Genetic and Clinical Heterogeneity of Achondrogenesis Type 1A and Odontochondrodysplasia

AUS DEM ZENTRUM FÜR KINDER- UND JUGENDMEDIZIN KLINIK FÜR ALLGEMEINE KINDER- UND JUGENDMEDIZIN DES UNIVERSITÄTSKLINIKUMS FREIBURG IM BREISGAU

INAUGURAL-DISSERTATION zur Erlangung des Medizinischen Doktorgrades

der Medizinischen Fakultät der Albert-Ludwigs-Universität Freiburg im Breisgau

Vorgelegt 2018 von Judith Carlotta Schneider geboren in Heidelberg

Dekan: Prof. Dr. Norbert Südkamp 1. Gutachter: PD Dr. med. Ekkehart Lausch 2. Gutachter: PD Dr. med. Carsten Speckmann Jahr der Promotion: 2020

TABLE OF CONTENTS

TABLE OF CONTENTS I LIST OF ABBREVIATIONS III 1 ABSTRACT 1 2 ZUSAMMENFASSUNG 2 3 INTRODUCTION 3 The physiological and pathological development of cartilage and bone 3 Thyroid hormone receptor interactor 11 (TRIP11) 5 3.2.1. TRIP11/GMAP210 functions as a transcription factor coactivator of thyroid hormone receptor and as a golgin 6 3.2.2 TRIP11/GMAP210 interacts with the intraflagellar transport protein 20 (IFT20) 9 Achondrogenesis type 1A (ACG1A) 11 Odontochondrodysplasia (ODCD) 13 Aim of the Study 16 4 MATERIALS AND METHODS 17 Materials 17 4.1.1 Chemicals and Reagents 17 4.1.2 Buffers and Solutions 18 4.1.3 Enzymes 19 4.1.4 Antibodies 19 4.1.5 Vectors 19 4.1.6 Primers 19 4.1.7 Ladders 21 4.1.8 Cell Culture Material 22 4.1.9 Antibiotics 22 4.1.10 Kits 22 4.1.11 Equipment 22 4.1.12 Software and Databases 23 4.1.13 Supplies 23 Methods 25 4.2.1 Cell Culture 25 4.2.2 Nucleic acid 26 4.2.3 Polymerase chain reaction (PCR) 28 4.2.4 Cloning of DNA fragments 32

I 4.2.5 Proteins 33 4.2.6 Western blotting 35 5 RESULTS 37 The mutations causing ACG1A and ODCD are variable 37 5.1.1 Sequencing results of patients diagnosed with ACG1A and ODCD 37 5.1.2 Whole Exome Sequencing detects a homozygous LBR mutation in patient 1 41 Molecular characterization of disease-associated genes in patient- derived primary cells 43 5.2.1 The LBR mutation in case 1 leads to mis-splicing and a premature stop in the LBR open reading frame 43 5.2.2 The abundance of LBR RNA is strongly reduced in case 1 and to a lesser extent in two of the ODCD patients 44 5.2.3 Novel splice site mutations were detected in TRIP11 46 5.2.4 The Abundance of TRIP11 RNA is reduced in ACG1A and ODCD patients but elevated in case 1 carrying an LBR mutation 50 There are variable effects of the different mutations in ACG1A and ODCD on the protein level 53 5.3.1 The LBR protein abundance is increased in patient 3 53 5.3.2 The TRIP11 protein is lost in ACG1A and ODCD patients 54 5.3.3 The IFT20 protein abundance is reduced in TRIP11-deficient primary cells 55 6 DISCUSSION 56 ACG1A may be caused by mutations in LBR 56 Mutations in TRIP11 cause ACG1A and ODCD 59 TRIP11 transcripts with a potential residual function are detected in ODCD patients 61 Limitations of the study 63 There might be an interrelationship of LBR and TRIP11 64 TRIP11 and IFT20 could be linked through regulatory mechanisms 65 7 SUPPLEMENTAL DATA 66 Electropherograms of patients 2-6 66 In silico tools predict mis-splicing in patient 1 69 8 LIST OF FIGURES 70 9 LIST OF TABLES 71 10 REFERENCES 72 11 PUBLICATIONS FEHLER! TEXTMARKE NICHT DEFINIERT. 12 EIDESSTATTLICHE VERSICHERUNG 80 13 ERKLÄRUNG ZUM EIGENANTEIL 78 14 DANKSAGUNG 80

II LIST OF ABBREVIATIONS

A Adenine ACG1A Achondrogenesis Type 1A ACG1B Achondrogenesis Type 1B ACG2 Achondrogenesis Type 2 AG Arbeitsgruppe ALPS ArfGAP1 lipid packing sensor APS Ammoniumpersulfate bp Base pair BSA Bovine serum albumin C Cytosine cDNA Complementary DNA cm Centimeter CTL Control del Deletion DI Dentinogenesis imperfecta DMEM Dulbecco’s Modified Eagle Medium DMSO Dimethylsulfoxide DNA Deoxyribonucleic acid dNTP Deoxynucleoside triphosphate ddNTP Dideoxynucleoside triphosphate DPBS Dulbecco's Phosphate-Buffered Saline dT Deoxythymidine DTT Dithiothreitol EDTA Ethylene Diamine Tetraacetic Acid ER Endoplasmic reticulum Ex. Exon FCS Fetal bovine serum Fig. Figure g Gramm G Guanine GRAB GRIP-related ARF binding GRBGD Greenberg dysplasia h Hour HEM Hydrops-ectopic calcification-moth-eaten skeletal dysplasia HRP Horse radish peroxidase H2O Water IFT Intraflagellar Transport IFT20 Intraflagellar Transport Protein 20 kDa Kilodalton LBR Lamin B Receptor M Molar mA Milliampere min Minute Mio Million ml Milliliter mM Millimolar MMLV-RT Moloney Murine Leukemia Virus Reverse Transcriptase mRNA Messenger RNA NaCl Sodium chloride NaOH Sodium hydroxide NCBI National Center for Biotechnology Information NEAA Non-essential amino acid NMD Nonsense-mediated decay NTC No template control OD Optical density ODCD Odontochondrodysplasia OI Osteogenesis imperfecta ORF Open reading frame

III PAGE Polyacrylamide gel electrophoresis Pat. Patient PCR Polymerase chain reaction PBS Phosphate-buffered saline Pen/Strep Penicillin/ Streptomycin PHA Pelger-Huët anomaly PLSD-T Platyspondylic Lethal Skeletal Dysplasia Type Torrance qPCR Real-time quantitative PCR rcf Relative centrifugal force rER Rough endoplasmic reticulum RIPA Radioimmunoprecipitation assay RNA Ribonucleic acid rpm Revolutions per minute Rb Retinoblastoma tumor-suppressor protein RT Reverse transcriptase SDS Shwachman-Diamond Syndrome SDS Sodium Dodecyl Sulfate SMDS Spondylometaphyseal Dysplasia, Sedaghatian Type sec Second T Thymine Taq Thermus aquaticus TBE TRIS-Borat-EDTA TBP TATA-box binding protein TD1 Thanatophoric Dysplasia 1 TEMED Tetramethylethylenediamine TR Thyroid hormone receptor TRBD Thyroid hormone receptor binding domain TRIP11 Thyroid Hormone Receptor Interactor 11 TRIS Tris(hydroxymethyl)aminomethane T3 Triiodthyronin V Volt WES Whole exome sequencing µg Microgram µl Microliter µm Micrometer °C Degrees Celsius

IV 1 ABSTRACT

Anchondrogensesis Type 1A (ACG1A) is a neonatal lethal disease affecting specialized cell types like chondrocytes and osteoblasts and therefore early skeletal development in men. Amongst other findings, individuals affected by ACG1A display severe micromelia, craniofacial malformations, an impaired bone ossification and die before or shortly after birth. The course of odontochondrodysplasia (ODCD) is very variable with some patients dying shortly after birth whereas others reach the age of adulthood. Typical clinical findings in these patients are short stature, narrow thorax, scoliosis and dentinogenesis imperfecta. Achondrogenesis type 1A is caused by mutations in the TRIP11 gene. Recently, the clinical and radiographic overlap of ACG1A and ODCD lead to the idea that ODCD is also caused by biallelic changes in the TRIP11 gene. In this study, we investigated TRIP11 mutations as the common genetic cause of ODCD and ACG1A. In five out of six patients (two ACG1A and three ODCD patients), we confirmed that mutations of the same gene (TRIP11) lead to two distinct skeletal dysplasias with varying phenotypic severity. This finding raised the question if there are mutations in the TRIP11 gene that may result in functional transcripts and thereby a TRIP11 protein with residual function. Indeed, when studying the TRIP11 mRNA expression in the fibroblasts of the patients, the abundance was significantly decreased in all patients affected by a mutation in TRIP11 but even more in ACG1A patients. Accordingly, a full loss of TRIP11 was observed in the ACG1A-patients on the protein level, while a TRIP11 protein was detected at least in one ODCD-patient. Notably, in one individual case of ACG1A, no TRIP11 mutation was found. This patient even showed a significantly elevated TRIP11 mRNA abundance. Genetically, a homozygous mutation of the lamin B receptor gene (LBR) and the concomitant loss of the LBR protein was identified to cause the disease in this patient. We concluded that a common finding in ODCD patients is a residual functional TRIP11 protein as opposed to ACG1A patients with a full loss of TRIP11 protein. This may partially explain the milder phenotype of ODCD compared to ACG1A and the phenotypic spectrum of both diseases.

1 2 ZUSAMMENFASSUNG

Achondrogenesis Typ 1A (ACG1A) ist eine perinatal tödliche Erkrankung, welche Chondrozyten und Osteoblasten und somit die frühe Skelettentwicklung des Menschen betrifft. An ACG1A erkrankte Menschen weisen eine ausgeprägte Mikromelie, kraniofaziale Malformationen und eine beeinträchtigte Knochenossifikation auf und versterben vor oder kurz nach der Geburt. Der Verlauf der Odontochondrodysplasie (ODCD) ist sehr variabel. Manche Patienten versterben kurz nach der Geburt, wohingegen andere das Erwachsenenalter erreichen. Typische Merkmale sind Kleinwuchs, ein schmaler Thorax, Skoliose und Dentinogenesis imperfecta. ACG1A entsteht durch Mutationen im TRIP11-Gen. Kürzlich wurden klinische und radiologische Gemeinsamkeiten zwischen ACG1A und ODCD beobachtet. Dies führte zu der Überlegung, dass ODCD ebenfalls durch biallelische Veränderungen im TRIP11-Gen verursacht werden könnte. In dieser Arbeit wurden daher TRIP11-Mutationen als gemeinsame Ursache für ODCD und ACG1A untersucht. In fünf von sechs Patienten (zwei ACG1A und drei ODCD-Patienten) konnte bestätigt werden, dass Mutationen in TRIP11 zu zwei spezi- fischen Skelettdysplasien mit variabler phänotypischer Ausprägung unterschiedlichen Schweregrades führen. Diese Erkenntnis warf die Frage auf, ob es TRIP11- Mutationen gibt, die zu funktionalen Transkripten und damit zu einem TRIP11-Protein mit Restfunktion führen. Tatsächlich zeigten die Analysen der TRIP11 mRNA- Expression in den Fibroblasten der ACG1A-Patienten eine signifikant stärker verminderte TRIP11-Transkriptmenge. Entsprechend wurde in ACG1A-Patienten ein vollständiger TRIP11-Verlust auf Proteinebene beobachtet, wohingegen bei mindestens einem ODCD-Patienten TRIP11-Protein nachgewiesen werden konnte. Bemerkenswerterweise wurde in einem einzigen ACG1A-Patientinen keine TRIP11- Mutation gefunden. Dieser Patient wies sogar eine signifikant erhöhte TRIP11 mRNA Transkriptmenge auf. Als genetische Ursache der Erkrankung wurde eine homo- zygote Mutation des Lamin B Rezeptor-Gens (LBR) und der damit einhergehende Verlust des funktionalen LBR Proteins identifiziert. Zusammenfassend konnte festgestellt werden, dass ein residuales, funktionales TRIP11-Protein eine Gemeinsamkeit in ODCD Patienten ist, wohingegen ACG1A mit einem vollständigen Verlust des TRIP11 Proteins einhergeht. Dies könnte teilweise den schwächer ausgeprägten Phänotyp der ODCD im Vergleich zur ACG1A, sowie das breite phänotypische Spektrum dieser beiden Erkrankungen erklären.

2 3 INTRODUCTION

3.1 The physiological and pathological development of cartilage and bone The skeleton is the supporting structure of the body in vertebrates and comprises bones as well as cartilage. Its precursors begin to form early in embryogenesis from mesenchymal tissue through desmal (also called direct or intramembranous) or enchondral (sometimes named indirect) ossification (Lüllmann-Rauch, 2009). Craniofacial bones, parts of the clavicles and thickening of the long bones develop through desmal ossification. The starting point is the condensation of mesenchymal cells, which further differentiate into osteoblasts. These specialized bone cells secrete an extracellular substance, the so-called osteoid, which is capable of binding minerals, e.g. calcium salts. After this process of mineralization/ossification, the osteoblasts become osteocytes, mature bone cells, and work together with osteoclasts to remodel the bone throughout the entire life span (Lüllmann-Rauch, 2009; Gilbert, 2000). The second type of ossification, namely enchondral ossification, requires a cartilaginous template before bone begins to form (Wuelling and Vortkamp, 2010). As in desmal ossification, the first step is the condensation of mesenchymal tissue. These nodules differentiate to cartilage cells, named chondrocytes, proliferate and secrete an extracellular matrix to form the bone model. The chondrocytes localized to the middle region of the future diaphysis differentiate to hypertrophied chondrocytes which initiate the mineralization of the cartilage matrix, e.g. by adding collagen type 10 to the matrix. In a next step, the hypertrophied chondrocytes die by apoptosis and give way for the growth of blood vessels and formation of the future bone marrow. Together with the blood vessels, osteoblasts invade the cartilage template, which begin to form bone matrix and deposit it on the cartilaginous framework. Step by step, the entire template is replaced by bone, starting from the middle of the diaphysis and spreading out in both directions towards the epiphyses. At the epiphyses, the same mechanisms take place, but from the center towards the periphery. This ossification front pushes further outwards and ensures longitudinal growth of the axial and appendicular skeleton; as hypertrophied chondrocytes die, new chondrocytes at the outward end of the ossification front proliferate (Lüllmann-Rauch, 2009; Gilbert, 2000) (Figure 3.1).

Figure 3.1: Enchondral ossification and the structure of the growth plate from Yeung Tsang et al., 2014. The figure depicts the essential steps of enchondral ossification from mesenchymal condensation, chondrogenesis, chondrocyte maturation and blood vessel invasion, to bone elongation. In the magnification at the right side of the image, the growth plate is shown with the resting zone, the proliferating zone, the prehypertrophic as well as the hypertrophic zone.

This region of continuous chondrocyte proliferation, degradation and ossification is called growth plate and can be subdivided into four regions (Figure 3.1): The resting or reserve zone contains a pool of chondrocyte progenitor cells and is found at the extreme ends of the growing bone. The cells proliferate in the proliferating zone and line up in column-like structures, before initiating hypertrophic differentiation in the prehypertrophic zone. In the section closest to the bone marrow, the cell’s volume increases dramatically, making up the hypertrophic zone which will be ossified by osteoblasts after hypertrophic cells undergo apoptosis (Yeung Tsang et al., 2014). A fine-tuned coordination of the processes described above is necessary to ensure a normal development of the skeleton. If these processes are disturbed, skeletal disorders can be the consequence (Erlebacher et al., 1995). Currently, 456 genetic skeletal disorders are known, comprising skeletal dysplasias, metabolic bone disorders, dysostoses, and skeletal malformation and/or reduction syndromes (Warman et al., 2011). In this work, I will focus on the skeletal dysplasias achondrogenesis type 1 A (ACG1A, OMIM 200600) and odontochondrodysplasia (ODCD, OMIM 184260).

4 3.2 Thyroid hormone receptor interactor 11 (TRIP11)

In 2010, Smits et al. published the paper “Lethal Skeletal Dysplasia in Mice and Humans Lacking the Golgin GMAP-210”. In their work they report on mutagenized neonatal lethal mice with short limbs and a narrow thorax. A cartilage and bone staining shows that the mineralization of the skull, the rib cage, vertebral bodies and limbs is impaired in the mutant mice compared to the wild-type mice (Figure 3.2). Further analysis revealed a nonsense mutation in the gene thyroid hormone receptor interactor 11 (Trip11) to cause the mutant phenotype. Since the mouse resembles the clinical picture of achondrogenesis type 1A (ACG1A), a neonatal lethal skeletal dysplasia in humans, TRIP11 seemed to be a promising candidate to cause this rare disease. Indeed, the sequencing of the DNA of 10 patients diagnosed with ACG1A showed mutations in TRIP11 (Smits et al., 2010).

Figure 3.2: Effects of Trip11 mutations in mice (Smits et al., 2010). Cartilage and bone staining with alcian blue (cartilage) and alizarin red (bones) in wild type and Trip11 mutated mice on embryonic day 17.5. The skull, the rib cage and the limbs are not mineralized in the mutant.

The gene TRIP11, composed of 21 exons, is located on chromosome 14 (14q31) in humans (Chang et al., 1997). There are four different protein-coding transcript isoforms of TRIP11 (Figure 3.3).

Figure 3.3: There are four putative protein-coding transcript isoforms of TRIP11. Shown is a schematic representation of the different TRIP11 transcripts based on predicted protein-coding isoforms from Ensembl, 2016 (Isoform 1-3) and Ramos-Morales et al., 2001 (Isoform 4). Exons are shown as boxes, the size of the box correlates to the number of base pairs of each exon. The introns are represented as lines but do not correlate in size. The exons are numbered 1-21 for the largest isoform (Isoform 1, 9996 base pairs, known as GMAP210 or TRIP11). The triangular-shaped lines in isoform 2 (5246 base pairs) demonstrate splicing. Isoform 3 (564 base pairs) is the smallest isoform. Isoform 4 is known as coding for GMAP-200 (Ramos-Morales et al., 2001).

In mice, Trip11 encodes for the protein Gmap210, also known as Gmap230, Trip11, Trip230 and Cev14. It is highly expressed in the testis, placenta, heart, skeletal muscle, and pancreas (Infante et al., 1999). Specimens of wild type shoulder girdle and humerus, obtained from mice on embryonic day 15.5, show an expression in all cells that is not specifically restricted to cartilage or bone (Smits et al., 2010). How this rather ubiquitous expression of TRIP11 causes the distinct skeletal phenotype of ACG1A remains an open question.

3.2.1 TRIP11/GMAP210 functions as a transcription factor coactivator of thyroid hormone receptor and as a golgin TRIP11, also known as the Golgi microtubule-associated protein 210 (GMAP210), is a protein located to the cis-Golgi network and composed of 1979 amino acids (Infante et al., 1999) with a molecular weight of 210 kDa (Rios et al., 2004). Several functions are reported in the literature. TRIP11 is described as a cytosolic transcription factor coactivator (Chang et al., 1997). The protein interacts via two specific binding sites with the retinoblastoma tumor-suppressor protein (Rb) and the thyroid hormone receptor (TR), hence the name TRIP11 for Thyroid hormone receptor interactor 11. TR functions as a transcription factor and regulates development, growth and homeostasis in humans. In the presence of the thyroid hormone triiodthyronine (T3), TRIP11 is imported to the nucleus during the S-phase of mitosis, binds to TR and increases the transcriptional activity of the receptor (Chen et al., 1999). Binding of the protein to TR is negatively regulated by Rb. The latter controls cell proliferation, differentiation and development (Chang et al., 1997). Best characterized for its role as a golgin, TRIP11 ensures the proper morphology and functioning of the Golgi apparatus (Infante et al., 1999; Pernet-Gallay et al., 2002), an

6 organelle engaged in the processing and trafficking of proteins (Lüllmann-Rauch, 2009). Golgins are a class of peripheral membrane proteins found in different parts of the Golgi stack, with a typical coiled-coil structure in which a number of α-helices are coiled together. Although their precise functions are still not clear, for most of the eleven members of the golgin family their role is to tether vesicles in subcellular trafficking (Munro et al., 2011). TRIP11 is a golgin located at the cis-face of the Golgi apparatus. There is a discrepancy in the literature concerning the question which terminus, the N- or C- terminus, anchors TRIP11 to the organelle (Infante et al., 1999; Pernet-Gallay et al., 2002; Gillingham et al., 2004; Drin et al., 2008; Roboti et al., 2015; Sato et al., 2015). This discrepancy may be explained by Follit et al., 2008, who found Golgi-targeting structures at both ends of the protein. However, the specific composition of TRIP11 enables it to asymmetric tethering: The ALPS (ArfGAP1 lipid packing sensor) motif of 38 residues at the N-terminus of TRIP11 is sensitive to strongly curved surfaces and traps small vesicles (Drin et al., 2007, 2008). At the C-terminus, TRIP11 contains the GRAB (GRIP-related ARF binding) domain that binds flat membranes and, according to some authors (Infante et al. 1999; Pernet-Gallay et al. 2002; Rios et al., 2004), minus microtubule ends. By tethering transport vesicles, TRIP11 is engaged in the antero- and retrograde cellular secretory trafficking from the endoplasmic reticulum (ER) to the Golgi apparatus (Pernet-Gallay et al., 2002; Roboti et al., 2015). An overview of TRIP11 and its three functional domains, the ALPS motif at the N- terminus (Drin et al., 2007), the GRAB domain at the C-terminus (Gillingham et al., 2004) and the central coiled-coil structure (Infante et al., 1999), including additional known domains, is shown in Figure 3.4. Their corresponding amino acid residues are listed in Table 3.1.

Figure 3.4: Schematic representation of the GMAP210/TRIP11 protein. The protein has several coiled-coil domains, shown as boxes. The prediction of the coiled-coil domains varies from six (Infante et al., 1999) to 26 regions (Ensembl, 2016). The centrally located domain is key to its function as a golgin. The first 38 residues form the amphiphatic lipid-packing sensor (ALPS) are marked in red. The IFT20 binding-site in light blue overlaps with the dark blue Rab2 binding domain 1 (RBD1). The Rab2 binding domain 2 (RBD2) is colored dark blue. Shown in orange is the Rb (retinoblastoma) binding domain (RbBD) (Chang et al., 1997). The thyroid hormone receptor binding domain (TRBD) is colored purple (Chang et al., 1997). The GRIP-related ARF binding domain (GRAB) is shown in green. Adapted and modified from Drin et al., 2008.

Table 3.1: The functional domains of TRIP11 with their corresponding amino acids.

Corresponding amino acid Domain Source residues Prediction of the coiled-coil Infante et al., 1999 Coiled-coil domains domains varies from six to 26 Ensembl, 2016 regions Amphiphatic lipid-packing sensor 1-38 Drin et al., 2008 (ALPS)

IFT20 binding-site 1157-1319 Follit et al., 2010

Rab2 binding domain 1 (RBD1) 1017-1195 Sato et al., 2015

Rab2 binding domain 2 (RBD2) 1325-1599 Sato et al., 2015

Retinoblastoma binding domain 1099-1255 Chang et al., 1997 (RbBD)

Thyroid hormone receptor binding 1754-1867 Chang et al.,1997 domain (TRBD)

GRIP-related ARF binding domain 1774-1823 Gillingham et al., 2004 (GRAB)

8 3.2.2 TRIP11/GMAP210 interacts with the intraflagellar transport protein 20 (IFT20) In 2008, Follit et al. identified the intraflagellar transport protein 20 (IFT20) as a direct binding partner of TRIP11. IFT20 is anchored to the Golgi complex via the IFT20 binding domain assigned to the amino acids 1157-1319 in TRIP11 (see Figure 3.4 and Table 3.1). Besides its localization to the Golgi apparatus and the centrosome, IFT20 is part of the intraflagellar transport (IFT) complex that assembles and maintains the cilia and flagella of cells. Cilia are organelles that resemble tiny antenna-like structures projecting from the membrane of eukaryotic cells. Anchored to the cell through the basal body, they appear on most vertebrate cells either motile and in groups (secondary cilia) or non- motile and as single structures (primary cilia). Their inner cytoskeleton consists of microtubules along which IFT subunits move to ensure antero- and retrograde trafficking of various ciliary particles directly under the ciliary membrane. The ciliary membrane has a different composition compared to the cytoplasmic membrane (reviewed by Rosenbaum et al., 2002; Bloodgood et al., 1990). By detecting extracellular signals through its specific cell membrane receptors, primary cilia have a sensory function. IFT20 is localized to the basal body of cilia and to the cilia itself and traffics between the Golgi complex and the cilium to deliver ciliary proteins, such as the ciliary membrane protein polycystin-2 (Follit et al., 2006; Figure 3.5).

Figure 3.5: Cilia structure and intraflagellar transport. The cilium is assembled and maintained by the intraflagellar transport complex B (IFTB) and A (IFTA) as well as kinesin and dynein motor proteins that transport cargo along the centrally localized microtubules. IFT20 is engaged in the trafficking of vesicles from the Golgi apparatus to the cilium and is anchored to the Golgi apparatus by TRIP11 (modified from Goetz et al., 2010).

In cells of mice lacking Trip11, the candidate protein for the pathogenesis of ACG1A and ODCD, Ift20 is no longer localized at the Golgi apparatus. In these cells, cilia are shorter, with a reduction of polycystin-2 (Follit et al., 2008). Concomitantly, in mouse kidney cells with an Ift20 deletion, cilia formation is prevented and the animals present with cystic kidney disease, a typical sign of malfunctioning of the cilia (Jonassen et al., 2012). Recently, Ift20 was shown to be an essential factor for the development of craniofacial bones. It regulates ciliary platelet-derived growth factor receptor alpha (PDGFα) signaling that controls osteogenic proliferation and cell survival. In addition, it is involved in the ER-to-Golgi transport in the process of collagen secretion during skull development (Noda et al., 2016). These findings indicate that the TRIP11-IFT20 interaction might play a role in the pathogenesis of ACG1A and ODCD in regard to sorting and trafficking of ciliary proteins important for chondrogenesis and osteogenesis. Definitive evidence is still lacking but if cilia are involved in the pathogenesis of ACG1A and ODCD, these diseases may be ciliopathies.

10 3.3 Achondrogenesis type 1A (ACG1A)

First described in 1952 by Marco Fraccaro, achondrogenesis is a general term for three subtypes of the most severe forms of congenital chondrodysplasias leading to stillbirth or death shortly after birth (Fraccaro et.al., 1952; Spranger et al., 2012):

1) Achondrogenesis type 1 A (ACG1A, OMIM 200600), also known as Houston-Harris type 2) Achondrogenesis type 1 B (ACG1B, OMIM 600972), referred to as Fraccaro type 3) Achondrogenesis type 2 (ACG2, OMIM 200610), also called Langer-Saldino type

As implied by the name, affected individuals are born with striking cartilage and bone malformations. Common clinical features are a narrow chest, short trunk, severe micromelia and craniofacial malformations (Stuart Houston, 1972; Harris, 1972). ACG1A is a rare autosomal recessive disease caused by homozygous or compound heterozygous mutations of the gene TRIP11 (Smits et al., 2010). The diagnosis is made upon clinical, radiographic and genetic findings. During prenatal sonographic screening, ACG1A fetuses are recognized because of intrauterine growth restriction and polyhydramnios. They can be diagnosed through a vaginal ultrasound from week 12 gestational age (Schramm et al., 2009). Besides severe micromelia, a narrow thorax and a short neck and trunk, ACG1A patients have a protuberant abdomen and a hydropic appearance. Craniofacial anomalies such as a disproportionately large head, protruding of the eyes and tongue, a short nose with anteverted nares and low set ears can be seen (Spranger et al., 2012; Grigelioniene et al., 2013; Taner et al., 2008) Figure 3.6A. If pregnancy is carried to term, patients are stillborn or die shortly after birth due to respiratory insufficiency either from pulmonary hypoplasia (Follit et al., 2008) or as a consequence of the skeletal phenotype (Smits et al., 2010). In radiographic examinations, the ossification of the skull, the vertebral bodies and the sacrum appear severely impaired. Short and bowed long bones with metaphyseal spurs are characteristic of this disease. The horizontally orientated ribs are short, beaded, splayed at the ends and fractured. Patients often have poorly mineralized hands and feet (Spranger et al., 2012; Yang et al., 1976b; Molz et al., 1980; Taner et al., 2008; Grigelioniene et al., 2013) Figure 3.6B.

Figure 3.6: Two cases with ACG1A. A) Clinical picture of a female baby with ACG1A at 34 weeks and 4 days (Taner et al., 2008). Face anomalies, prominent abdomen, micromelia and hydrops can be seen in this infant, who died shortly after birth. B) Radiograph of a 27-week-old fetus with ACG1A (Smits et al., 2010). The image displays typical features of ACG1A such as micromelia, a narrow thorax and short trunk. There is an insufficient ossification of the skull as well as the vertebral bodies.

Histological analyses indicate an impaired enchondral ossification and a deficient hypertrophic differentiation in ACG1A cases (Molz et al., 1980; Aigner et al., 2007; Smits et al., 2010). Chondrocytes fail to form columnar zones (Molz et al., 1980; Aigner et al., 2007; Smits et al., 2010) and have a ballooned appearance (Molz et al., 1980) due to intracellular vacuoles (Aigner et al., 2007; Borochowitz et al., 1988), Figure 3.7A. In resting chondrocytes, cytoplasmic inclusion bodies can be observed (Yang et al., 1976a; Molz et al., 1980; Borochowitz et al., 1988; Grigelioniene et al., 2013), showing a PAS-positive reaction (Molz et al., 1980; Grigelioniene et al., 2013), at least in part further identified as accumulation of the extracellular matrix protein perlecan (Smits et al. 2010). The rough endoplasmic reticulum (rER) looks dilated in chondrocytes and osteoblast (Smits et al., 2010), containing amorphous “electronopaque” (Molz et al.,1980) or fine fibrillar material (Aigner et al., 2007) Figure 3.7B. In most chondrocytes, the Golgi apparatus appears to be vesiculated and hypertrophied (Molz et al., 1980), lacking its typical structure (Molz et al., 1980; Smits et al., 2010) Figure 3.7C. Interestingly, the amount of extracellular matrix (ECM) was found to be severely altered, despite of the normal distribution pattern of the matrix molecules with exception of collagen type 10 expression (Col10a1) in immuno- histochemical analysis, which was reduced (Aigner et al., 2007). Aigner et al. concluded that the assembly of ECM is disturbed in ACG1A patients and Smits et al.

12 traces this back to a general impairment in glycosylation, synthesis and secretion of specific proteins.

Figure 3.7: Histological findings in ACG1A patients. A) The light microscope picture from Aigner et al., 2007, shows the lack of organization of the chondrocytes in tubular bones. B) and C) are electron micrographs from two ACG1A patients that display swollen endoplasmatic reticulum and vesiculated Golgi apparatus (Smits et al., 2010).

Due to the pleiotropic phenotype (Grigolioniene et al., 2013), ACG1A has to be distinguished not only from the different types of achondrogenesis (ACG1B, OMIM 600972 and ACG2, OMIM 200610) but also from individuals with thanatophoric dysplasia 1 (TD1, OMIM 187600), platyspondylic lethal skeletal dysplasia type Torrance (PLSD-T, OMIM 151210), hypophosphatasia (OMIM 241500) and odontochondrodysplasia (ODCD, OMIM 18426) (Spranger et al., 2012). Common to all of these differential diagnosis are a short stature, limb-shortening, a narrow thorax and deficient ossification of the skeleton.

3.4 Odontochondrodysplasia (ODCD)

The first patient described with odontochondrodysplasia (ODCD, OMIM 184260) was reported on by Goldblatt et al., 1991. The child suffered from dentinogenesis imperfecta (DI) and spondylometaphyseal dysplasia. Therefore, ODCD is also known as Goldblatt syndrome or spondylometaphyseal dysplasia with dentinogenesis imperfecta. Although it is a rare disease and few cases have been published (Goldblatt et al., 1991; Bonaventure et al., 1992; Maroteaux et al., 1996 and Unger et al., 2008), they confirm the distinct entity of ODCD. ODCD patients are of short stature with a narrow thorax, suffer from hyperextensive joints, scoliosis, increasing mesomelia with age and DI. Radiographs show platyspondyly with coronal clefts, severe metaphyseal alterations in the long bones, hands and knees, as well as coxa valga and genu varum (Goldblatt et al., 1991; Maroteaux et al., 1996 and Unger et al., 2008) Figure 3.8. The intellectual development is normal but the prognosis is very variable with some patients dying shortly after birth whereas others reach the age of adulthood (Unger et al., 2008).

Figure 3.8: Clinical and radiographic pictures of two ODCD patients. Patient 4 at the age of 14 (a) and 15 (b) months and 6 weeks (c), adapted and modified from Hermann, 2012. a) The patient displays a narrow and short thorax with a sternum deformation, a prominent abdomen and mesomelic limb shortening. b) This image shows dentinogenesis imperfecta in patient 4. Typical are the small, fragile, brown teeth. c) On the lateral radiographic image of the spine, the vertebral bodies show platyspondyly and wide coronal clefts as well as an impaired mineralization. d) Patient demonstrating joint laxity, adapted and modified from Goldblatt et al., 1991.

Histological examinations of ODCD patients’ cartilage biopsies show a hypocellular growth zone, lacking the typical column structure (Bonaventure et al., 1992; Figure 3.9a). The majority of the chondrocytes contain large cytoplasmic inclusion bodies. Taking a closer look through electron microscopy, dilatation and vesiculation of the rough endoplasmic reticulum (rER) and the Golgi apparatus are detected (Figure 3.9b). Further studies show a reduced quantity of type 1 collagen and an altered structure of type 2 collagen (Bonaventure et al., 1992).

Figure 3.9: Microscopic images of the upper tibial growth cartilage from ODCD patients. a) The histologic examination shows a decreased cellularity with an irregular arrangement of the chondrocytes. b) This electron micrograph of a large chondrocyte of the basal zone shows dilatations in the rER (R) and an enlarged Golgi apparatus. The irregularly shaped nucleus (N) is located at the periphery of the cell. Adapted and modified from Bonaventure et al., 1992.

One differential diagnosis of ODCD is osteogenesis imperfecta (OI). Characteristic features of OI are multiple fractures, blue sclera, wormian bones and DI (Goldblatt et al., 1991). According to Unger et al., 2008, and Spranger et al., 2012, other diagnoses that have to be taken into consideration are platyspondylic lethal skeletal dysplasia type Torrance (PLSD-T, OMIM 151210) and spondylometaphyseal dysplasia, Sedaghatian type (SMDS, OMIM 250220). The listed syndromes share platyspondyly and spiked metaphyses as radiographic signs. In contrary to ODCD, PLSD-T patients do not develop mesomelia. Severe neurologic and cardio-respiratory defects are seen in SMDS. The spectrum of differential diagnosis was enlarged by Unger et al., 2008, with severe Shwachman-Diamond syndrome (SDS, OMIM 260400), caused by mutations in the gene SBDS, after a publication from Nishimura et al., 2007. Although the two chondrodysplasias described in the above have several clinical, radiographic and histochemical similarities, ODCD differs from ACG1A through a less severe phenotype and additional dental findings.

15 3.5 Aim of the study

As to date, the literature classifies ACG1A and ODCD as two distinct skeletal dysplasias. Smits et al., 2010, identified mutations in the TRIP11 gene as the cause for ACG1A, whereas the molecular basis leading to ODCD remains unknown. In 2011, though, our group recognized a clinical and radiographic overlap of the two disorders and showed that ODCD has the same molecular origin as ACG1A (Wehrle et al., unpublished data). In this study, we sought to confirm TRIP11 mutations as the common genetic cause of ACG1A and ODCD. Furthermore, we intended to find out how mutations of the same gene (TRIP11) can result in a heterogeneous clinical picture of severe ACG1A and milder ODCD. Therefore, we investigated primary fibroblasts of patients affected by the dysplasias. In these cells we took a closer look at the interaction partner of TRIP11, namely IFT20, to study its potential involvement in pathogenesis.

16 4 MATERIALS AND METHODS

4.1 Materials

4.1.1 Chemicals and Reagents Chemical Supplier

2x QuantiTect SYBR® Green PCR Master Mix Qiagen, Venlo, Netherlands 5-Brom-4-chlor-3-indoxyl-β-D-galactopyranosid (X-gal) AppliChem, Darmstadt, Germany Aceton Roth, Karlsruhe, Germany Acrylamid Rotiphorese Gel 30 Roth, Karlsruhe, Germany Agarose MP Biomedicals, Santa Ana, CA, USA Ammoniumpersulfat (APS) Serva Electrophoresis, Heidelberg, Germany Bio-Rad Protein Assay-Reagent Bio-Rad Laboratories, Hercules, CA, USA Boronic acid AppliChem, Darmstadt, Germany Bovine Serum Albumin (BSA) Sigma-Aldrich, St. Louis, MO, USA Bromophenol blue Sigma-Aldrich, St. Louis, MO, USA Butanol Roth, Karlsruhe, Germany Chloroform Sigma-Aldrich, St. Louis, MO, USA Competent cells, DH5 α™ Thermo Fisher Scientific, Waltham, MA, USA Complete Phosphatase Inhibitor Cocktail Tablets Roche, Bale, Switzerland Deoxyribose nucleosid triphosphates (dNTPs) (10mM) Thermo Fisher Scientific, Waltham, MA, USA Dimethyl sulfoxide (DMSO) Sigma-Aldrich, St. Louis, MO, USA Dithiothreitol (DTT) Bio-Rad Laboratories, Hercules, CA, USA Ethanol AppliChem, Darmstadt, Germany Ethidium bromide Thermo Fisher Scientific, Waltham, MA, USA Ethylene Diamine Tetraacetic Acid (EDTA) MP Biomedicals, Santa Ana, CA, USA Formaldehyde Sigma-Aldrich, St. Louis, MO, USA Hi-Di Formamide Thermo Fisher Scientific, Waltham, MA, USA IGEPAL (NP-40) Sigma-Aldrich, St. Louis, MO, USA Isopropanol Roth, Karlsruhe, Germany Isopropyl-β-D-thiogalactopyranosid (IPTG) AppliChem, Darmstadt, Germany Luria Broth (LB) Sigma-Aldrich, St. Louis, MO, USA Methanol Roth, Karlsruhe, Germany Milk powder, Blotting grade Roth, Karlsruhe, Germany N,N,N‘,N‘-Tetramethylethylenediamine (TEMED) Sigma-Aldrich, St. Louis, MO, USA Orange G Sigma-Aldrich, St. Louis, MO, USA Paraformaldehyde (PFA) Serva Electrophoresis, Heidelberg, Germany PhosStop Roche, Bale, Switzerland Protease Inhibitor Roche, Bale, Switzerland RiboLock RNase Inhibitor Thermo Fisher Scientific, Waltham, MA, USA S.O.C. medium Life Technologies, Carlsbad, CA, USA Sephadex G-50 Fine GE Healthcare Life Sciences, Chalfont St Giles, UK Sodium chloride (NaCl) Sigma-Aldrich, St. Louis, MO, USA Sodium deoxychelate AppliChem, Darmstadt, Germany Sodium dodecyl sulfate (SDS) Gerbu Biotechnik, Heidelberg, Germany Sodium phosphate Merk, Darmstadt, Germany ß-Mercaptoethanol Sigma-Aldrich, St. Louis, MO, USA Tris base Biomol, Hamburg, Germany Tris, ultra pure Biomol, Hamburg, Germany TRIzol Reagent Thermo Fisher Scientific, Waltham, MA, USA Tween-20 Sigma-Aldrich, St. Louis, MO, USA Water, nuclease free Thermo Fisher Scientific, Waltham, MA, USA Yellow Sub Geneo BioTechProducts, Hamburg, Germany

4.1.2 Buffers and Solutions Buffer, Solution Ingredients

Blocking milk 0.5 g non-fat dry milk powder 10 ml PBS-T Lairds buffer 2 ml 200 mM NaCl 5 ml 100 mM Tris/HCl ph 8,3 1.25 ml 5 mM EDTA pH8 1 ml 0,2% SDS 10x PBS (pH 7,4) 80 g NaCl 2 g KCl 11,5 g Na2HPO4 (7H2O) 2 g KH2PO4 H2Odd ad 1 l 1x PBS-T 1x PBS 0.1% Tween-20 10x PhosStop buffer 1 Tablet PhosStop H2Odd ad 1 ml RIPA buffer 1 ml RIPA stock solution 1 mM DTT Benzonase (5 U/ml) 2% Protease Inhibitor 100 µl 10x PhosStop buffer RIPA stock solution 1% NP-40 1% sodium deoxychelate 0,1% SDS 150 mM NaCl 1 mM sodium phosphate pH 7,2 2 mM EDTA H2Odd ad 1 l TBE buffer (Tris-borate-EDTA) 108 g Tris 55 g boronic acid 40 ml 0,5 M EDTA-Na2-Salt H2Odd ad 1 l TE buffer 10 mM Tris (pH 8,0) 1 mM EDTA 6x Western blot loading buffer 350 mM Tris/HCl (pH 6,8) 34,4 % Glycerol 10 % SDS 10 % β-Mercaptoethanol 0,06 % Bromphenol blue 10x Western blot running buffer 30 g Tris 44 g Glycin 10 g SDS H2Odd ad 1 l Western blot transfer buffer (pH>8) 30 g Tris 144 g Glycin H2Odd ad 1 l

18 4.1.3 Enzymes Enzymes Supplier

Antarctic phosphatase New England Biolabs, Ipswich, MA, USA Benzonase Merck, Darmstadt, Germany DNase I Roche, Bale, Switzerland Exonuclease I New England Biolabs, Ipswich, MA, USA M-MLV Reverse Transcriptase Thermo Fisher Scientific, Waltham, MA, USA Proteinase K Roche, Bale, Switzerland RiboLock RNAse Inhibitor Thermo Fisher Scientific, Waltham, MA, USA RNase I Qiagen, Venlo, Netherlands Taq DNA Polymerase New England Biolabs, Ipswich,MA, USA

4.1.4 Antibodies Antibody Supplier

Anti-GMAP-210, monoclonal; BD Biosciences, San Jose, CA, USA 611712 Anti-IFT20, polyclonal; Proteintech, Manchester, UK 13615-1-AP Anti-LBR, monoclonal; Abcam, Cambridge, UK ab32535 Anti-β-Actin, monoclonal; Sigma-Aldrich, St. Louis, MO, USA A5441 Goat anti-mouse, polyclonal, HRP Dako, Hamburg, Germany Swine anti-rabbit, polyclonal, HRP Dako, Hamburg, Germany

4.1.5 Vectors Vector Supplier pCRII-TOPO Life Technologies, Carlsbad, CA, USA

4.1.6 Primers Primers used for standard PCR and sequencing reactions:

Primer Sequence 5’-3’

LBR; Ex3, FN/RN Forward GCAGTTCCTGCCTTTGTTATCC Reverse ACCTTACGCAGTTCAATCTACAAGC TRIP11; Ex1, F/R Forward CTTGCGCCAAGGACACGTCC Reverse GATGGAAGTAGGGACCAAAC TRIP11; Ex2, F/R Forward CATATCAGCCTACTATTCTGTG Reverse GAAAGGATCAAAGTAATGTTTG TRIP11; Ex3, F/R Forward CATAATGCTGTGCACATAAC Reverse ACAGATCTGAATATACCTCG TRIP11; Ex4, F/R Forward GATTCAGTTGATAGAGGACC Reverse CTATTTCCTAGTCCAGGGTTC TRIP11; Ex5, F/R Forward GGTCCATGGCATTCTTTAGTCGG Reverse CTGCACTCCAGCCAGGGCAACAC

19 TRIP11; Ex6, F/R Forward CAGCCTTAACATGTTCTGAG Reverse GATCGCGCCAGTGCACTCCAG TRIP11; Ex7, F/R Forward GCTTTCCAAATTCTGAACTGTC Reverse CCACTAAGTATTCAGTTAGTG TRIP11; Ex8, F/R Forward CTCAGAACTGTTACTGCTTGCC Reverse CAACTCTTTGAATCTCTTAAGG TRIP11; Ex9, F/R Forward GTCTGGCCAAGTATTGCATTC Reverse CTCAACATTCCATTTGGATATC TRIP11; Ex10, FN/RN Forward AAAATTGCACATGAATGAAGGA Reverse TAAATCACACCCACCATTTCTG TRIP11; Ex11.1, F/R Forward GAAGGATTAGAAATATTTGAGG Reverse GCTGATTGTTACCAGCAAGAC TRIP11; Ex11.2, FN/RN Forward TTACTTAAAGAAAGAGAAGCTGAAG Reverse CTTCTTGCAGATGATTATTTTCC TRIP11; Ex11.3, F/R Forward GTCATCTAGTTTAGAAGAGCAG Reverse CACTAATCTTTCCGTTTCAGC TRIP11; Ex11.4, F/R Forward CCCAGTTGCATGAAGAAAGAC Reverse CTTGTCACGTTCCTGTAGAAGC TRIP11; Ex11.5, F/R Forward CCAAGATATGTTTAGAGAAAC Reverse GCTCTGAGGTGGCAGCAATCG TRIP11; Ex11.6, FN/RN Forward TTCTGAATTGCTTCAGCAAGAG Reverse CTTAGAATGAATCACACCTTGAAA TRIP11; Ex12, F/R Forward GGAGTCTCTCTGAGCCTACTC Reverse CACTGATCACCTTTCCAGTTC TRIP11; Ex13, F/R Forward GATTTGATAACAAAATGGTTTG Reverse CAGATAATGAATTTTGCAAGG TRIP11; Ex14, FN/RN Forward GTAGGGAAGGTGGCTTCTTCTT Reverse ACCAGTGGGTAACCTTTCAGAG TRIP11; Ex15, F/R Forward CATTTGAACTGTTTTCGTTGG Reverse CCAAGACAAAGACTCTACAAG TRIP11; Ex16, F/R Forward GAGGTGCAGCTTCACCAGCTG Reverse CATCAATGAAGTTGGTCTCAC TRIP11; Ex17, FN/RN Forward TTGAATATTCCCAATTAGAATAAGTGT Reverse CATTAAAGCTGCATCCTTCCTC TRIP11; Ex18, F/R Forward CTATGCTTAGTGTTTGAGTGTAC Reverse CCACACTGAGAAAATTACACTC TRIP11; Ex19, F/R Forward CTTGTACTGATAATATTTGTC Reverse CTGATTCTTTGCAAATGAATG TRIP11; Ex20, F/R Forward GCTGGTACATTTCCTTAGTTG Reverse GAAGTCCTGATTACACATTTCC TRIP11; Ex21, F/R Forward GTGTTATTACCGTCAAGGGAG Reverse CCTAGCTTAAATTAGGTCAAATC

20 Primers used for semi-quantitative and real-time quantitative PCR and cloning:

Primer Sequence 5’-3’ h_qLBR; 1F/1R Forward TGGGGAGCCTGAGCATATTG (Lamin B receptor) Reverse AGGCAGGCCAAACATGATGA h_qLBR; 1F/7R Forward TGGGGAGCCTGAGCATATTG (Lamin B receptor) Reverse ACTGCCAGTTCTTTTGCAACG h_qLBR; 1F/9R Forward TGGGGAGCCTGAGCATATTG (Lamin B receptor) Reverse CGCTTTCAAAGAGCGCATGT h_qLBR; 4F/7R Forward AGCACCTCCCAGCTTTACAC (Lamin B receptor) Reverse ACTGCCAGTTCTTTTGCAACG HPRT1 Forward GCAGACTTTGCTTTCCTTGGTCAG (Hypoxanthine Phosphoribosyl- Reverse CAAGCTTGCGACCTTGACCATC transferase1) IFT20; 10F/10R Forward TGTGACAAGCAAGCGGACTT (Intraflagellar transport protein Reverse GGCTGTTTCCCATCCAGGTT 20) IFT20; 2F/2R Forward GGTGAAGCAGGGCTACACTT (Intraflagellar Transport Protein Reverse CAGCTCTATGGTCTGCTGGG 20) M13; F/R Forward GTAAAACGACGGCCAG Reverse CAGGAAACAGCTATGAC Patient 5; F/R Forward GAGTGCATCAGTGGAAGAAGTG (Thyroid Hormone Receptor Reverse CCAATTCTTCTATCTCAGCTATCA Interactor 11) TBP Forward TGTGCTCACCCACCAACAATTTAG (TATA Box Binding Protein) Reverse TTTCTGCTCTGACTTTAGCACCTG TRIP11_Patient 6; F3/R1 Forward ATATGCTGATGGAGGGCACG (Thyroid Hormone Receptor Reverse TCTGTTCCTTGTGCTTTGGAAG Interactor 11) TRIP11; F3/R2 Forward GCGTCATGAAGTGTTACGGT (Thyroid Hormone Receptor Reverse AGTCATCCACCTGGTAACAC Interactor 11) TRIP11; F3/R3 Forward GCGTCATGAAGTGTTACGGT (Thyroid Hormone Receptor Reverse GGTGGAATGGATGGATGAGA Interactor 11) All primers where ordered at metabion international AG, Steinkirchen, Germany.

4.1.7 Ladders Ladder Supplier

100 bp Ladder New England Biolabs, Ipswich, USA 2-log DNA Ladder New England Biolabs, Ipswich, USA 50 bp DNA Ladder New England Biolabs, Ipswich, USA Page Ruler Prestrained Protein Ladder Thermo Fisher Scientific, Waltham, USA Spectra Multicolor HighRange Protein Ladder Thermo Fisher Scientific, Waltham, USA

21 4.1.8 Cell Culture Material Cell culture material Supplier

100x NEAA (non-essential amino acids) PAN Biotech GmbH, Aidenbach, Germany DMEM GlutaMAXTM (Dulbecco Modified Eagle Gibco, Thermo Fisher Scientific, Waltham, MA, Medium) USA Gibco, Thermo Fisher Scientific, Waltham, MA, DPBS (Dulbeccos Phospate-Buffert Saline) USA FCS (fetal calves serum) Sigma-Aldrich, St. Louis, MO, USA Gibco, Thermo Fisher Scientific, Waltham, MA, Trypsin-EDTA 0.05% USA

4.1.9 Antibiotics Antibiotic Supplier

Ampicillin Roche, Bale, Switzerland BM-Cycline Roche, Bale, Switzerland Penicillin/Streptomycin Life Technologies, Carlsbad, CA, USA

4.1.10 Kits Kit Supplier

BigDye ® Terminator v3.1 Cycle Sequencing Kit Applied Biosystems, Waltham, MA, USA EndoFree Plasmid Mini Kit from Qiagen Qiagen, Venlo, Netherlands Mycoplasma Test Kit II AppliChem, Darmstadt, Germany RNeasy Mini Kit Qiagen, Venlo, Netherlands

4.1.11 Equipment Equipment Supplier

3130XL Genetic Analyzer Applied Biosystems, Waltham, MA, USA Bacterial incubator B6200 Thermo Electron, Waltham, MA, USA Centrifuge, 5430 R Eppendorf, Hamburg, Germany Centrifuge, benchtop, Sprout Biozym Scientific, Hessisch Oldendorf, Germany CFX384 real-time PCR detection system Biorad, Hercules, CA, USA Clean bench INTERGRA Biosciences, Zizers, Switzerland Dry Bath-ThermoCell MiXingBlock BIOER TECHNOLOGY, Binjiang, China E-Box VX5 documentation system Peqlab Biotechnologie, Erlangen, Germany Eight-channel eLINE electronic pipette Biozym Scientific, Hessisch Oldendorf, Germany Electrophoresis power supply EPS-200 Biorad, Hercules, CA, USA Fume hood, Secuflow WALDNER Holding GmbH & Co. KG, Wangen, Germany Fusion Fx Vilber Lourmat Peqlab Biotechnologie, Erlangen, Germany Ice machine ZBE Ziegra, Isernhagen, Germany Incubator T5042E Thermo Scientific Heraeus, Waltham, MA, USA Infinite M200 PRO Tecan, Männedorf, Switzerland LP Vortex mixer Thermo Fisher Scientific, Waltham, MA, USA Mini Horizontal Gel System, PerfectBlue™ Gel PEQLAB Biotechnologie GmbH, Erlangen, System Mini S-L Germany Mini-Electrophoretic Blotting System CE, EBU-204 C.B.S. Scientific, Del Mar, CA, USA NanoDrop® Spectrophotometer ND-1000 Peqlab Biotechnologie, Erlangen, Germany Pipet Poy acu 2 INTEGRA Biosciences AG, Zizers, Switzerland

22 Pipettes, 1; 10; 100; 1000 μl PEQLAB Biotechnologie GmbH, Erlangen, Germany Precision scale Sartorius Basic Sartorius, Göttingen, Germany Ultra sonic homogenizer Modell CV188 HTU SONI-130 MiniFIER, G. Heinemann, Schwäbisch Gmünd, Germany Western blot power supply, Power Pac HC Bio-Rad Laboratories Hercules, CA, USA

4.1.12 Software and Databases Software, database Supplier

Biorad CFX manager Biorad, Hercules, CA, USA Ensembl genome browser http://www.ensembl.org/index.html GraphPad Prism 6 GraphPad Software Inc., La Jolla, CA, USA Microsoft Excel Microsoft, Seattle, WA, USA OMIM- Online Mendelian Inheritance in Man https://www.omim.org/ Optimase ProtocolWriter™ http://www.mutationdiscovery.com/md/MD.c om/screens/optimase/OptimaseInput.html?a ction=none Primer-BLAST https://www.ncbi.nlm.nih.gov/tools/primer-blast/ SEQUENCE Pilot 3.5.2 JSI medical systems GmbH, Kippenheim, Germany Sequencher® version 4.9 sequence analysis software Gene Codes Corporation, Ann Arbor, MI, USA Sequencing Analysis, Version 5.4 Applied Biosystems, Waltham, MA, USA

4.1.13 Supplies Supplies Supplier

Amersham ECL Prime Western Blotting Detection GE Healthcare Life Sciences, Chalfont St Giles, Reagent UK Amersham ECL Prime Western Blotting Detection GE Healthcare Life Sciences, Chalfont St Giles, Reagent UK Amersham Hybond ECL Nitrocellulose Membrane GE Healthcare Life Sciences, Chalfont St Giles, UK Amersham Hybond ECL Nitrocellulose Membrane GE Healthcare Life Sciences, Chalfont St Giles, UK Cell culture dishes 10 cm TPP Techno Plastic Products, Trasadingen, Switzerland Cell culture flask 175 cm2 (550 ml) Greiner Bio-One, Kremsmünster, Austria Cell culture flask 25 cm2 (70 ml) BD Franklin Lakes, NJ, USA Cell culture flask 75 cm2 (250 ml) Greiner Bio-One, Kremsmünster, Austria Cell culture flasks with filter 175 cm2 Greiner Bio-One, Kremsmünster, Austria Cell culture flasks with filter 75 cm2 Greiner Bio-One, Kremsmünster, Austria Cell culture flasks with filter 25 cm2 BD Franklin Lakes, NJ, USA Cell culture plates, 6 well Greiner Bio-One, Kremsmünster, Austria Cell scraper BD Franklin Lakes, NJ, USA Cellulose Chromatography Paper Whatman Grade GE Healthcare Life Sciences, Chalfont St Giles, 3MM UK Cryogenic storage vials 2 ml Roth, Karlsruhe, Germany ECL solution GE Healthcare Life Sciences, Chalfont St Giles, UK epT.I.P.S. Standard pipet tips 50 - 1000 μl Eppendorf, Hamburg, Germany Erlenmeyer flask Schott AG, Mannheim, Germany Filter tips 10 μl; 100 μl; 200 μl Biozym Scientific, Hessisch Oldendorf, Germany Filter tips 1000 μl Starlab, Hamburg, Germany Filter tips 20 μl Peqlab Biotechnologie, Erlangen, Germany FS (first strand) buffer Invitrogen, Carlsbad, CA, USA Glas beads Roth, Karlsruhe, Germany Neubauer improved- Counting chamber LO – Laboroptik, Lancing, UK Parafilm M Laboratory Film Brand, Wertheim, Germany

23 PCR plate seal foil Bio-Rad Laboratories Hercules, CA, USA PCR plates, 96 well; transparent Bio-Rad Laboratories Hercules, CA, USA PCR plates, 384 well; white Bio-Rad Laboratories Hercules, CA, USA PCR SoftStripes 0.2 ml Biozym Scientific, Hessisch Oldendorf, Germany PCR SoftTubes 0.2 ml Biozym Scientific, Hessisch Oldendorf, Germany Pipets 5 ml; 10 ml; 25 ml Corning, Corning, NY, USA Plate septa, 96 well Life Technologies, Carlsbad, CA, USA; Applied Biosystems, Foster City, CA, USA PP tube, 15 ml BD Franklin Lakes, NJ, USA PP tube, 50 ml Greiner Bio-One, Kremsmünster, Austria Sephadex G-50 Fine GE Healthcare Life Sciences, Chalfont St Giles, UK Stripettes: 1 ml, 5 ml, 10 ml, 25 ml Corning, Corning, NY, USA Toothpick Hygostar®, Franz Mensch GmbH, Eresing, Germany Tube, 1.5 ml Sarstedt, Nümbrecht, Germany Tube, Safe-lock 1.5 ml; 2 ml Eppendorf, Hamburg, Germany

24 4.2 Methods

4.2.1 Cell Culture

4.2.1.1 Cultivating cells

The primary fibroblasts used for the experiments derived from skin biopsies of the patients. For the controls, patients without TRIP11 mutations and without an osteochondral phenotype were chosen. The cells were cultivated in a cell incubator at

37°C and a CO2 saturation of 5% in a humid atmosphere. As growth medium, DMEM GlutaMAXTM (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) with 10% heat inactivated FCS (Sigma-Aldrich, St. Louis, MO, USA) and 1% 100x NEAA (PAN Biotech GmbH, Aidenbach, Germany) was used and supplemented with 1% Penicillin/Streptomycin (Life Technologies, Carlsbad, CA, USA). Media changes were performed by aspirating the growth medium and replacing it with new medium. When the cells had reached confluency, they were split. For this purpose, the growth medium was removed and the cells were carefully rinsed with 1x DPBS (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). Further on, DPBS was discarded and 1x Trypsin-EDTA 0.05% (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) was added to the flask. After an incubation of 10 minutes at 37°C, the trypsinization was stopped with the growth medium. The cells were transferred to a falcon, centrifuged for 5 minutes at 1,300 rcf, the residual medium was discarded and the pellet was resuspended in new cultivation medium. An appropriate fraction of the cells was transferred into a new vessel with fresh medium.

4.2.1.2 Thawing and freezing cells

The cells were thawed in a water bath at 37°C for 5 minutes and resuspended in growth medium. In the next step, the fibroblasts were pelletized at 1,300 rcf for 5 minutes, the residual medium was discarded, the pellet was resuspended in new cultivation medium and the cells were transferred to a cell culture bottle. Before starting any experiments, all cells were tested with the Mycoplasma Test Kit II (AppliChem, Darmstadt, Germany) and when indicated, treated with BM-Cycline (Roche, Bale, Switzerland) and tested with the Mycoplasma Test Kit II (AppliChem, Darmstadt, Germany) to eliminate Mycoplasma sp. contamination. In order to freeze cells, they were detached as described above with Trypsin-EDTA 0.05% (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) and centrifuged at 1300 rcf for 5 minutes. The pellet was then resuspended in freeze medium, consisting of

25 heat inactivated FCS with 10% DMSO, sterile filtered (PanReac AppliChem, Darmstadt, Germany). An aliquot of 1 million cells was transferred to a 1 ml cryogenic storage vial and stored at -80°C or in a liquid nitrogen storage container.

4.2.2 Nucleic acid

4.2.2.1 DNA isolation from fibroblasts

To identify mutations in the patients, DNA was extracted from the cells. The fibroblasts were trypsinized with 1x Trypsin-EDTA 0.05% (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) and centrifuged for 5 minutes at 1,300 rcf. The dry pellet was resuspended in 0.25 ml 1x TE buffer and 1.5 ml of Lairds buffer, 200 µg/ml Proteinase K (10 mg/ml, Roche, Bale, Switzerland) and 200 µg/ml RNAse A (10 mg/ml), (Qiagen, Venlo, Netherlands) were added. The suspension was incubated over night at 55°C and shaken with 1,000 rpm. The next step was a centrifugation at 14,000 rpm for 20 minutes. To the supernatant, 1 ml isopropanol 100% (Sigma- Aldrich, St. Louis, MO, USA) was added, and the sample was stored at -20°C for one hour. After the precipitation the sample was centrifuged at 4°C for 20 minutes with a speed of 13,000 rpm and washed with 1 ml 70% ethanol (Sigma-Aldrich, St. Louis, MO, USA). The centrifugation step was repeated for 10 minutes and the supernatant was discarded. Depending on its size, the dried pellet was dissolved in 30-50 µl nuclease free water (Thermo Fisher Scientific, Waltham, MA, USA). The next day the DNA concentration was measured.

4.2.2.2 Measuring of DNA concentration

The DNA concentration was measured with a spectrophotometer (Tecan, Männedorf, Switzerland) at an optical density of 260 nm. Alternatively, the NanoDrop® Spectrophotometer ND-1000 (Peqlab Biotechnologie, Erlangen, Germany) and the corresponding computer software were employed. For both methods, the instruments were calibrated with 1-2 µl solvent and 1-2 µl of the sample was applied to measure the purity and the concentration of the DNA.

26 4.2.2.3 RNA isolation from fibroblasts

To extract RNA, one million cells were seeded and harvested the following day. All steps were performed under the safety hood. First, the medium was removed and the fibroblasts were washed with PBS. To detach the cells, 1 ml TRIzol® Reagent (Life Technologies, Carlsbad, CA, USA) was added and after an incubation time of 15 minutes at room temperature, the cells were scraped from the cell culture dish with a scratcher. The suspension was transferred to a 2 ml tube and incubated for 10-20 minutes. In the following step, 200 µl chloroform (Sigma-Aldrich, Steinheim, Germany) was added and the suspension was shaken, then incubated for 10 minutes at room temperature and centrifuged for 15 minutes at 4°C and a speed of 13,000 rpm. Approximately 600 µl of the supernatant was added to 500 µl isopropanol 100% (Sigma-Aldrich, Steinheim, Germany) in a new tube, inverted and incubated for 5 minutes at room temperature. After a centrifugation step for 10 minutes at 4°C and 13,000 rpm, the pellet was washed in 1 ml ethanol (75%) (Sigma-Aldrich, Steinheim, Germany), centrifuged again and then dried for 10 minutes. The pellet was resuspended in 50 µl nuclease free water (Thermo Fisher Scientific, Waltham, MA, USA).

4.2.2.4 RNA purification

In order to remove DNA impurities, DNase I was applied according to the DNase I protocol from Roche Diagnostics (Risch-Rotkreuz, Switzerland) for the duration of one hour. Further purification steps were performed following the instructions of the RNeasy Mini Kit (Qiagen, Venlo, Netherlands). The RNA concentration was measured with the spectrophotometer Tecan (Männedorf, Switzerland) at a wavelength of 260 nm.

4.2.2.5 RNA reverse transcription

To obtain cDNA, which is more stable than RNA, 4 µg RNA were applied and filled up with nuclease free water (Thermo Fisher Scientific, Waltham, MA, USA) to a total volume of 22 µl. The reaction mixture was denaturized at 70°C for 10 minutes, then, 18 µl of the reverse transcriptase master mix (Table 4.1) was added. After an incubation of 50 minutes at 37°C, the reaction was stopped by incubating at 70°C for 15 minutes and the cDNA was stored at -20°C until further use. Reverse transcriptase was replaced by nuclease free water for the negative control.

27 Table 4.1: Material for one RNA reverse transcription reaction.

Oligo dT (500µg/ml) 1 µl dNTP (10mM) 2,5 µl (0,5mM) 5x FS-Puffer 8 µl (1x) 0,1 M DTT 4 µl (0,01M) RNase Inhibitor RiboLock (40 U/µl) 1 µl (40 U) M-MLV Reverse Transcriptase (200 U/µl) 1,5 µl (300 U)

4.2.2.6 Agarose gel electrophoresis

The PCR products were analyzed with an agarose gel electrophoresis. This allows the separation of PCR products according to their size and charge. Therefore, agarose was heated to dissolve in 1x Tris-borate-EDTA (TBE) buffer. After cooling down, one drop of 0.07% Ethidium bromide solution (AppliChem, Darmstadt, Germany) per 50 ml agarose gel was added. When the gel was polymerized, the samples were mixed with a loading dye (Orange G, Sigma-Aldrich, St. Louis, MO, USA) and together with the molecular weight markers applied to the gel. Depending on the size of the gel, an electric field of 80-130 V was applied. The PCR products were detected with the E-Box VX5 documentation system (Peqlab Biotechnologie, Erlangen, Germany).

4.2.3 Polymerase chain reaction (PCR)

4.2.3.1 Standard polymerase chain reaction

The polymerase chain reaction (PCR) is a method to amplify a specific region of the DNA. The material used for a reaction volume of 25 µl is listed in Table 4.2. All components were mixed together and the reaction was performed according to the program in Table 4.3. The varying temperatures and the number of cycles were chosen depending on the size of the amplified DNA template. DNA was replaced by nuclease free water for the negative control.

Table 4.2: Material for one standard PCR reaction.

Forward primer (0,4 µl) 1 µl Reverse primer (0,4 µl) 1 µl Template DNA (100-1.000ng/ µl) 1 µl Nuclease free water 10.5 µl Quick-Load ® Taq 2x master mix 12.5 µl

Table 4.3: Program for a standard PCR reaction.

94°C 2 min 94°C 30-60 sec 54-64°C 60 sec 28-35 cycles 72°C 60 sec 72°C 5 min 15°C ∞

4.2.3.2 Semi-quantitative polymerase chain reaction

A semi-quantitative PCR can be used to quantify gene expression and to compare the transcription rates of specific RNA transcripts in cells. Therefore, a defined amount of cDNA, derived from the RNA extraction and reverse transcription of the primary fibroblasts (described in 4.2.2), is applied to a PCR reaction with specific primers. The PCR product was transferred to a 2% agarose gel (see 4.2.2.6) and the expression rate was visually analyzed and the transcription rate was estimated according to the strength of the band (the stronger the band, the higher the RNA transcription rate).

4.2.3.3 Real-time quantitative polymerase chain reaction (RT-PCR, qPCR)

In order to quantify the mRNA expression of cells, the real-time quantitative PCR (RT- PCR, qPCR) is used with a cDNA template. The main principle of this method is that a fluorescent dye is attached to the amplified cDNA in proportion to the amount of amplified cDNA. The higher the RNA expression, the stronger the fluorescent signal. This signal was measured during the reaction. The reaction mixture consisted of the components listed in Table 4.4. The cDNA and the primers were vortexed for a minimum of 20 seconds to obtain consistent results and the reaction was performed with the cycler CFX 384 (Biorad, Hercules, CA, USA). The PCR program is shown below Table 4.5. Data was analyzed with the Biorad CFX manager (Biorad, Hercules, CA, USA) and GraphPad Prism 6 (GraphPad Software Inc., La Jolla, CA, USA).

29 Table 4.4: Material for one qPCR reaction.

cDNA (4 µg) 1 µl Forward primer (0.25 µM) 1 µl Reverse primer (0.25 µM) 1 µl Yellow Sub 1:333 2x QuantiTect SYBR® Green PCR Master Mix 5 µl

Table 4.5: Program for the qPCR reaction.

95°C 15 min 95°C 15 sec 60°C 30 sec 42 cycles 72°C 30 sec 72°C 5 min 15°C ∞

4.2.3.4 Sanger sequencing

The Sanger sequencing method is used to obtain the sequence of a specific DNA template. The principle applied is called chain-termination sequencing. The starting material is the purified PCR product of a previous reaction (see 4.2.2.1) which is used as the DNA template for the sequencing reaction. Purification was achieved by adding 3.5 µl nuclease free water, 1 µl Antarctic phosphatase (NEB, Ipswich, MA, USA), 0.5 µl Exonuclease I (NEB, Ipswich, MA, USA) to the PCR product and incubating the mixture according to the following program (Table 4.6).

Table 4.6: Program for a PCR purification reaction.

37°C 15 min 80°C 15 min 10°C 15 min 4°C ∞

The sequencing reaction contained the components that are listed in Table 4.7 and was performed using the BigDye ® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Waltham, MA, USA). The BigDye® Reagent contains deoxynucleosidetri- phosphates (dNTPs) and dideoxynucleosidetriphosphates (ddNTP), which are fluorescently labeled.

30 Table 4.7: Material for one Sanger sequencing reaction.

PCR product 1 µl Primer (forward/reverse) 1 µl 5x Sequencing buffer 2 µl DMSO 0.5 µl Nuclease free water 4.5 µl BigDye® Reagent 1 µl

All components were mixed together. The PCR program is shown in Table 4.8.

Table 4.8: PCR-program for the Sanger sequencing reaction.

96°C 60 sec 96°C 15 sec 55°C 5 sec 29 Cycles 60°C 2 min 15°C ∞

In the next step, a plate with Sephadex G-50 Fine (GE Healthcare Life Sciences, Chalfont St Giles, UK) was used. Ten µl of the sample were added to each well and centrifuged into 10µl Hi-Di formamide (Thermo Fisher Scientific, Waltham, MA, USA) for 10 minutes at a speed of 3.000 rpm and 4°C. Processed sample plates were placed in the sequencer 3130 XL Genetic Analyzer (Applied Biosystems, Waltham, MA, USA). To analyze the sequencing results, the Sequencher® version 4.9 sequence analysis software (Gene Codes Corporation, Ann Arbor, MI, USA) and Sequencing Analysis, Version 5.4 (Applied Biosystems, Waltham, MA, USA) and SEQUENCE Pilot 3.5.2 (JSI medical systems GmbH, Kippenheim, Germany) were used.

31 4.2.4 Cloning of DNA fragments

Molecular cloning uses living organisms to amplify specific DNA sequences. Therefore, a PCR product is inserted in a cloning vector, which is then introduced into the host organism.

4.2.4.1 Ligation

The insert DNA was ligated to the vector in the following reaction and incubated at room temperature for 20 minutes.

Table 4.9: Material for a TOPO cloning reaction.

Insert DNA 4 µl pCR II Topo vector 1 µl Salt solution 1 µl

In the mean time, the competent E. coli were thawn on ice.

4.2.4.2 Heat shock transformation

To insert the plasmid containing the insert DNA to the chemically competent E. coli (Life Technologies, Carlsbad, CA, USA), a heat shock was used. Six µl of the cloning reaction were added to the cells and incubated for 20 minutes on ice. In the next step, the solution was heat shocked at 42°C for 30 seconds and after a 2 minute incubation on ice 250 µl of S.O.C. medium (Life Technologies, Carlsbad, CA, USA) was added. After an incubation of one hour at 37°C on the shaker, 100 µl of the solution were plated on an agar plate. The agar plates contained ampicillin (Roche, Bale, Switzerland) with a dilution factor of 1:1000, 1:500 Isopropyl-β-D-thiogalactopyranosid (IPTG) (AppliChem, Darmstadt, Germany) and 1:500 5-Brom-4-chlor-3-indoxyl-β-D- galactopyranosid (X-gal) (AppliChem, Darmstadt, Germany) and were incubated over night at 37°C.

4.2.4.3 Selecting transformed bacteria

Only bacteria with the resistance against ampicillin, which is encoded in the pCRII- TOPO vector, grow on agar plates with ampicillin. Bacteria colonies that contain the plasmid and the insert can be differentiated from those without the insert by their color. Bacteria that don’t contain the insert are blue because the gene encoding the β- galactosidase is not interrupted by the insert and therefore X-gal may be cleaved to form a bright blue insoluble pigment. That is why only white colonies containing the insert were picked using a tooth pick. The tooth pick was used to distribute the 32 bacteria in a PCR tube. Then the tooth pick was incubated over night at 37°C shaking with 225 rpm in a tube with 4 ml LB medium (Luria broth, Sigma-Aldrich, St. Louis, MO, USA) and ampicillin in a quantity of 1:1000. A PCR was performed to identify the colonies used for plasmid isolation.

4.2.4.4 Plasmid isolation

With the EndoFree Plasmid Mini Kit from Qiagen (Venlo, Netherlands), the plasmids were isolated from the bacteria. All steps were performed according to the protocol. This procedure is called mini preparation because a small amount of DNA is isolated.

4.2.5 Proteins

4.2.5.1 Protein isolation from fibroblasts

To analyze the effects of a mutation on the protein level, we extracted the proteins from the primary fibroblasts. To do so, we seeded one million cells per 10 cm cell culture dish and isolated the proteins the next day. All steps were performed on ice. The growth medium was removed and the cells were washed with PBS. Then, to start the process of lysis, 1 ml RIPA buffer was added to the cells and they were detached from the dish with a scratcher, transferred to a 2 ml safe-lock tube and vortexed. After an incubation of 20 minutes, the samples were placed in an ultra sonic homogenizer (HTU SONI-130 MiniFIER, G. Heinemann, Schwäbisch Gmünd, Germany) to fragment the cells. An on/off-interval of 10 seconds for a total of 200 joules was used. Before storing the protein containing supernatant at -20°C, the samples were centrifuged at a speed of 13,000 rcf for 10 minutes at 4°C.

4.2.5.2 Protein quantification

To quantify the protein concentration, the Bio-Rad Protein Assay (Bio-Rad Laboratories, Hercules, CA, USA), based on the Bradford protein assay, was used. In this assay, a dye binds to the proteins and shifts the spectrum of absorbance of the sample from red to blue. The binding of the dye is proportional to the protein concentration of the sample. Its maximum absorption spectrum is at 595 nm. To measure the protein concentration, the mean of three standard curves was determined using a defined concentration of bovine serum albumin (BSA), (Sigma- Aldrich, St. Louis, MO, USA). All sample concentrations were measured as duplicates. The assay was performed in a 96 well plate on ice. First, 56 µl Millipore water was pipetted to the wells for the samples and 40-60 µl to the wells of the standard curves.

33 The next step was to inject the proteins: 4 µl of the sample or 0-20 µl BSA were added to obtain a total volume of 60 µl per well. Simultaneously, 140 µl of a 2:5 mixture of Bradford reagent (Bio-Rad Protein Assay Reagent, Bio-Rad Laboratories, Hercules, CA, USA) and water were pipetted and thoroughly mixed. After an incubation of approximately 20 minutes, the extinction rate was detected at 595 nm with the UV/VIS-Spectrophotometer Infinite M200 PRO (Tecan, Männedorf, Switzerland). With the help of the standard curve and Microsoft Excel (Microsoft, Seattle, WA, USA), the protein concentration of each sample was calculated.

4.2.5.3 Protein precipitation

For further use of the proteins in an SDS-PAGE assay and western blotting, 200 µg protein were precipitated in the ninefold volume of ice-cold acetone (100%, Roth, Karlsruhe, Germany). The samples were stored at -20°C for a minimum of one night.

4.2.5.4 SDS-PAGE (Sodium dodecyl sulfate polyacrylamide gel electrophoresis)

This kind of polyacrylamide gel electrophoresis is used to separate proteins according to their molecule size. The precipitated proteins were centrifuged for 10 minutes at 13,000 rpm and 4°C. After decanting the supernatant and air-drying the pellet on ice, it was resuspended in 26 µl twofold western blot loading buffer. The gel consist of two parts, an upper stacking gel to align the samples in one level and a bottom running gel to separate the proteins by size. An electric current induces the migration of the proteins across the gel. First, the 10%-running gel was prepared with the following components:

Table 4.10: Material for a 5 ml 10%-SDS-PAGE running gel.

Water 1.9 ml 1.5 M Tris (pH 8.8) 1.3 ml 10% SDS 50 µl 10% APS 50 µl 30 % Acrylamid 1.7 ml TEMED 2 µl

To straighten the gel, 50 µl butanol (Roth, Karlsruhe, Germany) were added and the gel was left to polymerize for 30-45 minutes. The butanol was removed and the larger- pored stacking gel with the comb was added (Table 4.11) and left to dry for another 30-45 minutes.

34 Table 4.11: Material for a 3 ml 10%-SDS-PAGE stacking gel.

Water 2.1 ml 1 M Tris (pH 6.8) 0.38 ml 10% SDS 30 µl 10% APS 30 µl 30 % Acrylamid 0.5ml TEMED 3 µl

The gel was attached in a gel caster, onefold running buffer was added and the comb was removed. The next step was to denature the proteins in a 95°C heating block for 5 minutes. Afterwards, the samples were immediatley transferred to ice. 10-15 µl of the sample, 6 µl Page Ruler Prestained Protein Ladder or 8 µl High Range Ruler (both Thermo Fisher Scientific, Waltham, USA) as molecular weight size markers were injected in the sample wells. An electric field of 70 V was applied to the gel, after one hour the energy was increased to 95 V for approximately three hours.

4.2.6 Western blotting

Subsequent to the SDS-PAGE, the proteins were blotted to a nitrocellulose membrane. To do so, a fiber pad and the gel were put in transfer buffer, consisting of 40 ml 10x transfer buffer, 300 ml milipore water and 60 ml methanol (Roth, Karlsruhe, Germany) and the stacking gel was cut off. The running gel was transferred to a cassette containing the fiber pad and covered with a water-soaked Hyebond ECL membrane (GE Healthcare Life Sciences, Chalfont St Giles, UK) and four sheets of Whatman paper (GE Healthcare Life Sciences, Chalfont St Giles, UK). The cassette was attached in a chamber with transfer buffer in a horizontal electric field of 100 mA over night.

35 4.2.6.1 Immuno-blotting

Blotted to a nitrocellulose membrane, the proteins are accessible for detection through antibodies. To prevent non-specific binding of the antibodies, the membrane was placed in blocking milk at room temperature on a shaker. Blocking milk contains 0.5 g non-fat dry milk (Roth, Karlsruhe, Germany) and 10 ml PBS/Tween. After one hour, the membrane was incubated with the primary antibody at 4°C on a shaker over night. The primary antibodies were diluted in blocking milk as shown in Table 4.12.

Table 4.12: Antibody dilution for Western blot, diluted in blocking milk.

Anti-TRIP11 1:1000 Anti-IFT20 1:250 Anti-LBR 1:500 Anti-β-Actin 1:5000

The following day, the primary antibody was poured off and the membrane was washed three times for 10 minutes with one fold PBS/Tween to remove unbound primary antibodies. Next, the horseradish peroxidase-linked (HRP) secondary antibody was applied, diluted in blocking milk with a concentration of 1:5000, for one hour at room temperature. Through chemiluminescence, the specific protein-bound antibodies were detected with the imaging system Fusion Fx Vilber Lourmat (Peqlab Biotechnologie, Erlangen, Germany). To do so, the membrane was washed three times for 15 minutes with PBS/Tween, then covered with 1 ml Amersham ECL Prime Western Blotting Detection Reagent (GE Healthcare Life Sciences, Chalfont St Giles, UK) and placed in the Fusion detection system. For further use of the membrane, the antibodies were removed by three washing steps for 5 minutes each with water, then with 0.2 M NaOH and again with water. After exposing the membrane to blocking milk for one hour at room temperature, the next primary antibody could be used.

36 5 RESULTS

5.1 The mutations causing ACG1A and ODCD are variable

Mutations in the TRIP11 gene were previously identified as the underlying genetic cause of ACG1A and ODCD. To confirm the genotype of the original material, we analyzed primary fibroblasts from patient-derived skin biopsies for their mutational status.

5.1.1 Sequencing results of patients diagnosed with ACG1A and ODCD

In this study, primary fibroblasts of three ACG1A patients and three ODCD patients were cultivated for direct mutation analysis of TRIP11. In the following, the patients are numbered one through six (Pat. 1-6).

Patient 1 is the fetus of a consanguineous Turkish couple. The pregnancy was terminated at 21 weeks and 5 days gestational age because the fetus presented with extremely short arms and legs in an ultrasound examination. At the time, the parents were both 25 years old. Several independent experts diagnosed patient 1 with ACG1A. Clinical features that are characteristic of ACG1A (as described in Bone Dysplasias: An Atlas of Genetic Disorders of Skeletal Development, Spranger et al., 2012) such as a short trunk, a prominent abdomen, hydropic appearance and short long bones were recognized (Figure 5.1a) and b)). The radiographs (Figure 5.1 c) and d)) show a delayed ossification of the spine and the pelvis, the ribs are oriented horizontally and give the thorax a barrel shape. The long bones are extremely shortened and show spurs at the metaphyses. Although these findings suggest ACG1A as the correct diagnosis, no pathogenic mutation in TRIP11 was detected in patient 1 (see also Herrmann, 2011).

Figure 5.1: Patient 1 presents with hydrops, shortened extremities, protruding abdomen and short trunk. Clinical photographs a) frontal, b) lateral and radiographs c) frontal, d) lateral of patient 1. There is a delayed ossification of the spine and the pelvis. The thorax is barrel shaped with horizontally oriented ribs. The long bones are extremely shortened and show spurs at the metaphyses.

38 Patient 2 and patient 3 displayed ACG1A with previously identified TRIP11 mutations co-segregating with the disease phenotype. Patients 4-6 were diagnosed with ODCD, also known to carry biallelic TRIP11 mutations (Table 5.1, Figure 5.2).

Figure 5.2: Pedigrees of the families from patient 1-6. Each parent carries a TRIP11 mutation, indicated by a centered dot, except for the parents of patient 1. The offspring affected by the disease is represented by black circles (female), squares (male) and diamonds (unknown gender).

To confirm the genotype of the patients’ cells, genomic DNA was extracted from cultivated primary fibroblasts and Sanger sequencing of the TRIP11 gene was performed. The detected nucleotide changes and their corresponding electropherograms are shown in the supplemental data. As can be seen in Figure 5.2, all patients with TRIP11 mutations carry the mutations in a compound heterozygous state except for patient 2, carrying a homozygous TRIP11 mutation. There are variable mutations, predominantly small deletions and point mutations, often located in exon 11 and predicted to cause a frame-shift and/or premature stop codon in the TRIP11 open reading frame (ORF). Figure 5.3 summarizes the different locations of the mutations in TRIP11 in a graphical overview.

39 Table 5.1: Patients diagnosed with ACG1A and ODCD. The table shows the mutation sites for the TRIP11 gene and the corresponding predicted changes on the protein level in different patients (Pat. 1-6). The patients vary in their origin and mutation status. Of the individuals diagnosed with ACG1A, one patient does not carry a TRIP11 mutation (patient 1), one is homozygous (patient 2) and one is compound heterozygous (patient 3) for TRIP11 mutations. All ODCD patients are compound heterozygous for TRIP11 mutations (patients 4-6).

Con- Nucleotide Changes in Predicted Amino Acid Patient Diagnosis Origin Status Location sanguinity TRIP11 Changes

1 ACG1A Turkish Yes None None - -

c.[3671G>A] p.[(Trp1224*)]; 2 ACG1A Italian Yes Homozygous Ex11 c.[3671G>A] p.[(Trp1224*)]

c.[3478C>T] p.[(Gln1160*)]; Compound 3 ACG1A Italian No Ex11 c.[3499C>T] p.[(Arg1167*)] heterozygous

c.[1622delA] p.[(Lys541Argfs*17)]; Compound Ex11 4 ODCD German No c.[5416A>G] p.[(Met1806Val)] heterozygous Ex18

c.[1228G>T] p.[(Asp410Tyr)]; Compound Ex9 5 ODCD Turkish No c.[4815_4818delAGAG] p.[(Glu1606Leufs*3)] heterozygous Ex13

c.[586C>T] p.[(Gln196*)]; Ex4 Compound 6 ODCD Thai No c.[790C>T] p.[(Arg264*)] Ex6 heterozygous c.[3593G>A] p.[(Gly1198Asp)] Ex11

Figure 5.3: Different mutations in TRIP11 lead to ACG1A or ODCD. Schematic drawing of the largest transcript of TRIP11 based on the reference sequence ENST00000267622 from Ensembl, 2016. Exons 1-21 are represented as boxes, the size of the box correlates with the number of base pairs of each exon. The introns are represented as horizontal lines and not to scale. The relative position of disease-associated mutations is indicated. ACG1A-associated variants are on the top, colored in green. ODCD-associated variants are listed in blue at the bottom.

5.1.2 Whole exome sequencing detects a homozygous LBR mutation in patient 1 Since a TRIP11 mutation was excluded in patient 1, whole exome sequencing (WES) was performed. The analysis revealed a homozygous lamin B receptor (LBR) mutation in case 1 located at the exon-intron boundary of exon 3. This finding and the co-segregation of the mutation in the heterozygous state in the parents were confirmed by Sanger sequencing (Table 5.2 and Figure 5.4).

Table 5.2: LBR mutation in patient 1. The table shows the mutation status of patient 1 for the gene LBR. The DNA was derived from fetal tissue. Con- Patient Origin Nucleotide Changes in LBR Status Location sanguinity 1 Turkish Yes c.[366+1G>T] Homozygous Ex3

41 Figure 5.4: Identification of an LBR mutation in patient 1. a) WES shows LBR mutated in the family of patient 1. The analysis of the WES data shows a homozygous intron mutation in the LBR gene of patient 1 and a corresponding heterozygous mutation in the parents. The mutation is located in the intron between exon three and four (c.[366+1g>t], based on the Ensembl database, ENST00000338179.6, 2016). b) Case 1 carries a homozygous mutation in the intron between exon three and four in the LBR gene confirmed by Sanger sequencing. The mutation is located at the exon- intron boundary. c) Pedigree of the family of case 1. The consanguineous parents carry a heterozygous mutation in LBR.

42 5.2 Molecular characterization of disease-associated genes in patient-derived primary cells To define ACG1A and ODCD on the molecular level, the primary cell culture is a suitable method to analyze patient-specific RNA expression of target genes and disease-associated proteins. By comparing the primary fibroblasts of our patients with matched control cells of healthy individuals, we further characterized the effect of the different genomic mutations (see section 1.1 and 1.2) on the transcriptional level.

5.2.1 The LBR mutation in case 1 leads to mis-splicing and a premature stop in the LBR open reading frame Mutations at the exon-intron boundary are predilection sites for mis-splicing. In case 1, the mutation was predicted to cause mis-splicing by several in silico prediction tools (see supplemental data). To confirm mis-splicing, the effect of the mutation in LBR in case 1 was tested on the mRNA level via a PCR with primers spanning the region of the mutation. The product of the defective splicing, depicted in Figure 5.5, was smaller compared to the PCR product of the controls. This implied that a part of exon three is missing in the patient- derived cDNA.

Figure 5.5: A part of exon three is spliced out in patient 1.Shown is an agarose gel documentation. RNA was extracted from primary fibroblasts and transcribed into cDNA. The primers used span exons 2 and 4. The PCR product in the patient is smaller than in the controls. This is due to mis-splicing leading to a partial deletion of exon 3 in patient 1. Experiment without reverse transcriptase is indicated by (-RT).

The LBR mutation of case 1 affects the splice donor site of exon 3. As shown in Figure 5.6, sequencing of the smaller PCR product revealed that the splicosom uses an ectopic splice site in exon 3. This mis-splicing is predicted to result in a premature stop codon.

Figure 5.6: The intronic LBR mutation of patient 1 leads to mis-splicing. a) The mutation leads to an ectopic splice site in exon 3 and hence mis-splicing. This is predicted to result in a frameshift and a premature stop in the LBR open reading frame (ORF). b) cDNA electropherogram sequence of the mis-spliced region.

5.2.2 The abundance of LBR RNA is strongly reduced in case 1 and to a lesser extent in two of the ODCD patients To get an impression of the mRNA abundance of LBR in the fibroblasts of ACG1A and ODCD patients, we amplified the cDNA with primers specific for LBR. As can be seen in the gel documentation, the semi-quantitative analysis revealed a weaker signal of the PCR product in case 1 compared to the controls (Figure 5.7). This may indicate the nonsense-mediated decay of LBR, caused by the mis-spliced RNA transcript due to the mutation (c.[366+1G>T]) that is predicted to lead to a premature stop in the LBR open reading frame (ORF). In contrast, the LBR abundance of the ACG1A cases (case 2 and 3) seemed to be slightly increased compared to the controls, while there was no obvious difference detected in the strength of the PCR- signal in the ODCD patients (Pat. 4-6).

Figure 5.7: The LBR mRNA abundance is strongly reduced in case 1.Gel documentation of a semi-quantitative PCR analysis. RNA was extracted from primary fibroblasts and transcribed into cDNA. In patient 1, LBR (488 base pairs) is barely detectable. In contrast, the signal is elevated in the ACG1A patients 2 and 3 as compared to matched controls. TBP was used as a loading control. Controls without reverse transcriptase are indicated by (-RT); control sample without RNA is indicated by (H2O).

In order to confirm and further quantify the results of the semi-quantitative PCR, we performed a real-time quantitative PCR. As demonstrated in Figure 5.8, the expression of LBR was indeed significantly reduced in case 1, compatible with the assumption of nonsense-mediated decay of the aberrant transcript. Even if the highest expression level was detected in case 2, there was no significantly stronger signal for the LBR mRNA detected in the ACG1A cases. In contrast, the LBR expression was significantly reduced in two of the ODCD patients (patient 4 and patient 6). In conclusion, there is a variation of the LBR mRNA abundance in fibroblasts of ACG1A and ODCD patients compared to controls that may be relevant for the pathogenesis of both diseases.

Figure 5.8: The LBR mRNA abundance is significantly decreased in patient 1. Real-time quantitative PCR analysis of cDNA derived from primary fibroblasts. LBR mRNA is significantly reduced in case 1 compared to the control group. It is also significantly reduced in two of the ODCD patients (patient 4 and patient 6), calculating a p-value for * <0.05; ** <0.01; *** <0.001; **** <0.0001. Non-significant variables are marked with ns. For the experiment, the average expression of the controls (n=3) was calculated and set to 1. Expression of LBR was normalized to TBP.

5.2.3 Novel splice site mutations were detected in TRIP11

We further investigated the mutational effect on the RNA level in patients with a potential mis-splicing of the TRIP11 gene. Indeed, the c.[5416A>G] mutation of patient 4 in exon 18 that was originally predicted to cause a missense change in the TRIP11 protein, was previously shown to cause mis-splicing instead of a single base pair substitution (Herrmann, 2011). To confirm this, we inserted a PCR product spanning the region of the mutation into a vector for bacterial cloning. Interestingly, the sequence analysis of the inserted DNA of the individual clones revealed the known mis-spliced variant although the effect was not fully penetrant: we also found the predicted base pair substitution (Figure 5.9). This finding raised the question of a TRIP11 transcript that leads to a TRIP11 missense protein (p.[Met1806Val]) with a residual function in the fibroblasts of patient 4.

Figure 5.9: The c.[5416A>G] mutation of patient 4 causes both a missense mutation and aberrant splicing.Shown are the electropherograms of the sequence analysis of the inserted PCR fragments in individual bacterial clones originally amplified from the cDNA of patient 4 and a control. Mutation site marked in red. The predicted missense mutation p.M1806V was confirmed in patient 4 at least on RNA level through an exchange from deoxyadenosine to deoxyguanosine. In addition, the patient displays a mis-splice mutation, shown here as well as by Hermann, 2011. The model demonstrates the effect of the aberrant splicing. Exon 18* stands for the spliced version of exon 18.

In further analysis, a splice mutation was also found in patient 5. The c.[1228G>T] mutation in exon 9 leads to an ectopic splice pattern in patient-derived primary cells. Semi-quantitative PCR analysis of the patients cDNA with primers spanning the region of interest revealed different isoforms of TRIP11 generated through alternative splicing (Figure 5.10).

Figure 5.10: Patient 5 carries a splice mutation. Gel documentation of a semi-quantitative PCR analysis of cDNA from primary fibroblasts. The 362 bp band represents the wild type fragment size. Note that a faint band is also visible in the patient’s lane. The 275 bp fragment represents an isoform of TRIP11 without exon 9. This fragment is also detectable in the control lane but in a far smaller abundance.

Inserting the PCR product into a vector, bacterial cloning and sequencing of the inserts revealed different abundances of the splice products. While the control sequences were mainly wild type with a small fraction of in-frame splice variants without exon 9, the patient’s sequences showed a higher abundance of a fragment missing exon 9. Importantly, there was no sequence with the predicted nucleotide exchange c.[1228G>T]. This implies that the mutation in exon 9 does either not lead to a single base pair substitution at all or at least not in a high frequency. The different splice variants, represented by the PCR products of individual bacterial clones that were detected in patient 5 and controls, are shown in Figure 5.11. Since there is a known natural isoform of TRIP11 that lacks exon 9, this raises the question of a residual functional TRIP11 protein in patient 5.

Figure 5.11: The c.1228G>T transversion in exon 9 results in an altered splice pattern in patient 5.a) Exon-spanning cDNA amplicons (Figure 5.10) were inserted into pCRII-TOPO and cloned into bacteria. Shown is the gel documentation of a colony PCR with M13 forward and reverse primer of control- (above) and patient-derived clones (bottom); 1 and 2 mark the clones that were sequenced and counted. Iso 1 (isoform 1) refers to the wild type sequence, Iso 2 (isoform 2) refers to the variant without exon 9 (see also Figure 3.3). The number in brackets refers to the ratio number of the different isoforms based on the size of the PCR products. While the control cDNA sequences were mainly wild type with a small fraction of Iso 2 (16:4), the ratio in the patient’s fibroblasts was different (2:8). b) The diagram depicts the distribution of Iso 1 and 2 in the control compared to patient 5.

In patient 6, the mutations in exon 4 and exon 6 in TRIP11 were predicted to lead to a premature translational stop codon in the TRIP11 open reading frame (ORF). However, the RT-PCR analysis of patient-derived cDNA with exon-spanning primers revealed a transcript that lacks exon 4. This indicates that the mutation c.[586C>T] leads to aberrant splicing rather than creating a premature stop (Figure 5.12). Since there is a TRIP11 isoform described that lacks exon 4, there may be a translation of a TRIP11 protein with residual function in the fibroblasts of patient 6.

Figure 5.12: Patient 6 expresses a TRIP11 transcript without exon 4. a) Shown is a gel documentation of a semi-quantitative PCR with cDNA from primary fibroblasts. Patient 6 carries a mutation in exon 4 of the TRIP11 gene. The primers used span the region of the mutation. A transcript with the size of 229 bp is only visible in patient 6, corresponding to the size of a transcript lacking exon 4. In the controls, the wild type isoform with an expected size of 505 bp is detectable; -RT: negative controls without reverse transcriptase. b) Schematic drawing of aberrant splicing of exon 4 in patient 6. Sanger sequencing of the 229 bp cDNA amplicon confirms aberrant splicing.

In conclusion, each individual mutation analyzed in the ODCD patients fibroblasts raises the possibility of the transcription of an altered TRIP11 transcript (either with a base pair substitution or via alternative splicing) creating an shorter TRIP11 in the same open reading frame. This may lead to a TRIP11 protein with residual functions.

5.2.4 The abundance of TRIP11 RNA is reduced in ACG1A and ODCD patients but elevated in case 1 carrying an LBR mutation To further investigate the effect of the different TRIP11 mutations on the RNA level, we quantified the TRIP11 mRNA abundance using a semi-quantitative PCR approach. TRIP11 mRNA seemed to be reduced in two ACG1A cases (patients 2 and 3) and, even if to a lesser extent, in all ODCD patients (patients 4-6) compared to controls. This may indicate a nonsense-mediated decay of the TRIP11 mRNA in these five patients. In case 1, the PCR product showed the strongest signal in the gel documentation. No significant differences in the transcript amounts of IFT20, a direct protein interaction partner of TRIP11, were detected (Figure 5.13). The mRNA abundance was quantified by real-time quantitative PCR (Figure 5.14 and Figure 5.15).

Figure 5.13: The mRNA abundance of TRIP11 is reduced in ACG1A and ODCD patients but increased in case 1, IFT20 shows a similar signal compared to controls. Gel documentation of a semi-quantitative PCR in primary fibroblasts. In patients 2-6 a weaker signal of TRIP11 (240 bp) was detected, with the lowest signal in patients 3 and 4. Of all samples, patient 1 displayed the strongest signal for TRIP11. For IFT20, indicated by the PCR product with the length of 81 base pairs, no difference was observed between patients and controls. The house keeping gene used was TBP (143 base pairs) was used. Negative controls without reverse transcriptase (-RT) and without RNA (H2O) showed no signal.

Figure 5.14: The expression of TRIP11 is significantly decreased in patients 2-6 and significantly elevated in case 1. The real-time quantitative PCR shows a significantly lower expression of TRIP11 in two ACG1A and in all ODCD patients. ODCD patients (patients 4-6) have a slightly higher expression of TRIP11 mRNA abundance than ACG1A patients (patient 2 and 3). The TRIP11 expression is significantly increased in case 1. The p-value was calculated for * <0.05; ** <0.01; *** <0.001; **** <0.0001. All results were normalized to TBP. For the experiment, the average expression of the controls (n=3) was calculated and set to 1.

Figure 5.15: The expression of IFT20 is not significantly altered in all patients compared to controls. The graph shows the result of a real-time quantitative PCR for IFT20. The expression level varies not significantly (ns). RNA from primary fibroblasts was extracted and transcribed into cDNA. All results were normalized to TBP. For the experiment, the average expression of the controls (n=3) was calculated and set to 1.

To summarize, the semi-quantitative PCR and the real-time qPCR showed a strong reduction of TRIP11 mRNA in ACG1A cases 2 and 3 very likely caused by nonsense- mediated decay because of premature stops in the TRIP11 ORF. A reduction of TRIP11 was also observed in the ODCD patients, though to a lesser extent. This may indicate the presence of residual functional TRIP11 transcripts in these patients. In contrast, a significant increase in the TRIP11 mRNA abundance was found in case 1. Since this fetus carries a homozygous LBR mutation, there might be a regulatory relationship between LBR and TRIP11.

52 5.3 There are variable effects of the different mutations in ACG1A and ODCD on the protein level To further define ACG1A and ODCD on the molecular level and in view of the patient- specific RNA expression of target genes, we focused on a different regulatory level by investigating potential disease-associated proteins in the fibroblasts of our patients.

5.3.1 The LBR protein abundance is increased in patient 3

Since there might be an involvement of LBR in the pathogenesis of ACG1A, demonstrated by the ACG1A patient 1 with the homozygous LBR mutation, we tried to detect this protein in the protein lysates of the patients’ fibroblasts. In general, fibroblasts have a lower growth rate and a lower expression level of LBR compared to other cell types, e.g. HeLa cells (Clayton et al., 2010). A low abundance of LBR in fibroblasts might explain why the protein could not be detected in the control lysates. Nevertheless, LBR was detected in one ACG1A patient (patient 3, Figure 5.16). This finding is in line with the observation of a varying LBR mRNA expression level in the patients’ fibroblasts compared to the control cells (see Figure 5.8) and might indicate an aberrant regulation of this target either on the transcript and/or on the protein level.

Figure 5.16: Compared to controls without a TRIP11 mutation, the LBR protein amount is elevated in patient 3. Shown is a western blot analysis of protein lysates from primary fibroblasts. An LBR antibody was used to detect LBR at 67 kDa. LBR is only detected in patient 3. β-Actin was used as a loading control.

53 5.3.2 The TRIP11 protein is lost in ACG1A and ODCD patients

Trip11 is essential for anchoring Ift20 to the Golgi apparatus and the Ift20 interaction domain is highly conserved from mice to humans (Follit et al., 2008). Therefore, we were interested to see the effect of the different TRIP11 mutations on TRIP11 and IFT20 on the protein level. Figure 5.17 shows that the TRIP11 protein is absent in the cell extracts of fibroblasts of patients 2-5. Neither the full-length nor shortened variants with a reduced molecular weight were detected. In contrast, TRIP11 with a molecular weight similar to the full- length protein was detected in patient 6. In this case, the two mutations in a compound heterozygous state in exon 4 and exon 6 are both predicted to cause a premature stop. Though, the mutation in exon 4 was shown to cause a mis-splice (see 5.2.3). Therefore, the antibody may have detected an isoform of TRIP11 without exon 4, which was described previously in the literature (Ramos-Morales et al., 2001). The TRIP11 protein amount in patient 1 was comparable or even slightly elevated compared to the controls.

Figure 5.17: Patients with TRIP11 mutations lack the TRIP11 protein (patients 2-5). In patient 6, TRIP11 was detected. Shown is a western blot of protein lysates of primary fibroblasts. An N-terminal TRIP11-antibody was used and detected the protein at approximately 230 kDa. Controls 1-3 as well as case 1 do not have a mutation in TRIP11. The protein was detected in the lysates of these four subjects. Of the ACG1A and ODCD patients, only the lysate of patient 6 showed a detectable amount of TRIP11 protein. β-Actin was used as a loading control.

The finding that there is no TRIP11 protein detectable in patients with potentially residual functional transcripts (patients 4 and 5, see section 5.2.3) might indicate either a full loss of functional TRIP11 in these patients or a residual TRIP11 protein amount that lies below the detection limit of the method.

54 5.3.3 The IFT20 protein abundance is reduced in TRIP11-deficient primary cells Compared to controls, Western blot analyses with an IFT20 antibody revealed reduced amounts of IFT20 protein in all lysates of patient-derived primary fibroblasts lacking the TRIP11 protein. Patient 6 demonstrated the highest IFT20 protein abundance (Figure 5.18).

Figure 5.18: The IFT20 protein was reduced in all TRIP11-deficient patients. Shown is a western blot analysis of IFT20 in primary fibroblasts. The detected isoform of IFT20 at 15 kDa is conserved in humans and mice. Patients 1-6 show a reduced amount of IFT20 compared to controls 1-3. Of all patients, the signal intensity is highest in patient 6. As a loading control, β-Actin was used.

Since there was no difference of the expression of IFT20 on the transcript level (see section 5.2.4), this indicates a potential regulatory mechanism of TRIP11 and its direct interaction partner on the protein level. Importantly, this finding indicates a relevance of IFT20 for the pathogenesis of ACG1A and ODCD.

55 6 DISCUSSION

This study concentrates on the pathomechanism of the two skeletal dysplasias ACG1A and ODCD. Here we show the effect of pathogenic TRIP11 mutations on the mRNA and protein level in primary fibroblasts. In addition to TRIP11 and its direct interaction partner IFT20, we identify the lamin B receptor (LBR) gene as a possible determinant in the pathogenesis of ACG1A and ODCD. Although there is no clear genotype-phenotype correlation, the strong clinical heterogeneity of patients affected by ACG1A and ODCD may be at least partially explained by the molecular findings.

6.1 ACG1A may be caused by mutations in LBR

Verified by several independent experts, case 1 shows distinctive clinical features typical of ACG1A. To date, this lethal skeletal dysplasia is only known to be caused by recessive loss-of-function mutations of TRIP11. Nevertheless, a TRIP11 mutation was excluded and the TRIP11 protein abundance in the patient´s primary fibroblasts was comparable, or even increased, compared to controls. A lack of TRIP11 protein is therefore not the cause of the ACG1A phenotype in case 1. Instead, we identified a homozygous splice site mutation in the LBR gene via WES and confirmed it by Sanger sequencing. The LBR mutation c.[366+1G>T] leads to mis-splicing which results in a premature stop codon in the ORF of LBR. Accordingly, we found the LBR mRNA abundance in the fibroblasts of case 1 to be strongly reduced compared to cells of individuals without LBR mutations. This reduction is very likely caused by nonsense-mediated mRNA decay (NMD), a cellular mechanism to prevent the synthesis of aberrant proteins, in order to prevent harmful effects in the cell (reviewed in Lykke-Andersen and Jensen, 2015). The stop codon is located more than 50-55 nucleotides upstream of the 3’-most exon-exon junction and therefore makes the transcript amenable to NMD (Nagy and Maquat, 1998). Since both alleles are affected, this should result in a complete loss of the main isoforms of the LBR protein. Only a small transcript variant of LBR (encoded by isoform 4, see Figure 6.1) is not affected by the mutation and predicted to be translated into a functional protein (according to Ensembl; ENST00000338179.6, 2016).

Figure 6.1: There are four different protein-coding transcript isoforms of LBR.Shown is a schematic representation of the different LBR transcripts based on predicted protein-coding isoforms from Ensembl, ENST00000338179.6, 2016. Exons are shown as boxes, the size of the box correlates to the number of base pairs of each exon. The introns are represented as lines but not to scale. The exons are numbered 1-14 for the largest isoform (isoform 1, 3812 base pairs). Isoform 2 has a size of 3745 base pairs, isoform 3 874 base pairs and isoform 4 is 736 base pairs long. Indicated in red is the intronic mutation between exon 3 and 4 of patient 1.

LBR is composed of 615 amino acids (Ye and Worman et al., 1994). The protein has a structural as well as a functional role (Herrmann and Zwerger, 2010). It binds the nuclear lamina and DNA to the inner nuclear membrane through its N-terminus (Ye and Worman et al., 1994) and is engaged in the cholesterol biosynthesis pathway as a sterol reductase through its C-terminal domain (Silve et al., 1998, Waterham et al., 2003). LBR’s structural function is highlighted by the nuclear shape of granulopoetic cells, i.e. neutrophils, which are deformed and hypolobulated when mutations in LBR occur (Pelger-Huët anomaly; PHA, OMIM 169400). A homozygous LBR mutation can even lead to granulocytes with round nuclei which is then referred to as PHA homozygosity. Importantly, LBR is directly linked to different cell types of skeletal development. It is involved in murine and human osteochondral development, expressed in human osteoclasts, fibroblasts and throughout the growth plate cartilage, though to a lesser extent in the hypertrophic zone (Clayton et al., 2010). In general, there is a wide spectrum of disease manifestations that are linked to mutations in LBR. While individuals with heterozygous mutations in LBR and PHA do not display any clinical symptoms, compound heterozygous mutations have been shown to cause mild and seemingly innocuous anadysplasia-like spondylometaphyseal dysplasia (Sobreira et al., 2014). In addition, there is at least one patient

57 known who carries a homozygous splice acceptor mutation in LBR, displaying PHA homozygosity and suffering from cardiac malformations, mental retardation and skeletal abnormalities (Hoffmann et al., 2002). Other homozygous LBR mutations even show the severe clinical picture of hydrops-ectopic calcification-moth-eaten skeletal dysplasia (HEM)/ Greenberg dysplasia (GRBGD, OMIM 215140) with perinatal death, hydrops, ectopic calcifications and intense chondro-osseous malformations and micromelia (Greenberg et al., 1988). Although the specific function of the LBR protein is linked to its two distinct N- and C- terminal domains, it cannot be concluded that mutations at the N-terminus lead to PHA and mutations at the C-terminus to the lethal chondrodystrophy HEM/GRBGD (Borovik et al., 2013). Waterham and co-workers (2003) rather conclude that Greenberg dysplasia and homozygous PHA are “allelic disorders that display a wide clinical spectrum, with nonviable fetuses with HEM representing the severe end and minor limb defects representing the mild end of the spectrum“. Hoffmann et al., 2007, plead for an LBR dose-dependent severity of the disease displayed by the patients, with a reduced LBR expression leading to heterozygous PHA and null mutations to GRBGD. Case 1 carries a homozygous LBR mutation, which is predicted to lead to the loss of all protein isoforms with the exception of LBR-isoform 4 (see Figure 6.1). Although the lethal outcome of the phenotype is in line with an LBR dose-dependent severity of the disease, our patient is not affected by GRBGD but diagnosed with ACG1A. As can be seen in Figure 6.2, typical traits of GRBGD (Figure 6.2a) such as a moth-eaten appearance of the long bones, ectopic calcifications and hexadactyly (according to Clayton et al., 2010) are missing in case 1 (Figure 6.2b). In contrast, characteristics of ACG1A (Figure 6.2c), as described in Grigelioniene et al., 2013 are present. These similarities comprise a short trunk, hypoplastic ribs, a deficient mineralization of the spine and the pelvis and strongly shortened long bones with spurs at the metaphyses.

Figure 6.2: The phenotype of case 1 is typical for ACG1A and not for GRBGD. Displayed are post mortem radiographs of a case with GRBGD (a, Clayton et al., 2010), case 1 (b) and an ACG1A case (c, Grigelioniene et al., 2013). a) This image shows typical findings of GRBGD such as a moth-eaten appearance of the long bones, ectopic calcifications and hexadactyly, which cannot be seen in case 1. Images b) and c) display characteristic radiographic findings of ACG1A: a short trunk, hypoplastic ribs, a deficient mineralization of the spine and the pelvis and strongly shortened long bones with spurs at the metaphyses.

In this respect, our case broadens the clinical spectrum of LBR-associated diseases. A complete lack of the lamina-binding function and the cholesterol reductase activity of LBR in fibroblasts and in cell types linked to skeletal development might therefore explain the severe skeletal phenotype as well as the prenatal death of our patient and questions ACG1A to be a monogenic disorder.

6.2 Mutations in TRIP11 cause ACG1A and ODCD

Previously, it was shown that mutations in TRIP11 are the underlying genetic cause for ACG1A and ODCD (Herrmann, 2011). Accordingly, the fibroblasts of ACG1A cases 2 and 3 as well as ODCD patients 4-6 were all shown to carry mutations in this gene. Allelic variants range from small deletions to point mutations, often located to exon 11, the largest coding exon of TRIP11. In each case, we further investigated the mutational effect on the RNA level, thereby focusing on patients with a potential mis- splicing of the TRIP11 gene. Table 6.1 gives a summary of the predicted and confirmed findings, which will be discussed below.

59 Table 6.1: Mutational effects of TRIP11 in patients diagnosed with ACG1A and ODCD. The Table shows the mutation sites for the TRIP11 gene in patients 1-6 with the according predicted amino acid changes as well as the experimentally observed effects in the primary cells. Listed is also the functional domain affected by each mutation.

Affected Functional Experimentally Observed Con- Nucleotide Changes Predicted Amino Patient Diagnosis Origin Domain Mutational Effects Status Location sanguinity in TRIP11 Acid Changes (Amino acids) in Primary Cells

Increased TRIP11 mRNA, 1 ACG1A Turkish Yes None None None - - Detection of TRIP11 Protein

Truncation; c.[3671G>A] p.[(Trp1224*)]; All domains Strong reduction of TRIP11 2 ACG1A Italian Yes Homozygous Ex11 c.[3671G>A] p.[(Trp1224*)] mRNA, Loss of TRIP11 Protein

c.[3478C>T] p.[(Gln1160*)] Truncation; All domains Strong reduction of TRIP11 Compound 3 ACG1A Italian No Ex11 mRNA, Loss of TRIP11 heterozygous c.[3499C>T] p.[(Arg1167*)] Protein Frameshift/Truncation; Strong c.[1622delA] p.[(Lys541Argfs*17)] All domains Reduction of TRIP11 mRNA, Ex11 Loss of TRIP11 Protein Compound 4 ODCD German No Missense and Missplice; GRAB (1774-1823) heterozygous Strong Reduction of TRIP11 c.[5416A>G] p.[(Met1806Val)] and TRBD Ex18 mRNA, Loss of TRIP11 (1754-1867) Protein Coiled-coil No Missense but Missplice c.[1228G>T] p.[(Asp410Tyr)]; Ex9 (420-438) leading to loss of exon 9 Compound 5 ODCD Turkish No Framehift/Truncation; heterozygous c.[4815_4818delAGAG] p.[(Glu1606Leufs*3)] All domains Reduction of TRIP11 mRNA, Ex13 Loss of TRIP11 Protein Coiled-coil No Missense but Missplice c.[586C>T] p.[(Gln196*)] Ex4 (105-196) leading to loss of exon 4 Truncation; c.[790C>T] p.[(Arg264*)] All domains Reduction of TRIP11 mRNA, Compound Ex6 6 ODCD Thai No Detection of TRIP11 Protein heterozygous RbBD (1099-1255) c.[3593G>A] p.[(Gly1198Asp)] IFT20 binding-site Missense Ex11 (1157-1319)

60 In cases 2 and 3, diagnosed with ACG1A, the mutations were predicted to lead to an early stop codon in the TRIP11 ORF. In both cases, the location of the premature termination codon subject the transcripts to NMD (Nagy and Maquat, 1998). In line with this, no TRIP11 protein was detected by Western blotting in the protein lysates of cases 2 and 3. This full loss of TRIP11 protein might explain the severe phenotype of ACG1A in these cases.

6.3 TRIP11 transcripts with a potential residual function are detected in ODCD patients In contrast to the loss of TRIP11 in the ACG1A cases 2 and 3, mis-splicing and transcripts that might be translated into proteins with residual functions were found in ODCD patients: Besides the c.[1622delA] mutation that is predicted to cause NMD, patient 4 was shown to carry the base pair substitution c.[5416A>G] of TRIP11 in a compound heterozygous state. The experimental data shows the c.[5416A>G] mutation to result in mis-spliced transcripts as well as the predicted point mutation. While the mis- splicing results in a premature stop and very likely induces NMD, it is conceivable that the transcripts with the missense mutation lead to a protein with a single amino acid exchange and thereby cause a gain or loss of function. If so, the mutation might affect the thyroid hormone receptor binding domain (TRBD) and the overlapping GRAB domain which provide key functions of TRIP11. Through the TRBD, TRIP11 stimulates the thyroid hormone receptor (TR) which is assumed to promote chondrocyte maturation and is therefore important for chondro- and osteogenesis (Chen et al., 1999; Adams et al., 2007). The GRAB domain enables TRIP11 to function as a golgin through the tethering of vesicles (Gillingham et al., 2004). It is to consider that the amount of potentially functional TRIP11 should be strongly reduced in patient 4 compared to healthy controls because of the concomitant mis- splicing. Though, one functional allele seems to satisfy the demand of TRIP11 in the cell as can be seen in the healthy parents carrying heterozygous TRIP11 mutations. Therefore, a transcript with a base pair substitution leading to a certain amount of protein with residual or even full function could partially rescue the demand of TRIP11 in the cell. This would explain the non-lethal condition in our patient. In patient 5, the abundance of TRIP11 mRNA was shown to be reduced, very likely as a result of NMD because of the frameshift and premature stop caused by the c.[4815_4818delAGAG] mutation.

The c.[1228G>T] mutation was predicted to cause a single base pair substitution. Instead, mis-splicing, leading to a transcript with an in frame exon 9 deletion, was experimentally observed. Since one of the annotated protein-coding isoforms of TRIP11 lacks exon 9 (isoform 2, see the overview of isoforms in Figure 3.3), this isoform would not be affected by the mutation (see section 5.2.3). Likewise, the c.[1228G>T] mutation could also result in a transcript resembling TRIP11 isoform 1. This transcript, lacking exon 9, would result in a shortened protein. If so, the shortening affects 289 amino acids of the coiled-coil domain. As the length is important for the protein’s in vivo function (Sato et al., 2015), the reduced function of the shortened protein might explain the extent of the clinical features of patient 5. In patient 6, NMD caused by the c.[790C>T] mutation might explain the reduced TRIP11 mRNA abundance compared to controls. In addition, the patient’s fibroblasts carried a mutation at the intron-exon boundary of exon 5, a typical location for splicing. Indeed, molecular analysis revealed transcripts of cDNA lacking exon 4, in line with Ramos-Morales et al., 2001, whose study reported on a protein-coding TRIP11 isoform without exon 4 (GMAP-200). In this work, we refer to it as “isoform 4”. According to Ramos-Morales and co-workers, the binding capacity of isoform 4 for the cis-Golgi membranes is reduced compared to the primary transcript which could affect the interaction of cis-Golgi network membranes with microtubules. Such a protein with reduced function might contribute to the clinical outcome of patient 6. In conclusion, partially functional TRIP11 proteins involved in the pathogenesis of ODCD might explain the milder phenotype of ODCD compared to ACG1A and the phenotypic spectrum of both diseases at least to some extent.

6.4 Limitations of the study

With our method, a TRIP11 protein was only detectable in the control cell lysates and in the lysates of the fibroblasts of patient 1 and 6. A full loss of TRIP11 protein in all patients but patient 1 and 6 can therefore not be excluded and the existence of residual functional proteins in the other ODCD patients has to be questioned. Nevertheless, Western blotting has detection limits and the capacity of the N-terminal TRIP11 antibody used in this study might be limited to a certain protein amount that exceeds the amount of the predicted TRIP11 protein variants in patients 4 and 5. Importantly, we compared the patients’ abundance of TRIP11 mRNA and TRIP11 protein to controls with wild-type TRIP11 alleles. In these controls, strong signals are expected because of a high protein amount. In contrast, weak bands might be masked because of technical issues, e.g. to avoid the overexposure of the stronger bands. Therefore, it would be interesting to match the patients’ cellular TRIP11 abundance with the cellular abundance in TRIP11 heterozygotes, e.g. the patients’ parents. Carriers are expected to have a reduced TRIP11 mRNA and protein abundance. In this respect, control lysates gained from heterozygous individuals may better serve as controls and unmask potential weaker bands in the patients’ lysates. It is also to mention that every change in a mutated protein could interfere with the antibody binding capacity, the detection might also be limited to a certain degree by the conservation of the wild type amino acid sequence. It is likely that the affinity of the antibody binding site of the protein translated from isoform 2 in patient 5 or the protein translated from isoform 4 in patient 6 which may lack parts of the N-terminus compared to the full-length protein, is not sufficient for protein detection by Western blotting (Figure 6.3). To conclude, optimized experimental conditions are needed to further investigate potential proteins that may be missed by our approach. As an additional limitation of this study, it is to mention that we only analyzed fibroblasts and not chondrocytes. Different cell types might express different isoforms and the mutational effect observed in this study might have a different outcome in chondrocytes.

Figure 6.3: Coding region for the antibody (AB) binding site, corresponding to the four different protein-coding transcript isoforms of TRIP11. Illustrated is the approximate binding site of the N- terminal TRIP11 antibody that was used in this study in a schematic representation of the different TRIP11 transcripts based on predicted protein-coding isoforms from Ensembl, 2016 (Isoform 1-3) and Ramos-Morales et al., 2001 (Isoform 4). Exons are shown as boxes, the size of the box correlates to the number of base pairs of each exon. The introns are represented as lines but do not correlate in size. The exons are numbered 1-21 for the largest isoform (Isoform 1, 9996 base pairs, known as GMAP210 or TRIP11). The triangular-shaped lines in Isoform 2 (5246 base pairs) demonstrate splicing. Isoform 3 (564 base pairs) is the smallest isoform. Isoform 4 is known as coding for GMAP- 200 (Ramos-Morales et al., 2001).

6.5 There might be an interrelationship of LBR and TRIP11

All TRIP11-mutations were predicted to cause a loss of the TRIP11 protein. Accordingly, the abundance of TRIP11 mRNA was significantly reduced in ACG1A and ODCD patients 2-6 in RT-PCR. Striking, though, was the reduction of the LBR mRNA abundance in the ODCD patients 4 and 6. This hints at a possible direct or indirect regulatory interrelationship of TRIP11 and LBR, resulting in aberrant LBR and TRIP11 transcript amounts. Notably, it is more difficult to detect LBR in protein lysates of fibroblasts than in other cell types, e.g. HeLa cells (Clayton et al., 2010) because of its lower abundance. In line with this finding, the LBR protein was not detectable in fibroblast control cells. In contrast, case 3, affected by ACG1A due to the loss of TRIP11, was the only cell lysate that contained a detectable amount of LBR. This finding may indicate an up- regulation of LBR in ACG1A induced by the loss of TRIP11 in case 3. Furthermore, TRIP11 seems to be slightly upregulated because of the loss of LBR in case 1. Although these are preliminary data and further studies should be performed, a possible interrelationship of TRIP11 and LBR on the transcript as well as on the protein level should be considered. Finally, this relationship might explain how mutations in two different genes (TRIP11, LBR) cause the same disease (ACG1A).

6.6 TRIP11 and IFT20 could be linked through regulatory mechanisms We further investigated the intraflagellar transport protein 20 (IFT20), a direct interaction partner of TRIP11. TRIP11 anchors IFT20 to the Golgi apparatus (Follit et al., 2008) and is engaged in the intraflagellar transport system which ensures ciliary assembly (Follit et al., 2008; Rosenbaum and Wittman, 2002). The importance of the IFT20 binding domain in TRIP11 is underlined through a highly conserved amino acid sequence between mice and humans (Follit et al., 2008). Therefore, we were interested to see if there are any changes in IFT20 on the mRNA and protein level in patients affected by TRIP11 mutations. While IFT20 mRNA levels did not differ from the controls, the IFT20 protein abundance in patient 1 was higher as compared to patients 2-5, and comparable to patient 6. Therefore, patient 1 and patient 6 were the only patients where a TRIP11 protein could be detected, at the same time showing the highest IFT20 protein abundance. In conclusion, there might be a regulatory interrelationship of TRIP11 and IFT20 on the protein level. Notably, there are studies that link a loss of Ift20 to a disruption in skeletal development (Noda et al., 2016). Future studies will show if a loss of IFT20 and its function in intraflagellar transport (IFT) indeed plays a role in the pathogenesis of ACG1A and ODCD. If so, the two diseases might be classified as so-called “ciliopathies”.

7 SUPPLEMENTAL DATA

7.1 Electropherograms of patients 2-6

Figure 7.1: Electropherograms of patients 2-6, DNA was isolated from primary fibroblasts. The genomic reference sequence (ENST00000267622) is indicated on top, codons are underlined. Corresponding amino acids are written beneath the electropherogram. Pat 2) In patient 2, a homozygous mutation in exon 11 leads to an exchange from deoxyguanosin to deoxyadenosin, predicting a premature stop codon. Pat 3) Patient 3 carries two compound heterozygous mutations in exon 11. The nucleotide exchange from deoxycytidine to deoxythymidin at position 3478 and at position 3499 in exon 11 of TRIP11 is predicted to cause a premature stop codon in both cases. Pat 4) Patient 4 carries compound heterozygous TRIP11 mutations in exon 11 and exon 18. The missing nucleotide in exon 11 is predicted to cause a frameshift and therefore a premature stop. Exon 18 contains a nucleotide exchange from deoxyadenosin to deoxyguanosin predicted to cause a missense variant. Pat 5) Patient 5 carries TRIP11 mutations in exons 9 and 13. The mutation in exon 9 is predicted to lead to a missense variant because of the exchange from deoxyguanosin to deoxythymidin. A deletion of four nucleobases causes a reading frame shift and a premature stop in exon 13. Pat 6) Patient 6 carries compound heterozygous mutations in TRIP11 in exons four, six and 11. The electropherograms show the nucleotide exchanges from deoxycytidine to deoxythymidin leading to a premature stop codon in exon four and in exon six, thereby possibly preventing the translation of a missense variant due to the nucleotide exchange in exon 11.

7.2 In silico tools predict mis-splicing in patient 1

Figure 7.2: Predicted mis-splicing in patient 1. According to the in silico prediction, a high chance for mis-splicing, due to the mutation c.[366+1G>T] in the LBR-gene of patient 1, is calculated. Here, this leads to the inactivation of the donor site.

8 LIST OF FIGURES

Figure 3.1: Enchondral ossification and the structure of the growth plate from Yeung Tsang et al., 2014...... 4 Figure 3.2: Effects of Trip11 mutations in mice (Smits et al., 2010)...... 5 Figure 3.3: There are four putative protein-coding transcript isoforms of TRIP11...... 6 Figure 3.4: Schematic representation of the GMAP210/TRIP11 protein...... 8 Figure 3.5: Cilia structure and intraflagellar transport...... 10 Figure 3.6: Two cases with ACG1A...... 12 Figure 3.7: Histological findings in ACG1A patients...... 13 Figure 3.8: Clinical and radiographic pictures of two ODCD patients...... 14 Figure 3.9: Microscopic images of the upper tibial growth cartilage from ODCD patients...... 15 Figure 5.1: Patient 1 presents with hydrops, shortened extremities, protruding abdomen and short trunk...... 38 Figure 5.2: Pedigrees of the families from patient 1-6...... 39 Figure 5.3: Different mutations in TRIP11 lead to ACG1A or ODCD...... 41 Figure 5.4: Identification of an LBR mutation in patient 1...... 42 Figure 5.5: A part of exon three is spliced out in patient 1...... 43 Figure 5.6: The intronic LBR mutation of patient 1 leads to mis-splicing...... 44 Figure 5.7: The LBR mRNA abundance is strongly reduced in case 1...... 45 Figure 5.8: The LBR mRNA abundance is significantly decreased in patient 1...... 46 Figure 5.9: The c.[5416A>G] mutation of patient 4 causes both a missense mutation and aberrant splicing...... 47 Figure 5.10: Patient 5 carries a splice mutation...... 48 Figure 5.11: The c.1228G>T transversion in exon 9 results in an altered splice pattern in patient 5...... 49 Figure 5.12: Patient 6 expresses a TRIP11 transcript without exon 4...... 50 Figure 5.13: The mRNA abundance of TRIP11 is reduced in ACG1A and ODCD patients but increased in case 1, IFT20 shows a similar signal compared to controls...... 51 Figure 5.14: The expression of TRIP11 is significantly decreased in patients 2-6 and significantly elevated in case 1...... 51 Figure 5.15: The expression of IFT20 is not significantly altered in all patients compared to controls...... 52 Figure 5.16: Compared to controls without a TRIP11 mutation, the LBR protein amount is elevated in patient 3...... 53 Figure 5.17: Patients with TRIP11 mutations lack the TRIP11 protein (patients 2-5)...... 54 Figure 5.18: The IFT20 protein was reduced in all TRIP11-deficient patients...... 55 Figure 6.1: There are four different protein-coding transcript isoforms of LBR...... 57 Figure 6.2: The phenotype of case 1 is typical for ACG1A and not for GRBGD...... 59 Figure 6.3: Coding region for the antibody (AB) binding site, corresponding to the four different protein- coding transcript isoforms of TRIP11...... 64 Figure 7.1: Electropherograms of patients 2-6, DNA was isolated from primary fibroblasts...... 68 Figure 7.2: Predicted mis-splicing in patient 1...... 69

9 LIST OF TABLES

Table 3.1: The functional domains of TRIP11 with their corresponding amino acids...... 8 Table 4.1: Material for one RNA reverse transcription reaction...... 28 Table 4.2: Material for one standard PCR reaction...... 28 Table 4.3: Program for a standard PCR reaction...... 29 Table 4.4: Material for one qPCR reaction...... 30 Table 4.5: Program for the qPCR reaction...... 30 Table 4.6: Program for a PCR purification reaction...... 30 Table 4.7: Material for one Sanger sequencing reaction...... 31 Table 4.8: PCR-program for the Sanger sequencing reaction...... 33 Table 4.9: Material for a TOPO cloning reaction...... 32 Table 4.10: Material for a 5 ml 10%-SDS-PAGE running gel...... 34 Table 4.11: Material for a 3 ml 10%-SDS-PAGE stacking gel...... 35 Table 4.12: Antibody dilution for Western blot, diluted in blocking milk...... 36 Table 5.1: Patients diagnosed with ACG1A and ODCD...... 40 Table 5.2: LBR mutation in patient 1...... 41 Table 6.1: Mutational effects of TRIP11 in patients diagnosed with ACG1A and ODCD...... 60

10 REFERENCES

Adams, S. L., Cohen, A. J., & Lassová, L. (2007). Integration of signaling pathways regulating chondrocyte differentiation during endochondral bone formation. J. Cell. Physiol., 213(3), 635–641. https://doi.org/10.1002/jcp.21262 Aigner, T., Rau, T., Niederhagen, M., Zaucke, F., Schmitz, M., Pöhls, U., Stöss, H., Rauch, A., Thiel, C. T. (2007). Achondrogenesis Type IA (Houston-Harris): a still-unresolved molecular phenotype. Pediatr. Dev. Pathol., 10(4), 328–334. https://doi.org/10.2350/06-07-0134.1 Bloodgood, R. A. (Ed.). (1990). Ciliary and Flagellar Membranes. Boston, MA: Springer US. Retrieved from http://link.springer.com/10.1007/978-1-4613-0515-6 Bonaventure, J., Stanescu, R., Stanescu, V., Allain, J. C., Muriel, M. P., Ginisty, D., & Maroteaux, P. (1992). Type II collagen defect in two sibs with the Goldblatt syndrome, a chondrodysplasia with dentinogenesis imperfecta, and joint laxity. Am. J. Med. Genet., 44(6), 738–753. https://doi.org/10.1002/ajmg.1320440607 Borochowitz, Z., Lachman, R., Adomian, G. E., Spear, G., Jones, K., & Rimoin, D. L. (1988). Achondrogenesis type I: delineation of further heterogeneity and identification of two distinct subgroups. J. Pediatr., 112(1), 23–31. Borovik, L., Modaff, P., Waterham, H. R., Krentz, A. D., & Pauli, R. M. (2013). Pelger-huet anomaly and a mild skeletal phenotype secondary to mutations in LBR. Am. J. Med. Genet. A, 161A(8), 2066– 2073. https://doi.org/10.1002/ajmg.a.36019 Chang, K. H., Chen, Y., Chen, T. T., Chou, W. H., Chen, P. L., Ma, Y. Y., Yang-Feng, T. L., Leng, X., Tsai, M. J., O’Malley, B. W., Lee, W. H. (1997). A thyroid hormone receptor coactivator negatively regulated by the retinoblastoma protein. Proc. Natl. Acad. Sci. U.S.A., 94(17), 9040–9045. Chen, Y., Chen, P. L., Chen, C. F., Sharp, Z. D., & Lee, W. H. (1999). Thyroid hormone, T3-dependent phosphorylation and translocation of Trip230 from the Golgi complex to the nucleus. Proc. Natl. Acad. Sci. U.S.A., 96(8), 4443–4448. Clayton, P., Fischer, B., Mann, A., Mansour, S., Rossier, E., Veen, M., Lang, C., Baasanjav, S., Kieslich, M., Brossuleit, K., Gravemann, S., Schnipper, N., Karbasyian, M., Demuth, I., Zwerger, M., Vaya, A., Utermann, G., Mundlos, S., Stricker, S., Hoffmann, K. (2010). Mutations causing Greenberg dysplasia but not Pelger anomaly uncouple enzymatic from structural functions of a nuclear membrane protein. Nucleus (Austin, Tex.), 1(4), 354–366. https://doi.org/10.4161/nucl.1.4.12435 Courvalin, J. C., Lassoued, K., Worman, H. J., & Blobel, G. (1990). Identification and characterization of autoantibodies against the nuclear envelope lamin B receptor from patients with primary biliary cirrhosis. J. Exp. Med., 172(3), 961–967. Drin, G., Casella, J.-F., Gautier, R., Boehmer, T., Schwartz, T. U., & Antonny, B. (2007). A general amphipathic alpha-helical motif for sensing membrane curvature. Nat. Struct. Mol. Biol., 14(2), 138– 146. https://doi.org/10.1038/nsmb1194 Drin, G., Morello, V., Casella, J.-F., Gounon, P., & Antonny, B. (2008). Asymmetric tethering of flat and curved lipid membranes by a golgin. Science, 320(5876), 670–673. https://doi.org/10.1126/science.1155821 Erlebacher, A., Filvaroff, E. H., Gitelman, S. E., & Derynck, R. (1995). Toward a molecular understanding of skeletal development. Cell, 80(3), 371–378. https://doi.org/10.1016/0092- 8674(95)90487-5 Follit, J. A., San Agustin, J. T., Xu, F., Jonassen, J. A., Samtani, R., Lo, C. W., & Pazour, G. J. (2008). The Golgin GMAP210/TRIP11 anchors IFT20 to the Golgi complex. PLoS Genet., 4(12), e1000315. https://doi.org/10.1371/journal.pgen.1000315 Follit, J. A., Tuft, R. A., Fogarty, K. E., & Pazour, G. J. (2006). The intraflagellar transport protein IFT20 is associated with the Golgi complex and is required for cilia assembly. Mol. Biol. Cell, 17(9), 3781– 3792. https://doi.org/10.1091/mbc.E06-02-0133 Fraccaro, M. (1952). Contributo allo studio delle malattie del mesenchima osteopoietico: l’acondrogenesi. Folia Hered. Path., 1, 190–208. Gilbert, S. F. (2000). Developmental Biology. Retrieved from https://www.ncbi.nlm.nih.gov/books/NBK10056/

Gillingham, A. K., Tong, A. H. Y., Boone, C., & Munro, S. (2004). The GTPase Arf1p and the ER to Golgi cargo receptor Erv14p cooperate to recruit the golgin Rud3p to the cis-Golgi. J. Cell Biol., 167(2), 281–292. https://doi.org/10.1083/jcb.200407088 Goetz, S. C., & Anderson, K. V. (2010). The primary cilium: a signalling centre during vertebrate development. Nature Reviews. Genetics, 11(5), 331–344. https://doi.org/10.1038/nrg2774 Goldblatt, J., Carman, P., & Sprague, P. (1991). Unique dwarfing, spondylometaphyseal skeletal dysplasia, with joint laxity and dentinogenesis imperfecta. Am. J. Med. Genet., 39(2), 170–172. https://doi.org/10.1002/ajmg.1320390211 Greenberg, C. R., Rimoin, D. L., Gruber, H. E., DeSa, D. J., Reed, M., & Lachman, R. S. (1988). A new autosomal recessive lethal chondrodystrophy with congenital hydrops. Am. J. Med. Genet., 29(3), 623–632. https://doi.org/10.1002/ajmg.1320290321 Grigelioniene, G., Geiberger, S., Papadogiannakis, N., Mäkitie, O., Nishimura, G., Nordgren, A., & Conner, P. (2013). The phenotype range of achondrogenesis 1A. Am. J. Med. Genet. A, 161A(10), 2554–2558. https://doi.org/10.1002/ajmg.a.36106 Harris, R., Patton, J. T., & Barson, A. J. (1972). Pseudo-achondrogenesis with fractures. Clin. Genet., 3(6), 435–441. https://doi.org/10.1111/j.1399-0004.1972.tb01477.x Herrmann, H., & Zwerger, M. (2010). The danger of “multi-tasking”: LBR out of control. Nucleus (Austin, Tex.), 1(4), 319–324. https://doi.org/10.4161/nucl.1.4.11801 Herrmann, J. (2011). Molekulare Grundlagen der Achondrogenesis Typ 1a und der Odontochondrodysplasie. Hoffmann, K., Dreger, C. K., Olins, A. L., Olins, D. E., Shultz, L. D., Lucke, B., Karl, H., Kaps, R., Müller, D., Vayá, A., Aznar, J., Ware, R. E., Sotelo Cruz, N., Lindner, T. H., Herrmann, H., Reis, A., Sperling, K. (2002). Mutations in the gene encoding the lamin B receptor produce an altered nuclear morphology in granulocytes (Pelger-Huët anomaly). Nat. Genet., 31(4), 410–414. https://doi.org/10.1038/ng925 Hoffmann, K., Sperling, K., Olins, A. L., & Olins, D. E. (2007). The granulocyte nucleus and lamin B receptor: avoiding the ovoid. Chromosoma, 116(3), 227–235. https://doi.org/10.1007/s00412-007- 0094-8 Infante, C., Ramos-Morales, F., Fedriani, C., Bornens, M., & Rios, R. M. (1999). GMAP-210, A cis- Golgi network-associated protein, is a minus end microtubule-binding protein. J. Cell Biol., 145(1), 83–98. Jonassen, J. A., SanAgustin, J., Baker, S. P., & Pazour, G. J. (2012). Disruption of IFT complex A causes cystic kidneys without mitotic spindle misorientation. J. Am. Soc. Nephrol., 23(4), 641–651. https://doi.org/10.1681/ASN.2011080829 Lüllmann-Rauch, R. (2009). Taschenlehrbuch Histologie (3rd ed.). Stuttgart: Georg Thieme Verlag KG. Lykke-Andersen, S., & Jensen, T. H. (2015). Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes, 16(11), 665–677. https://doi.org/10.1038/nrm4063 Maroteaux, P., Briscioli, V., Lalatta, F., & Bonaventure, J. (1996). [Odontochondrodysplasia]. Arch Pediatr, 3(6), 549–554. Molz, G., & Spycher, M. A. (1980). Achondrogenesis type I: light and electron-microscopic studies. Eur. J. Pediatr., 134(1), 69–74. Munro, S. (2011). The golgin coiled-coil proteins of the Golgi apparatus. Cold Spring Harb Perspect Biol, 3(6). https://doi.org/10.1101/cshperspect.a005256 Nagy, E., & Maquat, L. E. (1998). A rule for termination-codon position within intron-containing genes: when nonsense affects RNA abundance. Trends in Biochemical Sciences, 23(6), 198–199. https://doi.org/10.1016/S0968-0004(98)01208-0 Nishimura, G., Nakashima, E., Hirose, Y., Cole, T., Cox, P., Cohn, D. H., Rimoin, D. L., Lachman, R. S., Miyamoto, Y., Kerr, B., Unger, S., Ohashi, H., Superti-Furga, A., Ikegawa, S. (2007). The Shwachman-Bodian-Diamond syndrome gene mutations cause a neonatal form of spondylometaphysial dysplasia (SMD) resembling SMD Sedaghatian type. J. Med. Genet., 44(4), e73. https://doi.org/10.1136/jmg.2006.043869 Noda, K., Kitami, M., Kitami, K., Kaku, M., & Komatsu, Y. (2016). Canonical and noncanonical intraflagellar transport regulates craniofacial skeletal development. Proc. Natl. Acad. Sci. U.S.A., 113(19), E2589-2597. https://doi.org/10.1073/pnas.1519458113 Pernet-Gallay, K., Antony, C., Johannes, L., Bornens, M., Goud, B., & Rios, R. M. (2002). The overexpression of GMAP-210 blocks anterograde and retrograde transport between the ER and the Golgi apparatus. Traffic, 3(11), 822–832. 73

Ramos-Morales, F., Vime, C., Bornens, M., Fedriani, C., & Rios, R. M. (2001). Two splice variants of Golgi-microtubule-associated protein of 210 kDa (GMAP-210) differ in their binding to the cis-Golgi network. Biochem. J., 357(Pt 3), 699–708. Ríos, R. M., Sanchís, A., Tassin, A. M., Fedriani, C., & Bornens, M. (2004). GMAP-210 recruits gamma-tubulin complexes to cis-Golgi membranes and is required for Golgi ribbon formation. Cell, 118(3), 323–335. https://doi.org/10.1016/j.cell.2004.07.012 Rios, R. M., Tassin, A. M., Celati, C., Antony, C., Boissier, M. C., Homberg, J. C., & Bornens, M. (1994). A peripheral protein associated with the cis-Golgi network redistributes in the intermediate compartment upon brefeldin A treatment. J. Cell Biol., 125(5), 997–1013. Roboti, P., Sato, K., & Lowe, M. (2015). The golgin GMAP-210 is required for efficient membrane trafficking in the early secretory pathway. J. Cell. Sci., 128(8), 1595–1606. https://doi.org/10.1242/jcs.166710 Rosenbaum, J. L., & Witman, G. B. (2002). Intraflagellar transport, 3(11), 813–825. https://doi.org/10.1038/nrm952 Sato, K., Roboti, P., Mironov, A. A., & Lowe, M. (2015). Coupling of vesicle tethering and Rab binding is required for in vivo functionality of the golgin GMAP-210. Mol. Biol. Cell, 26(3), 537–553. https://doi.org/10.1091/mbc.E14-10-1450 Schramm, T., Gloning, K. P., Minderer, S., Daumer-Haas, C., Hörtnagel, K., Nerlich, A., & Tutschek, B. (2009). Prenatal sonographic diagnosis of skeletal dysplasias. Ultrasound Obstet Gynecol, 34(2), 160–170. https://doi.org/10.1002/uog.6359 Silve, S., Dupuy, P. H., Ferrara, P., & Loison, G. (1998). Human lamin B receptor exhibits sterol C14- reductase activity in Saccharomyces cerevisiae. Biochim. Biophys. Acta, 1392(2–3), 233–244. Smits, P., Bolton, A. D., Funari, V., Hong, M., Boyden, E. D., Lu, L., Manning, D. K., Dwyer, N. D., Moran, J. L., Prysak, M., Merriman, B., Nelson, S. F., Bonafé, L., Superti-Furga, A., Ikegawa, S., Krakow, D., Cohn, D. H., Kirchhausen, T., Warman, M. L., Beier, D. R. (2010). Lethal Skeletal Dysplasia in Mice and Humans Lacking the Golgin GMAP-210. N Engl J Med, 362(3), 206–216. https://doi.org/10.1056/NEJMoa0900158 Sobreira, N., Modaff, P., Steel, G., You, J., Nanda, S., Hoover-Fong, J., Valle, D., Pauli, R. M. (2015). An Anadysplasia-Like, Spontaneously Remitting Spondylometaphyseal Dysplasia Secondary to Lamin B Receptor (LBR) Gene Mutations: Further Definition of the Phenotypic Heterogeneity of LBR-Bone Dysplasias. Am J Med Genet A, 167A(1), 159–163. https://doi.org/10.1002/ajmg.a.36808 Spranger, J. W., Brill, P., Superti-Furga, A., Unger, S., & Nishimura, G. (2012). Bone Dysplasias: An Atlas of Genetic Disorders of Skeletal Development (3rd edition). Oxford ; New York: Oxford University Press. Stuart Houston, C., Awen, C. F., & Kent, H. P. (1972). Fatal neonatal dwarfism. J Can Assoc Radiol, 23(1), 45–61. Taner, M. Z., Kurdoglu, M., Taskiran, C., Onan, M. A., Gunaydin, G., & Himmetoglu, O. (2008). Prenatal diagnosis of achondrogenesis type I: a case report. Cases J, 1, 406. https://doi.org/10.1186/1757-1626-1-406 Unger, S., Antoniazzi, F., Brugnara, M., Alanay, Y., Caglayan, A., Lachlan, K., Ikegawa, S., Nishimura, G., Zabel, B., Spranger, J., Superti-Furga, A. (2008). Clinical and radiographic delineation of odontochondrodysplasia. Am. J. Med. Genet. A, 146A(6), 770–778. https://doi.org/10.1002/ajmg.a.32214 Warman, M. L., Cormier-Daire, V., Hall, C., Krakow, D., Lachman, R., LeMerrer, M., Mortier, G., Mundlos, S., Nishimura, G., Rimoin, D. L., Robertson, S., Savarirayan, R., Sillence, D., Spranger, J., Unger, S., Zabel, B., Superti-Furga, A. (2011). Nosology and classification of genetic skeletal disorders: 2010 revision. Am. J. Med. Genet. A, 155A(5), 943–968. https://doi.org/10.1002/ajmg.a.33909 Wassif, C. A., Brownson, K. E., Sterner, A. L., Forlino, A., Zerfas, P. M., Wilson, W. K., Starost, M. F., Porter, F. D. (2007). HEM dysplasia and ichthyosis are likely laminopathies and not due to 3beta- hydroxysterol Delta14-reductase deficiency, 16(10), 1176–1187. https://doi.org/10.1093/hmg/ddm065 Waterham, H. R., Koster, J., Mooyer, P., Noort Gv, G. van, Kelley, R. I., Wilcox, W. R., Wanders, R. J. A., Hennekam, R. C. M., Oosterwijk, J. C. (2003). Autosomal recessive HEM/Greenberg skeletal dysplasia is caused by 3 beta-hydroxysterol delta 14-reductase deficiency due to mutations in the lamin B receptor gene. Am. J. Hum. Genet., 72(4), 1013–1017. 74

Wuelling, M., & Vortkamp, A. (2010). Transcriptional networks controlling chondrocyte proliferation and differentiation during endochondral ossification, 25(4), 625–631. https://doi.org/10.1007/s00467- 009-1368-6 Yang, S. S., Heidelberger, K. P., & Bernstein, J. (Nov 1976a). Intracytoplasmic inclusion bodies in the chondrocytes of type I lethal achondrogenesis. Hum. Pathol., 7(6), 667–673. Yang, S. S., Heidelberger, K. P., Brough, A. J., Corbett, D. P., & Bernstein, J. (1976b). Lethal short- limbed chondrodysplasia in early infancy. Perspect Pediatr Pathol, 3, 1–40. Ye, Q., & Worman, H. J. (1994). Primary structure analysis and lamin B and DNA binding of human LBR, an integral protein of the nuclear envelope inner membrane. J Biol Chem, 269(15), 11306– 11311. Yeung Tsang, K., Wa Tsang, S., Chan, D., & Cheah, K. S. E. (2014). The chondrocytic journey in endochondral bone growth and skeletal dysplasia. Birth Defects Res. C Embryo Today, 102(1), 52– 73. https://doi.org/10.1002/bdrc.21060

11 PUBLICATIONS

Wehrle, A., Witkos, T. M., Schneider, J. C., Hoppmann, A., Behringer, S., Köttgen, A., Elting, M., Spranger, J., Lowe, M., & Lausch, E. (2018). A common pathomechanism in GMAP-210– and LBR-related diseases. JCI Insight, 3(23). https://doi.org/10.1172/jci.insight.121150

Wehrle, A., Witkos, T. M., Unger, S., Schneider, J., Follit, J. A., Hermann, J., Welting, T., Fano, V., Hietala, M., Vatanavicharn, N., Schoner, K., Spranger, J., Schmidts, M., Zabel, B., Pazour, G. J., Bloch-Zupan, A., Nishimura, G., Superti- Furga, A., Lowe, M., & Lausch, E. (2019). Hypomorphic mutations of TRIP11 cause odontochondrodysplasia. JCI Insight, 4(3). https://doi.org/10.1172/jci.insight.124701

12 EIDESSTATTLICHE VERSICHERUNG

Ich erkläre hiermit, dass ich die vorliegende Arbeit ohne unzulässige Hilfe Dritter und ohne Benutzung anderer als der angegebenen Hilfsmittel angefertigt habe. Die aus anderen Quellen direkt oder indirekt übernommenen Daten und Konzepte sind unter Angabe der Quellen gekennzeichnet. Insbesondere habe ich hierfür nicht die entgeltliche Hilfe von Vermittlungs- beziehungsweise Beratungsdiensten (Promotionsberater oder anderer Personen) in Anspruch genommen. Niemand hat von mir unmittelbar oder mittelbar geldwerte Leistungen für Arbeiten erhalten, die im Zusammenhang mit dem Inhalt der vorgelegten Dissertation stehen. Die Arbeit wurde bisher weder im In- noch im Ausland in gleicher oder ähnlicher Form einer anderen Prüfungsbehörde vorgelegt. Die Bestimmungen der Promotionsordnung der Fakultät für Humanmedizin sind mir bekannt, insbesondere weiß ich, dass ich vor Vollzug der Promotion zur Führung des Doktortitels nicht berechtigt bin.

Freiburg, 13. Februar 2020

13 ERKLÄRUNG ZUM EIGENANTEIL

Diese Dissertation wurde durch meinen Doktorvater, Herrn PD Ekkehart Lausch konzipiert und von Frau Anika Wehrle betreut. Mitglieder der Arbeitsgruppe waren zum Zeitpunkt der Arbeit die PhD-Studenten Franziska Friedrich, Anselm Hoppmann, Niko Janocha, Anna Oschowitzer, Anika Salfelder und Anika Wehrle. Weitere Mitarbeiter der Arbeitsgruppe waren Jessica Heinze, Uta Matysiak, Tanja Velten und Violetta Volz. Alle in dieser Arbeit aufgeführten Versuche wurden durch mich, Judith C. Schneider, selbstständig durchgeführt. Materialien wurden durch Ekkehart Lausch zur Verfügung gestellt. Die Auswertung erfolgte durch mich sowie gemeinsam mit meiner Betreuerin, Anika Wehrle, und Ekkehart Lausch. Das Manuskript wurde von Judith C. Schneider verfasst und von Anika Wehrle und Ekkehart Lausch editiert.

Aus der Dissertation gingen zwei Paper hervor:

1) Wehrle, A., Witkos, T. M., Schneider, J. C., Hoppmann, A., Behringer, S., Köttgen, A., Elting, M., Spranger, J., Lowe, M., & Lausch, E. (2018). A common pathomechanism in GMAP-210– and LBR-related diseases. JCI Insight, 3(23). https://doi.org/10.1172/jci.insight.121150

Die Arbeit wurde von Ekkehart Lausch und Martin Lowe konzipiert. Anika Wehrle, Tomasz M. Witkos und Judith C. Schneider führten die Experimente durch und erhoben Daten. Anika Wehrle, Tomasz M. Witkos und Judith C. Schneider, Sidney Behringer, Anselm Hoppmann, Anna Köttgen, Mariet Elting und Martin Lowe trugen zur Datenanalyse bei. Anika Wehrle und Ekkehart Lausch verfassten das Manuskript. Anika Wehrle, Tomasz M. Witkos, Ekkehart Lausch und Martin Lowe editierten das Manuskript. Alle Ko-Autoren haben das Manuskript gelesen, es kommentiert und diesem zugestimmt.

2) Wehrle, A., Witkos, T. M., Unger, S., Schneider, J., Follit, J. A., Hermann, J., Welting, T., Fano, V., Hietala, M., Vatanavicharn, N., Schoner, K., Spranger, J., Schmidts, M., Zabel, B., Pazour, G. J., Bloch-Zupan, A., Nishimura, G., Superti-Furga, A., Lowe, M., & Lausch, E. (2019). Hypomorphic mutations of TRIP11 cause odontochondrodysplasia. JCI Insight, 4(3). https://doi.org/10.1172/jci.insight.124701

Anika Wehrle, Tomasz M. Witkos, Judith Schneider, Johannes Hermann, Tim Welting, Miriam Schmidts, Gregory J. Pazour und Ekkehart Lausch führten Experimente durch und erhoben Daten. John A. Follit, Miriam Schmidts und Gregory

J. Pazour trugen Daten bei und stellten Reagenzien zur Verfügung. Sheila Unger, Virginia Fano, Marja Hietala, Nithiwat Vatanavicharn, Katharina Schoner, Bernhard Zabel, Jürgen Spranger, Andrea Superti-Furga, Ekkehart Lausch und Gen Nishimura trugen klinische Daten bei. Jürgen Spranger, Gen Nishimura, Sheila Unger, Andrea Superti-Furga und Ekkehart Lausch analysierten die klinischen Daten. Anika Wehrle, Tomasz M. Witkos, Martin Lowe und Ekkehart Lausch konzipierten die Studie, analysierten Daten und verfassten und editierten das Manuskript. Sheila Unger und Jürgen Spranger editierten das Manuskript. Alle Ko-

Autoren haben das Manuskript gelesen und diesem zugestimmt.

14 DANKSAGUNG

Mein besonderer Dank gilt meinem Doktorvater, Herrn PD Dr. med. Ekkehart Lausch. Vielen Dank, dass du mir die Möglichkeit gegeben hast, meine Doktorarbeit in deiner Arbeits-gruppe durchzuführen. Ich habe mich vom ersten Tag an sehr gut aufgehoben gefühlt und hätte mir kein besseres Team wünschen können.

Zudem möchte ich mich bei Herrn PD Dr. med. Carsten Speckmann für die Erstellung des Zweitgutachtens bedanken.

Liebe kleine Anika, ohne dich wäre diese Arbeit nicht möglich gewesen. Vielen Dank für die umfangreiche Einarbeitung, deine fürsorgliche Betreuung und die ausführlichen Korrekturarbeiten.

Große Anika, ich habe deine Geduld, dein Feedback, deine Anregungen und deine wachsamen Augen sehr geschätzt. Vielen Dank für deine Unterstützung.

Niko, Anna und Franzi, bei euch möchte ich mich für die gute Stimmung, den motivierenden Zuspruch und eure Unterstützung bedanken. Dank euch bin ich immer gern ins Labor gekommen!

Dem Diagnostik-Team danke ich für die gute Zusammenarbeit.

Ein besonderer Dank geht an meine Eltern, die mir dieses Studium ermöglicht haben und an meinen Bruder sowie meine Freunde. Ihr alle habt mich durch mein Studium begleitet und mir auch während der Erarbeitung meiner Dissertation viel Kraft und Motivation gegeben.

Meinen Dank möchte ich ebenfalls den Patientinnen, Patienten und Familien- angehörigen aussprechen, die Teil dieser Studie waren.