DOCSLIB.ORG

Tonic Activation of Glun2c/Glun2d-Containing NMDA Receptors by Ambient Glutamate Facilitates Cortical Interneuron Maturation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Tonic Activation of Glun2c/Glun2d-Containing NMDA Receptors by Ambient Glutamate Facilitates Cortical Interneuron Maturation This Accepted Manuscript has not been copyedited and formatted. The final version may differ from this version. Research Articles: Development/Plasticity/Repair Tonic activation of GluN2C/GluN2D-containing NMDA receptors by ambient glutamate facilitates cortical interneuron maturation Elizabeth Hanson1,2, Moritz Armbruster1, Lauren A. Lau1,2, Mary E. Sommer1, Zin-Juan Klaft1, Sharon A. Swanger3, Stephen F. Traynelis3, Stephen J. Moss1,4, Farzad Noubary5, Jayashree Chadchankar4 and Chris G. Dulla1 1Department of Neuroscience, Tufts University School of Medicine, 136 Harrison Avenue, Boston, MA 02111, USA 2Neuroscience Program, Tufts Sackler School of Biomedical Sciences, 136 Harrison Avenue, Boston, MA 02111, USA 3Department of Pharmacology, Emory University School of Medicine, Atlanta, GA, 30322, USA 4AstraZeneca Tufts Laboratory for Basic and Translational Neuroscience, Tufts University School of Medicine, Boston, MA, 02111 5Department of Health Sciences, Bouvé College of Health Sciences, Northeastern University, Boston, MA, USA. https://doi.org/10.1523/JNEUROSCI.1392-18.2019 Received: 31 May 2018 Revised: 29 January 2019 Accepted: 26 February 2019 Published: 7 March 2019 Author contributions: E.H., M.A., M.E.S., Z.-J.K., S.A.S., S.F.T., S.J.M., J.C., and C.G.D. designed research; E.H., M.A., L.L., M.E.S., Z.-J.K., S.A.S., J.C., and C.G.D. performed research; E.H., M.A., L.L., M.E.S., Z.- J.K., S.A.S., S.F.T., F.N., J.C., and C.G.D. analyzed data; E.H., M.A., S.F.T., and C.G.D. wrote the first draft of the paper; E.H., M.A., L.L., M.E.S., S.A.S., S.F.T., S.J.M., J.C., and C.G.D. edited the paper; E.H., M.A., L.L., M.E.S., Z.-J.K., S.A.S., S.F.T., S.J.M., J.C., and C.G.D. wrote the paper. Conflict of Interest: The authors declare no competing financial interests. This work was supported by the Epilepsy Foundation (CD), National Institute of Neurological Disease and Stroke R01-NS076885 (CD), R56-NS076885 (CD), NS036554 (ST), Synapse Neurobiology Training Grant (EH, NINDS T32-NS061764, M. Jacob, P.I.), and Tufts Center for Neuroscience Research (P30 NS047243). We would like to thank Jennifer Shih, Thomas Papouin, Paul Rosenberg, Chinfei Chen, Christian Bjorbaek, Dan Cox, and John Lisman for their helpful comments. We would also like to thank Pedram Hamrah, Arisa Jamali, and Allen Parmelee for their help in establish a FACs protocol. Corresponding Author: Chris Dulla, [email protected], Tufts Sackler School of Biomedical Sciences, South Cove 203, 136 Harrison Avenue, Boston, MA 02111, 617-636-3418 Cite as: J. Neurosci 2019; 10.1523/JNEUROSCI.1392-18.2019 Alerts: Sign up at www.jneurosci.org/alerts to receive customized email alerts when the fully formatted version of this article is published. Accepted manuscripts are peer-reviewed but have not been through the copyediting, formatting, or proofreading process. Copyright © 2019 the authors 1 Tonic activation of GluN2C/GluN2D-containing NMDA receptors by ambient glutamate 2 facilitates cortical interneuron maturation 3 4 Elizabeth Hanson1,2, Moritz Armbruster1, Lauren A. Lau1,2, Mary E. Sommer1, Zin-Juan Klaft1, 5 Sharon A. Swanger3, Stephen F. Traynelis3, Stephen J. Moss1,4, Farzad Noubary5, Jayashree 6 Chadchankar4, Chris G. Dulla1 7 8 9 1. Department of Neuroscience, Tufts University School of Medicine, 136 Harrison Avenue, 10 Boston, MA 02111, USA 11 2. Neuroscience Program, Tufts Sackler School of Biomedical Sciences, 136 Harrison 12 Avenue, Boston, MA 02111, USA 13 3. Department of Pharmacology, Emory University School of Medicine, Atlanta, GA, 30322, 14 USA 15 4. AstraZeneca Tufts Laboratory for Basic and Translational Neuroscience, Tufts University 16 School of Medicine, Boston, MA, 02111 17 5. Department of Health Sciences, Bouvé College of Health Sciences, Northeastern 18 University, Boston, MA, USA. 19 20 21 Abbreviated Title: Ambient glutamate and interneuron maturation 22 23 Corresponding Author: 24 Chris Dulla 25 [email protected] 26 Tufts Sackler School of Biomedical Sciences 27 South Cove 203 28 136 Harrison Avenue, Boston, MA 02111 29 617-636-3418 30 31 Lead Contact: Chris Dulla 32 33 Number of pages: 41 34 Number of figures: 8 35 Number of words: Abstract, 249; Introduction, 646; Discussion, 1397 36 37 Conflict of interests: SFT is on the Scientific Advisory Board for Sage Therapeutics, and a co- 38 founder of NeurOp Inc. 39 40 Acknowledgements: This work was supported by the Epilepsy Foundation (CD), National 41 Institute of Neurological Disease and Stroke R01-NS076885 (CD), R56-NS076885 (CD), 42 NS036554 (ST), Synapse Neurobiology Training Grant (EH, NINDS T32-NS061764, M. Jacob, 43 P.I.), and Tufts Center for Neuroscience Research (P30 NS047243). We would like to thank 44 Jennifer Shih, Thomas Papouin, Paul Rosenberg, Chinfei Chen, Christian Bjorbaek, Dan Cox, 1 45 and John Lisman for their helpful comments. We would also like to thank Pedram Hamrah, Arisa 46 Jamali, and Allen Parmelee for their help in establish a FACs protocol. 2 47 ABSTRACT 48 49 Developing cortical GABAergic interneurons rely on genetic programs, neuronal activity, and 50 environmental cues to construct inhibitory circuits during early post-natal development. 51 Disruption of these events can cause long-term changes in cortical inhibition and may be 52 involved in neurological disorders associated with inhibitory circuit dysfunction. We 53 hypothesized that tonic glutamate signaling in the neonatal cortex contributes to and is 54 necessary for the maturation of cortical interneurons. To test this hypothesis, we utilized mice of 55 both sexes to quantify extracellular glutamate concentrations in the cortex during development, 56 measure ambient glutamate-mediated activation of developing cortical interneurons, and 57 manipulate tonic glutamate signaling using subtype-specific NMDA receptor antagonists in vitro 58 and in vivo. We report that ambient glutamate levels are high (≈100 nM) in the neonatal cortex 59 and decrease (to ≈50 nM) during the first weeks of life, coincident with increases in astrocytic 60 glutamate uptake. Consistent with elevated ambient glutamate, putative parvalbumin (PV)- 61 positive interneurons in the cortex (identified using G42:GAD1-eGFP reporter mice) exhibit a 62 transient, tonic NMDA current at the end of the first post-natal week. GluN2C/GluN2D- 63 containing NMDA receptors mediate the majority of this current, and contribute to the resting 64 membrane potential and intrinsic properties of developing putative PV interneurons. 65 Pharmacological blockade of GluN2C/GluN2D-containing NMDA receptors in vivo during the 66 period of tonic interneuron activation, but not later, leads to lasting decreases in interneuron 67 morphological complexity and causes deficits in cortical inhibition later in life. These results 68 demonstrate that dynamic ambient glutamate signaling contributes to cortical interneuron 69 maturation via tonic activation of GluN2C/GluN2D-containing NMDA receptors. 70 71 72 3 73 SIGNIFICANCE STATEMENT 74 75 Inhibitory GABAergic interneurons make up 20% of cortical neurons and are critical to 76 controlling cortical network activity. Dysfunction of cortical inhibition is associated with multiple 77 neurological disorders, including epilepsy. Establishing inhibitory cortical networks requires in 78 utero proliferation, differentiation, and migration of immature GABAergic interneurons, and 79 subsequent post-natal morphological maturation and circuit integration. Here, we demonstrate 80 that ambient glutamate provides tonic activation of immature, putative parvalbumin-positive 81 GABAergic interneurons in the neonatal cortex via high-affinity NMDA receptors. When this 82 activation is blocked, GABAergic interneuron maturation is disrupted, and cortical networks 83 exhibit lasting abnormal hyperexcitability. We conclude that temporally precise activation of 84 developing cortical interneurons by ambient glutamate is critically important for establishing 85 normal cortical inhibition. 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 4 113 114 115 INTRODUCTION 116 117 Inhibitory GABAefrgic interneurons (INs) control cortical function by constraining local neuronal 118 activity and orchestrating circuit synchronization (Hensch et al., 1998; Buzsáki and Draguhn, 119 2004; Markram et al., 2004; Cardin et al., 2009). During embryonic development, cells destined 120 to become cortical INs are generated in the medial and caudal ganglionic eminences (MGE and 121 CGE) (Xu et al., 2004). These newborn INs migrate to the cortex, before radially migrating into 122 the cortical lamina (Angevine and Sidman, 1961; Berry and Rogers, 1965). Once in the cortex, a 123 combination of genetic programs and environmental cues drive interneuron localization, 124 morphological differentiation, and synaptic connectivity (Huang et al., 1999; Levitt et al., 2004; 125 Flames and Marín, 2005; BatistaǦBrito and Fishell, 2009; Bortone and Polleux, 2009). 126 GABAergic synaptic activity is established prior to glutamatergic, and GABA is excitatory in 127 early development due to developmentally specific expression of chloride transporters (Kaila et 128 al., 2014). This engenders GABAergic INs with the ability to drive spontaneous developmental 129 network activity (Kasyanov et al., 2004; Allene et al., 2008; Minlebaev et al., 2011), which is 130 critical to establishing synaptic properties, local microcircuits, and long-range neuronal 131 connections. The underlying developmental events that shape interneuron activity and 132
Load more

Recommended publications
  • NMDA Receptor Dynamics Dictate Neuronal Plasticity and Function
    NMDA Receptor Dynamics Dictate Neuronal Plasticity and Function Tommy Weiss Sadan, Ph.D. and Melanie R. Grably, Ph.D. N-Methyl-D-Aspartate Receptor (NMDAR) are ubiquitously expressed along the central nervous system and are instrumental to various physiological processes such as synaptic plasticity and learning. Nevertheless, several mental disabilities including schizophrenia and Alzheimer’s disease are all related to NMDAR dysfunction. Here, we review many aspects of NMDAR function and regulation and describe their involvement in pathophysiological states using Alomone Labs products. Right: Cell surface detection of GluN2B in rat hippocampal neurons. Introduction Mechanism of Action Glutamate is a key neuro-transmitter in the central nervous system and NMDAR activation depends on sequential conformational changes to acts on a variety of cell surface receptors, collectively termed ionotropic relieve the magnesium blockade which is achieved by rapid membrane glutamate receptors (iGluRs)15. The N-Methyl-D-Aspartate receptors (NMDAR) depolarization and binding of both glycine and glutamate ligands6, 21. This in are members of the iGluR superfamily and are pivotal to many physiological turn removes the inhibitory electrostatic forces of magnesium and enables processes such as the formation of long term memory, synaptic plasticity calcium influx and transmission of long lasting signals (i.e. long-term and many other cognitive functions. Therefore, it is not surprising that potentiation), a key mechanism to learning and memory formation10.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Gene Expression Studies in Depression Development and Treatment
    Mariani et al. Translational Psychiatry (2021) 11:354 https://doi.org/10.1038/s41398-021-01469-6 Translational Psychiatry REVIEW ARTICLE Open Access Gene expression studies in Depression development and treatment: an overview of the underlying molecular mechanisms and biological processes to identify biomarkers Nicole Mariani 1, Nadia Cattane2,CarminePariante 1 and Annamaria Cattaneo 2,3 Abstract A combination of different risk factors, such as genetic, environmental and psychological factors, together with immune system, stress response, brain neuroplasticity and the regulation of neurotransmitters, is thought to lead to the development of major depressive disorder (MDD). A growing number of studies have tried to investigate the underlying mechanisms of MDD by analysing the expression levels of genes involved in such biological processes. These studies have shown that MDD is not just a brain disorder, but also a body disorder, and this is mainly due to the interplay between the periphery and the Central Nervous System (CNS). To this purpose, most of the studies conducted so far have mainly dedicated to the analysis of the gene expression levels using postmortem brain tissue as well as peripheral blood samples of MDD patients. In this paper, we reviewed the current literature on candidate gene expression alterations and the few existing transcriptomics studies in MDD focusing on inflammation, neuroplasticity, neurotransmitters and stress-related genes. Moreover, we focused our attention on studies, which have investigated 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; mRNA levels as biomarkers to predict therapy outcomes. This is important as many patients do not respond to antidepressant medication or could experience adverse side effects, leading to the interruption of treatment.
    [Show full text]
  • Ion Channels
    UC Davis UC Davis Previously Published Works Title THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels. Permalink https://escholarship.org/uc/item/1442g5hg Journal British journal of pharmacology, 176 Suppl 1(S1) ISSN 0007-1188 Authors Alexander, Stephen PH Mathie, Alistair Peters, John A et al. Publication Date 2019-12-01 DOI 10.1111/bph.14749 License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: Ion channels. British Journal of Pharmacology (2019) 176, S142–S228 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels Stephen PH Alexander1 , Alistair Mathie2 ,JohnAPeters3 , Emma L Veale2 , Jörg Striessnig4 , Eamonn Kelly5, Jane F Armstrong6 , Elena Faccenda6 ,SimonDHarding6 ,AdamJPawson6 , Joanna L Sharman6 , Christopher Southan6 , Jamie A Davies6 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 3Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 4Pharmacology and Toxicology, Institute of Pharmacy, University of Innsbruck, A-6020 Innsbruck, Austria 5School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 6Centre for Discovery Brain Science, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties.
    [Show full text]
  • The Glutamate Receptor Ion Channels
    0031-6997/99/5101-0007$03.00/0 PHARMACOLOGICAL REVIEWS Vol. 51, No. 1 Copyright © 1999 by The American Society for Pharmacology and Experimental Therapeutics Printed in U.S.A. The Glutamate Receptor Ion Channels RAYMOND DINGLEDINE,1 KARIN BORGES, DEREK BOWIE, AND STEPHEN F. TRAYNELIS Department of Pharmacology, Emory University School of Medicine, Atlanta, Georgia This paper is available online at http://www.pharmrev.org I. Introduction ............................................................................. 8 II. Gene families ............................................................................ 9 III. Receptor structure ...................................................................... 10 A. Transmembrane topology ............................................................. 10 B. Subunit stoichiometry ................................................................ 10 C. Ligand-binding sites located in a hinged clamshell-like gorge............................. 13 IV. RNA modifications that promote molecular diversity ....................................... 15 A. Alternative splicing .................................................................. 15 B. Editing of AMPA and kainate receptors ................................................ 17 V. Post-translational modifications .......................................................... 18 A. Phosphorylation of AMPA and kainate receptors ........................................ 18 B. Serine/threonine phosphorylation of NMDA receptors ..................................
    [Show full text]
  • Ligand-Gated Ion Channels
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2015/16: Ligand-gated ion channels. British Journal of Pharmacology (2015) 172, 5870–5903 THE CONCISE GUIDE TO PHARMACOLOGY 2015/16: Ligand-gated ion channels Stephen PH Alexander1, John A Peters2, Eamonn Kelly3, Neil Marrion3, Helen E Benson4, Elena Faccenda4, Adam J Pawson4, Joanna L Sharman4, Christopher Southan4, Jamie A Davies4 and CGTP Collaborators L 1 School of Biomedical Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK, N 2Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK, 3School of Physiology and Pharmacology, University of Bristol, Bristol, BS8 1TD, UK, 4Centre for Integrative Physiology, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2015/16 provides concise overviews of the key properties of over 1750 human drug targets with their pharmacology, plus links to an open access knowledgebase of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. The full contents can be found at http://onlinelibrary.wiley.com/ doi/10.1111/bph.13350/full. Ligand-gated ion channels are one of the eight major pharmacological targets into which the Guide is divided, with the others being: ligand-gated ion channels, voltage- gated ion channels, other ion channels, nuclear hormone receptors, catalytic receptors, enzymes and transporters. These are presented with nomenclature guidance and summary information on the best available pharmacological tools, alongside key references and suggestions for further reading. The Concise Guide is published in landscape format in order to facilitate comparison of related targets.
    [Show full text]
  • Rat GRIN2D Peptide (DAG-P1827) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Rat GRIN2D peptide (DAG-P1827) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Antigen Description N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of the key receptor subunit NMDAR1 (GRIN1) and 1 or more of the 4 NMDAR2 subunits: NMDAR2A (GRIN2A), NMDAR2B (GRIN2B), NMDAR2C (GRIN2C), and NMDAR2D (GRIN2D). [provided by RefSeq, Mar 2010] Nature Synthetic Expression System N/A Conjugate Unconjugated Sequence Similarities Belongs to the glutamate-gated ion channel (TC 1.A.10.1) family. NR2D/GRIN2D subfamily. Cellular Localization Cell Membrane; multi-pass membrane protein. Synapse; postsynaptic cell membrane. Procedure None Format Liquid Preservative None Storage Shipped at 4°C. Upon delivery aliquot and store at -20°C or -80°C. Avoid repeated freeze / thaw cycles. Information available upon request. ANTIGEN GENE INFORMATION Gene Name GRIN2D glutamate receptor, ionotropic, N-methyl D-aspartate 2D [ Homo sapiens (human) ] Official Symbol GRIN2D Synonyms GRIN2D; glutamate receptor, ionotropic, N-methyl D-aspartate 2D; EB11; NR2D; GluN2D; NMDAR2D; glutamate receptor ionotropic, NMDA 2D; estrogen receptor binding CpG island; N- methyl D-aspartate receptor subtype 2D; N-methyl-d-aspartate receptor subunit 2D; glutamate
    [Show full text]
  • Genetic Variations Associated with Pharmacoresistant Epilepsy (Review)
    MOLECULAR MEDICINE REPORTS 21: 1685-1701, 2020 Genetic variations associated with pharmacoresistant epilepsy (Review) NOEMÍ CÁRDENAS-RODRÍGUEZ1*, LILIANA CARMONA-APARICIO1*, DIANA L. PÉREZ-LOZANO1,2, DANIEL ORTEGA-CUELLAR3, SAÚL GÓMEZ-MANZO4 and IVÁN IGNACIO-MEJÍA5,6 1Laboratory of Neuroscience, National Institute of Pediatrics, Ministry of Health, Coyoacán, Mexico City 04530; 2Department of Postgraduate of Medical, Dental and Health Sciences, Clinical Experimental Health Research, National Autonomous University of Mexico, Mexico City 04510; Laboratories of 3Experimental Nutrition and 4Genetic Biochemistry, National Institute of Pediatrics, Ministry of Health, Coyoacán, Mexico City 04530; 5Laboratory of Translational Medicine, Military School of Health Graduates, Lomas de Sotelo, Militar, Mexico City 11200; 6Section of Research and Graduate Studies, Superior School of Medicine, National Polytechnic Institute, Mexico City 11340, Mexico Received August 28, 2019; Accepted January 16, 2020 DOI: 10.3892/mmr.2020.10999 Abstract. Epilepsy is a common, serious neurological disorder the pathophysiological processes that underlie this common worldwide. Although this disease can be successfully treated human neurological disease. in most cases, not all patients respond favorably to medical treatments, which can lead to pharmacoresistant epilepsy. Drug-resistant epilepsy can be caused by a number of mecha- Contents nisms that may involve environmental and genetic factors, as well as disease- and drug-related factors. In recent years, 1. Introduction numerous studies have demonstrated that genetic variation is 2. Pharmacoresistant epilepsy involved in the drug resistance of epilepsy, especially genetic 3. Genetic variations associated with pharmacoresistant variations found in drug resistance-related genes, including epilepsy the voltage-dependent sodium and potassium channels genes, 4. The role of genetic variants in the diagnosis and treatment and the metabolizer of endogenous and xenobiotic substances of pharmacoresistant epilepsy genes.
    [Show full text]
  • RGS4 Maintains Chronic Pain Symptoms in Rodent Models
    Research Articles: Cellular/Molecular RGS4 maintains chronic pain symptoms in rodent models https://doi.org/10.1523/JNEUROSCI.3154-18.2019 Cite as: J. Neurosci 2019; 10.1523/JNEUROSCI.3154-18.2019 Received: 16 December 2018 Revised: 2 May 2019 Accepted: 27 June 2019 This Early Release article has been peer-reviewed and accepted, but has not been through the composition and copyediting processes. The final version may differ slightly in style or formatting and will contain links to any extended data. Alerts: Sign up at www.jneurosci.org/alerts to receive customized email alerts when the fully formatted version of this article is published. Copyright © 2019 the authors 1 RGS4 maintains chronic pain symptoms in rodent models 2 3 4 Kleopatra Avrampou*,**, Kerri D. Pryce*, Aarthi Ramakrishnan*, Farhana Sakloth*, Sevasti 5 Gaspari*, Randal A. Serafini*, Vasiliki Mitsi*, Claire Polizu*, Cole Swartz*, Barbara Ligas*, 6 Abigail Richards*, Li Shen*, Fiona B. Carr*, and Venetia Zachariou*#^. 7 8 9 *Nash Family Department of Neuroscience, and Friedman Brain Institute, Icahn School of 10 Medicine at Mount Sinai, 1425 Madison Ave, New York, NY, 10029. 11 **University of Crete Faculty of Medicine, Heraklion, Crete, Greece, 71003. 12 ^Department of Pharmacological Sciences, Icahn School of Medicine at Mount Sinai, 1425 13 Madison Ave, New York, NY, 10029. 14 15 Number of pages: 28 16 Number of figures: 6 17 Number of words: Abstract: 240 Introduction: 585 Discussion 1612 18 19 #Corresponding author: Venetia Zachariou, Nash Family Department of Neuroscience, 20 Friedman Brain Institute and Department of Pharmacological Sciences, Icahn School of 21 Medicine at Mount Sinai, 1425 Madison Avenue, New York NY, tel.
    [Show full text]
  • Glutamate Receptor Ionotropic, NMDA 2D (GRIN2D) (NM 000836) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG224610 Glutamate receptor ionotropic, NMDA 2D (GRIN2D) (NM_000836) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Glutamate receptor ionotropic, NMDA 2D (GRIN2D) (NM_000836) Human Tagged ORF Clone Tag: TurboGFP Symbol: GRIN2D Synonyms: DEE46; EB11; EIEE46; GluN2D; NMDAR2D; NR2D Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG224610 representing NM_000836 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCGCGGCGCCGGTGGCCCCCGCGGCCCTCGGGGCCCCGCTAAGATGCTGCTGCTGCTGGCGCTGGCCT GCGCCAGCCCGTTCCCGGAGGAGGCGCCGGGGCCGGGCGGGGCCGGTGGGCCCGGCGGCGGCCTCGGCGG GGCGCGGCCGCTCAACGTGGCGCTCGTGTTCTCGGGGCCCGCGTACGCGGCCGAGGCGGCACGCCTGGGC CCGGCCGTGGCGGCGGCGGTGCGCAGCCCGGGCCTAGACGTGCGGCCCGTGGCGCTGGTGCTCAACGGCT CGGACCCGCGCAGCCTCGTGCTGCAGCTCTGCGACCTGCTGTCGGGGTTGCGCGTGCACGGCGTGGTCTT CGAAGACGACTCGCGCGCGCCCGCCGTCGCGCCCATCCTCGACTTCCTGTCGGCGCAGACCTCGCTGCCC ATCGTGGCCGTGCACGGCGGCGCCGCGCTCGTGCTCACGCCCAAGGAGAAGGGCTCCACCTTCCTGCAGC TGGGCTCTTCCACCGAGCAACAGCTTCAGGTCATCTTTGAGGTGCTGGAGGAGTATGACTGGACGTCCTT TGTAGCCGTGACCACTCGTGCCCCTGGCCACCGGGCCTTCCTGTCCTACATTGAGGTGCTGACTGACGGT AGTCTGGTGGGCTGGGAGCACCGCGGAGCGCTGACGCTGGACCCTGGGGCGGGCGAGGCCGTGCTCAGTG CCCAGCTCCGCAGTGTCAGCGCGCAGATCCGCCTGCTCTTCTGCGCCCGAGAGGAGGCCGAGCCCGTGTT
    [Show full text]
  • Converging Roles of Glutamate Receptors in Domestication and Prosociality
    bioRxiv preprint doi: https://doi.org/10.1101/439869; this version posted October 11, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Converging roles of glutamate receptors in domestication and prosociality Thomas O’Rourke1,2 and Cedric Boeckx1,2,3 1Universitat de Barcelona 2Universitat de Barcelona Institute of Complex Systems 3ICREA October 10, 2018 Abstract Building on our previous work and expanding the range of species consid- ered, we highlight the prevalence of signals of positive selection on genes coding for glutamate receptors (most notably kainate and metabotropic receptors) in domesticated species and anatomically modern humans. Re- lying on their expression in the central nervous system and phenotypes associated with mutations in these genes, we claim that regulatory changes in kainate and metabotropic receptor genes have led to alterations in lim- bic function and Hypothalamic-Pituitary-Adrenal axis regulation, with potential implications for the emergence of unique social behaviors and communicative abilities in (self-)domesticated species. 1 Introduction Under one account of recent human evolution, selective pressures on prosocial behaviors led not only to a species-wide reduction in reactive aggression and the extension of our social interactions [1], but also left discernible physical mark- ers on the modern human phenotype, including our characteristically “gracile” anatomy [2, 3]. It has long been noted that these morphological differences resemble those of domesticated species when compared with their wild counterparts [4].
    [Show full text]
  • The Pdx1 Bound Swi/Snf Chromatin Remodeling Complex Regulates Pancreatic Progenitor Cell Proliferation and Mature Islet Β Cell
    Page 1 of 125 Diabetes The Pdx1 bound Swi/Snf chromatin remodeling complex regulates pancreatic progenitor cell proliferation and mature islet β cell function Jason M. Spaeth1,2, Jin-Hua Liu1, Daniel Peters3, Min Guo1, Anna B. Osipovich1, Fardin Mohammadi3, Nilotpal Roy4, Anil Bhushan4, Mark A. Magnuson1, Matthias Hebrok4, Christopher V. E. Wright3, Roland Stein1,5 1 Department of Molecular Physiology and Biophysics, Vanderbilt University, Nashville, TN 2 Present address: Department of Pediatrics, Indiana University School of Medicine, Indianapolis, IN 3 Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 4 Diabetes Center, Department of Medicine, UCSF, San Francisco, California 5 Corresponding author: [email protected]; (615)322-7026 1 Diabetes Publish Ahead of Print, published online June 14, 2019 Diabetes Page 2 of 125 Abstract Transcription factors positively and/or negatively impact gene expression by recruiting coregulatory factors, which interact through protein-protein binding. Here we demonstrate that mouse pancreas size and islet β cell function are controlled by the ATP-dependent Swi/Snf chromatin remodeling coregulatory complex that physically associates with Pdx1, a diabetes- linked transcription factor essential to pancreatic morphogenesis and adult islet-cell function and maintenance. Early embryonic deletion of just the Swi/Snf Brg1 ATPase subunit reduced multipotent pancreatic progenitor cell proliferation and resulted in pancreas hypoplasia. In contrast, removal of both Swi/Snf ATPase subunits, Brg1 and Brm, was necessary to compromise adult islet β cell activity, which included whole animal glucose intolerance, hyperglycemia and impaired insulin secretion. Notably, lineage-tracing analysis revealed Swi/Snf-deficient β cells lost the ability to produce the mRNAs for insulin and other key metabolic genes without effecting the expression of many essential islet-enriched transcription factors.
    [Show full text]