Specific Rearrangements and New Molecular Markers in Acute Myeloid Leukemia: Study of MYBL2 Genetic Alterations and Its Involvement in Leukemogenesis
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplementary Data
Figure 2S 4 7 A - C 080125 CSCs 080418 CSCs - + IFN-a 48 h + IFN-a 48 h + IFN-a 72 h 6 + IFN-a 72 h 3 5 MRFI 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 7 B 13 080125 FBS - D 080418 FBS - + IFN-a 48 h 12 + IFN-a 48 h + IFN-a 72 h + IFN-a 72 h 6 080125 FBS 11 10 5 9 8 4 7 6 3 MRFI 5 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 Molecule Molecule FIGURE 4S FIGURE 5S Panel A Panel B FIGURE 6S A B C D Supplemental Results Table 1S. Modulation by IFN-α of APM in GBM CSC and FBS tumor cell lines. Molecule * Cell line IFN-α‡ HLA β2-m# HLA LMP TAP1 TAP2 class II A A HC§ 2 7 10 080125 CSCs - 1∞ (1) 3 (65) 2 (91) 1 (2) 6 (47) 2 (61) 1 (3) 1 (2) 1 (3) + 2 (81) 11 (80) 13 (99) 1 (3) 8 (88) 4 (91) 1 (2) 1 (3) 2 (68) 080125 FBS - 2 (81) 4 (63) 4 (83) 1 (3) 6 (80) 3 (67) 2 (86) 1 (3) 2 (75) + 2 (99) 14 (90) 7 (97) 5 (75) 7 (100) 6 (98) 2 (90) 1 (4) 3 (87) 080418 CSCs - 2 (51) 1 (1) 1 (3) 2 (47) 2 (83) 2 (54) 1 (4) 1 (2) 1 (3) + 2 (81) 3 (76) 5 (75) 2 (50) 2 (83) 3 (71) 1 (3) 2 (87) 1 (2) 080418 FBS - 1 (3) 3 (70) 2 (88) 1 (4) 3 (87) 2 (76) 1 (3) 1 (3) 1 (2) + 2 (78) 7 (98) 5 (99) 2 (94) 5 (100) 3 (100) 1 (4) 2 (100) 1 (2) 070104 CSCs - 1 (2) 1 (3) 1 (3) 2 (78) 1 (3) 1 (2) 1 (3) 1 (3) 1 (2) + 2 (98) 8 (100) 10 (88) 4 (89) 3 (98) 3 (94) 1 (4) 2 (86) 2 (79) * expression of APM molecules was evaluated by intracellular staining and cytofluorimetric analysis; ‡ cells were treatead or not (+/-) for 72 h with 1000 IU/ml of IFN-α; # β-2 microglobulin; § β-2 microglobulin-free HLA-A heavy chain; ∞ values are indicated as ratio between the mean of fluorescence intensity of cells stained with the selected mAb and that of the negative control; bold values indicate significant MRFI (≥ 2). -
Download.Cse.Ucsc.Edu/ Early Age of Onset (~2.5 Years) of This PRA Form in Goldenpath/Canfam2/Database/) Using Standard Settings
Kropatsch et al. Canine Genetics and Epidemiology (2016) 3:7 DOI 10.1186/s40575-016-0037-x RESEARCH Open Access A large deletion in RPGR causes XLPRA in Weimaraner dogs Regina Kropatsch1*, Denis A. Akkad1, Matthias Frank2, Carsten Rosenhagen3, Janine Altmüller4,5, Peter Nürnberg4,6,7, Jörg T. Epplen1,8 and Gabriele Dekomien1 Abstract Background: Progressive retinal atrophy (PRA) belongs to a group of inherited retinal disorders associated with gradual vision impairment due to degeneration of retinal photoreceptors in various dog breeds. PRA is highly heterogeneous, with autosomal dominant, recessive or X-linked modes of inheritance. In this study we used exome sequencing to investigate the molecular genetic basis of a new type of PRA, which occurred spontaneously in a litter of German short-hair Weimaraner dogs. Results: Whole exome sequencing in two PRA-affected Weimaraner dogs identified a large deletion comprising the first four exons of the X-linked retinitis pigmentosa GTPase regulator (RPGR) gene known to be involved in human retinitis pigmentosa and canine PRA. Screening of 16 individuals in the corresponding pedigree of short-hair Weimaraners by qPCR, verified the deletion in hemizygous or heterozygous state in one male and six female dogs, respectively. The mutation was absent in 88 additional unrelated Weimaraners. The deletion was not detectable in the parents of one older female which transmitted the mutation to her offspring, indicating that the RPGR deletion represents a de novo mutation concerning only recent generations of the Weimaraner breed in Germany. Conclusion: Our results demonstrate the value of an existing DNA biobank combined with exome sequencing to identify the underlying genetic cause of a spontaneously occurring inherited disease. -
Cytogenomic SNP Microarray - Fetal ARUP Test Code 2002366 Maternal Contamination Study Fetal Spec Fetal Cells
Patient Report |FINAL Client: Example Client ABC123 Patient: Patient, Example 123 Test Drive Salt Lake City, UT 84108 DOB 2/13/1987 UNITED STATES Gender: Female Patient Identifiers: 01234567890ABCD, 012345 Physician: Doctor, Example Visit Number (FIN): 01234567890ABCD Collection Date: 00/00/0000 00:00 Cytogenomic SNP Microarray - Fetal ARUP test code 2002366 Maternal Contamination Study Fetal Spec Fetal Cells Single fetal genotype present; no maternal cells present. Fetal and maternal samples were tested using STR markers to rule out maternal cell contamination. This result has been reviewed and approved by Maternal Specimen Yes Cytogenomic SNP Microarray - Fetal Abnormal * (Ref Interval: Normal) Test Performed: Cytogenomic SNP Microarray- Fetal (ARRAY FE) Specimen Type: Direct (uncultured) villi Indication for Testing: Patient with 46,XX,t(4;13)(p16.3;q12) (Quest: EN935475D) ----------------------------------------------------------------- ----- RESULT SUMMARY Abnormal Microarray Result (Male) Unbalanced Translocation Involving Chromosomes 4 and 13 Classification: Pathogenic 4p Terminal Deletion (Wolf-Hirschhorn syndrome) Copy number change: 4p16.3p16.2 loss Size: 5.1 Mb 13q Proximal Region Deletion Copy number change: 13q11q12.12 loss Size: 6.1 Mb ----------------------------------------------------------------- ----- RESULT DESCRIPTION This analysis showed a terminal deletion (1 copy present) involving chromosome 4 within 4p16.3p16.2 and a proximal interstitial deletion (1 copy present) involving chromosome 13 within 13q11q12.12. This -
Kmt2a-Mllt3 Ioannis Panagopoulos 1, Kristin Andersen 1, Martine Eilert-Olsen 1, Bernward Zeller 2, Monica Cheng Munthe-Kaas 2, Jochen Buechner 2, Liv T.N
CANCER GENOMICS & PROTEOMICS 18 : 67-81 (2021) doi:10.21873/cgp.20242 Therapy-induced Deletion in 11q23 Leading to Fusion of KMT2A With ARHGEF12 and Development of B Lineage Acute Lymphoplastic Leukemia in a Child Treated for Acute Myeloid Leukemia Caused by t(9;11)(p21;q23)/ KMT2A-MLLT3 IOANNIS PANAGOPOULOS 1, KRISTIN ANDERSEN 1, MARTINE EILERT-OLSEN 1, BERNWARD ZELLER 2, MONICA CHENG MUNTHE-KAAS 2, JOCHEN BUECHNER 2, LIV T.N. OSNES 3, FRANCESCA MICCI 1 and SVERRE HEIM 1,4 1Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway; 2Department of Pediatric Hematology and Oncology, Oslo University Hospital, Rikshospitalet, Oslo, Norway; 3Department of Immunology, Oslo University Hospital, Rikshospitalet, Oslo, Norway; 4Institute of Clinical Medicine, Faculty of Medicine, University of Oslo, Oslo, Norway Abstract. Background/Aim: Fusion of histone-lysine N- The histone-lysine N-methyltransferase 2A ( KMT2A , also methyltransferase 2A gene (KMT2A) with the Rho guanine known as MLL ) gene in 11q23 (1, 2) may fuse with more than nucleotide exchange factor 12 gene (ARHGEF12), both located 100 different partners in acute lymphoblastic leukemia (ALL), in 11q23, was reported in some leukemic patients. We report a acute myeloid leukemia (AML), chronic myeloid leukemia, KMT2A-ARHGEF12 fusion occurring during treatment of a myelodysplastic syndromes, lymphomas, and solid tumors (3). pediatric acute myeloid leukemia (AML) with topoisomerase II Some of the resulting chimeras are common, such as the fusions inhibitors leading to a secondary acute lymphoblastic leukemia with the AF4/FMR2 family member 1 ( AFF1 ) and MLLT3 (ALL). Materials and Methods: Multiple genetic analyses were super elongation complex subunit ( MLLT3 ) genes generated by performed on bone marrow cells of a girl initially diagnosed t(4;11)(q21;q23) in ALL ( KMT2A-AFF1 ) and t(9;11)(p21;q23) with AML. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
The Direction of Cross Affects Obesity After Puberty in Male but Not Female
Kärst et al. BMC Genomics (2015) 16:904 DOI 10.1186/s12864-015-2164-2 RESEARCH ARTICLE Open Access The direction of cross affects obesity after puberty in male but not female offspring Stefan Kärst1†, Danny Arends1†, Sebastian Heise1†, Jan Trost1, Marie-Laure Yaspo2, Vyacheslav Amstislavskiy2, Thomas Risch2, Hans Lehrach2 and Gudrun A. Brockmann1* Abstract Background: We investigated parent-of-origin and allele-specific expression effects on obesity and hepatic gene expression in reciprocal crosses between the Berlin Fat Mouse Inbred line (BFMI) and C57Bl/6NCrl (B6N). Results: We found that F1-males with a BFMI mother developed 1.8 times more fat mass on a high fat diet at 10 weeks than F1-males of a BFMI father. The phenotype was detectable from six weeks on and was preserved after cross-fostering. RNA-seq data of liver provided evidence for higher biosynthesis and elongation of fatty acids (p = 0.00635) in obese male offspring of a BFMI mother versus lean offspring of a BFMI father. Furthermore, fatty acid degradation (p = 0.00198) and the peroxisome pathway were impaired (p = 0.00094). The circadian rhythm was affected as well (p = 0.00087). Among the highest up-regulated protein coding genes in obese males were Acot4 (1.82 fold, p = 0.022), Cyp4a10 (1.35 fold, p = 0.026) and Cyp4a14 (1.32 fold, p = 0.012), which hydroxylize fatty acids and which are known to be increased in liver steatosis. Obese males showed lower expression of the genetically imprinted and paternally expressed 3 (Peg3) gene (0.31 fold, p = 0.046) and higher expression of the androgen receptor (Ar) gene (2.38 fold, p = 0.068). -
4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4). -
TTDN1 (MPLKIP) (NM 138701) Human 3' UTR Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC204348 TTDN1 (MPLKIP) (NM_138701) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: TTDN1 (MPLKIP) (NM_138701) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: MPLKIP Synonyms: ABHS; C7orf11; ORF20; TTD4 ACCN: NM_138701 Insert Size: 2000 bp This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 TTDN1 (MPLKIP) (NM_138701) Human 3' UTR Clone – SC204348 Insert Sequence: >SC204348 3’UTR clone of NM_138701 The sequence shown below is from the reference sequence of NM_138701. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC ACAGGCAAAAAAGGAAGATACTTTTGTTAACATTTCTGAAATTCAACTGGAAGCTTCATGTGTCAGGAA CATCTTGGACAAAACTTTAAGTTGTGTTGATATAAATTTACCCAAAGATGATGACTTTGATTGGATAAT TAGTAAGGTCTTTTTGTTATTTTTCATCGTATCAGGTATTGTTGATATTAGAGAAAAAAGTAGGATAAC TTGCAACATTTAGCTCTGGAAGTACCTACCACATTTTAGAGATTTACCGTTTCCATATATTTAACATTC CTGGTTACATAATGGACATTTGTCTTTTAATGTTTTTTCAATGTTTTAAAATAAAACATTTTGTCTTCT AGCTATTGTGGTTTTGTGGTATGATAAAGAAGTAGACTTACTACAGTAATGCTTTGTAGTCACTTAGAG TTCATAGGTAAATGTTTTGCAAATTATTTTTGAAAATGAAATAGGTAAACCATCCTTTGAGCTGTAGAC -
An Extra Chromosome 9 Derived from Either a Normal
ONCOLOGY LETTERS 18: 6725-6731, 2019 An extra chromosome 9 derived from either a normal chromosome 9 or a derivative chromosome 9 in a patient with acute myeloid leukemia positive for t(9;11)(p21.3;q23.3): A case report MAN GAO1, HUI PANG2, YOUNG MI KIM2, XIANGLAN LU2, XIANFU WANG2, JIYUN LEE2,3, MINGWEI WANG4, FANZHENG MENG1 and SHIBO LI2 1Department of Pediatrics, The First Hospital of Jilin University, Changchun, Jilin 130021, P.R. China; 2Department of Pediatrics, University of Oklahoma Health Sciences Center, Oklahoma, OK 73104, USA; 3Department of Pathology, College of Medicine, Korea University, Seoul, South Korea; 4Clinical Medical College of Beihua University, Jilin City, Jilin 132013, P.R. China Received March 11, 2019; Accepted September 27, 2019 DOI: 10.3892/ol.2019.11035 Abstract. Translocation (9;11)(p21.3;q23.3) is one the extra chromosome 9 could serve a crucial role in AML of the most common lysine methyltransferase 2A disease progression and contribute to cellular sensitivity to (KMT2A)-rearrangements in de novo and therapy-related chemotherapy. acute myeloid leukemia (AML). Numerous in vitro and in vivo studies have demonstrated that the KMT2A/MLLT3 Introduction super elongation complex subunit (MLLT3) fusion gene on the derivative chromosome 11 serves a crucial role in leuke- Chromosomal rearrangements of the lysine methyltransferase mogenesis. Trisomy 9 as a secondary chromosome change 2A (KMT2A) gene (former MLL) at 11q23 have been reported in patients with t(9;11) is relatively rare. The present study in ~10% of patients with acute leukemias (1). Analysis of reported a unique case of AML with a chromosome 9 trisomy the KMT2A recombinome of acute leukemias has identified secondary to t(9;11)(p21.3;q23.3) through the cytogenetic 135 totally different KMT2A rearrangements, and 94 related analysis of leukemic blood and bone marrow. -
Ingenuity Pathway Analysis of Differentially Expressed Genes Involved in Signaling Pathways and Molecular Networks in Rhoe Gene‑Edited Cardiomyocytes
INTERNATIONAL JOURNAL OF MOleCular meDICine 46: 1225-1238, 2020 Ingenuity pathway analysis of differentially expressed genes involved in signaling pathways and molecular networks in RhoE gene‑edited cardiomyocytes ZHONGMING SHAO1*, KEKE WANG1*, SHUYA ZHANG2, JIANLING YUAN1, XIAOMING LIAO1, CAIXIA WU1, YUAN ZOU1, YANPING HA1, ZHIHUA SHEN1, JUNLI GUO2 and WEI JIE1,2 1Department of Pathology, School of Basic Medicine Sciences, Guangdong Medical University, Zhanjiang, Guangdong 524023; 2Hainan Provincial Key Laboratory for Tropical Cardiovascular Diseases Research and Key Laboratory of Emergency and Trauma of Ministry of Education, Institute of Cardiovascular Research of The First Affiliated Hospital, Hainan Medical University, Haikou, Hainan 571199, P.R. China Received January 7, 2020; Accepted May 20, 2020 DOI: 10.3892/ijmm.2020.4661 Abstract. RhoE/Rnd3 is an atypical member of the Rho super- injury and abnormalities, cell‑to‑cell signaling and interaction, family of proteins, However, the global biological function and molecular transport. In addition, 885 upstream regulators profile of this protein remains unsolved. In the present study, a were enriched, including 59 molecules that were predicated RhoE‑knockout H9C2 cardiomyocyte cell line was established to be strongly activated (Z‑score >2) and 60 molecules that using CRISPR/Cas9 technology, following which differentially were predicated to be significantly inhibited (Z‑scores <‑2). In expressed genes (DEGs) between the knockout and wild‑type particular, 33 regulatory effects and 25 networks were revealed cell lines were screened using whole genome expression gene to be associated with the DEGs. Among them, the most signifi- chips. A total of 829 DEGs, including 417 upregulated and cant regulatory effects were ‘adhesion of endothelial cells’ and 412 downregulated, were identified using the threshold of ‘recruitment of myeloid cells’ and the top network was ‘neuro- fold changes ≥1.2 and P<0.05. -
Estrogen Receptor Α Polymorphism in a Species with Alternative Behavioral Phenotypes
Estrogen receptor α polymorphism in a species with alternative behavioral phenotypes Brent M. Hortona, William H. Hudsonb, Eric A. Ortlundb, Sandra Shirka, James W. Thomasc, Emily R. Youngd, Wendy M. Zinzow-Kramera, and Donna L. Maneya,1 aDepartment of Psychology, Emory University, Atlanta, GA 30322; bDepartment of Biochemistry, Emory University School of Medicine, Atlanta, GA 30322; cNIH Intramural Sequencing Center, National Human Genome Research Institute, National Institutes of Health, Rockville, MD 20852; and dDepartment of Biology, Georgia Institute of Technology, Atlanta, GA 30332 Edited by Ellen D. Ketterson, Indiana University, Bloomington, IN, and accepted by the Editorial Board December 5, 2013 (received for review September 12, 2013) The evolution of behavior relies on changes at the level of the (7, 8). Morph differences in behavior cannot be entirely explained genome; yet the ability to attribute a behavioral change to by these hormones, however, because the differences persist even a specific, naturally occurring genetic change is rare in vertebrates. when plasma levels are experimentally equalized (9). Individual In the white-throated sparrow (Zonotrichia albicollis), a chromo- variation in steroid-dependent behavior may be better explained somal polymorphism (ZAL2/2m) is known to segregate with a be- by neural sensitivity to the hormones, for example by variation in havioral phenotype. Individuals with the ZAL2m haplotype engage the distribution and abundance of steroid receptors (10, 11). in more territorial aggression and less parental behavior than indi- The gene encoding estrogen receptor α (ERα), estrogen re- m viduals without it. These behaviors are thought to be mediated by ceptor 1 (ESR1), has been captured by the ZAL2 rearrange- sensitivity to sex steroids, and the chromosomal rearrangement ment (3) and has therefore likely differentiated between the underlying the polymorphism has captured a prime candidate haplotypes. -
Redefining the Specificity of Phosphoinositide-Binding by Human
bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.163253; this version posted June 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Redefining the specificity of phosphoinositide-binding by human PH domain-containing proteins Nilmani Singh1†, Adriana Reyes-Ordoñez1†, Michael A. Compagnone1, Jesus F. Moreno Castillo1, Benjamin J. Leslie2, Taekjip Ha2,3,4,5, Jie Chen1* 1Department of Cell & Developmental Biology, University of Illinois at Urbana-Champaign, Urbana, IL 61801; 2Department of Biophysics and Biophysical Chemistry, Johns Hopkins University School of Medicine, Baltimore, MD 21205; 3Department of Biophysics, Johns Hopkins University, Baltimore, MD 21218; 4Department of Biomedical Engineering, Johns Hopkins University, Baltimore, MD 21205; 5Howard Hughes Medical Institute, Baltimore, MD 21205, USA †These authors contributed equally to this work. *Correspondence: [email protected]. bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.163253; this version posted June 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. ABSTRACT Pleckstrin homology (PH) domains are presumed to bind phosphoinositides (PIPs), but specific interaction with and regulation by PIPs for most PH domain-containing proteins are unclear. Here we employed a single-molecule pulldown assay to study interactions of lipid vesicles with full-length proteins in mammalian whole cell lysates.