of experimental botany, 62, 627-640. Bazin, J., Langlade, N., Vincourt, P., Arribat, S., Balzergue, S., El-Maarouf-Bouteau, H. and Bailly, C. (2011) Targeted mRNA oxidation regulates sunflower seed dormancy alleviation during dry after-ripening. The Plant cell, 23, 2196-2208. Beaudoin, N., Serizet, C., Gosti, F. and Giraudat, J. (2000) Interactions between abscisic acid and ethylene signaling cascades. The Plant cell, 12, 1103-1115. Bensmihen, S., Giraudat, J. and Parcy, F. (2005) Characterization of three homologous basic leucine zipper transcription factors (bZIP) of the ABI5 family during Arabidopsis thaliana embryo maturation. Journal of experimental botany, 56, 597-603. Bensmihen, S., Rippa, S., Lambert, G., Jublot, D., Pautot, V., Granier, F., Giraudat, J. and Parcy, F. (2002) The homologous ABI5 and EEL transcription factors function antagonistically to fine-tune gene expression during late embryogenesis. The Plant cell, 14, 1391-1403. Bentsink, L. and Koornneef, M. (2008) Seed dormancy and germination. The Arabidopsis book / American Society of Plant Biologists, 6, e0119. Bewley, J.D. (1997) Seed Germination and Dormancy. The Plant cell, 9, 1055-1066. Bewley, J.D. and Black, M. (1985) Seeds. In Seeds: Physiology of Development and Germination. Boston, MA: Springer US. Bewley, J.D. and Black, M. (1994) Seeds. In Seeds: Springer US. Bewley, J.D., Bradford, K.J., Hilhorst, H.W.M. and Nonogaki, H. (2013) Development and Maturation. In Seeds: Physiology of Development, Germination and Dormancy, 3rd Edition. New York, NY: Springer New York, pp. 27-83.
100
Black, M., Bewley, J.D. and Halmer, P. (2006) The encyclopaedia of seeds: science, technology and uses: Oxford University Press. Cadman, C.S., Toorop, P.E., Hilhorst, H.W. and Finch-Savage, W.E. (2006) Gene expression profiles of Arabidopsis Cvi seeds during dormancy cycling indicate a common underlying dormancy control mechanism. The Plant journal: for cell and molecular biology, 46, 805-822. Carrera, E., Holman, T., Medhurst, A., Dietrich, D., Footitt, S., Theodoulou, F.L. and Holdsworth, M.J. (2008) Seed after-ripening is a discrete developmental pathway associated with specific gene networks in Arabidopsis. Plant J., 53, 214-224. Chang, K.N., Zhong, S., Weirauch, M.T., Hon, G., Pelizzola, M., Li, H., Huang, S.S., Schmitz, R.J., Urich, M.A., Kuo, D., Nery, J.R., Qiao, H., Yang, A., Jamali, A., Chen, H., Ideker, T., Ren, B., Bar-Joseph, Z., Hughes, T.R. and Ecker, J.R. (2013) Temporal transcriptional response to ethylene gas drives growth hormone cross-regulation in Arabidopsis. eLife, 2, e00675. Cheng, W.H., Endo, A., Zhou, L., Penney, J., Chen, H.C., Arroyo, A., Leon, P., Nambara, E., Asami, T., Seo, M., Koshiba, T. and Sheen, J. (2002) A unique short-chain dehydrogenase/reductase in Arabidopsis glucose signaling and abscisic acid biosynthesis and functions. The Plant cell, 14, 2723-2743. Chibani, K., Ali-Rachedi, S., Job, C., Job, D., Jullien, M. and Grappin, P. (2006) Proteomic analysis of seed dormancy in Arabidopsis. Plant physiology, 142, 1493-1510. Chiwocha, S.D., Cutler, A.J., Abrams, S.R., Ambrose, S.J., Yang, J., Ross, A.R. and Kermode, A.R. (2005) The etr1-2 mutation in Arabidopsis thaliana affects the abscisic acid, auxin, cytokinin and gibberellin metabolic pathways during maintenance of seed dormancy, moist-chilling and germination. The Plant journal: for cell and molecular biology, 42, 35-48. Cocucci, M. and Negrini, N. (1991) Calcium-calmodulin in germination of phacelia- tanacetifolia seeds - effects of light, temperature, fusicoccin and calcium-calmodulin antagonists. Physiologia plantarum, 82, 143-149. Côme, D. and Corbineau, F. (1989) Some Aspects of Metabolic Regulation of Seed Germination and Dormancy. In Recent Advances in the Development and Germination of Seeds (Taylorson, R.B. ed. Boston, MA: Springer US, pp. 165-179.
101
Copeland, L.O. and McDonald, M.B. (2001) Seed Germination. In Principles of Seed Science and Technology. Boston, MA: Springer US, pp. 72-123. Corbineau, F., Bagniol, S. and Come, D. (1990) Sunflower (Helianthus-annuus L) seed dormancy and its regulation by ethylene. Israel Journal of Botany, 39, 313-325. Corbineau, F., Black, M. and Côme, D. (1993) Induction of thermodormancy in Avena sativa seeds. Seed Sci. Res., 3, 111-117. Corbineau, F., Rudnicki, R.M. and Côme, D. (1988) Induction of secondary dormancy in sunflower seeds by high temperature. Possible involvement of ethylene biosynthesis. Physiologia plantarum, 73, 368-373. Covell, S., Ellis, R.H., Roberts, E.H. and Summerfield, R.J. (1986) The influence of temperature on seed germination rate in grain legumes. I. A comparison of chickpea, lentil, soyabean, and cowpea at constant temperatures. Journal of experimental botany, 37, 705-715. Crowe, L.M. and Crowe, J.H. (1992) Anhydrobiosis: a strategy for survival. Advances in space research: the official journal of the Committee on Space Research, 12, 239-247. Dall'Osto, L., Cazzaniga, S., North, H., Marion-Poll, A. and Bassi, R. (2007) The Arabidopsis aba4-1 mutant reveals a specific function for neoxanthin in protection against photooxidative stress. The Plant cell, 19, 1048-1064. Daviere, J.M. and Achard, P. (2013) Gibberellin signaling in plants. Development, 140, 1147- 1151. Donohue, K., Dorn, L., Griffith, C., Kim, E., Aguilera, A., Polisetty, C.R. and Schmitt, J. (2005) Environmental and genetic influences on the germination of Arabidopsis thaliana in the field. Evolution; international journal of organic evolution, 59, 740-757. Dutta, S. and Bradford, K.J. (1994) Water relations of lettuce seed thermoinhibition. II. Ethylene and endosperm effects on base water potential. Seed Sci. Res., 4, 11-18. Egerton-Warburton, L.M. (1998) A smoke-induced alteration of the sub-testa cuticle in seeds of the post-fire recruiter, Emmenanthe penduliflora Benth. (Hydrophyllaceae). Journal of experimental botany, 49, 1317-1327. El-Maarouf-Bouteau, H. and Bailly, C. (2008) Oxidative signaling in seed germination and dormancy. Plant signaling & behavior, 3, 175-182.
102
El-Maarouf-Bouteau, H., Meimoun, P., Job, C., Job, D. and Bailly, C. (2013) Role of protein and mRNA oxidation in seed dormancy and germination. Frontiers in plant science, 4, 77. El-Maarouf-Bouteau, H., Sajjad, Y., Bazin, J., Langlade, N., Cristescu, S.M., Balzergue, S., Baudouin, E. and Bailly, C. (2015) Reactive oxygen species, abscisic acid and ethylene interact to regulate sunflower seed germination. Plant, cell & environment, 38, 364- 374. Fait, A., Angelovici, R., Less, H., Ohad, I., Urbanczyk-Wochniak, E., Fernie, A.R. and Galili, G. (2006) Arabidopsis seed development and germination is associated with temporally distinct metabolic switches. Plant physiology, 142, 839-854. Finch-Savage, W.E., Cadman, C.S.C., Toorop, P.E., Lynn, J.R. and Hilhorst, H.W.M. (2007) Seed dormancy release in Arabidopsis Cvi by dry after-ripening, low temperature, nitrate and light shows common quantitative patterns of gene expression directed by environmentally specific sensing. Plant J., 51, 60-78. Finch-Savage, W.E. and Leubner-Metzger, G. (2006) Seed dormancy and the control of germination. The New phytologist, 171, 501-523. Finkelstein, R., Reeves, W., Ariizumi, T. and Steber, C. (2008) Molecular aspects of seed dormancy. Annual review of plant biology, 59, 387-415. Finkelstein, R.R., Gampala, S.S. and Rock, C.D. (2002) Abscisic acid signaling in seeds and seedlings. The Plant cell, 14 Suppl, S15-45. Footitt, S., Huang, Z., Clay, H.A., Mead, A. and Finch-Savage, W.E. (2013) Temperature, light and nitrate sensing coordinate Arabidopsis seed dormancy cycling, resulting in winter and summer annual phenotypes. The Plant journal: for cell and molecular biology, 74, 1003-1015. Franks, S.J., Weber, J.J. and Aitken, S.N. (2014) Evolutionary and plastic responses to climate change in terrestrial plant populations. Evolutionary applications, 7, 123-139. Frigerio, M., Alabadi, D., Perez-Gomez, J., Garcia-Carcel, L., Phillips, A.L., Hedden, P. and Blazquez, M.A. (2006) Transcriptional regulation of gibberellin metabolism genes by auxin signaling in Arabidopsis. Plant physiology, 142, 553-563. Galland, M. and Rajjou, L. (2015) Regulation of mRNA translation controls seed germination and is critical for seedling vigor. Frontiers in plant science, 6, 284.
103
Gallardo, K., Job, C., Groot, S.P., Puype, M., Demol, H., Vandekerckhove, J. and Job, D. (2002) Proteomics of Arabidopsis seed germination. A comparative study of wild-type and gibberellin-deficient seeds. Plant physiology, 129, 823-837. Gallardo, M., Delgado Mdel, M., Sanchez-Calle, I.M. and Matilla, A.J. (1991) Ethylene Production and 1-Aminocyclopropane-1-Carboxylic Acid Conjugation in Thermoinhibited Cicer arietinum L. Seeds. Plant physiology, 97, 122-127. Gazzarrini, S. and Tsai, A.Y. (2015) Hormone cross-talk during seed germination. Essays in biochemistry, 58, 151-164. Gilmour, S.J. and Thomashow, M.F. (1991) Cold acclimation and cold-regulated gene expression in ABA mutants of Arabidopsis thaliana. Plant molecular biology, 17, 1233- 1240. Giraudat, J., Hauge, B.M., Valon, C., Smalle, J., Parcy, F. and Goodman, H.M. (1992) Isolation of the Arabidopsis ABI3 gene by positional cloning. The Plant cell, 4, 1251-1261. Goldberg, R.B., de Paiva, G. and Yadegari, R. (1994) Plant embryogenesis: zygote to seed. Science, 266, 605-614. Gonai, T., Kawahara, S., Tougou, M., Satoh, S., Hashiba, T., Hirai, N., Kawaide, H., Kamiya, Y. and Yoshioka, T. (2004) Abscisic acid in the thermoinhibition of lettuce seed germination and enhancement of its catabolism by gibberellin. Journal of experimental botany, 55, 111-118. Gonzalez-Guzman, M., Apostolova, N., Belles, J.M., Barrero, J.M., Piqueras, P., Ponce, M.R., Micol, J.L., Serrano, R. and Rodriguez, P.L. (2002) The short-chain alcohol dehydrogenase ABA2 catalyzes the conversion of xanthoxin to abscisic aldehyde. The Plant cell, 14, 1833-1846. Gosti, F., Beaudoin, N., Serizet, C., Webb, A.A., Vartanian, N. and Giraudat, J. (1999) ABI1 protein phosphatase 2C is a negative regulator of abscisic acid signaling. The Plant cell, 11, 1897-1910. Graeber, K., Nakabayashi, K., Miatton, E., Leubner-Metzger, G. and Soppe, W.J. (2012) Molecular mechanisms of seed dormancy. Plant, cell & environment, 35, 1769-1786. Gubler, F., Millar, A.A. and Jacobsen, J.V. (2005) Dormancy release, ABA and pre-harvest sprouting. Current opinion in plant biology, 8, 183-187. Harberd, N.P. (2003) Botany. Relieving DELLA restraint. Science, 299, 1853-1854.
104
Hedden, P. and Phillips, A.L. (2000) Gibberellin metabolism: new insights revealed by the genes. Trends in plant science, 5, 523-530. Hendricks, S.B. and Taylorson, R.B. (1976) Variation in germination and amino Acid leakage of seeds with temperature related to membrane phase change. Plant physiology, 58, 7-11. Hermann, K., Meinhard, J., Dobrev, P., Linkies, A., Pesek, B., Hess, B., Machackova, I., Fischer, U. and Leubner-Metzger, G. (2007) 1-Aminocyclopropane-1-carboxylic acid and abscisic acid during the germination of sugar beet (Beta vulgaris L.): a comparative study of fruits and seeds. Journal of experimental botany, 58, 3047-3060. Hilhorst, H.W.M. (1995) A critical update on seed dormancy. I. Primary dormancy. Seed Sci. Res., 5, 61-73. Hirano, K., Ueguchi-Tanaka, M. and Matsuoka, M. (2008) GID1-mediated gibberellin signaling in plants. Trends in plant science, 13, 192-199. Hoang, H.H., Bailly, C., Corbineau, F. and Leymarie, J. (2013) Induction of secondary dormancy by hypoxia in barley grains and its hormonal regulation. Journal of experimental botany, 64, 2017-2025. Hoang, H.H., Sechet, J., Bailly, C., Leymarie, J. and Corbineau, F. (2014) Inhibition of germination of dormant barley (Hordeum vulgare L.) grains by blue light as related to oxygen and hormonal regulation. Plant, cell & environment, 37, 1393-1403. Hoang, H.H., Sotta, B., Gendreau, E., Bailly, C., Leymarie, J. and Corbineau, F. (2013) Water content: a key factor of the induction of secondary dormancy in barley grains as related to ABA metabolism. Physiologia plantarum, 148, 284-296. Holdsworth, M.J., Bentsink, L. and Soppe, W.J. (2008) Molecular networks regulating Arabidopsis seed maturation, after-ripening, dormancy and germination. The New phytologist, 179, 33-54. Howell, K.A., Narsai, R., Carroll, A., Ivanova, A., Lohse, M., Usadel, B., Millar, A.H. and Whelan, J. (2009) Mapping metabolic and transcript temporal switches during germination in rice highlights specific transcription factors and the role of RNA instability in the germination process. Plant physiology, 149, 961-980. Hubbard, K.E., Nishimura, N., Hitomi, K., Getzoff, E.D. and Schroeder, J.I. (2010) Early abscisic acid signal transduction mechanisms: newly discovered components and newly emerging questions. Genes & development, 24, 1695-1708.
105
Huo, H., Dahal, P., Kunusoth, K., McCallum, C.M. and Bradford, K.J. (2013) Expression of 9- cis-EPOXYCAROTENOID DIOXYGENASE4 is essential for thermoinhibition of lettuce seed germination but not for seed development or stress tolerance. The Plant cell, 25, 884-900. Iuchi, S., Kobayashi, M., Taji, T., Naramoto, M., Seki, M., Kato, T., Tabata, S., Kakubari, Y., Yamaguchi-Shinozaki, K. and Shinozaki, K. (2001) Regulation of drought tolerance by gene manipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis. The Plant journal: for cell and molecular biology, 27, 325- 333. Karssen, C.M., Brinkhorst-van der Swan, D.L., Breekland, A.E. and Koornneef, M. (1983) Induction of dormancy during seed development by endogenous abscisic acid: studies on abscisic acid deficient genotypes of Arabidopsis thaliana (L.) Heynh. Planta, 157, 158-165. Kende, H. (1993) ETHYLENE BIOSYNTHESIS. Annual review of plant physiology and plant molecular biology, 44, 283-307. Kermode, A.R. (2005) Role of Abscisic Acid in Seed Dormancy. Journal of Plant Growth Regulation, 24, 319-344. Khan, A.A. and Karssen, C.M. (1980) Induction of Secondary Dormancy in Chenopodium bonus-henricus L. Seeds by Osmotic and High Temperature Treatments and Its Prevention by Light and Growth Regulators. Plant physiology, 66, 175-181. Kimura, M. and Nambara, E. (2010) Stored and neosynthesized mRNA in Arabidopsis seeds: effects of cycloheximide and controlled deterioration treatment on the resumption of transcription during imbibition. Plant molecular biology, 73, 119-129. Koornneef, M., Jorna, M.L., Brinkhorst-van der Swan, D.L. and Karssen, C.M. (1982) The isolation of abscisic acid (ABA) deficient mutants by selection of induced revertants in non-germinating gibberellin sensitive lines of Arabidopsis thaliana (L.) heynh. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik, 61, 385-393. Koornneef, M. and van der Veen, J.H. (1980) Induction and analysis of gibberellin sensitive mutants in Arabidopsis thaliana (L.) heynh. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik, 58, 257-263.
106
Kpczyska, E., Pikna-Grochala, J. and Kpczyski, J. (2006) Hormonal regulation of tomato seed germination at a supraoptimal temperature. Acta Physiologiae Plantarum, 28, 225- 231. Kucera, B., Cohn, M.A. and Leubner-Metzger, G. (2005) Plant hormone interactions during seed dormancy release and germination. Seed Sci. Res., 15, 281-307. Kushiro, T., Okamoto, M., Nakabayashi, K., Yamagishi, K., Kitamura, S., Asami, T., Hirai, N., Koshiba, T., Kamiya, Y. and Nambara, E. (2004) The Arabidopsis cytochrome P450 CYP707A encodes ABA 8'-hydroxylases: key enzymes in ABA catabolism. The EMBO journal, 23, 1647-1656. Larkindale, J., Hall, J.D., Knight, M.R. and Vierling, E. (2005) Heat stress phenotypes of Arabidopsis mutants implicate multiple signaling pathways in the acquisition of thermotolerance. Plant physiology, 138, 882-897. Layat, E., Leymarie, J., El-Maarouf-Bouteau, H., Caius, J., Langlade, N. and Bailly, C. (2014) Translatome profiling in dormant and nondormant sunflower (Helianthus annuus L) seeds highlights post-transcriptional regulation of germination. The New phytologist, 204, 864-872. Le, B.H., Cheng, C., Bui, A.Q., Wagmaister, J.A., Henry, K.F., Pelletier, J., Kwong, L., Belmonte, M., Kirkbride, R., Horvath, S., Drews, G.N., Fischer, R.L., Okamuro, J.K., Harada, J.J. and Goldberg, R.B. (2010) Global analysis of gene activity during Arabidopsis seed development and identification of seed-specific transcription factors. Proceedings of the National Academy of Sciences of the United States of America, 107, 8063-8070. Lee, K.H., Piao, H.L., Kim, H.Y., Choi, S.M., Jiang, F., Hartung, W., Hwang, I., Kwak, J.M., Lee, I.J. and Hwang, I. (2006) Activation of glucosidase via stress-induced polymerization rapidly increases active pools of abscisic acid. Cell, 126, 1109-1120. Leubner-Metzger, G. (2005) beta-1,3-Glucanase gene expression in low-hydrated seeds as a mechanism for dormancy release during tobacco after-ripening. The Plant journal: for cell and molecular biology, 41, 133-145. Leubner-Metzger, G., Petruzzelli, L., Waldvogel, R., Vogeli-Lange, R. and Meins, F., Jr. (1998) Ethylene-responsive element binding protein (EREBP) expression and the transcriptional regulation of class I beta-1,3-glucanase during tobacco seed germination. Plant molecular biology, 38, 785-795.
107
Leung, J. and Giraudat, J. (1998) Abscisic Acid Signal Transduction. Annual review of plant physiology and plant molecular biology, 49, 199-222. Leymarie, J., Robayo-Romero, M.E., Gendreau, E., Benech-Arnold, R.L. and Corbineau, F. (2008) Involvement of ABA in induction of secondary dormancy in barley (Hordeum vulgare L.) seeds. Plant & cell physiology, 49, 1830-1838. Lim, E.-K., Doucet, C.J., Hou, B., Jackson, R.G., Abrams, S.R. and Bowles, D.J. (2005) Resolution of (+)-abscisic acid using an Arabidopsis glycosyltransferase. Tetrahedron: Asymmetry, 16, 143-147. Lin, Z., Zhong, S. and Grierson, D. (2009) Recent advances in ethylene research. Journal of experimental botany, 60, 3311-3336. Linkies, A. and Leubner-Metzger, G. (2012) Beyond gibberellins and abscisic acid: how ethylene and jasmonates control seed germination. Plant cell reports, 31, 253-270. Linkies, A., Muller, K., Morris, K., Tureckova, V., Wenk, M., Cadman, C.S., Corbineau, F., Strnad, M., Lynn, J.R., Finch-Savage, W.E. and Leubner-Metzger, G. (2009) Ethylene interacts with abscisic acid to regulate endosperm rupture during germination: a comparative approach using Lepidium sativum and Arabidopsis thaliana. The Plant cell, 21, 3803-3822. Long, R.L., Gorecki, M.J., Renton, M., Scott, J.K., Colville, L., Goggin, D.E., Commander, L.E., Westcott, D.A., Cherry, H. and Finch-Savage, W.E. (2015) The ecophysiology of seed persistence: a mechanistic view of the journey to germination or demise. Biological reviews of the Cambridge Philosophical Society, 90, 31-59. Long, S.P. and Ort, D.R. (2010) More than taking the heat: crops and global change. Current opinion in plant biology, 13, 240-247. Ma, Y., Szostkiewicz, I., Korte, A., Moes, D., Yang, Y., Christmann, A. and Grill, E. (2009) Regulators of PP2C phosphatase activity function as abscisic acid sensors. Science, 324, 1064-1068. Manz, B., Muller, K., Kucera, B., Volke, F. and Leubner-Metzger, G. (2005) Water uptake and distribution in germinating tobacco seeds investigated in vivo by nuclear magnetic resonance imaging. Plant physiology, 138, 1538-1551. Marin, E., Nussaume, L., Quesada, A., Gonneau, M., Sotta, B., Hugueney, P., Frey, A. and Marion-Poll, A. (1996) Molecular identification of zeaxanthin epoxidase of Nicotiana
108
plumbaginifolia, a gene involved in abscisic acid biosynthesis and corresponding to the ABA locus of Arabidopsis thaliana. The EMBO journal, 15, 2331-2342. Matilla, A.J. and Matilla-Vazquez, M.A. (2008) Involvement of ethylene in seed physiology. Plant Science, 175, 87-97. Mayer, A.M. and Poljakoff-Mayber, A. (1982). In The Germination of Seeds (Third Edition): Pergamon. Meimoun, P., Mordret, E., Langlade, N.B., Balzergue, S., Arribat, S., Bailly, C. and El-Maarouf- Bouteau, H. (2014) Is gene transcription involved in seed dry after-ripening? PloS one, 9, e86442. Merchante, C., Alonso, J.M. and Stepanova, A.N. (2013) Ethylene signaling: simple ligand, complex regulation. Current opinion in plant biology, 16, 554-560. Morohash.Y and Shimokor.M (1972) Physiological studies on germination of phaseolus- mungo seeds .2. Glucose and organic-acid metabolisms in early phases of germination. Journal of experimental botany, 23, 54. Nakabayashi, K., Okamoto, M., Koshiba, T., Kamiya, Y. and Nambara, E. (2005) Genome-wide profiling of stored mRNA in Arabidopsis thaliana seed germination: epigenetic and genetic regulation of transcription in seed. The Plant journal: for cell and molecular biology, 41, 697-709. Nambara, E., Okamoto, M., Tatematsu, K., Yano, R., Seo, M. and Kamiya, Y. (2010) Abscisic acid and the control of seed dormancy and germination. Seed Sci. Res., 20, 55. Nascimento, W.M., Cantliffe, D.J. and Huber, D.J. (2000) Thermotolerance in lettuce seeds: Association with ethylene and endo-beta-mannanase. Journal of the American Society for Horticultural Science, 125, 518-524. Nascimento, W.M., Vieira, J.V., Silva, G.O., Reitsma, K.R. and Cantliffe, D.J. (2008) Carrot seed germination at high temperature: Effect of genotype and association with ethylene production. Hortscience, 43, 1538-1543. Nicolas, G. and Aldasoro, J.J. (1979) Activity of the pentose-phosphate pathway and changes in nicotinamide nucleotide content during germination of seeds of Cicer-arietinum-L. Journal of experimental botany, 30, 1163-1170. Nonogaki, H. (2014) Seed dormancy and germination-emerging mechanisms and new hypotheses. Frontiers in plant science, 5, 233.
109
North, H.M., De Almeida, A., Boutin, J.P., Frey, A., To, A., Botran, L., Sotta, B. and Marion- Poll, A. (2007) The Arabidopsis ABA-deficient mutant aba4 demonstrates that the major route for stress-induced ABA accumulation is via neoxanthin isomers. The Plant journal: for cell and molecular biology, 50, 810-824. Ogawa, M., Hanada, A., Yamauchi, Y., Kuwahara, A., Kamiya, Y. and Yamaguchi, S. (2003) Gibberellin biosynthesis and response during Arabidopsis seed germination. The Plant cell, 15, 1591-1604. Okamoto, M., Tatematsu, K., Matsui, A., Morosawa, T., Ishida, J., Tanaka, M., Endo, T.A., Mochizuki, Y., Toyoda, T., Kamiya, Y., Shinozaki, K., Nambara, E. and Seki, M. (2010) Genome-wide analysis of endogenous abscisic acid-mediated transcription in dry and imbibed seeds of Arabidopsis using tiling arrays. The Plant journal: for cell and molecular biology, 62, 39-51. Ooms, J., Leon-Kloosterziel, K.M., Bartels, D., Koornneef, M. and Karssen, C.M. (1993) Acquisition of Desiccation Tolerance and Longevity in Seeds of Arabidopsis thaliana (A Comparative Study Using Abscisic Acid-Insensitive abi3 Mutants). Plant physiology, 102, 1185-1191. Oracz, K., El-Maarouf Bouteau, H., Farrant, J.M., Cooper, K., Belghazi, M., Job, C., Job, D., Corbineau, F. and Bailly, C. (2007) ROS production and protein oxidation as a novel mechanism for seed dormancy alleviation. The Plant journal: for cell and molecular biology, 50, 452-465. Oracz, K., El-Maarouf-Bouteau, H., Bogatek, R., Corbineau, F. and Bailly, C. (2008) Release of sunflower seed dormancy by cyanide: cross-talk with ethylene signalling pathway. Journal of experimental botany, 59, 2241-2251. Oracz, K., El-Maarouf-Bouteau, H., Kranner, I., Bogatek, R., Corbineau, F. and Bailly, C. (2009) The mechanisms involved in seed dormancy alleviation by hydrogen cyanide unravel the role of reactive oxygen species as key factors of cellular signaling during germination. Plant physiology, 150, 494-505. Park, S.Y., Fung, P., Nishimura, N., Jensen, D.R., Fujii, H., Zhao, Y., Lumba, S., Santiago, J., Rodrigues, A., Chow, T.F., Alfred, S.E., Bonetta, D., Finkelstein, R., Provart, N.J., Desveaux, D., Rodriguez, P.L., McCourt, P., Zhu, J.K., Schroeder, J.I., Volkman, B.F. and Cutler, S.R. (2009) Abscisic acid inhibits type 2C protein phosphatases via the PYR/PYL family of START proteins. Science, 324, 1068-1071.
110
Pastore, A., Martin, S.R., Politou, A., Kondapalli, K.C., Stemmler, T. and Temussi, P.A. (2007) Unbiased cold denaturation: low- and high-temperature unfolding of yeast frataxin under physiological conditions. Journal of the American Chemical Society, 129, 5374- 5375. Penfield, S. (2008) Temperature perception and signal transduction in plants. The New phytologist, 179, 615-628. Penfield, S. and MacGregor, D. (2014) Temperature sensing in plants. In Temperature and Plant Development: John Wiley & Sons, Inc, pp. 1-18. Petruzzelli, L., Coraggio, I. and Leubner-Metzger, G. (2000) Ethylene promotes ethylene biosynthesis during pea seed germination by positive feedback regulation of 1- aminocyclo-propane-1-carboxylic acid oxidase. Planta, 211, 144-149. Phillips, J., Artsaenko, O., Fiedler, U., Horstmann, C., Mock, H.P., Muntz, K. and Conrad, U. (1997) Seed-specific immunomodulation of abscisic acid activity induces a developmental switch. The EMBO journal, 16, 4489-4496. Piskurewicz, U., Jikumaru, Y., Kinoshita, N., Nambara, E., Kamiya, Y. and Lopez-Molina, L. (2008) The gibberellic acid signaling repressor RGL2 inhibits Arabidopsis seed germination by stimulating abscisic acid synthesis and ABI5 activity. The Plant cell, 20, 2729-2745. Powell, A.A. and Matthews, S. (1978) The damaging effect of water on dry Pea embryos during imbibition. Journal of experimental botany, 29, 1215-1229. Priest, D.M., Ambrose, S.J., Vaistij, F.E., Elias, L., Higgins, G.S., Ross, A.R., Abrams, S.R. and Bowles, D.J. (2006) Use of the glucosyltransferase UGT71B6 to disturb abscisic acid homeostasis in Arabidopsis thaliana. The Plant journal: for cell and molecular biology, 46, 492-502. Rajjou, L., Duval, M., Gallardo, K., Catusse, J., Bally, J., Job, C. and Job, D. (2012) Seed germination and vigor. Annual review of plant biology, 63, 507-533. Rajjou, L., Gallardo, K., Debeaujon, I., Vandekerckhove, J., Job, C. and Job, D. (2004) The effect of alpha-amanitin on the Arabidopsis seed proteome highlights the distinct roles of stored and neosynthesized mRNAs during germination. Plant physiology, 134, 1598- 1613. Raz, V., Bergervoet, J.H. and Koornneef, M. (2001) Sequential steps for developmental arrest in Arabidopsis seeds. Development, 128, 243-252.
111
Rodríguez, M.V., Barrero, J.M., Corbineau, F., Gubler, F. and Benech-Arnold, R.L. (2015) Dormancy in cereals (not too much, not so little): about the mechanisms behind this trait. Seed Sci. Res., 25, 99-119. Rook, F., Corke, F., Card, R., Munz, G., Smith, C. and Bevan, M.W. (2001) Impaired sucrose- induction mutants reveal the modulation of sugar-induced starch biosynthetic gene expression by abscisic acid signalling. The Plant journal: for cell and molecular biology, 26, 421-433. Ruelland, E. and Zachowski, A. (2010) How plants sense temperature. Environ. Exp. Bot., 69, 225-232. Ruiz-Sola, M.A. and Rodriguez-Concepcion, M. (2012) Carotenoid biosynthesis in Arabidopsis: a colorful pathway. The Arabidopsis book / American Society of Plant Biologists, 10, e0158. Saini, H.S., Consolacion, E.D., Bassi, P.K. and Spencer, M.S. (1989) Control processes in the induction and relief of thermoinhibition of lettuce seed germination: actions of phytochrome and endogenous ethylene. Plant physiology, 90, 311-315. Saito, S., Hirai, N., Matsumoto, C., Ohigashi, H., Ohta, D., Sakata, K. and Mizutani, M. (2004) Arabidopsis CYP707As encode (+)-abscisic acid 8'-hydroxylase, a key enzyme in the oxidative catabolism of abscisic acid. Plant physiology, 134, 1439-1449. Salon, C., Raymond, P. and Pradet, A. (1988) Quantification of carbon fluxes through the tricarboxylic-acid cycle in early germinating lettuce embryos. J. Biol. Chem., 263, 12278-12287. Schneider, G., Jensen, E., Spray, C.R. and Phinney, B.O. (1992) Hydrolysis and reconjugation of gibberellin A20 glucosyl ester by seedlings of Zea mays L. Proceedings of the National Academy of Sciences of the United States of America, 89, 8045-8048. Schneider, G. and Schliemann, W. (1994) Gibberellin conjugates: an overview. Plant Growth Regulation, 15, 247-260. Schwartz, S.H., Tan, B.C., Gage, D.A., Zeevaart, J.A. and McCarty, D.R. (1997) Specific oxidative cleavage of carotenoids by VP14 of maize. Science, 276, 1872-1874. Schweighofer, A., Hirt, H. and Meskiene, I. (2004) Plant PP2C phosphatases: emerging functions in stress signaling. Trends in plant science, 9, 236-243. Seo, M., Nambara, E., Choi, G. and Yamaguchi, S. (2009) Interaction of light and hormone signals in germinating seeds. Plant molecular biology, 69, 463-472.
112
Shirley, B.W., Kubasek, W.L., Storz, G., Bruggemann, E., Koornneef, M., Ausubel, F.M. and Goodman, H.M. (1995) Analysis of Arabidopsis mutants deficient in flavonoid biosynthesis. Plant J., 8, 659-671. Sreenivasulu, N., Borisjuk, L., Junker, B.H., Mock, H.P., Rolletschek, H., Seiffert, U., Weschke, W. and Wobus, U. (2010) Barley grain development toward an integrative view. International review of cell and molecular biology, 281, 49-89. Stephen, W.A., Mary, L. and Stephen, J.S. (1986) Variation within Pure Lines of Wild Oats (Avena fatua) in Relation to Degree of Primary Dormancy. Weed Science, 34, 859-864. Sun, T.P. (2011) The molecular mechanism and evolution of the GA-GID1-DELLA signaling module in plants. Current biology: CB, 21, R338-345. Tan, B.C., Schwartz, S.H., Zeevaart, J.A. and McCarty, D.R. (1997) Genetic control of abscisic acid biosynthesis in maize. Proceedings of the National Academy of Sciences of the United States of America, 94, 12235-12240. Taylor, N.J., Hills, P.N., Gold, J.D., Stirk, W.A. and van Staden, J. (2005) Factors contributing to the regulation of thermoinhibition in Tagetes minuta L. Journal of plant physiology, 162, 1270-1279. Toh, S., Imamura, A., Watanabe, A., Nakabayashi, K., Okamoto, M., Jikumaru, Y., Hanada, A., Aso, Y., Ishiyama, K., Tamura, N., Iuchi, S., Kobayashi, M., Yamaguchi, S., Kamiya, Y., Nambara, E. and Kawakami, N. (2008) High temperature-induced abscisic acid biosynthesis and its role in the inhibition of gibberellin action in Arabidopsis seeds. Plant physiology, 146, 1368-1385. Umezawa, T., Sugiyama, N., Mizoguchi, M., Hayashi, S., Myouga, F., Yamaguchi-Shinozaki, K., Ishihama, Y., Hirayama, T. and Shinozaki, K. (2009) Type 2C protein phosphatases directly regulate abscisic acid-activated protein kinases in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America, 106, 17588-17593. Vigh, L., Horvath, I., Maresca, B. and Harwood, J.L. (2007) Can the stress protein response be controlled by 'membrane-lipid therapy'? Trends in biochemical sciences, 32, 357-363. Vlad, F., Rubio, S., Rodrigues, A., Sirichandra, C., Belin, C., Robert, N., Leung, J., Rodriguez, P.L., Lauriere, C. and Merlot, S. (2009) Protein phosphatases 2C regulate the activation of the Snf1-related kinase OST1 by abscisic acid in Arabidopsis. The Plant cell, 21, 3170- 3184.
113
Wang, K.L., Li, H. and Ecker, J.R. (2002) Ethylene biosynthesis and signaling networks. The Plant cell, 14 Suppl, S131-151. Washio, K. and Ishikawa, K. (1994) Organ-specific and hormone-dependent expression of genes for serine carboxypeptidases during development and following germination of rice grains. Plant physiology, 105, 1275-1280. Weitbrecht, K., Muller, K. and Leubner-Metzger, G. (2011) First off the mark: early seed germination. Journal of experimental botany, 62, 3289-3309. Wigge, P.A. (2013) Ambient temperature signalling in plants. Current opinion in plant biology, 16, 661-666. Xiong, L., Lee, H., Ishitani, M. and Zhu, J.K. (2002) Regulation of osmotic stress-responsive gene expression by the LOS6/ABA1 locus in Arabidopsis. The Journal of biological chemistry, 277, 8588-8596. Xiong, L. and Zhu, J.K. (2003) Regulation of abscisic acid biosynthesis. Plant physiology, 133, 29-36. Xu, Z.Y., Lee, K.H., Dong, T., Jeong, J.C., Jin, J.B., Kanno, Y., Kim, D.H., Kim, S.Y., Seo, M., Bressan, R.A., Yun, D.J. and Hwang, I. (2012) A vacuolar beta-glucosidase homolog that possesses glucose-conjugated abscisic acid hydrolyzing activity plays an important role in osmotic stress responses in Arabidopsis. The Plant cell, 24, 2184-2199. Yamaguchi, S. (2008) Gibberellin metabolism and its regulation. Annual review of plant biology, 59, 225-251. Yamauchi, Y., Ogawa, M., Kuwahara, A., Hanada, A., Kamiya, Y. and Yamaguchi, S. (2004) Activation of gibberellin biosynthesis and response pathways by low temperature during imbibition of Arabidopsis thaliana seeds. The Plant cell, 16, 367-378. Yang, S.F. and Hoffman, N.E. (1984) Ethylene biosynthesis and its regulation in higher-plants. Annual review of plant physiology and plant molecular biology, 35, 155-189. Yoshioka, T., Endo, T. and Satoh, S. (1998) Restoration of Seed Germination at Supraoptimal Temperatures by Fluridone, an Inhibitor of Abscisic Acid Biosynthesis. Plant and Cell Physiology, 39, 307-312. Zentella, R., Zhang, Z.L., Park, M., Thomas, S.G., Endo, A., Murase, K., Fleet, C.M., Jikumaru, Y., Nambara, E., Kamiya, Y. and Sun, T.P. (2007) Global analysis of della direct targets in early gibberellin signaling in Arabidopsis. The Plant cell, 19, 3037-3057
114
Annexes
Annexe 1 One way to achieve germination: common molecular mechanism of ethylene and after-ripening
Qiong Xia1, Marine Saux1, Françoise Gilard2, François Perreau3, Stéphanie Huguet4, Sandrine Balzergue4, Nicolas Langlade5, Christophe Bailly1, Hayat El-Maarouf-Bouteau1*
1- Sorbonne Universités, UPMC Univ Paris 06, CNRS, Biologie du développement Paris Seine - Institut de Biologie Paris Seine (LBD - IBPS), 75005 Paris, France
2- Plateforme Métabolisme-Métabolome, Institute of Plant Sciences Paris-Saclay (IPS2), UMR 9213/UMR1403, CNRS, INRA, Université Paris-Sud, Université d'Evry, Université Paris-Diderot, Sorbonne Paris-Cité, Saclay Plant Sciences, Bâtiment 630, 91405 0rsay, France
3- Institut Jean-Pierre Bourgin (UMR1318 INRA – AgroParisTech), Institut National de la Recherche Agronomique, Saclay Plant Science, Versailles, France
4- Unité de Recherche en Génomique Végétale (URGV), Evry Cedex, France
5- Laboratoire Interactions Plantes Microorganismes, INRA, Castanet Tolosan, France
Running head: Metabolome and transcriptome in seed germination
*Corresponding author: Hayat El-Maarouf-Bouteau ; Sorbonne Universités, UPMC Univ Paris 06, UMR 7622, 75005 Paris, France; (33)144275929 ; [email protected]
115
Summary
Dormancy is an adaptive trait that blocks seed germination until the environmental conditions become favorable for subsequent vegetative plant growth. Seed dormancy is defined as the inability to germinate at favorable conditions. Dormancy is alleviated during after-ripening, a dry storage period, during which dormant (D) seeds unable to germinate become non- dormant (ND), able to germinate in a wide range of environmental conditions. Treatment of dormant seeds with ethylene (D/ET) promotes seed germination and ABA treatment inhibits non-dormant (ND/ABA) seeds germination in sunflower (Helianthus annuus). Metabolomic and transcriptomic studies have been performed during imbibition to compare germinating seeds (ND and D/ET) and non-germinating seeds (D and ND/ABA). Principal component analysis (PCA) of metabolite contents showed that imbibition did not trigger significant change during the first hours (3 and 15h). Metabolic changes associated to germination capacity occurred at 24h and was related to hexoses, as their content was higher in ND and D/Eth and reduced by ABA treatment. At the transcriptional level, a large number of genes were altered oppositely in germinating seeds as compared to non-germinating ones. Metabolomic and transcriptomic results were integrated in the interpretation of processes involved in germination. Our results show that ethylene treatment triggers molecular changes comparable to that of after-ripening treatment concerning sugar metabolism and ABA signaling inhibition.
116
Introduction
Seed dormancy is a fundamental adaptive trait that enables species persistence, by blocking mature seed germination until conditions become favorable for seedlings establishment. Seed dormancy is alleviated during a period of dry storage called after-ripening after which dormant seeds become able to germinate. Germination begins with water uptake by the seed and ends with the start of embryonic axis elongation. After-ripening depends on environmental factors such as temperature, light, oxygen and moisture that affect seed hormonal balance determining dormancy alleviation. Hormonal regulation of dormancy and germination is well established (for review North et al., 2010). Abscissic acid (ABA) is involved in the induction and the maintenance of seed dormancy while other hormones as gibberellic acid (GA), ethylene or brassinosteroides are positive regulators of seed germination (Finkelstein et al., 2008). Ethylene regulation of germination and dormancy has been demonstrated using physiological studies or mutants affected in ethylene synthesis and signaling. This regulation was related to direct ethylene action but also to ABA sensitivity change. In fact, ethylene overcomes the inhibitory action of ABA on germination in numerous species (for review Corbineau et al., 2014). In sunflower, ethylene supply breaks dormancy and endogenous ethylene is increased by dormancy alleviation treatments as methylviologen, a reactive oxygen species (ROS)- generating compound, or cyanide (HCN) (Corbineau et al., 1990; Oracz et al., 2008, 2009; El- Maarouf-Bouteau et al., 2015). After-ripening did not trigger ethylene increase before the end of germination sensu stricto in sunflower (El-Maarouf-Bouteau et al., 2015). It was shown that a peak of ethylene emission was concomitant with radicle protrusion through the seed coat in different species (reviewed in Corbineau et al., 2014). However, Ethylene Responsive Factor (ERF1) gene expression was fivefold higher in non-dormant than in dormant embryos, and markedly stimulated by HCN in sunflower (Oracz et al., 2008) suggesting that ethylene signaling is acting before the peak recorded during radicle protrusion probably due to ethylene production below the detectable level.
Global analyses have been used in the last few years in order to discover and connect the mechanisms involved in dormancy alleviation process. Transcriptional studies showed that genes related to ABA and stress response as late embryogenesis or heat-shock proteins are over represented in dormant (D) seeds while genes associated with protein synthesis including RNA translation, protein degradation and also cell wall modification were reduced compared
117
to after-ripened, non-dormant (ND) seeds (Cadman et al., 2006; Carrera et al., 2008). The same protein families have been identified in proteomic analyses of seed dormancy and germination. Stress related proteins were more abundant in D seeds while proteins related to protein metabolism and folding, energy and glycolysis are up-regulated in germinating seeds (Yang et al., 2007; Arc et al., 2012). Fait et al. (2006) showed that TCA-cycle intermediates, 2- oxoglutarate and isocitrate, as well as dehydroascorbate, 3-phosphoglycerate, fructose-6- phosphate (Fru6P) and glucose-6-phosphate (Glc6P) increased, while numerous amino-acids and sugars were reduced during seed vernalization and germination sensu stricto. However, the relationship between hormones and seed metabolism associated with germination and the way by which hormonal balance and sensitivity change during imbibition after dormancy alleviation, are still unclear. To answer these questions, we performed transcriptomic and metabolomic analyses during imbibition comparing germinating seeds, ND and D/ET (D treated with ethylene) and non-germinating seeds D and ND/ABA (ND treated with ABA). Imbibition times were chosen in order to be prior to the end of germination sensu stricto (between 0 to 24h) to target processes that induce germination and not elongation and growth which happened at 48h of imbibition. In this paper, we show a high similarity between ethylene and after-ripening treatments and a determinant cross-talk with ABA signaling in the induction of germination.
Results
Seed physiology
Figure 1 shows that sunflower seeds are deeply dormant at harvest as only 25 % of seeds can germinate after 7 days of imbibition at 10°C. After-ripening alleviates this dormancy as ND seeds germinate at 97 % (Fig. 1). Ethylene treatment is efficient in dormancy breaking; it allows the germination of D seeds at 100 % (Fig. 1). The proportion of seeds which germinate in D or
ND was halved by ethylene synthesis inhibitors, AIB and CoCl2, and ABA treatments. AIB and
CoCl2 inhibit 1-aminocyclopropane 1-carboxylic acid (ACC)-oxidase, the enzyme that produces ethylene from the oxidation of ACC (Lau and Yang, 1976). These results suggest that ethylene synthesis is important for sunflower seed germination to counteract ABA induced dormancy (Fig. 1). ABA being responsible for dormancy maintenance during imbibition, ABA content has been quantified in order to characterize the kinetics of dormancy breaking during the chosen
118
imbibition times. Figure 2 shows that in D seeds, ABA content is reduced at 15 h and then increased at 24h of imbibition while in ND seeds, ABA decreased continuously during imbibition. The largest variation between D and ND seeds occurred thus at 24h of imbibition (24ng/mg DW and 5ng/mg DW, in D and ND, respectively, Fig. 2).
Metabolome analysis
Non-targeted metabolome analysis was performed on D and ND dry seeds, D and ND seeds imbibed on water, ethylene-treated D (D/ET) and ABA-treated ND (ND/ABA) seeds for 3, 15 and 24h at 10°C. Principal component analysis (PCA) using Pearson correlation (p<0,005) of metabolites content showed sample differentiation in 3 groups (Fig. 3 and Supplemental Table S1). One group contains dry D and ND seeds in addition to imbibed D and ND seeds on water, D/ET and ND/ABA for 3h; demonstrating that no significant change in metabolites happened in the 3 first hours of imbibition. A second group contains imbibed seeds for 15h for all treatments but also D imbibed on water and ND/ABA at 24h indicating that metabolite profile at 15h cannot discriminate between germinating and non-germinating seeds and that the metabolism of non-germinating seeds (D and ND/ABA) did not changed between 15 and 24h. Interestingly, only ND and D/ET for 24h are represented in the last group, suggesting that the differentiation between germinating and non-germinating seeds occurred between 15 and 24h of imbibition. In fact, ABA treatment on ND seeds maintained their metabolism at 24h close to that of the second group (Fig. 3). Thus, based on this analysis we can conclude that imbibition has an influence on the change of the entire metabolism between 3 and 15h whatever the physiological state but that metabolic changes related to germination potential occur at 24h. Therefore, altered metabolites were analyzed at 24h of imbibition comparing ND and D/ET to D; and also ND/ABA to ND seeds. It is worth noting that among the 86 metabolites detected (Supplemental Table S1), significant changes between the different conditions (> 2 fold at p < 0.05) concerned only few metabolites. In fact, only glucose, fructose and xylose contents changed between D and ND metabolite profiles (Fig. 4A). They were accumulated more than 3 fold in ND and D/ET. ABA treatment of ND seeds did not allow this accumulation; sugar content being comparable to that of D (Fig. 4C). Slight accumulation of some amino acids was observed in ethylene treatment (Fig. 4B) and sorbitol was up- accumulated in D/ET and in ND/ABA (Fig. 4B and 4C). These results showed that hexose content seems to be associated to germination potential.
119
Transcriptome analysis
Transcriptomic changes between germinating and non-germinating seeds were studied by microarray analysis using the same conditions as in metabolomic analysis (D, ND, D/ET, ND/ABA at 24h). Gene ontology (GO) annotations based on MapMan software and Ashburner et al. (2000) showed that altered transcripts in all treatments belong to the same classes (Fig. 5). Transcriptome analysis by PCA confirmed that in ND and D/ET, the gene variation is similar at a high extent as PCA axes F1 and F2 can explain variability at the score of 83,78 % (Fig. 6). ABA treatment on ND seeds (ND/ABA) induced important change in gene expression as compared to ND but did not reverse gene expression to that of D seeds (Fig.6). Interestingly, all altered genes in ND/ABA as compared to D were altered oppositely in ND and D/ET, thus they could represent good candidates for germination induction (Table 1). Up-regulated genes in germinating seeds and down-regulated genes in non-germinating seeds are members of sugar and cell wall metabolism such as glycosyltransferase, β-xylosidase or xyloglucan endotransglucosylase/hydrolase. Hormone metabolism related genes are also represented by GAST1 protein homolog, S-adenosylmethionine decarboxylase, MYB-related transcription factor family or an AP2/EREBP member and B12D. Genes involved in signaling such as MAPKKK 20 like and amino acid transport, or in development, such as pentatricopeptide and DUF 3049, are also of high interest. Genes regulated in the opposite way (down in germinating seeds and up in non-germinating seeds) are represented by members of lipid, cell wall, oxidation- reduction metabolism, LEA family, and also hormones metabolism regulators (Table 2; Supplemental Table S2). Nine genes belonging to the two categories have been used for qPCR validation (Supplemental Fig. S1). Microarray and qPCR values correlated at a high coefficient of 0, 83.
The first version of sunflower genome annotation (https://www.heliagene.org/HA412.v1.1.bronze.20141015/) allowed us to analyze the cis- elements present in the 500 bp promoter regions of these common genes. Thirty six percent (8 out of 22 sequences) of up-regulated genes in ND and D/ET and down-regulated in ND/ABA contained an homeodomain binding site ATHB6, a target of ABI1, a negative regulator of ABA signaling (Himmelbach et al., 2002). Sixteen percent (4 of 24 sequences) of down-regulated genes in ND and D/ET and up-regulated in ND/ABA contained a Z-box motif (Ha and An, 1988). Z-box is recognized by AtMYC2 and AtMYB2 biding factors shown to be transcriptional
120
activators in ABA-inducible gene expression under drought stress in plants (Abe et al., 2003) and as a negative regulator of the JA/ET-dependent anti-fungal defense program (Zander et al., 2010). These results confirm that ethylene and ABA cross-talk in germination execution in sunflower seeds.
Discussion
Sunflower seeds are dormant at harvest and exogenous ethylene application improved efficiently their germination (Fig. 1). The involvement of endogenous ethylene in the regulation of sunflower seed dormancy and germination has been assessed by using inhibitors of ethylene synthesis. Figure 1 showed that ethylene inhibitors reduced germination of ND seeds which clearly demonstrates that ethylene evolved by the seeds plays an important role in breaking embryo dormancy. Ethylene is important in germination promotion in several species (Linkies and Leubner-Metzger, 2012). Other hormones such as GA, auxin or brassinosteroides or small molecules like ROS and NO can break dormancy depending on species (Finkelstein et al., 2002). Dormancy release process may be specific to each specie due to seed structure or composition, environment or crop selection, whereas, dormancy induction and maintenance is common as ABA has a conserved role in these processes across species (Nambara and Marion-Poll, 2005; Linkies and Leubner-Metzger, 2012). Therefore, it is important when studying dormancy related mechanisms to characterize seed physiological state by quantifying ABA during imbibition times as dormancy depends on seed lots and environmental conditions as related to ABA content (Finch-Savage and Leubner-Metzger, 2006). In sunflower seeds, ABA content decreased similarly in D and ND seeds upon imbibition till 15 h, and then it increased only in D seeds at 24h (Fig. 2). This pattern has been observed in several species due to the regulation of both ABA catabolism and neo-synthesis (for review, Arc et al., 2013). Seed imbibition time 24h was also the time that allows the differentiation between the metabolism of germinating seeds (D/ET and ND) and non-germinating seeds (D and ND/ABA). Furthermore, ABA treatment on ND seeds maintained their metabolism close to that of D seeds (Fig. 3). ABA seems to represent the key regulator of metabolism remodeling to determine seed germination capacity.
Metabolites comparison at 24 h of imbibition showed that only fructose, glucose and xylose increased in ND seeds when compared to D (Fig. 4A). They also increased in D/ET and
121
decreased upon ABA treatment as ND/ABA hexoses content is similar to that of D (Fig. 4; Supplemental Table S1). Glucose and fructose are the products of sucrose degradation. In our samples, sucrose content did not change significantly between D and ND or D/ET (Supplemental Table S1). It can be explained by an alteration in both sucrose generation and degradation processes. Sucrose synthase 3 (SUS3) gene expression is down-regulated in germinating seeds while it was induced in ABA treated seeds (Table 2). Sucrose synthase catalyzes the reversible cleavage of sucrose into UDP-glucose and fructose. SUS is supposed to be important in the rate of seed development by the influence of the sucrose/hexose ratio on the pattern of storage compounds in Arabidopsis (Angeles-Nunez and Tiessen, 2010). AtSUS3 transcripts were induced in mid seed development, increased in abundance in the mature seed, and decreased to undetectable levels in germinating seed in Arabidopsis (Bieniawska et al., 2007). Our results suggest that the sucrose/hexose ratio may be determinant in metabolism of seed germination.
Hexoses can also be generated by cellulose and hemicellulose depolymerization. In accordance, β-xylosidase 2 and 4 transcripts were shown to be up-regulated in ND and D/ET and down-regulated in ND/ABA (Table 1); they are involved in the conversion of (1->4)-β-D- xylan oligosaccharide to β-D-xylopyranose which generates D-xylulose. Furthermore, xyloglucan endotransglucosylase/hydrolase (XTH) which cleaves and relegates xyloglucan polymers is also up-regulated in ND and D/ET (Supplemental Table S2). These proteins modify cell wall to make it more extensible, thereby facilitating cellular expansion (Sasidharan and Pierik, 2010). XTH and xylosidase are induced by GA and ethylene, respectively (Jan et al., 2004; Hayama et al., 2006). In D/ET, glucose 6P and fructose 6P were significantly over- accumulated (Fig. 4B) suggesting the activation of glycolysis and TCA is also activated by ethylene as oxalic acid content decreased and that of malic acid increased (Fig. 4B). The accumulation of hexose phosphates and TCA cycle intermediates has been reported during Arabidopsis seed stratification (Fait et al., 2006). These results indicate that ethylene induces comparable metabolic changes to that of seed stratification.
Principal component analysis of altered gene expression showed that ND and D/ET are highly similar (Fig. 6). ND/ABA is however distinct from D whereas their metabolism was comparable at 24h (Fig. 3; 4). Previous works argued that ABA treated seeds are not close to dormant ones at the metabolic and physiological level (Pritchard et al., 2002; Müller et al., 2006; Carrera et
122
al., 2008). In sunflower, exogenous application of ABA can inhibit germination but not efficiently in all seeds as germination percentage of ND/ABA remains 2 fold higher than that of D (Fig. 1). ND/ABA seed population is therefore enriched by germinating seeds. However, we show here that a significant proportion of genes were altered oppositely in ND and D/ET compared to ND/ABA (Table 1). They correspond to almost all genes altered in ND/ABA condition (Table 1; Supplemental Table S2). In addition to sugar and cell wall related genes discussed in metabolic part, genes related to hormone response were represented in up- regulated in germinating seeds and down-regulated in non-germinating seeds, such as gibberellin-regulated protein GASA4 which promotes GA responses and exhibits redox activity, S-adenosylmethionine decarboxylases (SAMDCs) involved in polyamine biosynthetic pathway, Myb and AP2/EREBP transcription factors (TFs) and MKKK20 (Table 1; Supplemental Table S2). Some Myb TFs might function as key mediators of stress responses and can be regulated by hormones as ABA and JA (Fujita et al. 2006; 2009; 2011). It has been shown that a Myb TF, DUO1 is targeted by MKKK20 pathway (Borg et al., 2011). AP2/EREBP transcription factors have been implicated in hormone, sugar and redox signaling in the context of abiotic stresses such as cold and drought (Dietz et al., 2010). RAP2.6, an Arabidopsis AP2/ERF family member, can function in multiple abiotic stresses during seed germination, including salt, osmotic, and cold stress (Zhu et al., 2010). On the other hand, ABA responsive genes such as ABI2 and ABI five binding protein 3 and stress related genes (dehydrin and LEA) were represented in down-regulated genes in germinating seeds that are up-regulated in non- germinating seeds (Table 2). These elements are likely to be the target of hormone cross-talk signaling pathway.
Genes involved in organelle functioning have been identified in up-regulated genes in germinating seeds, such as Seed Imbibition 1 (SIP1), B12D and pentapeptide. SIP1.1 and SIP1.2 may function as water channels in the ER (Ishikawa, 2005). B12D1 was identified in the mitochondrion in rice seeds and was proposed to enhance electron transport through mediating Fe and oxygen availability under flooded conditions during germination (He et al., 2014). Pentapeptide is targeted to mitochondria or chloroplasts, binds one or several organellar transcripts, and influences their expression by altering RNA sequence, turnover, processing or translation. Their combined action has profound effects on organelle biogenesis and function and, consequently, on photosynthesis, respiration, plant development, and
123
environmental responses (for review Barkan and Small, 2014). These genes may be involved in organelles functioning resumption necessary for germination.
Cytochrome P450 and glutathione peroxidase (GPX) were characterized in down-regulated genes in germinating seeds that are up-regulated in non-germinating seeds (Table 2). GPXs catalyze the reduction of lipid peroxides and other organic peroxides to the corresponding alcohols using thioredoxins as preferred electron donors (Herbette et al., 2002; Navrot et al., 2006). The major function of GPXs in plants is the scavenging of phospholipid hydroperoxides and thereby the protection of cell membranes from peroxidative damage (Gueta-Dahan et al., 1997). On the other hand, recent data emphasized the role of GPXs in redox signal transduction under stressful conditions (Miao et al., 2006). Redox responsive genes such as RD21 and Pap15 that are up-regulated in D/ET, have been associated with sunflower seed dormancy alleviation induced by methylviologen (MV), a ROS generating compound (El- Maarouf-Bouteau et al., 2015). Similarly, ABA signaling elements were down-regulated by MV, suggesting a cross-talk between ROS and hormones in sunflower seed germination (El- Maarouf-Bouteau et al., 2015). The common underlying mechanism may be redox signaling as several redox genes were altered in ND and D/ET, e.g. glutathione S-transferase which represent an important component of redox system (Supplemental Table S2). Cross-talk between ROS and hormones regulates many metabolic and developmental processes in plants (for review, Kocsy et al., 2013). In the event that the germination is a conserved mechanism, after-ripening may trigger a redox potential change following ROS amplification that determines hormone signaling. Ethylene treatment may induce redox potential change by its action on ROS production evidenced in El-Maarouf-Bouteau et al. (2015) and cross-talks with ABA signaling towards germination processes by reducing sucrose/hexose ratio which activates TCA cycle, glycolysis and organellar function.
Conclusion
This study evidenced that ethylene treatment triggers comparable molecular change to after- ripening treatment suggesting that dormancy alleviation is based on a unique execution program. Moreover, ABA treatment induces opposite regulation of genes and metabolites compared to ND and D/ET. It further provides a strong indication that sucrose/hexoses ratio could be determinant in cell metabolism activation towards radicle elongation. Furthermore,
124
transcriptomic data provides accurate information about ABA and ethylene responsive genes in seeds that will help to unravel the signaling network as a whole.
Material and methods
Seeds and treatments
Sunflower seeds (Helianthus annuus L) cultivar LG5665 were grown by Valgrain in open field in South of France in 2010. Mature seeds were stored at -20°C to preserve dormancy (dormant seeds, D) and at 20°C for 2 months to release dormancy (non-dormant seeds, ND). Treatment with ethylene was carried out by placing D embryos on water in the presence of 100 ppm of gaseous ethylene in closed Petri dishes as described by Corbineau et al. (1990) (D/ET). ABA and GA treatment consisted in ND seed imbibition with ABA solution at 10-5 M (ND/ABA) and GA solution at 10-4 M. Ethylene synthesis inhibitors treatment was done by imbibing seeds with 1 mM solution of inhibitors of ACC oxidase activity, α-aminoisobutyric acid (AIB) and cobalt chloride (CoCl2). All treatments were performed on embryos (seeds without pericarp) to focus on embryo dormancy. Embryonic axis (Oracz et al., 2008) were isolated, frozen in liquid nitrogen and stored at – 80 °C until use for ABA quantification and omics analysis.
Germination tests
Germination assays were carried out on 25 sunflower embryos (4 replicates) in 9 cm Petri dishes on water or with various solutions in the darkness at 10°C. Germination was counted daily and an embryo was considered as germinated when the radicle starts to elongate.
ABA quantification
100 mg of freeze-dried axes were ground in 7 or 1.5 ml of extraction solvent, respectively (acetone:water:acetic acid, 80:19:1, v:v:v) containing 50 ng of deuterated ABA (purchased from Irina Zaharia, Plant Biotechnology Institute, National Research Council Canada, http://www.nrc-cnrc.gc.ca) as internal standard. Samples were analyzed as previously described (Plessis et al., 2011). ABA was quantified using an LC-ESI-MS-MS system (Quattro LC; Waters, http://www.waters.com).
125
Metabolite extraction, identification and GC-TOF analyses
Metabolites were extracted from lyophilized samples using methanol/water mixture (80/20 v/v). Metabolite derivatization, GC (gas chromatography)-TOF (time-offlight)-MS, data processing and profile analyses were performed as described in Noctor et al. (2007). Each metabolite was identified by comparison of spectra with those obtained using the corresponding pure metabolite and its relative amount was calculated on the basis of the corresponding peak area compared with an internal standard (ribitol). The analysis was performed using a on a LECO Pegasus III with an Agilent (Massy, France) 6890N GC system and an Agilent 7683 automatic liquid sampler. The column was an RTX-5 w/integra-Guard (30m_0.25mm internal diameter + 10m integrated guard column) (Restek, Evry, France). The combination of chromatography retention time (t) and parent mass pattern was used to selectively monitor the different metabolites. The different samples were spiked with internal standard molecule (ribitol) to evaluate the level of analysis reproducibility. 86 among 144 metabolites (listed in table S2) from the different samples were quantified by reporting MS peak areas to calibration curves made with standard molecules of lactate, fructose and urea at different concentrations.
RNA extraction, microarray hybridization and analysis
Total RNA was extracted as previously described by Oracz et al. (2009). RNA hybridization (two biological and two technical repetitions) was performed using Affymetrix Sunflower Gene WT Chip at the affymetrix platform (INRA-URGV) and the protocol developed on sunflower seeds (Bazin et al., 2011; Meimoun et al., 2014; El-Maarouf-Bouteau et al., 2013). Statistical analysis were based on t-test adjusted with Bonferoni method (Bazin et al. 2011; Meimoun et al., 2014; El-Maarouf-Bouteau et al., 2013). A Bonferroni P-Value less than 0.05 was required for significant variation in gene expression. Data are available on gene expression omnibus (GEO) repository of the national center for biotechnology information (NCBI) at the accession number of GSE44165.
Real-time quantitative RT–PCR
Quantitative PCR was performed according to Meimoun et al. (2014). Relative expression was calculated according to Hellemans et al., 2007, with HaEF1, Haβ-tubulin and HaS19 as
126
reference genes (Meimoun et al., 2013; El-Maarouf-Bouteau et al., 2014). Gene names and corresponding primers used are listed in supplemental Table 3. An arbitrary value of 100 was assigned to dormant seed samples, which were used as control samples for normalization (Pfaffl et al., 2001). Results presented are the means of three biological replicates ± SD.
References
Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell 15: 63-78 Angeles-Nunez JG, Tiessen A (2010) Arabidopsis sucrose synthase 2 and 3 modulate metabolic homeostasis and direct carbon towards starch synthesis in developing seeds. Planta 232: 701-718 Arc E, Chibani K, Grappin P, Jullien M, Godin B, Cueff G, Valot B, Balliau T, Job D, Rajjou L (2012) Cold stratification and exogenous nitrates entail similar functional proteome adjustments during Arabidopsis seed dormancy release. J Proteome Res 11: 5418-5432 Arc E, Sechet J, Corbineau F, Rajjou L, Marion-Poll A (2013) ABA crosstalk with ethylene and nitric oxide in seed dormancy and germination. Front Plant Sci. 4: 63. Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, Harris MA, Hill DP, Issel-Tarver L, Kasarskis A, Lewis S, Matese JC, Richardson JE, Ringwald M, Rubin GM, Sherlock G (2000) Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 25: 25-29 Bailly C, El Maarouf Bouteau H, Corbineau F (2008) Seed dormancy alleviation and oxidative signaling. J Soc Biol 202: 241-248 Bailly C, El-Maarouf-Bouteau H, Corbineau F (2008) From intracellular signaling networks to cell death: the dual role of reactive oxygen species in seed physiology. C R Biol 331: 806-814 Bailly C, Leymarie J, Lehner A, Rousseau S, Come D, Corbineau F (2004) Catalase activity and expression in developing sunflower seeds as related to drying. J Exp Bot 55: 475-483 Barkan A, Small I (2014) Pentatricopeptide repeat proteins in plants. Annu Rev Plant Biol 65: 415-442
127
Bazin J, Langlade N, Vincourt P, Arribat S, Balzergue S, El-Maarouf-Bouteau H, Bailly C (2011) Targeted mRNA oxidation regulates sunflower seed dormancy alleviation during dry after-ripening. Plant Cell 23: 2196-2208 Bazin J, Langlade N, Vincourt P, Arribat S, Balzergue S, El-Maarouf-Bouteau H, Bailly C (2011) Targeted mRNA oxidation regulates sunflower seed dormancy alleviation during dry after-ripening. Plant Cell 23: 2196-2208 Becnel J, Natarajan M, Kipp A, Braam J (2006) Developmental expression patterns of Arabidopsis XTH genes reported by transgenes and Genevestigator. Plant Mol Biol 61: 451-467 Bewley, J. D., and Black, M. (1994). Seeds: Physiology of Development and Germination. NewYork: Plenum Press. doi: 10.1007/978-1-4899-1002-8 Bieniawska Z, Paul Barratt DH, Garlick AP, Thole V, Kruger NJ, Martin C, Zrenner R, Smith AM (2007) Analysis of the sucrose synthase gene family in Arabidopsis. Plant J 49: 810- 828 Borg M, Brownfield L, Khatab H, Sidorova A, Lingaya M, Twell D (2011) The R2R3 MYB transcription factor DUO1 activates a male germline-specific regulon essential for sperm cell differentiation in Arabidopsis. Plant Cell 23: 534-549 Cadman CS, Toorop PE, Hilhorst HW, Finch-Savage WE (2006) Gene expression profiles of Arabidopsis Cvi seeds during dormancy cycling indicate a common underlying dormancy control mechanism. Plant J 46: 805-822 Carrera E, Holman T, Medhurst A, Dietrich D, Footitt S, Theodoulou FL, Holdsworth MJ (2008) Seed after-ripening is a discrete developmental pathway associated with specific gene networks in Arabidopsis. Plant J 53: 214-224 Chibani K, Ali-Rachedi S, Job C, Job D, Jullien M, Grappin P (2006) Proteomic analysis of seed dormancy in Arabidopsis. Plant Physiol 142: 1493-1510 Corbineau F, Bagniol S, Come D (1990) Sunflower (Helianthus-annuus L) seed dormancy and its regulation by ethylene. Israel Journal of Botany 39: 313-325 Corbineau F, Xia Q, Bailly C, El-Maarouf-Bouteau H (2014) Ethylene, a key factor in the regulation of seed dormancy. Front Plant Sci. 5:539. Dietz KJ, Vogel MO, Viehhauser A (2010) AP2/EREBP transcription factors are part of gene regulatory networks and integrate metabolic, hormonal and environmental signals in stress acclimation and retrograde signalling. Protoplasma 245: 3-14
128
El-Maarouf-Bouteau H, Meimoun P, Job C, Job D, Bailly C (2013) Role of protein and mRNA oxidation in seed dormancy and germination. Front Plant Sci 4: 77 El-Maarouf-Bouteau H, Sajjad Y, Bazin J, Langlade N, Cristescu SM, Balzergue S, Baudouin E, Bailly C (2015) Reactive oxygen species, abscisic acid and ethylene interact to regulate sunflower seed germination. Plant Cell Environ 38: 364-374 Fait A, Angelovici R, Less H, Ohad I, Urbanczyk-Wochniak E, Fernie AR, Galili G (2006) Arabidopsis seed development and germination is associated with temporally distinct metabolic switches. Plant Physiol 142: 839-854 Fernie AR, Carrari F, Sweetlove LJ (2004) Respiratory metabolism: glycolysis, the TCA cycle and mitochondrial electron transport. Curr Opin Plant Biol 7: 254-261 Finch-Savage WE, Leubner-Metzger G (2006) Seed dormancy and the control of germination. New Phytol 171: 501-523 Finkelstein R, Reeves W, Ariizumi T, Steber C (2008) Molecular aspects of seed dormancy. Annu Rev Plant Biol 59: 387-415 Finkelstein RR, Gampala SS, Rock CD (2002) Abscisic acid signaling in seeds and seedlings. Plant Cell 14 Suppl: S15-45 Fujita M, Fujita Y, Noutoshi Y, Takahashi F, Narusaka Y, Yamaguchi-Shinozaki K, Shinozaki K (2006) Crosstalk between abiotic and biotic stress responses: a current view from the points of convergence in the stress signaling networks. Curr Opin Plant Biol 9: 436-442 Fujita Y, Fujita M, Shinozaki K, Yamaguchi-Shinozaki K (2011) ABA-mediated transcriptional regulation in response to osmotic stress in plants. J Plant Res 124: 509-525 Fujita Y, Nakashima K, Yoshida T, Katagiri T, Kidokoro S, Kanamori N, Umezawa T, Fujita M, Maruyama K, Ishiyama K, Kobayashi M, Nakasone S, Yamada K, Ito T, Shinozaki K, Yamaguchi-Shinozaki K (2009) Three SnRK2 protein kinases are the main positive regulators of abscisic acid signaling in response to water stress in Arabidopsis. Plant Cell Physiol 50: 2123-2132 Gueta-Dahan Y, Yaniv Z, Zilinskas BA, Ben-Hayyim G (1997) Salt and oxidative stress: similar and specific responses and their relation to salt tolerance in citrus. Planta 203: 460- 469 Ha SB, An G (1988) Identification of upstream regulatory elements involved in the developmental expression of the Arabidopsis thaliana cab1 gene. Proc Natl Acad Sci U S A 85: 8017-8021
129
Hayama H, Shimada T, Fujii H, Ito A, Kashimura Y (2006) Ethylene-regulation of fruit softening and softening-related genes in peach. J Exp Bot 57: 4071-4077 He D, Zhang H, Yang P (2014) The mitochondrion-located protein OsB12D1 enhances flooding tolerance during seed germination and early seedling growth in rice. Int J Mol Sci 15: 13461-13481 Herbette S, Lenne C, Leblanc N, Julien JL, Drevet JR, Roeckel-Drevet P (2002) Two GPX-like proteins from Lycopersicon esculentum and Helianthus annuus are antioxidant enzymes with phospholipid hydroperoxide glutathione peroxidase and thioredoxin peroxidase activities. Eur J Biochem 269: 2414-2420 Himmelbach A, Hoffmann T, Leube M, Hohener B, Grill E (2002) Homeodomain protein ATHB6 is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis. EMBO J 21: 3029-3038 Huang H, Moller IM, Song SQ (2012) Proteomics of desiccation tolerance during development and germination of maize embryos. J Proteomics 75: 1247-1262 Ishikawa F, Suga S, Uemura T, Sato MH, Maeshima M (2005) Novel type aquaporin SIPs are mainly localized to the ER membrane and show cell-specific expression in Arabidopsis thaliana. FEBS Lett 579: 5814-5820 Jan A, Yang G, Nakamura H, Ichikawa H, Kitano H, Matsuoka M, Matsumoto H, Komatsu S (2004) Characterization of a xyloglucan endotransglucosylase gene that is up-regulated by gibberellin in rice. Plant Physiol 136: 3670-3681 Kim JM, Woo DH, Kim SH, Lee SY, Park HY, Seok HY, Chung WS, Moon YH (2012) Arabidopsis MKKK20 is involved in osmotic stress response via regulation of MPK6 activity. Plant Cell Rep 31: 217-224 Kocsy G, Tari I, Vankova R, Zechmann B, Gulyas Z, Poor P, Galiba G (2013) Redox control of plant growth and development. Plant Sci 211: 77-91 Koornneef M, Bentsink L, Hilhorst H (2002) Seed dormancy and germination. Curr Opin Plant Biol 5: 33-36 Koornneef M, van der Veen JH (1980) Induction and analysis of gibberellin sensitive mutants in Arabidopsis thaliana (L.) heynh. Theor Appl Genet 58: 257-263 Kucera B, Cohn MA, Leubner-Metzger G (2005) Plant hormone interactions during seed dormancy release and germination. Seed Science Research 15: 281-307
130
Lau OL, Yang SF (1976) Inhibition of ethylene production by cobaltous ion. Plant Physiology 58: 114–117 Layat E, Leymarie J, El-Maarouf-Bouteau H, Caius J, Langlade N, Bailly C (2014) Translatome profiling in dormant and nondormant sunflower (Helianthus annuus) seeds highlights post-transcriptional regulation of germination. New Phytol 204: 864-872 Linkies A, Leubner-Metzger G (2012) Beyond gibberellins and abscisic acid: how ethylene and jasmonates control seed germination. Plant Cell Rep 31: 253-270 Meimoun P, Mordret E, Langlade NB, Balzergue S, Arribat S, Bailly C, El-Maarouf-Bouteau H (2014) Is gene transcription involved in seed dry after-ripening? PLoS One 9: e86442 Miao Y, Lv D, Wang P, Wang XC, Chen J, Miao C, Song CP (2006) An Arabidopsis glutathione peroxidase functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Plant Cell 18: 2749-2766 Muller K, Tintelnot S, Leubner-Metzger G (2006) Endosperm-limited Brassicaceae seed germination: abscisic acid inhibits embryo-induced endosperm weakening of Lepidium sativum (cress) and endosperm rupture of cress and Arabidopsis thaliana. Plant Cell Physiol 47: 864-877 Nambara E, Marion-Poll A (2005) Abscisic acid biosynthesis and catabolism. Annu Rev Plant Biol 56: 165-185 Navrot N, Collin V, Gualberto J, Gelhaye E, Hirasawa M, Rey P, Knaff DB, Issakidis E, Jacquot JP, Rouhier N (2006) Plant glutathione peroxidases are functional peroxiredoxins distributed in several subcellular compartments and regulated during biotic and abiotic stresses. Plant Physiol 142: 1364-1379 Nishitani K (1997) The role of endoxyloglucan transferase in the organization of plant cell walls. Int Rev Cytol 173: 157-206 Nishitani K, Vissenberg K (2007) Roles of the XTH Protein Family in the Expanding Cell. In J-P Verbelen, K Vissenberg, eds, The Expanding Cell, Vol 6. Springer Berlin Heidelberg, pp 89-116 Noctor G, De Paepe R, Foyer CH (2007) Mitochondrial redox biology and homeostasis in plants. Trends Plant Sci 12: 125-134 North H, Baud S, Debeaujon I, Dubos C, Dubreucq B, Grappin P, Jullien M, Lepiniec L, Marion- Poll A, Miquel M, Rajjou L, Routaboul JM, Caboche M (2010) Arabidopsis seed secrets unravelled after a decade of genetic and omics-driven research. Plant J 61: 971-981
131
Oracz K, El-Maarouf Bouteau H, Farrant JM, Cooper K, Belghazi M, Job C, Job D, Corbineau F, Bailly C (2007) ROS production and protein oxidation as a novel mechanism for seed dormancy alleviation. Plant J 50: 452-465 Oracz K, El-Maarouf-Bouteau H, Bogatek R, Corbineau F, Bailly C (2008) Release of sunflower seed dormancy by cyanide: cross-talk with ethylene signalling pathway. J Exp Bot 59: 2241-2251 Oracz K, El-Maarouf-Bouteau H, Kranner I, Bogatek R, Corbineau F, Bailly C (2009) The mechanisms involved in seed dormancy alleviation by hydrogen cyanide unravel the role of reactive oxygen species as key factors of cellular signaling during germination. Plant Physiol 150: 494-505 Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45 Pieruzzi FP, Dias LL, Balbuena TS, Santa-Catarina C, dos Santos AL, Floh EI (2011) Polyamines, IAA and ABA during germination in two recalcitrant seeds: Araucaria angustifolia (Gymnosperm) and Ocotea odorifera (Angiosperm). Ann Bot 108: 337-345 Plessis A, Cournol R, Effroy D, Silva Perez V, Botran L, Kraepiel Y, Frey A, Sotta B, Cornic G, Leung J, Giraudat J, Marion-Poll A, North HM (2011) New ABA-hypersensitive Arabidopsis mutants are affected in loci mediating responses to water deficit and Dickeya dadantii infection. PLoS One 6: e20243 Pritchard SL, Charlton WL, Baker A, Graham IA (2002) Germination and storage reserve mobilization are regulated independently in Arabidopsis. Plant J 31: 639-647 Rose JK, Braam J, Fry SC, Nishitani K (2002) The XTH family of enzymes involved in xyloglucan endotransglucosylation and endohydrolysis: current perspectives and a new unifying nomenclature. Plant Cell Physiol 43: 1421-1435 Röhrig H, John M, Schmidt J (2004) Modification of soybean sucrose synthase by S-thiolation with ENOD40 peptide A. Biochem Biophys Res Commun. 325: 864-70 Sasidharan R, Pierik R (2010) Cell wall modification involving XTHs controls phytochrome- mediated petiole elongation in Arabidopsis thaliana. Plant Signal Behav 5: 1491-1492 Seo M, Nambara E, Choi G, Yamaguchi S (2009) Interaction of light and hormone signals in germinating seeds. Plant Mol Biol 69: 463-472 Takahashi F, Yoshida R, Ichimura K, Mizoguchi T, Seo S, Yonezawa M, Maruyama K, Yamaguchi-Shinozaki K, Shinozaki K (2007) The mitogen-activated protein kinase
132
cascade MKK3-MPK6 is an important part of the jasmonate signal transduction pathway in Arabidopsis. Plant Cell 19: 805-818 Tan L, Chen S, Wang T, Dai S (2013) Proteomic insights into seed germination in response to environmental factors. Proteomics 13: 1850-1870 Xiao X, Tang C, Fang Y, Yang M, Zhou B, Qi J, Zhang Y (2014) Structure and expression profile of the sucrose synthase gene family in the rubber tree: indicative of roles in stress response and sucrose utilization in the laticifers. FEBS J. 281: 291-305 Yang P, Li X, Wang X, Chen H, Chen F, Shen S (2007) Proteomic analysis of rice (Oryza sativa) seeds during germination. Proteomics 7: 3358-3368 Yoo SD, Sheen J (2008) MAPK signaling in plant hormone ethylene signal transduction. Plant Signal Behav 3: 848-849 Zander M, La Camera S, Lamotte O, Metraux JP, Gatz C (2010) Arabidopsis thaliana class-II TGA transcription factors are essential activators of jasmonic acid/ethylene-induced defense responses. Plant J 61: 200-210 Zhu Q, Zhang J, Gao X, Tong J, Xiao L, Li W, Zhang H (2010) The Arabidopsis AP2/ERF transcription factor RAP2.6 participates in ABA, salt and osmotic stress responses. Gene 457: 1-12
133
Table 1. MapMan classification (http://bar.utoronto.ca) of sunflower genes (https://www.heliagene.org/) up- regulated in germinating, ND and D/ET as compared to D, and down-regulated in non-germinating, ND/ABA as compared to ND.
Annotation Log2 Heliagene Log2 Log2 (TAIR Ratio Affymetrix gene Accession number Ratio Ratio HaT131 ID Accession Biological Process ND/AB chip annotation (www.heliagene.o ND D/Et number or A vs rg) vs D vs D IPR) ND
cell wall
Heli005917_st HuCL00926C002 HaT13l008346 AT2G28110 Exostosin family protein 1,65 2,72 -1,73
Heli024944_st HuCL09512C001 HaT13l011542 AT1G02640 beta-xylosidase 2(BXL2) 2,15 3,29 -2,52
Heli030585_st HuCL11891C001 HaT13l017099 AT5G64570 beta-D-xylosidase 4(XYL4) 1,49 2,43 -2,00
AT5G63180 pectate lyases and Heli009082_st HuCL12520C001 HaT13l004701 1,42 1,42 -1,95
polygalacturonases xyloglucan Heli054183_x_s
HuCL00144C005 AT4G03210 endotransglucosylase/hydrolas 2,87 4,06 -2,65 t es (XTHs)
cell
Heli006622_st HuCL00145C001 HaT13l001013 AT1G50010 tubulin alpha-2 chain(TUA2) 1,49 2,31 -1,59
carbohydrate metabolic
Heli059476_st HuCL06382C001 HaT13l021515 AT1G74790 1,54 1,70 -1,99 process
secondary metabolism
Deoxyxylulose-5-phosphate Heli000031_st HuCL01414C001 HaT13l030038 AT4G15560 2,10 1,63 -1,70 synthase
Heli006291_st HuCL12958C001 HaT13l012178 AT1G18590 sulfotransferase 17(SOT17) 1,63 1,87 -1,72
hormone metabolism
Heli001834_st HuCL04379C001 HaT13l016180 AT5G15230 GAST1 protein homolog 4 2,22 2,88 -2,50
polyamine metabolism
S-adenosylmethionine Heli007531_st HuCL00106C002 HaT13l001132 AT3G02470 2,17 2,20 -2,03 decarboxylase(SAMDC)
minor CHO metabolism
Heli002812_st HuCL03745C001 HaT13l003267 AT1G55740 seed imbibition 1(SIP1) 2,12 1,46 -1,79
RNA regulation of transcription
MYB-related transcription
Heli012022_st HuCL08506C001 HaT13l014951 AT2G38090 2,50 2,38 -2,23 factor family
protein postranslational modification
mitogen-activated protein Heli094295_st HuAJ827835 HaT13l017219 AT3G50310 kinase kinase kinase 2,53 2,17 -2,44 20(MAPKKK20)
development
134
Heli028832_st HuCL10045C001 HaT13l019017 AT3G48140 B12D 1,40 1,89 -1,85
Integrase-type DNA-binding Heli022386_st HuCL11611C001 HaT13l015228 AT4G36920 1,87 2,19 -1,57 superfamily protein
oxidation-reduction
Heli032638_st HuCL03867C002 HaT13l019432 IPR008922 oxidoreductase activity 1,65 3,13 -2,82
transport
Heli033065_st HuCL07407C001 HaT13l101638 AT2G39130 Amino acid transporter 2,16 2,23 -1,78
not assigned
UDP-glucosyl transferase Heli000358_st HuCL03981C001 HaT13l009509 AT1G22370 1,15 2,02 -1,62 85A5(UGT85A5) Heli068232_x_s pentatricopeptide (PPR)
HuBU031493 AT3G02650 1,28 2,69 -1,81 t repeat-containing protein Heli068743_x_s pentatricopeptide (PPR)
HuBU030210 AT3G02650 2,06 3,24 -2,37 t repeat-containing protein
Heli027060_st HuDY915375 HaT13l031124 AT1G53035 Protein of unknown function 1,84 2,36 -1,84
Protein of unknown function
Heli029666_st HuBU027813 HaT13l086005 AT4G02810 2,21 2,11 -2,42 DUF3049
Heli066534_st HuBU024903 HaT13l001118 AT5G37010 Protein of unknown function 1,87 2,71 -1,75
Table 2. MapMan classification (http://bar.utoronto.ca) of sunflower genes (https://www.heliagene.org/) down-regulated in germinating seeds, ND and D/ET, and up- regulated in non-germinating seeds, ND/ABA.
Annotation Log2 Heliagene Log2 Log2 (TAIR Ratio Affymetrix gene Accession number Ratio Ratio HaT131 ID Accession Biological Process ND/AB chip annotation (www.heliagene.o ND D/Et number or A vs rg) vs D vs D IPR) ND
cell wall
Heli005917_st HuCL00926C002 HaT13l008346 AT2G28110 Exostosin family protein 1,65 2,72 -1,73
Heli024944_st HuCL09512C001 HaT13l011542 AT1G02640 beta-xylosidase 2(BXL2) 2,15 3,29 -2,52
Heli030585_st HuCL11891C001 HaT13l017099 AT5G64570 beta-D-xylosidase 4(XYL4) 1,49 2,43 -2,00
AT5G63180 pectate lyases and Heli009082_st HuCL12520C001 HaT13l004701 1,42 1,42 -1,95
polygalacturonases xyloglucan Heli054183_x_s
HuCL00144C005 AT4G03210 endotransglucosylase/hydrolas 2,87 4,06 -2,65 t es (XTHs)
cell
Heli006622_st HuCL00145C001 HaT13l001013 AT1G50010 tubulin alpha-2 chain(TUA2) 1,49 2,31 -1,59
carbohydrate metabolic
Heli059476_st HuCL06382C001 HaT13l021515 AT1G74790 1,54 1,70 -1,99 process
135
secondary metabolism
Deoxyxylulose-5-phosphate Heli000031_st HuCL01414C001 HaT13l030038 AT4G15560 2,10 1,63 -1,70 synthase
Heli006291_st HuCL12958C001 HaT13l012178 AT1G18590 sulfotransferase 17(SOT17) 1,63 1,87 -1,72
hormone metabolism
Heli001834_st HuCL04379C001 HaT13l016180 AT5G15230 GAST1 protein homolog 4 2,22 2,88 -2,50
polyamine metabolism
S-adenosylmethionine Heli007531_st HuCL00106C002 HaT13l001132 AT3G02470 2,17 2,20 -2,03 decarboxylase(SAMDC)
minor CHO metabolism
Heli002812_st HuCL03745C001 HaT13l003267 AT1G55740 seed imbibition 1(SIP1) 2,12 1,46 -1,79
RNA regulation of transcription
MYB-related transcription
Heli012022_st HuCL08506C001 HaT13l014951 AT2G38090 2,50 2,38 -2,23 factor family
protein postranslational modification
mitogen-activated protein Heli094295_st HuAJ827835 HaT13l017219 AT3G50310 kinase kinase kinase 2,53 2,17 -2,44 20(MAPKKK20)
development
Heli028832_st HuCL10045C001 HaT13l019017 AT3G48140 B12D 1,40 1,89 -1,85
Integrase-type DNA-binding Heli022386_st HuCL11611C001 HaT13l015228 AT4G36920 1,87 2,19 -1,57 superfamily protein
oxidation-reduction
Heli032638_st HuCL03867C002 HaT13l019432 IPR008922 oxidoreductase activity 1,65 3,13 -2,82
transport
Heli033065_st HuCL07407C001 HaT13l101638 AT2G39130 Amino acid transporter 2,16 2,23 -1,78
not assigned
UDP-glucosyl transferase Heli000358_st HuCL03981C001 HaT13l009509 AT1G22370 1,15 2,02 -1,62 85A5(UGT85A5) Heli068232_x_s pentatricopeptide (PPR)
HuBU031493 AT3G02650 1,28 2,69 -1,81 t repeat-containing protein Heli068743_x_s pentatricopeptide (PPR)
HuBU030210 AT3G02650 2,06 3,24 -2,37 t repeat-containing protein
Heli027060_st HuDY915375 HaT13l031124 AT1G53035 Protein of unknown function 1,84 2,36 -1,84
Protein of unknown function
Heli029666_st HuBU027813 HaT13l086005 AT4G02810 2,21 2,11 -2,42 DUF3049
Heli066534_st HuBU024903 HaT13l001118 AT5G37010 Protein of unknown function 1,87 2,71 -1,75
136
Figure Legends
Figure 1. Germination percentage of sunflower dormant and non-dormant embryos after 7 days of imbibition in the dark at 10°C on water (D and ND), or in presence of ethylene (D/ET and ND/ET), ethylene inhibitors α-aminoisobutyric acid (D/AIB) and cobalt chloride (D/CoCl2), and ABA (D/ABA and ND/ABA). Values are means of three replicates of 50 embryos ± standard deviation.
Figure 2. ABA content in embryonic axis of dormant (D) and non-dormant (ND) during imbibition at 10 °C. Values are means of four replicates ± standard deviation.
Figure 3. PCA of metabolite content in dry dormant (D); dry non-dormant (ND); D imbibed on water for 3h (D 3h), 15h (D 15h), 24h(D 24h); ND imbibed on water for 3h (ND 3h), 15h (ND 3h), 24h (ND 24h); D treated with ethylene for 3h (D/ET 3h), 15h (D/ET 15h), 24h (D/ET 24h) and ND treated with ABA for 3h (ND/ABA 3h), 15h (ND/ABA 15h), 24h(ND/ABA 24h). Results are means of three biological repelicaions.
Figure 4. Main relative metabolite content change expressed as log2 (fold change) of (A) non- dormant compared to dormant seeds (ND vs D); (B) dormant treated with ethylene compared to dormant (D/ET vs D); (C) non-dormant treated with ABA compared to dormant (ND/ABA vs D). A-Ala: α- alanine; B-Ala: β- alanine; Gln: glutamine; Thr: threonine; malic ac: malic acid; oxalic ac: oxalic acid; p-Ohbenzoic: p-hydroxybenzoic acid.
Figure 5. GO classification based on MapMan software and Ashburner et al. (2000) of genes altered in non-dormant compared to dormant seeds (ND vs D); dormant treated with ethylene compared to dormant (D/ET vs D); and non-dormant treated with ABA compared to non- dormant (ND/ABA vs ND).
Figure 6. PCA of transcriptomic changes of dormant (D) imbibed on water or in presence of ethylene (D/ET) and non-dormant (ND) imbibed on water or in presence of abscisic acid (ND/ABA) during 24h at 10 °C.
Supplemental data
Supplemental Table S1. Metabolites content at 24 h of imbibition of three replicates (1, 2 and 3) in dormant and non-dormant axes imbibed on water (D and ND), D treated with ethylene (D/ET) and ND treated with ABA (ND/ABA). Comparison of ND with D Log2 values (ND vs D); D 137
imbibed on water in the presence of ethylene (D/ET) to D (D/ET vs D); and ND imbibed on abscisic acid (ABA, ND/ABA) to ND imbibed on water, at 24h at 10 °C, and t-test values are represented.
Supplemental Table S2. List of up- and down-regulated genes in non-dormant (ND) imbibed on water compared to dormant (D) imbibed on water (ND vs D up; ND vs D down); D imbibed on water in the presence of ethylene (D/ET) compared to D (D/ET vs D up; D/ET vs D down); and ND imbibed on ABA (ND/ABA) compared to ND imbibed on water (ND/ABA vs ND up; ND/ABA vs ND down); during 24h at 10 °C. Common genes up- or down-regulated in ND and D/ET are also presented.
Supplemental Table S3. Gene names and primer sequences used for qPCR validation.
Supplemental Figure S1. qPCR result of 9 genes altered oppositely in germinating and non- germinating seeds. Results represent values in non-dormant (ND), ND treated with ABA (ND/ABA) and dormant treated with ethylene (D/ET). Value 100% was attributed to values obtained in dormant (D). Bars represent qPCR values +/- SD from three biological replicates.
Figure 1.
138
Figure 2.
Figure 3.
139
Figure 4.
Figure 5.
140
Figure 6.
Supplemental Figure S1.
800
700 HuBQ971589 unit) 600 HuCL01845C001 HuCL01692C001 500
arbitrary HuCL00270C001 400 HuDY919565 300 HuCL11228C002 200 HuCL00001C346 100 HuCL08567C001
Gene expression ( Gene expression 0 HuCL17391C001 D ND D/Eth ND/ABA
141
142
Annexe 2 Determination of Protein Carbonylation and Proteasome Activity in Seeds
143 Chapter 16
Determination of Protein Carbonylation and Proteasome Activity in Seeds
Qiong Xia , Hayat El-Maarouf-Bouteau , Christophe Bailly , and Patrice Meimoun
Abstract
Reactive oxygen species (ROS) have been shown to be toxic but also function as signaling molecules in a process called redox signaling. In seeds, ROS are produced at different developmental stages including dormancy release and germination. Main targets of oxidation events by ROS in cell are lipids, nucleic acids, and proteins. Protein oxidation has various effects on their function, stability, location, and degradation. Carbonylation represents an irreversible and unrepairable modifi cation that can lead to protein degradation through the action of the 20S proteasome. Here, we present techniques which allow the quantifi cation of protein carbonyls in complex protein samples after derivatization by 2,4-dinitrophenylhydrazine (DNPH) and the determination proteasome activity by an activity-based protein profi ling (ABPP) using the probe MV151. These techniques, routinely easy to handle, allow the rapid assessment of protein carbonyls and proteasome activity in seeds in various physiological conditions where ROS may act as signaling or toxic elements.
Key words Protein oxidation , Carbonylation , Degradation , Proteasome activity , Seeds
1 Introduction
Reactive oxygen species (ROS) , such as hydrogen peroxide or superoxide anion , are known to be toxic but can also act as signal- ing molecules in cells. In seeds, ROS, which can be produced dur- ing both dry storage and imbibition , have been shown to be involved in seed dormancy alleviation, germination, and aging [1 – 3 ]. ROS can act by oxidizing macromolecules in cell as lipids, nucleic acids, and proteins. The oxidation of specifi c proteins or mRNAs, thus preventing their translation, has been proposed as being a key mechanism regulating seed dormancy alleviation and germination [ 4 – 6 ]. ROS are considered as being the signal between environmental factors, such as temperature or oxygen, and internal determinants of dormancy and germination, such as hormones [7 ]. Proteins are major determinants of seed germination since seeds
L. Maria Lois and Rune Matthiesen (eds.), Plant Proteostasis: Methods and Protocols, Methods in Molecular Biology, vol. 1450, DOI 10.1007/978-1-4939-3759-2_16, © Springer Science+Business Media New York 2016 205 206 Qiong Xia et al.
contain all RNA species needed for germination [8 ] and that de novo transcription is not necessary for germination [ 9 ]. Protein abundance, location, degradation, and modulation of their activity are regulated at different levels, during transcription, translation, and by post-translational modifi cations (PTMs) . It has been shown that PTMs, including S-nitrosylation , carbonylation, and glycosyl- ation , are also involved in the regulation of seed germination [4 , 10 – 13 ]. Protein oxidation is often associated with change in func- tion, stability, localization, or degradation [14 ], and it also inter- acts with other PTMs such as phosphorylation [15 ]. Oxidative modifi cation of enzymes has been shown to inhibit a wide array of enzyme activities thus leading to either mild or severe effects on cellular or systemic metabolism [ 16 ]. Among oxidative modifi ca- tions, the involvement of protein carbonylation has been demon- strated in seed, from dormancy breaking to aging, in different species [ 4 , 6 ]. Oxidative attack of exposed residues, such as Lys, Arg, Pro, and Thr, induces the formation of carbonyl groups [17 ]. Carbonylation of proteins is irreversible and not repairable [ 18 ]. To avoid their accumulation that could lead to aggregation of oxi- dized proteins and to a toxic effect in cell, carbonylated proteins are degraded through the action of the 20S proteasome in the cytosol [ 17 ]. In seeds, the role of proteasome in dormancy and germination is not completely understood. The involvement of the 20S proteasome was suggested during germination of spinach, Arabidopsis, and wheat seeds [11 , 19 , 20 ]. The study of protein carbonyls relies on many tests developed for several decades. They are often based on derivatization of the carbonyl group by 2,4-dinitrophenylhydrazine (DNPH) , which leads to the formation of a stable 2,4-dinitrophenyl (DNP) hydra- zone product [21 ], thus allowing the detection of protein carbonyls. One of the techniques presented here is the quantifi cation of protein carbonyls in a complex protein sample. This technique, routinely used in the laboratory, is based on the spectral property of DNP at 370 nm. The second technique, complementary to the fi rst one, is an in gel activity-based protein profi ling (ABPP) using MV151, a proteasome inhibitor , containing a Bodipy fl uorescent group for fl uorescent imaging that allow the proteasome activity investigation [22 ]. These two techniques allow to obtain robust, reliable, and rapid results about protein oxidative modifi cations and proteolytic events that can be involved in any seed developmental process.
2 Materials
2.1 Determination 1. Protein extraction buffer: 10 mM Hepes-NaOH buffer pH of Protein 7.5 containing 0.1 % protease inhibitor cocktail (Sigma-Aldrich) Carbonylation and 0.07 % (v/v) β-mercaptoethanol. by Spectrophotometry 2. Protein Assay Dye Reagent Concentrate (Bio-Rad). Protein Carbonylation and Degradation in Seeds 207
3. Derivatization solution: 0.2 % DNPH in 2 M HCl (see Note 1 ). 4. Derivatization blank solution: 2 M HCl. 5. 100 % (w/v) trichloroacetic acid. 6. Absolute ethanol-ethyl acetate (1:1). 7. 6 M guanidine-HCl (pH 2.3) (see Note 2 ). 8. 2-D Quant Kit (GE Healthcare). 9. 1.5 ml quartz cuvette.
2.2 Proteasome 1. Protein extraction buffer: 50 mM Tris–HCl, pH 7.4. Activity Profi ling 2. Protein Assay Dye Reagent Concentrate (Bio-Rad). 3. MV151 probe (see Note 3 ). 4. 12 % Mini-PROTEAN TGX Precast Gels (Bio-Rad).
3 Methods
Protein carbonylation is a type of protein oxidation that can be promoted by reactive oxygen species [23 ]. Detection and quantifi - cation of carbonylated proteins is accomplished after derivatiza- tion of the carbonyl groups. It usually refers to a process that forms reactive ketones or aldehydes that can be reacted by 2,4- dinitrophenylhydrazine (DNPH) to form hydrazones (Fig. 1 ). Carbonyl concentration in mol carbonyl/l is the sample absorbance at 370 nm divided by the molar absorptivity of the hydrazone (22,000 mol− 1 cm− 1 ).
3.1 Determination 1. Ground approximately 0.1 g dry weight seeds or tissue in an of Protein ice-cold mortar and homogenize with 1.2 ml Hepes extraction Carbonylation buffer. by Spectrophotometry 2. Incubate the solution on ice for 20 min with occasional 3.1.1 Protein Extraction mixing. and Quantifi cation 3. Centrifuge for 20 min at 16,000 × g at 4 °C. 4. Determine protein concentration in supernatant by Bradford protein assay according to the manufacturer’s recommendations (see Note 4 ).
NO NO R1 2 R1 2 H+ C=O + H2N-NH NO2 C=N-NH NO2 + H2O
R R Carbonyl group 2,4-Dinitrophenylhydrazine Stable color (Aldehydes and Ketones) Hydrazone derivative
Fig. 1 Carbonyl group reaction with 2,4-dinitrophenylhydrazine (DNPH) to form hydrazones 208 Qiong Xia et al.
3.1.2 Determination 1. Prepare two 1.5 ml polypropylene tubes containing 1 mg of of Carbonyl Groups protein for each sample, one tube being the derivatization blank (control), another being the derivatization treatment . 2. Add 0.5 ml of 2 M HCl in the control and 0.5 ml of 0.2 % DNPH in the derivatization tube respectively, vortex to sus- pend the sample. 3. Incubate tubes 15 min at room temperature in the dark, vortex occasionally. 4. Precipitate proteins in 10 % (v/v) TCA and incubate 15 min on ice. 5. Concentrate the extract using a slow-speed centrifugation for 2 min at 3,000 × g which is adequate to form a loose, easily dispersed pellet. 6. Discard the supernatant carefully, wash the pellet with 1 ml ethanol-ethyl acetate 1:1 three times, and every time shake smoothly to disperse the pellet and centrifuge for 2 min at no more than 5,000 × g to avoid compacting the pellet (see Note 5 ). 7. Dry the pellet thoroughly, and dissolve it in 1.2 ml 6 M guani- dine pH 2.3 (at 37 °C for 1 h), and then centrifuge at 10,000 × g for 5 min to remove insoluble material ( see Note 6 ). 8. Take 1 ml supernatant to measure carbonyl at the absorbance of 370 nm, and read spectra against a blank of the related control. 9. Take 4 μl supernatant to measure protein concentration by 2-D Quant Kit (see Note 7 ). Calculate the results by the following equations: ()A370 Carbonyl() nmol/ ml = =A370× 45. 45 22,/ 000 mol / cm A370× 45./ 45() nmol ml Carbonyl() nmol carbonyl/ mg protein = Protein concentration mg/ ml () 10. An example of the results obtained is presented in Fig. 2 .
3.2 Proteasome Activity-based protein profi ling (ABPP) has emerged as a powerful Activity Profi ling chemical proteomic strategy to characterize enzyme function directly in native biological systems at a global scale [ 24 ]. In this approach, probe-treated proteomes are fi rst resolved by polyacryl- amide gel electrophoresis (PAGE), and the labeled enzymes then are visualized by either in-gel fl uorescence scanning (for fl uores- cent probes) or avidin blotting (for biotinylated probes) (Fig. 3a, b ). Recently, the fl uorescent and cell-permeable proteasome inhibitor
probe Bodipy TMR-Ahx3 L3 VS (MV151) has been synthesized (Fig. 3c ). It specifi cally targets all active subunits of the proteasome and immunoproteasome in living cells, allowing a rapid and sensi- tive in-gel detection [23 , 25 ]. Protein Carbonylation and Degradation in Seeds 209
F i g . 2 Changes in protein oxidation in dormant and non-dormant sunfl ower seeds during their imbibition at 10 °C. Dormant (D) seeds: freshly harvested, unable to germinate under favorable conditions; non-dormant (ND) seeds: able to germi- nate after a dry storage period called after ripening. As showed in the graph, ND seeds exhibited higher protein carbonylation level compared to dormant seeds at all tested imbibition times. Data are mean ± SD of three independent biological replicates
3.2.1 Protein Extraction 1. Grind approximately 0.1 g dry weight seeds or tissue in an and Quantifi cation ice- cold mortar and homogenize with 1 ml 50 mM Tris–HCl pH 7.4 extraction buffer. 2. Centrifuge for 20 min at 16,000 × g , 4 °C. 3. Filter the supernatant with Miracloth to remove remaining cell debris. 4. Determine protein concentration by Bradford protein assay.
3.2.2 In-gel Proteasome 1. Incubate 15 μg protein in 1 μM MV151 (see Note 8 ) for 3–6 h Activity-Based Protein at related temperature ( see Note 9 ) in the dark. Profi ling 2. Load the labeled proteins on 12 % precast gels (Bio-Rad). Electrophoresis can be performed in a Mini Protean III (Bio-Rad) by using a Tris-Glycine-SDS running buffer (Bio-Rad), at 200 V and 40 mA for 45 min. 3. Visualize activity by revealing fl uorescence using for example a Typhoon 8600 scanner (GE Healthcare Life Sciences) with excitation and emission wavelengths at 532 nm and 580 nm respectively (Fig. 4 ).
4 Notes
1. When preparing 0.2 % DNPH in 2 M HCl, please take into account the actual content of DNPH in the reagent as most manufactures supply DNPH with at least 30 % of water 210 Qiong Xia et al.
a b
c
O Tag
Reactive group F N B F N O O H H N N O N N S O 3H O H O
F i g . 3 Gel-based activity-based protein profi ling (ABPP) and MV151 probe structures. (a ) R e p r e s e n t a t i v e structure of an ABPP probe, which contains a reactive group (blue ), a spacer or binding group (black ) , a n d a reporter tag ( yellow ). A variety of reporter tags can be used for enzyme visualization and enrichment, includ- ing fl uorophores and biotin; ( b ) Probe-labeled enzymes are visualized and quantifi ed across proteomes by in-gel fl uorescence scanning, adapted from [ 24] ; ( c ) Molecular structures of MV151 probe used in this experiment. MV151 carries a VS reactive group, a Bodipy fl uorescent reporter tag, a leucine tripeptide binding group, and a long linker region, adapted from [ 25 ]
F i g . 4 Proteasome activity assessed using Activity-Based Protein Profi ling ( ABPP , a functional proteomic technology method) in which the fl uorochrome (MV151) reacts with the active site of catalytic subunits β2, β5, and β1 of the proteasome in an activity-dependent manner. D: dormant sunfl ower seeds; ND: non-dormant sunfl ower seeds; D3/ND3: dormant/non-dormant seeds after 3 h of imbibition at 10 °C; D24/ND24: dormant/ non-dormant seeds after 24 h of imbibition at 10 °C. As showed on the gel, ND seeds exhibited higher protea- some activity for each catalytic subunits compared to dormant seeds at all tested imbibition times
content, and be sure that the dry weight/volume ratio reached 0.2 %. After dissolving DNPH, stir the solution several hours in the dark and fi lter before use. Store protected from light at 4 °C for a maximum of 7 days. 2. Initial pH of 6 M guanidine solution is almost 5 and it decreases very rapidly. 3. In plants, three of the seven β subunits are responsible for the proteolytic activities of the proteasome. The vinyl sulfone Protein Carbonylation and Degradation in Seeds 211
(VS)-based probe MV151 can react with the active site of these three catalytic subunits [22 ]. 4. Nucleic acids are carbonyl positive, thus nucleic acid contami- nation of extracts in the spectrophotometric carbonyl assay can cause artifactual elevation in protein carbonyl measurements. In order to remove nucleic acids after protein extraction, add streptomycin sulfate to a fi nal concentration of 1 % (v/v), then incubate 30 min at room temperature and centrifuge at 6,000 × g for 10 min at 4 °C. 5. If the pellet still look yellow after three times washing, more washes are needed to remove all free DNPH . 6. The time of pellet solubilization can be shortened, but not less than 15 min, and centrifugation of the samples is recommended to avoid light scatter. 7. A part of proteins may be lost during the washing process, so an accurate protein concentration must be obtained. Considering the low amount of proteins fi nally dissolved in guanidine pH 2.3, the 2-D Quant Kit is proposed for quantifi cation . 8. A fl uorochrome (MV151) reacts with the active site of cata- lytic subunits of the proteasome in an activity-dependent manner [22 ]. 9. Concerning the MV151 incubation temperature, room tempera- ture is normally used, but the proteasome activity is very sensitive to temperature, so if the samples are treated under different temperatures, the incubation also should be made at the same temperature. In order to obtain a good profi ling, the incubation time should be extended when temperature decreases.
References
1. Bailly C, Leymarie J, Lehner A, Rousseau S, 5. Bazin J, Langlade N, Vincourt P, Arribat S, Come D, Corbineau F (2004) Catalase activity Balzergue S, El-Maarouf-Bouteau H, Bailly C and expression in developing sunfl ower seeds (2011) Targeted mRNA oxidation regulates as related to drying. J Exp Bot 55(396):475– sunfl ower seed dormancy alleviation during 483. doi: 10.1093/jxb/erh050 dry after-ripening. Plant Cell 23(6):2196– 2. Bailly C, El-Maarouf-Bouteau H, Corbineau F 2208. doi: 10.1105/tpc.111.086694 (2008) Seed dormancy alleviation and oxida- 6. El-Maarouf-Bouteau H, Meimoun P, Job C, tive signaling. J Soc Biol 202(3):241–248. Job D, Bailly C (2013) Role of protein and doi: 10.1051/jbio:2008025 mRNA oxidation in seed dormancy and germi- 3. Bailly C, El-Maarouf-Bouteau H, Corbineau F nation. Front Plant Sci 4:77. doi: 10.3389/ (2008) From intracellular signaling networks to fpls.2013.00077 cell death: the dual role of reactive oxygen 7. El-Maarouf-Bouteau H, Sajjad Y, Bazin J, species in seed physiology. C R Biol 331(10): Langlade N, Cristescu SM, Balzergue S, Baudouin 806–814. doi: 10.1016/j.crvi.2008.07.022 E, Bailly C (2015) Reactive oxygen species, 4. Oracz K, El-Maarouf Bouteau H, Farrant JM, abscisic acid and ethylene interact to regulate Cooper K, Belghazi M, Job C, Job D, sunfl ower seed germination. Plant Cell Environ Corbineau F, Bailly C (2007) ROS production 38(2):364–374. doi: 10.1111/pce.12371 and protein oxidation as a novel mechanism for 8. Bewley JD (1997) Seed germination and seed dormancy alleviation. Plant J 50(3):452– dormancy. Plant Cell 9(7):1055–1066. 465. doi: 10.1111/j.1365-313X.2007.03063.x doi: 10.1105/tpc.9.7.1055 212 Qiong Xia et al.
9. Rajjou L, Gallardo K, Debeaujon I, 19. Miyawaki M, Aito M, Ito N, Yanagawa Y, Vandekerckhove J, Job C, Job D (2004) The Kendrick RE, Tanaka K, Sato T, Nakagawa H effect of alpha-amanitin on the Arabidopsis (1997) Changes in proteasome levels in spin- seed proteome highlights the distinct roles of ach (Spinacia oleracea) seeds during imbibition stored and neosynthesized mRNAs during ger- and germination. Biosci Biotechnol Biochem mination. Plant Physiol 134(4):1598–1613. 61(6):998–1001. doi: 10.1271/bbb.61.998 doi: 10.1104/pp.103.036293 20. Shi C, Rui Q, Xu LL (2009) Enzymatic prop- 10. Berger S, Menudier A, Julien R, Karamanos Y erties of the 20S proteasome in wheat endo- (1996) Regulation of De-N-glycosylation sperm and its biochemical characteristics after enzymes in germinating radish seeds. Plant seed imbibition. Plant Biol 11(6):849–858. Physiol 112(1):259–264 doi: 10.1111/j.1438-8677.2009.00193.x 11. Job C, Rajjou L, Lovigny Y, Belghazi M, Job D 21. Levine RL, Garland D, Oliver CN, Amici A, (2005) Patterns of protein oxidation in Climent I, Lenz AG, Ahn BW, Shaltiel S, Arabidopsis seeds and during germination. Stadtman ER (1990) Determination of car- Plant Physiol 138(2):790–802. doi: 10.1104/ bonyl content in oxidatively modifi ed proteins. pp.105.062778 Methods Enzymol 186:464–478 12. Bethke PC, Libourel IG, Jones RL (2006) 22. Verdoes M, Florea BI, Menendez-Benito V, Nitric oxide reduces seed dormancy in Maynard CJ, Witte MD, van der Linden WA, Arabidopsis. J Exp Bot 57(3):517–526. van den Nieuwendijk AM, Hofmann T, doi: 10.1093/jxb/erj060 Berkers CR, van Leeuwen FW, Groothuis TA, 13. Zhao MG, Tian QY, Zhang WH (2007) Nitric Leeuwenburgh MA, Ovaa H, Neefjes JJ, oxide synthase-dependent nitric oxide produc- Filippov DV, van der Marel GA, Dantuma NP, tion is associated with salt tolerance in Overkleeft HS (2006) A fl uorescent broad- Arabidopsis. Plant Physiol 144(1):206–217. spectrum proteasome inhibitor for labeling doi: 10.1104/pp.107.096842 proteasomes in vitro and in vivo. Chem Biol 14. Davies MJ (2005) The oxidative environment 13(11):1217–1226. doi: 10.1016/j. and protein damage. Biochim Biophys Acta chembiol.2006.09.013 1703(2):93–109. doi: 10.1016/j.bbapap. 23. Wong CM, Bansal G, Marcocci L, Suzuki YJ 2004.08.007 (2012) Proposed role of primary protein car- 15. Hardin SC, Larue CT, Oh MH, Jain V, Huber bonylation in cell signaling. Redox Rep SC (2009) Coupling oxidative signals to pro- 17(2):90–94. doi: 10.1179/13510002 tein phosphorylation via methionine oxidation 12Y.0000000007 in Arabidopsis. Biochem J 422(2):305–312. 24. Cravatt BF, Wright AT, Kozarich JW (2008) doi: 10.1042/BJ20090764 Activity-based protein profi ling: from enzyme 16. Shacter E (2000) Quantifi cation and signifi - chemistry to proteomic chemistry. Annu Rev cance of protein oxidation in biological sam- Biochem 77:383–414. doi: 10.1146/annurev. ples. Drug Metab Rev 32(3-4):307–326. biochem.75.101304.124125 doi: 10.1081/DMR-100102336 25. Gu C, Kolodziejek I, Misas-Villamil J, Shindo 17. Nystrom T (2005) Role of oxidative carbonyl- T, Colby T, Verdoes M, Richau KH, Schmidt J, ation in protein quality control and senescence. Overkleeft HS, van der Hoorn RA (2010) EMBO J 24(7):1311–1317. doi: 10.1038/sj. Proteasome activity profi ling: a simple, robust emboj.7600599 and versatile method revealing subunit- selective inhibitors and cytoplasmic, defense- 18. Dalle-Donne I, Giustarini D, Colombo R, induced proteasome activities. Plant Rossi R, Milzani A (2003) Protein carbonyl- J 62(1):160–170. doi: 10.1111/j.1365-313X. ation in human diseases. Trends Mol Med 2009.04122.x 9(4):169–176
Annexe 3 Ethylene, a key factor in the regulation of seed dormancy
153 REVIEW ARTICLE published: 10 October 2014 doi: 10.3389/fpls.2014.00539 Ethylene, a key factor in the regulation of seed dormancy
Françoise Corbineau*, Qiong Xia, Christophe Bailly and Hayat El-Maarouf-Bouteau
Biologie des Semences (Seed Biology), UMR7622 CNRS-UPMC, Sorbonne Universités – Université Pierre et Marie Curie-Paris, Paris, France
Edited by: Ethylene is an important component of the gaseous environment, and regulates numerous Domenico De Martinis, Italian plant developmental processes including seed germination and seedling establishment. National Agency for New Technologies, Energy and Sustainable Dormancy, the inability to germinate in apparently favorable conditions, has been demon- Economic Development, Italy strated to be regulated by the hormonal balance between abscisic acid (ABA) and Reviewed by: gibberellins (GAs). Ethylene plays a key role in dormancy release in numerous species, the Wendy A. Peer, University of effective concentrations allowing the germination of dormant seeds ranging between 0.1 Maryland, USA 1 and 200 µLL− . Studies using inhibitors of ethylene biosynthesis or of ethylene action and Luciano Freschi, University of São Paulo, Brazil analysis of mutant lines altered in genes involved in the ethylene signaling pathway (etr1, *Correspondence: ein2, ain1, etr1, and erf1) demonstrate the involvement of ethylene in the regulation of Françoise Corbineau, Biologie des germination and dormancy. Ethylene counteracts ABA effects through a regulation of ABA Semences (Seed Biology), Laboratoire metabolism and signaling pathways. Moreover, ethylene insensitive mutants in Arabidopsis de Biologie du Développement, are more sensitive to ABA and the seeds are more dormant. Numerous data also show Sorbonne Universités – Université Pierre et Marie Curie-Paris, UMR an interaction between ABA, GAs and ethylene metabolism and signaling pathways. It has 7622, Bat C2, Boîte Courrier 24, 4 been increasingly demonstrated that reactive oxygen species (ROS) may play a significant Place Jussieu, 75005 Paris, France role in the regulation of seed germination interacting with hormonal signaling pathways. e-mail: [email protected] In the present review the responsiveness of seeds to ethylene will be described, and the key role of ethylene in the regulation of seed dormancy via a crosstalk between hormones and other signals will be discussed.
Keywords: abscisic acid, dormancy, ethylene, gibberellins, reactive oxygen species, seed germination
INTRODUCTION non-dormant seeds in response to unfavorable conditions for In soil, seeds are exposed to various environmental factors germination (Hilhorst, 2007; Hilhorst et al., 2010). including temperature, moisture, oxygen and light, which reg- The involvement of the hormonal balance between abscisic ulate seed germination, and subsequent seedling growth. Phase acid (ABA) and gibberellins (GAs) in the regulation of seed I of the germination process is initiated by imbibition, which is germination and dormancy in response to environmental signals required to activate the respiratory metabolism, and transcrip- is well documented and discussed in recent reviews (Finkelstein tional and translational activities. In phase II called germination et al., 2008; Nambara et al., 2010; Nonogaki et al., 2010; Weit- sensu stricto,wateruptakeceasesandreservemobilizationstarts. brecht et al., 2011; Graeber et al., 2012; Rajjou et al., 2012; Arc Phase III is characterized by radicle protrusion (Bewley and et al., 2013; Miransari and Smith, 2014). ABA is well known Black, 1994; Bewley, 1997; Nonogaki et al., 2010; Weitbrecht to play a crucial role in induction of dormancy in the devel- et al., 2011). Germination requires specific temperatures, oxy- oping seeds and in maintenance of dormancy during seed gen levels and light, the exact proportions being species specific. imbibition, while GAs are involved in dormancy release and/or However, the seeds of species (or even within species) do not germination (Finkelstein et al., 2008; Cutler et al., 2010; Nam- germinate, or do so with difficulty, even when incubated under bara et al., 2010; Miransari and Smith, 2014). In addition to apparently favorable conditions; these are considered as dormant GAs and ABA, other hormones (ethylene, jasmonates, auxins) and cannot germinate in the same conditions (i.e., water, air, also play a role in the control of seed germination (Linkies temperature) under which non-dormant seeds do (Bewley and and Leubner-Metzger, 2012; Arc et al., 2013; Miransari and Black, 1994; Corbineau and Côme, 1995; Bewley, 1997). Dor- Smith, 2014). Ethylene (C2H4)inparticularregulatesgermina- mancy is a heritable trait, but its intensity at harvest and its tion and dormancy of numerous species via a complex hormonal maintenance after harvest is highly modulated by the environ- signaling network (Matilla, 2000; Brady and McCourt, 2003; Feur- mental conditions throughout seed development and ripening tado and Kermode, 2007; Matilla and Matilla-Vazquez, 2008; on the plant, and during seed storage (Bewley, 1997). Fac- Arc et al., 2013). tors inhibiting germination can reside within the embryo itself The role of reactive oxygen species (ROS) in seed biology (embryo dormancy) or can result from an inhibitory action of has progressively emerged and evolved this last decade. Orig- the covering structures (seed coat imposed dormancy; Bewley inally considered as harmful compounds, causing deleteri- and Black, 1994; Hilhorst, 2007). Primary dormancy sets dur- ous reactions toward a wide range of biomolecules and thus ing seed development, but a secondary dormancy can develop to seeds, ROS are now widely acknowledged as signaling in mature seeds with some degree of primary dormancy or in compounds regulating the germination process through an
www.frontiersin.org October 2014 | Volume 5 | Article 539 | 1 Corbineau et al. Ethylene in seed germination
hormonal network (Bailly et al., 2008; Diaz-Vivancos et al., 2013; aprogressiveaccumulationofACS and ACO transcripts El-Maarouf-Bouteau et al., 2014). (Gomez-Jimenez et al., 1998; Matilla and Matilla-Vazquez, 2008; In this review, we describe how ethylene interacts with other Linkies et al., 2009; Iglesias-Fernandez and Matilla, 2010; Linkies plant hormones in regulation of germination and dormancy, and Leubner-Metzger, 2012). Although ACS is considered to be concentrating on its interactions with ABA, GAs, and ROS. a key enzyme in the regulation of ethylene production in most plant responses to abiotic and biotic stresses (Wang et al., 2002), ETHYLENE BIOSYNTHESIS DURING GERMINATION it was demonstrated in seeds that ACO activity plays a fundamen- Ethylene production by seeds begins immediately after the tal role during germination (Matilla and Matilla-Vazquez, 2008; onset of imbibition and increases with time of germination. Linkies and Leubner-Metzger, 2012). Both ACS and ACO are There is, however, a peak in ethylene emission concomitant encoded by a multigene family, and the regulation of particular with the radicle protrusion through the seed coat (Ketring and ACS and ACO genes differ among each other (Wang et al., 2002, Morgan, 1969; Fu and Yang, 1983; Satoh and Esashi, 1983; 2005; Yamagami et al., 2003). In both Arabidopsis and cress (Lep- Gallardo et al., 1991; Gorecki et al., 1991; Siriwitayawan et al., idium sativum), ACO1 and ACO2 have been demonstrated to be 2003; El-Maarouf-Bouteau et al., 2014). Seed ethylene production the major ACOs involved in ethylene synthesis (Linkies et al., 2009; is species dependent (Kepczynski and Kepczynska, 1997; Matilla, Linkies and Leubner-Metzger, 2012), and the correlation between 2000), but is generally below levels detectable by gas chromatogra- the abundance of ACO transcripts and the ACO activity suggests phy during imbibition. Using a high sensitivity laser photo acoustic its regulation at a transcriptional level during germination. spectroscopy (Cristescu et al., 2008), El-Maarouf-Bouteau et al. Ethylene is involved in various developmental processes and (2014) have confirmed the occurrence of an ethylene peak at the responses to biotic and abiotic stresses in plants (Bleecker end of the germination process in sunflower (Helianthus annuus) and Kende, 2000; Wang et al., 2002). The key components seeds. Interestingly, a close relationship between the ability to pro- in its signaling pathway have been identified using a molecu- duce ethylene and seed vigor has been reported in various species lar dissection of ethylene responsiveness in Arabidopsis (Wang including rape (Brassica napus; Takayanagi and Harrington, 1971), et al., 2002; Stepanova and Alonso, 2009; Yoo et al., 2009). cotton (Gossypium spp.; Ketring et al., 1974), peanut (Arachis Five membrane-localized ethylene receptors, ethylene resistant hypogaea; Ketring et al., 1974), cocklebur (Xanthium pennsylvan- 1(ETR1),ETR2,ethyleneresponsesensor1(ERS1),ERS2, icum; Gorecki et al., 1991), snap bean (Phaseolus vulgaris; Samimy and ethylene insensitive 4 (EIN4) exist in Arabidopsis (Wang and Taylor, 1983), sunflower (Chonowski et al., 1997)andpea et al., 2002). Among them, ETR1 and ERS1 contain three trans- (Pisum sativum; Gorecki et al., 1991), and 1-aminocyclopropane membrane domains in the N-terminus and a histidine kinase 1-carboxylic acid (ACC)-dependent C2H4 production was pro- domain in the C-terminus, when ETR2, EIN4, and ERS2 posed as a marker of seed quality (Khan, 1994; Corbineau, present four transmembrane regions and a serine-threonine kinase 2012). domain in the C-terminus (Wang et al., 2006; Kendrick and The pathway of ethylene biosynthesis in seeds is the same Chang, 2008). Binding of ethylene to its receptors results in as that described for other plant organs, in which S-adenosyl- inactivation of CTR1 (constitutive triple response 1) protein methionine (S-AdoMet) and ACC are the main intermediates kinase, which in turn activates the kinase cascade control- (Yang and Hoffman, 1984; Wang et al., 2002; Rzewuski and ling EIN2 and its transcription factors in the nucleus. These, Sauter, 2008; Figure 1). S-AdoMet synthesized from methionine such as EIN3, EILs, ethylene response element binding pro- by the S-AdoMet synthetase (or SAM synthetase), is converted teins (EREBPs)/ethylene responsive factors (ERFs) activate the to ACC, the direct precursor of ethylene, by ACC synthase transcription of ethylene response genes (Wang et al., 2002; (S-adenosyl-L-methionine methylthioadenosine-lyase, ACS). The Liu et al., 2004; Hall et al., 2007; Rzewuski and Sauter, 2008; by-product 5′-methylthioadenosine (MTA) is recycled back to Yoo et al., 2008, 2009; Stepanova and Alonso, 2009; Figure 1). methionine through the Yang Cycle (Yang and Hoffman, 1984; Recently, it was demonstrated that EIN2 is phosphorylated by Kende, 1993). S-AdoMet is also the precursor of the biosynthe- CTR1 kinase in the absence of ethylene, and that EIN2 protein sis of polyamines, which can also play a role in seed germination level is regulated through its degradation by the proteasome (Matilla, 1996). Ethylene production results from the oxidation (Qiao et al., 2009, 2012; Ju et al., 2012). of ACC by ACC oxidase (ACO), which also generates CO2 and hydrogen cyanide (HCN; Figure 1). Autocatalytic synthesis of SEED RESPONSIVENESS TO EXOGENOUS ETHYLENE ethylene via induction of ACC and ACO transcription is well Exogenous ethylene or ethephon, an ethylene releasing com- known in fruit ripening (Lin et al., 2009), ethylene also regulates pound, improves germination in numerous species (Esashi, 1991; ACO expression in pea (Petruzzelli etal., 2000, 2003), beechnut Corbineau and Côme, 1995; Kepczynski and Kepczynska, 1997; (Fagus sylvatica; Calvo et al., 2004b), and turnip (Brassica rapa; Matilla, 2000; Matilla and Matilla-Vazquez, 2008; Arc et al., 2013). Puga-Hermida etal., 2003). In contrast, ethylene or ACC does It stimulates germination of non-dormant seeds incubated in not affect the abundance of ACO transcript in sugar beet (Beta non-optimal environmental conditions such as too high tem- vulgaris; Hermann et al., 2007) and, expression of SoACS7 in peratures (Rao et al., 1975; Abeles, 1986; Gallardo et al., 1991), Sisymbrium officinale and PsAC1 in pea (Petruzzelli etal., 2000, osmotic stress (Negm and Smith, 1978; Kepczynski, 1986; Khan 2003; Iglesias-Fernandez and Matilla, 2010). et al., 2009), hypoxia (Esashi et al., 1989; Corbineau and Côme, Increased ethylene production during germination is asso- 1992), and salinity (Zapata et al., 2003; Wang et al., 2011; Lin ciated with an increase in ACO activity, as well as et al., 2013; Silva et al., 2014). It can also break primary and
Frontiers in Plant Science | Plant Physiology October 2014 | Volume 5 | Article 539 | 2 Corbineau et al. Ethylene in seed germination
FIGURE 1 | Ethylene biosynthesis and signaling pathways. S-adenosyl Ethylene can stimulate its own biosynthesis, by improving ACC methionine (S-AdoMet) is synthesized from methionine by the SAM synthesis catalyzed by ACS, and conversion to ethylene by ACO. synthetase, it is then converted to 1-aminocyclopropane-1-carboxylic acid Ethylene binds to receptors (among which ethylene receptor 1, ETR1) (ACC) by the ACC synthase (ACS), 5-methylthioadenosine (MTA) being a located in the endoplasmic reticulum, which leads to the deactivation by-product. MTA is recycled to methionine through the Yang Cycle by of the receptors that become able to recruit CTR1 (constitutive triple successive enzymatic reactions involving different intermediates among response). Release of CTR1 inhibition allows EIN2 to act as a positive which 5-methylthioribose (MTR) and 2-keto-4-methylthiobutyrate (KMB). regulator of ethylene signaling pathway. EIN2 acts upstream of nuclear S-AdoMet is also the precursor of the spermidine/spermine transcription factors, such as EIN3 (ethylene insensitive), EILs biosynthesis pathway. Ethylene production results from the ACC (EIN3-like), ERBPs (ethylene responsive element binding protein), and oxidation catalyzed by the ACC oxidase (ACO) that also generates ERFs (ethylene response factor). and — arrows indicate positive −→ • carbon dioxide and cyanide. Malonylation of ACC to malonyl-ACC and negative interactions between the different elements of the (MACC) reduces ACC content and consequently ethylene production. signaling cascade, respectively. secondary dormancy (Table 1). It breaks the embryo dormancy paniculatus (Kepczynski and Kepczynska, 1993). In Rhus coriaria,a 1 in apple (Malus domestica; Kepczynski et al., 1977; Sinska and post-fire pioneer, low ethylene concentrations (0.03–0.10 µLL− ) Gladon, 1984; Sinska and Lewandowska, 1991)andbeechnut released by wet ash stimulates germination (Ne’eman et al., 1999), (Calvo et al., 2004a), the dormancy of which is usually broken although it does not improve that of many other species in by chilling, and in sunflower (Corbineau et al., 1990), the dor- which germination is smoke-induced (Brown and van Staden, mancy of which is progressively alleviated during dry storage 1997). Ethylene also improves germination of seeds from parasitic (after-ripening). It also promotes the germination of seeds exhibit- plants such as Striga asiatica, Striga lutea and Striga hermonthica ing a seed coat imposed dormancy in various species such as (Egley and Dale, 1970; Bebawi and Eplee, 1986). cocklebur (Katoh and Esashi, 1975; Esashi et al., 1978), subter- The stimulatory effect of ethylene is dose dependent, the ranean clover (Trifolium subterraneum; Esashi and Leopold, 1969), hormone being efficient when applied at concentration rang- 1 Rumex crispus (Taylorson, 1979), and Arabidopsis (Siriwitayawan ing from 0.1 to 200 µLL− depending on the species, the et al., 2003). In particular, it can also overcome the secondary dor- depth of dormancy and the environmental conditions. Break- mancy induced by high temperatures in lettuce (Lactuca sativa; ing of dormancy either during chilling in apple (Sinska, 1989) Speer et al.,1974; Abeles, 1986), sunflower (Corbineau et al.,1988), or dry storage in sunflower (Corbineau and Côme, 2003), Ama- Amaranthus caudatus (Kepczynski etal., 1996a) and Amaranthus ranthus retroflexus (KepczynskiandSznigir,2014) and Stylosanthes
www.frontiersin.org October 2014 | Volume 5 | Article 539 | 3 Corbineau et al. Ethylene in seed germination
Table 1 | Plant species whose seed dormancy is broken by ethylene, ethephon, an ethylene releasing compound, or 1-aminocyclopropane- 1-carboxylic acid, the direct precursor of ethylene.
Type of dormancy Species Reference
Primary dormancy Amaranthus caudatus Kepczynski and Karssen (1985) Amaranthus retroflexus Kepczynski et al. (1996b) Arabidopsis thaliana Siriwitayawan et al. (2003) Arachis hypogaea Ketring and Morgan (1969) Chenopodium album Machabée and Saini (1991) Fagus sylvatica Calvo et al. (2004a) Helianthus annuus Corbineau et al. (1990) Pyrus malus Kepczynski et al. (1977) Sinska and Gladon (1984) Rhus coriaria Ne’eman et al. (1999) Rumex crispus Taylorson (1979) Stylosanthes humilis Ribeiro and Barros (2006) Trifolium subterraneum Esashi and Leopold (1969) Xanthium pennsylvanicum Katoh and Esashi (1975)
Thermo-dormancy Lactuca sativa Speer et al. (1974)
Secondary dormancy Amaranthus caudatus Kepczynski and Karssen (1985) Amaranthus paniculatus Kepczynski and Kepczynska (1993) Helianthus annuus Corbineau et al. (1988) Lactuca sativa Abeles (1986) Rumex crispus Samimy and Khan (1983) Xanthium pennsylvanicum Esashi et al. (1978) humilis (Ribeiro and Barros, 2006) is associated with an increas- Esashi, 1975), and lettuce (Negm and Smith, 1978; Saini et al., ing sensitivity to ethylene. At harvest, dormant sunflower seeds 1986). In the case of cocklebur (Esashi et al., 1986)andsunflower 1 require 50 µLL− ethylene in order to germinate at 15◦C, but (Corbineau et al., 1990) seeds, it was suggested that the improving 1 only 10 and 3 µLL− after 8 and 15 weeks of dry-storage effect of CO2 results from an enhancement of C2H4 biosynthesis, at 5◦C, respectively (Corbineau and Côme, 2003). In contrast, since it is suppressed in the presence of inhibitors of ethylene the responsiveness to the hormone decreases progressively dur- synthesis. ing seed incubation under environmental conditions that induce a secondary dormancy (Negm et al., 1973; Speer et al., 1974; INVOLVEMENT OF ETHYLENE IN SEED GERMINATION AND Esashi et al., 1978; Jones and Hall, 1984; Corbineau and Côme, DORMANCY 2003). Numerous studies demonstrate that the ability to germinate Although ethylene stimulates the germination of numer- correlates with ethylene production, suggesting that ethylene is ous light sensitive seeds, it does not overcome the light involved in the regulation of seed germination and dormancy requirement in Amaranthus retroflexus (Schönbeck and Egley, (reviewed in Kepczynski and Kepczynska, 1997; Matilla and 1981), celery (Apium graveolens; Thomas et al., 1975), lettuce Matilla-Vazquez, 2008; Arc et al., 2013). For example, induc- (Burdett and Vidaver, 1971), and Spergula arvensis (Olatoye tion of thermodormancy at high temperatures is associated with and Hall, 1973). Recently, Wilson et al. (2014b) demonstrate a reduced ethylene production in chickpea (Cicer arietinum; that loss of ETR1 reduces the inhibitory effect of far-red Gallardo et al., 1991), sunflower (Corbineau et al., 1988), and on the germination of Arabidopsis seeds through expression lettuce (Prusinski and Khan, 1990). This decrease in C2H4 pro- of genes involved in ABA and GAs metabolism. An epis- duction may result from an increase in ACC-malonyltransferase tasis analysis performed by the same authors also suggests activity, thus from a decrease in ACC content as demonstrated that ETR1 may interact with phytochromes to control seed in chickpea (Martinez-Reina etal., 1996), an inhibition of ACO germination. activity (Corbineau et al., 1988; Gallardo et al., 1991), or a reduced An additive or synergistic effect of CO2 and ethylene has also expression of ACS and ACO (Argyris et al., 2008). In con- been demonstrated in seeds of peanut (KetringandMorgan,1972), trast, breaking of dormancy by various treatments (e.g., chilling, Spergula arvensis (Jones and Hall, 1984), cocklebur (Katoh and GAs, NO, HCN) leads to an increase in ethylene production
Frontiers in Plant Science | Plant Physiology October 2014 | Volume 5 | Article 539 | 4 Corbineau et al. Ethylene in seed germination
(Kepczynski and Kepczynska, 1997; Arc et al., 2013). In Ara- dormancy might result from insufficient ACC level due to low bidopsis,theinductiveeffectofchillingisassociatedwith ACS activity. a reduced expression of ACO,butinatransientinduction It is important to notice that HCN, a co-product of ACC oxi- of ACS (Narsai et al., 2011; Linkies and Leubner-Metzger, dation, can also break seed dormancy in apple (Perino et al., 1984; 2012). However, after-ripening of Sisymbrium officinale seeds Lewak, 2011; Krasuska and Gniazdowska, 2012; Krasuska et al., inhibits expression of SoACS7 and SoACO2 which are involved 2014), sunflower (Oracz et al., 2008) and Amaranthus retroflexus in ethylene biosynthesis, during early seed incubation, but (Kepczynski and Sznigir, 2014). stimulates that of SoGA20ox2, SoGA3ox2, and SoGA2ox6 Using Arabidopsis lines altered in ethylene biosynthesis and involved in GA metabolism (Iglesias-Fernandez and Matilla, signaling allowed to characterize the regulation of dormancy 2009). by ethylene (Table 2). Seeds of ethylene insensitive etr1 (ethy- Data obtained using inhibitors of ethylene biosynthesis path- lene resistant) as well as ein2 (ethylene insensitive 2)mutants way or mutants altered in ethylene biosynthesis and signaling display enhanced primary dormancy relative to wild type, prob- pathways demonstrated that endogenous ethylene plays a key ably due to high ABA sensitivity, whereas ctr1 (constitutive triple role in the regulation of germination and dormancy. Incuba- responses) mutant have a slightly enhanced rate of germination tion of seeds in the presence of aminoethoxyvinylglycine (AVG) (Bleecker et al., 1988; Leubner-Metzger et al., 1998; Beaudoin and aminooxyacetic acid (AOA), inhibitors of ACS activity, et al., 2000; Ghassemian et al., 2000; Hall et al., 2001; Chiwocha CoCl2 and α-aminoisobutyric acid (α-AIB), inhibitors of ACO et al., 2005; Subbiah and Reddy, 2010). EIN2 plays a key role in activity, or 2,5-norbornadiene (2,5 NBD) and silver thiosul- the ethylene signaling pathway, and loss of its function results fate (STS), inhibitors of ethylene action, allowed demonstra- in a hypersensitivy to salt and osmotic stress during germina- tion of the involvement of endogenous ethylene in germination tion and early seedling development in Arabidopsis (Wang et al., and dormancy breakage (Kepczynski et al., 1977, 2003; Sin- 2007). ERFs genes might also play a pivotal role in ethylene ska and Gladon, 1989; Corbineau et al., 1990; Longan and responsiveness and regulation of germination (Leubner-Metzger Stewart, 1992; Gallardo et al., 1994; Hermann et al., 2007). In et al., 1998; Pirrello et al., 2006). FsERF1 expression is minimal contrast, seed incubation in the presence of ACC, the direct in dormant beechnut embryo, but increases during moist chill- precursor of ethylene, improves seed germination in numerous ing which breaks dormancy (Jimenez et al., 2005). In sunflower, species such as lettuce (Fu and Yang, 1983), sunflower (Cor- ERF1 expression is fivefold higher in non-dormant than in dor- bineau et al., 1990), cocklebur (Satoh et al., 1984), Amaranthus mant embryos, and expression is markedly stimulated by HCN, sp. (Kepczynski, 1986; Kepczynski etal., 1996b), chickpea (Gal- which breaks dormancy (Oracz et al., 2008). In tomato (Solanum lardo et al., 1994), and sugar beet (Hermann et al., 2007). This lycopersicon), SlERF2 transcript abundance is higher in germinat- effect of ACC suggests that ACO is potentially active, and that ing seeds than in non-germinating ones, and its overexpression
Table 2 | Dormancy and ABA sensitivity of various mutants of Arabidopsis thaliana affected in ethylene biosynthesis or signaling pathway.
Mutant or transgenic linesa Gene/locus Seed dormancy Hormone sensitivity and content Referenceb etr1-1 ETR1 Enhanced C2H4 insensitive and ABA hypersensitive 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12 etr1-2 Higher ABA content etr1-3 ETR1 Enhanced Reduced C2H4 sensitivity 10 etr1-6 ETR1 Slightly enhanced More sensitive to ABA 10, 13 etr1-8 ETR1 Enhanced – 10 ein2-1, ein2-5, ein2-49 EIN2 Enhanced ABA hypersensitivity 1, 3, 4, 7, 11, 12 Higher ABA content ein4-4 EIN4 Enhanced – 10 ein6 EIN6 Enhanced ABA hypersensitivity 11 ctr1-1, ctr1-10 CTR1 Early germination Reduced ABA sensitivity 1, 3, 7, 9, 11, 12 acs7 ACS Early germination ABA hypersensitivity 5 eto3 Early germination Reduced ABA sensitivity 3, 11 amutant abbreviations: acs7 ACC synthetase7; ctr1 constitutive triple response1; ein2, ein4, ein6 ethylene insensitive1, 4, 6; etr1 ethylene resistant1; = = = = eto3 ethylene overproducer3. = breferences: (1) Beaudoin et al. (2000); (2) Bleecker et al. (1988); (3) Cheng et al. (2009); (4) Chiwocha et al. (2005); (5) Dong et al. (2011); (6) Ghassemian et al. (2000); (7) Hall et al. (2001); (8) Leubner-Metzger et al. (1998); (9) Ouaked et al. (2003); (10) Siriwitayawan et al. (2003); (11) Subbiah and Reddy (2010); (12) Wang et al. (2007); (13) Wilson et al. (2014a).
www.frontiersin.org October 2014 | Volume 5 | Article 539 | 5 Corbineau et al. Ethylene in seed germination
in transgenic lines results in premature seed germination by data obtained with various mutants affected in the signaling (Pirrello et al., 2006). pathway of both hormones. Ethylene insensitive mutants (etr1, Transcriptional arrays have been used to draw a global view of ein2, and ein6) are hypersensitive to ABA, whereas seeds of ein3, gene expression in germinating and non-germinating seeds and ein4, ein5, and ein7 germinate normally. Conversely, eto1, eto3, core sets of genes were analyzed with respect to hormone respon- and ctr1 mutants (characterized by an increase in C2H4 produc- sive elements. The analysis of transcriptome data of dormant and tion) exhibit a reduced sensitivity to ABA (Table 2; Beaudoin et al., after-ripened states in Arabidopsis performed by Cadman et al. 2000; Ghassemian et al., 2000; Subbiah and Reddy, 2010). Loss of (2006) showed that ACS2 gene expression was up-regulated in function of CRT1 enhances the tolerance to ABA of abi1-1 seeds the dormant state and AtERF5 was up-regulated in germinating (Beaudoin et al., 2000). Genetic approaches, using double mutants state. In lettuce, Argyris et al. (2008) have shown that ethylene obtained by crossing ethylene insensitive mutants (ctr1, ein1, ein3, responsive genes are regulated by thermo-inhibition; ACO and and ein6) with aba2 mutant, demonstrate that ABA and C2H4 ACS gene expression is reduced while CTR1, EIN2, ETR1 expres- may also act in parallel, since they exibit phenotypes resulting sion is increased at high temperature. These results point out from both ABA deficiency and altered ethylene sensitivity (Cheng the gap that exists between hormone metabolism and signal- et al., 2009). ing regulation at the level of gene expression. In wheat seeds, Although ACC and exogenous ethylene do not affect ABA con- 78 probesets annotated as ethylene metabolism and signaling tent in Lepidium sativum (Linkies et al., 2009)andsugarbeet genes have been differentially expressed between dormant and (Hermann et al., 2007), Arabidopsis seeds from ethylene insen- after-ripened seeds (Chitnis et al., 2014). ACO is represented by sitive mutants, etr1 and ein2, have a higher ABA content than that four probesets that are up-regulated in after-ripened wheat seeds of wild type seeds (Kende et al., 1998; Beaudoin et al., 2000; Ghas- but no ACS corresponding probeset has been found. Ethylene semian et al., 2000; Chiwocha et al., 2005; Wang et al., 2007). For signaling element as reversion to ethylene sensitivity 1, ERS1, example, mutation in ETR1 results in an 8-fold higher ABA con- EBF1 (EIN3 binding box protein1), prohibitin 3 or ERF have tent in mature seeds than in wild type, probably due to a decrease been shown to be up-regulated in after-ripened seeds at 12 or in ABA conjugation (Chiwocha et al., 2005). Loss of function of 24 h of imbibition. The number of genes related to ethylene ACS7, one of type 3 ACS with a very short C-terminus and no involved in germination is underestimated since only direct known phosphorylation site, results in reduced C2H4 emission and hyper- ethylene signaling components are targeted for analysis in omic sensitivity to ABA, consequently conferring abiotic stress tolerance studies. It has been shown that treatment with ACC of 7 days to Arabidopsis seeds (Dong et al., 2011). ABA accumulation is also germinated seedlings triggers change in expression of 544 genes, associated with stimulation of ABA biosynthesis through an up- among them 244 were common to seeds given an ABA treat- regulation of NCED and a down-regulation of CYP707A2 in seeds ment (Nemhauser et al., 2006). These results have been used to of the etr1 mutant (Cheng et al., 2009), or an up-regulation of compare genes regulated in Lepidium seed tissues during germi- NCED3 associated with an up-regulation of ABA1 in ein2 seeds nation (Linkies et al., 2009). Pectate Lyase 1, Argos-like, Expansin (Wang et al., 2007). A2, B-1,3-glucanase and chitinase B which play an important role Inhibition of germination by ABA is associated with an in endosperm weakening and/or radicle growth in germination inhibition of in vivo ACO activity and is correlated with a of Lepidium seeds, are proposed as putative ethylene response reduction in ACO transcript accumulation (Bailly et al., 1992; down-stream genes. Cell wall loosening enzymes expressed in Petruzzelli etal., 2000, 2003; Linkies et al., 2009), leading to endosperm are also controlled by both ABA and GA (Groot et al., areductionofethyleneproduction(Kepczynski and Kepczyn- 1988; Toorop et al., 2000). ska, 1997; Matilla, 2000). In Arabidopsis, accumulation of ACO1 and ACO2 transcripts during germination is inhibited by ETHYLENE CROSSTALK WITH ABA/GAs AND SEED ABA, and the high level of ACO1 transcript in ABA-insensitive GERMINATION mutants suggest a tight regulation of ACO expression by ABA INTERRELATIONSHIP BETWEEN ETHYLENE AND ABA (Penfield et al., 2006; Carrera et al., 2008; Linkies et al., 2009). The antagonistic effects of ABA and ethylene in the regulation In Lepidium sativum, ABA inhibits expression of both ACO1 of seed germination and dormancy have been extensively stud- and ACO2 in the endosperm cap (Linkies et al., 2009). Up- ied (Leubner-Metzger et al., 1998; Beaudoin et al., 2000; Kucera regulation of ACO transcript has also been detected by microar- et al., 2005; Matilla and Matilla-Vazquez, 2008; Linkies et al., 2009; ray analysis in the aba2 mutant in Arabidopsis (Cheng et al., Arc et al., 2013). Ethylene overcomes the inhibitory action of ABA 2009). In contrast, there is an ABA-mediated up-regulation of on germination of numerous species among which are Amaran- ACC accumulation and ACO expression in sugar beet seeds thus caudatus (Kepczynski, 1986), Chenopodium album (Karssen, (Hermann et al., 2007). 1976), cotton (Halloin, 1976), tobacco (Nicotiana tabacum), and Arabidopsis (Leubner-Metzger et al.,1998). In Arabidopsis and Lep- INTERRELATIONSHIP BETWEEN ETHYLENE AND GAs idium sativum, ethylene also counteracts the inhibition by ABA of Gibberellins improve the germination of dormant seeds in numer- endosperm cap weakening and rupture (Linkies et al., 2009). On ous species whose dormancy is broken by ethylene, ethephon, the contrary, ABA increases the ethylene requirement in order or ACC (c.f. Table 1). Both hormones promote the germina- to release dormancy in sunflower (Corbineau and Côme, 1995, tion of primary dormant seeds of Arabidopsis (Ogawa et al., 2003; 2003) and Amaranthus caudatus (Kepczynski et al., 2003). The Siriwitayawan etal., 2003), Amaranthus retroflexus (Kepczynski negative interaction between ABA and ethylene is also supported et al., 1996b; Kepczynski and Sznigir, 2014), beechnut (Calvo
Frontiers in Plant Science | Plant Physiology October 2014 | Volume 5 | Article 539 | 6 Corbineau et al. Ethylene in seed germination
et al., 2004a,b), apple (Kepczynski et al., 1977; Sinska and Gladon, ga1-3), RGL1 (RGA LIKE1), RGL2 and RGL3 (Sun and Gubler, 1984; Sinska, 1989; Lewak, 2011), and Sisymbrium officinale 2004; Davière and Achard, 2013). GAs destabilizes the DELLA (Iglesias-Fernandez and Matilla, 2010). They also break secondary proteins, which act as growth repressors by targeting GAs for dormancy in Rumex crispus (Samimy and Khan, 1983)andcock- ubiquitination and degradation (Dill et al., 2004). In Arabidopsis, lebur seeds (Esashi et al., 1975), and thermodormancy in lettuce Achard et al. (2003, 2007) reported that a part of ethylene action achenes (Keys et al., 1975). In Arabidopsis,C2H4 restores the ger- on hypocotyl growth and floral transition was mediated via its mination of the GA-deficient mutant ga1-3 (Karssen et al., 1989), effects on the DELLA proteins. This may be true too in the control and GA3 stimulates that of the etr1 mutant (Bleecker et al., 1988), of germination since DELLA proteins seem to play a key role in the while no stimulatory effect is noted on the germination of the GA- regulation of seed germination (Lee et al., 2002; Tyler et al., 2004; deficient gib-1 mutant in tomato (Groot and Karssen, 1987). All Cao et al., 2006; Steber, 2007; Piskurewicz et al., 2008; Schwech- these data suggest that GAs and ethylene pathways interact (Brady heimer, 2008). Thus, the seed GA content and responsiveness may and McCourt, 2003; Feurtado and Kermode, 2007; Matilla and result from a regulation of DELLA accumulation by ethylene. Matilla-Vazquez, 2008; Miransari and Smith, 2014). In beechnut, incubation of embryos in the presence of GA3 ROS AND ETHYLENE INTERACT TO REGULATE SEED results in an accumulation of ACC and an increase in ACC GERMINATION oxidase activity and C2H4 production, concomitant with an It has been shown in various seed species (Oracz et al., 2007; increased expression of FsACO1 (Calvo et al., 2004a). Similarly, Ishibashi et al., 2008, 2013; Müller et al., 2009; Bahin et al., 2011), the improving effect of GA4 on the germination of Arabidopsis including Arabidopsis (Liu et al., 2010; Leymarie et al., 2012), that ga1-3 mutant seeds is associated with an increase in AtACO radicle protrusion is associated with and/or required a controlled (Ogawa et al., 2003). Decrease of the expression of FsACO1 accumulation of ROS. Regarding the role of plant hormones in in the presence of paclobutrazol, a GAs biosynthesis inhibitor, seed germination and dormancy, several studies have investi- confirms that GAs activates the ethylene biosynthesis pathway gated the possible relationship between metabolic and signaling (Calvo et al., 2004a,b). However, in Sisymbrium officinale, Iglesias- pathways of these hormones, mainly ABA and GAs, and ROS Fernandez and Matilla (2010) demonstrate that expression of homeostasis (Bailly et al., 2008). Up-to-date, however, the rela- SoACS7 and SoACO2 during germination is inhibited by paclobu- tionship between ROS and ethylene has been scarcely studied trazol, but is not affected by application of either ethrel or within the context of seed germination, although this is well doc- GA4 7.Inaddition,theup-regulationofAtERS1 (ETHYLENE umented in other contexts such as plant pathogen interactions RESPONSE+ SENSOR encoding a member of ethylene receptor (Mersmann et al., 2010)orcelldeathregulation(Overmyer et al., family) in Arabidopsis in the presence of GA4 (Ogawa et al., 2003). 2003)andofanEIN-3 like in beechnut in the presence of In sunflower embryos, whose dormancy is released by exoge- GA3 (Lorenzo et al., 2000)suggestaneffectofGAsonethylene nous ethylene (Corbineau et al., 1990), it has been recently response. demonstrated that ethylene markedly enhanced ROS accumu- Numerous data also suggest that ethylene stimulates seed ger- lation within dormant embryonic axes, probably through the mination by affecting the GAs biosynthesis or signaling pathway. activation of NADPH oxidase (El-Maarouf-Bouteau et al., 2014). GA1, GA4, and GA7 strongly accumulate in dry mature seeds Whether ethylene produced in response to ROS has a direct effect of the etr1-2 Arabidopsis mutant relative to wild type, and both on cell wall properties and cell elongation or if it stimulates cell GA4 and GA7 contents remain higher than in wild type dur- signaling pathways related to germination, is however not known. ing the two first days of imbibition (Chiwocha et al., 2005). The Contrasting results obtained by Lin et al. (2012, 2013) demon- changes in GA content during germination suggest that lack of strates that ethylene decreases ROS content in Arabidopsis seeds ETR1, i.e., of ethylene signaling pathway, results (i) in alter- germinating under salinity stress. In the case of the former species, ation of GAs biosynthesis pathway, and (ii) in a requirement ethylene has an antagonistic effect to ROS that are detrimental for for higher levels of GAs than wild type, to promote germination germination, probably because their production increases to exces- (Chiwocha et al., 2005). In beechnut, expression of FsGA20ox1, sivelevelsinresponsetostress. Thishighlightstheplasticityof seed which is involved in the synthesis of active GAs, remains low responses to ROS but also the complexity of their interaction with in stratified seeds (i.e., non-dormant seeds) and seeds treated ethylene (Bailly et al., 2008). with GA3 or ethephon, but inhibition of ethylene biosynthesis Several authors have also studied the effect of ROS on ethy- by AOA (2-aminoxyacetic acid) results in an increase in this tran- lene production during seed germination. Dormant sunflower script indicating the involvement of ethylene in the regulation of embryos treated by methylviologen, a ROS generating compound, GA biosynthesis (Calvo et al., 2004b). Studies of expression of germinate rapidly at temperatures that would otherwise prevent genes involved in GA synthesis (SoGA3ox2 and SoGA20ox2) and their germination (Oracz et al., 2007). However, this improving degradation (SoGA2ox6)duringimbibitionofSisymbrium offic- effect is not associated with an increase in ethylene production inale seeds in the presence of GA4 7,ethylene,andinhibitors which peaks at the time radicle elongates, and which therefore of GA synthesis or ethylene synthesis+ and signaling, indicate must be considered as a post-germinative event (El-Maarouf- that GA biosynthesis is strongly regulated by GA and ethylene Bouteau et al., 2014). These authors propose that ethylene might (Iglesias-Fernandez and Matilla, 2010). participate in association with ROS to facilitate the initiation Gibberellin signaling pathways depend on DELLA proteins of cell elongation, the first visible symptom of germination. including GAI (GA INSENSITIVE), RGA (REPRESSOR OF In dormant apple embryos, Gniazdowska etal. (2010) suggest
www.frontiersin.org October 2014 | Volume 5 | Article 539 | 7 Corbineau et al. Ethylene in seed germination
that the improving effect of NO and HCN results from a tran- sient ROS production leading to an ethylene production required in termination of the sensu stricto germination process before radicle elongation and propose that this might result from a non- enzymatic oxidation of ACC. Ishibashi et al. (2013) have proposed that ROS produced in soybean (Glycine max)embryonicaxesdur- ing imbibition induces ethylene production, which promotes cell elongation in the radicle. However, in that case, ethylene was mea- sured after the onset of radicle protrusion, and this production was probably more related to the kinetics of seedling elongation than on a direct effect of H2O2.Incontrast,inpea,whichger- mination is not strongly regulated by ethylene, Barba-Espin et al. (2011) demonstrate that H2O2 treatment results in a reduction in PsACS2 transcript abundance consistent with a decrease in ACC content. These results suggest that ROS and ethylene probably do not interact directly, but rather through a complex hormonal network (Diaz-Vivancos et al., 2013). All together these data suggest that the interaction between ROS and ethylene in seeds can operate in both directions, depending on the physiological context of germination, i.e., on the envi- ronmental conditions prevailing during imbibition, and is highly species related. One can predict that the use of seeds of the plant model Arabidopsis will help decipher the molecular bases of this interaction. In particular it will be interesting to deter- mine whether ROS can trigger expression of the ethylene signaling FIGURE 2 | Interactions between ethylene, abscisic acid, gibberellins, and ROS in the regulation of seed germination and dormancy. This pathway components and vice versa.Forexample,Oracz et al. scheme is based on genetic analyses, microarray data, and physiological (2009) has demonstrated the occurrence of such a cross talk, since studies on seed responsiveness to ethylene, ABA, GAs, or ROS cited in the the treatment of dormant sunflower embryos by methylviologen text. Ethylene down-regulates ABA accumulation by both inhibiting its synthesis and promoting its inactivation or catabolism, and also negatively induced the expression of ETR2 and of the transcription fac- regulates ABA signaling. ABA inhibits ethylene biosynthesis through ACS tor ERF1. The involvement of ethylene transcription factors in and ACO activities. Ethylene also improves the GAs metabolism, and GAs response to ROS appears to be worth investigating since studies signaling, and vice versa. ROS enhance ABA catabolism and both C2H4 with other plant systems have also implicated such a relationship and GAs signaling. Whether ROS are signals induced by environmental factors to modulate the hormonal network toward germination is to be (Sewelam et al., 2013). investigated. and — arrows indicate positive and negative interactions → • between the different elements of the signaling cascade, respectively. CONCLUSION: NETWORK BETWEEN ETHYLENE, PLANT HORMONES, AND ROS Seed germination is regulated by ethylene in a complex signaling expression of genes (GA3ox and GA20ox) involved in GAs syn- network, which is also operational in numerous developmental thesis. Ethylene also probably modifies the GAs signaling pathway processes, including vegetative growth, flowering timing, fruit via a regulation of DELLA proteins, as demonstrated in growth ripening and organ senescence and abscission (Yoo et al., 2009; processes (Achard et al., 2003, 2007). To add to the complexity of Muday et al., 2012; Arc et al., 2013). As mentioned above, ethy- the ABA-GAs-C2H4 network, there are antagonistic interactions lene interacts with ABA and GAs, both hormones being essential between ABA and GAs, C2H4 and brassinosteroids, jasmonates regulators of germination and dormancy (Feurtado and Kermode, and auxins (Wang et al., 2002; Brady and McCourt, 2003; Weiss 2007; Nambara et al., 2010; Nonogaki et al., 2010; Miransari and and Ori,2007; Finkelstein et al.,2008; Matilla and Matilla-Vazquez, Smith, 2014). Thus, the improving effect of ethylene may occur 2008; Cheng et al., 2009; Divi et al., 2010; Linkies and Leubner- via the involvement of C2H4-GAs-ABA crosstalk but whether Metzger, 2012). ROS also regulate seed germination through its action is direct or indirect needs clarification. Research on hormonal networks, in particular with ABA and GAs (Bethke the effect of ABA and GAs on C2H4 biosynthesis and signal- et al., 2007; Liu et al., 2010; Diaz-Vivancos et al., 2013). It would ing pathways, especially in seeds, would then require further be then important to discriminate the hierarchy of the differ- investigation, specifically in relation with ROS. Figure 2 sum- ent signaling pathways, and their role as sensor of environmental marizes the current data concerning ABA-GAs-C2H4 networks signals. based on genetic analyses, microarray data, and physiologi- Omics studies are now available in the field of seed germination cal studies. ABA inhibits the C2H4 biosynthesis pathway via but efforts to develop transcriptomic analysis of ethylene action an inhibitory action on ACO activity and on the ACO tran- are required to understand ethylene involvement in seed germina- script accumulation. On the contrary, C2H4 counteracts both tion. Analysis of the effects of ethylene on specific cellular processes ABA synthesis and signaling, ETR1 having a key role. In addi- highlighted by dormancy and germination studies such as tran- tion, C2H4 affects the synthesis of GAs via modification of scription regulation, cell cycle activity and endosperm weakening
Frontiers in Plant Science | Plant Physiology October 2014 | Volume 5 | Article 539 | 8 Corbineau et al. Ethylene in seed germination
should help to understand the regulatory network of germination Calvo, A. P., Nicolas, C., Lorenzo, O., Nicolas, G., and Rodriguez, D. (2004a). process in seeds. Moreover, although hormonal signaling network Evidence for positive regulation by gibberellins and ethylene of ACC oxidase share common components, they may work in specific territories expression and activity during transition from dormancy to germination in Fagus sylvatica L. seeds. J. Plant Growth Regul. 23, 44–53. doi: 10.1007/s00344-004- in seeds. 0074-7 Calvo, A. P.,Nicolas, C., Nicolas, G., and Rodriguez, D. (2004b). Evidence of a cross- REFERENCES talk regulation of a GA 20-oxidase (FsGA20ox1) by gibberellins and ethylene Abeles, F. B. (1986). Role of ethylene in Lactuca sativa cv Grand Rapids seed during the breaking of dormancy in Fagus sylvatica seeds. Physiol. Plant. 120, germination. Plant Physiol. 81, 780–787. doi: 10.1104/pp.81.3.780 623–630. doi: 10.1111/j.0031-9317.2004.0270.x Achard, P., Baghour, M., Chapple, A., Hedden, P., Van Der Straeten, D., Cao, D., Cheng, H., Wu, W., Soo, H. M., and Peng, J. (2006). Gibberellin Genschik, P., et al. (2007). The plant stress hormone ethylene controls flo- mobilizes distinct DELLA-dependent transcriptomes to regulate seed germina- ral transition via DELLA-dependent regulation of floral meristem-identity tion and floral development in Arabidopsis. Plant Physiol. 142, 509–525. doi: genes. Proc. Natl. Acad. Sci. U.S.A. 104, 6484–6489. doi: 10.1073/pnas.061 10.1104/pp.106.082289 0717104 Carrera, E., Holman, T., Medhurst, A., Dietrich, D., Footitt, S., Theodoulou, Achard, P.,Vriezen, W. H., Van Der Straeten, D., and Harberd, N. P.(2003). Ethylene F. L., etal. (2008). Seed after-ripening is a discrete developmental path- regulates Arabidopsis development via the modulation of DELLA protein growth way associated with specific gene networks in Arabidopsis. Plant J. 142, repressor function. Plant Cell 15, 2816–2825. doi: 10.1105/tpc.015685 1493–1510. Arc, E., Sechet, J., Corbineau, F., Rajjou, L., and Marion-Poll, A. (2013). ABA Cheng, W. H., Chiang, M. H., Hwang, S. G., and Lin, P. C. (2009). Antagonism crosstalk with ethylene and nitric oxide in seed dormancy and germination. Front. between abscisic acid and ethylene in Arabidopsis acts in parallel with the recip- Plant Sci. 4:63. doi: 10.3389/fpls.2013.00063 rocal regulation of their metabolism and signaling pathways. Plant Mol. Biol. 71, Argyris,J.,Dahal,P.,Hayashi,E.,Still,D.W.,andBradford,K.J.(2008). Geneticvari- 61–80. doi: 10.1007/s11103-009-9509-7 ation for lettuce seed thermoinhibition isassociatedwithtemperature-sensitive Chitnis, V. R., Gao, F., Yao, Z., Jordan, M. C., Park, S., and Ayele, B. T. (2014). expression of abscisic acid, gibberellin, and ethylene biosynthesis, metabolism, After-ripening induced transcriptional changes of hormonal genes in wheat seeds: and response genes. Plant Physiol. 148, 926–947. doi: 10.1104/pp.108. the cases of brassinosteroids, ethylene, cytokinin and salicylic acid. PLoS ONE 125807 9:e87543. doi: 10.1371/journal.pone.0087543 Bahin, E., Bailly, C., Sotta, B., Kranner, I., Corbineau, F., and Leymarie, J. Chiwocha, S. D. S., Cutler, A. J., Abrams, S. R., Ambrose, S. J., Yang, J., and (2011). Crosstalk between reactive oxygen species and hormonal signaling path- Kermode, A. R. (2005). The ert1-2 mutation in Arabidopsis thaliana affects the ways regulates grain dormancy in barley. Plant Cell Environ. 34, 980–993. doi: abscisic acid, auxin, cytokinin and gibberellin metabolic pathways during main- 10.1111/j.1365-3040.2011.02298.x tenance of seed dormancy, moist-chilling and germination. Plant J. 42, 35–48. Bailly,C.,Corbineau,F.,andCôme,D.(1992). Theeffectsof abscisicacidandmethyl doi: 10.1111/j.1365-313X.2005.02359.x jasmonate on 1-aminocyclopropane 1-carboxylic acid conversion to ethylene in Chonowski, M., Corbineau, F., and Côme, D. (1997). Physiological and bio- hypocotyl segments of sunflower seedlings, and their control by calcium and chemical changes induced in sunflower seeds by osmopriming and subsequent calmodulin. Plant Growth Regul. 11, 349–355. doi: 10.1007/BF00130641 drying, storage and aging. Seed Sci. Res. 7, 323–332. doi: 10.1017/S0960258500 Bailly, C., El-Maarouf-Bouteau, H., and Corbineau, F. (2008). From intracellular 00372X signaling networks to cell death: the dual role of reactive oxygen species in seed Corbineau, F. (2012). Markers of seed quality: from present to future. Seed Sci. Res. physiology. C. R. Biol. 331, 806–814. doi: 10.1016/j.crvi.2008.07.022 22, S61–S68. doi: 10.1017/S0960258511000419 Barba-Espin, G., Diaz-Vivancos, P., Job, D., Belghazi, M., Job, C., and Hernandez, Corbineau, F., Bagniol, S., and Côme, D. (1990). Sunflower (Helianthus annuus L.) J. A. (2011). Understanding the role of H2O2 during pea seed germination: a seed dormancy and its regulation by ethylene. Isr. J. Bot. 39, 313–325. combined proteomic and hormone profiling approach. Plant Cell Environ. 34, Corbineau, F., and Côme, D. (1992). “Germination of sunflower seeds and its 1907–1919. doi: 10.1111/j.1365-3040.2011.02386.x regulation by ethylene,” in Advances in the Science and Technology of Seeds, eds F. Beaudoin, N., Serizet, C., Gosti, F., and Giraudat, J. (2000). Interactions between Jiarui and A. A. Khan (Beijing, NY: Science Press), 277–287. abscisic acid and ethylene signaling cascades. Plant Cell 12, 1103–1115. doi: Corbineau, F., and Côme, D. (1995). “Control of seed germination and dormancy 10.1105/tpc.12.7.1103 by gaseous environment,”in Seed Development and Germination, eds J. Kigel and Bebawi, F. F., and Eplee, R. E. (1986). Efficacy of ethylene as a germination stimulant G. Galili (New York: Marcel Dekker), 397–424. of Striga hermonthica. Weed Sci. 34, 694–698. Corbineau, F., and Côme, D. (2003). “Germination of sunflower seeds as related Bethke, P. C., Libourel, I. G. L., and Jones, R. L. (2007). “Nitric oxide in seed to ethylene synthesis and sensitivity – an overview,” in Biology and Biotechnology dormancy and germination,”in Annual Plant Reviews, Vol. 27, Seed Development, of the Plant Hormone Ethylene III, eds M. Vendrell, H. Klee, J. C. Pech, and F. Dormancy and Germination,edsK.BradfordandH.Nonogaki(Oxford:Blackwell Romojaro (Amsterdam: IOS Press), 216–221. Publishing Ltd), 153–175. Corbineau, F., Rudnicki, R. M., and Côme, D. (1988). Induction of sec- Bewley, J. D. (1997). Seed germination and dormancy. Plant Cell 9, 1055–1066. doi: ondary dormancy in sunflower seeds by high temperature. Possible involvement 10.1105/tpc.9.7.1055 of ethylene biosynthesis. Physiol. Plant. 73, 368–373. doi: 10.1111/j.1399- Bewley, J. D., and Black, M. (1994). Seeds: Physiology of Development and 3054.1988.tb00612.x Germination. NewYork: Plenum Press. doi: 10.1007/978-1-4899-1002-8 Cristescu, S. M., Persijn, S. T., Lintel Hekkert, S., and Harren, F. J. M. (2008). Laser- Bleecker, A. B., Estelle, M. A., Somerville, C., and Kende, H. (1988). Insensitivity to based systems for trace gas detection in life sciences. Appl. Phys. B 92, 343–349. ethylene conferred by a dominant mutation in Arabidopsis thaliana. Science 241, doi: 10.1007/s00340-008-3127-y 1086–1089. doi: 10.1126/science.241.4869.1086 Cutler, S. R., Rodriguez, P. L., Finkelstein, R. R., and Abrams, S. R. (2010). Abscisic Bleecker, A. B., and Kende, H. (2000). Ethylene: a gaseous signal molecule in plants. acid: emergence of a core signaling network. Annu. Rev. Plant Biol. 61, 651–679. Annu. Rev. Cell Dev. Biol. 16, 1–18. doi: 10.1146/annurev.cellbio.16.1.1 doi: 10.1146/annurev-arplant-042809-112122 Brady, S. M., and McCourt, P.(2003). Hormone cross-talk in seed dormancy. J. Plant Davière, J.-M., and Achard, P. (2013). Gibberellin signalling in plants. Development Growth 22, 25–31. doi: 10.1007/s00344-003-0018-7 140, 1147–1151. doi: 10.1242/dev.087650 Brown, N. A. C., and van Staden, J. (1997). Smoke as a germination cue: a review. Diaz-Vivancos, P., Barba-Espin, G., and Hernandez, J. A. (2013). Elucidating hor- Plant Growth Regul. 22, 115–124. doi: 10.1023/A:1005852018644 monal/ROS networks during germination: insights and perspectives. Plant Cell Burdett, A. N., and Vidaver, W. (1971). Synergistic action of ethylene with gib- Rep. 32, 1491–1502. doi: 10.1007/s00299-013-1473-7 berellin or red light in germinating lettuce seeds. Plant Physiol. 48, 656–657. doi: Dill, A., Thomas, S. G., Steber, C. M., and Sun, T.-p. (2004). The Arabidopsis F-box 10.1104/pp.48.5.656 protein SLEEPY1 targets gibberellin signaling repressors for gibberellin-induced Cadman, C. S. C., Toorop, P. E., Hilhorst, H. W. M., and Finch-Savage, W. E. degradation. Plant Cell 16, 1392–1405. doi: 10.1105/tpc.020958 (2006). Gene expression profiles of Arabidopsis Cvi seeds during dormancy cycling Divi, U. K., Rahman, T., and Krishna, P.(2010). Brassinosteroid-mediated stress tol- indicate a common underlying dormancy control mechanism. Plant J. 46, 805– erance in Arabidopsis shows interactions with abscisic acid, ethylene and salicylic 822. doi: 10.1111/j.1365-313X.2006.02738.x acid pathways. BMC Plant Biol. 10:151. doi: 10.1186/1471-2229-10-151
www.frontiersin.org October 2014 | Volume 5 | Article 539 | 9 Corbineau et al. Ethylene in seed germination
Dong, H., Zhen, Z., Peng, J., Chang, L., Gong, Q., and Wang, N. N. (2011). deficient tomato seeds prior to radicle protrusion. Planta 174, 500–504. doi: Loss of ACS7 confers abiotic stress tolerance by modulating ABA sensitivity 10.1007/BF00634479 and accumulation in Arabidopsis. J. Exp. Bot. 62, 4875–4887. doi: 10.1093/jxb/ Hall, B., Shakeel, S., and Schaller, G. (2007). Ethylene receptors: ethylene perception err143 and signal transduction. J. Plant Growth Regul. 26, 118–130. doi: 10.1007/s00344- Egley, G. H., and Dale, J. E. (1970). Ethylene, 2-chloroethylphosphonic acid and 007-9000-0 witchweed germination. Weed Sci. 18, 586–589. Hall, M. A., Moshkov, I. E., Novikova, G. V., Mur, L. A. J., and Smith, A. R. (2001). El-Maarouf-Bouteau, H., Sajjad, Y., Bazin, J., Langlade, N., Cristescu, S. M., Balzer- Ethylene signal perception and transduction: multiple paradigms? Biol. Rev. 76, gue,S.,et al. (2014). Reactive oxygen species,abscisic acid and ethylene interact to 103–128. doi: 10.1017/S1464793100005649 regulate sunflower seed germination. Plant Cell Environ. doi: 10.1111/pce.12371 Halloin, J. M. (1976). Inhibition of cotton seed germination with abscisic acid and [Epub ahead of print]. its reversal. Plant Physiol. 57, 454–455. doi: 10.1104/pp.57.3.454 Esashi, Y. (1991). “Ethylene and seed germination,”in The Plant Hormone Ethylene, Hermann, K., Meinhard, J., Dobrev, P., Linkies, A., Pesek, B., Hess, B., et al. (2007). eds A. K. Mattoo and J. C. Suttle (Boca Raton, FL: CRC Press), 133–157. 1-amynocyclopropane-1-carboxylic acid and abscisic acid during the germination Esashi, Y., Abe, Y., Ashino, H., Ishizawa, K., and Saitoh, K. (1989). Germination of of sugar beet (Beta vulgaris L.): a comparative study of fruits and seeds. J. Exp. cocklebur seeds and growth of their axial and cotyledonary tissues in response to Bot. 58, 3047–3060. doi: 10.1093/jxb/erm162 C2H4, CO2 and/or O2 under water stress. Plant Cell Environ. 12, 183–190. doi: Hilhorst, H. W. M. (2007). “Definitions and hypotheses of seed dormancy,” in 10.1111/j.1365-3040.1989.tb01931.x Annual Plant Reviews, Vol. 27, Seed Development, Dormancy and Germination, Esashi, Y., Hata, Y., and Katoh, H. (1975). Germination of cocklebur seeds: inter- eds K. Bradford and H. Nonogaki (Oxford: Blackwell Publishing Ltd), 50–71. actions between gibberellic acid, benzyladenine, thiourea, KNO3 and gaseous doi: 10.1002/9780470988848.ch3 factors. Aust. J. Plant Physiol. 2, 569–579. doi: 10.1071/PP9750569 Hilhorst, H. W. M., Finch-Savage, W. E., Buitink, J., Bolingue, W., and Leubner- Esashi, Y., and Leopold, A. C. (1969). Dormancy regulation in subterranean clover Metzger, G. (2010). “Dormancy in plant seeds,” in Dormancy and Resistance in seeds by ethylene. Plant Physiol. 44, 1470–1472. doi: 10.1104/pp.44.10.1470 Harsh Environment,edsE.Lubzens,J.Cerdà,andM.Clarck(Berlin:Springer), Esashi, Y., Okazaki, M., Yanai, N., and Hishinuma, K. (1978). Control of the germi- 43–67. doi: 10.1007/978-3-642-12422-8_4 nation of secondary dormant cocklebur seeds by various germination stimulants. Iglesias-Fernandez, R., and Matilla, A. (2009). After-ripening alters the gene expres- Plant Cell Physiol. 19, 1497–1506. sion pattern of oxidases involved in the ethylene and gibberellin pathways during Esashi, Y., Ooshima, Y., Abe, M., Kurota, A., and Satoh, S. (1986). CO2-enhanced early imbibition of Sisymbrium officinale L. seeds. J. Exp. Bot. 60, 1645–1661. doi: C2H4 production in tissues of imbibed cocklebur seeds. Aust. J. Plant Physiol. 13, 10.1093/jxb/erp029 417–429. doi: 10.1071/PP9860417 Iglesias-Fernandez, R., and Matilla, A. (2010). Genes involved in ethylene and Feurtado, J. A., and Kermode, A. R. (2007). “A merging of paths: abscisic acid gibberellins metabolism are required for endosperm-limited germination of and hormonal cross-talk in the control of seed dormancy maintenance and alle- Sisymbrium officinale L. seeds. Planta 231, 653–664. doi: 10.1007/s00425-009- viation,” in Annual Plant Reviews, Vol. 27, Seed Development, Dormancy and 1073-5 Germination,edsK.BradfordandH.Nonogaki(Oxford:BlackwellPublishing Ishibashi, Y., Koda, Y., Zheng, S.-H., Yuasa, T., and Iwaya-Inoue, M. (2013). Ltd), 176–223. doi: 10.1002/9780470988848.ch8 Regulation of soybean seed germination through ethylene production in Finkelstein, R. R., Reeves, W., Ariizumi, T., and Steber, C. (2008). Molec- response to reactive oxygen species. Ann. Bot. 111, 95–102. doi: 10.1093/aob/ ular aspects of seed dormancy. Annu. Rev. Plant Biol. 59, 387–415. doi: mcs240 10.1146/annurev.arplant.59.032607.092740 Ishibashi, Y., Yamamoto, K., Tawaratsumida, T., Yuasa, T., and Iwaya-Inoue, M. Fu, J. R., and Yang, S. F. (1983). Release of heat pretreatment-induced dormancy in (2008). Hydrogen peroxide scavenging regulates germination ability during wheat lettuce seeds by ethylene or cytokinin in relation to the production of ethylene (Triticum aestivum L.) seed maturation. Plant Signal. Behav. 3, 183–188. doi: and the synthesis of 1-aminocyclopropane-1-carboxylic acid during germination. 10.4161/psb.3.3.5540 J. Plant Growth Regul. 2, 185–192. doi: 10.1007/BF02042247 Jimenez, J. A., Rodriguez, D., Calvo, A. P., Mortensen, L. C., Nicolas, G., and Nicolas, Gallardo, M., Del Mar Delgado, M., Sanchez-Calle, I. M., and Matilla, A. J. (1991). C. (2005). Expression of a transcription factor (FsERF1) involved in ethylene Ethylene production and 1-aminocyclopropane-1-carboxylic acid conjugation signaling during the breaking of dormancy in Fagus sylvatica seeds. Physiol. Plant. in thermoinhibited Cicer arietinum L. seeds. Plant Physiol. 97, 122–127. doi: 125, 373–380. doi: 10.1111/j.1399-3054.2005.00571.x 10.1104/pp.97.1.122 Jones, J. F., and Hall, M. A. (1984). Studies on the requirement for carbon dioxide Gallardo, M., Gallardi, M. E., Matilla, A., Munoz de Ruedo, P., and Sanchez-Calle, and ethylene for germination of Spergula arvensis L. seeds. Plant Sci. Lett. 16, I. M. (1994). Inhibition of polyamine synthesis by cyclohexylamine stimulates 87–93. doi: 10.1016/0304-4211(79)90012-9 the ethylene pathway and accelerates the germination of Cicer arietinum seeds. Ju, C., Yoon, G. M., Shemansky, J. M., Lin, D. Y., Ying, Z. I., Chang, J., et al. (2012). Physiol. Plant. 91, 9–16. doi: 10.1111/j.1399-3054.1994.tb00652.x CTR1 phosphorylates the central regulator EIN2 to control ethylene hormone Ghassemian, M., Nambara, E., Cutler, S., Kawaide, H., Kamiya, Y., and McCourt, P. signaling from the ER membrane to the nucleus in Arabidopsis. Proc. Natl. Acad. (2000). Regulation of abscisic acid signaling by the ethylene response pathway in Sci. U.S.A. 109, 19486–19491. doi: 10.1073/pnas.1214848109 Arabidopsis. Plant Cell 12, 1117–1126. doi: 10.1105/tpc.12.7.1117 Karssen, C. M. (1976). Two sites of hormonal action during germination of Gniazdowska, A., Krasuska, U., and Bogatek, R. (2010). Dormancy removal in apple Chenopodium album seeds. Physiol. Plant. 36, 264–270. doi: 10.1111/j.1399- embryos by nitric oxide or cyanide involves modifications in ethylene biosynthetic 3054.1976.tb04426.x pathway. Planta 232, 1397–1407. doi: 10.1007/s00425-010-1262-2 Karssen, C. M., Zagórsky, S., Kepczynski, J., and Groot, S. P. C. (1989). Key role for Gomez-Jimenez, M. C., Matilla, A. J., and Garrido, D. (1998). Isolation and char- endogenous gibberellins in the control of seed germination. Ann. Bot. 63, 71–80. acterization of a cDNA encoding an ACC oxidase from Cicer arietinum and its Katoh, H., and Esashi, Y. (1975). Dormancy and impotency of cocklebur seeds. expression during embryogenesis and seed germination. Aust. J. Plant Physiol. 25, I. CO2,C2H4,O2 and high temperature. Plant Cell Physiol. 16, 687–696. doi: 765–773. doi: 10.1071/PP97166 10.1093/jxb/35.10.1515 Gorecki, R. J., Ashino, H., Satoh, S., and Esashi, Y. (1991). Ethylene production Kende, H. (1993). Ethylene biosynthesis. Annu. Rev. Plant Physiol. Plant Mol. Biol. in pea and cocklebur seeds of differing vigour. J. Exp. Bot. 42, 407–414. doi: 44, 283–307. doi: 10.1146/annurev.pp.44.060193.001435 10.1093/jxb/42.3.407 Kende, H., van der Knaap, E., and Cho, H. T.(1998). Deepwater rice: a model plant to Graeber, K., Nakabayashi, K., Miatton, E., Leubner-Metzger, G., and Soppe, W. J. study stem elongation. Plant Physiol. 118, 1105–1110. doi: 10.1104/pp.118.4.1105 (2012). Molecular mechanisms of seed dormancy. Plant Cell Environ. 35, 1769– Kendrick, M. D., and Chang, C. (2008). Ethylene signaling: new levels 1786. doi: 10.1111/j.1365-3040.2012.02542.x of complexity and regulation. Curr. Opin. Plant Biol. 11, 479–485. doi: Groot, S. P., and Karssen, C. M. (1987). Gibberellins regulate seed germination 10.1016/j.pbi.2008.06.011 in tomato by endosperm weakening: a study with gibberellin-deficient mutants. Kepczynski, J. (1986). Inhibition of Amaranthus caudatus seed germination Planta 171, 525–531. doi: 10.1007/BF00392302 by polyethylene glycol-6000 and abscisic acid and its reversal by ethephon Groot, S. P., Kieliszewska-Rokicka, B., Vermeer, E., and Karssen, C. M. or aminocyclopropane-1-carboxylic acid. Physiol. Plant. 67, 588–591. doi: (1988). Gibberellin-induced hydrolysis of endosperm cell walls in gibberellin- 10.1111/j.1399-3054.1986.tb05060.x
Frontiers in Plant Science | Plant Physiology October 2014 | Volume 5 | Article 539 | 10 Corbineau et al. Ethylene in seed germination
Kepczynski, J., Bihun, M., and Kepczynska, E. (1996a). Induction and release of Lin,Y.,Yang, L., Paul, M., Zu,Y., and Tang, Z. (2013). Ethylene promotes germination secondary dormancy in Amaranthus caudatus L. seeds. Plant Physiol. Biochem. of Arabidopsis seed under salinity by decreasing reactive oxygen species: evidence Special Issue S03–S50, 42. for the involvement of nitric oxide simulated by sodium niroprusside. Plant Kepczynski, J., Corbineau, F., and Côme, D. (1996b). Responsiveness of Amaran- Physiol. Biochem. 73, 211–218. doi: 10.1016/j.plaphy.2013.10.003 thus retroflexus seeds to ethephon, 1-aminocyclopropane-1-carboxylic acid and Lin, Y. C., Wang, J. J., Zu, Y. G., and Tang, Z. H. (2012). Ethylene antagonizes gibberellic acid in relation to temperature and dormancy. Plant Growth Regul. 20, the inhibition of germination in Arabidopsis induced by salinity by modulating 259–265. doi: 10.1007/BF00043316 the concentration of hydrogen peroxide. Acta Physiol. Plant. 34, 1895–1904. doi: Kepczynski, J., Bihun, M., and Kepczynska, E. (2003). The release of secondary 10.1007/s11738-012-0989-8 dormancy by ethylene in Amaranthus caudatus L. seeds. Seed Sci. Res. 13, 69–74. Lin, Z., Zhong, S., and Grierson, D. (2009). Recent advances in ethylene research. J. doi: 10.1079/SSR2002125 Exp. Bot. 60, 3311–3336. doi: 10.1093/jxb/erp204 Kepczynski, J., and Karssen, C. M. (1985). Requirement for the action of endogenous Linkies, A., and Leubner-Metzger, G. (2012). Beyond gibberellins and abscisic acid: ethylene during germination of non-dormant seeds of Amaranthus caudatus. how ethylene and jasmonates control seed germination. Plant Cell Rep. 31, 253– Physiol. Plant. 63, 49–52. doi: 10.1111/j.1399-3054.1985.tb02816.x 270. doi: 10.1007/s00299-011-1180-1 Kepczynski, J., and Kepczynska, E. (1993). “The effect of putrescine, ethephon and Linkies, A., Muller, K., Morris, K., Tureckova, V., Wenk, M., Cadman, C. S., et al. ACC on germination of thermodormant Amaranthus paniculatus L. seed,”in Basic (2009). Ethylene interacts with abscisic acid to regulate endosperm rupture during and Applied Aspects of Seed Biology, Fourth International Workshop on Seeds, eds germination: a comparative approach using Lepidium sativum and Arabidopsis D. Côme and F. Corbineau (Paris: ASFIS), 537–554. thaliana. Plant Cell 21, 3803–3822. doi: 10.1105/tpc.109.070201 Kepczynski, J., and Kepczynska, E. (1997). Ethylene in seed dormancy and germi- Liu, Q., Zhou, G. Y., and Wen, C. K. (2004). Ethylene signal transduction in nation. Physiol. Plant. 101, 720–726. doi: 10.1034/j.1399-3054.1997.1010407.x Arabidopsis. J. Plant Physiol. Mol. Biol. 30, 241–250. Kepczynski, J., Rudnicki, R. M., and Khan, A. A. (1977). Ethylene requirement for Liu, Y., Ye, N., Liu, R., Chen, M., and Zhang, J. (2010). H2O2 mediates the regula- germination of partly after-ripened apple embryo. Physiol. Plant. 40, 292–295. tion of ABA catabolism and GA biosynthesis in Arabidopsis seed dormancy and doi: 10.1111/j.1399-3054.1977.tb04075.x germination. J. Exp. Bot. 61, 2979–2990. doi: 10.1093/jxb/erq125 Kepczynski, J., and Sznigir, P. (2014). Participation of GA3, ethylene, NO and HCN Longan, D. C., and Stewart, G. R. (1992). Germination of the seeds of parasitic in germination of Amaranthus retroflexus L. seeds with various dormancy levels. angiosperms. Seed Sci. Res. 2, 179–190. Acta Physiol. Plant. 36, 1463–1472. doi: 10.1007/s11738-014-1524-x Lorenzo,O., Rodriguez, D., Nicolas, C., and Nicolas, G. (2000). “Characterization Ketring, D. L., and Morgan, P.W.(1969). Ethylene as a component of the emanations and expression of two protein kinase and an EIN3-like genes, which are regulated from germinating peanut seeds and its effect on dormant Virginia-type seeds. by ABA and GA3 in dormant Fagus sylvatica seeds,”in Seed Biology: Advances and Plant Physiol. 44, 326–330. doi: 10.1104/pp.44.3.326 Applications,edsM.Black,K.J.Bradford,andJ.Vazquez-Ramos(Wallingford: Ketring, D. L., and Morgan, P. W. (1972). Physiology of oil seeds. IV. Role of CAB International), 329–340. endogenous ethylene and inhibitory regulators during natural and induced after- Machabée, S., and Saini, H. S. (1991). Differences in requirement for endoge- ripening of dormant Virginia-type peanut seeds. Plant Physiol. 50, 382–387. doi: nous ethylene during germination of dormant and non-dormant seeds of 10.1104/pp.50.3.382 Chenopodium album L. J. Plant Physiol. 138, 97–101. doi: 10.1016/S0176- Ketring, D. L., Morgan, P. W., and Powell, R. D. (1974). “Relations of ethylene 1617(11)80737-6 production to germinability and growth of two oil seeds, cotton and peanuts,”in Martinez-Reina, G., Matilla, A. J., Martin-Remesal, C., Gallardo, M., and Munoz De Plant growth substances 1973, ed. Y. Sumiki (Tokyo: Hirokawa), 891–899. Rueda, P. (1996). Biochemical properties of 1-aminocyclopropane-1-carboxylate Keys, R. D., Smith, O. E., Kumamoto, J., and Lyon, J. J. (1975). Effect of gibberel- N-malonyl transferase activity from early growing embryonic axes of chick- lic acid, kinetin, and ethylene plus carbon dioxide on the thermodormancy of pea (Cicer arietinum L.) seeds. J. Exp. Bot. 47, 1771–1778. doi: 10.1093/jxb/47. lettuce seed (Lactuca sativa L. cv Mesa 659). Plant Physiol. 56, 826–829. doi: 11.1771 10.1104/pp.56.6.826 Matilla, A. J. (1996). Polyamines and seed germination. Seed Sci. Res. 6, 81–93. doi: Khan, A. A. (1994). ACC-derived ethylene production, a sensitive test for seed vigor. 10.1017/S096025850000310X J. Am. Soc. Hort. Sci. 119, 1083–1090. Matilla, A. J. (2000). Ethylene in seed formation and germination. Seed Sci. Res. 10, Khan, M. A., Ansari, R., Gul, B., and Li, W. Q. (2009). Dormancy and germination 111–126. doi: 10.1017/S096025850000012X responses of halophyte seeds to the application of ethylene. C. R. Biol. 332, 806– Matilla, A. J., and Matilla-Vazquez, M. A. (2008). Involvement of ethylene in seed 815. doi: 10.1016/j.crvi.2009.05.002 physiology. Plant Sci. 175, 87–97. doi: 10.1016/j.plantsci.2008.01.014 Kucera, B., Cohn, M. A., and Leubner-Metzger, G. (2005). Plant hormone interac- Mersmann, S., Bourdais, G., Rietz, S., and Robatzek, S. (2010). Ethylene signaling tions during seed dormancy release and germination. Seed Sci. Res. 15, 281–307. regulates accumulation of the FLS2 receptor and is required for the oxida- doi: 10.1079/SSR2005218 tive burst contributing to plant immunity. Plant Physiol. 154, 391–400. doi: Krasuska, U., Ciacka, K., Debska, K., Bogatek, R., and Gniazdowska, A. (2014). 10.1104/pp.110.154567 Dormancy alleviation by NO or HCN leading to decline of protein carbonylation Miransari, M., and Smith, D. L. (2014). Plant hormones and seed germination. levels in apple (Malus domestica Borkh.) embryos. J. Plant Physiol. 171, 1132– Environ. Exp. Bot. 99, 110–121. doi: 10.1016/j.envexpbot.2013.11.005 1141. doi: 10.1016/j.jplph.2014.04.015 Muday, G. K., Rahman, A., and Binder, B. M. (2012). Auxin and ethy- Krasuska, U., and Gniazdowska, A. (2012). Nitric oxide and hydrogen cyanide as lene: collaborators or competitors? Trends Plant Sci. 17, 181–195. doi: regulating factors of enzymatic antioxidant system in germinating apple embryos. 10.1016/j.tplants.2012.02.001 Acta Physiol. Plant. 34, 683–692. doi: 10.1007/s11738-011-0868-8 Müller, K., Linkies, A., Vreeburg, R. A. M., Fry, S. C., Krieger-Liszkay, Lee, S., Cheng, H., King, K. E., King, K. E., Wang, W., He, Y.,et al. (2002). Gibberellin A., and Leubner-Metzger, G. (2009). In vivo cell wall loosening by regulates Arabidopsis seed germination via RGL2, a GAI/RGA-like gene whose hydroxyl radicals during cress (Lepidium sativum L.) seed germination and expression is up-regulated following imbibition. Genes Dev. 16, 646–658. doi: elongation growth. Plant Physiol. 150, 1855–1865. doi: 10.1104/pp.109. 10.1101/gad.969002 139204 Leubner-Metzger, G., Petruzzelli, L., Waldvogel, R., Vogeli-Lange, R., and Meins, Nambara, E., Okamoto, M., Tatematsu, K.,Yano, R., Seo, M., and Kamiya,Y. (2010). F. (1998). Ethylene-responsive element binding protein (EREBP) expression and Abscisic acid and the control of seed dormancy and germination. Seed Sci. Res. the transcriptional regulation of class I beta-1,3-glucanase during tobacco seed 20, 55–67. doi: 10.1017/S0960258510000012 germination. Plant Mol. Biol. 38, 785–795. doi: 10.1023/A:1006040425383 Narsai, R., Law, S. R., Carrie, C., Xu, L., and Whelan, J. (2011). In depth tempo- Lewak, S. (2011). Metabolic control of embryonic dormancy in apple seed: seven ral transcriptome profiling reveals a crucial developmental switch with roles for decades of research. Acta Physiol. Plant. 33, 1–24. doi: 10.1007/s11738-010- RNA processing and organelle metabolism that are essential for germination in 0524-8 Arabidopsis thaliana. Plant Physiol. 157, 1342–1362. doi: 10.1104/pp.111.183129 Leymarie, J., Vitkauskaite, G., Hoang, H. H., Gendreau, E., Chazoule, V., Meimoun, Ne’eman, G., Henig-Sever, N., and Eshel, A. (1999). Regulation of the germination P., etal. (2012). Role of reactive oxygen species in the regulation of Arabidopsis of Rhus coriaria,apost-firepioneer,byheat,ash,pH,waterpotentialandethylene. seed dormancy. Plant Cell Physiol. 53, 96–106. doi: 10.1093/pcp/pcr129 Physiol. Plant. 106, 47–52. doi: 10.1034/j.1399-3054.1999.106107.x
www.frontiersin.org October 2014 | Volume 5 | Article 539 | 11 Corbineau et al. Ethylene in seed germination
Negm, F. B., and Smith, O. E. (1978). Effects of ethylene and carbon dioxide on the Qiao, H, Shen, Z., Huand, S.-S. C., Schmitz, R. J., Urich, M. A., Briggs, S. P., germination of osmotically inhibited lettuce seeds. Plant Physiol. 49, 869–872. etal. (2012). Processing and subcellular trafficking of ER-tethered EIN2 control doi: 10.1104/pp.49.6.869 response to ethylene gas. Science 338, 390–393. doi: 10.1126/science.1225974 Negm, F. B., Smith, O. E., and Kumamoto, J. (1973). The role of phytochrome Rajjou, L., Duval, M., Gallardo, K., Catusse, J., Bally, J., Job, C., etal. (2012). Seed in an interaction with ethylene and carbon dioxide in overcoming lettuce seed germination and vigor. Annu. Rev. Plant Biol. 63, 507–533. doi: 10.1146/annurev- thermodormancy. Plant Physiol. 51, 1089–1094. doi: 10.1104/pp.51.6.1089 arplant-042811-105550 Nemhauser, J. L., Hong, F., and Chory, J. (2006). Different plant hormones regulate Rao, V. S., Sankhla, N., and Khan, A. A. (1975). Additive and synergistic effects similar processes through largely nonoverlapping transcriptional responses. Cell of kinetin and ethrel on germination, thermodormancy, and polyribosome 126, 467–475. doi: 10.1016/j.cell.2006.05.050 formation in lettuce seeds. Plant Physiol. 56, 263–266. doi: 10.1104/pp.56.2.263 Nonogaki, H., Bassel, G. W., and Bewley, J. D. (2010). Germination – Still a mystery. Ribeiro, D. M., and Barros, R. S. (2006). Sensitivity to ethylene as a major component Plant Sci. 179, 574–581. doi: 10.1016/j.plantsci.2010.02.010 in the germination of seeds of Stylosanthes humilis. Seed Sci. Res. 16, 37–45. doi: Ogawa, M., Hanada, A., Yamauchi, Y., Kuwahara, A., Kamiya, Y., and Yam- 10.1079/SSR2005233 aguchi, S. (2003). Gibberellin biosynthesis and response during Arabidopsis seed Rzewuski, G., and Sauter, M. (2008). Ethylene biosynthesis and signaling in rice. germination. Plant Cell 15, 1591–1604. doi: 10.1105/tpc.011650 Plant Sci. 175, 32–42. doi: 10.1016/j.plantsci.2008.01.012 Olatoye, S. T., and Hall, M. A. (1973). “Interaction of ethylene and light on dormant Saini, H. S., Consolacion, E. D., Bassi, P. K., and Spencer, M. S. (1986). Requirement weed seeds,”in Seed Ecology, ed. W. Heydecker (London: Butterworths), 233–240. for ethylene synthesis and action during relief of thermoinhibition of lettuce seed Oracz, K., El-Maarouf-Bouteau, H., Bogatek, R., Corbineau, F.,and Bailly, C. (2008). germination by combinations of gibberellic acid, kinetin, and carbon dioxide. Release of sunflower seed dormancy by cyanide: cross-talk with ethylene signaling Plant Physiol. 81, 950–953. doi: 10.1104/pp.81.4.950 pathway. J. Exp. Bot. 59, 2241–2251. doi: 10.1093/jxb/ern089 Samimy, C., and Khan, A. A. (1983). Secondary dormancy, growth-regulator effects, Oracz, K., El-Maarouf-Bouteau, H., Farrant, J. M., Cooper, K., Belghazi, M., Job, and embryo growth potential in curly dock (Rumex crispus) seeds. Weed Sci. 31, C., etal. (2007). ROS production and protein oxidation as a novel mechanism 153–158. for seed dormancy alleviation. Plant J. 50, 452–465. doi: 10.1111/j.1365- Samimy, C., and Taylor, A. G. (1983). Influence of seed quality on ethylene 313X.2007.03063.x production of germinating snap bean seeds. J. Am. Soc. Hort. Sci. 108, 767–769. Oracz, K., El-Maarouf-Bouteau, H., Kranner, I., Bogatek, R., Corbineau, F., Satoh, S., and Esashi, Y. (1983). Ethylene production, 1-aminocyclopropane-1- and Bailly, C. (2009). The mechanisms involved in seed dormancy alleviation carboxylic acid content and its conversion to ethylene in axial segments of by hydrogen cyanide unravel the role of reactive oxygen species as key fac- dormant and nondormant cocklebur seeds. Plant Cell Physiol. 24, 883–887. tors of cellular signaling during germination. Plant Physiol. 150, 494–505. doi: Satoh, S., Takeda, Y., and Esashi, Y. (1984). Dormancy and impotency of cocklebur 10.1104/pp.109.138107 seeds. IX. Changes in ACC-ethylene conversion activity and ACC content of Ouaked, F., Rozhon, W., Lecourieux, D., and Hirt, H. (2003). A MAPK path- dormant and non-dormant seeds during soaking. J. Exp. Bot. 35, 1515–1524. doi: way mediates ethylene signaling in plants. EMBO J. 22, 1282–1288. doi: 10.1093/jxb/35.10.1515 10.1093/emboj/cdg131 Schönbeck, M.W.,and Egley, G. H. (1981). Phase-sequence of redroot pigweed seed Overmyer, K., Brosche, M., and Kangasjarvi, J. (2003). Reactive oxygen species and germination responses to ethylene and other stimuli. Plant Physiol. 68, 175–179. hormonal control of cell death. Trends Plant Sci. 8, 335–342. doi: 10.1016/S1360- doi: 10.1104/pp.68.1.175 1385(03)00135-3 Schwechheimer, C. (2008). Understanding gibberellic acid signaling-are we there Penfield, S., Li, Y., Gilday, A. D., Graham, S., and Graham, I. A. (2006). Arabidop- yet? Curr. Opin. Plant Biol. 11, 9–15. doi: 10.1016/j.pbi.2007.10.011 sis ABA INSENSITIVE4 regulates lipid mobilization in the embryo and reveals Sewelam, N., Kazan, K., Thomas-Hall, S. R., Kidd, B. N., Manners, J. M., and Schenk, repression of seed germination by the endosperm. Plant Cell 18, 1887–1899. doi: P. M. (2013). Ethylene response factor 6 is a regulator of reactive oxygen species 10.1105/tpc.106.041277 signaling in Arabidopsis. PLoS ONE 8:e70289. doi: 10.1371/journal.pone.0070289 Perino, C., Simond-Côte, E., and Côme, D. (1984). Effets du cyanure de potassium et Silva, P. O., Medina, E. F., Barros, R. S., and Ribeiro, D. M. (2014). Germina- de l’acide salicylhydroxamique sur la levée de dormance et l’activité respiratoire tion of salt-stressed seeds as related to ethylene biosynthesis ability in three des embryons de Pommier (Pirus malus L.). C. R. Acad. Sci. Paris III 299, Stylosanthes species. J. Plant Physiol. 171, 14–22. doi: 10.1016/j.jplph.2013. 249–251. 09.004 Petruzzelli, L., Coraggio, I., and Leubner-Metzger, G. (2000). Ethylene promotes Sinska, I. (1989). Interaction of ethephon with cytokinin and gib- ethylene biosynthesis during pea seed germination by positive feedback regulation berellin during the removal of apple seed dormancy and germina- of 1-amonocyclopropane-1-carboxylic acid oxidase. Planta 211, 144–149. doi: tion of embryos. Plant Sci. 64, 39–44. doi: 10.1016/0168-9452(89) 10.1007/s004250000274 90149-0 Petruzzelli, L., Sturaro, M., Mainieri, D., and Leubner-Metzger, G. (2003). Calcium Sinska, I., and Gladon, R. (1984). Ethylene and the removal of embryonal apple seed requirement for ethylene-dependent responses involving 1-aminocyclopropane- dormancy. HortScience 19, 73–75. 1-carboxylic acid oxidase in radicle tissues of germinated pea seeds. Plant Cell Sinska, I., and Gladon, R. (1989). Effects of inhibitors of synthesis and action of Environ. 26, 661–671. doi: 10.1046/j.1365-3040.2003.01001.x ethylene on apple seed stratification and embryo germination. Acta Physiol. Plant. Pirrello, J., Jaimes-Miranda, F., Sanchez-Ballesta, M. T., Tournier, B., Khalil-Ahmad, 11, 307–316. Q., Regad, F.,etal. (2006). Sl-ERF2, a tomato ethylene response factor involved in Sinska, I., and Lewandowska, U. (1991). Polyamines and ethylene in the removal ethylene response and seed germination. Plant Cell Physiol. 47, 1195–1205. doi: of embryonal dormancy in apple seeds. Physiol. Plant. 81, 59–64. doi: 10.1093/pcp/pcj084 10.1111/j.1399-3054.1991.tb01713.x Piskurewicz, U., Jikumaru, Y., Kinoshita, N., Nambara, E., Kamiya, Y., and Siriwitayawan, G., Geneve, R. L., and Downie, A. B. (2003). Seed germination of Lopez-Molina, L. (2008). The gibberellic acid signaling repressor RGL2 inhibits ethylene perception mutants of tomato and Arabidopsis. Seed Sci. Res. 13, 303–314. Arabidopsis seed germination by stimulating abscisic acid synthesis and ABI5 doi: 10.1079/SSR2003147 activity. Plant Cell 20, 2729–2745. doi: 10.1105/tpc.108.061515 Speer, H. L., Hsiao, A. I., and Vidaver, W. (1974). Effects of germination promoting Prusinski, J., and Khan, A. A. (1990). Relationship of ethylene production to stress substances given in conjunction with red light on the phytochrome-mediated alleviation in seeds of lettuce cultivars. J. Am. Soc. Hort. Sci. 115, 294–298. germination of dormant lettuce seeds (Lactuca sativa L.).PlantPhysiol.54, 852– Puga-Hermida, M. I., Gallardo, M., Rodroguez-Gacio, M. D., and Matilla, A. 854. doi: 10.1104/pp.54.6.852 J. (2003). The heterogeneity of turnip-tops (Brassica rapa) seeds inside the Steber, C. M. (2007). “De-repression of seed germination by GA signaling,” in silique affects germination, the activity of the final step of the ethylene path- Annual Plant Reviews, Vol. 27, Seed Development, Dormancy and Germination, way, and abscisic acid and polyamine content. Funct. Plant Biol. 30, 767–775. doi: eds K. Bradford and H. Nonogaki (Oxford: Blackwell Publishing Ltd), 248–263. 10.1071/FP03053 doi: 10.1002/9780470988848.ch10 Qiao, H., Chang, K. N.,Yazaki, J., and Ecker, J. R. (2009). Interplay between ethylene, Stepanova, A. N., and Alonso, J. M. (2009). Ethylene signaling and response: where ETP1/ETP2 F-box proteins, and degradation of EIN2 triggers ethylene responses different regulatory modules meet. Curr. Opin. Plant Biol. 12, 548–555. doi: in Arabidopsis. Genes Dev. 23, 512–521. doi: 10.1101/gad.1765709 10.1016/j.pbi.2009.07.009
Frontiers in Plant Science | Plant Physiology October 2014 | Volume 5 | Article 539 | 12 Corbineau et al. Ethylene in seed germination
Subbiah, V., and Reddy, K. J. (2010). Interactions between ethylene, abscisisc acid Wilson, R. L., Kim, H., Bakshi, A., and Binder, B. M. (2014a). The ethylene receptors and cytokinin during germination and seedling establishment in Arabidopsis. J. ETHYLENE RESPONSE1 and ETHYLENE RESPONES2 have contrasting roles in Biosci. 35, 451–458. doi: 10.1007/s12038-010-0050-2 seed germination of Arabidopsis during salt stress. Plant Physiol. 165, 1353–1366. Sun, T. P., and Gubler, F. (2004). Molecular mechanism of gibberellin in plants. doi: 10.1104/pp.114.241695 Annu. Rev. Plant Biol. 7, 847–859. doi: 10.1146/annurev.arplant.55.031903.141753 Wilson, R. L., Bakshi, A., and Binder, B. M. (2014b). Loss of the ETR1 ethy- Takayanagi, K., and Harrington, J. F. (1971). Enhancement of germination rate of lene receptor reduces the inhibitory effect of far-red light and darkness on seed aged seeds by ethylene. Plant Physiol. 47, 521–524. doi: 10.1104/pp.47.4.521 germination of Arabidopsis thaliana. Front. Plant Sci. 5:433. doi: 10.3389/fpls. Taylorson, R. B. (1979). Response of weed seeds to ethylene and related hydrocar- 2014.00433 bons. Weed Sci. 27, 7–10. Yamagami, T., Tsuchisaka, A., Yamada, K., Haddon, W. F., Harden, Thomas, T. H., Palevitch, D., Biddington, N. L., and Austin, R. B. L. A., and Theologis, A. (2003). Biochemical diversity among the 1- (1975). Growth regulators and the phytochrome-mediated dormancy of aminocyclopropane-1-carboxylate synthase isozymes encoded by the Arabidop- celery seeds. Physiol. Plant. 35, 101–106. doi: 10.1111/j.1399-3054.1975. sis gene family. J. Biol. Chem. 278, 49102–49112. doi: 10.1074/jbc.M308 tb03876.x 297200 Toorop, P. E., van Aelst, A. C., and Hilhorst, H. W. (2000). The second step of the Yang, S. F., and Hoffman, N. E. (1984). Ethylene biosynthesis and its regulation biphasic endosperm cap weakening that mediates tomato (Lycopersicon esculen- in higher plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 35, 155–189. doi: tum) seed germination is under control of ABA. J. Exp. Bot. 51, 371–379. doi: 10.1146/annurev.arplant.35.1.155 10.1093/jexbot/51.349.1371 Yoo,S.D.,Cho,Y.H.,andSheen,J.(2009). Emergingconnectionsintheethylenesig- Tyler, L., Thomas, S. G., Hu, J., Dill, A., Alonso, J. M., Ecker, J. R., et al. (2004). naling network. Trends Plant Sci. 14, 270–279. doi: 10.1016/j.tplants.2009.02.007 DELLA proteins and gibberellin-regulated seed germination and floral devel- Yoo, S. D., Cho, Y. H., Tena, G., Xiong, Y., and Sheen, J. (2008). Dual control opment in Arabidopsis. Plant Physiol. 135, 1008–1019. doi: 10.1104/pp.104. of nuclear EIN3 by bifurcate MAPK cascades in C2H4 signalling. Nature 451, 039578 789–795. doi: 10.1038/nature06543 Wang, B., Zhang, J., Xia, X., and Zhang, W. H. (2011). Ameliorative effect of Zapata, H., P. J., Serrano, M., Pretel, M. T., Amoros, A., and Botella, M. A. (2003). brassinosteroid and ethylene on germination of cucumber seeds in the presence Changes in ethylene evolution and polyamine profiles of seedlings of nine culti- of sodium chloride. Plant Growth Regul. 65, 407–413. doi: 10.1007/s10725-011- vars of Lactuca sativa L. in response to salt stress during germination. Plant Sci. 9595-9 164, 557–563. doi: 10.1016/S0168-9452(03)00005-0 Wang, K. L. C., Li, H., and Ecker, J. R. (2002). Ethylene biosynthesis and signaling networks. Plant Cell 14(Suppl. ), S131–S151. Conflict of Interest Statement: The authors declare that the research was conducted Wang, N. N., Shih, M. C., and Li, N. (2005). The GUS reporter-aided analysis in the absence of any commercial or financial relationships that could be construed of the promoter activities of Arabidopsis ACC synthase genes AtACS4, AtACS5, as a potential conflict of interest. and AtACS7 induced by hormones and stresses. J. Exp. Bot. 56, 909–920. doi: 10.1093/jxb/eri083 Received: 14 August 2014; accepted: 22 September 2014; published online: 10 October Wang, W., Esch, J. J., Shiu, S.-H., Agula, H., Binder, B. M., Chang, C., et al. (2006). 2014. Identification of important regions for ethylene binding and signaling in the Citation: Corbineau F, Xia Q, Bailly C and El-Maarouf-Bouteau H (2014) Ethy- transmembrane domain of the ETR1 ethylene receptor of Arabidopsis. Plant Cell lene, a key factor in the regulation of seed dormancy. Front. Plant Sci. 5:539. doi: 18, 3429–3442. doi: 10.1105/tpc.106.044537 10.3389/fpls.2014.00539 Wang, Y., Liu, C., Li, K., Sun, F., Hu, H., Li, X., etal. (2007). Arabidopsis EIN2 This article was submitted to Plant Physiology, a section of the journal Frontiers in modulates stress response through abscisic acid response pathway. Plant Mol. Plant Science. Biol. 64, 633–644. doi: 10.1007/s11103-007-9182-7 Copyright © 2014 Corbineau, Xia, Bailly and El-Maarouf-Bouteau. This is an open- Weiss, D., and Ori, N. (2007). Mechanisms of cross talk between gibberellin access article distributed under the terms of the Creative Commons Attribution License and other hormones. Plant Physiol. 144, 1240–1246. doi: 10.1104/pp.107. (CC BY). The use, distribution or reproduction in other forums is permitted, provided 100370 the original author(s) or licensor are credited and that the original publication in this Weitbrecht, K., Müller, K., and Leubner-Metzger, G. (2011). First of the mark: early journal is cited, in accordance with accepted academic practice. No use, distribution or seed germination. J. Exp. Bot. 62, 3289–3309. doi: 10.1093/jxb/err030 reproduction is permitted which does not comply with these terms.
www.frontiersin.org October 2014 | Volume 5 | Article 539 | 13
XIA Qiong – Molecular aspects of temperature regulation of sunflower seed dormancy - 2016
Abstract A seed is the product of sexual reproduction and the means by which the new individual is dispersed by angiosperms. Seed germination being the first step of plant establishment, the ultimate role of the transition between seed dormancy and germination during plant lifecycle is an important ecological and commercial trait. Last several decades, several environment factors have been reviewed to strongly effect the process of seed dormancy and germination. However, studies about seed response to temperature change are acute with the global warming. The aim of this work was to investigate temperature regulation of dormancy and germination in sunflower seeds. Proteomic analysis and enzyme profiling have been used to study metabolism regulation during seed dormancy release by temperature. Moreover, using molecular and cytological approaches, we investigate the interaction between temperature and phytohormones involved in this process. Our results revealed that temperature as an external factor to effect seed dormancy and germination by affecting, in one hand, the metabolism, and in the other hand the level and localization of major endogenous hormones.
Keywords: Dormancy, Germination, Hormones, Proteomic Sunflower, Temperature
Mécanismes moléculaires de la régulation de la dormance des graines de tournesol par la température Résumé La graine est le produit de la reproduction sexuée chez les Angiospermes. Elle assure la survie et la dispersion de l'espèce. La germination des graines est la première étape de la croissance des plantes. La transition entre l'état de dormance des graines et leur germination est une étape clef dans le cycle de vie des plantes qui a des conséquences écologique et commerciale. Depuis plusieurs décennies, de nombreux facteurs de l'environnement ont été étudiés pour leurs implications et leurs conséquences dans le processus de dormance et de germination des graines. Les études sur la réponse des semences aux changements de température en liens avec le réchauffement climatique ont un intérêt primordiale. Le but de ce travail a été d'étudier la régulation de la dormance et de la germination des graines de tournesol par la température. Une analyse protéomique et un profilage enzymatique ont été réalisés afin de mieux comprendre la régulation du métabolisme pendant la levée de dormance par la température. L'utilisation d'approches moléculaires et cytologiques, nous ont permis d'appréhender l'interaction entre la température et les phytohormones impliquées dans ce processus. Nos résultats ont révélé le rôle joué par la température comme facteur externe affectant la dormance et la germination des graines en agissant d'une part sur le métabolisme et d'autre part sur la quantité et la localisation cellulaire des principales hormones endogènes.
Mots clés : Dormance, Germination, Hormones, Protéomique, Température, Tournesol