Univerzita Karlova v Praze Přírodovědecká fakulta Katedra zoologie
Molekulární fylogeografie lína obecného Tinca tinca (Linnaeus, 1758)
Zdeněk Lajbner
Disertační práce
Školitel: RNDr. Petr Kotlík, Ph.D. ÚŽFG AV ČR, v.v.i., Liběchov
Praha 2010
DD 6 #$ %%tiky & ()*+,5 D D . % a s 0 6D D z jeho strany dostávalo. D#1% .20 %\ 4. T% $$. () +,54.D0 D $ TT 0 T "T 0 a cenné rady. , TD D \ .0 T .D tvorby di 60 T T ? \\ 0 D , D DD D
8 0 #6$9 D"0 $ 5 republiky - 6 4:;<;=>" "0 D\TD"0 6 #$ % % $+ D5 .$- 6 +,;?@;A@;@B@TD0 # D Univerzity Karlovy v Praze - 6 CB
The tench Tinca tinca (Linnaeus, 1758) is a valued table fish native to Europe and Asia, but which is now widely distributed in many temperate freshwater regions of the world as the result of human-mediated translocations. Spatial genetic analysis applied to sequence data from four unlinked loci (three nuclear introns and mitochondrial DNA) defined two groups of populations that were little structured geographically but were significantly differentiated from each other, and it identified locations of major genetic breaks, which were concordant across genes and were driven by distributions of two major phylogroups. This pattern most reasonably reflects isolation in two principal glacial refugia and subsequent range expansions, with the Eastern and Western phylogroups remaining largely allopatric throughout the tench range. However, this phylogeographic variation was also present in European cultured breeds studied and some populations at the western edge of the native range contained the Eastern phylogroup. Thus, natural processes have played an important role in structuring tench populations, but human-aided dispersal have also contributed significantly, with the admixed genetic composition of cultured breeds most likely contributing to the introgression. We have then designed novel PCR-RFLP assays of two nuclear-encoded markers and one mitochondrial DNA (mtDNA) marker, which allow a rapid identification of the morphologically undistinguishable Western and Eastern phylogroup and also of three geographical mtDNA clades within the Eastern phylogroup. The method will enable researchers and also fishery practitioners to rapidly distinguish genetically divergent geographical populations of the tench and will be useful for monitoring the introduction and human-mediated spread of the phylogroups in wild populations, for characterization of cultured strains and in breeding experiments. The population genetic test based on analyses of variation at introns of nuclear genes, microsatellites, allozymes and mitochondrial DNA in populations from two postglacial lakes within the contact zone of both phylogroups did not detect robust linkage and Hardy-Weinberg disequilibria that would not be limited to individual loci and would be concordant between populations. This test, based on the expectation that in the presence of strong barriers to reproduction the hybrid populations would show genome-wide associations among alleles and genotypes, supports the hypothesis of free interbreeding between the two phylogroups of tench. Therefore, although the phylogroups may be considered as separate phylogenetic species, the present data suggest that they form a single species under the biological species concepts.
= > = ? @ B G I J MOQV B O X O = Y Z = = ? [ G G > = X [ G \ ] G ^ = B > ^ \ ] G > =O B Y _ MQ B Y Z Q
Y > _ _ ` J { V | } Y G _ G > G J? ^ IV > G J V J? > IV G G G J` ~ = Y ^ V _ J` @=BV _ J ` X @@Q @@@ | ` V { [ G _ _ G G J IV ? G _ _ _ J? @OO Y ^ @Q @V ? G _ G G > G > G G J? > IV _ G J G G V J O Y >> QV | _ _ _ ~ _ ~ Y JX G MV ? J @@MV Y _ G G _ J IV G ?
6 G _ _ J G > G V G J~ V ~ J @@ V G G > G > G ] G > G _ ] _ J @@@ ~ IV G _ G > G > G G > J @QM V _ G > > J? ^ IV G G > > G G G > G G > G G _ J V > G G > > G G _ _ > G G > J V G > _ J _V J? @V > G G > J X V G G > > G J G V _ J V J @@QV { _ J @@QV _ > G J~ @Q@V G J V J` @@OV J V J V Y _ > J V J ~ > OV _ J V
7 ` G _ J~ ^ G @MIV G > _ > G G > G > J V { _ > G G > J| @@OV | J ^ @V J G @Q V > G G > _ _ J @@O \ ? @@M ~ @@@ ~ @V J G @Q V G _ _ J ^ ` V } G ` J` QV G J @V Y ` J V } _ _ > G G > _ J V > _ JY V _ G Y G G J ] V
8
G G G J| @@@V G G _ _ } > G J > V ? _ J G _ V J> V J V _ J _V G J I @V _ _ _ _ Y _ G _ > J @@I ? G @@QV _ G G G G G J G GV [ G _ > _ _ J QV G G G J G G @V ` > G G J @M@ ? @@ V Y J @V _ _ J ^ G Y @@MV _ G G ^? J | V _ > G G > > G J | G ` V
9
Q JX V > _ } G _ } J | O ? QV } G _ _ J V _ G _ J` @== ~ X = QV _ _ _ J] @OQ X @@B ` X X [ ~ OV _ J{ B OV G J~ = @V _ G } J V J } V ~ _ _ _ J ? G I Y^ M ` V _ JY^ V _ J > MV _ _ G > _ J QV J } @@OV J G MV G _ J? V
10 _ G J G M ` X Q ~ V Y _ G G > G G > J I | I Y = G M ` Q Q ` > @V { _ _ X _ > J > Q ? G Q ` V _ _ J OV _ J IV G _ G _ G _ G G _ G J >> MV _ > G _ _ _ J ~ @@ V _ J ^ M Y MV > _ _ J ~ @@ V _ J V ] J? V
11 | > J >> Q V _ _ > J{ G | BV | _ _ G > _ _ J V J V
12
J~ MV > G G > J QQI Y >> @@OV ` G BM ` J V _ J O IV } Q J QQIV | JY >> @@OV J? @@O @@QV _ ~ ~ J~ @@@ V ? > G G > > _ G > G G > _ J? ^ IV G X Q = { J @IMV | } J ? ^ @@ V X JX ` @V J~ @@QV G G [> G _ =Y J V X _ X | > G G | JX ` @V G J @Q ~ V J @QMV YY J YV > _ J @@OV > J @MMV _ J G V } > J G @B ~
13 @@@ V _ > J~ @@@ V ~ ? ` J @M@ ~ G V ~ J @@ V J @= V Y JY @BI ~ @@@ V > G G _ G G J| @O V Y > ~ J| @ O @O V J Q@ V M [Q O J~ QV J\ @QQ ~ @@@ V > _ ] Q J @M V { ` J @@O @@QV J = V J @V | > G G > _ > G G > J V
{ ~ J V _ _ G G G G _ _ _ G > G J @@OV
14
X > G G > _ _ > > G G > > G G > > G > G > G G > } `
J V ? [ G G > J Z MO [IOM MI V
| > G G > G _ > G G >
J] ^ Y] V X [ G \ ] G ^ J Z MOO[ @@Q @ I V
> > G G >
J V > ^ \ ] G > Q@[B J Z M = [ @[@ BM[ V
Y _ ! [ _ G G
15
> \ Y \ G { J V | ^ Z G G | ] G ] =Z= B[= ]X | ] J V [ > > G G G = Z M[ @@ ? ~ ~ `{ ~ `Y J QV > [ ^ ] ZBI [BOO Y ] { { \ G ?] { J @@OV G ^ ` G ~ IZ @=[ = {X J @@IV ` X ? ^ {X J @@QV | ^ > G G Z > ` ] G MZBM [BM@ {X J V G G Z | > > ? X G {X J V Z G G X Z==O[==@ {X { ~ ` ~ G ] | G {] X Y X J @QMV > G G [ [ G ^ G ^ > ] G Y QZIQ@[O {X |{ J QV ? Z ^ > G Y ~ G OMZO B[O M ~ ] J @@ V ? ^ G > > ^ ] ~ G > BBZ =M[ Q ~ { X { G Y X ~ G [ |{ J V G G G > Z J V \ > X G X G @[ O ~ ` J @@ V G G > > ^ Z > > ^ ] [ G \ ~ { J @@@V ` [ > G >> ^ G O ZM=B[MMB ~ ` J MV X [ > ] B ZO[ I
16 ~ X\ { ` | J @Q@V G G G > Z >> > G Z= B[= M ~ Y J QV | > ~ Y Z | ~ XX | J V > G > ~ Y ~ Y G [ G ~ B@Q[I M ~ > ` ` Y ` { ~ Y ? Y^ Y ` J OV | G G > ^ Y B Z [ B ~ ` J V ^ > > > ~ ^ > Y G > ^ X G Y G BMZ O [ MB ~ ` G J V > > > J> V ^^^ ^ [ ~ { ~ ` ~ J @@QV ` G > X > > ` G ] @Z [ Q ~ |` ` ` X ~ ~ \ G { > Y ` G ? [| X J V ? > X ~ G =Z@ @[@ B ~ ` ~ ] ~ ` J @@@ V X Q M Z ~ ` J V | ^ > ] OZ X [ G \ O[ @ ~ ` ~ ] ~ ` J @@@ V J MOQV Z ~ ` J V | ^ > ] OZ X [ G \ @[B X {| {~ J @@BV ] G Z G > G G Y = ZMQ[Q X ` [~ ] J OV G > | ] G ] Z X G ] ? { Y G ~ ` J =V Z G >> > Y ~ G IZ I O[ I X { J V G > [ | I OZ B J @@OV X Q M [ } Z ~ J V Y ` Q
17 J Q@ V Y > G G G Y G Z= [ ^ {{ ~ ? G ` | \ ^ \ \ X J MV X G G > [ G > G > ` G ] G IZIQB[I@I G {? G J @V G > | ] G ] IZBB [BI ^ G |] Y X J @@MV | > G > > ^ ] G Y QZO@B[= @ Y Y ] >> J V G > G > ` ] G Z OM [ OQ { ? ~ J @@@V G G G > J" V ] ` ] G QZ@Q@[@@M ` { J V ] > G G G ` G > > Y Y @MZ@ O[@ ] XY J @OQV | ] G > X ? ] { ` X X {` ? X \ ~ ^ \] ? > X` J V G G G G G G [ G G G > > Y Y MZ = @=[ = ] >> J IV > G > G Z > > [ ` ] G BZQOB[Q=I G G ? Y ` X | J MV Z ] Y { J V | Y Z X ` G ~ ^ > BOM[B@Q { J QV ? ^ ^ G G ] ZOBO[OQ= { ? Y ] G { ? G { J V X > > [^ G ^ ] G Z@BO[@OB J @@MV Y > > G G ^ G G IMZ@ O[@ O { J @M@V > G | G J [~ V G > G Y G O Z [ =
18 { J @Q V ` > G J~ G V [ X ] Y J V @ Z BB[ B= ` J @@QV G > J V X > ? G IOZB [B I J O IV ` X ` ` X ~ J V G > ] G G ` G ] @Z [BB J QV G ` G Y ^ MZ O [ O @ X X J @V Y G ` ] G QZIMBI[IMO= | \ J OV G Z >> G ] G QZ@@B[ @ ? G Y` J @@QV ` ] G M@ZI B[I O ? ~Y \ G Y Y X ` G X ~ { X Y ] X ?] ? ?Y ` ]` `| Y G ] Y G ` Y \ J QV G > Y B @Z@IQ[@O ? ` J @V G \ [~ ^ ^ ? `` ]] ] ~ X ` G [ J V G > G ^ J# V G X { > Y OMZ B [ B@ ? ~ [ ` ` X >> { ` ` Y J V ? ^ ^ > Z G G > [ ~`X ] ~ G Z =@ ? ^ ` J IV > | > Y ~ BO@Z QB[ @O ? > ` Y G X ` Y Y J IV > G G ] > G G > > Y Y Z @=B[ @=Q ? ^ { J @@ V Y G G Z ^ Z \ > { {Y J V X Y G X ? [BB ? X J @OOV ? ^ > Y G IZ [
19 ? J @@OV ^ > G > J$ V G @Z I [ OO ? G { { J IV ` > Z > ~ Y OIZ @M[B @ ? G { { J QV | > > [ > G[ ` ] G MZ @I[B B X \{ ` J @V ` > X J| Z X > V ^ G > > ^ > Z > G ` G ] O ZOII[OI@ X G J MV | G G > [X Z [? Y ` J V | ~ Y Z G Y G @[ IQ { ` J BV > Y B Z MO[ MM { G Y | X J BV ] ^ > ^ > G =ZY B[Y Q X ? \ ~ Y{ ` \ {\? X ` ` J OV > > [ J^ V G G { > Y ZBMM[B@I ` J @M V | G > J V ^ G > =@~ZB [Q G { X J @Q V | Y BZ BO[ IQ ^ J @V Y G G ^ > ] G ] Y I ZO@B[= ^ ` \ Y G G ` ] G Z = B[ =BO J @@QV ] ^ > J V > ? G IOZB B[B J =V ` Z IZB[M ` ` J V >> > ^ > > ^ ~ G Z M@[ QQ ~ J V G G > J V ` ] G Z MM[ QO ~ G ] J IV X ~ Y G G > > ^ > Z G G > G ` ] G BZQM[@O
20 ` > { J MV ? > ] > ^ > X > ~ Y J @IMV Y G OZOB[=I J V ` { { J @@OV ] G >> > G ` [? G G I Z I [ IB >> J QV ] > > { > ~ G MBZ QB[ @B J IV G _ J V > ` ~ J @V > ^ ^ G { > ~ G MIZI Q[IB= J @= V > ^ > > > ] > YY ` G J V ` J IV ? > > ^ > ^ { > ` ^ BQZIQ [O ` ` {` Y { J @@ V | ` > > ] | > Y > ~ B QZBO@[BQO ] J V Z [ G ] G BZ O= [ OM X Y J @V X [ > J V { > ~ G M=ZI [I M ` Y ? ` J QV ` G [ > [ G > J$ V { ` ] G MZM@=[Q @ ` \ J QV X G > ` O Z G ` ~ J =V > > > ^ ] Z ^ > { > I Z [ O
21 ` Y X Y Y \ { ~ J V > JX V > ~ ` G ] OOZIQQ[O ` ~ J V > G G ^ G J# V ` ] G @Z O[ BM ` Y J @==V > ZBB@[BI ` J V > > G % > Y ~ G QZ BI ` ] J @=BV ? X G ` X ` ~ ^ X X ? ? ^ Y X | Y ? X] J QV ] >> > > G G Z > > G ] ZBO=[BMO ` X { J @@QV | > > Z G G ^ G Z ? ^ { ~ Y? J V ] > Z > ^ M [ QO ` | X > {\ J V ` >> > > G X]Y { > ` Y =MZI [I O ` ? X ]] J V | > G > > Y Y @QZOII=[OIO ` \Y J @@OV > G G > Z [G [G ] I@ZM Q[M = ` > XX ^ Y| ` ` |] | ` Y > \ J @V ? > > ^ ~ G OZB Q[BB { { { X ^ G ` ? GG { | ` {? J @V G G > ^ G X Z ` ^ ] @ZIMI[IQO ~ ` J @V Y > G G ` ] G QZ BI[ IM ` J @@@V > > ? QBZO BO Q J @MMV Y^ [ > | YY G G G I Z BO[ I=
22 { J @QMV G G | YY > > G G \ > O=ZM @[MB { >> G ` G `] J IV ] G > G | ] G ] @Z Q[ I Y J V ] [ ^ G > Y @BZ MQ=[ M@ \ J IV G > > [ G ] Z | X][O J ` V X] ^ > ] Y B Z [ I@ } ` J @@OV Z Y ` J ~ V B [ I= G ` J V ] > G Y ~ Y O ZOB[=O G ` J OV ^ [ Y ] G ] O Z MB[ QQ >> { ` ` ` J MV ? G > G G G > > Y Y IZOMB [OMBM { J V ? G > > ^ > ^ ] G Y BBZ @ [B O G ? G ? J @@ V G ^ ^ > ^ G >> ` ~ G ] @ZOO [O=@ ` Y J V ` G Z > ^ Z J V Y > Z ^ G { \ Y Y G @[ IB \~ \X ` X Y ` { Y ` ? J @@MV ^ G > ~ Y > ` G BQZ @[ = Y X ` X [` { J =V ? G ^ ^ J# V G ~ G X B Z MQ[ Q@ Y Y X ^ ? G J MV [ > G ] G ^ Z ` G ] G IZB=@[BQ
23 Y ^ { J @Q V \ > ^ > | ` Y YY [MO Y Y > X ` Y Y Y >> \ J @@OV | J V G > > ? G I Z = [ Q Y >> { ~ G ` X ?~ [{ ? [ ? ` { Y{ { { ` [ | Y G Y >> ~ Y GG [ ` Y ] Y \ {\X J QV ? G [ ^ G > ^ Y B Z=Q [=QI Y^ Y ? {` J MV ] [ > G > Y ~Z ~ G Y MIZ O[ Y^ J V > [ > J& ! V ] J V Z MO [IOM Q Y ^ { ` ~ J V > G Z > G > Y ~ MMZ== [=M ` J @@OV J V X > ? G I Z BB[ I { J QQI @@MVZ X | } | J @Q@V Y > G BZOQO[O@O | ]~ J IV ] Z > > > Y Z ? Y Y J V ] Y > > B [ =B | ] X J @@OV Y G > [ > G G > G I ZM=M[MQ | J @ OV Y^ > ] G G > Y Z ` ? J V ? ~ > ` G Y ^ Y G ~ BZ [B | J @O V G G Y ^ ^ ] ~ G ^ Q ] Y ^ G G Y G
24 | G X ~ J V ~ G G > G > ^ G J| Z X V G G G G ~ G { > Y MOZQB[@@ | ` ~ ? X { J V | | ] G ] =ZBB [BIB | J @@@V \ > ^ ~ G @Z Q [ @M ` Y J @M@V G > ! ^ Z J V G > X > ~ ~ I | X > YY G I[ I ] ? { J @@ V G > Z | { > ~ G JY V B@ZB @[BBI \ { ? { J @@MV ] G IOZQIM[QOO \ J @QQV > | @I G G > ` G ` ^ { ` ` Y J OV Y > > ^ > > G ^ ^ ^ X G ~ G Z OOM[ O=I
25
J V
J Z MO [IOM MI V
26 Human-aided dispersal has altered but not erased the phylogeography of the tench
?D4.1,2 , Otomar Linhart 3 and Petr Kotlík 1
1 Laboratory of Fish Genetics, Department of Vertebrate Evolutionary Biology and Genetics, Institute of Animal $ %$) 0 +0 $#200 # : 0 .04.D0 : 0 .0 2 Department of Zoology, Faculty of Science, Charles University, Prague, Czech Republic >F $#2 G 5 GD0(0 $#( 0 #J 0 1 # ( : K$.%$ ,N$: 0 .0
Correspondence: ZdD Laboratory of Fish Genetics, Department of Vertebrate Evolutionary Biology and Genetics, Institute of Animal Physiology and Genetics, Academy of Sciences of the Czech Republic, Rumburská 89, D e-mail: [email protected], phone: +420 315 639 516, fax: +420 315 639 510.
Abstract Human-aided dispersal can result in phylogeographical patterns that do not reflect natural historical processes, particularly in species prone to intentional translocations by humans. Here we use a multiple-gene sequencing approach to assess the effects of human-aided dispersal on phylogeography of the tench Tinca tinca, a widespread Eurasian freshwater fish with a long history in aquaculture. Spatial genetic analysis applied to sequence data from four unlinked loci and 67 geographic localities (38–382 gene copies per locus) defined two groups of populations that were little structured geographically but were significantly differentiated from each other, and it identified locations of major genetic breaks, which were concordant across genes and were driven by distributions of two phylogroups. This pattern most reasonably reflects isolation in two major glacial refugia and subsequent range expansions, with the Eastern and Western phylogroups remaining largely allopatric throughout the tench range. However, this phylogeographic variation was also present in all 17 cultured breeds studied and some populations at the western edge of the native range contained the Eastern phylogroup. Thus, natural processes have played an important role in structuring tench populations, but human-aided dispersal have also contributed significantly, with the admixed genetic composition of cultured breeds most likely contributing to the introgression.
Keywords Intron; mtDNA; secondary contact; species range; stocking; Tinca tinca
27 Introduction Determining the effects of human-aided dispersal and how it overlays with natural distributional changes is essential for the effective protection of species throughout their native ranges. Translocations that occur within the limits of the natural distribution of a species do not extend its range but instead superimpose new genetic signatures on the natural diversity patterns if they involve genetically divergent populations or domestic breeds (Taylor 2004; Ferguson et al. 2007; Stone et al. 2007; Mabuchi et al. 2008; Randi 2008; Muhlfeld et al. 2009). The impacts of such translocations are therefore more difficult to detect. Molecular phylogeography offers here a powerful tool, which can also be used to resolve the ‘cryptogenic’ nature of species whose status in a given area may be either native or introduced but where clear evidence for either origin is absent (Carlton 1996). The international trade and human-aided transport provides an effective dispersal mechanism in many aquatic organisms, and freshwater fishes in particular. Up until now, phylogeographic studies of European freshwater fishes were largely focused on species that were not targets of aquaculture (e.g. Durand et al. 1999; Kotlík and Berrebi 2001; Šlechtová et al. 2004; Bohlen et al. 2007; Šedivá et al. 2008). Few economically important species have been studied phylogeographically across their ranges, but even in those cases the focus has been primarily on putative native populations, assuming (or hoping for) negligible phylogeographic contribution of human-aided dispersal (see Nesbø et al. 1999; Triantafyllidis et al. 2002; Van Houdt et al. 2005). As the result, phylogeographic information is still lacking for many common fishes, despite their role in freshwater communities and economic importance. One such domesticated fish (Bilio 2007) with poorly known genetic structure (Kohlmann et al. 2010; Lo Presti et al. 2010) despite the ancient history in the European aquaculture and cuisine (Giovio 1524; Lebedev 1960; Steffens 1995; García-Berthou et al. 2007) is the tench Tinca tinca (Linnaeus, 1758). The tench is widely distributed between the British Isles and Iberian Peninsula in the west to central Siberia in the east (Fig. 1), but because it has been in cultivation in Europe for a long time (Šusta 1884; Steffens 1995), its exact native range is difficult to discern: in some areas (e.g. Spain: García-Berthou et al. 2007; Italy: Gherardi et al. 2008; Turchini and De Silva 2008), it may be either native or introduced but clear evidence for either origin is absent (i.e. it is cryptogenic there). There are records of tench introduction outside its native range from as early as the 18th century (e.g. to Ireland: Kennedy and Fitzmaurice 1970), and since then, introduced . . 0 M0 + 0 0&J0 BHDDNG$L et al. 1999). In some countries it is even considered as an invasive, potentially harmful species due concerns over competition with native fish (e.g. Rowe 2004; Stokes et al. 2004; Hesthagen and Sandlund 2007; Rowe et al. 2008; De Vaney et al. 2009).
28 Distribution of genetic diversity of freshwater fishes is largely controlled by the island-like nature of their habitats (Bernatchez and Wilson 1998), and the present-day phylogeographic patterns of temperate species have been shaped primarily by isolation in multiple glacial refugia during the last glacial maximum (18 000-23 000 years ago), followed by range expansion and drainage isolation. Many widely distributed temperate freshwater fish species therefore show deep phylogeographic subdivisions (e.g. Durand et al. 1999; Bernatchez 2001; Kotlík and Berrebi 2001; Van Houdt et al. 2005; Kotlík et al. 2008; Hänfling et al. 2009). However, some species display only a limited or shallow phylogeographic structure, which is usually interpreted as the result of a recent dispersion from only one glacial refugium (Triantafyllidis et al. 2002; Bohlen et al. 2007). Alternatively, it can point to strong effects of human-aided translocations (Hänfling et al. 2009). The present study uses a multiple-gene sequencing approach (Brito and Edwards 2008) and barrier-detection statistics to test if the range-wide genetic variation of the tench shows a significant phylogeographic structure that can be explained by natural processes during the last glacial-interglacial cycle. Tench occupy all major freshwater regions in Europe, so that it should be possible to identify the contribution of different refugia (Fig. 1) to its present-day distribution. However, if human-aided dispersal significantly altered recent evolutionary history of the tench, the haplotypes could have been re-distributed among populations, wiping out any natural phylogeographic structure (Sanz et al. 2006). Captive breeding can produce admixed gene pools, increasing the homogenizing effect of human-aided dispersal. To assess this effect of hatchery practices, in addition to putative native populations we also sampled various cultured strains and known introduced populations outside the native range.
Figure 1 Putative native (olive) and part of non-native (violet) distribution range of the tench. Large areas where the origin is considered ambiguous are highlighted by orange. Locations of major freshwater glacial refugia in Europe, Western/ Atlantic (R1), Danubian (R2) and Ponto-Caspian (R3), are indicated. Sampling countries are labelled (codes: B, Belgium; BG, Bulgaria; BIH, Bosnia and Herzegovina; CH, Switzerland; CZ, Czech Republic; D, Germany; EST, Estonia; GB, Great Britain; H, Hungary; I, Italy; P, Portugal; RO, Romania; S, Sweden; SK, Slovakia). #0 PF0 BHH@NG$L BHHHN9 # BHHHN2 and Petr 1999; Economidis et al. 2000; Wang et al. 2004; Innal and Erk’akan 2006; Hestagen and Sandlund 2007; Popov 2009; Mamilov et al. 2010.
29 Y ^ > G > ] ^ @O > O ^ > M= O ^ J G V G J`? BOMV > > ` ? ^ \ = X > G G > > X ? G } X J @@Q @@@ =V G > G J V
> G > G J| V ^ J X V > > G G | G ^ ^ ] | | X > ^ J| G ~ ` V | G X ^ > G ` ` G X > G > ^ ^ ~ Y` ~ G | X Y G J ~ V > G ] Y J G V | ^ ~ BMB BMB Y ^ G Y] ` J Y V ^ > ^ > G J? @@@V > ^ ~ ?` =M@BO[?` =M@=O > G > G J V ^ > G [ [ [ [ J BV | > G G > | J V ^ > G { J V | > > G G > YM J #'V ^ > G YM ] YM ] JX ^ ? @@QV ? ^ > > JX @@ \ ? OV > > > ? Y] JY Y =V | G J$ V ^ > ^ | ` J V ^ ^ G > ^ JO [ X XXX X X| [ B V G JO [ X | | |X ||X| [ B V
30
Figure 2 Geographical distribution of major clades and SAMOVA groups. Clade W is shown in red and clade E in blue for ATPase (a), Act (b) and RpS7 (c). For Cytb (d), clade W is in red, clade EA in blue, clade EC in green and clade EI in yellow. The same colours are used for the SAMOVA groups (e). Boxed data points to the right and left of the maps in (b) through (e) represent identities for two sites in North America and in China and New Zealand, respectively [see (a)]. For exact haplotype distribution and frequencies see Appendix A.
31 # ( ^ J @QMV | ^ G >> > #') ^ > [G J? @QOV ` [ J @@ V ^ > > $ > > G G G >> G > | * > > X JX ` @V G J ~ @O= QV ^ > G Y I O B J BV
! / G ^ [ J` V G ` B J BV \ > ` | J QV > ? > > $ | > #' Y #' ^ J B OMQ@V > G ! > > G ^ #' | > ^ J =V G J @QOV G ` ^ ^ > G J| @@ V |XY JX V
; ! | ^ ^ % J| @Q@V J @@MV ^ Y ] B J] >> OV | G > ^ G G G > J [Y QV G > G > J| @Q@ @@MV ^ > G G > > G ^ > > ^ >> J V G ^ > > G \ ^ > G J G ? G @@ V
32 G J] >> IV G ] | ^ > G [ [ ^ ^ > ! " JY ] >> @@@V G JY ] >> @@@V ^ > G > JYY V ^ \ ^ G > $ > > > O O ` ^ G J V ~ G J QV
# |^ [ ^ > G G > G J @V | G G > G G ^ > > G Y ` J V | G > Y ` G G > G G G G G > G [ > > G J > G ^ G J $ V > G ^ G J #$V ` > G ^ ` J @MBV >> G ~ ] J` IV > ^ G G G G > G ] | G ^ ^ G G G > G G G J` IV ^ > > G G ^ ^ > ^ G G G 33 $ \ > > ^ > > G > > >> | ^ > G G > ] J V ^ G ` O J` Q ` ` QV > J|` X V ^ B G G > G O G J` QV G > > J` @OB @=OV \ > >> J= V G ^ > J O @@QV ^ I G J` @OBV > >> = = > B J| =V \ > > > ^ > ^ [ > |` X ^ > = G > ^ O > G = ^ ^ >> > > ^ > >> ^ G G [ G > J @OV ^ G > ^ > > G ^ > [G G > G G > G 34 | > G > > > G JBQIB G G V | | ^ > J#O V J V G G G #' J| V ^ ^ G G > ^ [ ^ > G G \ J ^V G [ G G ] > #' ^ > > [G G >> > G | ` [ > G > $ G J $ OV | G ^ G [^ > $ ^ G J \ ]V ^ = > G J G B >V G G > =I B = B G | \ G ^ > ] ^ ~ ^ ] G ^ > ] G X ^ > ^ \ G ] J G V \ \ ^ ] ^ J G B >V | > ^ ] ^ ^ Z ]X G > X Y ] > G ~ G J G V \ G ^ > G > #' J G B V | > > > G G G G > G ^ ^ G G G ^ \ ] G ^ G > #' G G G ^ $ J G V G ^ G G G G G > X G ^ ^ G ^ > [ >> G G > G J G V 35 The introduced populations in Turkey and China carried at all loci only clade E haplotypes, as did the overseas introduction to the state of Washington. However, the non-native populations in Bosnia and Herzegovina, in New Zealand and in Quebec carried at one or more loci haplotypes from both clade W and clade E (Fig. 2a–d). The phylogeographical variation observed among the tench populations was present also in the cultured breeds, with the exception of Cytb clades EC and EI that had very restricted geographical distrib Q0 # B< 0 . ,N$ % . as well as the Italian regional breed carried haplotypes from both clades W and E at one or more loci, including the seven regional Czech breeds, three European breeds (German, Romanian and Hungarian), three experimental breeds and three ornamental breeds (Appendix A). Figure 3 Haplotype relationships. Clade E is shown in blue and clade W in red for ATPase (a), Act (b) and RpS7 (c, d). For Cytb (e, f), clade W is in red, clade EA in blue, clade EC in green and clade EI in yellow. The networks were constructed under the 95 % maximum parsimony criterion and the size of the circles is proportional to the haplotype frequency; small empty circles represent unobserved haplotypes. The maximum-likelihood phylograms are shown with bootstrap (from 1000 replicates)/ aLRT support for major partitions in the RpS7 (d) and Cytb (f) phylogenies, with branch lengths proportional to the scale bar with the unit being a mean number of nucleotide changes per site. 36 Table 1 Summary of polymorphism for each gene and the results of demographic analyses Å Æ É Ê É ÇÈ Ç Ç È ÈÉ ! ! "# Å ÇÈ Ç Ç È È È Ë È È Ë È $ % Ì & '' (&&)Ë ( Ì) ()Ë ( *) Æ(+Ì ,,",,",, Æ(Ì** (&-" (')' ÌÇ $ %. ' ) - ( *Ë ( '- ( +Ë ( ' Æ&( /*,,,",,,",,, Æ'(-+,,,",,,",,, (&)/" ('& $ % * ÆÆ Æ $ %$ * ' ' (- Ë (&) ( *Ë ( Ì' Æ( Ì) Æ ()/ ())&" ()+/ $ 0 - * Ì (' )Ë ( - ( &+Ë ( - Æ(&-),"Æ"Æ Æ&(+)),"Æ", ('//" ( +& & - ÌÌ (*)Ë ( &+ (/)-Ë ( ') ( +& Ì(++Ì ( " (&' $ % & ' & ( +Ë ( ' ( &Ë ( & Æ(&-+Æ",", Æ*(-)Æ",",,, ( +" ( )& )/)Ç $ 0 -& * Ì (///Ë ( ) (/Ë ( - (&// ()+ ( *'" ( * ')& ) * * (/'-Ë ( & ())'Ë ( ' 3.669+++/+/+++ )(&&&11"111"1 ('" (&-Ì $ % &'- & ( )Ë ( ) ( 'Ë ( ' Æ (+'ÌÆ&(+*&Æ"Æ",, ( ''" (++/ &)+Ç $ 0 +' & ( Ë ( ( ÌË ( ÌÆ (+*/ Æ&(--/Æ"Æ", ( * " (++ Ì' Ì / (* Ë ( / ()/ Ë ( + '(&Ì 11"11"11 )())/1"11"1 ( " ( ) ATPase $ % &/ ÆÆ Æ Ç $ 0 & ÆÆ Æ ') & (ÌÌÌË ( *) (ÌÌÌË ( *) (&*' (*') ( +*" ( * È2 Ê . Ê ÅÉ È ÅÈ 3 Å É È Ç È ( Ç ÈÇ ÈÈ Ç ÈÈ È Ç Ç È 4 3 5 , 6 ( *7 ,, 6 ( 7 ,,, 6 ( 7 4 ÈÅ 5 1 6 ( *7 11 6 ( 8Æ9 É ÈÅÈÊÈ ÅÈ ÈÉ È É Ê Å Å ÈÅ È" Å É Ê È ÈÊÊ ÈÉ .: È Ì(* (' # 2 ( & ' " ÅÈ .#;%Î< È '( % ÊÊÈ ( & * Ç È( 3 Ç ÈÈ Ê ÈÅ Å ÊÈ 3 É È ÈÈ É Å ÇÈ "Ç È Ç È È ( 37 | % ^ G > $ \ ] ^ > ] ]X > G > > \ ] ] >> ^ G > J| V ^ #' G ^ > % G G G ^ G > > #' ] J| V > G \ ] ^ > $ ] ]X ^ G > J J YY ≥ YY V $ V ^ > J| V | > $ \ J BMBV ] JB V > B QB BI G O M = @ M G | Y ` > G > ^ [G > J G V ^ =O > G ^ ^ G J$ Z $ =QM # O #$ = = # Z $ ==M # #$ Q # V G > [G > $ J ]XV J ]V ^ G J G V G G $ J M@ # V ^ #$ J[ @O # V > G ^ [G G Y ` G ^ > ^ ^ > ^ G G ^ ^ G G J ~ Y^ Y G ^ G ^ > ] G V | ~ ] G > > > ^ > J G IV | G ^ ^ > ^ J G IV G G > ^ \ ] G J G V Y G > > ^ > | ~ > ^ > ^ > Y^ % > Y^ ~ Y ^ > ^ > J G IV ^ ^ > ] J G IV > ^ G ^ G G J G V 38 F G | > |` X G = > MB > ^ O > ^ B G \ > ^ >> > > ^ > > G J G G > > V ^ > >> ^ G [ ? ^ > = G ^ G O |` X G > > = G I @O > ^ B G | >> > > > I ^ > O G = = > B ^ ^ > O G > H ] G G > ~ ] G ` G | G ^ | > >> G > J ^ V 39 | Y ` G > G G > \ ] G ^ G G ^ J G V | ~ ] ^ [ G G ] [ J G IV G ^ G J G V | G > G G G G G G G | > G G G G > G G > G J| @@Q ? ^ V > G \ G G > ^ ] > G ^ ] G G > ] ^ > G | ^ G G G > ^ > G G > > J @@@ @@@ ~ V ~ X Y J~ @@ ~ I QV | > [X > G > G > > > G ~ Y J @= V G $ ]X X Y G ^ ] X Y > J G V ] ^ G ^ G ^ ^ J G V | ^ > > G ^ [X G G G G > ^ ^ | G > G ^ > [G > > > G | > > ^ > ^ G G > G > > | G G > > ] G > \ G G ^ G G > > G G G ] G ^ >> G ^ ] G J~ V 40 ] ^ G Y ` G Y ` G J G V G > G ^ G ^ G ~ G ] J G V X G G > > > > > >> > G ~ G [ |` X G > ^ > > G > G G ^ G > >> > G J G | @@Q ? ^ V \ > ^ G ] G > [G ^ G > ^ > G I ^ > G > G ^ ] J G V | Y ` > ^ ] G G > ] G G ^ > ] J G V | ^ ~ Y^ ^ > ^ ^ ~ ] > J G IV > Y G ] G ^ G > > J [~ M @V ] | > G G > G ^ > G JX @@=V | > G G ^ ^ > > J M | Y QV | > G G > J G IV GG > > [ G G 41 ^ ] ] % Y^ GG > > J> V ^ G \ G > ^ ^ > | ~ ^ > ^ ~ ] > ] \ G ^ ^ > Y ` G G G J G V | > > ] G ~ G ^ > ^ ] G ^ > ] G ^ ] J Y @V | G GG [ G G > | > G G ^ > G G G ^ > G G G > >> > ] >> > > \ ] G J V > > G | > G ^ G ^ > G ^ G > > [G G ^ > ^ ^ G J V ^ ^ > J G V | ^ G > G ^ G > >> G >> > G J ^ V G > > G ^ G G > | > G > G ^ G 42 J | G G G > ~ ? G ^ Y ^ J =V | > G ^ > > G ^ G J G V > G | G ^ ~ Y J~ @@@V ^ > ^ | J O ] =V | [ | J V > ] G J G V ^ G > > G J G IV | > ^ G > ] G | X ] G J G V | ^ G > X G J\ G @@@ ? G V > G X ^ J G V G ] G G > G } ^ X > G ^ G X J\ G IV > G G ^ G > ] G > | > > > ] Y QMM J~ QM@V ~ Q@= B= > ^ G X @Q= J Z V ~ > J~ G @IM @@@ V X ^ > G ^ Y ` G ^ ^ ] J G V ? ^ Y > \ G ] G ^ G ^ ] Y ` J G V | GG G > Y > \ G @ @ J\ \ BV ^ ^ ^ ] 43 ^ ^ @ > | J Q== Q=Q QQ | @ ? BV ^ > > ] G QOQ J Q== Q=QV | G J G V ^ Y ` G Y ` G J G V \ ^ > | GG ] G ] G @ G > ~ | >> > G G > G >> > > > G > G G > G G > > >> > G > G G ^ G > G \ ^ G G G G ^ [ G > > G > G ^ G >> > [^ > G [ G ^ G G > G > G G ^ > G G G J V \ G G > >> > G ^ ^ G >> Y G ^ > G ^ > > ^ J Q ? G Q ` > > V Y G > ^ >> > JY ^ B OV 44 G J \ G ^ ^ ` Y ? ~ { ~ G ~ ~ X { G ` G X G Y ~ ] ` >> & ` { ` ? ` ? ^ ? G ? ~ { ? | ] ] ^ [ ^ ` { ` ` | ? | ~ Y Y Y ` ` ` \ G { \ X > ^ ` Y ~ [ { > | ^ ^ ` > ] Y > X J X = MB `Y`= M==OQ @V > Y > X J O IO O O O V X Y J = @ OIV 45 Q=Q | > > Y G G Q=Q ` > G > Y > | > Q=Q G QB ` Q== > > > > G > > ^ > ^ ` > G > Y > | > Q== G = =I ` Q=Q ` >> > > | ` > G > Y > | > Q=Q G BBB= ` = [ | > ~ Z ^ > Y ~ G ZOB@OO | ` X [~ X Y G ] ~ ~ B > ] X > > > > G ~ | Z=M==MQ =Q =Q ? ~ ~ ` { ` Y ~ Q > [ ^ ] ZBI BOO \ QQ ? > > ^ | G > Y > ^ Z Q ~ Y QM@ Y X > > X > QMM Y G >> \ G X ~ @@ G G > > ^ Z > > ^ ] [ G \ ~ G { @IM | { > \ > ` G Z @M I ~ | > ^ J# V > > G G > ] ZBO BM@ ~ X \ @@Q X G G > > ` ] G ZIB IO ~ ` M X > ] J VZO I ~ { M ^ G ] ^ J V { > ~ G JY ~VZ Q= @I ~ ? Y ] ^ Q ` G G G G [ ZIB@IOO 46 ~ ` ] ~ ` ~ @@@ J MOQV G @ B ` ~ | ^ > ] OZ X [ G \ ~ G X X ^ { ` \ Q G Z > G ` ~ G ] Z= I =BB X { | @@= ~ G G ] G Z =OB =OO X \ { ` @ ` > X J| Z X > V ^ G > > ^ > Z > > G ` G ] ZOIIOI@ X ^ Y ? @@Q X > YM G > ` ] G Z OO O= X @@ > > > X [ > > ` ~ G ] Z X ` X |XYZ G G G G ` ] G KZ =OM =O@ Y X ` ` { ~ \ | ] \ @ | > X 'Z ] G ` G > Y ] Z OIO ^ G | ] X | \ ` Y ] > G J| Z X V > X Z==O =MQ { > | Y G =@ MM X ] ` [{ >> X ^ ^ > X Y X ^ Y Y ] >> G > G > ` ] G Z OM OQ { ? ~ @@@ G G G > J" V ] ` ] G Z@Q@@@M ] Y ] G ] ` > ^ > ` G ] G Z B@ O ] >> I > G > G Z > > [ ` ] G ZQOBQ=I 47 ] >> Y Y O B Z G > ^ G > G ] ~ > ZIMO { @QO X > G Z G ] K MQBM@ G G ? ( Y ` | X M G BOMB@Q ] Y { | Y Z X ` G ~ ^ > ` @@@ > > X Z > G ZI=@IQ O Y G { > ] ~ G ZMO MOO { Y ? { ] G { ? G X > > ^ G ^ ] G Z@BO@OB @@M Y > > G G ^ G G Z@ O@ O { \ @@@ G \ > Y Y Y M ~ ` [~ ] ~ ` X M [ G ^ G B I ~ G ^ Z > G Z Y G Y ] G Y G X ` > ) ` G G > > > G > G > G ' ^ ~ G ZBOMB=O ` @@Q G > J V X > ? G ZB B I ` ` ` = | G G > Z @O B 48 Y ~ ` ~ Y X Y X > ` G ] ` ] Y Y ] | Q ^ Z > ^ ~ G ZIBOIOI O I ` X J V ~ = Y > ? ~ ^ Y G G I G > Z _ > } I O O = > Y ~ ~ X X @ Y G ` ] G ZIMBIIMO= Y B > G G G Y ~ G Z=@=M I ? ` Y Y @@@ | > G G > > G [ > G ` ] G Z MI@ MO ? > G ~ X ~ G ~ ` ~ @ Y ^ G G G > > ] GG ^ > G G G { > ~ G Z =@ Q= ? G | | Y M [ > ^ > ^ Z { > ~ G JY VZ MB QB ? ^ ` | G G > G Z@ M@ B ? ~ { B ~ G > J# ! V ^ G I@[OQ ` G G ^ ^ G > ^ > X ` ? > X \ G ^ ? G { X ? X G =[ Y Y Y X [ Z ~ G ` G G > \ ~ G | > O Q X G @Q X ? @QO Y > > > > Z IM =I ? G { { Q | > > [ > G[ ` ] G Z @IB B 49 ] = ]>> > > ^ > | ^ ~ G ZB@O { Y \ ] G > X > > ` ~ G ZBIMBOO ` @M | G > J V ^ G > KLZB Q ` ` >> > ^ > > ^ ~ G Z M@ QQ + % O | | > ^ G I > \ ~ G \ ~ G G > J V ` ] G Z MM QO ~ G ] I X ~ Y G G > ~ > ^ > Z G G > G ` ] G ZQM@O Y ` X ~ G ] Q G ^ G > ^ ^ [X > G > G G G ` ] G Z M= QQ > ^ ^ G > ^ ~ G Z Q@B @= > ^ > > > ] > YY ` G J V X Y X [ > { > ~ G ZI I M ] ~ Y Y ? ^ G G G Z Y^ ` ] G KZB@@OI Y ? @@Q | > J J VV > > G ^ > JX V > ? G ZI MI I ` ? Y ` Q ` G [ > [ G > J$ V { ` ] G M@=Q @ 50 ` ] > X ~ [ > ^ > G G J" X V ` G ] Z O =B ` \ Q X G > ` O Z G ` \ ` Q ` Z > O Z G ` Y ~ Y > > ^ > ~ { > ~ G JBVZ Q Q= ` ] ] ? I G > JG G G V Z ^ ` G ' ? ~ G Z MB @ ` ~ > G G ^ G J# V ` ] G KZ O BM ` { ? ` @@ ! % Z=O =OI ` > | @@@ > | Y ~ J V G I@[ =M Z | ? G Z | BQO G G > ` { @OB J V Y J G > J V \ Y V | | G G Z = O J V ` ` @MB ` [ >> Z G G BZ IO = ` > X X Y | ^ | ] ` ` ` | Y \ > @ ? > > ^ ~ G ZB QBB ` ~ Y ~ Y ` { Y Q | G IX G G Z=B =M ` @QM ` ] X ^ X | Y { @@@ G G G G ] J V > G > G G ` ] G Z BQM I I 51 Y Y G Y # Z G G Y !=O $ Z I I = @=O _ J V J > J V ^ G V ~ ? } J VZ I Q J X V @ Y X > Y { > G KZIQBI@O Q ` | Z G ` G G ` ~ G ] Z OB O= [Y Y ] [ { X > Q Y ^ > G ^ KZOOOO=M ] Q G ^ ^ ` ] G Z QO @B ` { X [ ~ ` @ [ > > ^ > G ` Z G ^ G ` G ] G Z OO =I G ? ? G @@ G ^ ^ > ^ G >> ` ~ G ] KZOO O=@ ^ I >> > J V ^ > ^ \ X ? ` I O > \ ? ^ ^ ` G X ` Y \ ^ { X Q ^ > > G > ^> G G > > ] \ ? G X Z^^^ G [> { { X Y [ ~ ` G B Y ~ > KZ I@= I@M Y ` X X { [` = ? G ^ ^ J# V G ~ G X Z MQ Q@ 52 Y | @@@ > [ J| Y V X G =Q QM Z | ? G Z | BQO G G > Y ` Y = > > > G [ G Z > G G G { > ? Z= @=II Y Y ] >> @@@ ] > G > > ^ >> ^ G Z Z M@ Q@ Y { ~ Y ` { Y ? ` @ | X > G > ~ Z G > G G G > Y > Y ~Z ~ G Y ZI QMI @ Y >> \ @@O | J V G > > ? G Z = Q Y ^ X ? ` | B X G | ] G ] Z@I Y ` I ; ; ! ] ? G Y \ > Y ~ > ~ > Y { X { X ? ^ Y ` Y ] Y G Y GG M | G G Z G > [ > ] G ^ ! / ` ] G Z M=Q MQ { Y ` Q X Z > > > G > > J V ` ] G Z MM @ { ~ { > ? ~ I | [ > ^ > G G > > ^ G ` G ] Z O B@ { QQI J > V Y J QQIV ^ @BQ G J X V 53 | G \ { X @@Q X G G G ] ` ] G IOBI=I | @Q@ Y > G ZOQOO@O | ] ~ I ] Z > > > # ! G B =B ? Y Y ] Y > > | X X Y G @@ > ^ > > G X G Z= @=BQ | ` @ | > ^ X G X G | > G X X | { X | G G > ] > J# V ` ] G Z B@ OO | G X Y ~ ` G > ` > ^ JG Z X V > > Z G G ` G ] Z =O M@ | Y Y Q ~ [] ] > > X ] \ Z IB M | | ` { ` ` ~ = > >> G > Y > Y ~Z ~ G Y ZB =OB MB @@O > J V G OQ[= Z | > G G Z X X Q@I G G > ? { X O G ^ > ? > ^ G J" V ` ] G Z IIO IOM \ ? G @@@ > ^ X G B M | ? G | G G > 54 \ G { \ ` ` Y ? I | > G X Z > G B Y Y ^ \ ~ G X > | | J V \ Y B I G \ @QQ > | @I G G > \ { { ? O G G > ` ~ G ] Z @MB M \ Y \ B > > \ G Y ] ] Y ~ ` > \ G Y 55 Appendix A: Origin of tench specimens with haplotype codes and frequencies. !! "# $ % &'()) *(++ ,%--. ,-/. ,-/. & /''& # " -+ -0 /-. +& 1 !2 3 $ 4 ! 5 */(6* /*('' ,4-& ,--' ,--' ,-/ & /''& ! " 2 " $ " 5 */('/ /+('6 ,%-- ,-/ ,--. - /''& % " ,/- 7! 2 $ " 4 *+('& -)(0' -- ,--. +-. - /''& 8! 8 % " 9 -- *- " 2 $ 2 9 4 *+('0 -)(6: ,%-+ ,-/. /+. + /''& % " -* +-. */ " <# 3 *&(-/ )+(/: -+ ,--. ,--. + /''& ; <2 9 -& /*. <2$% +- 1 =# <# $ # =# *)(+' 0(:/ ,%--. ,-/. ,--. & /''& " -* -0 /:. +- 8 $ % *&(60 0(6) -/ ,-/. //. * /'': " -: +-. &- 1 3 $ >2 = *6(:- -)(/& ,-/ - -0:+ ! " 7!?@ , $ # 8A2! = &'(** -*(&0 ,%--. ,--. --. / /''+ " -- -+ /- B#; 1 $ 5 3 &+(': -*(-+ -- ,-/. -+. -/ & -66) " B#; -: /- 2 $ 3 &+('6 0(/- -+. -0 ,--. -/ * /''* # " &- -+. /* <# $ # <# 3 *6(6/ 0(+/ +* ,-+. ,-*. * /''& " -& //. +/ 8C "#; $ D 3 &*(-+ -'(*) ,%--. / /'') " -- 3C 1 $ 7 3 &/(60 -+(&) ,%-/. ,--. +: & -66: " 3C -/ -) 5 5 $ 5E , +6(** &(+- ,%-- ,-/ ,-/ - /'': % 1 DF 2 $ , EF ,"G &0(0+ /)('' ,%-& ,-:. ,--' & /''& " -* 8 <#H $ % B *:('' &(/) -/ ,--. --. / /''& > -+ +- " <#H $ <#H B *&()0 &(0- -/ -* -* -/ / /''& > " 5I <# $ # 5I B *0(') :(0) -/ -* ,--. / /''& " ++ 1 $ # % 5 &*('& -('- ,%+-. ,-+. ,-+. / /''& " -- -- -- " 1 $ # % 5 &+(0: -('6 ,%-/ ,-+. ,-/. / /''& " -- /-. *- 56 8 $ % % 2 4 *&(/0 6(*0 -+ ,-/. -/. + /''& " < -* /-. +/. *- 5#J " %J 4< +)(*) *6(++ ,-+. ,--' ,-+. ,-/ & /''& ,/-. ,+- ,+- " G J 7 J# 7= &'(&6 )'(/6 ,%-+ ,-: ,-: ,-/ + /''& 7 J# ! $ = +)(0' -)&(/0 ,%--. ,-0 ,-*. ,-/ * /''+ G " ! 9 -/ +/ /''& GE $ % GE 8 +6()+ )(*6 ,%-- - /'') 1 "K 8 $ "E 8 &*('0 /-(': ,%:-. ,--. ,-/. -/ & /'': " ; " ,%)- ,/-. -/. .-+ -0 /-. +& 7; D $ ; 8 &+(-/ //(0' ,%-/ ,--. ,-+. / /''& " -+ -- G 3 $ 3 <1 *&('' /6('' ,%-+. ,-0 ,-0 * /''* ! " ,%*- % !# D $ D 57 "2 3 $ "2 ! E L% *6(+0 +)('/ ,%-* ,-0 ,-0 * /'': %J2 " 3 5 8 3 $ 3 L% *:(+- +/(+- ,%-* ,-0 ,-0 ,-* * /'': ! " "!2 3 $ %J2 7 E L% *6(&- +)(:6 ,%-/ ,-* ,-* ,-/ / /'': " 1 ! > ! "2 ! 9 L"% *)(&* --)(:& ,%-& ,--' ,--' ,-/ & /''& <2 $ 8 1 822 > $ B # 5 */(-& /*()/ ,%-/ / /'') % " D 5 $ B # , +0(06 :(00 ,%-& ,--' ,--' ,-/ & /'': 5 % 1 > <#H $ B # B *&(6' *(6/ -/ -* --. / /''& > /-. " +/ [ <#H $ B # B *:('/ *(66 --. ,-/. +/ / /''& > /- -/ " 8 G $ G 4 *+(-& -/(-' -/ -* +* -/ / /''& G # ! " >. 8 $ % 5 ! 4 *&(&& -'()' -+ ,--. -/. + /''& " -*. //. " /- +/ D $ B # 8 &/('& /-('+ --. ,-+. ,--. -/ / /''& " &- -- ++ # J <2 B # 8< +'(&: --*(+) ,%-+. ,-0 ,-/ ,-/ * /''* $ , # ,%/- " Q R S 8 $ % B # 4 **(0' )(0/ -/ ,--. -+. / /''& % " -+ +- R S !R. ; , $ # B # = *6('& -*(*+ ,%-/. ,--. ,--. + /''* ! " -- -& -/. ++ !R. , $ # B # = *6('& -*(*+ ,%-+ ,-/. //. + /''* ! " -* +* >R !I , $ # B # = *6(6) -/()' ,%-+ ,-+. ,-*. + /''& RJ " -+ +/ GR , $ # B # = *6(*& -*(+: ,%-/. ,-/. ,-/. * /''* >2 !. " -/ -* +/ ; ! GR. , $ # B # = *6(*' -*(:6 ,%-+ ,-/. ,-/. + /''* ! " -* --. ++ D!I , $ # B # = *6(+& -:('/ ,%--. ,-/. ,-/. + /''* >J?@U@ " --. -* -* *- D , $ # B # = *6(-& -*(-0 ,%-+ ,-*. ,-&. + /''* " -/ /- 7C ;# , $ # B # 3 &-(+- -*(++ ,%--. ,--. ,--. & /''* 5 " -- -6 -&. // 58 < 3 $ B # <1 ,%-- ,-&. ,-/. * /''* ! " . -+ -+ --. ++ 3 $ B # ,%-& ,-/. ,--. & /''* ! " -0 ++ # 6/ B # = /+ ,--. ,-: + /''* -& " # B # = ,%-+ ,-+. ,-/. + /''* -+ //. +/ 5 B # = ,%-+ -: ,-*. + /''* +-. *- 5 B # = ,%-/ ,-/. ,--. / /''* -/ -+ B # = ,%-/ ,--. ,--. / /''* -+ --. +/ % B # = ,%-/ ,--. ,--. / /''* -+ -/. +- B # # # 2 !. # # . ;# # [ # 2( † G# ; . 5. 4. 3. ";J . J# < =. 5 3. " ,. , ,"G. B B. 5 5 . . 4 4. 4 4<. 7J!# 7=. ; = =. 8 8. 8 8. # 8<. < <1. < 59 H U I J J] ^ Y] V J Z MOO[ @@Q @ I V 60 Molecular Ecology Resources (2010) doi: 10.1111/j.1755-0998.2010.02914.x MOLECULAR DIAGNOSTICS AND DNA TAXONOMY PCR-RFLP assays to distinguish the Western and Eastern phylogroups in wild and cultured tench Tinca tinca Z. LAJBNER*† and P. KOTLI´K* *Laboratory of Fish Genetics, Department of Vertebrate Evolutionary Biology and Genetics, Institute of Animal Physiology and Genetics, Academy of Sciences of the Czech Republic, Rumburska´ 89, 277 21 Libeˇchov, Czech Republic, †Department of Zoology, Faculty of Science, Charles University, 128 44 Prague, Czech Republic Abstract The tench Tinca tinca is a valued table fish native to Europe and Asia, but which is now widely distributed in many temperate freshwater regions of the world as the result of human-mediated translocations. Fish are currently being trans- planted between watersheds without concern for genetic similarity to wild populations or local adaptation, and efficient phylogeographic markers are therefore urgently needed to rapidly distinguish genetically distinct geographical popula- tions and to assess their contribution to the hatchery breeds and to the stocked wild populations. Here, we present a new method to distinguish recently discovered and morphologically undistinguishable Western and Eastern phylogroups of the tench. The method relies on PCR-RFLP assays of two independent nuclear-encoded exon-primed intron-crossing (EPIC) markers and of one mitochondrial DNA (mDNA) marker and allows the rapid identification of the Western and Eastern phylogroup and also of three geographical mtDNA clades within the Eastern phylogroup. Our method will enable researchers and fishery practitioners to rapidly distinguish genetically divergent geographical populations of the tench and will be useful for monitoring the introduction and human-mediated spread of the phylogroups in wild populations, for characterization of cultured strains and in breeding experiments. Keywords: EPIC, exon-primed intron-crossing marker, mtDNA, stocking Received 14 July 2010; revision received 6 August 2010; accepted 7 August 2010 The tench Tinca tinca is a valued table fish, native to Recently, phylogeographic analysis of DNA Europe and Asia between the British Isles and central sequences of several exon-primed intron-crossing (EPIC) Siberia (Brylin´ska et al. 1999), but it is now widely distrib- markers and of a mitochondrial DNA (mtDNA) gene dis- uted in many temperate freshwater regions of the world covered within the Eurasian range of the tench two geo- as the result of human-mediated translocations (Welcom- graphical clades, a Western phylogroup (clade W) found me 1988). Up until recently, there has been only limited in Europe from the British Isles to Poland and an Eastern information about population structure of the tench phylogroup (clade E) distributed from Europe through- throughout its vast native range (Kohlmann et al. 2010), out Asia to China (Z. Lajbner, O. Linhart and P. Kotlı´k, resulting in the absence of efficient phylogeographic unpublished manuscript). Within the Eastern phylo- markers to monitor the genetic and geographical origin group, populations with mtDNA (but not nuclear mark- of hatchery stocks, such that fish are being transplanted ers) distinct from the major Eastern clade (EA) were from one watershed to another without concern for found in a southern tributary of the Danube River in genetic similarity to neighbouring wild populations or Bulgaria (clade EI) and in the southern part of the Caspian adaptation to local environment. Therefore, for successful Sea basin in Iran (clade EC). Separation into the phylo- fishery management and sustainable exploitation of groups most reasonably reflects long-term evolutionary tench, it is extremely important to develop easy markers isolation of populations in different parts of the native that would enable researchers and fishery practitioners range, but we have shown that tench of both phylo- to rapidly distinguish genetically distinct geographical groups can freely interbreed with one another when in populations and to assess their contribution to the hatch- contact in wild populations (Lajbner et al. 2010). The ery breeds and to the stocked wild populations. presence of both phylogroups in cultured breeds of dif- ferent geographical origins and the occurrence of EA Correspondence: Zdeneˇk Lajbner, Fax: (420) 315 639 510; haplotypes at the western edge of the native range (e.g. E-mail: [email protected] in Spain and Britain) showed that extensive admixture 2010 Blackwell Publishing Ltd 61 2 MOLECULAR DIAGNOSTICS AND DNA TAXONOMY has occurred both in wild populations and in hatcheries, stabilizers, additives; Top-Bio, Prague, Czech Republic), largely as a consequence of fishery practices that ignore 10 pmol of each primer, 0.2 lg of template DNA and the genetic structure among and within populations. demineralized water to the final volume. To facilitate To facilitate the assessment of admixture among wild high-throughput analysis, the amplification in a PTC 200 and cultured tench, we have developed a rapid and effi- Peltier thermal cycler (MJ Research, Watertown, MA, cient method that distinguishes between the nuclear USA) was performed using the same PCR program for and mtDNA genomes of the phylogroups. The method all markers, which contained 5 min of initial denatur- further enables distinguishing between the three ation at 95 C, six cycles of a touch-down profile of 1-min mtDNA clades (EA, EI and EC) in the Eastern phylo- denaturation at 94 C, 1 min 30 s at 60–56 C with the group. The method relies on polymerase chain reaction annealing temperature lowered by 2 C after every two (PCR) restriction fragment length polymorphism (RFLP) cycles and 2-min elongation at 72 C, followed by 30 assays of two independent nuclear-encoded EPIC mark- cycles with the annealing temperature held at 54 C. For ers, the second intron of the actin gene (Act) and the the RFLP analyses, 4 lL of the PCR products were first intron of the gene coding for the S7 ribosomal pro- digested for 10 h at 37 Cin10lL reaction volumes con- tein (RpS7), and of one mtDNA marker, the cytochrome taining 4 lL of demineralized water and 1 lL of endonu- b gene (Cytb). Examination of DNA sequences of all clease buffer with 1 lL of the endonuclease Eco52I, AluI, known haplotypes for each of these three markers found MboI (Fermentas, Vilnius, Lithuania) or NdeI (New in a survey of 225 tench from a wide range of geograph- England Biolabs, Ipswich, MA, USA) and then ical regions (GenBank accession nos HM167935– deactivated at 65 C for 20 min. Restriction fragments HM167938, HM167941–HM167965) indicated that the were separated on 2% agarose gels containing 2 lLof Western and Eastern phylogroup could be reliably dis- GoldView (SBS Genetech, Shanghai, China). tinguished by cleavage of Act by Eco52I restriction endo- Digesting the amplicons of individuals carrying all nuclease, of RpS7 by NdeI endonuclease and of Cytb by known haplotypes for each of the three genes, including AluI and MboI endonucleases. In addition, cleavage of heterozygotes for each nuclear gene, yielded the pre- Cytb using AluI distinguishes the EI clade and cleavage dicted RFLP profiles (Fig. 1). The restriction digestion of with MboI the EC clade. the 1226-bp amplicon of Cytb by MboI at four cleavage To validate the new assays, tench genomic DNA was sites (345, 642, 876, 946 bp) resulted in five fragments (70, extracted from ethanol-preserved muscle tissue or fin 234, 280, 297, 345 bp) in the Eastern phylogroup, except clips using DNeasy Tissue Kit (Qiagen, Valencia, CA, in clade EC, which does not have the 642-bp and 946-bp USA). A 335-bp amplicon containing the Act intron was sites but has a 132-bp site and had a four-band pattern PCR-amplified with the EPIC primers described by (132, 213, 350, 531 bp). The Western phylogroup also has Atarhouch et al. (2003), and a 923–927-bp amplicon (928 the 132-bp site but does not have the 946-bp site and had total bp of the alignment) containing the RpS7 intron with a unique five-band pattern (132, 213, 234, 297, 350 bp). the EPIC primers published by Chow & Hazama (1998). The digestion of Cytb by AluI at three cleavage sites (184, A 1226-bp part of the mitochondrial DNA containing the 891, 1168 bp) resulted in four fragments (58, 184, 277, entire Cytb was amplified with the primers located in 707 bp) in the Eastern phylogroup, except in the EI clade, flanking tRNAs as described by Machordom & Doadrio which does not have the 1168-bp site and had a three- (2001). Primer names and sequences are listed in Table 1. band pattern (184, 335, 707 bp). The Western phylogroup The 25 lL PCRs contained 0.5· concentration of PPP does not have the 891-bp site and had a different three- Master Mix (2· stock solution: 150 mM Tris-HCl [pH 8.8], band pattern (58, 184, 984 bp), except in one of the haplo- l 40 mM (NH4)2SO4, 0.02% Tween 20, 5 mM MgCl2, 400 M types (W2), which only has the 1168-bp site and had a of each dNTP, 100 U ⁄ mL Taq-Purple DNA polymerase, two-band pattern (58, 1168 bp). Table 1 Primers and their sequences Marker (amplicon size) Primer Sequence (5¢ to 3¢) Reference Cytb (1226 bp) GluF AACCACCGTTGTATTCAACTACAA Machordom & Doadrio (2001) ThrR ACCTCCGATCTTCGGATTACAAGACCG Machordom & Doadrio (2001) RpS7 (923–927 bp)* S7RPEX1F TGGCCTCTTCCTTGGCCGTC Chow & Hazama (1998) S7RPEX2R AACTCGTCTGGCTTTTCGCC Chow & Hazama (1998) Act (335 bp) Act-2-F GCATAACCCTCGTAGATGGGCAC Atarhouch et al. (2003) Act-2-R ATCTGGCACCACACCTTCTACAA Atarhouch et al. (2003) *Length variation because of gaps. 2010 Blackwell Publishing Ltd 62 MOLECULAR DIAGNOSTICS AND DNA TAXONOMY 3 (a) Cytb (MboI) Cytb (AluI) (b) RpS7 (NdeI) (c) Act (Eco52I) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 1000 500 500 100 100 bp bp Fig. 1 Agarose gels showing diagnostic restriction fragment patterns. (a) Cytb assays. Lanes 1, 5 and 10: 100-bp ladder molecular weight standard (500- and 1000-bp bands highlighted); lane 2: Western phylogroup digested with MboI; lane 3: EC clade digested with MboI; lane 4: other Eastern clades digested with MboI; lane 6: W2 haplotype digested with AluI; lane 7: other Western haplotypes digested with AluI; lane 8: EI clade digested with AluI; lane 9: other Eastern clades digested with AluI. (b) RpS7 assay with NdeI. Lanes 11 and 15: 100-bp ladder; lane 12: Western phylogroup; lane 13: Western ⁄ Eastern heterozygote; lane 14: Eastern phylogroup. (c) Act assay with Eco52I. Lanes 16, 20 and 24: 100-bp ladder (500-bp band highlighted; note different version of ladder than in panels a and b); lanes 17–19: native PCR product; lane 17: Western phylogroup; lane 18: Western ⁄ Eastern heterozygote; lane 19: Eastern phylogroup; lanes 21–23: target amplicon (335-bp) purified by gel-extraction prior to endonuclease treatment; lane 21: Western phylogroup; lane 22: Western ⁄ Eastern heterozygote; lane 23: Eastern phylogroup. Note that fragments with size under 100 bp are difficult to visualize but this does not affect scoring. The digestion of the 923–927-bp amplicon of RpS7 All individuals with previously sequenced amplicons (size range is because of gaps) by NdeI yielded a two- (Cytb: n = 17; RpS7: n = 11; Act: n = 11) were correctly band pattern for the Eastern phylogroup and a three- genotyped by the new method, which demonstrates its band pattern for the Western phylogroup (Fig. 1b). There accuracy. An additional 71 tench, originated from two is a cleavage site at 110 bp common to both phylogroups lakes in Germany where the Western and Eastern phylo- that produced a small fragment (110 bp) in both phylo- group (EA clade) coexist (Lajbner et al. 2010), were groups and a second, large fragment (813–817-bp) in the screened by these assays (only 35 fish for Cytb) to verify Eastern phylogroup. An additional cleavage site at the efficiency of the protocol. All specimens were unam- 478 bp that is absent in the Eastern phylogroup produced biguously genotyped as either the Western phylogroup two fragments of an intermediate size (368, 446–448 bp) (Cytb: n = 32; RpS7: n = 55; Act: n = 42) or Eastern phylo- in the Western phylogroup. group (Cytb: n =3;RpS7: n =4;Act: n = 1) or heterozyg- The digestion of the 335-bp amplicon of Act by Eco52I otes (RpS7: n = 12; Act: n = 28). Thus, the new RFLP at a single cleavage site (182 bp), which is absent in the assays are a robust and rapid method to distinguish the Eastern phylogroup, resulted in two fragments (153, Western and Eastern phylogroup and also the three 182 bp) in the Western phylogroup (Fig. 1c). mtDNA clades in the Eastern phylogroup of the tench. The amplification of Act under the above-mentioned The assays will be useful for monitoring the human-med- conditions produced a second major amplicon of a lar- iated dispersal of the phylogroups among wild popula- ger molecular size (approximately 580 bp) than our tions currently occurring via aquaculture, for marker, plus a minor amplicon (approximately 430 bp). characterization and identification of cultured strains, The genome of teleost fishes contains multiple paralo- and in breeding experiments. gous actin genes (Venkatesh et al. 1996), and these addi- tional amplicons thus were most probably derived from Acknowledgements paralogous annealing of the EPIC primers. The extra amplicons were not cleaved with Eco52I, so that for reli- The authors thank Silvia Markova´ for laboratory assistance and able genotyping of our EPIC marker, they did not need for advice. The work was supported by the Ministry of Educa- tion, Youth and Sports of the Czech Republic (LC06073) and by to be removed (see Fig. 1c). Occasionally, the amplifica- the Academy of Sciences of the Czech Republic (IRP IAPG tion of RpS7 also yielded up to three minor amplicons AV0Z50450515 and IGA UZFG ⁄ 05 ⁄ 22). of different molecular sizes in addition to the expected amplicon, some of which were present in multiple indi- viduals (most notably amplicons of approximately 580 References and 1600 bp), but these minor amplicons were not Atarhouch T, Rami M, Cattaneo-Berrebi G et al. (2003) Primers for EPIC cleaved by NdeI and did not interfere with the genotyp- amplification of intron sequences for fish and other vertebrate popula- ing. tion genetic studies. BioTechniques, 35(4), 676–682. 2010 Blackwell Publishing Ltd 63 4 MOLECULAR DIAGNOSTICS AND DNA TAXONOMY Brylin´ska M, Brylin´ski E, Bnin´ska M (1999) Tinca tinca (Linnaeus, 1758). Reviews in Fish Biology and Fisheries, 20, 289–300. doi:10.1007/s11160- In: The Freshwater Fishes of Europe, 5 ⁄ I: Cyprinidae 2 ⁄ I (ed. Ba˘na˘rescu 009-9137-y PM), pp. 229–302. AULA-Verlag, Wiesbaden. Machordom A, Doadrio I (2001) Evidence of a Cenozoic Betic-Kabilian Chow S, Hazama K (1998) Universal PCR primers for S7 ribosomal connection based on freshwater fish phylogeography (Luciobarbus, protein gene introns in fish. Molecular Ecology, 7(9), 1255–1256. Cyprinidae). Molecular Phylogenetics and Evolution, 18(2), 252–263. Kohlmann K, Kersten P, Panicz P, Memis¸D, Flajsˇhans M (2010) Genetic Venkatesh B, Tay BH, Elgar G, Brenner S (1996) Isolation, characterization variability and differentiation of wild and cultured tench populations and evolution of nine pufferfish (Fugu rubripes) actin genes. Journal of inferred from microsatellite loci. Reviews in Fish Biology and Fisheries, 20, Molecular Biology, 259(4), 655–665. 279–288. doi:10.1007/s11160-009-9138-x Welcomme RL (1988) International introductions of inland aquatic species. Lajbner Z, Kohlmann K, Linhart O, Kotlı´k P (2010) Lack of reproductive FAO Fisheries, Technical Paper No. 294, , Food and Agriculture Orga- isolation between the Western and Eastern phylogroups of the tench. nization of the United Nations, Rome, Italy. 2010 Blackwell Publishing Ltd 64 J U I J V ! Q@[B J Z M = [ @[@ BM[ V 65 Rev Fish Biol Fisheries (2010) 20:289–300 DOI 10.1007/s11160-009-9137-y RESEARCH PAPER Lack of reproductive isolation between the Western and Eastern phylogroups of the tench Zdeneˇk Lajbner • Klaus Kohlmann • Otomar Linhart • Petr Kotlı´k Received: 2 November 2008 / Accepted: 21 September 2009 / Published online: 14 November 2009 Springer Science+Business Media B.V. 2009 Abstract The Eurasian range of the tench distribu- lakes within the contact zone in Germany. The test is tion is subdivided into deeply divergent Western and based on the expectation that in the presence of Eastern phylogroups evidenced by nuclear and mito- strong barriers to reproduction, a hybrid population chondrial DNA sequence markers. A broad zone of will show genome-wide associations among alleles overlap exists in central and western Europe, sug- and genotypes from each phylogroup even after gesting post-glacial contact with limited hybridisa- hundreds of generations of interbreeding. In contrast tion. We conducted a population genetic test of this to this expectation, no consistent significant devia- indication that the two phylogroups may represent tions from linkage and Hardy–Weinberg equilibria distinct species. We analysed variation at introns of were found. Samples from both lakes did show nuclear genes, microsatellites, allozymes and mito- significant disequilibria but they were limited to chondrial DNA in populations from two postglacial individual loci and were not concordant between populations, and were not robust to the method used. The single consistent association can be attributed to Z. Lajbner (&) P. Kotlı´k Department of Vertebrate Evolutionary Biology physical linkage between two microsatellite loci. and Genetics, Institute of Animal Physiology Thus, results of our study support the hypothesis of and Genetics, Academy of Sciences of the Czech free interbreeding between the two phylogroups of Republic, Rumburska´ 89, 277 21 Libeˇchov, tench. Therefore, although the phylogroups may be Czech Republic e-mail: [email protected] considered as separate phylogenetic species, the present data suggest that they are a single species Z. Lajbner under the biological species concept. Department of Zoology, Faculty of Science, Charles University, 128 44, Prague, Czech Republic Keywords Allozymes Microsatellites K. Kohlmann mtDNA Disequilibrium Hybridization Department of Aquaculture and Ecophysiology, Tinca tinca Leibniz-Institute of Freshwater Ecology and Inland Fisheries, Mueggelseedamm 310, P.O. Box 850119, 12561 Berlin, Germany Introduction O. Linhart ˇ University of South Bohemia, Ceske´ Budeˇjovice, Most freshwater fish species in Eurasia show phylog- Research Institute of Fish Culture and Hydrobiology at Vodnˇany, Za´tisˇ´ı 728/II, 389 25 Vodnˇany, eographic subdivisions of their geographic ranges that Czech Republic developed in response to recurrent isolation in glacial 123 66 290 Rev Fish Biol Fisheries (2010) 20:289–300 refugia during the Pleistocene (Hewitt 2004). These The present study examines the existence of range shifts and the accompanying demographic barriers to reproduction between the Western and changes resulted in divergence between refugial Eastern phylogroups of tench in two lakes within the populations, which in some species may have pro- zone of their postglacial contact. The Grosser ceeded towards speciation (see Bernatchez and Wil- Felchowsee and Kleiner Do¨llnsee lakes are situated son 1998; Knowles 2001; Carstens and Knowles in north-eastern Germany in an area covered by the 2007). A recent phylogeographic study of the tench Scandinavian ice sheet during the Weichselian gla- Tinca tinca (L.) demonstrated that the Eurasian range ciation (Ehlers et al. 2004). The phylogeographic of this species is subdivided into deeply divergent study revealed the presence of markers characteristic Western and Eastern phylogroups (i.e. clades with of the Western as well as the Eastern phylogroup in geographically adjacent distributions), evidenced by both lakes (Lajbner et al. unpublished). The lakes phylogenetic analysis of sequence variation at introns could only be colonised by tench after the deglaci- of nuclear genes (actin, S7 ribosomal protein and ATP ation, and the populations inhabiting the lakes today synthase beta subunit) and at a mitochondrial (mt) most likely were not founded before the end of the DNA gene (cytochrome b) (Lajbner et al. 2007). Younger Dryas (Jahns 2000), about 11,500 years ago Similar to other European freshwater fish species (Muscheler et al. 2008). Nevertheless, the period (Durand et al. 1999; Nesbø et al. 1999; Kotlı´k and since then corresponds to roughly 3,000 generations Berrebi 2001), these phylogroups probably diverged of tench, and the populations founded by a mixture of after a colonization of western Europe from the Black the Western and Eastern phylogroups should not Sea basin during a Pleistocene interglacial and their show genome-wide associations among alleles and subsequent separation by cold periods, conforming to genotypes from each phylogroup if they have been the ‘chub’ paradigm pattern (Hewitt 2004). A broad freely interbreeding (Nagylaki 1976, 1977; Barton zone of overlap was formed upon the geographic and Gale 1993). If, on the contrary, the phylogroups contact between the tench phylogroups in central and show genetic incompatibilities in terms of differential western Europe following their postglacial expansion frequency or viability of homospecific versus heter- from two principal freshwater refugia, the Ponto- ospecific crosses, the populations should display Caspian refugium (Ba˘na˘rescu 1991; Kotlı´k et al. genome-wide linkage and Hardy–Weinberg disequi- 2004) and the western European refugium (e.g. libria, even after the many generations of interbreed- Durand et al. 1999; Nesbø et al. 1999; Kotlı´k and ing (e.g. Lajbner et al. 2009). To rectify this issue, Berrebi 2001). The sequence divergence between the tench sampled from these lakes were genotyped for tench phylogroups at mtDNA (1.3% for cytochrome b two introns of nuclear genes (actin and S7 ribosomal gene) approaches divergence among distinct fish protein) and for a mtDNA. These three markers are species (Hendry et al. 2000a) and it roughly corre- fully diagnostic between the two phylogroups in that sponds to a separation time for at least 750,000 years they posses alternate, DNA sequence-based classes of (see Waters et al. 2007). Allopatric speciation takes alleles (Lajbner et al. 2007), which were distin- usually a prolonged time (McCune and Lovejoy 1998) guished here by restriction fragment length polymor- but there are exceptions (Near and Benard 2004), and phism (RFLP) assay. To provide a broader genomic in sympatry mating barriers can evolve in just few coverage of markers, these data were analysed along generations (Hendry et al. 2000b). The existence of with genotypes for the same individuals at additional broad contact zone with the presence of individuals of fourteen genetic loci with unknown phylogroup apparently hybrid ancestry (i.e. heterozygous for specificity (allozyme and microsatellite), which were alternate phylogroup-specific alleles at nuclear loci scored by starch electrophoresis (allozymes for the or homozygous at a nuclear locus but with mtDNA of Felchowsee individuals) or were available from the opposite phylogroup) suggests that there is earlier studies (Kohlmann and Kersten 1998, 2006; incomplete reproductive isolation between the tench Kohlmann et al. 2007, 2009). phylogroups. On the other hand, the fact they have The principal question addressed by this study is remained effectively allopatric outside the contact whether there is evidence of two genetically distinct zone suggests the existence of mechanisms restricting reproductive units in each lake. More specifically, the introgression. results are used to determine whether the lakes show 123 67 Rev Fish Biol Fisheries (2010) 20:289–300 291 signs of a hybrid population structure (i.e. purebred Total DNA of fish from Felchowsee and Do¨llnsee Western, purebred Eastern, F1 hybrids etc.), and if was extracted from ethanol-preserved muscle tissue there are consistent (between lakes and across loci or from fin clips by using Dneasy Tissue Kit and methods) deviations from linkage and Hardy– (Qiagen). A part of nuclear DNA containing 2nd Weinberg equilibria in these lakes that could be intron of actin gene (336 bp) was amplified using attributed to the existence of barriers to merging of primers Act-2-R and Act-2-F designed by Touriya gene pools of the two founding phylogroups. et al. (2003) and another part containing 1st intron of RPS7 gene (900 total bp) using primers S7RPEX2R and S7RPEX1F (Chow and Hazama 1998). In Materials and methods addition, an approximately 1,225 bp long portion of mtDNA containing entire gene for cytochrome b was Data acquisition amplified for fish from Felchowsee using primers GluF and ThrR (Machordom and Doadrio 2001). For The study was conducted on 49 tench collected from a the sake of simplicity, the PCR program was unified wild population inhabiting Lake Grosser Felchowsee for all markers and contained 5 min of initial (160 ha; 53°30N, 14°80E). This sampling was supple- denaturation at 95°C, touch-down profile of 1 min mented by an additional 19 individuals from Lake at 94°C, two cycles at 60–56°C(2°C/cycle) for 1 min Kleiner Do¨llnsee (25 ha; 52°590N, 13°340E). Both 30 s, and 2 min at 72°C followed by 30 cycles with lakes are situated in Germany in the north-eastern part annealing temperature held at 54°C. The PCR of the Oder River drainage of the Baltic Sea basin, in reaction mix consisted of 12.5 mm3 of Top-Bio the lowland area rich in lakes and wetlands. There PPP Master Mix (Top-Bio, Prague, Czech Republic), have probably never been introductions of foreign 10 pmol of each primer, 0.2 lg of DNA and demi- tench into the lakes or supportive artificial reproduc- neralised water up to 25 mm3. For RFLP analysis, tion of the indigenous tench from the lakes (T. Lo¨we, 4mm3 of the PCR products were digested for 10 h at Lake Felchowsee owner, personal communication). 37°Cin10mm3 volumes containing 4.7 mm3 of Recently conducted large scale phylogeographic demineralised water and 1 mm3 of Y?/Tango buffer study (Lajbner et al. 2007) gives a possibility to with 0.3 mm3 of the restriction endonucleases AluI, discriminate the two evolutionary lineages of tench Eco52I or MboII (Fermentas, Vilnius, Lithuania) for on the basis of two nuclear markers and one fragments in the same order as listed above and than mitochondrial marker, which can be easily scored deactivated at 65°C for 20 min. Restriction fragments by RFLP. A restriction map was generated for each were separated on 2% agarose gel containing 2 mm3 marker using the CLC Free Workbench 4.5.1 (CLC of GoldView (SBS Genetech, Shanghai, China). bio) from haplotype sequences of T. tinca (Lajbner Samples from Felchowsee were analysed for their et al. unpublished) and endonucleases digesting the genetic variability in 11 enzymatic systems repre- markers at lineage specific positions were selected. senting 24 gene loci by horizontal starch gel electro- The phylogroup specific restriction endonuclease phoresis (Aebersold et al. 1987) (Table 1). Staining Eco52I was selected for the 2nd intron of the actin of all but two enzymes followed the standard gene and MboII for the 1st intron of the S7 ribosomal procedures of Shaw and Prasad (1970) and the protein (RPS7) gene. Both endonucleases were modified protocol of Vuorinen (1984). Creatine predicted to yield phylogroup-specific RFLP profiles kinase was visualised using general protein staining following digestion of the respective polymerase (amido black). Superoxide dismutase appeared as chain reaction (PCR) products due to restriction sites light, whitish spots on gels stained for alcohol present only in one of the phylogroups. The restric- dehydrogenase, glycerol-3-phosphate dehydrogenase tion endonuclease AluI was predicted to yield or phosphoglucomutase, respectively. Enzyme band- phylogroup-specific RFLP profiles following diges- ing patterns were read by using the tench gene tion of a PCR product of the mtDNA cytochrome b nomenclature of Sˇlechtova´ et al. (1995), which gene due to a diagnostic restriction site, which follows the rules suggested by Shaklee et al. unambiguously identified each individual to either (1990). Alleles were named according to their Eastern or Western phylogroup maternal ancestry. relative electrophoretic mobilities. 123 68 292 Rev Fish Biol Fisheries (2010) 20:289–300 Table 1 Enzymes and tissues examined, number of loci screened and buffer systems used Enzyme E.C. number Abbreviation Tissue Number of loci Buffera Aspartate aminotransferase 2.6.1.1. mAAT Muscle 2 B sAAT Muscle/liver 1 B Alcohol dehydrogenase 1.1.1.1. ADH Liver 1 C Creatine kinase 2.7.3.2. CK Muscle 1 A Glycerol-3-phosphate dehydrogenase 1.1.1.8. G3PDH Muscle/liver 2 C Glucose-6-phosphate isomerase 5.3.1.9. GPI Muscle/liver 2 A Isocitrate dehydrogenase 1.1.1.42. mIDHP Muscle 2 C sIDHP Liver 2 B Lactate dehydrogenase 1.1.1.27. LDH Muscle/liver 3 B Malate dehydrogenase 1.1.1.37. mMDH Muscle/liver 2 B sMDH Muscle/liver 2 B Phosphogluconate dehydrogenase 1.1.1.44. PGDH Liver 1 B ? C Phosphoglucomutase 5.4.2.2. PGM Muscle/liver 2 C Superoxide dismutase 1.15.1.1. SOD Liver 1 C a Buffers: A Tris–citric acid, pH 8.5 (gel) and lithium hydroxide—boric acid, pH 8.1 (tray; Ridgway et al. 1970), B Citric acid— morpholine, pH 6.5 (Clayton and Tretiak 1972, modified by Vuorinen 1984), C Tris–citric acid, pH 7.1 (Shaw and Prasad 1970) Additional raw data for the same allozyme loci for tables (with the same allelic counts) with the same or fish from Do¨llnsee and 6 microsatellite loci for fish lower probability. Two variants of the more powerful from both lakes were taken from studies of Kohlmann score test (U test) were run, which assumed, respec- and Kersten (1998, 2006) and Kohlmann et al. (2007, tively, heterozygote excess or heterozygote defi- 2009). Microsatellite locus MTT8 was inferred to ciency as the alternative hypothesis to panmixia contain a null allele (Kohlmann et al. 2009) and was (Rousset and Raymond 1995). The Markov chain therefore discarded from most analyses. Allelic algorithm to estimate without bias the exact P-value frequencies of MTT6 and MTT2 were compared of this test (Guo and Thompson 1992) was conducted with raw data of Kohlmann et al. (2009) from Las by 1,000 batches of 20,000 iterations following Vegas del Guadiana fish farm in Spain (Bada), 20,000 dememorization steps. Wuhan in China (Chin) and Lake Sapanca in Turkey Wright’s F-statistics was used as another means of (Turk) that appeared to contain only Eastern phylo- quantifying the conformity of genotype frequencies to group alleles (Lajbner et al. unpublished). Hardy–Weinberg proportions and to test the existence of geographical subdivision of populations. Two Data analyses parameters were estimated for the polymorphic loci according to Weir and Cockerham (1984) with the For each population, variation at polymorphic loci Genetix software package, v.4.05 (Belkhir et al. was summarized as Nei’s unbiased expected hetero- 2004). The inbreeding coefficient FIS was estimated zygosity or gene diversity (Nei 1987). by the estimator f, and the fixation index FST by the Three types of exact test of Hardy–Weinberg estimator h (Weir and Cockerham 1984). The signif- equilibrium were conducted for each population by icance of the multilocus estimates was assessed by a using Genepop 4.0 (Rousset 2008), which all assume permutation test using a 20,000 randomised data set the same null hypothesis (random union of gametes) generated by permuting the alleles among individuals but differ in the construction of the rejection zone. In for FIS and the individuals among the samples for FST the exact probability test (e.g. Haldane 1954; Weir (Dallas et al. 1995; Balloux and Lugon-Moulin 2002). 1996), the probability of the observed sample is used Exact multilocus tests for association between to define the rejection zone, and the P-value of the alleles were also computed using software MLD test corresponds to the sum of the probabilities of all (Zaykin et al. 1995) allowing haplo-diploid data 123 69 Rev Fish Biol Fisheries (2010) 20:289–300 293 combination. In this test, the proportion of 20,000 crossing between the parental species were allowed permuted multilocus genotypic arrays as probable or (pure Western phylogroup, pure Eastern phylogroup, less probable than the sample forms an estimate of the F1 hybrid, F2 hybrid, BC1 to Western phylogroup, significance level. Pairwise genotypic and allelic BC1 to Eastern phylogroup and their crosses). Three linkage disequilibria were calculated by Black and separate NewHybrids analyses were run, the first for Krafsur (1985) method of Linkdos (Garnier-Ge´re´ and the Felchowsee and Do¨llnsee together, the second for Dillmann 1992) implemented in Genetix 4.05 (Belk- the Felchowsee alone, and the third for the Do¨llnsee hir et al. 2004), and using Cockerham and Weir’s alone. For all analyses the Markov chain was run with (1977) coefficient of gametic disequilibrium for each a burn-in period of 100,000 iterations and 1,000,000 pair of loci (Dij) and Weir’s (1979) correlation iterations following the burn-in, and assuming unin- coefficient between alleles at two loci (Rij). The formative Jeffreys-type priors on the parameters. significance of the genotypic linkage disequilibria was Each analysis was run several times to assess calculated using 10,000 permutations of genotypes convergence. The analysis was considered to have among individuals within each population while converged upon a stationary distribution if the significance of allelic associations were estimated by independent runs generated similar results. the chi-square test (Weir 1979). Pairwise genotypic We determined the number of subpopulations of associations among all loci (nuclear-encoded and tench within each lake using a statistical procedure mitochondrial) were also calculated by Linkdos (Pritchard et al. 2000) that attempts to minimize (Garnier-Ge´re´ and Dillmann 1992) as implemented disequilibrium (Hardy–Weinberg and linkage) within in Genepop 4.0 (Rousset 2008). Contingency tables groupings. The number of subpopulations (K) with the were created for all pairs of loci for each lake and a G highest posterior probability was estimated by using test was computed for each table using the Markov the program Structure 2.2 (Pritchard et al. 2000; chain algorithm of Raymond and Rousset (1995). Falush et al. 2003, 2007). The admixture model and Bayesian method and the program NewHybrids the option of correlated allele frequencies between v.1.1 (Anderson and Thompson 2002) were used for populations (also called the F-model) were selected quantifying the level of certainty that each individual because it is considered the superior model for belongs to each of pre-specified genotype classes. detecting structure even among closely related pop- The method does not require that allele frequencies of ulations (Falush et al. 2003). Markov Chain Monte each of the species are known and the loci used do Carlo runs consisted of 100,000 burn-in iterations not necessarily need to be diagnostic. Rather, it uses a followed by 1,000,000 iterations. We explored K in Markov chain Monte Carlo simulation to integrate the range from one to nine and performed 10 runs for over possible values of the model parameters (i.e. the each K value in each lake separately. proportion of individuals from the different genotype classes and the allele frequencies of each species), and estimates the posterior probability that an indi- Results vidual belongs to each genotype class (Anderson and Thompson 2002). The inheritance model imple- Hardy–Weinberg and linkage equilibrium mented assumes that a sample has been drawn from a mixed population of two species with unknown Tench populations from Felchowsee and Do¨llnsee were proportions of individuals from the different hybrid moderately but significantly differentiated (FST = classes. Although it is generally possible to consider 0.012, P \ 0.05). Samples from each lake were there- as many hybrid classes as needed, the finite number fore treated separately in the analyses. of available loci is not sufficient to reliably distin- Heterozygote deficiencies measured by the guish between these numerous categories, and it is inbreeding coefficient and by the exact tests of thus more appropriate to concentrate on the early Hardy–Weinberg equilibrium (probability and scores generation hybrid classes (Boecklen and Howard test) revealed a significant deviation of genotype 1997; Epifanio and Philipp 1997; Rieseberg and frequencies from Hardy–Weinberg proportions in Linder 1999). Therefore, only those genotype classes both lakes. However, the loci that showed deviations that could occur after up to three generations of in Felchowsee were not the same as the loci that 123 70 294 Rev Fish Biol Fisheries (2010) 20:289–300 showed significant patterns in Do¨llnsee (Table 2). lower than for K = 1, and higher values of K Multilocus heterozygote deficiencies measured by the received progressively decreasing probabilities. inbreeding coefficient revealed a significant deviation The NewHybrids analysis did not detect any from Hardy–Weinberg proportions in Felchowsee individual that could be classified as either purebred (FIS = 0.079, P \ 0.01) but not in Do¨llnsee (FIS = Western or purebred Eastern or any of the early- 0.040, P [ 0.05). The exclusion of locus MTT8 from generation hybrids. Instead, the analyses assigned all this analysis slightly reduced the values of the individuals from both lakes as advanced backcrosses inbreeding coefficient but did not reduce the levels to Western phylogroup. Genotypically, this category of significance of these findings in Felchowsee corresponds to the product of mating of the first- (FIS = 0.059, P \ 0.05) or in Do¨llnsee (FIS = generation backcrosses of a backcross-to-Western 0.032, P [ 0.05). The significant indication of mul- type among themselves. The posterior probability of tilocus heterozygote deficiency is further suported in assignment to this category was similar for individ- Felchowsee (P \ 0.001) but not in Do¨llnsee (P [ uals from Felchowsee (mean 0.884, SD 0.066) and 0.05) by the multilocus score test under the hetero- Do¨llnsee (mean 0.735, SD 0.021) and for a pooled zygote deficiency alternative hypothesis. The result sample (0.923, SD 0.039). remained significant after the exclusion of MTT8 locus in Felchowsee (P \ 0.05) and insignificant in Do¨llnsee (P [ 0.05). Discussion Multilocus test of linkage disequilibria detected significant associations in both lakes (MLD exact Despite their high evolutionary divergence (1.3% for test, P \ 0.05). However, few significant pairwise cytochrome b gene) that compares with genetic genotypic disequilibria were found (Table 3) and no distance between species (Avise et al. 1998), two significant cytonuclear disequilibria were detected. phylogroups of tench emanating from different Only the disequilibrium between microsatellite loci Pleistocene refugia form a broad contact zone in MTT2 and MTT6 was consistently significant in both Europe composed of individuals of mixed ancestry lakes, independent on the method used (Table 3). The (Lajbner et al. unpublished). The present study found associated alleles of these loci were the same in both evidence that these phylogroups are not separated by lakes (Table 4), and they were indistinguishable in strong barriers to reproduction and that they merged size from alleles fixed in three putatively pure Eastern back into a single population after colonization of the populations (Bada, Chin and Turk) analysed by same postglacial lake. Kohlmann et al. (2009). If the phylogroups evolved genetic incompatibil- ities during their refugial isolation, the current hybrid Population and hybrid structure populations should consistently display significant associations among alleles and genotypes from each Partitioning of the tench populations in two distinct phylogroup caused by lowered frequency and/or reproductive units (i.e. subpopulations) was not viability of crosses between the phylogroups (e.g. supported by the Structure analysis. Although the Caputi et al. 2007; Sta¨dler et al. 2008; Lajbner et al. prior parameters for the F model (gamma distribution 2009). If, on the contrary, they freely interbreed, with mean 0.01 and SD 0.05) were chosen to allow current populations that were postglacially founded the existence of two populations even with very by both phylogroups should not show genome-wide similar allele frequencies, in both populations the associations anymore as the result of inter-locus highest log likelihood value (Felchowsee: mean recombination over the many generations of inter- -1,168.467, SD 0.327; Do¨llnsee: mean -406.750, breeding (see Templeton 2006). SD 0.565) was found for K = 1. Log likelihood Results of the various analyses in this study values for the population consisting of two (Fel- strongly supported the hypothesis of free interbreed- chowsee: mean -1,175.483, SD 4.080; Do¨llnsee: ing between the phylogroups as opposed to strong mean -407.420, SD 0.258) or three separate repro- barriers to reproduction. The Structure analysis ductive units (Felchowsee: mean -1,190.433, SD (Pritchard et al. 2000) suggested that tench in each 9.279; Do¨llnsee: mean -408.840, SD 0.559) were lake corresponded with the highest probability to a 123 71 e ihBo ihre 21)20:289–300 (2010) Fisheries Biol Fish Rev Table 2 Variation at each polymorphic locus and conformity to Hardy–Weinberg expectations evaluated with four different tests Marker Felchowsee Do¨llnsee Sample Number of Gene FIS FIS HW HE HD Sample Number of Gene FIS FIS HW HE HD size alleles diversity (P) (P) (P) (P) size alleles diversity (P) (P) (P) (P) Actin 36 2 0.3658 -0.2963 0.0871 0.1555 0.0838 1.0000 17 2 0.4011 -0.0275 0.7109 1.0000 0.7120 0.7631 RPS7 36 2 0.3658 0.3196 0.0714 0.0724 0.9901 0.0727 17 2 0.2139 -0.1065 0.8229 1.0000 0.8212 1.0000 MTT1 47 7 0.7884 -0.1078 0.0980 0.4743 0.0914 0.9154 19 5 0.7397 0.1496 0.1975 0.0415 0.9607 0.0396 MTT2 49 2 0.3737 0.1273 0.2991 0.4415 0.8999 0.2947 19 2 0.4623 -0.2611 0.2706 0.3449 0.2683 0.9586 MTT5 49 4 0.6449 0.1149 0.1397 0.2172 0.8243 0.1739 19 4 0.6615 0.2895 0.0456 0.0890 0.9806 0.0267 MTT6 49 5 0.7084 0.1950 0.0236 0.2101 0.9887 0.0108 18 6 0.6238 -0.1632 0.2273 0.3824 0.2552 0.8516 MTT8 49 3 0.2401 0.5775 0.0001 0.0002 0.9999 0.0002 17 3 0.1693 0.3118 0.0898 0.0909 0.9690 0.0931 MTT9 49 19 0.9007 0.0488 0.1945 0.8056 0.8431 0.1111 18 9 0.8587 -0.0362 0.5197 0.5184 0.4565 0.5859 sAAT* 49 2 0.1851 0.1193 0.3969 0.3992 0.9390 0.3978 19 2 0.3087 -0.2000 0.5133 1.0000 0.5105 1.0000 ADH* 49 2 0.2897 0.0850 0.4307 0.6160 0.8669 0.4287 19 2 0.2347 -0.1250 0.7404 1.0000 0.7416 1.0000 GPI-1* 49 2 0.0978 0.3766 0.1044 0.1015 0.9984 0.1016 19 1 0 GPI-2* 48 2 0.2211 0.0581 0.5443 0.5432 0.8642 0.5449 19 2 0.3087 0.4953 0.0796 0.0762 0.9976 0.0763 mIDHP-2* 49 2 0.2619 0.1442 0.2922 0.2936 0.9365 0.2929 19 2 0.2347 0.3333 0.2618 0.2587 0.9887 0.2585 LDH-2* 49 2 0.0978 -0.0435 0.8994 1.0000 0.8982 1.0000 19 1 0 PGDH* 49 2 0.3158 0.0310 0.5692 1.0000 0.7611 0.5713 19 2 0.3087 -0.2000 0.5187 1.0000 0.5103 1.0000 SOD* 49 2 0.3518 -0.0447 0.5504 1.0000 0.5588 0.7601 19 2 0.3983 0.2117 0.3537 0.5498 0.9362 0.3492 Only eight out of 24 examined allozyme loci were polymorphic in Felchowsee and six in Do¨llnsee. Test probabilities (P) are given for the inbreeding coefficient FIS, for the exact probability test of Hardy–Weinberg proportions (HW), and for two variants of the score test assuming respectively heterozygote excess (HE) or heterozygote deficiency (HD) as the alternative hypothesis to panmixia. Probability values lower than 5% are in bold Locus symbols are italicized for allozyme loci and include an asterisk to distinguish them from abbreviations of the enzymes they code (see Shaklee et al. 1990) 123 295 72 296 123 Table 3 Linkage disequilibria in Do¨llnsee (above the diagonal) and Felchowsee (below the diagonal) expressed as average correlation coefficients between alleles (Rij) at each pair of loci Marker Actin RPS7 MTT1 MTT2 MTT5 MTT6 MTT8 MTT9 sAAT* ADH* GPI-1* GPI-2* mIDHP-2* LDH-2* PGDH* SOD* Actin – 0.0286 0.1922 0.1669 0.2772 0.3233 0.3178 0.1845 0.1480 0.3064 – 0.0639 0.4006 – 0.0617 0.4041 RPS7 0.0857 – 0.3006 0.5243 0.2820 0.3031 0.1839 0.2956 0.4931 0.3804 – 0.4711 0.0159 – 0.1057 0.2885 MTT1 0.2040 0.1240 – 0.2091 0.1614 0.2093 0.1466 0.2045 0.3242 0.2660 – 0.1900 0.2066 – 0.2714 0.2460 MTT2 0.0863 0.1308 0.1871 – 0.1410 0.4322**/** 0.0898 0.1551 0.3636 0.3514 – 0.2634 0.0754 – 0.3636 0.1674 MTT5 0.1260 0.2043 0.0927 0.1602 – 0.1732 0.2999 0.2889*/NS 0.1944 0.2250 – 0.1368 0.1617 – 0.1997 0.2304 MTT6 0.1319 0.2000 0.1452NS/* 0.3166***/*** 0.1187 – 0.1041 0.2699 0.2556 0.1894 – 0.4008*/NS 0.2053 – 0.1707 0.1783 MTT8 0.2775*/NS 0.2216NS/** 0.1703 0.0552 0.1376 0.1456 – 0.1984 0.1175 0.2196 – 0.2027 0.1574 – 0.2513 0.2589 MTT9 0.1663 0.1108 0.1139 0.1204 0.1256 0.1020 0.1070 – 0.2033 0.2796 – 0.2158 0.2781 – 0.1675 0.1638 sAAT* 0.0266 0.0194 0.1176 0.2083 0.0546 0.1422 0.1917 0.1027 – 0.0413 – 0.1002 0.1773 – 0.1005 0.2235 ADH* 0.0087 0.1460 0.1321 0.1358 0.1756 0.0670 0.1179 0.1354 0.0391 – – 0.3491 0.3035 – 0.2203 0.4407 GPI-1* 0.0162 0.1177 0.1336 0.0400 0.0528 0.0747 0.0988 0.1255 0.0026 0.1305 – – – – – – GPI-2* – – 0.1189 0.1377 0.1650 0.0931 0.0925 0.1318 0.0489 0.1790 0.1512 – 0.0241 – 0.0728NS/* 0.2073 mIDHP-2* 0.0314 0.1416 0.1350 0.1403 0.1111 0.1189 0.0482 0.1280 0.0052 0.0141 0.0496 0.1017 – – 0.0333 0.0552 LDH-2* 0.1619 0.2501 0.1828 0.2622 0.0587 0.1419 0.1188 0.0999 0.0031 0.0911 0.0965 0.1608 0.1865 – – – PGDH* 0.0149 0.1447 0.1835 0.1323 0.1610 0.0672 0.1196 0.1427 0.0100 0.1058 0.1076 0.1183 0.0555 0.1293 – 0.0536 NS/* SOD* 0.2381 0.1039 0.1137 0.0438 0.2070 0.0944 0.0115 0.1036 0.0411 0.0414 0.0754 0.1158 0.2187 0.0294 0.1627 – 20:289–300 (2010) Fisheries Biol Fish Rev Superscript asterisks denote significance with the results obtained with the permutation method (Garnier-Ge´re´ and Dillmann 1992) separated by a slash mark (/) from the results obtained with the Markov chain method (Raymond and Rousset 1995) where at least one method gave a significant result (in bold). The values for the linkage disequilibrium measures between GPI-2* and the two intron loci are missing due to missing data * P \ 0.05; ** P \ 0.01; *** P \ 0.001; NS, non-significant 73 Rev Fish Biol Fisheries (2010) 20:289–300 297 Table 4 Allelic associations between alleles at the microsat- significance of linkage disequilibria (permutations vs. ellite loci MTT2 and MTT6 expressed as correlation coeffi- Markov chain Monte Carlo approximation). Kohl- cients (Rij) mann et al. (2009) explained the heterozygote defi- Alleles Felchowsee Do¨llnsee ciency found in Felchowsee at the microsatellite locus MTT8 by the presence of a ‘null’ allele not amplified Rij PRij P with the current primers, resulting in a biased estimate 236-160 0.6672 0.0001 0.7379 0.0017 of population genotype frequencies at this locus. 236-164 – – 0.2161 0.3592 Of all pairwise comparisons, only the microsatel- 236-168 – – 0.1483 0.5293 lite loci MTT2 and MTT6 were in significant linkage 236-170 -0.1424 0.3188 -0.4323 0.0667 disequilibrium in both lakes and this pattern was not 236-172 -0.4675 0.0011 -0.5994 0.0110 dependent on the method. Because no other pair of 236-174 -0.1123 0.4319 -0.2965 0.2084 loci showed consistent disequilibria, it seems most 236-176 -0.0707 0.6208 – – reasonable to attribute the observed association 240-160 -0.6672 0.0001 -0.7379 0.0017 between MTT2 and MTT6 to strong physical linkage 240-164 ––-0.2161 0.3592 of these loci (Page and Holmes 1998). The relative 240-168 – – -0.1483 0.5293 location of the markers in the tench genome is, 240-170 0.1424 0.3188 0.4323 0.0667 however, currently unknown and this hypothesis 240-172 0.4675 0.0011 0.5994 0.0110 needs further testing. Furthermore, the comparison 240-174 0.1123 0.4319 0.2965 0.2084 with purebred Eastern populations suggest positive 240-176 0.0707 0.6208 – – association of alleles at these loci within phylogroups. Although the tench phylogroups formed a broad Significant probability values (at the 0.05 level) are in bold and alleles present in the three presumably pure Eastern contact zone during their postglacial dispersions, they populations (Bada, Chin and Turk) are in italics have remained effectively allopatric outside the contact zone. This is especially evident in the Eastern phylogroup that shows no signs of introgression with single population at equilibrium (Hardy–Weinberg genes from the Western phylogroup throughout its and linkage). The NewHybrids analysis (Anderson broad distribution between the Danube River in the and Thompson 2002) did not detect any individual west to Lake Baikal in the east (Lajbner et al. that could be classified as either purebred Western or unpublished). This is remarkable given that the purebred Eastern or any of the early-generation present study demonstrated that the phylogroups are hybrids, and it assigned all individuals from both not reproductively isolated and their gene pools have lakes as advanced backcrosses to the Western phylo- effectively merged in mixed populations. Further- group. This suggests that the data does not fit well the more, it is reasonable to expect that similar patterns NewHybrids model assuming two hybridizing popu- to that observed today were created by dispersion lations, which is consistent with the result of the from the refugia also following earlier glacial max- Structure analysis. ima because the mtDNA divergence between the The conformity of genotype frequencies to Hardy– phylogroups covers multiple glacial-interglacial Weinberg proportions could not be rejected for the cycles (Hewitt 2004). What could have caused the majority of loci by any of the methods. Although the refugial populations to retain their genetic integrity in samples from both lakes showed significant disequi- face of recurrent contacts and interbreeding? The libria at some loci, the patterns were not concordant: answer may be found in the dynamics of species the loci that showed deviations from the Hardy– response to changing climate. If, as appears to be the Weinberg or linkage equilibrium in Felchowsee were case, most species responded to glacier advances by not the same as the loci that showed a significant extinction of populations in northerly areas with only disequilibrium in Do¨llnsee. Furthermore, whether a populations in the vicinity or refugia surviving locus showed a significant deviation was dependent on (Hewitt 2004), the admixed populations outside the the statistics used to quantify the conformity of the refugia would have been extirpated at the onset of samples to the Hardy–Weinberg proportions (FIS vs. each glaciation, protecting the genetic purity of exact test) or on the method used to estimate the refugia (Hofreiter et al. 2004). 123 74 298 Rev Fish Biol Fisheries (2010) 20:289–300 The tench phylogroups can be considered separate Anderson EC, Thompson EA (2002) A model-based method species according to the phylogenetic species concept for identifying species hybrids using multilocus genetic data. Genetics 160:1217–1299 (Mishler and Theriot 2000; Wheeler and Platnick Avise JC, Walker D, Johns GC (1998) Speciation durations and 2000). Some genetic disequilibria were detected in Pleistocene effects on vertebrate phylogeography. Proc R natural hybrid populations but the pattern is not Soc Lond B 265:1707–1712 consistent between populations and across methods Balloux F, Lugon-Moulin N (2002) The estimation of popu- lation differentiation with microsatellite markers. Mol as would be expected in case of a strong reproductive Ecol 11:155–165 barrier. Thus, the present data suggest that the tench Ba˘na˘rescu PM (1991) Zoogeography of fresh waters, 2: dis- can be considered a single species under the biolog- tribution and dispersal of fresh water animals in North ical species concept (Mayr 1942, 1963). America and Eurasia. AULA-Verlag, Wiesbaden Barton NH, Gale KS (1993) Genetic analysis of hybrid zones. The fact that tench phylogroups can interbreed but In: Harrison RG (ed) Hybrid zones and the evolutionary remained distinct in the refugia has important process. Oxford University Press, Oxford, pp 13–45 practical implications. For example, populations in Belkhir K, Borsa P, Chikhi L, Raufaste N, Bonhomme F (2004) the vicinity of the refugia may show physiological Genetix 4.05, Logiciel sous Windows pour la Ge´ne´tique des Populations. Laboratoire Genome, Populations, adaptations to different selective environments that Interactions, CNRS UMR. 5171. Universite´ de Montpel- could be lost if these populations were extirpated lier II, Montpellier (e.g. by anthropogenic habitat change) or admixed by Bernatchez L, Wilson CC (1998) Comparative phylogeography stocking with individuals of the opposite phylogroup of nearctic and palearctic freshwater fishes. Mol Ecol 7:431–452 or the mixed ancestry (Allendorf et al. 2001). On the Black WC IV, Krafsur ES (1985) A FORTRAN program for other hand, since the two phylogroups readily form the calculation and analysis of two-locus linkage dis- mixed populations without detectable negative fitness equilibrium coefficients. Theor Appl Genet 70:491–496 consequences and tench are widely used for aqua- Boecklen WJ, Howard DJ (1997) Genetic analysis of hybrid zones: numbers of markers and power of resolution. culture, controlled genetic experiments can be envis- Ecology 78:2611–2616 aged to identify the genes underlying important Buerkle CA, Lexer C (2008) Admixture as the basis for genetic physiological or structural phenotypes (Nikinmaa mapping. Trends Ecol Evol 23:686–694 and Waser 2007). Furthermore, many tench popula- Caputi L, Andreakis N, Mastrototaro F, Cirino P, Vassillo M, Sordino P (2007) Cryptic speciation in a model inverte- tions in Europe are admixed, which offers a unique brate chordate. Proc Natl Acad Sci USA 104:9364–9369 opportunity to identify the genetic basis of pheno- Carstens BC, Knowles LL (2007) Shifting distributions and typic traits by the admixture mapping approach speciation: species divergence during rapid climate (Buerkle and Lexer 2008). Tench phylogroups, change. Mol Ecol 16:619–627 Chow S, Hazama K (1998) Universal primer for S7 ribosomal therefore, represent unique genetic resources and a protein gene intron in fish. Mol Ecol 7:1255–1256 valuable new model for applied genetic research. Clayton JW, Tretiak DN (1972) Amine-citrate buffers for pH control in starch gel electrophoresis. J Fish Res Board Can Acknowledgments The authors thank Petra Kersten for 29:1169–1172 laboratory assistance and Silvia Markova´ and Petr Ra´b for Cockerham CC, Weir BS (1977) Digenic descent measures for advice. The work was supported by the Ministry of Education, finite populations. Genet Res 30:121–147 Youth and Sports of the Czech Republic (LC06073, Dallas JF, Dod B, Boursot P, Prager EM, Bonhomme F (1995) MSM6007665809), and by the Academy of Sciences of the Population subdivision and gene flow in Danish house Czech Republic (IRP IAPG AV0Z50450515, IGA UZFG/05/ mice. Mol Ecol 4:311–320 22 and IGA UZFG/08/13). Durand JD, Persat H, Bouvet Y (1999) Phylogeography and postglacial dispersion of the chub (Leuciscus cephalus)in Europe. Mol Ecol 8:989–997 Ehlers J, Eissmann L, Lippstreu L, Stephan H-J, Wansa S (2004) Pleistocene glaciations of Northern Germany. In: References Ehlers J, Gibbard PL (eds) Quaternary glaciations—extent and chronology. Elsevier B.V., Amsterdam, pp 135–146 Aebersold PB, Winans GA, Teel DJ, Millner GB, Utter FM Epifanio JM, Philipp DP (1997) Sources for misclassifying (1987) Manual for starch gel electrophoresis: A method genealogical origins in mixed hybrid populations. J Hered for the detection of genetic variation. NOAA Technical 88:62–65 Report NMFS 61. U.S. Department of Commerce Falush D, Stephens M, Pritchard JK (2003) Inference of pop- Allendorf FW, Leary RF, Spruell P, Wenburg JK (2001) The ulation structure using multilocus genotype data: linked problems with hybrids: setting conservation guidelines. loci and correlated allele frequencies. Genetics 164:1567– Trends Ecol Evol 16:613–622 1587 123 75 Rev Fish Biol Fisheries (2010) 20:289–300 299 Falush D, Stephens M, Pritchard JK (2007) Inference of pop- Mayr E (1942) Systematics and the origin of species. Harvard ulation structure using multilocus genotype data: domi- University Press, Cambridge nant markers and null alleles. Mol Ecol Notes 7:574–578 Mayr E (1963) Animal species and evolution. Harvard Uni- Garnier-Ge´re´ P, Dillmann C (1992) A computer program for versity Press, Cambridge testing pairwise linkage disequilibria in subdivided pop- McCune A, Lovejoy NR (1998) The relative rate of sympatric ulations. J Hered 83:239 and allopatric speciation in fishes. In: Howard DJ, Berl- Guo SW, Thompson EA (1992) Performing the exact test of ocher SH (eds) Endless forms: species and speciation. Hardy–Weinberg proportion for multiple alleles. Bio- Oxford University Press, Oxford, pp 172–185 metrics 48:361–372 Mishler BD, Theriot EC (2000) The phylogenetic species con- Haldane JBS (1954) An exact test for randomness of mating. J cept (sensu Mishler and Theriot): monophyly, apomorphy, Genet 52:631–635 and phylogenetic species concepts. In: Wheeler QD, Meier Hendry AP, Vamosi SM, Latham SJ, Heilbuth JC, Day T R (eds) Species concepts and phylogenetic theory. A (2000a) Questioning species realities. Conserv Genet debate. Columbia University Press, NY, pp 44–54 1:67–76 Muscheler R, Kromer B, Bjo¨rck S, Svensson A, Friedrich M, Hendry AP, Wenburg JK, Bentzen P, Volk EC, Quinn TP (2000b) Kaiser KF, Southon J (2008) Tree rings and ice cores Rapid evolution of reproductive isolation in the wild: evi- reveal 14C calibration uncertainties during the Younger dence from introduced salmon. Science 290:516–518 Dryas. Nat Geosci 1:263–267 Hewitt GM (2004) Genetic consequences of climatic changes Nagylaki T (1976) The evolution of one- and two-locus sys- in the Quaternary. Phil Trans R Soc Lon B 359:183–195 tems. Genetics 83:583–600 Hofreiter M, Serre D, Rohland N, Rabeder G, Nagel D, Conard Nagylaki T (1977) The evolution of one- and two-locus sys- N, Mu¨nzel S, Pa¨a¨bo S (2004) Lack of phylogeography in tems II. Genetics 85:347–354 European mammals before the last glaciation. Proc Natl Near TJ, Benard MF (2004) Rapid allopatric speciation in log- Acad Sci USA 101:12963–12968 perch darters (Percidae: Percina). Evolution 58:2798–2808 Jahns S (2000) Late-glacial and Holocene woodland dynamics Nei M (1987) Molecular evolutionary genetics. Columbia and land-use history of the Lower Oder valley, north- University Press, New York eastern Germany, based on two, AMS 14C dated, pollen Nesbø CL, Fossheim T, Vøllestad LA, Jakobsen KS (1999) profiles. Veg Hist Archaeobot 9:111–123 Genetic divergence and phylogeographic relationship Knowles LL (2001) Did the Pleistocene glaciations promote among European perch (Perca fluviatilis) populations divergence? Tests of explicit refugial models in montane reflect glacial refugia and postglacial colonisation. Mol grasshoppers. Mol Ecol 10:691–701 Ecol 8:1387–1404 Kohlmann K, Kersten P (1998) Enzyme variability in a wild Nikinmaa M, Waser W (2007) Molecular and cellular studies population of tench (Tinca tinca). Pol Arch Hydrobiol in evolutionary physiology of natural vertebrate popula- 45:303–310 tions: influences of individual variation and genetic Kohlmann K, Kersten P (2006) Microsatellite loci in tench: components on sampling and measurements. J Exp Biol isolation and variability in a test population. Aquac Int 210:1847–1857 14:3–7 Page RD, Holmes EC (1998) Molecular evolution: a phylo- Kohlmann K, Kersten P, Flajsˇhans M (2007) Comparison of genetic approach. Blackwell, Oxford microsatellite variability in wild and cultured tench (Tinca Pritchard JK, Stephens M, Donnelly P (2000) Inference of tinca). Aquaculture 272S1:S147–S151 population structure using multilocus genotype data. Kohlmann K, Kersten P, Panicz P, Memis¸D, Flajsˇhans M (2009) Genetics 155:945–959 Genetic variability and differentiation of wild and cultured Raymond M, Rousset F (1995) An exact test for population tench populations inferred from microsatellite loci. Rev differentiation. Evolution 49:1283–1286 Fish Biol Fisher. doi:10.1007/s11160-009-9138-x Ridgway GJ, Sherburne SW, Lewis RD (1970) Polymorphism Kotlı´k P, Berrebi P (2001) Phylogeography of the barbel in the esterases of Atlantic herring. Trans Am Fish Soc (Barbus barbus) assessed by mitochondrial DNA varia- 99:147–151 tion. Mol Ecol 10:2177–2185 Rieseberg LH, Linder RC (1999) Hybrid classification: insights Kotlı´k P, Bogutskaya NG, Ekmekc¸i FG (2004) Circum Black from genetic map-based studies of experimental hybrids. Sea phylogeography of Barbus freshwater fishes: diver- Ecology 80:361–370 gence in the Pontic glacial refugium. Mol Ecol 13:87–95 Rousset F (2008) Genepop’007: a complete re-implementation Lajbner Z, Linhart O, Kotlik P (2007) Molecular phylogeog- of the genepop software for Windows and Linux. Mol raphy of the tench Tinca tinca (Linnaeus, 1758). In: Buj I, Ecol Res 8:103–106 Zanella L, Mrakovcic M (eds) The 12th European con- Rousset F, Raymond M (1995) Testing heterozygote excess gress of ichthyology, book of abstracts, Cavtat, 2007, p 35 and deficiency. Genetics 140:1413–1419 Lajbner Z, Sˇlechtova´ V, Sˇlechta V, Sˇva´tora M, Berrebi P, Shaklee JB, Allendorf FW, Morizot DC, Whitt GS (1990) Gene Kotlı´k P (2009) Rare and asymmetrical hybridization of nomenclature for the protein-coding loci in fish. Trans Am the endemic Barbus carpathicus with its widespread Fish Soc 119:2–15 congener B. barbus. J Fish Biol 74:418–436 Shaw CR, Prasad R (1970) Starch gel electrophoresis of enzymes– Machordom A, Doadrio I (2001) Evidence of a cenozoic Betic- a compilation of recipes. Biochem Genet 4:297–320 Kabilian connection based on freshwater fish phylogeog- Sˇlechtova´ V, Sˇlechta V, Valenta M (1995) Genetic protein raphy (Luciobarbus, Cyprinidae). Mol Phylogenet Evol variability in tench (Tinca tinca L.) stocks in Czech 18:252–263 republic. Pol Arch Hydrobiol 42:133–140 123 76 300 Rev Fish Biol Fisheries (2010) 20:289–300 Sta¨dler T, Arunyawat U, Stephan W (2008) Population dates and molecular rates: rapid divergence of rivers and genetics of speciation in two closely related wild tomatoes their biotas. Syst Biol 56:271–282 (Solanum section Lycopersicon). Genetics 178:339–350 Weir BS (1979) Inferences about linkage disequilibrium. Templeton AR (2006) Population genetics and microevolu- Biometrics 35:235–254 tionary theory. Wiley, Hoboken Weir BS (1996) Genetic data analysis II. Sinauer, Sunderland Touriya A, Rami M, Cattaneo-Berrebi G, Ibanez C, Augros S, Weir BS, Cockerham CC (1984) Estimating F-statistics for the Boissin E, Dakkak A, Berrebi P (2003) Primers for EPIC analysis of population structure. Evolution 38:1358–1370 amplification of intron sequences for fish and other ver- Wheeler QD, Platnick NI (2000) The phylogenetic species tebrate population genetic studies. BioTechniques 35: concept (sensu Wheeler and Platnick). In: Wheeler QD, 676–678, 680, 682 Meier R (eds) Species concepts and phylogenetic theory. Vuorinen J (1984) Electrophoretic expression of genetic vari- A debate. Columbia University Press, NY, pp 55–69 ation and duplicate gene activity in vandace, Coregonus Zaykin D, Zhivotovsky LA, Weir BS (1995) Exact test for albula (Salmonidae). Hereditas 101:85–96 association between alleles at arbitrary number of loci. Waters JM, Rowe DL, Apte S, King TM, Wallis GP, Anderson Genetica 96:169–178 L, Norris RJ, Craw D, Burridge CP (2007) Geological 123 77 V G G _ G G > J V G G > G _ J G V _ [ | _ G > G ] | _ G _ G } _ _ G G _ > G G J V > J V | _ _ > G G G G _ G _ _ _ G , J V | G > G _ , ` > G > _ _ G G > _ ` _ _ G G 78 > G G > G _ _ G _ G J V G G G G J V > G JY ^ V } _ G G > _ _ G > G G > | J V J V { > G > G _ _ J > V | G G JY ^ B OV { J V G > G _ > G > J \ MV ` > > J V > G > _ J~ QV ] G G _ _ G > G > 79 > \ Y \ G { J V | ^ Z G G | ] G ] =Z= B[= ~ X X J QV > G G | ] G ] BZ=Q=[=@I J OV Y G { > ] ~ G QZMO [MOO J V > ^ \ ] G > ^ ~ G Z Q@[B J] ^ Y] V X [ G \ ] G ^ | ` ] G J Z MOO[ @@Q @ I V J V ? [ G G > ] J Z MO [IOM MI V ~ ] Y Y J V ? ^ G G G Z Y^ ` ] G @ZB@@O[I ` \ \ J MV ` G > Z > > G G { > ] ~ G Z QIM[ QOM Y { ^ { J V > G G G G G G =ZBIB[BOB Y ^ X ? ` | B X G | ] G ] QZ@I[ \ {` ^ Y G |` \ { X ^ ~ G X J MV G ` Z G > | ~ Y ~ G O=Z M [ Q 80