Gene Transfer in the Sandhoff Murine Model Using a Specific Recombinant AAV9 Vector

UNIVERSITE PARIS DESCARTES (PARIS 5)

ECOLE DOCTORALE BIOLOGIE ET BIOTECHNOLOGIE B2T

THÈSE

Présentée pour obtenir le grade de

DOCTEUR DE L'UNIVERSITÉ PARIS DESCARTES Spécialité: Biothérapies et Biotechnologies

par

Natalia Niemir

Gene transfer in the Sandhoff murine model using a specific recombinant AAV9 vector

Soutenue le 25 novembre 2013

JURY

Pr Isabelle DESGUERRE Présidente Pr Thierry LEVADE Rapporteur Dr Jérôme AUSSEIL Rapporteur Dr Caroline SEVIN Examinatrice Dr Pierre Olivier COURAUD Examinateur Dr Catherine CAILLAUD Directrice de thèse

Résumé de la thèse

La maladie de Sandhoff ou gangliosidose à GM2 variant 0 est une affection à transmission autosomique récessive, due à des mutations du gène HEXB codant la chaine β des hexosaminidases. Elle s’accompagne d’un double déficit en Hex A (αβ) et Hex B (ββ), responsable d’une accumulation de gangliosides GM2, principalement dans le système nerveux central (SNC). Sur le plan clinique, cette maladie débute généralement dans les premiers mois de la vie et conduit au décès vers l’âge de 2-3 ans. Un modèle animal a été obtenu par invalidation du gène HEXB, mimant assez bien la maladie humaine et constituant un bon outil pour les études physiopathologiques et la mise au point d'approches thérapeutiques, sachant que cette maladie évolue inexorablement vers le décès. Au cours de mon projet de thèse, j'ai décidé d'explorer différentes stratégies thérapeutiques, basées soit sur des thérapies moléculaires ciblées, soit sur un transfert de gènes à l'aide d'un vecteur de type AAV. Pour développer la première approche, des études moléculaires préalables ont été réalisées chez des patients français et libanais atteints de maladie de Sandhoff. Nous avons pu montrer qu'en France, 36% des allèles sont porteurs d'une grande délétion de 16 kb, les autres mutations étant assez hétérogènes. A l'inverse, au sein de la population libanaise, tous les patients sont porteurs d'une même mutation d'épissage appelée c.1082+5G>A. Des fibroblastes ont été obtenus pour certains de ces patients et ces cellules ont été utilisées pour tester l'effet d'une molécule, la pyriméthamine, qui a été décrite comme pouvant avoir un effet chaperon sur certaines mutations dans la maladie de Tay-Sachs, une autre forme de gangliosidose à GM2. Chez les patients Sandhoff testés, nous avons pu observer une augmentation de l'activité des hexosaminidases sous l'effet du médicament (analyse faite avec le substrat artificiel), mais des tests métaboliques ont montré que le substrat naturel (GM2) ne peut pas être dégradé. Au final, dans la maladie de Sandhoff, la pyriméthamine n'est pas active sur l'Hex A, mais seulement sur l'Hex S (homodimère αα) qui n'a pas de rôle physiologique connu. L'essentiel de mon projet a été focalisé sur la mise au point d'un transfert de gènes basé sur l'utilisation d'un vecteur AAV9, qui a précédemment démontré sa capacité à transduire le SNC après administration par voie veineuse. Un vecteur AAV9 codant la chaine β des hexosaminidases sous le contrôle du promoteur PGK a donc été construit et il a été administré au niveau de la veine temporale chez des souriceaux Hexb-/- en période néonatale. Un groupe d'animaux a été suivi à long terme afin d'étudier leur survie et leur comportement, un autre a fait l'objet d'études enzymatiques, biochimiques et histologiques. Les animaux injectés ont un allongement significatif de leur espérance de vie (> 500 jours au lieu de 120 jours en moyenne chez des animaux Sandhoff non traités) et leur comportement (rotarod, actimètre, ...) est comparable à celui des animaux normaux. Par ailleurs, l'analyse histologique a montré l'absence de surcharge et de signes de neuroinflammation (astrocytose, microgliose) chez les animaux traités. De plus, l'étude des lipides cérébraux révèle une accumulation nette de GA2 et GM2 chez les souris Sandhoff, mais un profil quasiment normal chez les souris Hexb-/- injectées avec le vecteur thérapeutique. Il est à noter que ces résultats ont été obtenus malgré une restauration enzymatique partielle, liée à la large diffusion du vecteur administré par voie intraveineuse. Ces données encourageantes pourraient permettre une application chez l'homme, après évaluation chez des animaux traités à un âge plus tardif (plus grande pertinence clinique).

Remerciements

Je tiens à dire en premier lieu que le Doctorat m’a apporté une énorme satisfaction. Le temps passé au sein de l’Institut Cochin, puis de l’Institut Necker, mais aussi au King’s College de Londres et à l’Université de Milan a été une incroyable formation à la vie et un enrichissement, tant sur le plan scientifique que culturel et humain.

Il m'est difficile d'exprimer en quelques mots ce que je dois à Catherine Caillaud, ma directrice de thèse. Nous avons passé ensemble quatre années remplies d’aventures (parfois difficiles !) et j’ai toujours pu compter sur votre soutien et vos conseils judicieux. Vous m’avez encouragé dans mes projets au laboratoire et aussi dans d’autres non directement liés à la recherche. Grace à vous, au cours de ma thèse, j’ai pu voyager, créer des collaborations fructueuses, rencontrer des gens fascinants et explorer le monde. Ensemble, nous avons appris que la volonté est le premier pas vers la réussite et que la motivation permet de ressortir de chaque impasse.

Je souhaite également remercier : - Laura Rouvière qui a pris soin de mes expériences et de mes animaux quand je ne pouvais pas le faire et qui continue ce beau projet.

- Jean-Philippe Puech et Emilie Azouguène pour leur soutien au quotidien et leur précieuse aide tout au long de ma these.

Je remercie aussi chaleureusement nos collaborateurs:

- Martine Barkats et son équipe: Aurore Besse, Stéphanie Astord, Thibaut Marais pour notre précieux virus, les productions et la grande disponibilité qui nous a permis d’avancer ce projet

- Marie Vanier, pour son expertise d’énorme valeur et son excellence dans le domaine de la biochimie des gangliosides

- Jonathan Cooper qui m’a accueilli au sein de son laboratoire pendant deux mois, qui m ‘a « adoptée » comme membre de son équipe et initié à l’analyse histopathologique, la vraie.

Un grand merci à Lionel Batista, toujours souriant, qui m’a formé pendant mon stage de Master, et qui depuis, suis mes efforts et m’encourage malgré la grande vitesse de sa vie.

A Marc, qui m’a donné un coup de main encore et encore, et qui me rappelle à chaque fois le long chemin que j’ai fait depuis mon premier jour au Magistère de Génétique…

A l’équipe des animaliers EOPS pour les longues heures que nous avons passées ensemble et pour avoir veillé sur le bien-être de mes animaux.

Enfin, je tiens à remercier mes parents:

- A mon Père qui n’a pas pu vivre ce moment avec moi mais qui a toujours fait confiance à mes choix et qui m’a appris à assumer la responsabilité de mes décisions. Papa, tu me manques chaque jour…

- A ma Mère qui me montre comment être forte.

Ainsi que mes amis : - A Marta R. et Marta T, qui ne sont jamais trop loin - A Ania K. pour son regard objectif - A Zuza, avec laquelle j’ai partagé un appartement, mon quotidien et tous les ennuis de la thèse - A tous les gens rencontrés durant ces 6 ans passés en France, pour tous les moments de joie que nous avons partagés.

Et à Franck, qui croyait en moi, quand je n’y croyais plus. Merci pour ta compréhension, ta patience et chaque sourire que tu m’apportes. Et pour le coup de fil matinal, chaque jour sans faille, tout au long de la rédaction de ce manuscrit.

« Aut viam inveniam aut faciam. »

I shall either find a way or make one.

Seneca

Table of Contents

CHAPTER 1

Introduction...... 12

1.1 GM2 gangliosidoses...... 13

Definition ...... 14 Cinical forms ...... 16 Infantile form ...... 17 Juvenile and adult forms...... 18 Biochemical aspects ...... 20 Hexosaminidases biosynthesis and maturation...... 20 Metabolic bases...... 23 Structure of glycosphingolipids ...... 23 Biosynthesis of GSLs ...... 24 Degradation of glycosphingolipids...... 26 Genetic aspects ...... 27 HEXA – gene coding for the α subunit of β-hexosaminidases ...... 27 HEXB – gene coding for β subunit of β-hexosaminidases ...... 27 GM2A - gene coding for GM2 activator protein ...... 27 Mutations and correlation between genotype and phenotype...... 28 HEXA mutations...... 28 HEXB mutations...... 29 GM2A mutations...... 30 Diagnosis of GM2 gangliosidoses ...... 30 Biochemical analysis: enzymatic assays...... 30 Determinant role of the hexosaminidases residual activity...... 31 Molecular analysis ...... 32

1.2 Molecular therapeutic approaches for GM2 gangliosidoses ...... 33

Substrate reduction therapy - SRT...... 34 Eliglustat tartrate and ethylenedioxy-PIP2 Oxalate- EtDO-PIP2, or ‘‘3h’’...... 35 N-butyldeoxynojirimycin – NB-DNJ...... 36 N-butyldeoxygalactonojirimycin - NB-DGJ...... 38 Non-steroid anti-inflammatory drugs - NSAIDs...... 39 NSAIDs and synergy with SRT and antioxidants ...... 39 Bone marrow transplantation - BMT...... 40 Combined therapy between bone marrow transplantation and substrate reduction...... 42

6 Enzyme replacement therapy - ERT...... 43 Chaperone therapy ...... 46 Results ...... 49

Article 1 ...... 50 Detection of novel mutations in Sandhoff patients and impact on hexosaminidase structure and activity...... 57

Article 2 ...... 63 Discussion...... 73

Use of pyrimethamine as chaperone in GM2 gangliosidoses ...... 74

CHAPTER 2

Introduction...... 80

2.1 Animal models of Sandhoff disease...... 81 Sandhoff mouse model ...... 81 Microglial activation...... 83 GM2 ganglioside storage ...... 83 Immune system abnormalities...... 85 CNS pathology associated with neuron loss...... 88 Inducible murine model...... 91 Other models...... 91 Feline model...... 91 Canine Model ...... 92

2.2 Adeno-Associated Virus (AAV): vector for CNS gene transfer...... 93 Natural AAVs...... 93 Tropism and cell entry ...... 94 Origin of known AAVs and hunt for new serotypes...... 96 Recombinant AAVs ...... 97 AAV vectors engineering...... 98 Mosaic AAVs...... 98 Chimeric AAVs ...... 98 Combinatorial AAV vector libraries ...... 98 CNS-directed transgene delivery...... 99 Promoter ...... 100 Enhancers...... 101 Capsid modifications...... 102 Self-complementary AAVs ...... 102

2.3 Ways of administration for an efficient CNS treatment...... 104

7 Intracranial administration ...... 105 Intrathecal administration ...... 106 Intravenous delivery...... 106 Blood-brain barrier opening ...... 107 Results ...... 109

Gene transfer for the treatment of GM2 gangliosidoses ...... 110 Strategic positioning of our project : what has already been done ? ...... 110 Choice of an scAAV9 vector for gene transfer in Sandhoff models ...... 112

Article 3 ...... 120

Discussion and perspectives ...... 171

What is the critical period for an efficient administration of the AAV9 vector ? ...... 172 Is it necessary to administer one or both hexosaminidase subunits ? ...... 174 Are they still unknown aspects in the neurohistopathology of Sandhoff disease ?...... 175 Thalamus as a focus point of the pathology ...... 175 Synaptic impairment ...... 176 Can immunity alter the success of gene transfer in Sandhoff disease ?...... 178

ABBREVIATIONS

REFERENCES

Table of Figures

Figure 1: Multilamellar aspect of lysosomal storage in GM2 gangliosidoses ...... 13 Figure 2: Different LSDs on the sphingolipid degradation pathway ...... 15 Figure 3: GM2 gangliosidosis variants and their corresponding genes and β-hexosaminidase isoenzymes...... 16 Figure 4: Cherry red macular spot in an infantile patient with GM2 gangliosidosis ...... 17 Figure 5: Posttranslational modifications of the β-hexosaminidase subunits and activator protein 20 Figure 6: Biosynthesis of lysosomal enzymes and mannose-6-phosphate receptor trafficking pathway...... 22 Figure 7: General structure of a ganglioside (example of GM1 ganglioside) ...... 23 Figure 8: Schematic view of ganglioside biosynthesis in mammalian cells...... 25 Figure 9: Degradation of GM2 ganglioside by β-hexosaminidase A...... 26 Figure 10: The principle of “residual activity hypothesis” experimental verification ...... 31 Figure 11: Main therapeutic options for lysosomal diseases...... 34 Figure 12: Effect of different NSAIDs drugs on survival of Sandhoff disease mice...... 40 Figure 13: Damage-response pathway in lysosomal storage disease...... 42 Figure 14: General action of chemical and pharmacological chaperones ...... 47 Figure 15: Characterization of the c.1082+5G>A mutation at the genomic and cDNA level ...... 75 Figure 16: Hexosaminidase specific activity in fibroblasts from both patients with "atypical" form of infantile Sandhoff disease...... 77 Figure 17: Pyrimethamine structure...... 78 Figure 18: Hexb-/- mice at a terminal stage of the disease (4 months)...... 81 Figure 19: AAV genome...... 93 Figure 20: Simplified clade dendrogram of AAV species representing neighbour-joining phylogenies of the VP1 protein sequence of primate AAVs...... 97 Figure 21: Formation of dimeric inverted repeat genomes (scAAV) ...... 103 Figure 22: A schematic representation of the self-complimentary AAV (scAAV) genome...... 104 Figure 23: Vector delivery strategies for gene therapy of neurogenetic diseases...... 105 Figure 24: The blood-brain barrier structure...... 108 Figure 25: Advantages of the use of scAAV leading to immediate and efficient expression of the gene of interest ...... 118

9 Figure 26: AAV9-Hexb vector coding for mouse Hexb gene under the PGK promoter control 119 Figure 27: Distinct staging of pathology in the thalamus and cortex of Hexb-/- mice...... 177

Tables

Table 1: General features of the different variants of GM2 gangliosidoses ...... 19 Table 2: Market approved ERT drugs for different LSDs with manufacturer and date of approval ...... 45 Table 3: Previously described HEXB mutations and their impact in Sandhoff patients ...... 62 Table 4: Development of disease phenotype in Hexb-/- mice...... 82 Table 5: Reported immune system abnormalities in Sandhoff disease...... 88 Table 6: Double knock-out animals presenting different phenotypes are a powerful tool for better comprehension of Sandhoff disease neuropathology ...... 90 Table 7: Receptors and co-receptors of AAVs ...... 96 Table 8: Results obtained by different gene transfer approaches using recombinant AAV9 vectors ...... 117

CHAPTER 1

Introduction

1.1 GM2 gangliosidoses

Lysosomal storage diseases (LSDs) are a group of 50 genetic disorders generally caused by the defective activity of one or several lysosomal enzyme(s). They result from mutations on specific genes leading to enzyme deficiency or dysfunction and to the subsequent accumulation of biological compounds in the lysosomes. Some LSDs can be due to mutations in genes encoding lysosomal membrane transporters (cystinosis,...). Although lysosomal storage disorders are individually rare, their combined prevalence is estimated to be 1:7000 live births (Meikle, et al. 1999). LSDs are monogenic and they are mainly transmitted as autosomal recessive traits, except mucopolysaccharidosis type II (Hunter disease), Fabry disease and Danon disease that are X-linked disorders. Lysosomal storage disorders were historically classified according to the nature of the accumulated substrate: sphingolipidoses (storage of sphingolipides), mucopolysaccharidoses (mucopolysaccharides or glycosaminoglycans), glycoproteinoses or oligosaccharidoses, .... The stored compounds can sometimes be found in excess in the patient urine (mucopolysaccharidoses, …) or they can be seen within the cells using electron microscopy (membranous cytoplasmic bodies in GM2 gangliosidoses, curvilinear profiles in ceroid lipofuscinoses type 2, ….).

Figure 1: Multilamellar aspect of lysosomal storage in GM2 gangliosidoses

This electron microscopy picture shows ganglioside accumulation in the lysosome of neurons presenting as characteristic multilamellar membranous cytoplasmic bodies, sometimes also called “zebra bodies” (arrows), containing a dense amorphous core (asterisks) (high magnification: 100 nm. Inset: lower magnification: 250 nm). From (Rickmeyer, et al. 2013).

Most LSDs present a broad clinical spectrum, ranging from severe, rapidly evolutive, infantile-onset forms to less progressive forms beginning in childhood or adulthood. This variability is due to the relative severity of the mutations present in the patient and to the resulting

13 residual enzymatic activity, with “null” mutations with a complete absence of enzyme giving the earliest clinical forms and the most severe symptoms. The high diversity of the symptoms is also related to the fact that some of the substrates are more abundantly present in specific organs or cell types. Thus, metachromatic leukodystrophy (MLD) due to defaults in sulfatide metabolism mainly affects the myelin, as sulfatides are present in high concentration in oligodendrocytes and Swann cells. Moreover, the turnover of the protein and intensity of the metabolism can influence the severity of the corresponding lysosomal disorder. Neuronopathic LSDs have some similarities with other neurodegenerative disorders such as Alzheimer, Parkinson or Huntington disease due to the accumulation of some secondary compounds and to their deleterious action into the central nervous system (CNS).

Definition

Sphingolipidoses form an important group among LSDs. They are due to the accumulation of glycosphingolipids (GSL) and other sphingolipids in different organs, including CNS. Within this subgroup, specific lysosomal ganglioside storage diseases exist, called GM2- gangliosidoses. They are inherited defects of ganglioside catabolism caused by the deficiency of one of the enzymes catalysing the degradation of GM2 gangliosides and associated glycolipids (GA2 or globosides). These disorders result in lipid storage into the lysosomes of many tissues, but their hallmark is a massive accumulation into the brain (Figure 1).

Figure 2 :Different LSDs on the sphingolipid degradation pathway

Lysosomal storage disorders are generally caused by the deficiency of one lysosomal hydrolase resulting in a build-up of undegraded substrate(s) within the lysosome. The scheme shows the lysosomal sphingolipid degradation pathway. Hydrolases are indicated in green and the corresponding metabolic diseases are in black. Sphingolipid activator proteins (SAPs) necessary for the in vivo degradation are noted in red. The frame highlights the part of the pathway on which this work is focused. From (Sandhoff and Harzer 2013).

15 Among GM2 gangliosidoses, three disorders can be distinguished: Tay-Sachs disease (the most common), Sandhoff disease and the rare GM2 activator deficiency (Figure 2), respectively due to mutations in one of the following genes: HEXA, HEXB and GM2A. The HEXA and HEXB genes respectively encode the β-hexosaminidase α- and β-subunits, which dimerize to produce two major enzymatic forms, hexosaminidase A (αβ) and hexosaminidase B (ββ), and a minor form called hexosaminidase S (αα). GM2 gangliosides can be degraded only by the Hex A isozyme in conjunction with the GM2 activator protein.

&(=@&%()/7& %(3*/4,& ')9;(846&*+-)0+3)=& !07+(7+& '(60(38& & '(60(38&A& '(60(38&' &

',+)8+*&.+3+& $"'$% $"' % #%;$% !+:>/;<9;=% !+>/:<% !+>/<;9<<%

$41=5+59*+& &4)4-,1%7% &4)4-,1%8% $*25(1.0%

"3>=2+&

#+<&%& #+<&'& #+<& &

Figure 3: GM2 gangliosidosis variants and their corresponding genes and β-hexosaminidase isoenzymes

According to the classification proposed by Sandhoff and colleagues (Sandhoff, et al. 1971) based on the β-hexosaminidase functional subunit, three variants called B, AB and 0 have been described among GM2 gangliosidoses. Variant B corresponds to Tay Sachs disease exhibiting Hex A deficiency with normal Hex B. Variant 0 or Sandhoff disease is characterized by a double deficiency in both hexosaminidases. In patients with variant AB, Hex A and Hex B are present, but the disease results from a non-functionality of the GM2 activator protein.

Clinical forms

Tay-Sachs disease has a global estimated incidence in the general population of 1/222 000 live births (Meikle, et al. 1999) with a heterozygote estimated frequency around 1/300, justifying the orphan status of the disease. The Sandhoff variant prevalence and incidence rates were reported to be 1 in 384 000 and 1 in 422 000 live births, respectively (Meikle, et al. 1999). While TSD is frequent in Ashkenazi Jews (heterozygote frequency: 1/30), no ethnic predominance was detected

16 for Sandhoff disease. Even if these disorders can manifest with variable clinical symptoms in almost any age group, three main clinical forms can be described according to the age of onset: severe infantile form, juvenile form and late-onset (adult) variant. Their most frequent symptoms are given in Table 1.

Infantile form

The early infantile form is the most common variant of the disease and it presents the most severe spectrum of symptoms. This form is dominated by an involvement of the central nervous system (Lyon 1996) and a rapid evolution. The first symptoms appear between 2 to 9 months of age and lead to death before the patient reaches the age of three. Whereas during the first months of life, the child development is not alarming, after 6 months, the motor abilities start to degrade due to muscle weakening and the disease rapidly progresses. Affected children lose motor skills such as turning over, sitting, and crawling. In parallel, they develop seizures, hearing and vision loss due to axonal decay and loss of ganglion cells. In fact, GM2 gangliosidosis often present eye abnormalities, caused by the accumulation of intra-lysosomal GM2 ganglioside. The apoptosis of retinal ganglion cells in the foveolar region, normally giving white appearance to the fovea centralis in the eye, produces the reddish phenotype known as the cherry-red spot (Figure 4).

Figure 4: Cherry red macular spot in an infantile patient with GM2 gangliosidosis

The dark red spot is secondary to lipid storage in neuronal cells. The storing cells have lost their processes that normally cover the fovea centralis, responsible for white colour. With no ganglion cells, the red macular spot shows the natural colour of the choroidea behind the retina. According to (Sandhoff and Harzer 2013).

At the late stage of the disease, paralysis and mental retardation are obvious, and a brain atrophy can be observed. The cerebral degeneration is due to the lipid storage present in neuronal cells and to the subsequent neuron apoptosis. The peripheral and autonomous nerve systems are also involved, but with minor clinical relevance. Extra-neural manifestations are absent in GM2- gangliosidosis with the exception of the previously mentioned variant 0 (Sandhoff disease), in which a slight visceromegaly is frequent (Gravel, et al. 2001) and some involvement of bone and heart can occur (Venugopalan and Joshi 2002). In these infantile forms, the enzyme is usually completely absent due to the presence of severe mutations on the corresponding gene. Other

17 mutations can produce proteins with some residual metabolic activities, giving rise to protracted clinical forms often described as late infantile, juvenile, or chronic diseases (Sandhoff 1989) with a wide range of clinical symptomatology.

Juvenile and adult forms

Juvenile and adult onset forms of GM2 gangliosidosis are rare and symptoms, that can begin in childhood, adolescence, or adulthood are usually milder compared to the infantile variant of the disease. The juvenile form starts between 3 and 10 years of age, and the disease is usually fatal by the age of 15. This form frequently presents gait and speech disturbances and incoordination with intellectual impairment (Hendriksz, et al. 2004; Maegawa, et al. 2006). As the disease progresses, dysphagia, diarrhea and/or constipation, poor weight gain, behavioural or psychiatric problems, proximal-to-distal weakness and muscle wasting can occur (Tallaksen and Berg 2009). Adult onset variant of GM2 gangliosidosis is classified by its occurrence in older patients and it presents the highest inter-individual variability. As in the infantile form, motor and/or mental involvement is possible causing some difficulty from a diagnostic point of view. Two major groups can be distinguished: - patients with motor neuron disease symptoms: showing a progressive pattern of muscle weakness and secondary skeletal anomalies that can easily be confused with spinal amyotrophies or amyotrophic lateral sclerosis. - patients with psychiatric abnormalities: affecting approximately 40 % of patients with late GM2 gangliosidoses, include symptoms like schizophrenia marked by disorganisation of thought, agitation, delusions, hallucinations, paranoia and depression.

Disease Clinical forms Regular symptoms Facultative symptoms Remarks GM2-gangliosidosis, variant B Infantile Loss of head/trunk control and Megalencephaly, visceral (Tay-Sachs) and variant 0 smiling by about 6 months, involvement and oligo- (Sandhoff) cherry-red macular spot, high sacchariduria only in variant 0 startle response to noise, muscle hypotonia by 1 year, epilepsy, tetraparesis with some spasticity, dementia, blindness Juvenile/subacute Onset by 3 to 6 years, Seizures, irritability, psychiatric Clinical variability even in dysarthria, loss of speech, signs, denervation, muscle siblings spastic paraparesis, later on atrophy (EMG), areflexia, paraplegy, pyramidal signs, cherry-red macular spot cerebellar ataxia, mental deterioration Adult Clumsiness, lower motor Psychosis High clinical variability, oldest neuron disease, denervation patient was 76 years muscle atrophy, cerebellar ataxia Chronic Combines late infantile, juvenile, and sometimes adult manifestations in which the above listed symptoms are partly or gradually developed GM2-gangliosidosis, variant Most as in variants B, 0 Cherry-red macular spot No adult patients known AB (activator deficiency)

Table 1: General features of the different variants of GM2 gangliosidoses

19 Biochemical aspects

Hexosaminidases biosynthesis and maturation

The hexosaminidases α and β subunits as well as the activator monomer are synthesized in the rough endoplasmic reticulum (ER). The initial recognition of lysosomal enzymes in the ER is likely based on the recognition of a N-terminal peptide that is subsequently removed from the prepropolypeptide by signal peptidase. Next, the propolypeptides are glycosylated at selected Asn- X-Ser/Thr positions (Kornfeld and Kornfeld 1985). Phosphate markers are then added (mannose- 6-phosphate “tag”) to one or more high mannose-type oligosaccharide(s) allowing the polypeptides to be separated from secretory proteins through interactions with mannose-6-phosphate receptors in the trans Golgi (Griffiths, et al. 1988). In the lysosomal acidic environment, the loop structures necessary for the initial protein folding are removed by proteolytic and glycosidic processing events and the single pro-α and β-polypeptides are converted into two or three smaller polypeptides, held together by disulphide bonds in the mature subunits (Figure 5).

Figure 5: Posttranslational modifications of the β-hexosaminidase subunits and activator protein

The α/β subunits and GM2 activator polypeptides are represented as yellow bars; the numbers below show the amino acids of the termini, black bars indicate the signal peptides. Asparagine residues modified by oligosaccharides are presented within the bars. On the precursor level: the red circles present the phosphorylation-preferred oligosaccharides and the blue circles show the completely phosphorylated activator saccharide. In the activator protein the purple circle corresponds to incompletely phosphorylated oligosaccharides. The different parts of the mature subunits are connected by disulphide bonds (in yellow) and the degraded oligosaccharides are shown as black lines. According to (Scriver 2001).

The final steps in the maturation of the lysosomal enzyme include proteolysis, folding and assembly. As mentioned before, the dimerization is essential for the catalytic activity of the

20 hexosaminidases and it leads to the formation of the three distinct isoforms: Hex S (αα), Hex A (αβ) and Hex B (ββ). The process takes place upon the entry into the ER and the ββ dimerization occurs first, probably thanks to the high affinity of the β subunit for itself than for the α subunit (Mahuran 1999). The link between the α and β chains for the Hex A formation requires more time. The newly synthesized α chains enter the pool retained into the lysosome and the association with the β subunits happens several hours after the formation of the α and β homodimers (Sonderfeld-Fresko and Proia 1988).

The mannose 6-phosphate receptor pathway

Acid hydrolases traffic within the Golgi network where phosphorylated mannoses are recognized by mannose-6-phosphate receptors (M6PR) and directed to the lysosome, a process described the first time by Elizabeth Neufeld (Neufeld 1973). Two mannose-6-phosphate receptors have been characterized (Ghosh, et al. 2003): the first, composed of M6P cation- independent receptor/insulin like growth factor II (IGF II) receptor (CI-MPR) and the second, significantly smaller receptor, cation-dependent-MPR (CD-MPR). Each receptor has two sites where the M6P moieties can be fixed and by which the hydrolases can be connected. In the Golgi compartment, lysosomal enzymes acquire the M6P ligand - the mandatory marker for lysosomal entry - by the sequential action of a phosphotransferase and a diesterase. Phosphorylated enzyme then binds the M6PR at physiologic pH in the Golgi. The complex is then targeted through the endosomal system to the mature lysosome where the acidic pH uncouples the enzyme and the receptor. The hydrolase translocates into the lysosome and the receptor is recycled either to the Golgi apparatus or to the plasma membrane. But the generation of the mannose-6-phosphate tag is not 100% efficient, nor is the binding of properly tagged molecules to the mannose-6-phosphate receptor. If either one of these processes fails, the untagged and/or unbound pro-Hex molecule follows the cellular default pathway. Therefore, a small percentage of lysosomal enzymes is diverted from the endosomal/lysosomal compartment and secreted from the cell (Figure 6). The secreted enzymes can then bind either the M6PR (if the enzyme retains the M6P moiety) or the mannose receptor (ManR) on the plasma membrane (if the enzyme has exposed mannose residues on some of its oligosaccharide side chains). This process gives to LSDs a unique possibility of cross-correction on the neighbour cells even if the lysosomal enzyme is not produced in the specific cell type. This forms the basis of many therapeutic approaches currently developed for these disorders. The phenomenon will also be mentioned further in this work. Both M6P receptors can mediate the endocytosis and trafficking of extracellular enzyme to

21 the lysosome where the captured enzymes can carry out their normal catabolic functions. The M6PR is ubiquitously expressed, whereas the ManR is highly expressed only on cells of the reticuloendothelial (RE) system. This limits the effectiveness of the mannose receptor-mediated endocytic pathway for widespread uptake of exogenous enzyme. Hence, M6P-dependent pathway is not specific for all lysosomal enzymes. Gieselmann et al. reported that arylsulfatase A and cathepsine D secreted by isolated human macrophages can be uptaken without involving the M6PR pathway (Muschol, et al. 2002). Moreover, it has recently been shown that the lysosomal integral membrane protein type 2 (LIMP-2) - a ubiquitously expressed transmembrane protein mainly found in lysosomes and late endosomes - is a receptor for lysosomal M6P-independent targeting of glucocerebrosidase (Reczek, et al. 2007).

Figure 6: Biosynthesis of lysosomal enzymes and mannose-6-phosphate receptor trafficking pathway

Newly produced lysosomal enzymes are glycosylated (green dots) in the endoplasmic reticulum (ER). The enzymes then acquire the mannose 6-phosphate modification (red dots) in the Golgi apparatus, where they bind the mannose 6-phosphate receptor (M6PR). The majority (heavy arrows) of the enzymes are then trafficked to the mature lysosome (Lys). A minority (fine arrows) of the lysosomal enzymes are secreted and leave the cell. Extracellular phosphorylated enzyme can bind the plasma membrane-localized M6PR, whereas the non-phosphorylated form is fixing the mannose receptor (ManR). Both receptors mediate the endocytosis and subsequent lysosomal targeting of the exogenous enzymes. It is to note that the M6PR is ubiquitously expressed, whereas expression of the ManR is limited to cells of the reticuloendothelial system. From (Sands and Davidson 2006).

22 Metabolic bases

As stated previously, glycosphingolipids catabolism is achieved through complex interconnecting pathways and many LSDs are caused by deficiencies in different enzymatic steps in this pathway (Jeyakumar, et al. 2002; Kolter and Sandhoff 2006).

Structure of glycosphingolipids

Glycolipids are biomolecules containing one or more carbohydrate residues linked to a hydrophobic lipid moiety through a glycosidic linkage. More than 300 different glycolipids have been described. Glycolipids containing either a sphingoid base or a ceramide as the hydrophobic lipid moiety are known as glycosphingolipids. GSLs possess highly heterogeneous and diverse molecular structures and are found in plasma membrane of many organisms from bacteria to humans.

Figure 7: General structure of a ganglioside (example of GM1 ganglioside)

Selection of different ganglioside structures are also illustrated G, ganglioside; M, monosialo-; D, disialo-; and T, trisialo-. The carbohydrate backbone consists of: Glc, glucose; Gal, galactose; GalNac, N-acetyl galactosamine; and NANA, sialic acid. The ceramide (Cer) is composed of sphingosine, which is a long chain base containing, most commonly, stearic acid (C18), or C16, C20, or C22, NeuAc, N-acetylneuraminic acid.

Acidic glycosphingolipids containing one or more sialic acid (N-acetylneuraminic acid or N- glycolylneuraminic acid) residue(s) in their carbohydrate moiety are especially referred to as gangliosides. This group of GSLs is most abundantly present in the nervous system. The first ganglioside (GM1) and its structure was described by Kuhn and Wiegand in the early seventies (Kuhn and Wiegandt 1963) and since then, six major and many minor ganglioside species have been

23 identified in mammalian brains (Yu, et al. 2011). The structure of GM1 ganglioside is represented in figure 7. In adult brain, at least twelve different gangliosides were identified and four of them (GM1, GD1a, GD1b and GT1b) constitute 90 % of total amount. The common element of all gangliosides is the tetrasaccharide chain to which one (GM1), two (GD1a and GD1b), or three (GT1b) sialic acid residues (or optionally N-acetylneuraminic acid, NeuAc) are attached. In GM2 and GM3 gangliosides, the oligosaccharide chain is incomplete and is formed by bi or trisaccharide molecules respectively, to which the sialic acid molecule is attached (Kolter, et al. 2002).

Biosynthesis of GSLs

Glycosphingolipids are primarily synthesized in the endoplasmic reticulum and they are further modified in the Golgi apparatus by sequential addition of carbohydrate moieties to an existing lipid molecule. This basic molecule is called ceramide and it is created in the ER from palmitoyl-CoA by a series of reactions (van Echten and Sandhoff 1993). The subsequent creation of gangliosides is catalyzed by a series of specific glycosyltransferases. With the exception of GM4, derived from galactosylceramide (GalCer), most gangliosides are synthesized from lactosylceramide (LacCer). GM3 ganglioside is synthesized by the addition of a sialic acid to LacCer by CMP-sialic acid: LacCer α2–3 sialyltransferase (ST-I or GM3 synthase). GD3 and GT3 are synthesized by sequential addition of sialic acids to GM3 and GD3 by CMP-sialic acid: GM3 α2–8 sialyltransferase (ST-II or GD3 synthase) and CMP-sialic acid: GD3 α2–8 sialyltransferase (ST-III or GT3 synthase), respectively. GM3, GD3 and GT3 further serve as precursors of more complex gangliosides. The ceramide is transported to the endoplasmic reticulum by a vesicule or non-vesicule mediated pathway where the galactose or glucose residue is attached to the ceramid core. These two reactions are catalysed by the galactosylceramide synthase (GalCer) and the glucosylceramide (GlcCer) synthase, respectively. If GalCer gives a low number of GSLs like sulfatides or GM4, GlcCer permits to synthesize 300 complex glucosphingolipids divided into series based on their basic carbohydrate structures, namely: ganglio-, isoganglio-, lacto-, neolacto-, lactoganglio-, globo-, isoglobo-, muco-, gala-, neogala-, mollu-, arthro-, schisto- and spirometo-series divided in 0, A, B and C series (Figure 8). It is also possible for the ceramide to be transported to the mitochondrial compartment of the cell where it can play apoptotic related functions (Rusinol, et al. 1994) (Merrill 2002) for example by targeting autophagosomes to mitochondria in order to induce lethal mitophagy (Sentelle, et al. 2012).

24 In the case of gangliosides, the biosynthesis in the Golgi apparatus implies a sequence of reactions catalysed by different enzymes resulting in the sequential addition of specific saccharide residues, each ganglioside being therefore defined by the sequence of saccharides related to the ceramide core.

Figure 8: Schematic view of ganglioside biosynthesis in mammalian cells

The addition of sialic acid residues to lactosylceramide (LacCer) by the specific sialyl-transferases I, II and III gives the monosialo, disialo and trisialo-gangliosides GM3, GD3 and GT3, respectively. These glycolipids are the precursors for the a, b and c series of gangliosides. which are formed by glycosylation, i.e., by addition of N- acetyl-betagalactosamine (GalNAc), beta-galactose (Gal) and sialic acid by a GalNAc-transferase, a galactosyl- transferase and a sialyl-transferase, respectively. From (Popa, et al. 2011).

25 Degradation of glycosphingolipids

GM2-ganglioside is the main substrate of β-hexosaminidase A, deficient in GM2- gangliosidosis variant B or suppressed in the GM2-activator-deficient variant AB. In Sandhoff disease or GM2-gangliosidosis variant 0, lacking hexosaminidase A and B, the substrates are not only GM2- ganglioside, but also oligosaccharides. For correct GM2 ganglioside degradation by β-hexosaminidase A, the three different gene products must undergo proper synthesis, intracellular transport, posttranslational processing, and further association into a GM2-containing quaternary complex. β- Hexosaminidase A cleaves glycolipid substrates on membrane surfaces when they extend far enough into the aqueous phase and in the absence of detergents, this degradation of GM2 ganglioside can occur exclusively in the presence of the GM2 activator (Figure 9). When the activator is not fixed to a lipid, it is in an open state. When the lipid is present, the activator binds with two hydrophobic loops to the membrane and penetrates the bilayer. Further, the lipid recognition site of the activator interacts with the ganglioside substrate, and its ceramide moiety inserts into the hydrophobic cavity. Finally, the conformation of the activator changes by the flexible hydrophobic loop movement and lipid-loaded activator changes from the open conformation to the more hydrophilic closed state, making the activator-ganglioside complex recognizable by the Hex A enzyme.

Figure 9 : Degradation of GM2 ganglioside by β-hexosaminidase A

Hydrolysis of GM2 ganglioside by human β-hexosaminidase A requires enzyme activator GM2A. The GM2A glycolipid binding site is lined by two hydrophobic surface loops: Val90–Trp94 and Val153–Leu163 (red) and a single short helix. The Val153–Leu163 loop thanks to its flexibility control the entrance in the hydrophobic cavity allowing an open or closed state. GM2AP, GM2 activator protein; Hex A, β-hexosaminidase A. From (Kolter, et al. 2005).

26 Genetic aspects

HEXA – gene coding for the α subunit of β-hexosaminidases

The HEXA gene is localised on the long arm of the human chromosome 15 (15q23-q24) (Takeda, et al. 1990). It has 35 kb total length and it is composed of 14 exons. The gene promoter is situated 100 to 150 kb before the initiation codon and contain the GC-rich sequences of a housekeeping gene (Norflus, et al. 1996). Mutations on the HEXA gene, coding for the β- hexosaminidases α subunit, result in Tay Sachs disease showing an enzymatic deficiency mainly in Hex A, but also in the minor form Hex S probably not having substrate degradation activity. The Hex A deficiency is responsible for a GM2 ganglioside accumulation mainly in neurons and for a neurodegenerative disorder.

HEXB – gene coding for β subunit of β-hexosaminidases

The HEXB gene is located on the long arm of the human chromosome 5 (5q13) (Fox, et al. 1984) and similarly to HEXA, it is composed of 14 exons. The gene is 45 kb long and is expressed under the control of a promoter with characteristics similar to the HEXA promoter. HEXB gene encodes the β-hexosaminidases β subunit which, together with the cofactor GM2 activator protein, catalyses the degradation of GM2 ganglioside and other molecules containing terminal N-acetyl hexosamines. When mutations are present on this gene (Sandhoff disease), both Hex A and Hex B isoenzyme activities are reduced or absent leading to a GM2 storage in the CNS and in other organs.

GM2A - gene coding for GM2 activator protein

GM2A is a 16kb gene located on chromosome 5q31.1-31.3 and it has 4 exons (Burg, et al. 1985; Heng, et al. 1993). Due to alternative splicing of exons 3 and 4, two different forms of the protein can be produced. The major form is made of 160 amino acids, whereas the smaller form accounts for 109 amino acids. The GM2A protein has N- and C-terminal domains enabling the respective cleavage of substrates containing NeuAc and GalNac (Conzelmann and Sandhoff 1978). The GM2A promoter is GC rich (Xie, et al. 1991). Mutations of the GM2A gene are causing a deficiency of the GM2 activator protein, responsible for the GM2 gangliosidosis AB variant. Although

27 the Hex A and Hex B are both present, the lack of the activator protein leads to the absence of GM2 ganglioside catabolism.

Mutations and correlation between genotype and phenotype

Numerous mutations have been characterised on the HEXA, HEXB and GM2A genes explaining the spectrum of clinical phenotypes.

HEXA mutations

About 170 mutations have been reported to date on the HEXA gene (GenBank Accession NM-000520.4; http://www.biobase-international.com/product/hgmd). In the infantile form of Tay- Sachs disease (TSD), which is the most common, mutations are severe. Some of them are insertions and deletions responsible for frameshift, or nucleotide substitutions resulting in premature stop codon. When splice mutations or inframe deletions are found, the protein is produced and therefore can be detected, but it is not able to assure its function towards the substrate due to an alteration of the association process of the αβ heterodimer or to a loss of the enzyme catalytic activity. Subacute juvenile forms of TSD are characterised by a residual activity of Hex A ranging from 2-5 % of normal activity. Mutations associated with this phenotype are splicing errors or nucleotidic substitutions. A particular variant, called B1 variant, has been delineated (dos Santos, et al. 1991). The α mutation inactivates the polypeptide, but neither interferes with the dimerization, nor with lysosomal enzyme processing. This variant is frequent in the Portuguese population and the R178H is responsible for the majority of the cases. It is associated with symptoms close to late infantile form when associated with a null allele, and with ameliorated phenotype when present in a homozygous state. Different mutations at the same locus like R178C (Tanaka, et al. 1990), R178L (Triggs-Raine, et al. 1991) and others (influencing a possible site participating in the cleavage of glycoside bonds) were also described frequently as causative for the B1 variant. The adult or chronic form of TSD is also caused by mutations resulting in detectable residual Hex A activity. One of the most frequent aberrations is the G269S, leading to a partial loss of affinity between the mutated α and the normal β chain of the Hex A heterodimer. It is to note that the adult variant of the disease is the most heterogeneous at the clinical level, depending on the rate of properly

28 folded α monomers present in the endoplasmic reticulum, accessible for the dimerization with the β chain (Brown and Mahuran 1993). Several mutations have been reported to be more frequent in some populations. In Ashkenazi Jews, the 4-bp duplication c.1274-1277dupTATC in exon 11 was found in 80–98% of carriers and the G269S and c.1421+1G>C mutations have also been reported (Myerowitz and Costigan 1988; Navon and Proia 1989; Paw, et al. 1990; Triggs-Raine, et al. 2001). 50% of the Moroccan Jewish carriers presented the F305del mutation (Navon and Proia 1991) and the c.1073+1G>A (IVS9+1G>A) splice mutation was found in 15% of the alleles of non-Jewish Tay–Sachs carriers (Akerman, et al. 1992). A 7.6 kb deletion including exon 1 was found to be the major mutation causing TSD in the French Canadian population (Myerowitz and Hogikyan 1987). The R178H mutation has also been reported to be highly frequent, respectively reaching 95% and 75% of the alleles in Portuguese and Italian patients with Tay-Sachs B1 variant (dos Santos, et al. 1991; Montalvo, et al. 2005). Some genetic HEXA alterations lead to hexosaminidase A pseudodeficiency, a phenomenon present in subjects exhibiting a low Hex A activity (around 10% of the normal rate) and who are asymptomatic (Grebner and Jackson 1985; Navon, et al. 1986; Thomas, et al. 1982; Vidgoff, et al. 1973). The reduced enzymatic activity due to a pseudodeficiency is probably high enough to guarantee the lack of pathological symptoms (Cao, et al. 1997). This observation is the basis of the assumption concerning the critical threshold according to which only 5-10 % of the activity would be sufficient to assure adequate turnover rate of the GM2 substrate in the lysosome (Leinekugel, et al. 1992).

HEXB mutations

Around 85 mutations were reported on the HEXB gene involved in Sandhoff disease (GenBank Accession NM-000521.3; http://www.biobase-international.com/product/hgmd). These abnormalities are diverse in nature (missense/nonsense substitutions, splice mutations, small/gross deletions, insertions) and spread throughout the gene. The infantile form of Sandhoff disease is mainly due to mutations leading to the absence or instability of the corresponding mRNA. The mutations causing this acute variant are numerous, but the most common is a 16 kb deletion spanning from the HEXB promoter to exons 1–5 and part of intron 5 (Neote, et al. 1990). In Mediterranean Sandhoff patients, this deletion is less frequent and many SD patients are homozygous for other mutations even though the majority of them are not consanguineous (Gort, et al. 2012b; Zampieri, et al. 2009) (Delnooz, et al. 2010; Gomez-Lira, et al. 2001; Kaya, et al. 2011). Some genetic abnormalities found in infantile patients, like the Y456S or

29 C534Y substitutions, lead to the loss of catalytic functions, or trigger the enzyme instability like P504S, R505Q and A543T. All known mutations in the HEXB gene are presented in Table 3.

GM2A mutations

Only six mutations were identified on the GM2A gene (GenBank Accession NC_000005.9; http://www.biobase-international.com/product/hgmd) as the GM2 gangliosidosis AB variant is very rare.. Some of these mutations are substitutions or small deletions resulting in an unstable protein and its subsequent degradation, in an unstable mRNA, or in defective interactions with the Hex A enzyme.

Diagnosis of GM2 gangliosidoses

In France, only a small number of laboratories are involved in the diagnosis of lysosomal storage disorders and only 5-10 novel Tay-Sachs cases and 2-5 Sandhoff cases are found each year. GM2 gangliosidoses can be detected at the enzymatic or molecular level in patients showing symptoms at physical examination. Some tools and protocols are available in order to facilitate the identification and correct diagnosis of those metabolic disorders.

Biochemical analysis: enzymatic assays

The standard method for the diagnosis of GM2 gangliosidoses is based on the measurement of β-hexosaminidases activity in leukocytes, plasma, serum or fibroblasts determined. The enzymatic activities are measured in cellular homogenates or serum from patients with Tay-Sachs or Sandhoff disease using synthetic substrates coupled to a fluorescent residue. 4-methylumbelliferyl-β-N-acetyl glucosaminide (MUG) is used for the hexosaminidases A and B total activity, and the sulphated substrate 4-methylumbelliferyl-β-N-acetylglucosaminide-6-sulfate (MUGS) permit to determine the specific Hex A activity (Kaback, et al. 1974; Lowden, et al. 1973). Study of oligosaccharides in the patient urine shows a specific profile for GM2 gangliosidoses. Recently, new methods for the enzymatic detection of TSD and SD in newborns using dried blood spots (DBS) on filter paper have been described (Chamoles, et al. 2002). The DBS analysis offers several advantages over the whole blood samples in terms of cost and ease of transportation and it could therefore be used in populations from areas of the world lacking specialized laboratories.

30 Additionally, the technique seems suitable for sample collection in neonates, where obtaining larger blood quantities is sometimes difficult.

Determinant role of the hexosaminidases residual activity

A correlation between age of onset or duration (chronicity) of the disease and fundamental catabolic functions have been described and called “residual activity hypothesis” (Figure 10). Using a catabolic activity assay based on the physiological radiolabelled GM2 substrate in cell culture, the basis of a greatly simplified kinetic model has been proposed (Conzelmann and Sandhoff 1983; Leinekugel, et al. 1992).

Figure 10: The principle of “residual activity hypothesis” experimental verification

In order to experimentally verify the basic assumptions of this model, studies were performed in cell culture (Leinekugel et al., 1992). The radiolabelled GM2 ganglioside substrate was added to cultured skin fibroblasts with different hexosaminidase A activities and then, its uptake and turnover were measured. The correlation between residual enzyme activity and turnover rate of the substrate was essentially as predicted: degradation rate of GM2 ganglioside increased steeply with residual activity, to reach the control level for a residual activity around 10–15% of normal. All cells with an activity above this critical threshold had a normal turnover.

A correlation was observed between the decrease of the GM2 ganglioside turnover and the clinical course of the disease. 10-20% of normal GM2 cleaving activity appear already compatible with no pathological symptoms. This was confirmed by similar observations in metachromatic leukodystrophy (MLD), Gaucher disease, and Niemann–Pick disease (Graber, et al. 1994; Kudoh, et al. 1983; Kytzia, et al. 1984; Leinekugel, et al. 1992) Additional factors induced by the mutation and the storage process during the disease will also contribute to the clinical course and disease pathogenesis (Igisu and Suzuki 1984; Nilsson, et al. 1982; Tessitore, et al. 2004). Genetic mutation and resulting loss of a catabolic activity may not only result in

31 the accumulation of non-degradable substrates but may also affect the transcription rate of many other genes. For example, mutations in the HEXB gene and the subsequent loss of Hex A and Hex B activity in genetically engineered mice trigger a significant down-regulation of ≈ 300 transcripts and a significant upregulation of another ≈ 250 transcripts including genes of the immune system (Myerowitz, et al. 2002).

Molecular analysis

After enzymatic diagnosis, HEXA and HEXB sequencing are performed respectively in Tay- Sachs and Sandhoff patients by using genomic DNA extracted from peripheral blood leukocytes. For Tay-Sachs disease, our team has developed an efficient method permitting to sequence the HEXA gene entire coding region and intron/exon boundaries with a unique PCR technical condition (Giraud, et al. 2010). With this technique, 100% of alleles can rapidly be determined on TSD patients and in potential carriers. For Sandhoff disease, we have recently developed a similar approach based on a unique PCR condition for the complete HEXB sequencing (Gaignard, et al. 2013). As the 5′-end 16 kb deletion is common, it is usually tested first in each patient. This large deletion results from recombination between two ALU sequences (Neote, et al. 1990). In order to easily detect it, we have developed a specific method based on two PCR amplifications (see results and (Gaignard, et al. 2013). Finally, segregation of the alleles is then confirmed by DNA analysis of the parental samples. Other methods have been developed for molecular analysis, namely multiplex ligation dependent probe amplification (MLPA). This assay is a well-established method for the identification of nucleotide deletions and insertions and it has recently been adapted for the HEXB and HEXA genes (Sobek, et al. 2013; Zampieri, et al. 2012). MLPA is based on robust multiplex PCR amplifying the probe in ligation-dependent steps that can only occur if target DNA is present in the sample. It has been documented that this technique can be helpful in the detection of gene aberrations in Sandhoff and Tay Sachs diseases. It is mainly useful for the detection of the 16 Kb deletion common on the HEXB gene. As some DNA sequence alterations have a degradating effect at the protein level, resulting from defects in the RNA splicing process, mRNA analysis can be required in some patients. This study is performed after RNA extraction from cultured fibroblasts and reverse-transcription. The complementary DNA is then sequenced as described previously.

32 Prenatal diagnosis is available for at-risk families for Tay-Sachs or Sandhoff disease. It can be performed by enzymatic assays using the artificial substrates or by the detection of the previously determined familial mutations either on chorionic villi or on cultured amniotic cells. Pre-implantation diagnosis is another possibility, but the access to this method is still limited due to the low number of laboratories able to offer this technique. Concerning heterozygote detection, it can be performed by the detection of the familial mutations in at-risk families. In Ashkenazi Jews, the detection will be focused on the most common mutations present in this population.

1.2 Molecular therapeutic approaches for GM2 gangliosidoses

Several therapeutic options have been tested in order to minimize the burden of lysosomal storage disorders and to restore correct cellular and organ functions. Among them, two major strategies have been particularly explored. The first is focused on the replacement or restoration of the defective or absent catabolizing enzyme. This can be achieved either by the infusion of recombinant enzyme, or by chaperone therapy, bone marrow transplantation or gene therapy. The second possible strategy is based on an inhibition of the substrate synthesis (Figure 11). Even if certain of these therapies are applicable to all the LSDs, it is necessary to keep in mind that each disease offers unique challenges of target tissues. In Sandhoff disease, the central nervous system is the major affected organ, and it is protected by the blood-brain barrier (BBB) that significantly limits or even unable the therapeutic outcomes of many approaches. Nevertheless, various approaches have been tested in the Hexb-/- mouse model such as non-steroid anti-inflammatory drugs, substrate reduction therapy, caloric restriction and more recently bone marrow transplantation, stem cell therapy and gene therapy.

Figure 11: Main therapeutic options for lysosomal diseases

The therapeutic strategies permit either to compensate the enzymatic deficiency (enzyme replacement therapy, bone-marrow transplantation, stem cell transplantation, gene therapy) or to reduce the substrate accumulation (substrate reduction therapy).

Substrate reduction therapy - SRT

The aim of substrate reduction therapy is to decrease the rate of glycosphingolipids (GSL) biosynthesis in a way that the residual enzyme activity can fully catabolize the GSLs entering the lysosome. This deprivation technique gives the best results in juvenile and adult forms of storage diseases, where low to moderate levels of residual enzyme activity are present. In infantile forms, the substrate reduction is not able to slow the onset of symptom and to increase life expectancy, as the enzyme residual activity is very low or not existing. This therapeutic strategy is based on inhibitors of glucosylceramide synthase (GCS), which act by reducing the downstream biosynthesis of gangliosides. These molecules can potentially be used to treat any disorders in which the storage product is derived from GlcCer, such as Sandhoff disease (late-onset forms). Based on small molecules, this approach has the additional advantage to be orally available and to cross the blood-brain barrier. This technique was successfully applied to a number of lysosomal storage diseases, such as Gaucher disease, but so far the experience is limited in Sandhoff patients. Few classes of inhibitors acting on ceramide-specific glucosyltransferase have been identified and approved. Their administration as well as their impact of Sandhoff disease patient will be described briefly.

34 Therapeutic molecules

The therapeutic molecules used in SRT can be divided in two groups: - GSL inhibiting molecules analogue to D,L-threo-1-phenyl-2-decanoylamino-3-morpholino-1- propanol (PDMP) and its derivate PPMP, were first developed by Radin in 1980 (Radin 1996; Vunnam and Radin 1980). Twenty years later, Schayman developed new generation of molecules based on PDMPs (Lee, Abe et al. 1999, (Abe, et al. 2000), and today some of their derivates like eliglustat tartrate (Genz-112638) are being commercialized. Nowadays, analogues of this molecule start to be developed. - The second group of molecules have been developed later by Frances Platt in Oxford, and their chemical nature derives from imino sugars: deoxynojirimycine (DNJ) and deoxygalactonojirimycine (DGJ) (Platt, et al. 1994a; Platt, et al. 1994b).

Eliglustat tartrate and ethylenedioxy-PIP2 Oxalate- EtDO-PIP2, or ‘‘3h’’

Eliglustat tartrate (PDMP analog; Genz-112638), currently under development by Genzyme Corp, is a glucocerebroside synthase inhibitor and it is used in phase II clinical trials in patients with type 1 (non-neuronopathic) Gaucher disease (Cox 2010). Unfortunately, drug distribution studies indicate that eliglustat tartrate has a low capacity to cross the blood-brain barrier (McEachern, et al. 2007), possibly due to its affinity to P-glycoprotein (MDR1) transporter. As the P-glycoprotein is a gatekeeper of the BBB, it markedly limits the brain penetration of many drugs (Miller 2010; Miller, et al. 2008) and the eliglustat tartrate has been described as one of its substrates (Shayman 2010). This is a crucial disadvantage against the use of these molecules in Sandhoff patients. Nevertheless, recently the novel eliglustat tartrate analog, ethylenedioxy-PIP2 Oxalate (EtDO-PIP2, or ‘‘3h’’) was tested in juvenile Sandhoff mice (Arthur, et al. 2012). The 3h daily injection at postnatal days 9-15 significantly reduced the total content of brain and liver gangliosides in SD mice. Despite the absence of hexosaminidase β-subunit, the degree of GM2 storage was considerably less abundant in the SD mouse brain than in the infantile SD human brain and EtDO-PIP2 significantly reduced the accumulation of GM2 and GA2 in cerebrum, cerebellum, and in liver indicating a systemic therapeutic response. The reduction of ganglioside in liver was likely linked to the reduction of GlcCer, the upstream metabolic precursor. The ganglioside reduction in brain was similar to that previously reported in LSD mice treated with iminosugars. Moreover, the 3h dosage was 20 times lower than the

35 one used for treatment with NB-DNJ or NB-DGJ, suggesting that this new PDMP analogue can be an effective alternative to existing substrate reduction molecules, even if caution is needed. The 3h intraperitoneal administration in normal adult C57BL/6 mice during three days caused a significant dose-dependent decrease of the brain glucosylceramide, the upstream precursor of ganglioside biosynthesis (Larsen, et al. 2012), showing that there is still lot to learn about the mechanism of action of those molecules.

N-butyldeoxynojirimycin – NB-DNJ

The N-butyldeoxynojirimycin (NB-DNJ) is the alkylated derivate of imino sugar deoxynojirimycin and it can inhibit the N-linked oligosaccharide processing enzymes α-glucosidase I and II and glucosyltransferases (Platt, et al. 1994a). NB-DNJ was commercialized under the name of Miglustat (Zavesca®) and it was first used in Gaucher disease. Although the general outcome is positive, the prolonged use of NB-DNJ in Gaucher patients has some side effects like weight loss, diarrhea, poor appetite (Cox, et al. 2000; Elstein, et al. 2004). Additionally, patients suffer of tremor resulting from secondary sites of action of the molecule, unrelated to glycolipid synthesis inhibition (Hollak, et al. 2009; Machaczka, et al. 2012). In fact, due to a certain non-specificity of the molecule and to the direct binding to β-glucocerebrosidase, the imino sugar also has a coincidental chaperone effect, increasing the activity of the enzyme in several cell lines bearing mutations, including the most frequently present in Gaucher disease (Brumshtein, et al. 2007) (Alfonso, et al. 2005). In the Sandhoff disease mouse model, SRT therapy using NB-DNJ gave some positive outcome. The life expectancy of Hexb-/- mice treated with NB-DNJ was increased by 40% and the storage of GM2 and its derivates was reduced in the CNS (Jeyakumar, et al. 1999). The reduction was even more pronounced in the liver, since peripheral organs are exposed to higher levels of NB-DNJ, whereas only about 5–10% of the concentration present in the serum is detected in the cerebrospinal fluid (Platt, et al. 1997). Finally, after the treatment, the onset of symptoms (reduced motor coordination, …) in Hexb-/- animals, is delayed (135 days for SRT-treated mice versus 100 days for untreated animals) and the terminal stage of the disease was prolonged. It is to be noted, that the adverse effects such as weight loss and lymphoid organ shrinkages were observed in mice treated with high doses of NB-DNJ (Andersson, et al. 2000). On the basis of these preliminary data, therapeutic trials have been performed in some patients with juvenile Sandhoff disease and their results would support certain efficacy of this drug (Masciullo,

36 et al. 2010). An open-label trial with Miglustat over 24 months in five patients showed that such treatment failed to ameliorate progressive neurological deterioration, but the cognitive functions and brain lesions were stabilized during the treatment period and no further regression in motor development or ataxia was noted (Tallaksen and Berg 2009; Wortmann, et al. 2009) (Maegawa, et al. 2009). As seen in the preclinical studies, the age of the subjects receiving the drug could be determinant when considering the potential outcome. A positive evolution was documented in a 14- year-old patient with a subacute form of Sandhoff disease. Two years after the initiation of a therapeutic trial with Miglustat, this patient showed a stable neurological picture, with a subjective improvement in some motor skills (Wortmann, et al. 2009). In contrast, a 24 months open-label clinical study with in 30 patients with late-onset Tay-Sachs disease (Shapiro, et al. 2009), nor therapeutic trial in a patient affected by a chronic form of Sandhoff disease (Santoro, et al. 2007) documented a beneficial efficacy for this drug. The nutrition seems to be able to play a modulating role in the pathophysiology of Sandhoff disease and thanks to nutrimental changes, management of symptoms seems possible. The caloric restriction (CR), which generally improves health and increases longevity, was studied as a therapy in Hexb-/- knockout mice (Denny, et al. 2006). Adult animals were restricted to reduce body weight by 15-18% and in result motor abilities were improved and the lifespan was extended but the treatment had no significant effect on brain lipid composition or on cytoplasmic neuronal vacuoles presence. Moreover, the caloric restriction approach decreased the expression of inflammatory markers like CD68 and F4/80, leading to the conclusion that CR could delay disease progression in SD and possibly in other ganglioside storage diseases through anti-inflammatory mechanisms. The restricted ketogenic diet (KD-R) is a high-fat, adequate-protein, low-carbohydrate regime that has recently been used in adult Hexb-/- mice in parallel with the iminosugar NB-DNJ (Denny, et al. 2010). When the total forebrain GM2 content was analysed, its level was significantly reduced in both NB-DNJ and KD-R + NB-DNJ treated groups when compared with non NB-DNJ treated groups. The results of the combinatorial diet and drug therapy were superior, suggesting that KD-R was facilitating NB- DNJ absorption into the brain. This potentially may allow lower dosing of NB-DNJ to achieve the same degree of efficacy as high dose monotherapy, but with a reduction of side effects such as severe weight loss. Additionally, it has been proposed that KD-R is effective in preventing weight loss and diarrhea in patients with LSDs. It is possible that the fat composition of the KD would allow body weight stability as seen in mouse model. A diet mainly composed of fat may allow to increase nutrient absorption that would otherwise be inhibited by NB-DNJ given with a diet mainly composed of carbohydrates. Most interestingly, it has been found that the content of NB-DNJ in brain tissue was

37 significantly greater (3.5-fold) in the KD-R + NB-DNJ mice than in mice receiving NB-DNJ alone, suggesting that KD-R might facilitate NB-DNJ uptake and transport across the BBB. Therefore, it is highly appropriate to state that the most effective therapeutic strategy for the life-long management of Sandhoff disease and possibly other LSDs should involve combinatorial therapies that are able to give unexpected beneficial outcomes.

N-butyldeoxygalactonojirimycin - NB-DGJ

As seen previously, the treatment of neuropathological forms of LSDs requires high systemic doses of NB-DNJ in order to obtain a therapeutic level into the CNS. As only low dosing of the molecule can be acceptable, other compounds needed to be developed to provide life-long therapy for these diseases. A potentially more selective glucosyltransferase inhibitor is the galactose analogue N- butyldeoxygalactonojirimycin (NB-DGJ). This compound has been shown to inhibit GSL biosynthesis in vitro as effectively as NB-DNJ, but it does not inhibit α-glucosidase I and II or β- glucocerebrosidase (Platt, et al. 1994a). NB-DGJ permits greater dose escalation and it is not associated with any adverse effects (Andersson, et al. 2004). The molecule has therefore been tested in the Sandhoff mouse model. The oral administration of NB-DGJ for 6 weeks in adult SD mice increased life expectancy and decreased the storage, not only for GM2, but also for GD1a, GD1b, GT1b and GQ1b (Andersson, et al. 2004). Furthermore, the molecule did not alter the CNS phospholipid composition: the reduction did not cause the accumulation of upstream precursors of GlcCer (Andersson, et al. 2004; Kasperzyk, et al. 2005; Kasperzyk, et al. 2004). Since GM2 ganglioside accumulates as early as day 2 after birth in SD mice, the effect of NB-DGJ was also tested in Hexb-/- neonates from postnatal day 2 to 5. The molecule was shown to significantly reduce total brain GM2 ganglioside content. Furthermore, NB-DGJ treatment reduced GM2 concentration to a greater extent in neonates than in adult SD mice (Andersson, et al. 2004), without adverse effects on brain or body weight or on lipid composition. NB- DGJ treatment did not alter brain maturation in contrast to mice with complete knockout of GlcCerS, which did alter maturation (Jennemann, et al. 2005). Additionally, it seems to have a chaperone effect on sialidase (Tominaga, et al. 2001) (Matsuda, et al. 2003) therefore increasing the level of this enzyme. In fact, sialidase can hydrolyze the internal sialic acid of GM1 and GM2 gangliosides and it has been reported that in neonatal Hexb-/- mice treated with NB-DNJ, GA2 was significantly elevated in brain. This is highly unusual since the level of GA2 in neonates is stable during

38 development (Sango, et al. 1995) (Phaneuf, et al. 1996) (Hahn, et al. 1997) (Matsuda, et al. 1997). All stated examples suggest that NB-DGJ may be more efficient at younger ages when GSL synthesis and turnover rates are more rapid than at older ages when these rates are much slower. Those findings could potentially lead to an effective early intervention for GM2 gangliosidoses.

Non-steroid anti-inflammatory drugs - NSAIDs

Anti-inflammatory therapies have been evaluated in several neurodegenerative diseases. In mouse models of Alzheimer and Parkinson disease, several non-steroid anti-inflammatory drugs (NSAIDs), including indomethacin, ibuprofen and aspirin, were shown to reverse microglial response. Therefore, the idea of testing this type of drugs came up in GM2 gangliosidosis models. Sandhoff mice were treated with non-selective COX inhibitors during the development of the disease in order to closely mimic a symptomatic patient just after the diagnosis. Animals receiving the drugs maintained their coordination and strength in behavioural tests longer than their untreated littermates and they survived significantly longer (12–23%). The results were comparable to the double knock-out mice for inflammatory genes, like FcRγ and MIP-1α (Wu and Proia 2004). The decreased MHC class II staining in the brain of Sandhoff mice treated with NSAIDs demonstrates that treatment has prevented macrophage infiltration and/or microglial activation. In addition, the activated microglial/macrophage cells present at the initiation of therapy were converted into an inactive state, comparable to that found in untreated mice at 8 weeks of age, prior to symptom onset (Jeyakumar, et al. 2004).

NSAIDs and synergy with SRT and antioxidants

Antioxidative agents like L-ascorbic acid (vitamin C) and α-tocopherol acetate (vitamin E) were tested in parallel with indomethacin, aspirin, ibuprofen. All treatments significantly slowed the clinical course (Figure 12) to approximately the same extent indicating greater potential of combining NSAIDs and antioxidants as a mean of slowing the disease progression. Nonsteroidal anti- inflammatory drugs and antioxidant therapies also delayed the loss of motor function and coordination. Combined therapy using the NSAID indomethacin or aspirin with the GSL substrate- decreasing drug NB-DNJ was then evaluated. When survival was analysed, it was found that the two therapies (anti-inflammatory and SRT) were synergistic. When NB-DNJ was combined with indomethacin, the presymptomatic phase was extended from 65 days in the untreated mice to 115 days

39 in the combination group, with a 48-day delay in test failure. The NB-DNJ + aspirin combination therapy resulted in 11% synergy with a maximum survival improvement of 73% (Jeyakumar, et al. 2004).

Figure 12 : Effect of different NSAIDs drugs on survival of Sandhoff disease mice

Survival curves (A) and percentage of increase in life expectancy (B) are presented. Survival was significantly different in all treated groups compared with untreated controls. Moreover the survival in combination therapy groups was significantly different compared with the monotherapy groups. The NB-DNJ + indomethacin combination resulted in 6% synergy with a maximum improvement of 66% survival. NB-DNJ + aspirin resulted in 11% synergy with a maximum improvement of 73% for survival. From (Jeyakumar, et al. 2004).

Bone marrow transplantation - BMT

Bone marrow transplantation (BMT) has emerged as a potential treatment for some lysosomal storage disorders. It is attractive for neuronopathic LSDs as donor cells, primarily of the monocyte- macrophage lineage, can repopulate target organs and provide a source of the missing lysosomal

40 enzyme potentially not only in visceral organs, but also within the brain (microglial population). However, improvement of CNS function in LSDs after BMT has been more difficult to assess and highly different results have been obtained depending on the disease or model. In the Hexb-/- mouse model, BMT with wild-type cells resulted in extended lifespan from 4.5 months to up to 8 months and slowed mice neurologic deterioration (Norflus, et al. 1998). The transplantation corrected biochemical deficiency in somatic tissues as indicated by decreased excretion of urinary oligosaccharides, lower glycolipid storage and increased levels of β-hexosaminidase activity in visceral organs. Enhanced performance on behavioural tests assessing motor function was additional evidence that CNS function was preserved by this technique. Interestingly, the clinical benefit occurred without an apparent biochemical reduction in total brain GM2 and GA2 glycolipid storage or noticeable morphological neuronal changes. BMT-treated mice eventually underwent a disease process similar to untreated Sandhoff mice, indicating that only a partial correction was obtained with a small increase of β- hexosaminidase activity. A limited amount of enzyme was introduced into the CNS indicating that this treatment alone may not be highly effective for infantile forms of GM2 gangliosidoses where no degradative capacity exists. Genetically engineered donor cells to hypersecrete enzyme or BMT combined with glycolipid synthesis inhibitors could possibly increase the efficacy of the enzymatic restoration. In late-onset forms of the disorder, where residual enzyme is present, a small increase in CNS enzyme activity after BMT might improve the clinical course of the disease. When comparing the results obtained in Sandhoff mice by NB-DNJ-based SRT or syngeneic BMT, lipids accumulated into the CNS had even higher ratio in transplanted animals because of their enhanced survival. In Sandhoff mice treated with NB-DNJ, a significant effect was observed on peripheral storage compared to BMT, as well as on GSL storage in the CNS. As NB-DNJ is a small molecule, it crosses the blood–brain barrier and it is able to affect GSLs neuronal storage in a way that is difficult to achieve with BMT. The effect of BMT on the lifespan could be due to the effects on the inflammation events. In normal conditions, one of the roles of microglia is to recognize damaged and dying neurons and to remove them by phagocytosis. This process can elicit to some degree an inflammatory reaction. However, in LSDs exhibiting enzymatic deficiency, the process is greatly exacerbated by the inability of the microglia to degrade the endocytosed glycolipids. As a result, blood-borne microglial precursors are continuously recruited by activated, lipid-loaded microglia into the CNS in an attempt to manage the neuronal damage (Figure 13). The expansion of activated microglia could trigger cell death in neurons already compromised by excessive storage through expression of neurotoxic cytokines and other mediators. BMT suppresses this inflammatory pathogenic process by the infiltration of normal

41 microglia into the CNS. These enzyme-competent cells are fully functional and able to remove damaged neurons. They also suppress the explosive expansion of activated microglia seen in untreated mice. BMT suppress both the reactive microgliosis and neuron apoptosis without detectable decrease in neuronal GM2 ganglioside storage suggesting a mechanism of neurodegeneration where inflammatory response is an important component (Wada, et al. 2000).

Figure 13 : Damage-response pathway in lysosomal storage disease

In physiological conditions, microglia and macrophages of nervous system can be derived from precursors in the blood; those cells can pass through the BBB into the perivascular regions and find their place in parenchyma. In the case of CNS injury, macrophages/microglia and astrocytes are activated and cytokines and chemokines are being produced. Subsequent up-regulation of adhesion molecules on nervous system endothelial cell can occur, resulting in enhanced transendothelial migration of monocytes from the blood into perivascular regions. Diseased cells migrate to sites of damage where they may secrete cytotoxic proinflammatory cytokines causing further damage and apoptosis. Thanks to therapeutic approaches, the hematopoietic precursors can be corrected, the macrophages and microglia gain therefore the ability to transfer the missing lysosomal enzyme to deficient cells of CNS and the injury sites. From (Proia and Wu 2004).

Combined therapy between bone marrow transplantation and substrate reduction

As previously described, different therapeutic approaches can give synergic results and enlarge

42 the spectrum of beneficial actions on some pathological events that could not be corrected through monotherapy. In Hexb-/- mice, BMT has been tested in combination with substrate synthesis inhibitors (Jeyakumar, et al. 2001). The NB-DNJ iminosugar has been administered in adult Sandhoff mice that received the allogeneic BMT. Animals receiving this double therapy survived significantly longer than those treated with BMT or NB-DNJ alone and the onset of symptoms and the rate of disease progression were significantly delayed. Moreover, the survival increase in this cohort was 13% more than the sum of the two monotherapy effects, indicating a synergy. Moreover, GSL analysis at the terminal stage showed that in BMT/NB-DNJ-treated animals, an increased GM2 storage burden was found, due to enhanced survival (Jeyakumar, et al. 2001). This suggests once again that there is not a simple threshold level of brain GM2 storage that leads to the disease.

Enzyme replacement therapy - ERT

Enzyme replacement therapy (ERT) was clinically approved for many lysosomal storage diseases with peripheral manifestations. The safety and effectiveness of ERT for Fabry disease, mucopolysaccharidoses (MPS) I, II and VI, as well as for Gaucher and Pompe disease have been demonstrated in human clinical trials, and treatments are now commercially available throughout the world. Several different biotech companies are implicated in the trials and the synthetic information about them and the product that are being commercialized can be found in Table 3. The first ERT trials for GM2 gangliosidoses were conducted in the seventies. Patients were treated by the administration of hexosaminidase A extracted from urine. Short half-life of the enzyme in the blood system (10-20 min), low restoration of Hex A activity and modest degradation of accumulated substrate on biopsies were reported (von Specht, et al. 1979). Replacement with recombinant beta-hexosaminidases produced in chinese hamster ovary (CHO) cells was tested on SD mouse microglia and Schwann cells, as well as on SD human fibroblasts (Ohsawa, et al. 2005) where the incorporated enzyme was able to degrade the accumulated GM2 substrate. Although these results are rather positive, there are several disadvantages of this approach, not overcome to date. Firstly, the absence of distribution of the infused recombinant enzyme into the CNS limits the effectiveness for LSDs involving neurological symptoms such as Sandhoff or Tay-Sachs disease. Secondly, there is a high risk to develop antibodies against the protein in patients who carry null mutations. Finally, due to the high frequency of administration and to the relatively high doses of enzyme needed to obtain the optimal results, production of neutralizing antibodies in LSD patients is a real issue. Matsuka and colleagues (Matsuoka, et al. 2011a) have recently described a novel technique based on a genetically

43 engineered HEXB encoding a chimeric human β-subunit containing partial amino acid sequence of the α-subunit. The modified Hex B was produced by a CHO cell line stably expressing the chimeric HEXB gene. The resulting enzyme was able to degrade artificial anionic substrates and GM2 ganglioside in vitro, and it had a thermostability similar to the wild-type in the presence of blood plasma. The modified Hex B was efficiently incorporated via cation-independent mannose-6- phosphate receptor into fibroblasts derived from Tay-Sachs patients, and it reduced the GM2 ganglioside accumulated in the cultured cells. Indeed, when considering the uptake rate, modified Hex B is superior in respect to wild type Hex A since ββ homodimer possess four N-glycans carrying M6P responsible for the affinity to the mannose-6-phosphate receptor, compared to only 3 moieties within the structure of heterodimeric wild type Hex A. Furthermore, the same team tested the intracerebroventricular (icv) administration of the modified Hex B in the Sandhoff mouse model showing a restoration of the Hex activity in brain. GM2 and GA2 ganglioside storage in the parenchyma of treated animals was significantly reduced. According to this data, it seems that icv enzyme replacement therapy using the modified Hex B could potentially offer a more efficient solution for GM2 gangliosidoses than the native Hex A.

Disease / Deficient Enzyme FDA-Approved Product (Generic name) FDA Approval Date Manufacturer

Fabry Disease Fabrazyme® (agalsidase beta) April 2003 Genzyme Corporation α-galactosidase A Cerezyme® (imiglucerase) May 1994 Genzyme Corporation

Type I Gaucher disease VPRIV™ (velaglucerase alfa) March 2010 Shire Human Genetic Therapies, Inc. glucocerebrosidase Elelyso™ (taliglucerase) May 2012 Pfizer Inc

Glycogen storage disease type II Myozyme® (alglucosidase alfa) April 2006 Genzyme Corporation (Pompe disease) acid alpha-glucosidase Lumizyme® (alglucosidase alfa) May 2010 Genzyme Corporation

MPS I Aldurazyme® (laronidase) April 2003 Genzyme Corporation (Hurler, Hurler- Scheie, or Scheie syndrome) alpha-L-iduronidase

MPS II (Hunter disease) Elaprase® (idursulfase) July 2006 Shire Human Genetic Therapies, Inc. iduronate sulfatase

MPS VI

(Maroteaux- Lamy syndrome) Naglazyme™ June 2005 Biomarin Pharmaceutical, Inc. arylsulfatase B

Table 2 : Market approved ERT drugs for different LSDs with manufacturer and date of approval

Adapted from: (Ratko, et al. 2013)

45 Chaperone therapy

A certain number of mutations induces the synthesis of improperly folded proteins and results in low enzymatic activity due to incorrect import and/or retention in the ER during the co- translational process. These proteins can either be recognized by the ER quality-control system, and therefore be degraded by the proteasome, or they continue their route, but fail to reach the lysosome. The aim of chaperone therapy is to reduce the elimination of these proteins, which can be catalytically active (Figure 14). Chaperones are small molecules and their role is to selectively bind and stabilize target proteins, thereby assisting their normal folding, improving intracellular trafficking and finally increasing lysosomal enzyme activity. While chaperone therapy is expected to restore small conformational changes, it is not able to restore the effect of mutations causing major structural changes like null or frameshift mutations. The chaperones currently used or developed for the treatment of LSDs are reversible competitive inhibitors of their target enzyme. Several in vitro studies have described a growing number of chaperones susceptible to restore enzyme transport/maturation and to increase residual enzyme activity in cells of patients with chaperone-sensitive mutations (Valenzano, et al. 2011). Two classes of chaperones can be distinguished: - Chemical chaperones: osmotic, non specific molecules, that can stabilize mutant misfolded proteins at the ER level (Sato, et al. 1996). - Pharmacological chaperones (PC): analogues of the specific substrate of each enzyme, stabilizing the proteins during their synthesis.

Figure 14 : General action of chemical and pharmacological chaperones a. Natural enzyme Newly synthesized enzyme is transported into the endoplasmic reticulum (ER) and endogenous molecular chaperones facilitate its correct folding and dimerization by specialized processing enzymes. Next, the molecular chaperones dissociate from the folded and dimerized enzyme that moves subsequently to the Golgi apparatus and further to lysosomes. At acidic pH into the lysosome, the enzyme is stable and ready to hydrolyse its specific glycosphingolipid substrate. b. Mutant enzyme Due to mutations, enzymes can be misfolded, misassembled or aggregated into the ER, where they are degraded by the ubiquitin-proteasome pathway. However, certain missense mutations can decrease the stability of the enzyme without altering the conformation of the active site. Although most of these mutant enzymes are degraded in the endoplasmic reticulum, they might be stabilized by site-specific pharmacological chaperones which bind the active site of the enzyme, promote its folding and stabilize it. Then, part of the enzyme reaches the lysosome, where it can have some enzymatic activity. In the lysosome, the accumulated glycosphingolipid substrates displace the pharmacological chaperones and are therefore hydrolysed by the enzyme. According to (Desnick and Schuchman 2002).

The chaperone therapy has some advantages. First, the drug can be administered orally, minimizing the invasiveness of this approach. Next, as the molecules are relatively easy to produce, their cost is reduced compared to some other therapies and the risk of immune response is unlikely. Finally, thanks to its small size, it can pass the BBB and potentially correct brain. This was

47 illustrated in mouse models for many LSDs. The first clinical trial of chaperone therapy was based on the use of galactose in patients with cardiac variant of Fabry disease and it had promising outcomes (Frustaci, et al. 2001). Since then, several phase I/II clinical trials have been conducted for Fabry (migalastat hydrochloride)(Germain, et al. 2012), Gaucher (isofagomine) (Khanna, et al. 2010a), Pompe disease and GM2 gangliosidosis (Frustaci, Chimenti et al. 2001). The clinical trials for GM2 gangliosidoses and the structure of the specific chaperone pyrimethamine will be discussed later. Even though the chaperone approach presents important advantages, it also has downsides. First, the use of chaperones is restricted to a small subset of mutations, as shown in Pompe (Flanagan, et al. 2009), Fabry (Ishii 2012) and Gaucher disease (Sawkar, et al. 2005). The chaperone eligible mutations are in general those affecting the stability, but retaining catalytic competency. Mutant forms that are catalytically inactive, unable to bind their substrate and with severe folding deficiencies, or that have important structural alterations, are unlikely to respond to chaperone treatment. Another difficulty of chaperone treatment is the determination of the correct dosage, as the current generation of chaperones competes with endogenous substrates for binding to the active site of lysosomal enzymes. The chaperone must correct protein folding as much as possible and it must inhibit the catalytic function as little as possible. Novel high-throughput screening methodologies were used to identify non inhibitory chaperones for Gaucher disease (Patnaik, et al. 2012) or to search for chaperones acting as enzyme activators in Pompe disease (Marugan, et al. 2010). Animal models are also helpful for dose optimization studies. In Fabry mice expressing a mutant form of human α-galactosidase A (R301Q) on a KO background, intermittent administration of chaperone therapy (4 days on/3 days off or every other day) resulted in greater substrate reduction than daily administration (Khanna, et al. 2010b). In the same ways as previously described treatments, it is being explored whether chaperones can have a synergistic effect when combined with ERT. Compared with ERT alone, co-administration of PC with ERT has been described to enhance substrate clearance and increase enzyme activity in several LSDs: Gaucher (Shen, et al. 2008), Fabry (Porto, et al. 2012) and Pompe (Porto, et al. 2009) disease in vitro, and in Fabry (Benjamin, et al. 2012) and Pompe mice (Porto, et al. 2009) and drug-drug interaction studies of chaperone therapy and ERT in patients with Fabry (NCT01196871) and Pompe disease (NCT01380743) are currently ongoing.

Results

Article 1

50 Gene 512 (2013) 521–526

Contents lists available at SciVerse ScienceDirect

Gene

journal homepage: www.elsevier.com/locate/gene

Short Communication Characterization of seven novel mutations on the HEXB gene in French Sandhoff patients

Pauline Gaignard a,b, Jérôme Fagart c, Natalia Niemir d,e, Jean-Philippe Puech a, Emilie Azouguene a, Jeanne Dussau a, Catherine Caillaud a,d,e,⁎ a Service de Biochimie et Génétique Moléculaire, Groupe Hospitalier Cochin - Broca - Hotel Dieu, Assistance Publique - Hôpitaux de Paris, Paris, France b Laboratoire de Biochimie, Hôpital Bicêtre, Assistance Publique - Hôpitaux de Paris, Le Kremlin Bicêtre, France c INSERM UMR693, Faculté de Médecine Paris-Sud, Université Paris-Sud, Le Kremlin Bicêtre, France d INSERM UMRS-845, Paris, France e Université Paris Descartes, Sorbonne Paris Cité, Faculté de Médecine, Paris, France article info abstract

Article history: Sandhoff disease (SD) is an autosomal recessive lysosomal storage disease caused by mutations in the HEXB Accepted 29 September 2012 gene encoding the beta subunit of hexosaminidases A and B, two enzymes involved in GM2 ganglioside deg- Available online 6 October 2012 radation. Eleven French Sandhoff patients with infantile or juvenile forms of the disease were completely characterized using sequencing of the HEXB gene. A specific procedure was developed to facilitate the detec- Keywords: tion of the common 5′-end 16 kb deletion which was frequent (36% of the alleles) in our study. Eleven other Sandhoff disease disease-causing mutations were found, among which four have previously been reported (c.850C>T, GM2 gangliosidosis Hexosaminidases c.793T>G, c.115del and c.800_817del). Seven mutations were completely novel and were analyzed using HEXB gene molecular modelling. Two deletions (c.176del and c.1058_1060del), a duplication (c.1485_1487dup) and a Mutation analysis nonsense mutation (c.552T>G) were predicted to strongly alter the enzyme spatial organization. The splice mutation c.558+5G>A affecting the intron 4 consensus splice site led to a skipping of exon 4 and to a truncated protein (p.191X). Two missense mutations were found among the patients studied. The c.448A>C mutation was probably a severe mutation as it was present in association with the known c.793T>G in an infantile form of Sandhoff disease and as it significantly modified the N-terminal domain structure of the protein. The c.171G>C mutation resulting in a p.W57C amino acid substitution in the N-terminal region is probably less drastic than the other abnormalities as it was present in a juvenile patient in association with the c.176del. Finally, this study reports a rapid detection of the Sandhoff disease-causing alleles facilitating genetic counselling and prenatal diagnosis in at-risk families. © 2012 Elsevier B.V. All rights reserved.

1. Introduction (Hex B). This double deficiency is responsible for an intralysosomal accumulation of GM2 gangliosides and related glycolipids, mainly in neu- Sandhoff disease (SD, OMIM 268800), also called GM2 gangliosidosis rons, explaining the predominance of neurological signs in this disease. type 0, is a recessively inherited neurodegenerative disorder due to mu- Classically, SD begins before the age of 6 months with motor weakness tations in the HEXB gene encoding the hexosaminidases β-chain. It is and progressive psychomotor retardation, and it culminates in death characterized by a deficiency in both the heterodimeric (αβ) hexosa- by 3–5 years of age. Beside this common infantile acute form, juvenile minidase A (Hex A) and the homodimeric (ββ) hexosaminidase B forms as well as adult forms also exist. They begin in late childhood or adulthood and show a slower progression (Gravel et al., 2001). All these clinical phenotypes depend on the nature of the causal mutations Abbreviation: HEXB, gene encoding the hexosaminidases β chain; HEXA, gene and on their effect on the hexosaminidases activity. encoding the hexosaminidases α chain; Hex A, hexosaminidase A; Hex B, hexosamin- The HEXB gene is about 40 kb long and it contains 14 exons (Neote et idase B; SD, Sandhoff disease; GM2, monosialic ganglioside; DNA, desoxyribonucleic acid; cDNA, complementary DNA; RNA, ribonucleic acid; kb, kilobase; bp, base pair; al., 1988; Proia, 1988). Around 50 mutations were reported in Sandhoff dNTP, desoxyribonucleotide triphosphate; del, deletion; dup, duplication; OMIM, on- patients from various countries (http://www.biobase-international. line mendelian inheritance in man; PCR, polymerase chain reaction; PDB ID, identifica- com/product/hgmd). They are diverse in nature (missense/nonsense, tion in protein data bank. splicing, small deletions, gross deletions) and spread throughout the ⁎ Corresponding author at: Laboratoire de Biochimie et Génétique Moléculaire, Faculté gene. One large deletion removing 16 kb of DNA from theHEXB promot- de Médecine Cochin, 24 rue du Faubourg Saint Jacques, 75014 Paris, France. Tel.: +33 1 44 – 41 24 02; fax: +33 1 44 41 24 46. er to exons 1 5 and part of intron 5 was found common in SD (Neote et E-mail address: [email protected] (C. Caillaud). al., 1990).

51 522 P. Gaignard et al. / Gene 512 (2013) 521–526

We report here the HEXB mutations characterized in 11 French pa- The 14 HEXB exons and intronic junctions were amplified by PCR tients with infantile or juvenile forms of Sandhoff disease using geno- and then sequenced using oligonucleotides given in Table 2. For exons mic sequencing and we analyze their phenotypic consequences and 2–14, DNA amplification was performed in a 100 μL volume containing predictive effect on the course of the disease mainly using in silico 100 ng of genomic DNA, 0.25 mM of each dNTP, 0.1 μM of each primer, tools. 2.5 U of Taq polymerase, 2.5 mM of MgCl2 and 10 μL of buffer 10X. For exon 1, a mix containing 3 mM of MgCl2 and 5% vol/vol of dimethylsulfoxide was used. Thermocycling conditions were those pre- 2. Material and methods viously described for the common deletion. PCR amplifications were purified using Bio-Gel P10 (Bio-Rad Laboratories). Sequencing reaction 2.1. Patients was carried out using Big Dye Terminator Kit (Applied Biosystems, Life Technologies, USA) following the instructions of the manufacturer and Eleven unrelated patients affected with Sandhoff disease were in- DNA fragments were analyzed on the ABI PRISM 3700 DNA Analyzer cluded in this study. They have previously been diagnosed with enzy- (Applied Biosystems, Life Technologies, USA). matic assays: total hexosaminidase activity (mainly hexosaminidases A Putative mutations were validated by sequencing PCR products on and B) was measured using the fluorogenic 4-methyl-umbelliferyl- both strands. Segregation of the alleles was confirmed by DNA analysis N-acetyl-β-D-glucosaminide substrate (Sigma-Aldrich, St Louis, of the parents. For point mutations (p.W57C, p.T150P and p.Y266D), MO, USA), and hexosaminidase A specific activity was determined 100 alleles from healthy European subjects were sequenced on the cor- using the sulphated fluorogenic 4-methyl-umbelliferyl-N-acetyl- responding regions, i.e. exons 1, 3 and 7, respectively. β-D-glucosaminide-6-sulfate substrate (Sigma-Aldrich, St Louis, MO, USA). Clinical forms and geographical origins are given in 2.3. HEXB mRNA analysis Table 1. Written informed consent was obtained from the parents for each patient. For patient 6, total RNA was extracted from cultured fibroblasts. RNA extraction was carried out using the MiniKit RNeasy according 2.2. Molecular analysis of the HEXB gene to manufacturer's recommendations (Qiagen, Hilden, Germany). Reverse-transcription was performed as follows: 400 ng of total Genomic DNA was prepared from peripheral blood leukocytes, RNA was incubated 5 min at 65 °C with 0.50 mM of each dNTP, using a standard protocol. A 5′-end 16 kb deletion is common in 50 ng random hexamers (Invitrogen, Life Technologies, USA) in a HEXB gene and it likely occurs from recombination between two final volume of 12 μl and then briefly chilled on ice. Super-Script II ALU sequences (Neote et al., 1990). The presence of this deletion Reverse-Transcriptase (200 U), 2 mM of dithiothreitol, 40 U of was tested in each patient by a specific method based on two PCR am- RNase OUT, and 4 μL of buffer 5X (Invitrogen, Life Technologies, plifications (Fig. 1). The first PCR detects the normal alleles (without USA) were added (final volume: 20 μL) and the mixture was incubat- deletion) using a forward primer located upstream the ALU sequence ed at 42 °C for 60 min. The inactivation was performed by heating at in the promoter and a reverse primer downstream to the promoter 70 °C for 15 min. The HEXB cDNA was amplified in four PCR reactions (Table 2). The second PCR visualizes the alleles carrying the deletion using oligonucleotides given in Table 2. cDNA amplification was using the same forward primer in the promoter and a reverse primer performed in a 100 μL volume containing 5 μL of cDNA, 0.25 mM of downstream the deletion junction in intron 5. DNA from patients het- each dNTP, 0.1 μM of each primer, 2.5 U of Taq polymerase, 2.5 mM erozygous for the deletion was used as positive controls for each test. of MgCl2 and 10 μL of buffer 10X. The thermocycling conditions PCR amplifications were carried out in a 100 μL volume containing were 40 cycles of amplification consisting in denaturation at 95 °C 100 ng of genomic DNA, 0.25 mM of each dNTP (Thermo Scientific, for 30 s, annealing at 55 °C for 30 s and primer extension at 72 °C Waltham, MA, USA), 0.1 μM of each primer (Sigma-Aldrich, St Louis, for 1 min, preceded by an initial denaturation at 95 °C for 10 min

MO, USA), 2.5 U of Taq polymerase, 2.5 mM of MgCl2 and 10 μL of and followed by an final extension at 72 °C for 7 min. The four buffer 10X (Applied Biosystems, Life Technologies, USA). DNA was cDNA fragments were sequenced as previously described for genomic submitted to 40 cycles of amplification: denaturation at 95 °C for DNA, but with the cDNA primers. 30 s, annealing at 57 °C for 30 s and primer extension at 72 °C for 1 min, preceded by an initial denaturation at 95 °C for 10 min and 2.4. Bioinformatic analyses followed by a final extension at 72 °C for 7 min. In silico analyses were conducted to visualize and predict the effect Table 1 of point mutations (p.W57C, p.T150P and p.Y266D). PolyPhen-2, a HEXB mutations detected in Sandhoff patients. tool based on multiple-sequence alignment, was used to assign a score from 0.00 (benign) to 1.00 (probably damaging) reflecting the Patient Clinical Origin Paternal allele (p) Maternal allele (m) form impact of amino acid substitution (www.genetics.bwh.harvard.edu/ pph2)(Adzhubei et al., 2010). The effect of the missense mutations 1 Infantile France 5′-end 16 kb deletion 5′-end 16 kb deletion 2 Infantile France 5′-end 16 kb deletion 5′-end 16 kb deletion on the overall organization of the protein and on its activity was also ex- 3 Infantile Pakistan c.850C>T (p.R284X) c.850C>T (p.R284X) plored using the crystal structure of human β-hexosaminidase B (PDB 4 Infantile France 5′-end 16 kb deletion c.552T>G (p.Y184X) ID 1O7A) (Maier et al., 2003) using the O package (Jones et al., 1991). 5 Infantile Vietnam (p) c.115del 5′-end 16 kb deletion For intronic mutations, the splicing prediction program Human Splicing France (m) (p.V39WfsX25) Finder was used to evaluate their effect on splice site signal strengths 6 Infantile France c.558+5G>A 5′-end 16 kb deletion 7 Infantile France c.1058_1060del c.1485_1487dup (http://www.umd.be/HSF/)(Desmet et al., 2009). (p.353delG) (p.T496dup) 8 Infantile Algeria c.800_817del c.800_817del 3. Results and discussion (p.267_272delTPNDVR) (p.267_272delTPNDVR) ′ 9 Infantile France c.793T>G (p.Y266D) 5 -end 16 kb deletion fi 10 Infantile France c.793T>G (p.Y266D) c.448A>C (p.T150P) Twelve different Sandhoff-causing mutations were identi ed in 11 11 Juvenile France c.171G>C (p.W57C) c.176del (p.L59RfsX5) unrelated patients (Table 1). Five of them have previously been reported: the 5′-end 16 kb deletion, the nonsense mutation c.850C>T, the mis- Novel mutations are indicated in bold (nucleotidic nomenclature). For cDNA, numbering +1 corresponds to the A of the first ATG translation initiation codon (RefSeq cDNA sense mutation c.793T>G, and the deletions c.115del and c.800_817del NM_000521). (Fitterer et al., 2012; Gort et al., 2012; Maegawa et al., 2006; Neote et

52 P. Gaignard et al. / Gene 512 (2013) 521–526 523

Fig. 1. Detection of the common 5′ end 16 kb deletion. Two PCR amplifications were performed using three primers flanking the deletion junction. P1: upstream the ALU sequence in the promoter; P2a: downstream the ALU sequence (normal allele); P2b: in intron 5, downstream the deletion junction (mutant allele). al., 1990, Zhang et al., 1994). Seven mutations were novel: two missense reported a frequency close to ours (11/30 alleles). By comparison, mutations (c.171G>C, c.448A>C), two small deletions (c.176del, c.1058_ the deletion was not observed in 31 independent alleles from Argen- 1060del), one small duplication (c.1485_1487dup), one nonsense muta- tinean patients (Kleiman et al., 1994). Similarly, in a group of six pa- tion (c.552T>G) and one splice mutation (c.558+5G>A). All of these tients with various ethnic background described by Maegawa et al. mutations were confirmed on two independent PCR products and on (2006), the presence of the common deletion was not noted, but parent's DNA. The polymorphism rs1665894 (c.510+45G>A) was pres- these patients all presented juvenile forms of the disease. The ent in 8/10 patients either in a homozygous or heterozygous state. Two 5′-end 16 kb deletion could have a restricted distribution among Eu- new putative polymorphisms were described: the c.1614-14C>A variant ropeans, as the common deletion was completely absent in 14 Span- (intron 13) was present in a homozygous state in two patients and one ish patients (Gort et al., 2012) and rare (1/32 alleles) in recently father's patient; the c.902-48del mutation (intron 7) was found in one studied Italian patients (Zampieri et al., 2009, 2012). Conversely, the patient, but analysis of numerous controls permitted us to confirm that c.850C>T transition (p.R284X), which was the most frequent muta- this abnormality is likely a polymorphism. tion reported in the Italian population (29% of the alleles) (Zampieri The common 5′-end 16 kb deletion was tested in our patients et al., 2009), was found only once in our study in an infantile Sandhoff using an easy procedure based on PCR amplifications using primers patient originating from Pakistan, born from consanguineous parents flanking the deletion junction (Fig. 1). It was found in 8 out of 22 al- and the small c.171delG deletion reported in 6 out of 28 alleles in leles in our study (frequency: 36%). The majority of patients carrying Spanish patients was absent in our series (Gort et al., 2012). the deletion were Caucasian and the deletion was not found in the We identified seven novel mutations, most of them associated with two non-European patients 3 and 8. Neote et al. (1990), who first the particularly severe infantile form of Sandhoff disease. Hexosamini- fully characterized the deletion, have already reported a high fre- dases A and B were totally inactive in these patients and they likely quency of the deletion (8/30 alleles, frequency: 27%) and shown the inherited two null alleles from their heterozygous parents. The novel strong prevalence in patients of French or French-Canadian extrac- c.552T>G nonsense mutation was found associated with the common tion. In a cohort of European patients, Bolhuis and Bikker (1992) deletion in an infantile form of Sandhoff disease, like the previously

Table 2 Oligonucleotides used for PCR ampliﬁcation and sequencing of the HEXB gene.

Exon/region Forward primers (5′–3′) Reverse primers (5′–3′) PCR product size (bp)

Analysis of the HEXB gene (genomic DNA) Exon 1 GGAGGAAATTCTCGAGGTGAC AGGTGTCCCTTAAGAAGCAGTAG 699 Exon 1a GTCATCTGACTCGGTGACTC AGGTGTCCCTTAAGAAGCAGTAG 610 Exon 2 GGGTGAGAATCTCTAGTTGGACT AGGAATCATAAACTCACTGGTTG 400 Exon 3 CATGTGCTTGGGAGAAAATAATA CAATGGAAATCATTTTGGAACTA 326 Exons 4–5 ATTTGCCTTACCTGGTTATGAGT CCCTGTTCCAAACTACACAATAG 611 Exon 6 TTAAAGGAAGCAGACATATTGGA ATTTACACTTCCCCAAGATTGTT 443 Exon 7 TGGCTATCATCCTTTGAGTATGT AGTGAGCCGAGATTGTACTACTG 473 Exon 8 AATGACGTAGTAAAATCATGTGGA TTTAGTAGAGATGGGGTTTCACC 432 Exon 9 AAGCCATTTTTAAAGGAAATCAG ATTGCCTCCTTTAGTGATTTTTC 432 Exon 10 ATCAAGTGCTAAAAAGGAGGAAC CAAACCTAGCTTGGAACTATGAG 407 Exon 11 TCCCTAAAATGAGTATCACATGG CTTGAATTTAGGCAACTGTATGG 582 Exons 12–13 AGGATAAAGATGGAGGAAACAAA AAATTAAAGCAACTCAAGATGGA 641 Exon 14 TGCTGTGATTTAGTGATTCTAATTT ATGTTTAAAGCCACTGTACCTGA 459 Detection of 5′ end deletion (genomic DNA) Without deletion P1 P2a 583 GTGTCTGTTCAAATTCTTCTTGG CAGAGCAAGCCATAGAAACTAGA With deletion P2b 657 ATTATGGGATGACTGCCTATTTT Analysis of the HEXB cDNA Region 1 GTCATCTGACTCGGTGACTC AAGGTCTCTAAACCTCGTAATGC 638 Region 2 GTTCAGCAACTTCTTGTCTCAAT CTCGTAATCTGGCATATTCAATCA 475 Region 3 CATAGTTGATGACCAGTCTTTCC TCAAATCTAAGTACCAAGGAGCA 650 Region 4 CCGGGCACAATAGTTGAAG GATTGTAGTACAGATTGCTGTGGC 465

a In patients carrying the polymorphism rs70976124 (c.-122del, NM_000521), alternative primers were used to correctly analyze the exon 1 coding region.

53 524 P. Gaignard et al. / Gene 512 (2013) 521–526 reported c.115del small deletion. c.552T>G and c.115del are both null pathogenic effect of the c.800_817del deletion found in patient 8 is alleles encoding inactive β-hexosaminidase β-subunits. The c.552T>G similar. This 18 bp deletion does not generate a shift in the reading transversion produces a premature stop codon (p.Y184X) and the frame, but leads to the deletion of six amino acids (p.267_ c.115del small deletion causes a frameshift also leading to a premature 272delTPNDVR). The loss of these six residues strongly disturbs the stop codon 25-bp downstream (p.V39WfsX25). These two mutations correct positioning of the Tyr266 residue. Normally, the Tyr266 resi- are predicted to permit the synthesis of proteins truncated before the due forms hydrogen bonds with the main chain of Leu214 that stabi- main active site Glu355, and consequently inactive. These drastic alter- lizes the loop containing the Arg211 residue, a residue essential for ations definitely explain the clinical severity in patients 4 and 5 suffer- substrate binding, like Glu491 (Hou et al., 2000). Therefore, the ing from infantile form of SD. Other small deletions described in the proteic change p.267_272delTPNDVR alters substrate binding. As HEXB gene result in a frameshift and behave as a null allele. It is the this abnormality was present in a homozygous state in an infantile case for the two mutations c.534_537del (p.L178Ffs28X) and c.965del form in our study and associated with a frameshift in a recently (p.I322KfsX5) found in a homozygous state in severe infantile forms reported Spanish infantile SD patient (Gort et al., 2012), this strongly (Gomez-Lira et al., 2001; Zampieri et al., 2009). In our study, it is impor- reinforces our hypothesis that c.800_817del is a null allele. tant to note that the characterization of the c.115del deletion was diffi- Three missense mutations were present in our study: two in in- cult due to the presence of a polymorphism 5-bp before exon 1 fantile forms (c.793T>G and c.448A>C) and one in a juvenile form (rs70976124; c.-122del). Amplification of this allele was reduced, (c.171G>C) in association with the novel deletion c.176del. To ascer- resulting in a misinterpretation of the sequence. This problem was tain the pathogenicity of these variant alleles, we excluded their pres- solved by the use of alternative primers (Table 2). The c.115del deletion ence from 100 control alleles and investigated the evolutionary has recently been reported as frequent in the Saskatchewan communi- conservation of mutant nucleotides across orthologous genes and ty, a population originating from the European immigration (Fitterer et the structural consequences of amino acid replacement. The al., 2012). Interestingly, patient 5 inherited this allele from his Vietnam- c.793T>G mutation (p.Y266D) has previously been reported, but its ese father, implying that the presence of this pathogenic variant is prob- deleterious effect was not strictly studied (Maegawa et al., 2006). In ably not limited to West Canada. patient 9 suffering from infantile SD, the p.Y266D mutation was asso- A new intronic c.558+5G>A mutation was found in association ciated with the common 5′ end deletion and we postulate that it be- with the 5′-end deletion in an infantile patient. The nucleotide G at po- haves as a null allele, based on several observations. First, the Tyr266 sition +5 is part of the human 5′ consensus splice site GURAGU (R is pu- residue is highly conserved among several species (PolyPhen-2 score rine). In silico analysis using Human Splicing Finder predicts that the at 1.00), indicating a structurally or functionally important role in the intronic c.558+5G>A transition severely alters the natural 5′ splice β-hexosaminidase β-chain (Adzhubei et al., 2010). Moreover, as donor site of intron 4 (Desmet et al., 2009). cDNA sequencing of the cor- explained above, the Tyr266 residue carries two hydrogen bonds responding region (not shown) confirmed this prediction. The that stabilize the loop with Arg211, a residue involved in substrate c.558+5G>A mutation leads to a skipping of exon 4, and the subse- binding. The p.Y266D amino acid change is probably severely delete- quent loss of 47 bp results in a premature stop codon at residue 191. rious as an aspartate residue at position 266 impairs the formation of Therefore, this mutation also leads to a probably inactive protein the hydrogen bonds with Leu214 and therefore is not able to stabilize (p.191X). Numerous splicing mutations have previously been described the loop with the Arg211 residue. The p.Y266D mutation was first de- in the HEXB gene. The c.446-1G>A mutation results in an exon skipping scribed in a juvenile form, in association with an intronic mutation without causing a frameshift and the c.1509-26G>A mutation produces (c.1509-26G>A) that creates a cryptic splice site and results in an an aberrant transcript by activation of a cryptic splice site (Dlott et al., in-frame insertion of 24 intronic nucleotides. The addition of eight 1990; Nakano and Suzuki, 1989; Yoshizawa et al., 2002). Interestingly, amino acids in the C-terminal domain leads to an unstable protein. a same G>A transition also located at position +5 in intron 4 However, a partial use of the normal splice site generating a slight (c.459+5G>A) was described in the HEXA gene (RefSeq NM_000520) quantity of functional β-chain could explain the juvenile form ob- encoding the β-hexosaminidase α-subunit, which has a high homology served in this patient carrying the c.1509-26G>A and c.793T>G mu- with the HEXB gene sequence (Proia, 1988). The c.459+5G>A mutation tations (Dlott et al., 1990; Maegawa et al., 2006; Nakano and Suzuki, results in a skipping of exon 4 (Akli et al., 1991). One can note that po- 1989). sition +5 is one of the most frequent mutant position after position +1 The other missense mutations c.448A>C (p.T150P) and c.171G>C as listed in the Human Gene Mutation Database, and that the mutability (p.W57C) were both studied for the first time. The c.448A>C muta- rate is higher for C/G than for T/A (Krawczak et al., 2007). tion was found associated with the c.793T>G mutation (p.Y266D) We found two small deletions and one duplication probably also in patient 10 exhibiting an infantile form of Sandhoff disease. Al- resulting in null alleles according to our molecular modelling. The though this novel variant was not detected in any of 100 healthy al- novel c.1058_1060del deletion and the c.1485_1487dup duplication leles tested, we noted that the evolutionary conservation of Thr150 were associated in an infantile form (patient 7) and, given the crystal is mild (Poly-Phen2 score: 0,711). Nevertheless, it is not contradicto- structure of the human hexosaminidase β-subunit described by Maier ry with a strong deleterious effect of the p.T150P amino acid replace- et al. (2003), they are predicted to generate pathogenic alterations of ment. Indeed, the Thr150 residue takes part of a β-sheet located in the enzyme. The c.1058_1060del deletion causes the loss of the the N-terminal domain of human β-hexosaminidase B (Fig. 2C). Sub- Gly353 residue. The Gly353 residue is strongly closed to the Glu355 stitution by residues serine or valine, as seen in mus musculus residue that is the main amino acid of the catalytic site. In the absence (mouse) or sus scrifa (pig), should be easily tolerated in position of the Gly353 residue, the required positioning of the Glu355 residue 150 because the β-sheet conformation is maintained. On the contrary, is disturbed and the nucleophilic attack of the substrate is strongly al- the substitution of threonine by proline considerably disfavors the tered (Fig. 2B). The c.1485_1487dup duplication causes the insertion β-sheet conformation and alters the N-terminal domain structure. of one threonine between the Thr496 and Asn497 residues. In the Like most glycosidases, β-hexosaminidase B is characterized by a wild-type protein, the Thr496 residue carries a hydrogen bond with TIM-barrel structure containing the active site and a N-terminal do- the Asp494 residue that strengthens a loop containing the Glu491 main (Fig. 2)(Nagano et al., 2002). Function of the N-terminal do- residue (Fig. 2B). This residue is required to bind the substrate to main is not clearly known, but it seems essential for protein activity. the catalytic site (Maier et al., 2003). Consequently, the c.1485_ Indeed, previous characterization of two variants confirmed the 1487dup duplication could also be predicted as harmful for enzyme N-terminal domain importance. The pathogenic p.G171-L172del var- activity: the 3-bp insertion disturbs the regular orientation of the sub- iant (c.512-1G>T) was predicted to disrupt the N-terminal domain, strate by a remodelling of the loop with the Glu491 residue. The thus destroying dimerization or overall folding of the protein (Mark

54 P. Gaignard et al. / Gene 512 (2013) 521–526 525

Fig. 2. Structural localization of β-hexosaminidase B mutations. Pictures showing the X-ray crystal structure of β-hexosaminidase B (PDB ID 1O7A): overall view (A); picture centred on the catalytic site (B) or on the junction between the N-terminal and catalytic domains (C). Alpha helices and beta strands are represented by ribbons and arrows, respectively. In both the N-terminal and catalytic domains, beta strands are coloured using violet to cyan gradients. Helices are coloured in red and green for respectively the N-terminal and catalytic domains. The main chain of the deleted regions in the catalytic domain are coloured in gold. The residues with identiﬁed mutations or those altered by the mutations together with the substrate are represented with their carbon, nitrogen and oxygen atoms coloured in white, blue and red, respectively. The panels were generated using the Dino package (DINO: Visualizing Structural Biology (2002) http://www.dino3d.org.

et al., 2003; Zampieri et al., 2009). The c.185C>T (p.S62L) allele must deletion. This novel 1-bp deletion, like the c.115delG described above, behave as a null allele since it was found in acute infantile form asso- causes a shift in the reading frame leading to the generation of a prema- ciated with another null allele (Zhang et al., 1995). According to the ture stop codon 25 bp downstream. Therefore, it could have been con- β-hexosaminidase β-subunit crystal structure, the p.S62L variant sidered as a null allele. However, patient 11 carrying the genotype was confirmed to be deleterious because it disturbs the N-terminal c.171G>C/c.176del (p.W57C/p.L59RfsX5) had a juvenile form whereas domain fold (Maier et al., 2003). All these observations enable us to patient 10 whose genotype was c.448A>C/c.793T>G (p.T150P/ assume that the p.T150P substitution might result in a p.Y266D) had an infantile form, the most severe form of Sandhoff dis- non-functional human hexosaminidase β-chain because it disar- ease. Thus, we postulate that p.W57C is less drastic than p.T150P for ranges the N-terminal domain folding. the protein structure. Finally, we described the p.W57C amino acid substitution also located in the N-terminal domain. The Trp57 residue takes part of the anchoring 4. Conclusion between the N-terminal domain and the active barrel structure due to its aromatic core (Fig. 2C). The p.W57C variant may be pathogenic since the We fully characterized 11 French Sandhoff patients and showed resulting cysteine residue does not have such an aromatic structure. that their carried either the common 5′-end 16 kb deletion (36%) or Moreover, the c.171G>C mutation was not found in 100 control alleles other abnormalities among which four have previously been and the evolutionary conservation of Trp57 is strong (PolyPhen-2 score reported. Seven novel disease-causing mutations were identified 1.00). This missense mutation was found associated with the c.176del and their pathogenicity was confirmed by in silico analysis.

55 526 P. Gaignard et al. / Gene 512 (2013) 521–526

Conflict of interest Hou, Y., Vocadlo, D., Withers, S., Mahuran, D., 2000. Role of beta Arg211 in the active site of human beta-hexosaminidase B. Biochemistry 39, 6219–6227. Jones, T.A., Zou, J.Y., Cowan, S.W., Kjeldgaard, M., 1991. Improved methods for building Authors declare no conflicts of interest. protein models in electron density maps and the location of errors in these models. Acta Crystallogr. A 47 (Pt 2), 110–119. Kleiman, F.E., Dekremer, R.D., Deramirez, A.O., Gravel, R.A., Argarana, C.E., 1994. Acknowledgments Sandhoff disease in Argentina: high frequency of a splice site mutation in the HEXB gene and correlation between enzyme and DNA-based tests for heterozygote detection. Hum. Genet. 94, 279–282. We thank the following physicians for referring their Sandhoff Krawczak, M., et al., 2007. Single base-pair substitutions in exon–intron junctions of patients: Prs Thierry Billette de Villemeur (Paris, France), Olivier Dulac human genes: nature, distribution, and consequences for mRNA splicing. Hum. (Paris, France), Diana Rodriguez (Paris, France), and Drs Christine Mutat. 28, 150–158. Barnerias (Paris, France), Valérie Belian-Pallet (Bondy, France), Claude Maegawa, G.H., et al., 2006. The natural history of juvenile or subacute GM2 gangliosidosis: 21 new cases and literature review of 134 previously reported. Pe- Cances (Toulouse, France), Bénédicte Héron (Paris, France), Muriel Hold- diatrics 118, e1550–e1562. er (Lille, France), Isabelle Kemlin (Paris, France), Alice Masurel (Dijon, Maier, T., Strater, N., Schuette, C.G., Klingenstein, R., Sandhoff, K., Saenger, W., 2003. France). N.N. was supported by a doctoral fellowship from the Associa- The X-ray crystal structure of human beta-hexosaminidase B provides new insights into Sandhoff disease. J. Mol. Biol. 328, 669–681. tion Française contre les Myopathies (AFM) and the association Vaincre Mark, B.L., Mahuran, D.J., Cherney, M.M., Zhao, D., Knapp, S., James, M.N., 2003. Crystal les Maladies Lysosomales (VML). structure of human beta-hexosaminidase B: understanding the molecular basis of Sandhoff and Tay-Sachs disease. J. Mol. Biol. 327, 1093–1109. Nagano, N., Orengo, C.A., Thornton, J.M., 2002. One fold with many functions: the evo- References lutionary relationships between TIM barrel families based on their sequences, structures and functions. J. Mol. Biol. 321, 741–765. Adzhubei, I.A., et al., 2010. A method and server for predicting damaging missense mu- Nakano, T., Suzuki, K., 1989. Genetic cause of a juvenile form of Sandhoff disease. Ab- tations. Nat. Methods 7, 248–249. normal splicing of beta-hexosaminidase beta chain gene transcript due to a point Akli, S., Chelly, J., Lacorte, J.M., Poenaru, L., Kahn, A., 1991. Seven novel Tay–Sachs mu- mutation within intron 12. J. Biol. Chem. 264, 5155–5158. tations detected by chemical mismatch cleavage of PCR-amplified cDNA frag- Neote, K., et al., 1988. Characterization of the human HEXB gene encoding lysosomal ments. Genomics 11, 124–134. β-hexosaminidase. Genomics 3, 279–286. Bolhuis, P.A., Bikker, H., 1992. Deletion of the 5′-region in one or two alleles of HEXB in Neote, K., McInnes, B., Mahuran, D.J., Gravel, R.A., 1990. Structure and distribution of an 15 out of 30 patients with Sandhoff disease. Hum. Genet. 90, 328–329. Alu-type deletion mutation in Sandhoff disease. J. Clin. Invest. 86, 1524–1531. Desmet, F.O., Hamroun, D., Lalande, M., Collod-Beroud, G., Claustres, M., Beroud, C., Proia, R.L., 1988. Gene encoding the human β-hexosaminidase β chain: extensive ho- 2009. Human Splicing Finder: an online bioinformatics tool to predict splicing sig- mology of intron placement in the α- and β-chain genes. Proc. Natl. Acad. Sci. nals. Nucleic Acids Res. 37, e67. U.S.A. 85, 1883–1887. Dlott, B., d'Azzo, A., Quon, D.V., Neufeld, E.F., 1990. Two mutations produce intron inser- Yoshizawa, T., Kohno, Y., Nissato, S., Shoji, S., 2002. Compound heterozygosity with two tion in mRNA and elongated beta-subunit of human beta-hexosaminidase. J. Biol. novel mutations in the HEXB gene produces adult Sandhoff disease presenting as a Chem. 265, 17921–17927. motor neuron disease phenotype. J. Neurol. Sci. 195, 129–138. Fitterer, B.B., Antonishyn, N.A., Hall, P.L., Lehotay, D.C., 2012. A polymerase chain Zampieri, S., et al., 2009. Molecular and functional analysis of the HEXB gene in Italian reaction-based genotyping assay for detecting a novel Sandhoff disease-causing patients affected with Sandhoff disease: identification of six novel alleles. mutation. Genet. Test. Mol. Biomarkers 16, 401–405. Neurogenetics 10, 49–58. Gomez-Lira, M., et al., 2001. A novel 4-bp deletion creates a premature stop codon and Zampieri, S., et al., 2012. Sequence and copy number analyses of HEXB gene in patients dramatically decreases HEXB mRNA levels in a severe case of Sandhoff disease. affected by Sandhoff disease: functional characterization of 9 novel sequence var- Mol. Cell. Probes 15, 75–79. iants. PLoS One 7, e41516. Gort, L., de Olano, N., Macías-Vidal, J., Coll, M.A., The Spanish GM2 Working Group, Zhang, Z.X., Wakamatsu, N., Mules, E.H., Thomas, G.H., Gravel, R.A., 1994. Impact of pre- 2012. GM2 gangliosidoses in Spain: analysis of the HEXA and HEXB genes in 34 mature stop codons on mRNA levels in infantile Sandhoff disease. Hum. Mol. Tay-Sachs and 14 Sandhoff patients. Gene 506, 25–30. Genet. 3, 139–145. Gravel, R.A., Kaback, M.M., Proia, R.L., Sandhoff, K., Suzuki, K., Suzuki, K., 2001. The GM2 Zhang, Z.X., Wakamatsu, N., Akerman, B.R., Mules, E.H., Thomas, G.H., Gravel, R.A., gangliosidoses. In: Scriver, C.R., Beaudet, A.L., Sly, W.S., Valle, D. (Eds.), The metabolic 1995. A second, large deletion in the HEXB gene in a patient with infantile Sandhoff and molecular bases of inherited disease. McGraw-Hill, New-York, pp. 3827–3876. disease. Hum. Mol. Genet. 4, 777–780.

56 Detection of novel mutations in Sandhoff patients and impact on hexosaminidase structure and activity

Our team has performed the molecular characterization of several French Sandhoff patients. The presence of the common 5’-end 16 kb deletion, frequent on the HEXB gene, and including promoter, exons 1 at 5 and part of intron 5, was first screened in each patient using a novel method specifically developed by us. One PCR detects the normal alleles using a forward primer located upstream the ALU sequence in the promoter and a reverse primer downstream to the promoter, the other reveals the alleles carrying the deletion by using the same forward primer and a reverse primer downstream the deletion junction in intron 5. For the determination of the other deleterious mutations, exonic and intronic flanking sequences of the HEXB gene were amplified by PCR and sequenced using specific oligonucleotides. This method permitted us to characterized 100% of the mutations present in our patients. Moreover, it is now routinely applied in the laboratory for all the novel patients, as previously performed for Tay-Sachs patients (Giraud, et al. 2010). Our work (Gaignard, et al. 2013) shows the high prevalence (36% of alleles) of the 16 kb deletion in French Sandhoff patients, as previously described in other populations, but contrarily to Italian patients (Zampieri, et al. 2012). Concerning the other mutations found among French Sandhoff patients, they are heterogeneous and the majority of the affected persons are compound heterozygotes. This result is comparable to previous publications reporting mutations from different populations also showing a huge heterogeneity. The known mutations in the HEXB gene are given in Table 3. Another aspect of our work was focused on the molecular modelling of few novel mutations. These data give insights on how α and β-subunits dimerize to form either Hex A or Hex B, and the way these isoenzymes hydrolyse diverse substrates. Although the α and β-subunits each contain an active site, dimer formation is necessary to confer functionality. Some mutations affecting the active sites therefore will cause a loss of function of hexosaminidases and in consequence a symptomatic outcome. It is known that both subunits have very similar active sites. Nevertheless, only the α-subunit active site can accommodate negatively charged substrates, such as GM2 and the presence of the α-subunit together with the β-subunit is required in order to bind of the GM2–activator complex to Hex A (Maier et al. 2003, Mark et al. 2003). The structure of the human hexosaminidase subunits was based on the prokaryote homologues and on the work of Don Mahuran and Elizabeth Neufeld on the purified protein (Hasilik and Neufeld 1980b, Hasilik & Neufeld 1980a, Mahuran et al. 1982). Then, the predictions were confirmed by crystallisation of the enzyme. According to these data, the α chain of hexosaminidases is composed of 2

57 polypeptides, whereas the β subunit has 3 polypeptides. The α and β chains have almost a similar size (55 kDa and 50 kDa for α and β, respectively), whereas the GM2 activator protein is a monomer of 22 kDa composed of 160 aminoacids. Moreover, the modelled Hex A in complex with the activator and ganglioside has been published (Mark, et al. 2003). This knowledge helps to understand how documented α and β-subunit point mutations cause the enzyme deficiency and subsequent Sandhoff and Tay–Sachs disease. Recently, simulation analysis combining β-subunit exhibiting the mutation p.Arg505Gln, GM2AP/GM2 complex and β-hexosaminidase A showed that the mutation impaired each step of molecular conformation of the α- and β-subunits heterodimer, the activator protein and GM2 ganglioside (Yasui, et al. 2013). The results indicated that p.Ser341ValfsX30 reduced the amount of β-subunit, and that p.Arg505Gln hampered the maturation of α- and β-subunits, and hindered the catalytic ability of β-hexosaminidase A.

Nucleotidic Mutation effect at the proteic level Described by alteration (cDNA) (Neote, et al. 1990) (Bikker, et al. 16kb Absence of exons 1 -5 1989; Bikker, et al. 1990)

(Bolhuis and Bikker 1992) Del 50kb Absence of exons 1 - 6 (Zhang, et al. 1995) Del >16 kb Absence of promoter (Lee, et al. 2000) c.-117_669del ? (Sobek, et al. 2013) (Hara, et al. 1994), (Banerjee, et al. c.76delA Smaller mRNA 1994), (Redonnet-Vernhet, et al. 1996) (Fitterer, et al. 2012), Our team c.115delG V39WfsX25 (Gaignard, et al. 2013) c.146C>A S49X; nonsense (Zampieri, et al. 2012) c.171G>C W57C Our team (Gaignard, et al. 2013) (Gort, et al. 2012a; Zhang, et al. c.171delG W57CfsX6, exon 1 1995) c.176delT L59fsX5 Our team (Gaignard, et al. 2013) c.185C>T S62L (Zhang, et al. 1995) c.299G>T no RNA 299+1471_408del2406 (Zampieri, et al. 2009) c.300-2A>G R101_S148delfsX12; before exon 2 (Zampieri, et al. 2009) (Maegawa, et al. 2006), (Aryan, et al. c.410G>A C137Y 2012) c.446-1G>A Exon 3 skipping(Maegawa, et al. 2006) (Yoshizawa, et al. 2002) (Brown, et al. 1992; Kleiman, et al. c.446+1G>A IVS2 ; mRNA absent 1994) c.448A>C T150P Our team (Gaignard, et al. 2013)) c.497delAGTT Stop in exon 5 (Gomez-Lira, et al. 2001) c.508C>T R170X, exon 3 (Gort, et al. 2012a) c.512-1G>T G171-L172del before exon 5 (Zampieri, et al. 2009) c.534delAGTT L178fs27X (Zampieri, et al. 2009)

59 c.550delT S183fsX23 exon 4 (Aryan, et al. 2012) c.552T>G Y184X (Sobek, et al. 2013) c.558+5G>A Intron 4; loss of exon 4 in cDNA Our team (Gaignard, et al. 2013) (Banerjee, et al. 1994), (Cashman, et c.619A>G I207V al. 1986) c.626C>T T209I conformation change in binding site (Zampieri, et al. 2012) H212N, no severe structural changes, high residual activity, c.634C>A (Zampieri, et al. 2012) deleterious effect or pseudodeficiency ? c.695A>C N232T Our team (Gaignard, et al. 2013) c.703C>T H235Y (Yamada, et al. 2013) c.765C>G S255R (Fujimaru, et al. 1998) (McInnes, et al. 1992a; McInnes, et c.772delG 274X al. 1992b) (Brown, et al. 1992), (Kleiman, et al. c.782delCTTT 260 1994) c.796T>G Y266D, exon 7 (Gort, et al. 2012a) c.793T>G Y266D (Maegawa, et al. 2006) c.800_817del Del267-272 (Gort, et al. 2012a) 839_842delinsGGC L280WfsX27 Our team (Gaignard, unpublished) c.846G>A G282E, exon 7 (Zhang, et al. 1994), (Zampieri, et al. c.850C>T R284X; mRNA absence 2009) c.884C>G T295R (Sobek, et al. 2013) c.902-2A>G ? (Sobek, et al. 2013) (Gomez-Lira, et al. 1995a), (Zhang, c.926G>A C309Y et al. 1995) C309F high Hex A activity (36%), abrogation of the disulphide c.926G>T (Zampieri, et al. 2012) bridge formation between hex chains c.965delT I322fsX5 (Zampieri, et al. 2009) c.1057G>C G353R (Maegawa, et al. 2006) c.1078T>C C360R (Sobek, et al. 2013) c.1058_1069delGAG 353delG Our team (Gaignard, et al. 2013)

60 Mutation in intron 8, exon 8 skipping, premature stop (Zampieri, et al. 2012), (Gort, et al. c.1082+5G>A G301_W361delfsX10 2012a) c.1082+5G>C IVS8 (Furihata, et al. 1999) Skipping of 87 nt of exon 9; in-frame expulsion of 28 AA, c.1169+5G>A (Zampieri, et al. 2012) E362_K390del c.1214C>T P405L (Wakamatsu, et al. 1992) c.1234T>C ? (Sobek, et al. 2013) c.1242G>A L414L, normal splicing (Gomez-Lira, et al. 1995a) ? V391_K414delfs6X (Zampieri, et al. 2009) c.1242-1G>A Intron 10 Gomez-Lira 1998 Intron 10, 2 transcripts: skipping of exon 10 or skipping of part of c.1242+1G>A exon 10/part of exon 11, no consensus splicing site recognition, (Zampieri, et al. 2012) exclusion of 112 nt from transcript c.1242-17A>G Intron 10; mRNA absence (Furihata, et al. 1999) (Gomez-Lira, et al. 1995b; c.1250C>T P417L Wakamatsu, et al. 1992) ? T437P (Lee, et al. 2000) c.1260_1265delAGTTGA V421_E422del, in-frame (Zampieri, et al. 2012) (McInnes, et al. 1992a; McInnes, et c.1305_1306delAG R435MfsX20; mRNA absence al. 1992b), (O'Dowd, et al. 1986) c.1344delT 451X; mRNA absence (Zhang, et al. 1994) c.1367A>C Y456S (Banerjee, et al. 1994) c.1372C>T Q458X (Zampieri, et al. 2009) c.1376A>C D459A (Wang, et al. 2008) G484E, conformation change in binding region; change of c.1451G>A (Zampieri, et al. 2012) plasticity of protein main chain c.1489_1491dup D497dup Our team (Gaignard, et al. 2013) (Nakano and Suzuki 1989), (Dlott, et c.1508-26G>A IVS 12; insertion of 24 intronic bp in mRNA al. 1990) c.1510C>T P504S (Hou, et al. 1998) c.1514G>A R505Q (Bolhuis, et al. 1993) c.1534A>G R512G (Juban)

61 c.1538T>C L513P (Sobek, et al. 2013) c.1541G>A W514X, exon 13 (Gort, et al. 2012a) c.1552delG D518fsX12, exon 13 (Aryan, et al. 2012) c.1556A>G D494G; exon skipping (Santoro, et al. 2007) c.1565G>A C522Y (Kuroki, et al. 1995) R533C, disruption on dimer formation, severe miss-folding of (Kaya, et al. 2011), (Aryan, et al. c.1597C>T protein C terminal loop 2012) c.1598G>A R533H (Yoshizawa, et al. 2002) (Zampieri, et al. 2009), (Kuroki, et al. c.1601G>A C534Y 1995) c.1614-16_1615dup18 E538_R539insLHVIYR (Dlott, et al. 1990) (Gomez-Lira, et al. 1995b), c.1613+2T>G E538ins4X5, Insertion of 48pb in mRNA (Zampieri, et al. 2009) c.1615C>T R539C, exon 14 (Gort, et al. 2012a) c.1627G>A A543T; thermo sensitive form (Narkin 1997) c.1645G>A G549R (Wu 2013) c.1751delTG Exon 14; less mRNA (Kleiman, et al. 1998) c.1752delTG ? (Aryan, et al. 2012)

Table 3 : Previously described HEXB mutations and their impact in Sandhoff patients

Article 2

Effects of the chaperone pyrimethamine on fibroblasts from atypical infantile forms of

Sandhoff disease

Natalia Niemir1*, Elena Chiricozzi2*, Massimo Aureli2, Alessandro Magini3, Nicoletta

Loberto2, Rosaria Bassi2, A, Alice Polchi3, Alessandro Prinetti2, Carla Emiliani3, Catherine

Caillaud1,4 , Sandro Sonnino2, §

1 INSERM U845, Université Paris Descartes, Sorbonne Paris Cité, Faculté de Médecine

Necker, Paris, France.

2 Department of Medical Biotechnology and Translational Medicine, University of Milano,

Italy

3 Department of Experimental Medicine and Biochemical Sciences, University of Perugia,

Italy.

4 Service de Biochimie et Génétique Moléculaire, Groupe Hospitalier Cochin-Broca-Hotel

Dieu, Assistance Publique-Hôpitaux de Paris, Paris, France.

* These authors contributed equally to this work.

§Corresponding author: Department of Medical Biotechnology and Translational Medicine,

University of Milano, LITA, Via Fratelli Cervi 93, 20090 Segrate (Milano), Italy, Fax : +39

0250330365, e-mail: [email protected]

Abstract

Pyrimethamine, a new pharmacological chaperone for β-hexosaminidase, was tested on fibroblasts from patients with atypical infantile forms of Sandhoff disease. A significant increase of hexosaminidase activity was observed with the hexosaminidase A specific artificial substrate, but this was not confirmed by feeding experiments using the GM2 substrate. Our results highlight the fact that tests with the natural substrate are required to determine the true effect of pyrimethamine on the recovery of lysosomal β-hexosaminidase activity and that a particular attention should be paid to the use of pyrimethamine chaperone in Sandhoff disease due to its potential toxicity.

Keywords: Pharmacological chaperone; GM2-gangliosidosis; β-hexosaminidase;

Pyrimethamine; Sandhoff disease; Metabolic feeding in fibroblasts.

65 Background

Sandhoff disease is an autosomal recessive neurodegenerative disease characterized by the intralysosomal accumulation of GM2 ganglioside, due to a genetic defect of the β-chain of the dimeric enzyme β-hexosaminidase A. β-Hexosaminidases exists in three different dimeric isoforms: A (αβ), B (ββ) and S (αα). The mutations in the HEXB gene encoding the β- hexosaminidase β-chain and it results in a β-hexosaminidase A and B deficiency [1]. Like other lysosomal enzymes, β-hexosaminidase is synthesized in the endoplasmic reticulum and then it undergoes posttranslational modifications. The endoplasmic reticulum contains a highly conserved degradation pathway that protects cells from misfolded proteins. This protein turnover ensures the integrity and biological functions of cells [2].

Despite the low incidence of sphingolipidoses, including GM2-gangliosidoses, their treatment has received a particular interest. As enzyme replacement therapy meets the problem to cross the blood-brain barrier, alternative approaches such as pharmacological chaperones are now under investigation. Pyrimethamine was found to act as a chaperone for β-hexosaminidase A

[2,3]. It can stabilize the conformation of mutant proteins, allowing them to pass the quality control system of the endoplasmic reticulum. Thus, the stably folded protein can be transported to lysosome, increasing the residual enzymatic activity. Like numerous other chaperones, pyrimethamine is a competitive inhibitor and its effect is reversible in the presence of accumulated substrate in lysosomes. Pyrimethamine affinity for β-hexosaminidase is regulated by pH: the acid pH of lysosome reduces the affinity between the pharmacological chaperone and the enzyme [2,3]. The effectiveness of pyrimethamine as a chaperone depends on the conformation of the mutant protein. Indeed, its effect was tested on cells carrying different β- chain mutations and only some of them allow the resulting protein to interact with pyrimethamine [3].

Findings

Two patients were diagnosed with atypical infantile Sandhoff disease, beginning at 7 and 9 months, but showing an unusual slow evolution. Biological diagnosis was performed on leukocytes and serum by using enzymatic tests based on the 4-methylumbelliferyl derivatives of

β-N-acetylglucosaminide (MUG) or β-N-acetylglucosamine-6-sulfate (MUGS), permitting to evaluate the total β-hexosaminidases activity or specific β-hexosaminidase A and S, respectively. Both patients had a β-hexosaminidase A and B deficiency confirming the diagnosis of Sandhoff disease. Complete sequencing of the HEXB gene showed that patient #1 carried the common 16 kb deletion (including promoter and exons 1-5) on one allele [4] and a novel splice mutation in intron 2 (c.446-13A>G) on the other allele. Patient #2 was homozygous for a previously reported mutation (c.1082+5G>A) present in intron 8 [5].

Cultured fibroblasts were obtained from these patients after the signed of the informed consent by the parents and β-hexosaminidase activities were measured on the artificial substrates MUG and MUGS by an assay available in all laboratories. Both patients showed a residual β- hexosaminidase A and S activity around 2% with the MUGS substrate, leading the possibility for them to be candidate for an enhancement enzyme therapy [2]. As pyrimethamine was described as a potential pharmacological chaperone for β-hexosaminidase A, able to reduce

GM2 accumulation in Tay-Sachs (mutation of the β-hexosaminidase α-chain) and Sandhoff diseases [3,6,7], it was tested on fibroblasts from patients #1 and #2. Treatment with pyrimethamine resulted in an increase of the residual β-hexosaminidase activity up to 10% as measured with the MUGS artificial substrate (not shown). This value should theoretically be able to limit the accumulation of GM2 in vivo [8]. To confirm the capacity of pyrimethamine to physiologically increase the activity of β-hexosaminidase A, fibroblasts were fed with isotopically tritium-labeled GM1 ganglioside [9]. Surprisingly, no transformation of GM2 in

GM3 (or reduction in GM2) was observed in pyrimethamine-treated Sandhoff cells (Fig. 1).

67 This negative result was explained after fractionation of the total cell proteins by ion-exchange

DEAE-cellulose column chromatography (Fig. 2) [9]. The separation of β-hexosaminidase isoenzymes showed that the increased β-hexosaminidase activity measured with the artificial substrate in pyrimethamine-treated cells was due to an increase of the β-hexosaminidase S activity. Unfortunately, the isoform S (the homodimer αα) hydrolyzes the artificial substrate but not the GM2 natural substrate. Therefore, pyrimethamine was unable to modify the lysosomal GM2 metabolism in the two cell lines tested.

Our results were obtained in atypical Sandhoff patients showing delayed symptomatology possibly due to splice mutations able to generate some residual enzymatic activity. They confirm the necessity of in vitro tests before the use of pyrimethamine as a therapeutic drug in patients. Enzymatic assays for β-hexosaminidase isoforms and feeding experiments using tritium-labeled gangliosides are helpful to determine the potential efficacy of chaperone pyrimethamine on patient fibroblasts. However, even if pyrimethamine in vitro efficacy can be predicted using the natural substrate, no simple method exists to follow its in vivo efficacy

(optimal dose, follow-up at short and long-term, ...) during oral administration in Sandhoff patients, as tests on blood leukocytes or serum using artificial substrates are not truly informative in Sandhoff disease. This point is crucial, as this component can induce side effects due to its inhibitory potential. In these conditions, the use of pyrimethamine in Sandhoff patients remains problematic.

Competing interest

The authors have declared that no competing interests exist.

Authors’ contributions:

All the authors have made substantial contributions to the conception and design of this work and have been involved in drafting the manuscript.

68 References

1. Gravel RA, Kaback MM, Proia RL, Sandhoff K, Suzuki K, Suzuki K. The GM2

gangliosidoses. In: The metabolic and molecular bases of inherited disease. Volume 3. 8th

edition. Edited by Scriver CR, Beaudet AL, Sly WS, Valle D. New York:McGraw-Hill;

2001:3827-3876.

2. Tropak MB and Mahuran DJ. Lending a helping hand, screening chemical libraries for

compounds that enhance β-hexosaminidase A activity in GM2 gangliosidosis cells. FEBS

J. 2007, 274:4951-4961.

3. Maegawa GH, Tropak M, Buttner J, Stockley T, Kok F, Clarke JT, and Mahuran DJ.

Pyrimethamine as a potential pharmacological chaperone for late-onset forms of GM2

gangliosidosis. J Biol Chem 2007, 282:9150-9161.

4. Neote K, Mclnnes B, Mahuran DJ and Gravel RA. Structure and distribution of an Alu-

type deletion mutation in Sandhoff disease J Clin Invest 1990, 86:1524-1531

5. Zampieri S, Cattarossi S, Oller Ramirez AM, Rosano C, Lourenco CM, Passon N,

Moroni I, Uziel G, Pettinari A, Stanzial F, de Kremer RD, Azar NB, Hazan F, Filocamo

M, Bembi B and Dardis A. Sequence and copy number analyses of HEXB gene in

patients affected by Sandhoff disease : functional characterization of 9 novel variants. PLoS

One 2012, 7:e41516.

6. Clarke JT, Mahuran DJ, Sathe S, Kolodny EH, Rigat BA, Raiman JA and Tropak MB.

An open-label phase I/II clinical trial of pyrimethamine for the treatment of patients

affected with chronic GM2 gangliosidosis (Tay-Sachs or Sandhoff variants). Mol Genet

Metab 2011, 102:6-12.

7. Osher E, Fattal-Valevki A, Sagie L, Urshanski N, Amir-Levi Y, Katzburg S, Peleg L,

Lerman-Sagie T, Zimran A, Elstein D, Navon R, Stern N, Valevski A. Pyrimethamine

increases β-hexosaminidase A activity in patients with late onset Tay Sachs. Mol Genet

Metab 2011, 102:356-363.

69 8. Leinekugel P, Michel S, Conzelmann E and Sandhoff K. Quantitative correlation

between the residual activity of β-hexosaminidase A and arysulfatase A and the severity of

the resulting lysosomal storage disease. Hum Genet 1992, 88:513-523.

9. Arfi A, Bourgoin C, Basso L, Emiliani C, Tancini B, Chigorno V, Li YT, Orlacchio A,

Poenaru L, Sonnino S, Caillaud C. Bicistronic lentiviral vector corrects β-hexosaminidase

deficiency in transduced and cross-corrected human Sandhoff fibroblasts. Neurobiol Dis

2005, 20:583-593.

10. Tropak MB, Bukovac SW, Rigat BA, Yonekawa S, Wakarchuk W and Mahuran DJ. A

sensitive fluorescence-based assay for monitoring GM2 ganglioside hydrolysis in live

patient cells and their lysates. Glycobiology 2010, 20:356-365.

".$ "-$

",$

1 2 1 2 1 2

%+')('*($ $$$(&$!$ #,$$ #-$

Fig.1 HPTLC chromatographic separation of the ganglioside mixture extracted from cells fed with [3-3H-Sph]GM1.

Control and Sandhoff cultured fibroblasts were metabolically labeled with [3-3H-Sph]GM1 and treated with pyrimethamine [10] (1, untreated cells; 2, treated cells). Total lipid extracts were partitionated and gangliosides were separated on HPTLC using the solvent system chloroform/methanol/0.2% calcium chloride 50:42:11 (v/v/v). After separation, the radioactive lipids were visualized by digital autoradiography.

In control cells (healthy donor), GM3 ganglioside is visible indicating that GM1 was transformed into GM2 by β-galactosidase and then into GM3 by β-hexosaminidase. In the untreated and pyrimethamine-treated Sandhoff cell lines #1 and #2, no GM3 was formed due to the ineffectiveness of pyrimethamine on these cells. The reduced production of GM3 in control cells treated with pyrimethamine confirms the inhibitory activity of the chaperone on β- hexosaminidase A in the absence of an accumulation of GM2 [3].

71 Untreated cells Pyrimethamine-treated cells

3,00 !$*$-$ 0,4 3,00 !$*$ $ !$*$-$ 0,4 $+"!)$ $+!!)$ $+"!)$ 2,40 2,40 !$*$ $ 0,3 0,3 $+!!)$ 1,80 1,80 !$*$ $$ 0,2 0,2 1,20 &'$#)'(%'$ 1,20 !$*$ $$ $+!!)$ &'$#)'(%'$ Control cells 0,1 0,1 0,60 0,60 $+!!)$

0,00 0 0,00 0 1 7 1 7

MUGS] 13 19 25 31 37 43 49 13 19 25 31 37 43 49 !

NaCl 0,20 0,4 0,20 0,4

!$*$"$ concentration ! MUG; $+"")$ 0,15 0,3 0,15 0,3 /ml [ 0,10 0,2 0,10 0,2 mU , !$*$"$ , M [ M , Cell line # 1 0,05 $+"")$ 0,1 0,05 0,1 ---- activity

0,00 0 0,00 0 ] 1 1 7 13 19 25 31 37 43 49 7 13 19 25 31 37 43 49

Enzymatic 0,20 0,4 0,20 0,4

0,15 0,3 0,15 0,3 !$*$"$ 0,10 0,2 0,10 $+"")$ 0,2

Cell line # 2 0,05 !$*$"$ 0,1 0,05 0,1 $+"")$

0,00 0 0,00 0 1 7 1 13 19 25 31 37 43 49 7 13 19 25 31 37 43 49

Elution volume, ml

Fig. 2 Analysis of β-hexosaminidase isoform pattern.

β-hexosaminidase isoenzymes separation was performed by ion exchange DEAE-cellulose column chromatography using a NaCl gradient as eluting system. β-hexosaminidase B (ββ- dimer) was unretained by the column and eluted with the void volume, whereas β- hexosaminidase A (αβ-dimer) and β-hexosaminidase S (αα-dimer) were eluted by the linear saline gradient as previously described [9]. Fractions of 1 ml were collected and assayed for β- hexosaminidase activity using the fluorescent substrates MUG (hydrolyzed by β- hexosaminidase isoforms A, B and S) and MUGS (hydrolyzed by the isoforms A and and S).

The same amount of proteins for each sample was loaded on the column.

Discussion

73 Use of pyrimethamine as chaperone in GM2 gangliosidoses

After our publication (Gaignard, et al. 2013) other Sandhoff patients originating from France and Lebanon were recruted and they were genotyped using the same strategy: detection of the common deletion and if negative, complete sequencing of the HEXB gene. One French infantile patient carried the 16 kb deletion on one allele and the c.446-13A>G on the other allele. An adult patient was a compound heterozygote for the c.534delAGTT (frameshift mutation) and c.772-4A>G mutations. One Lebanese patient with an infantile form of Sandhoff disease was also tested. The 16 kb common deletion was not present. The complete sequencing of the HEXB gene showed the presence of the splice mutation c.1082+5G>A. This mutation has previously been reported by others in Argentinian patients (Zampieri, et al. 2012). Three other Lebanese patients, previously diagnosed by enzymatic methods, were therefore studied in order to determine if they have a similar genotype. They were all negative for the 16 kb deletion and they all carried the intronic c.1082+5G>A mutation (intron 8) in a homozygous state. This variant was not detected in any of fifty healthy Lebanese controls indicating a possible common variant in this probable Lebanese subpopulation. The effect of the c.1082+5G>A mutation on the splicing process was studied. Analysis of the cDNA was performed on the fibroblast cell line from one Lebanese patient after RNA extraction, reverse transcription and PCR using specific primers. As shown in Figure 15, the c.1082+5G>A mutation, located in intron 8, leads to a skipping of exon 8. The loss of 181 bases creates a frameshift and a premature stop codon nine amino acids downstream (residue 311). This protein is truncated before the catalytic site Glu355 of the human β-hexosaminidase β-subunit and it is therefore probably inactive.

74 &2" Genomic DNA ;!" 9!" !"#$# !"#%# !"#&#

")-,*)'&"(0-$.*)"&276>8@;"!A&" 33!&#! " 33&&#! "

splicing

cDNA ;!" 9!" ;!" 9!" !"#$# !"%# !"#&# !"#$# !"#&#

!"! #$# !"! #%# !"! #$# !"! #&#

2" <=;"%+" :?:"%+"

7" 8"

Figure 15 : Characterization of the c.1082+5G>A mutation at the genomic and cDNA level

A. The G>A point mutation at position c.1082+5 was determined after direct sequencing on genomic DNA. It probably falls within an enhancer site (prediction) causing its brake. The changed sequence can not be recognized by the splicing machinery and exon 8 is skipped. B. The electrophoresis of a portion of cDNA containing the exons 7-9 shows a band of 494 bp (lane 1) corresponding to a deletion of 181 bp by comparison with the normal band with a total size of 675 bp (lane 2).

At the end of the previously performed molecular studies, our team wanted to explore the feasibility of molecular therapies for patients carrying specific splice mutations, in particular chaperones. Recently, high-throughput screening of libraries with chemicals and registered drugs has been used to identify novel molecules which can be Hex A inhibitors. This strategy led to the identification of pyrimethamine (PYR or 2,4-diamino 5-(4-chlorophenyl)-6- ethylpyrimidine) (Maegawa, et al. 2007), known before as antiparasite and antimalarian drug, as a potential hexosaminidase inhibitor. PYR was originally developed as a dihydrofolate reductase inhibitor (Leport, et al. 1996; Weiss, et al. 1988). This molecule possesses major advantages such as oral administration, well-studied pharmacokinetics and FDA-approved profile. Moreover, it has a small molecular weight enabling CNS penetration (Weiss, et al. 1992), an important point in regard to neuronopathic GM2 gangliosidoses.

75 Recently, pyrimethamine has been described to be able to increase the Hex A activity in cells from adult Tay-Sachs and Sandhoff patients by a chaperone effect (Maegawa, et al. 2007). Indeed, PYR pharmacological chaperone action is based on the presence of a minimal residual activity. The use of this approach can therefore be considered in patients with juvenile or adult forms of the disease, resulting from the production of an unstable protein and the subsequent enzymatic deficiency. In TSD and SD patients, unstable hexosaminidase is prematurally degraded by the quality control system of the endoplasmic reticulum and is not transported to lysosomes. However, many mutations in either the α or β hexosaminidase subunit can be partially rescued and an enhanced enzymatic activity can be obtained following administration of pyrimethamine to cells in in vitro conditions. Unless the mutation affects a functional residue like Arg178 in the α-subunit directly binding the substrate (αR178H mutation associated with the TSD B1-variant) (Maegawa, et al. 2007; Ohno and Suzuki 1988), in theory PYR could bind and stabilize the “native” folded conformation of Hex A. The enzyme would therefore cease to be degraded by endoplasmic reticulum associated degradation pathway (ERAD) and could be transported to lysosomes where stored substrate can displace PYR. Moreover, pyrimethamine inhibits its target enzyme better at the neutral pH of the ER than at the acidic pH of lysosomes and therefore an additional stability is obtained once a lysosomal enzyme is folded correctly in the ER (Bernales, et al. 2006), and the mutant subunit assembles with a wild-type subunit to form the Hex A heterodimer. As the presence of residual enzyme is necessary for chaperone treatment efficacy, it has been stated that only GM2 chronic patients with specific mutations such as the most common Tay Sachs late-onset mutation αG269S, mutations resulting in reduced hexosaminidase heat stability or some splice junction mutations can benefit from this approach. Therefore, we decided to test pyrimethamine in the two recently characterized patients carrying the mutations c.446-13A>G and c.1082+5G>A (on one allele in each case). These patients showed atypical infantile forms of Sandhoff disease, i.e. with a slow clinical evolution (in the early phase) compared to other classical infantile Sandhoff and with a small, but significant residual activity detected by the standard synthetic substrate degradation assays. Moreover, in vitro study of chaperone effect on fibroblasts from both patients showed a significant increase of Hex A activity compared to untreated fibroblasts (Figure 16). Those results made us consider both cases potentially eligible for PYR treatment. However, as shown in our paper (Niemir et al) presented above, the use of natural substrate (GM2 ganglioside) did not confirm the presence of a real residual activity in these two patients and the positive effect of pyrimethamine.

76 Hex A specific activity

***

** *** *** ****

MUGS activity (nmol/h/mg of protein) WT WT+PYR P1 P1+ PYR P2 P2+PYR

Figure 16 : Hexosaminidase specific activity in fibroblasts from both patients with "atypical" form of infantile Sandhoff disease

Results were obtained with the MUGS synthetic substrate according to (Bayleran, et al. 1984) and they are expressed in nmol/h/mg of protein. Single PYR treatment increased the levels of WT, P1 and P2 fibroblasts hexosaminidase A activities. All tests were made by triplicate. The same lineages served for subsequent natural substrate degradation assays. Error bars show SEM, n=3, *** p<0,001, 2 ways ANOVA test with post hoc Bonferroni analysis were used.

The efficacy of pyrimethamine molecule in the treatment of chronic GM2- gangliosidosis (Tay-Sachs or Sandhoff variants) has been investigated in a number of cell culture studies (Maegawa, et al. 2007) followed by an open-label phase I/II clinical trial for tolerability assessment (Clarke, et al. 2011). The results show that PYR administered orally using doses lower than those used to treat the parasitic diseases, enhanced Hex A activity in peripheral blood leukocytes of patients with late-onset GM2 gangliosidosis. Moreover, a comparable enhancement was observed in either Sandhoff or Tay–Sachs variant of GM2 gangliosidosis, and the degree of improvement was proportional to the plasma PYR concentration. Nevertheless, the clinical effects of PYR treatment were difficult to assess, mainly due to short treatment duration (up to 10 months) (Osher, et al. 2011). Previous complicated profile with mutant cell lines responding differently to chaperone (Maegawa, et al. 2006; Maegawa, et al. 2007) was confirmed in patients, and individual variations in the pharmacokinetics of the drug were noted. At high dosage of the drug, significant side effects were experienced by most patients (Clarke, et al. 2011). Moreover, regular clinical examinations, along with a panel of hematologic and biochemical studies (repeated measurements of Hex A activity normalized by lysosomal ß-glucuronidase) were not sufficient for therapeutic efficacy assessment. This indicated a need for further trial extension and new methods to evaluate clinical outcome. At high drug concentrations, Mahuran and coll. observed an evident inhibitory effect of the drug on Hex, in parallel with the absence of effect on the activities of two other lysosomal enzymes. Also, some important risks can result from the

77 nature of the molecule. The chaperone competes with the endogenous substrates for binding to the active site of enzymes, and therefore, the appropriate dosage is critical. Moreover, the chemical structure of this chaperone containing two primary amines (Figure 17) could, in case of elevated lysosomal concentrations, decrease lysosomal pH leading to subsequent increased secretion of lysosomal enzymes through inhibition of mannose-6-phosphate receptor recycling.

Figure 17: Pyrimethamine structure

The presence of primary amines (pyrimidine) at positions 2 and 4 could change the lysosomal pH. Abundant levels of the molecule in the lysosomal compartment could inhibit the pathway by which the receptors return to the plasma membrane (lysosomotropic effect) (Clarke, et al. 2011; Strous, et al. 1985).

These results point towards the necessity to develop efficient tools for the clinical follow-up and for overcoming the pitfalls of diagnostic techniques. Extreme caution is clearly needed when considering PYR treatment. The inhibitor effect and difficult dosage as well as the absence of specific information on the molecule half-life can lead to an aggravation of the patient state. In our work, the absence of correlation between enzymatic tests with the synthetic substrate and natural substrate degradation assays and the difficulties during the clinical use in late-onset forms of GM2 gangliosidoses show that progress is necessary in order to develop reliable techniques for chaperone effect monitoring at the molecular and clinical level.

CHAPTER 2

Introduction

2.1 Animal models of Sandhoff disease

In order to develop therapeutic approaches for Sandhoff disease, the first step was the obtention of pertinent animal models, necessary for the preclinical analyses.

Sandhoff mouse model

Two Sandhoff murine models were generated simultaneously by two different teams. These models resulted from the introduction of a neomycine cassette either in exon 2 (Phaneuf, et al. 1996) or in exon 13 of the HEXB murine gene (Sango, et al. 1995). They have similar characteristics and they display a phenotype quite close to the human disease.

Figure 18 : Hexb-/- mice at a terminal stage of the disease (4 months)

Due to severe paralysis, the animal is unable to stand up and hypophagy is leading to a drastic weight loss. According to (Phaneuf, et al. 1996).

At birth, Hexb-/- mice are not distinguishable from wild type littermates. Muscle weakness and lack of purposeful movement were the early symptoms at approximately 2.5 months, followed by tremor, ataxia and spasticity (3 months). Then, the progression is rapid toward severe motor and neurological deterioration, with finally an immobile state approximately 4 weeks after the onset of the disease (Jeyakumar, et al. 2003) (Gulinello, et al. 2008). The GM2 accumulation in neurons is probably slow in the first weeks of life explaining the absence of early symptoms till a critical threshold where the disease progression becomes evident (Phaneuf, et al. 1996). Abnormalities of neuronal structure and function are induced and axonal damage in the spinal cord and the brain is initiated. As the severity of the nerve tract depletion increases, mice manifest a pathological phenotype with a serious motor dysfunction. After 3–4 months, mice enter a rapid phase leading to complete paralysis 6 weeks after the first symptoms. The main phenotypic milestones are presented in Table 4.

81 Age Phenotype Head tremor 2.5 months Memory defects Behavioural abnormalities with increased anxiety Onset of motor dysfunction

3 months Muscle weakness Ataxic gait Epileptic attacks begin to appear Hind limb paralysis

4 months Immobile state Humane end point: unable to right themselves after falling

Table 4 : Development of disease phenotype in Hexb-/- mice.

As the onset of the pathology occurs after sexual maturation, Hexb-/- animals are able to reproduce. Although males are fertile and can sire normal sized litters up to nine weeks of age (Trasler, et al. 1998), the homozygote breeding appears to be quite complicated due to the narrow time-frame for mating and gestation before the pathological symptoms of the disease start to appear. The animals after 2.5-3 months are unlikely to breed due to increasing body tremor. In human patients, the accumulation of GM2 gangliosides in the retinal ganglion cells and particularly in the fovea centralis produces the characteristic cherry-red spot, surrounded by a white halo in the macula (Kivlin, et al. 1985). SD patients also exhibit optic abnormalities and have visual loss because of impairment of the retinal ganglion cells (Brownstein, et al. 1980) (Norby, et al. 1980). By comparison, the murine model did not show the cherry-red spot (Sango, et al. 2005), but the presence of pathological abnormalities like ganglion cell loss and optic nerve atrophy was found in the retina of Hexb-/- mice (Brownstein, et al. 1980; Cairns, et al. 1984). A significant reduction of retinal lysosomal β-hexosaminidase activity causes GSL abnormalities within the eye of diseased animals and it is associated with membranous cytoplasmic bodies, altered retinal architecture and neurite outgrowth (Sango, et al. 2005). Nevertheless, it seems that those changes do not lead to visual impairment (Denny, et al. 2007). Electrophysiological studies of visual function in Sandhoff mice have been conducted in old mice (3.5–4 months). Electroretinogram was normal even at this late stage and visual evoked potentials were generally present (Denny, et al. 2007). Animals presented a normal behaviour at novel object exploration and they had a normal pupil dilatation (Gulinello, et al. 2008). Sandhoff mutant mice also develop evident short-term memory deficit by 11-12 weeks (Gulinello, et al. 2008).

82 Few pathophysiological hallmarks can be noted as causative of the severe phenotype of Sandhoff mice.

Microglial activation

In symptomatic Sandhoff mice, extensive microglial activation was found to precede massive apoptotic neuronal cell death, suggesting that inflammation process may participate in neurodegeneration (Wada, et al. 2000). Although the initiating signals for this microglial activation are still poorly elucidated, there is no doubt on its detrimental effect in Sandhoff disease pathogenesis (Wada, et al. 2000) (Kyrkanides, et al. 2008; Wu and Proia 2004). Similarly, gene expression profiles in cerebral cortex from Sandhoff patients revealed elevated expression of genes encoding proteins involved in inflammation, including class II histocompatibility antigens, pro-inflammatory cytokine osteopontin, complement components, osteonectin and prostaglandin D2 synthase (Myerowitz, et al. 2002). In Sandhoff mice, various inflammatory cytokines such as TNFα, IL1β, TGFβ1 were also found highly expressed in the CNS, particularly in the late stages of the disease (Jeyakumar, et al. 2003). Activated microglia is the highest in thalamic sensory nuclei. During disease progression, microglia aspect changes from a ramified-like morphology at 1 month of age to a fully amoeboid macrophage morphology by 3 months of age (Pressey S., unpublished).

GM2 ganglioside storage

It has been proposed that GM2 ganglioside accumulation in neurons is progressive and that it correlates with disease evolution, with an absence of behavioural symptoms in the early phase of the disease, even though a small but significant level of GM2 was already detectable at embryonic day 10 (Pelled, et al. 2003). This hypothesis could explain the initiation of axonal damage in the spinal cord and the brain and the subsequent abnormalities of neuronal structure when a threshold level of GM2 is reached triggering the pathological process. Nonetheless, this process is probably more complexe and GM2 and GA2 ganglioside accumulation cannot account for all of the nervous system damages in Hexb-/- mice, as bone marrow transplantation from non-deficient animals is able to suppress neuronal death and to improve lifespan expectancy despite no effect on either β-hexosaminidase activities or ganglioside brain accumulation (Norflus, et al. 1998; Wada, et al. 2000). Moreover, GM2 ganglioside accumulation causes lysosomal swelling. Glycolipid storage was demonstrated with

83 periodic-acid-Schiff (PAS) in almost all neurons of the central nervous system. GM2 storage was first detected in anterior horn cells at 2–3 weeks postnatal (Phaneuf, et al. 1996). No macroscopic abnormalities were detected in the brain or visceral organs of Hexb-/- mice, but extensive neuronal GM2 storage was observed throughout the central nervous system and in particular in the CA3 region of the hippocampus. The neuronal viability is not affected by GM2 accumulation in hippocampal neurons and ceramide was proposed to act as a second messenger (Huang, et al. 1997). GM2 accumulation in neuronal tissues affects the rate of Ca2+ uptake into the brain and as a result, neurons are becoming more sensitive to induced neuronal cell death. In the mouse model of Sandhoff disease, it has been shown that calcium homeostasis was altered in brain and in cultured neurons, because of a significant reduction in the rate of calcium uptake via the sarco/endoplasmic reticulum Ca2+-ATPase (SERCA) (Pelled, et al. 2003). This effect could be mimicked in vitro by exogenously added GM2, suggesting a causal relationship between GM2 and the reduction in SERCA activity. Other studies also showed changes in the rate of axonal and dendritic growth in neurons cultured from the hippocampus of embryonic Sandhoff mice and demonstrated distortion of neuronal geometry and formation of ectopic dendrites in human brain and in animal models of Sandhoff disease. Together, these data imply a direct correlation between the initiation of neuronal cell dysfunction and/or death and modulation of SERCA activity by GM2. Moreover, downstream response to changes in cytosolic Ca2+ levels might initiate a stress response, which may subsequently act as an initiating signal for the neuroinflammatory response. Interestingly, the inflammatory response predates symptom onset in Hexb-/- mice, and changes in SERCA activity can be detected in mice as young as embryonic day 17, even though no symptoms of Sandhoff disease are observed until 2–3 months of age (Pelled, et al. 2003). Accumulated GM2 has been shown to induce ectopic sprouting of neurites in cortical pyramidal cells (Walkley, et al. 1990a) and may also affect neurotransmitter function (Walkley, et al. 1991). Additionally, GM1 and GM3 gangliosides can induce apoptosis (Zhou, et al. 1998). Neuronal loss, gliosis and storage were described at the terminal stages of the disease, but the mechanism leading from genetic deficiency to cell death and subsequent symptoms, remains unclear. In fact, which pathological events are caused by the genetic deficiency and which are secondary events is still poorly understood.

84 Immune system abnormalities

One pathological hallmark in GM2 gangliosidoses is the development of an inflammatory response. It has been documented that the nervous system can influence the immune organs in a significant manner through the action of hormones and through direct innervation (Zhou, et al. 1998), suggesting close relationship between those two systems, and potential impairment of immune function in these neurodegenerative disorders. Specific components of the immune response like cytokines and antibodies are implicated in the pathological development of LSDs. Important upregulation of proinflammatory genes involved in neuronal death has been documented in Hexb-/- mice and in human patients (Wada, et al. 2000). Recently, the role of TNFα in the development and progression of disease course in SD mice has been highlighted by the creation of a double- knockout Hexb-/- x Tnfα-/- presenting ameliorated disease course, extended lifespan, enhanced sensorimotor coordination and improved neurological function (Abo-Ouf, et al. 2013b). SD mice also show decreased levels of astrogliosis and reduced neuronal cell death, with no alterations in neuronal GM2 accumulation. Also, NF-kappa-B-inducing kinase (NIK)/noncanonical nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) pathway is activated in SD and it is reduced in the absence of TNFα (Abo-Ouf, et al. 2013a). Even before the onset of pathological symptoms, Hexb-/- mice present an increased expression of MIP-1α in astrocytes (Wu and Proia 2004). The elevated MIP-1α mRNA and protein levels are accompanied by a significant infiltration of macrophage-like populations into the CNS. A MIP-1α gene disruption provoked significant amelioration of some prominent pathophysiological phenotypes (Wu and Proia 2004). Additionally, relationship between the upregulation of MIP-1α and accumulation of natural substrates of Hex B was observed. The upregulation of MIP-1α was closely correlated with a marked cellular accumulation of N- acetylglucosaminyl (GlcNAc)-oligosaccharide, but not within microglia that predominantly accumulated GM2 (Wu and Proia 2004). As such, the accumulation of gangliosides and GlcNAc-oligosaccharides in subpopulations of glial cells was proposed to cause an uncontrolled MIP-1α expression specific upregulation. Although the relationship between the modifications of the lysosomal compartment and the changes in the immune system remains unclear, emerging evidence for early neuroimmune responses has been documented in many LSDs. Glycosphingolipid storage is known to induce an enhanced formation of lysosomal lipid rafts, which are specialized platforms in the plasma membrane, important for signalling and membrane sorting (Simons and van Meer 1988). The lipid raft-mediated signalling is implicated in the response of B cells

85 to an antigen. B cell receptors (BCR), normally in the liquid-disordered part of the plasma membrane, are recruited with other factors to membrane rafts after the receptor-antigen clustering (Cherukuri, et al. 2004). Glycosphingolipid storage enhances the formation of lysosomal lipid raft and subsequently decreases the surface expression of the B cells. Accordingly, in Hexb-/- B cells, the trafficking from Golgi to lysosome is altered and the overdegraded B cell receptor presents a decreased expression at the cell surface (te Vruchte, et al. 2010). This highlights the fact that storage may alter the expression of immunoreceptors and thus modify immune responses (te Vruchte, et al. 2010). An autoimmune response with accompanying pathophysiological phenotypes has been described in Hexb-/- mice (Yamaguchi, et al. 2004). It has been suggested that the accumulating lysosomal storage material within cells derived from Hexb-/- mice has the potential to trigger an autoimmune response. Indeed, Hexb-/- mice show the presence of antiganglioside autoantibodies and demonstrate an age-dependent increase in autoantibody titers. The important role of antiganglioside autoantibodies in Hexb-/- pathophysiology was also confirmed by the disruption of the Fc receptor gamma (FcRγ), a key actor in immune complex-mediated diseases. The double-KO mice showed amelioration of clinical symptoms such as improved lifespan and reduced anti-GA2 autoantibody serum titer by comparison with Hexb-/- x FcRγ+/+ mice (see Table 5). In the Sandhoff murine model, the production of autoantibodies has been attributed to thymic alterations. In fact, it has been observed that Hexb-/- mice present severe thymic involution even at the early stages of the disease and by 14-15 weeks, the massive apoptotic cell death causes a rapid decrease of thymocytes to about 3 % of wild-type (Matsuoka, et al. 2011b). The causes of this event are diverse in the literature. The level of corticosterone (CC), a potent inducer of apoptosis (Thompson 1999), was significantly higher in SD mice than in wild-type animals at a late stage of the pathogenesis and it has been proposed that this elevation in the serum of SD mice could be responsible for a drastic increase in apoptosis of Hexb-/- thymocytes (Wiegers, et al. 2001). Moreover, the cDNA microarray analysis of gene expression during the thymic involution process revealed the upregulation of many genes associated with the immune responses and in particular expressed in macrophages. One of them, CXCL13, was overexpressed in many autoimmune diseases. CXCL13 was upregulated in end-stage SD mice and its expression was found to be specific to the thymus (Gadola, et al. 2006). Kanzaki and colleagues reported elevated chemotaxis of B1 cells toward CXCL13 in Sandhoff mouse model. This results in thymic alteration and possible thymic autoimmune responses (Kanzaki, et al. 2010).

86 Thymic impairment has significant consequences on the functions of the immune system. Hexb deficient animals were reported to present a reduction of invariant natural killer T-cells (iNKT) (Gadola, et al. 2006). This specific decrease of iNKT, a highly specialized subset of CD1d-restricted T lymphocytes, is due to the presentation impairment in the thymus in Hexb- /- animals. It suggests that, like in NKT knock-out mice, limited protection mechanisms against microorganisms, infectants/parasites, or fungus is possible. From a functional point of view, the reduction of iNKT cells caused undetectable rates of iNKT-dependent response to antigen (secretion into the serum of several different cytokines, like IL-4 and IFN-γ), although residual iNKT cells from deficient mice were able to release IFN-γ when stimulated by α-GalCer-pulsed, wild-type bone marrow–derived dendritic cells suggesting its functionality (Gadola, et al. 2006). Processing and presentation of endogenous iNKT selecting ligands may also be affected by GSL storage. It has been proposed that isoglobotrihexosylceramide (IGb3) could serve as selecting ligand, since HEXB is necessary for its formation and iGb3 binds to CD1d and stimulates iNKT cells (Zhou, et al. 2004). Subsequent studies, however, have challenged this hypothesis (Porubsky, et al. 2007; Porubsky, et al. 2012). In Hexb-/- mice, the iGb4 precursor of iGb3 and iGb3 itself were increased in the dorsal root ganglion (DRG), but both forms were undetectable in thymus and dendritic cells. Furthermore, several other mouse strains with defects in GSL metabolism also have decreased iNKT cells, irrespective of the role of the mutant gene in the generation of iGb3. Finally, human tissues were also negative for both iGb3 and iGb4 (Porubsky, et al. 2012; Xu, et al. 1999). In the light of those results, the degree of iNKT cell deficiency in the mutant strains is more probably related to the extent of their lipid storage, disrupting the normal loading of glycolipids into CD1d through spatial endocytic system (Paduraru, et al. 2013). Additionally, the significant reduction in the frequency of iNKT cells in Sandhoff mice at postnatal day 12 (Gadola, et al. 2006), when appreciable levels of GSL storage are already detected, suggests that accumulation of GSLs in thymocytes may lead to a decreased capacity to positively select iNKT cells. Collectively, these data suggest that the accumulation of GSL in the lysosome can impair lysosomal processing and/or loading of CD1d ligands for presentation to iNKT cells and the defect in sphingolipid trafficking may contribute to the reduction in exogenous ligand presentation (Gadola, et al. 2006).

Immune system phenotype Reference

Proinflammatory cell infiltration of CNS (Jeyakumar, et al. 2003) Astrocyte and microglial activation; complement involvement (Jeyakumar, et al. 2003; Wada, et al. 2000) Upregulation of proinflammatory genes (Myerowitz, et al. 2002) MIP-1α upregulation and recruitment of blood-borne cells into the (Wu and Proia 2004) CNS Presymptomatic expression of MIP-1α (Tsuji, et al. 2005) Age-dependent presence of anti-ganglioside autoantibodies and their (Yamaguchi, et al. 2004) localization in the CNS TNFα-mediated JAK2/STAT3 activation and subsequent (Abo-Ouf, et al. 2013a) astrocytosis induction

Table 5 : Reported immune system abnormalities in Sandhoff disease

CNS pathology associated with neuron loss

A massive apoptosis within CNS has been documented in Hexb-/- mice (Huang, et al. 1997) (Jeyakumar, et al. 2003; Wada, et al. 2000) The brain and spinal cord of Hexb-/- mice are replete with swollen neurons due to lysosomes accumulating high levels of GM2 ganglioside and its asialo derivative, glycolipid GA2. Visceral organs, mostly liver and kidneys, are also involved. SD mice present a dramatic extent of axon damage and large storage bodies filled with GM2 in neurons in the grey matter, including motor neurons. Apoptotic cells can be identified in cerebral cortex, brain stem, cerebellum and spinal cord. The circuitry is presumably disrupted at multiple levels by the end of the disease, leading to total incoordination of somatic motor systems. The extensive storage of GM2 ganglioside in the basal ganglia, cerebellum and cerebral cortex possibly contribute to those manifestations (Phaneuf, et al. 1996). Although the CNS is severely affected by the disease, the peripheral nervous system of Hexb-/- mice shows no significant functional, structural, or compositional abnormalities (McNally, et al. 2007). As shown previously, Hexb-/- model was back-crossed with many knock-out mice. These double KO animals are extremely helpful in elucidating the importance of processes involved in the pathophysiology of SD disease. All existing double KO models are described in Table 6.

Genotype Phenotype Meaning References

Hexb-/- Total deficiency of all forms of β-hexosaminidase (Hex S Glycosaminoglycans as crucial substrates for β- (Sango, et al. Hexa-/- included) phenotypic, pathologic and biochemical features of hexosaminidase and their lack of storage in Tay-Sachs 1996) mucopolysaccharidoses; severe decrease in rotarod performance and Sandhoff diseases is due to functional redundancy compared to SD, early ganglioside accumulation and lethality in the β-hexosaminidase enzyme system

Hexb-/- Ameliorated disease course; extended lifespan; enhanced TNFα activation of the JAK2/STAT3 pathway as a (Abo-Ouf, et TNFα-/- sensorimotor coordination; improved neurological functions; mechanism for astrocyte activation; al. 2013b) decreased levels of astrogliosis and neuronal apoptosis; neurological improvement independent of ganglioside no alterations in neuronal ganglioside storage; temporal microglia storage; activation similar to SD TNFα as cytokine mediating astrogliosis and neuronal apoptosis in SD

Hexb-/- Genetic model of substrate deprivation therapy; GM2/GA2 Pathology of mucopolysaccharidosis-proteoglycans (Liu, et al. GalNAcT-/- synthase absence, no complex gangliosides; male infertility caused possibly not a major pathogenic factor; minor 1999) by degeneration of seminiferous tubules; longer lifespan (300 days contribution to pathogenesis; vs 120-150 in SD mice); hunched posture complete absence of complex gangliosides render CNS No GSL accumuntaion in liver and brain more sensitive to damaging effects of oligosaccharide worse performance on rotarod than Hexb-/- GalNAcT+/– mice storage; complex gangliosides may stabilize or protect the CNS from insult or injury

Hexb−/− Ablation of the chemokine receptor CCR2; Infiltrating PBMC and activated microglia are major (Kyrkanides, Ccr2−/− significant blockage of peripheral blood mononuclear cell source of TNFα in the Hex-/- brain; et al. 2008) (PBMC) infiltration into the brain; TNFα expression in mouse brain contributes to decrease in TNFα; MHC-II mRNA abundance, retardation in residual behavioural impairment in mice; clinical disease development; no change in the level of GM2 proinflammatory cytokines (i.e. IL-1β), upregulation in storage and pro-apoptotic activity or astrocyte activation the brain may be part of an inherent neuroprotective response

89 Genotype Phenotype Meaning References

Hexb-/- Decreased macrophage infiltration; decreased microglial- Pathogenesis of SD: increase MIP-1α inducing (Wu and MIP1α-/- associated pathology and neuronal apoptosis; improved neurologic monocyte infiltration into the CNS, expand the Proia 2004) status; longer lifespan (up to 175 days), maintenance of body activated macrophage microglial population, and weight until 19 wks; improved righting reflex trigger apoptosis of neurons, resulting in a rapid neurodegenerative course.

Hexb-/- No change in storage level; symptoms improved; lifespan Production of autoantibodies plays an important role (Yamaguchi, FcRγ-/- extended; number of apoptotic cells decreased; reduction in in the pathogenesis of neuropathy in SD et al. 2004) degeneration of Purkinje cells, decreased levels of anti-GA2 antibody-ganglioside complexes are important for the antibodies induction of microglial activation that is mediated via FcRγ in SD mice

Table 6 : Double knock-out animals presenting different phenotypes are a powerful tool for better comprehension of Sandhoff disease neuropathology

90 Inducible murine model

The possibility to obtain genetic models allowing manipulation of the gene of interest over time is very helpful to understand the pathophysiological sequelae of the gene deficiency and the detailed disease development. In this idea, the generation of two inducible mouse models of Sandhoff disease have recently been reported (Sargeant, et al. 2012). Thanks to the use of autoregulatory tet-based constructs, the reversible expression of β-hexosaminidase directed by two promoters, mouse Hexb and human Synapsin 1, was possible. The models displayed near-total gene silencing in the presence of doxycycline: administration of the agent induced Sandhoff disease with all its stereotypic features. Silencing transgenic Hexb expression in five-week-old mice induced pathological signs and progression of Sandhoff disease, with tremor, bradykinesia, and hind-limb paralysis. Similarly to classical knock-out model, neurodegenerative manifestations progressed rapidly, indicating that the pathogenesis and progression of GM2 gangliosidosis is not influenced by developmental events in the maturing nervous system. In the absence of doxycycline, both the Hex and Syn inducible cassettes rescued the mouse from acute Sandhoff disease, although expression of transgenic β- hexosaminidase throughout the central nervous system caused incomplete effect and residual neurodegenerative disease became apparent beyond six months of age (Sargeant, et al. 2012).

Other models

Other naturally occurring animal models of GM2-gangliosidoses were reported in several species. Canine and feline models could potentially provide an opportunity to study novel therapeutic approaches for GM2-related diseases.

Feline model

Feline GM2 gangliosidosis variant 0 has been described in shorthaired domestic cats (Baker, et al. 1979; Cork, et al. 1977) and in Korat cats (Muldoon, et al. 1994; Neuwelt, et al. 1985). The GM2 model described by Baker and coll. is an authentic analog of human Sandhoff disease and it was well characterized, except for its molecular pathology (Baek, et al. 2009). Sequence analysis determined that the causative mutation in this domestic shorthair SD cat resulted from a 25-base-pair inversion at the 3’ end of the Hexb gene (Martin, et al. 2004). Affected cats have <3% normal hexosaminidase activity in cerebral cortex and the disease

91 progression is stereotyped and is primarily marked by neuromuscular dysfunction. Disease begins at about 8 weeks with a slight head tremor and the animal progressively develops total paralysis. Mid-disease is reached at about 12 weeks, when the animal has an unstable gait and falls occasionally and by 20 weeks, the animal can no longer walk or sit upright. Moreover, contrarily to mouse model, both SD cats and human patients succumb to the disease prior to reproduction. Total brain ganglioside distribution was analysed at similar time-points in disease progression in Sandhoff mouse, cat, and human. It has been shown that GM2 accumulation in SD cat was intermediate between SD mouse and SD patient with a feline sialidase activity closer to the human than to the mouse (Baek, et al. 2009). The myelin-enriched lipids are significantly reduced in the SD cat compared to the normal cat similarly to GM2 accumulation. Cerebroside and sulfatide reductions in the SD cat were intermediate to that observed in SD mouse and human (Baek, et al. 2009). The Korat cat provides a second accessible animal model for SD. Affected offspring of Korat cats show clinical symptoms by 4 weeks of age. They demonstrate cytoplasmic storage vacuoles containing stacked lamellar inclusions typical of neuronal lipidoses, and lysosomal hypertrophy in neurons, hepatocytes, macrophages, and bone marrow. Furthermore, this animal model demonstrates hepatomegaly as in the human form of the disease. From a molecular point of view, the disease phenotype does not result from a lack of mRNA production and the disease-related defect did not cause abnormally sized mRNA. The single base pair deletion in exon 1 of the HEXB cDNA causes a frameshift of one ORF and an early chain termination with a stop codon and absence of active protein production (Muldoon, et al. 1994).

Canine Model

No specific Sandhoff disease canine model of gangliosidosis has been described. Japanese spaniels (Japanese Chin dogs) affected by the disease are considered similar to human AB variant caused by a deficiency of GM2-activator protein and the biochemical basis in these dogs was due to an attenuation in the stimulatory activity of the GM2 activator (Ishikawa, et al. 1987; Sanders, et al. 2013). The biochemical features of another canine case, German shorthair pointer, suggest the possibility of a B1 variant that is allelic with the B variant form (Tay-Sachs disease) (Singer and Cork 1989). A case of a golden retriever dog was also described (Yamato, et al. 2002) showing a set of clinical and biochemical features indicating GM2-gangliosidosis caused by a deficiency of hexosaminidase activity and being similar to human form of the disease.

2.2 Adeno-Associated Virus (AAV): vector for CNS gene transfer

AAV vectors were the most efficient for a gene transfer in GM2 gangliosidoses and our team has therefore decided to test them for a novel gene transfer approach in the Sandhoff mouse model. Therefore, only adeno-associated virus will be subsequently described in details.

Natural AAVs

Adeno-associated virus (AAV) is a member of the genus Dependovirus, which lies within the Parvoviridae family. The virion shell has a diameter of approximately 25 nm and it encapsidates a single-stranded DNA genome of 4.7 kb. The AAV genome has two large open reading frames (ORFs) flanked by two palindromic sequences called inverted terminal repeats (ITR) (Rose, et al. 1969). It folds upon itself in a hairpin structure and after uncoating in the host cell, it primes the synthesis of a complementary strand by the cellular DNA polymerase (Berns and Adler 1972; Samulski, et al. 1987). Those cis-acting elements are required not only for genome replication, but also for packaging. The ORFs code for 2 different types of products: replication (rep) and capsid (cap) polypeptides (Figure 19). The left ORF encodes four replication proteins responsible for site-specific integration, nicking, and helicase activity, as well as regulation of promoters within the AAV genome. The right ORF encodes the viral structure proteins, VP1, VP2, and VP3 assembled into icosahedral protein shells composed of almost 60 capsid subunits. The separate plus or minus polarity strands are packaged with equal frequency, none with the infectious abilities.

Figure 19 : AAV genome

The rep gene, through the use of two promoters and alternative splicing, encodes four regulatory proteins: Rep78, Rep68, Rep52 and Rep42. Rep proteins are involved in AAV genome replication. The

93 cap gene, through alternative splicing and initiation of translation, gives rise to three capsid proteins, VP1, VP2 and VP3, which assemble into a near-spherical protein shell of 60 subunits. From (Russell and Kay 1999).

For an efficient infection, AAV requires an helper virus (usually adenovirus or herpes simplex), but treatments of AAV-infected cells with UV irradiation or hydroxyurea (HU) are also used to allow replication although limited (Rose and Koczot 1972; Yakobson, et al. 1989; Yakobson, et al. 1987; Yalkinoglu, et al. 1988). In the absence of the helper virus, AAV establishes a latent infection in the host cell, either by rare site-specific integration in the host genome (chromosome 19) or, in most of the cases, it persists in an episomal form (Penaud- Budloo, et al. 2008; Wu, et al. 2006b). Expression of viral genome requires the formation of duplex DNA and it appears to be lost within 5–13 weeks in dividing cells if the viral DNA is not converted in its double form (Miao, et al. 1998).

Tropism and cell entry

The final transduction efficiency and the kinetics of transgene expression vary significantly among different serotypes. The serotype specificity and affinity to particular organ and tissue or even cell type is known as tropism and it is based on viral capsid recognition of specific viral receptors expressed on the different cell types. The AAVs cellular recognition is initiated by an interaction of the capsid with cell surface glycosaminoglycan receptors and followed by secondary interactions of the viral capsid with co-receptors dictating the intracellular trafficking pathway and fate of the virus. Those first stages of the infectious pathway are crucial and determining for AAVs specificity and can therefore be influenced by the choice of AAV serotype or hybrid vector. AAV2, has been described to interact with heparan sulfate proteoglycans for cell binding and transduction (Summerford and Samulski 1998) and subsequently with human fibroblast growth factor receptor 1 (FGFR1) (Qing, et al. 1999), hepatocyte growth factor receptor (Kashiwakura, et al. 2005), and integrins aVβ5/a5β1 (Summerford, et al. 1999). The closely related strains AAV1 and AAV6 use α2,3 and α2,6 sialic acids which are present on N-linked glycoproteins as primary receptors for efficient viral infection (Rabinowitz, et al. 2002; Wu, et al. 2006c). Further, AAV6 sharing ~85% homology with the AAV2 capsid sequence, has been shown to bind heparan, implying a potential dual mechanism of interaction with cell surface (Blankinship, et al. 2004; Halbert, et al. 2001; Wu, et al. 2006a). The ability to bind heparan is conserved in AAV3, (Handa, et al. 2000; Rabinowitz, et al. 2002) and additionally this AAV utilizes human hepatocyte growth factor receptor (hHGFR) as a cellular co-receptor for viral entry (Cheng, et al. 2012). The AAV serotypes 4 and 5 (Kaludov, et al. 2001; Walters, et al.

94 2001) as well as bovine AAV (Schmidt and Chiorini 2006) all display different tropism with respect to AAV2, and use sialic acid for cell surface binding and entry. In addition, the platelet- derived growth factor receptor has been identified as a coreceptor for AAV5 (Di Pasquale, et al. 2003). In the same way, the laminin receptor (LamR) has been described as a receptor used for functional transduction of AAV8 and AAV9 (Akache, et al. 2006). Tissue tropism and main receptors of different AAV are presented in Table 7. The knowledge about internalization and specific interactions with cell receptors was used for the design of recombinant AAVs in order to increase their entry efficiency, even if this process of high complexity still remains to be fully determined. Recombinant AAVs display widespread and robust transduction following systemic administration in animal models, but they show low infectivity in cell culture (Gao, et al. 2004; Zincarelli, et al. 2008). This limitation was recently described on the example of AAV9 (Shen, et al. 2011). The low infectivity was explained in part the nature of interaction between the vector and the nonsialylated cell surface glycans. Sialic acid appears to mask cell surface glycans that selectively facilitate AAV9 infection in vivo. In cell culture conditions, the lack of natural agents such as sialyltransferases lowers the concentration of available N-glycans and it therefore limits the binding of AAV9 to its principal receptor (Shen, et al. 2011). Moreover, it has been shown that the enzymatic removal of sialic acid residues, using desialylating agents like glycosidase from V. cholera or sialidase, exposing asialo N-glycans on the cell surface, results in a higher AAV9 in vitro transduction regardless of the cell type with no effect on other serotypes (Shen, et al. 2011). Further, the lack of correlation in in vitro-in vivo transduction assay could be additionally due to potential interactions of AAVs with blood components or co-receptors, such as integrins (Baker, et al. 2007) (Nemerow, et al. 2009) which are not present in cell culture, but are involved in animal models.

Serotype Receptor Coreceptor Tissue Reference

AAV-1 N-linked sialic acid Muscles, heart, (Wu, et al. 2006b) liver AAV-2 HSPG hFGFR1 Muscles, liver, (Summerford, et al. 1999; 37/67 kDa laminin integrins joints, CNS Summerford and Samulski receptor aVh5/a5h1 1998) (Akache, et al. 2006). AAV-3 HSPG hHGFR Liver cancer (Cheng, et al. 2012; Handa, et cells, al. 2000) haematopoietic cells AAV-4 O-linked sialic acid Retina, CNS (Kaludov, et al. 2001) AAV-5 N-linked sialic acid PDGFR Retina, CNS, (Di Pasquale, et al. 2003; liver Walters, et al. 2001) AAV-6 N-linked sialic acid Muscle, heart, (Wu, et al. 2006b)

95 liver AAV-8 37/67 kDa laminin Muscles (Akache, et al. 2006) receptor

AAV-9 nonsialylated cell CNS, heart, (Akache, et al. 2006; Shen, et al. surface glycans muscles 2011) 37/67 kDa laminin receptor

Table 7: Receptors and co-receptors of AAVs

Origin of known AAVs and hunt for new serotypes

The first AAVs, AAV serotypes 1 to 6 were isolated as contaminants in laboratory adenovirus stocks, with the exception of AAV5, which was isolated from human genital condylomatous lesions (Bantel-Schaal and zur Hausen 1984). Among all serotypes, the AAV2 has been most extensively investigated for the biology of AAV and explored as a gene delivery vector (Inagaki, et al. 2006) (Erles, et al. 1999). In contrast, AAV4 appears to have originated probably in monkeys and AAV6 is thought to be a hybrid recombinant between AAV1 and AAV2, since the left ITR and p5 promoter regions are virtually identical to those of AAV2, while the rest of the genome is nearly identical to that of AAV1 (Erles, et al. 1999). Recently isolated AAV10 and AAV11 come from cynomolgus monkeys and phylogenetic analysis showed that AAV10 and AAV11 ressembled AAV8 and AAV4, respectively. Moreover, the lack of cross-reactivity between mouse antisera against AAV2, AAV10 and AAV11 capsids suggests that AAV10 and 11 can potentially be used for gene transfer in individuals with high antibody titers against AAV2. In addition to primates, AAV genomes have also been isolated from other species such as horse, cow, chicken, snake, lizard, goat, but only bovine, avian, and caprine AAV have been used as vectors in gene transfer studies (Bossis and Chiorini 2003; Schmidt, et al. 2004). The discovery of novel AAVs serotypes is based on a PCR strategy called « signature PCR » that spans a short variable region of capsid gene and it is used to screen for new AAV isolates. Additional rounds of PCR are next carried out to isolate full-length Rep or Cap sequences. Newly isolated AAV serotypes and variants, along with the other existing AAV serotypes, have been subdivided into six « clades » or several « clones» based on their genetic relatedness (Figure 20) (Gao, et al. 2004).

Figure 20 : Simplified clade dendrogram of AAV species representing neighbour-joining phylogenies of the VP1 protein sequence of primate AAVs

Clade C was identified and positively determined to originate through the recombination of known clades. The AAV2-AAV3 hybrid clade originated after one recombination event, and its unrooted neighbour-joining phylogeny is shown. hu, human; rh, rhesus macaque; cy, cynomolgus macaque; bb, baboon; pi, pigtailed macaque; ch, chimpanzee. From (Gao, et al. 2004).

Recombinant AAVs

The interest for AAV family has been stimulated because of their potential use as gene transfer vectors (Kotin 1994). Recent studies report AAVs in vivo gene transfer efficiencies, including transduction of whole tissues like heart, muscles or liver (Cunningham, et al. 2008; Gregorevic, et al. 2004; Wang, et al. 2005; Yue, et al. 2008). Recombinant AAV (rAAV) are produced from natural AAV serotypes by removing cap and rep viral genes and replacing them by therapeutic protein genes. rAAV delivery vectors also package ssDNA of plus or minus polarity, and rely on cellular replication factors for synthesis of the complementary strand (McCarty, et al. 2001). A number of AAV serotypes and over 100 AAV variants have been isolated from adenovirus stocks or from human/nonhuman primate tissues giving alternative solutions for gene transfer use. Thanks to their physiological differences, they help to lower the vector load needed for efficient transduction or to minimise the risk of neutralizing immune response (due to natural AAV infection) resulting in no transgene expression. Moreover, AAV serotypes and variants can serve as templates for the design of tissue (or even organ) specific capsid constructs that will serve to expand the characteristics of the existing AAV vectors.

97 AAV vectors engineering

The creation of new forms of AAV vectors makes possible the delivery process in some conditions not available to naturally occurring AAVs. A number of modifications can be done in order to engineer custom-designed adeno-associated virus-derived vectors.

Mosaic AAVs

Mosaic virions are based on the association of capsid subunits from different serotypes with the purpose of combining selective features from many sources and synergically enhance the transgene expression. One example is the use of a mixture of AAV1 and 2 helper constructs, in order to generate mosaic viruses having AAV1 capacity to transduce muscle combined to AAV2 liver tropism and heparin-binding property (Hauck, et al. 2003). This type of modification can also lead to the acquisition of novel properties. AAV1 and AAV2 do not transduce C2C12 (mouse myoblast) cells efficiently in culture, but the mosaic AAV1/2 virions, produced by transfection of AAV1 and 2 helper constructs in specific ratio, exhibit significantly increased transduction in those cells possibly due to altered intracellular trafficking of mosaic AAV1/2 virions in muscle cells (Rabinowitz, et al. 2004).

Chimeric AAVs

Creation of chimeric virions is based on modifications of domain or particular amino acid in the capsid composition by swapping between different AAVs in order to transfer specific elements such as surface loops or specific residues from one serotype to another. This technique, namely the domain-swapping strategy, also gives a good insight in the structural composition of an AAV vector. It was used to identify that the 350–430 region (AAV1 VP1 numbering) is critical for AAV1 muscle tropism (Hauck and Xiao 2003).

Combinatorial AAV vector libraries

DNA shuffling and error-prone PCR are two library-based approaches for directed AAVs evolution, which helps to obtain diversity by recombination and combination of mutations from individual genes. Libraries of hybrid genes can be generated by random fragmentation of a pool of related genes, followed by reassembly of the fragments in a self-

98 priming polymerase reaction (Crameri, et al. 1998). One example of error-prone PCR and DNA-shuffling strategy is AAV2 variations induced by random mutations in capsid gene in order to select variants that can escape neutralizing antibodies (Maheshri, et al. 2006; Perabo, et al. 2006). Moreover, DNA shuffling of AAV capsid genes has been used for a number of serotypes and directed evolution was conducted to identify a novel chimeric serotype able to exhibit increased efficacy for melanoma cell transduction (Li, et al. 2008). More recently, combining AAV capsid DNA shuffling with directed evolution was described to have a great potential for CNS application (Gray, et al. 2010).

CNS-directed transgene delivery

AAV vectors are able to successfully manipulate CNS function using a wide variety of approaches, including expression of foreign genes, endogenous genes, antisense RNA and iRNA. The transduction efficacy and the kinetics of transgene expression vary among different serotypes due to differences at the capsid level as well as in cellular uptake and intracellular trafficking in the different tissues (Thomas, et al. 2004; Wu, et al. 2006b). As mentioned previously, recombinant AAVs have been extensively investigated as gene transfer vehicles, as they transduce both dividing and non-dividing cells in the CNS resulting in long-term transgene expression while persisting mainly in an episomal form (Penaud-Budloo, et al. 2008; Wu, et al. 2006b). Moreover, they are not known to cause human disease, an advantage over herpes-simplex virus, which has similar efficacy in transducing neurons. AAV serotype 2 vector demonstrated effective gene transfer and long-term, non-toxic gene expression in the CNS, primarily in neurons (Kaplitt et al., 1994; McCown et al., 1996) and recombinant AAV2 vectors made possible phase I/II clinical trials for neurodegenerative disorders such as Canavan disease (Janson et al., 2002), Parkinson disease (Kaplitt et al., 2007; Marks et al., 2010) or Alzheimer disease (Bakay et al., 2007). Compared with AAV2, the more recently characterized serotypes 5, 6, 7, 8 and 9 show better efficacy, stability of transgene expression and tissue tropism and they may be more relevant for CNS disease (Mandel, et al. 2006; Wu, et al. 2006b). AAV9 was documented to be the most efficient vector for transduction of spinal cord cells including motoneurons (up to 28% compared to failed transduction with previous serotypes) in both neonate and adult mice, and after single intravenous delivery, the transgene expression was stable in the CNS and non nervous tissues for at least 5 months (duration of the study).

99 With the discovery of different AAV serotypes, as well as the obtention of novel chimeric recombinant serotypes, the potential of in vivo transduction have been expanded substantially. Recently, the directed evolution of AAVs permitted to develop new clones showing transduction patterns combining the ability of AAV8 to gain CNS access through seizure- compromised BBB with the peripheral organ detargeting of AAV1 (Gray, et al. 2010). Additionally, several elements can significantly influence the profile and longevity of neuronal transduction, distinct from the tropism inherent to AAV vectors. The level of transgene expression and cell-specific expression can be directed by cis-acting elements within the vector genome or by the innate tropism of the virus itself. The choice of 5' untranslated region (UTR), 3' UTR, enhancer, promoter and polyadenylation signal can affect cell specificity and modulate the therapeutic outcome.

Promoter

The promoter choice is important for the transgene expression pattern in CNS (Tenenbaum, et al. 2004). Firstly, it can influence the time of the expression in some parts of the brain. It has been described that while overall long-term expression (up to 1 year) is possible from the CMV promoter in AAV2-mediated transduction of the CNS (Klein, et al. 1999; Tenenbaum, et al. 2000), a reduction of the transgene expression is visible over time in different brain regions (McCown, et al. 1996) (Wang, et al. 2003). In hippocampus and inferior colliculus, a strong transgene expression was noted one week after administration, but at 3 months post-injection, a drastic decrease in the number of transduced neurons was visible in the hippocampus. This loss of expression in hippocampal part of the brain was suggested to be due to the CMV promoter extinction by a methylation process (Klein, et al. 1998). Similar results were observed when the endogenous GABAR-α 4 promoter was used in the nervous tissue (Klein et al., 1998; McCown et al., 1996; Raol et al., 2006). In contrast, cellular promoters (not subjected to methylation) such as the neuron-specific enolase (NSE) promoter used in recombinant AAV2 to deliver GFP marker to rat hippocampus or substantia nigra or hybrid promoters such as the chicken β-actin/CMV promoter for GFP expression in hippocampus, caused sustained transgene expression (Klein, et al. 2002; Xu, et al. 2001). Moreover, for the chicken β-actin/CMV (CBA) hybrid promoter, transgene expression was shown to be stable until at least 25 months post-injection (Klein, et al. 2002). Similarly, scAAV9/GFP vector expression has been analysed in mouse motoneurons (MNs) and dorsal root ganglia (DRG). Three distinct promoters, CBA, CMV, and CBh or mini-CBA promoter, were compared 10 weeks post-injection. Although the level of expression was sustained for

100 CBh vectors, CBA and CMV showed significantly lower marker transgene levels in cells of interest (Gray, et al. 2011a). Secondly, the choice of promoter can also potentially restrain the expression to specific tissue or cell-type. For example, the use of the MBP promoter allows rAAV2-mediated transduction to be specifically targeted to oligodendrocytes (Chen, et al. 1998). The NSE and MeP, the recent mini-version of the murine MeCP2 promoter, were known to have primarily a neuronal expression (Adachi, et al. 2005; Klein, et al. 2002; Rastegar, et al. 2009). Although the promoter choice is restricting the transgene expression, this system can be leaky due to fundamental enhancer elements in the rAAV construction itself and therefore in some cases, the expression has to be additionally controlled. This can be achieved by the Tet-based system, where a tet-off expression cassette confers rapid and complete (or near-complete) shut-off of AAV-based transgene expression in the presence of a tetracycline derivative, guaranteeing rapid transgene on-off change in the presence or absence of the drug. Finally, the promoter option will be driven by the available free cloning space, especially in double stranded AAVs where the capacity of packaging is limited to about 2.2 kb of foreign DNA, compared to 4.5 kb for ssAAV less performing vectors.

Enhancers

Regardless of the promoter, transduction efficiency can be increased by the use of posttranscriptional regulatory elements, such as the woodchuck hepatitis virus element posttranscriptional regulator (WPRE). This element has been shown to increase the steady- state level of messenger RNA and the efficiency of translation, resulting in increased levels of transgene expression (Loeb, et al. 1999). When incorporated into the untranslated 3’ region of a vector construct, WPRE increases the transgene expression. In the context of AAVs, the inclusion of a WPRE element in a ssAAV2/9 vector resulted in a higher gene expression level into the brain. However, WPRE could not be included in scAAV2/9 vectors, as they have a reduced cloning capacity due to the inclusion of the complementary strand in the vector (Rahim, et al. 2011). Another example of the role of an enhancer element is a comparative study performed after rAAV2 administration in rat brain. The expression of vector containing either CMV or PDGF-β promoter in conjunction with WPRE in the substantia nigra was tested. They resulted in more efficient and widespread transduction of WPRE-bearing construct compared to PDGF-β or CMV promoter alone (Paterna, et al. 2000). Accordingly, others documented that WPRE addition increased transgene expression by 13-fold in the striatum and by 35-fold in the hippocampus (Xu, et al. 2001). What is more, AAV-encapsidated viral genomes possess

101 terminal repeats (TR), which contain enhancer/promoter elements (Haberman et al., 2000). Thus, transgene expression can occur independently of promoter activity as shown with on AAV2 only containing the terminal repeats and a GFP transgene and still having a low GFP expression in vivo (Haberman et al., 2000).

Capsid modifications

Viral capsid engineering can increase vector potency and cell specificity and reduce adverse effects. For that, different types of AAVs optimization strategies were established like the transcapsidation or the creation of chimeric AAVs by adding a new peptide at N- or C- terminal part of VP proteins. Peptide insertions can give novel features to AAV capsids and, by using a phage display library to generate novel peptides, modified AAV capsids can be developed in order to specifically target the cerebral vasculature after systemic administration as performed for AAV2 (Chen, et al. 2009). As mentioned before, AAV9 has a great potential as a vector for CNS transduction, but this might be limited by its high liver tropism. This tendency can be reduced by specific capsid modifications. Introduction of point mutations into the capsid sequence (Pulicherla, et al. 2011) or insertion of micro-RNA target sequences responding to microRNAs highly expressed in the liver by comparison to CNS, can reduce toxicity in non target areas (Bennett, et al. 2012).

Self-complementary AAVs

Other strategies can be used to increase the efficacy of AAVs transduction by modulating the limiting elements of the infection cycle like the synthesis of the double strained genome. Indeed, to escape the limit of the de novo synthesis of DNA complementary strand of AAV, double strand genome encapsidation has been proposed (McCarty, Monahan et al. 2001; McCarty 2008). Self-complementary AAVs (scAAVs) are dimeric, and spontaneously reanneal, reducing the requirement for host-cell DNA synthesis (McCarty, et al. 2001). The superiority of scAAVs results from the ability of the sc genome to bypass the step of second strand DNA synthesis mediated by the host cell, achieving greater saturation of transduced cells within a limited area (Wang, et al. 2005). scAAV vectors are 10–100 fold more efficient than traditional single-stranded (ss) AAVs, but they have a limited place for genes that could potentially be delivered to the brain by an intravenous approach. The second strand of DNA reduces the cloning capacity to 2500 bp (the half of the normal size of AAV genome). The deletion of trs site (terminal resolution site) within 3’-ITR increases considerably the number of sc molecules that can be encapsidated during the recombinant AAV production.

102

scAAV Parental

Newly synthesized

Figure 21: Formation of dimeric inverted repeat genomes (scAAV)

1- The viral genome enters the host cell and the host polymerase uses the 3’-ITR as a primer for the synthesis of complementary strand of AAV DNA. The 5’-ITR of the parental strand is denaturated and replicated. 2- The ITRs form the double hairpin. 3- If the trs sequence is deleted, rep endonuclease can not clive the 3’-ITR. 4- The polymerase continue to replicate new strand, parent strand and mutated strand. 5- At the end of second replication, complementary ITRs associate in the hairpin structure. The Rep endonuclease clives the strand at the level of trs sequence present on the non mutated ITR and separates the two dimeric strands. Before the separation, the polymerase replicates the 5’-ITR of the parental strand. 6- The two dimeric strands can restart the replication cycle or 7- they can then be packaged into the AAV virion (scAAV) Adapted from (McCarty, et al. 2001).

When the single-stranded virion DNA enters the host-cell nucleus, the 3'-inverted terminal repeat (ITR) acts as a primer for host DNA polymerase (Figure 21). First, the 3'-ITR primer is elongated, the 5'-ITR is replicated and the duplex ITR is refolded into a double-hairpin configuration by host or viral DNA helicase. This structure can serve as a new primer for DNA synthesis. While the 3'-ITR is elongated and the complementary strand displaced, AAV Rep protein recognizes and binds to the ITR at the downstream end. During the synthesis process, the Rep endonuclease binds the trs sequence of the 3’-ITR of the parental strand and clives the strand. If the binding site is deleted, the second strand cannot be synthesized leading to the

103 formation of DNA molecule bearing two ITRs, the transgene cassette and the mutated ITR separating the complementary sequences (Figure 20). Replication continues through the ITR and the displaced strand, to generate a dimeric scDNA template, which can initiate a new round of DNA synthesis or can be packaged into the AAV virion (McCarty, et al. 2001). The scAAV is schematically presented in Figure 22.

Figure 22 : A schematic representation of the self-complimentary AAV (scAAV) genome

The Cap and Rep genes are replaced by the transgene. The structure is composed of three hairpins. From (Ellis, et al. 2013).

The effectiveness of each form was compared for AAV9. Self-complementary AAV9 vectors utilize a mutant AAV2 inverted terminal repeat on one side of the transgene to package two complementary copies of the transgene linked in cis to the mutant inverted terminal repeat and flanked by wild-type AAV2 inverted terminal repeats (McCarty, et al. 2003; McCarty, et al. 2001). While the systemic injection of single-stranded (ss) AAV9 vector to the inner layer of the retina in neonatal mice, failed to deliver the transgene in adult mice (Bostick, et al. 2007), the scAAV9 successfully mediated the retinal gene therapy in murine model, illustrating the superiority of the self complementary form over the single-stranded one (Bemelmans, et al. 2013). In fact, in single-stranded forms, lower capacity of transduction might reflect the inability to infect cells to form double stranded genome from conventional rAAV or the loss or degradation of the single form DNA before the formation of the duplex.

2.3 Ways of administration for an efficient CNS treatment

This part will be focused on potential routes of vector delivery for a widespread distribution of the transgene into the CNS. Three main strategies showing promising results in animal models will be presented (Figure 23): intracranial injections into the brain parenchyma, injection into the cerebrospinal fluid, vector entry into the brain via intravenous (IV) administration. As AAV vectors are the best suited for such approaches, the results obtained with these vectors will be presented. Other possible delivery systems, such as temporary osmotic opening of the blood–brain barrier, will also be mentioned.

104

a b c

Figure 23 : Vector delivery strategies for gene therapy of neurogenetic diseases a- Direct administration into the brain parenchyma b- Injections into the cerebrospinal fluid (ventricles, cisterna magna or spinal cord) c- Vector entry into the brain via intravenous administration of adeno-associated virus i.e. AAV9. Adapted from (Simonato, et al. 2013).

Intracranial administration

Intracranial administration of vectors was used in many disease models. Injection of an AAV2 vector expressing beta glucuronidase (GUSB) into the brain parenchyma of adult MPSVII mice resulted in levels of expression sufficient to reduce lysosomal storage throughout the brain. It has also been shown that a single intrastriatal injection of a viral vector encoding alpha-L-iduronidase can provide enzyme and reduce storage throughout the brain of diseased mouse model of MPSI (Desmaris, et al. 2004). Clinical trials based on direct injection of AAV2 vector into the brain of patients affected by Canavan disease (Leone, Janson et al. 2000) or Batten disease (Leone, et al. 2000; Worgall, et al. 2008) were initiated. Other neurodegenerative disorders like Parkinson disease (LeWitt, et al. 2011), Alzheimer disease (Nagahara, et al. 2009) or Huntington disease (McBride, et al. 2011) were also treated by AAV-mediated intracranial gene therapy. Additionally, a number of methods have been proposed that may considerably improve this way of AAV delivery, including convection-enhanced delivery (CED). This technique specifically established for CNS delivery of large molecules in order to pass BBB, such as anti- tumour drugs (Bobo, et al. 1994). The CED principle is based on constant pressure gradient, leading to bulk flow of fluid through the interstitium. This method has already been tested in order to deliver AAV into the brain (Bankiewicz, et al. 2000)). The study showed that compared to relatively minimal transduction of the striatum by a simple injection method

105 (constant delivery flow rate), CED delivery of AAV2 distributed the vector more successfully to the whole monkey striatum. Nevertheless, direct intracranial injection of vectors has important limitations such as invasiveness of the procedure, small volume of vector that can be delivered and possible need for multiple sites of injection (Bosch, et al. 2000a; Bosch, et al. 2000b), especially in large animals (Vite, et al. 2005).

Intrathecal administration

An alternative to intracranial injection is intrathecal administration of vector into the cerebrospinal fluid. It has been described that a single administration can cause widespread, long-lasting expression of the missing enzyme within the brain, resulting in extensive reduction of storage material (Elliger, et al. 1999; Elliger, et al. 2002). Recombinant adeno-associated virus vectors carrying an alpha-L-iduronidase (IDUA) sequence were administered to MPSI mice via injection into the cerebrospinal fluid (Watson, et al. 2006). In contrast to intravenous administration, this route permitted to generate widespread IDUA activity into the brain, with the highest activities in cerebellum and olfactory bulbs (Watson, et al. 2006). In neonates, the pattern of intracerebroventricular-based transduction of different AAV pseudotypes has marked similarity with intracranial delivery. AAV8 and AAV1 are the most efficient vectors for neuronal transduction via this route (Broekman, et al. 2006). AAV5 is an exception, as it efficiently transduces neurons via intracerebral injection, but has limited neuronal transduction capacity through icv delivery (Passini, et al. 2003; Watson, et al. 2005). Contrarily to its successful therapeutic delivery in neonates (Passini, et al. 2003) ICV delivery of AAV5 to adult animals mostly results in ependymal cell transduction (Davidson, et al. 2000) thus limiting the applicability of this strategy. Intrathecal delivery has also been described to have good results in non human primates where AAV9 and rationally engineered capsid AAV2/5 were able to achieve broad transduction throughout the brain parenchyma and spinal cord following a single injection into the CSF (via cisterna magna or lumbar cistern) (Gray, et al. 2013).

Intravenous delivery

AAV vectors administered intravenously are generally not able to treat CNS lesions, except when the injection is performed in the neonatal period during which the BBB is probably not mature (Daly, et al. 2001). However, as patients are usually not diagnosed so early,

106 but at a later symptomatic state, this situation has no real clinical pertinence. The discovery of self-complementary (sc) AAV9 has raised novel possibilities for gene therapy of neurological disorders (Foust, et al. 2008). Indeed, AAV can infect CNS cells through intravenous injection (Duque, et al. 2009; Foust, et al. 2009; Foust, et al. 2010; Gray, et al. 2011b). With the viral vector dose used (reaching 1.0E+12 vg/kg), organs such as liver and heart can also be significantly infected. By using this way of administration, non-CNS tissue can be unintentionally targeted (Duque, et al. 2009). Peripheral off-target expression can be partially circumvented through the use of a tissue-specific microRNA target sites in the expression cassette (Xie, et al. 2011). These target sites serve as substrates for tissue-specific microRNAs, preventing translation in undesirable tissues such as liver. A different strategy entails the directed evolution of chimeric AAV capsids that target particular CNS cell populations, while potentially avoiding targeting to other tissues (Gray, et al. 2010).

Blood-brain barrier opening

The blood brain barrier is a selective physical barrier formed by microvascular endothelial cells, astrocytes and pericytes. It maintains the neural microenvironment by regulating the passage of molecules into and out of the brain, protecting it from microorganisms and toxins circulating in the blood. Brain microvascular endothelial cells have distinctive features, such as intercellular tight junctions, polarized expression of numerous transport systems and low rates of pinocytosis (Rubin and Staddon 1999; Ruffer, et al. 2004). One of the hallmarks of brain endothelium in mammals is its highly restricted and controlled permeability to plasmatic compounds and ions, reflected by a very high transendothelial electrical resistance (Abbott, et al. 2006; Petty and Lo 2002). Astrocytes and pericytes also help to maintain the barrier property of brain microvascular endothelial cells (Figure 24).

107

Figure 24 : The blood-brain barrier structure

Formed by capillary endothelial cells, surrounded by basal lamina and astrocytic perivascular endfeet, the BBB protects the brain from external factors thanks to complex tight junctions (belt-like region of adhesion between adjacent cells). Tight junctions regulate paracellular flux, and contribute to the maintenance of cell polarity by stopping molecules from diffusing into the cerebrum. The figure also shows pericytes, microglial cells and astrocytes providing the cellular link to the neurons. Adapted from (Abbott, Ronnback et al. 2006).

Temporary osmotic opening of the blood–brain barrier by using agents like mannitol can aid large molecules to passively enter the CNS, by transiently loosening the tight junctions between endothelial cells. When AAV2 was delivered intravenously following drug-induced disruption of the BBB, therapeutic gene transfer to mice with lysosomal storage disease led to a reduction in cognitive and motor deficits and to an increased survival time (Fu, et al. 2007). Furthermore, new techniques are being developed for BBB opening, for example by noninvasive, reversible, microbubble-facilitated focused ultrasound (FUS) (Huang, et al. 2012). This method facilitating local delivery of rAAV vectors into mice brain was used for the IV administration of an AAV2-GFP. When using a low concentration (1.0E+9 vg/kg), this vector resulted in the predominant transduction of astrocytes and only some neurons (Hsu, et al. 2013). AAV9 seems to cross the BBB by an active transport mechanism and mannitol coadministration in adult mice had only modest effects on its transduction efficacy (Gray, et al. 2011b).

108

Results

109

Gene transfer for the treatment of GM2 gangliosidoses

Strategic positioning of our project : what has already been done ?

The main aim of my project was to develop an efficient gene transfer for Sandhoff disease, which is a good candidate for such approach like other lysosomal diseases. Indeed, lysosomal enzymes are submitted to a secretion-reuptake phenomenon by the way of mannose- 6-phosphate receptor, suggesting that it will not be necessary to correct each cell of an organ, because surrounding or distant cells could uptake the enzyme produced by a corrected cell (cross-correction). Moreover, as previously discussed, it is likely that even a partial correction could be sufficient to avoid a clinical expression. Since several years, our group and others have already explored gene transfer methods for GM2 gangliosidoses, using either patient cell lines or the Hexb-/- murine model which nicely mimickes the human disease. By comparison, Hexa-/- mice do not show early neurological abnormalities. This is probably due to the fact that the mouse sialidase interferes in ganglioside catabolism and compensates the loss of hexosaminidase A activity (Phaneuf, et al. 1996; Sango, et al. 1995). Recent studies have confirmed that lysosomal sialidase/neuraminidase 4 (Neu4) is a functional component of ganglioside catabolism (Seyrantepe, et al. 2008). Although Neu4/Hexa double homozygotes showed a more severe disease outcome than mice with single mutation alone, the severity of symptoms was not equal to those observed in Hexb-/- deficient mice suggesting that other sialidases also may contribute to the bypass pathway in Hexa deficient animals (Seyrantepe, et al. 2010). Therefore, Sandhoff mice are useful tools not only for understanding the underlying pathology of GM2 gangliosidoses, but also for preclinically testing therapeutic strategies. A first generation adenovector (deleted for the E1A, E1B and E3 regions) containing the human HEXA cDNA was constructed and tested on fibroblasts from Tay-Sachs patients, allowing a correction of the hexosaminidase A activity, with a normal processing and targeting to lysosomes (Akli, et al. 1996). This AdHEXA vector was then used in vivo in the Tay-Sachs murine model. The adenovector encoding the a chain was injected intravenously, either alone or in association with an adenoviral vector permitting the synthesis of the β chain. The coadministration of both vectors leaded to a better restoration of Hex A activity in deficient animals, as well as a huge excretion in serum and a correction of peripheral organs (Guidotti, et al. 1999). A more direct way of administration was tested in the murine model of Sandhoff disease. The recombinant adenovirus containing the cDNA encoding the β chain of human

110 hexosaminidases was directly injected into the brain of Hexb-/- mice by stereotaxy, in conjunction with hyperosmotic concentrations of mannitol able to open the BBB. This strategy significantly increased the vector diffusion and its transduction efficiency in the brain parenchyma reducing the viral titer and potential toxicity of the vector (Bourgoin, et al. 2003). Lentiviral vectors were also tested in the Sandhoff mouse model. This vector has a high cloning capacity, an efficient integration and a long-term expression in dividing and post- mitotic cells and it permitted the design of double subunit-carrying constructions. Therefore, mono and bicistronic simian immunodeficiency virus (SIV) vectors containing the HEXA or/and HEXB cDNAs under the control of the CMV promoter, were obtained and tested in vitro on fibroblasts from Sandhoff patients. A massive restoration of Hex A and B activity was obtained on the synthetic substrates with the SIV.ASB bicistronic vector expressing both the α and β subunits separated by an IRES (internal ribosome entry site). The hexosaminidases activity measured on the natural substrate was around 20%, a level sufficient to restore the GM2 metabolism, as demonstrated by metabolic labelling experiments. Moreover, enzymes secreted by transduced Sandhoff fibroblasts were endocytosed by naive deficient cells, and were able to restore the GM2 metabolism showing the efficient cross-correction in the SD model, a critical step for the success of a gene transfer approach (Arfi, et al. 2005). The efficacy of the bicistronic vector was also tested on the cellular parameters described in the pathophysiology of Sandhoff disease. Hippocampal embryonic neurons were infected with the SIV.ASB vector. A restoration of the axonal growth was obtained, as well as a correction of Ca++ uptake via the SERCA (sarco/endoplasmic reticulum Ca++ATPase) pump and sensitivity to neuronal death induced by thapsigargin, concomitantly with the reduction of GM2 and GA2 accumulation. These results confirmed the ability of the vector to reverse the biochemical defect and its consequences at the cellular level (Arfi, et al. 2006). The same bicistronic lentiviral vector was also used to determine if transduced cerebral endothelium is able to produce hexosaminidases in the whole brain. This technique developed in our laboratory used an in vitro model of BBB, which is an immortalized human cerebral endothelial cell line called hCMEC/D3 exhibiting the main characteristics of the blood-brain barrier (Weksler, et al. 2005). Infection with the bicistronic lentiviral vector encoding both the α and β chain cDNAs was performed in culture plate inserts and β-hexosaminidase activities were measured in the transduced endothelial cells, but also in Sandhoff fibroblasts cocultured in the lower compartment. A 30% increase in β-hexosaminidase activities was observed in (non- deficient) transduced hCMEC/D3 cells permitting to generate a 70-90% restoration in cross- corrected deficient fibroblasts and nicely showing the ability of transduced endothelial cells to

111 synthesize and secrete hexosaminidases after transduction with a specific lentiviral vector (Batista, et al. 2010). Other techniques have also been used for gene transfer in Sandhoff disease such as intravenous plasmid-mediated gene injection with cationic liposomes (Yamaguchi, et al. 2003), but no passage was noted across the BBB. The most impressive results were obtained in 2006 by Cox et al. in 4 weeks-old Sandhoff mice. The animals were stereotaxically inoculated with recombinant adeno-associated viral (rAAV) serotype 2 vectors encoding complementing human β hexosaminidase α and β subunits (rAAV2/α and rAAV2/β) (Cachon-Gonzalez, et al. 2006). After the treatment, a widespread and sustained expression of hexosaminidase could be detected in the brain and spinal cord and a subsequently reduced pathological storage and inflammation were noted. The onset of neurological signs was markedly delayed and the pattern of disability attenuated. Survival was greatly prolonged over 1 year compared to 4.5 months for untreated Hexb-/- mice. Further work showed that single striatal injection of rAAV2/1 coding for Hex A and Hex B is effective to prevent lysosomal storage, neuroinflammation and neuronal loss in the Sandhoff model (Sargeant, et al. 2011). More recently, it has been shown that intracranial co-injection of recombinant rAAV2/1, expressing human β-hexosaminidase α (HEXA) and β (HEXB) subunits into 1 month-old Sandhoff mice can result in a 2 years lifespan and is able to prevent the disease throughout the brain and spinal cord. Localized gene transfer to the striatum or cerebellum resolved classical manifestations of the disease. Moreover, the abundant biosynthesis of β-hexosaminidase isozymes was documented to be distributed globally via axonal, perivascular, and cerebrospinal fluid (CSF) spaces, as well as via cross-correction, a process that could account for the sustained phenotypic rescue and long-term protein expression by transduced different brain parts (Cachon-Gonzalez, et al. 2012).

Choice of an scAAV9 vector for gene transfer in Sandhoff models

In Sandhoff disease, the crucial aim of gene therapy is to deliver the therapeutic transgene mainly into the brain. This cerebral correction can be accomplished by using a stereotaxic way of administration, which has already demonstrated its efficacy (Cachon- Gonzalez, et al. 2006). However, this strategy is invasive and moreover, it does not permit to correct other organs which are also affected in SD, such as liver. In our project, we have decided to use a systemic administration, as such an approach of low invasiveness seems to us more easily achievable in the perspective of a future clinical application. This strategy was conceivable with an AAV9, as this vector has recently

112 demonstrated particular capacities. Originally isolated by Wilson and coll., the AAV9 stands out as a virus enabling the transduction of rodent muscle, liver and lung about 100-fold more efficiently than AAV2. Moreover, it has the capacity to deliver a transgene into brain after intravenous administration with a high neuronal tropism (Gao, et al. 2004; Inagaki, et al. 2006). Although some AAVs (AAV6 or AAV8) were described to have a small capacity to cross endothelial barriers in after intravenous administration with a high neuronal tropism (Gao, et al. 2004; Inagaki, et al. 2006; Wang, et al. 2005) and to lead to transgene expression in the CNS after intravenous delivery (Foust, et al. 2008) (Towne, et al. 2008), the rate of expression of those vectors was too low for successful therapeutic outcome. The AAV9 has overcome this limitation showing significantly higher transduction rate in the CNS (Foust, et al. 2009). AAV9 is able to transduce twice as many neurons as astrocytes across the entire adult rodent nervous system and mannitol coadministration has only modest effects on transduction. This suggests that AAV9 is transported across the BBB by an active mechanism (Gray, et al. 2011b), possibly using specific receptors or coreceptors like N-terminal glucose or LamR (Akache, et al. 2006; Shen, et al. 2011). The proof-of-principle of the therapeutic efficacy of this method has been obtained in a mouse model of spinal muscular atrophy (SMA) model (Bemelmans, et al. 2013; Kolstad, et al. 2010) (Duque, et al. 2009; Foust, et al. 2009) (Dominguez, et al. 2011; Foust, et al. 2010; Valori, et al. 2010) and more recently, in mucopolysaccharidosis type IIIA (MPSIIIA) (Haurigot, et al. 2013). The experimental applications of AAV9 in different animal models are gathered in Table 8.

113 Species Moment and way of delivery Construct Outcome References

Mouse WT In utero Marker gene: CNS: brain, spinal cord, (Rahim, et al. 2011) single IV ssAAV2/9-CMV-GFP all layers of the retina or scAAV2/9-CMV-GFP predominantly neuronal transduction PNS: myenteric plexus and innervating nerves; no immune response

Neonates Marker gene: Lung: especially the alveolar cells and (Bostick, et al. 2007; Ghosh, single IV AAV9-RSV-AP vasculature et al. 2007) (facial or temporal vein) Some liver and smooth muscles transduction

striated muscles, heart, lung (Bostick, et al. 2007; inner layer of retina, Inagaki, et al. 2006) no aorta and smooth muscle transduction

Marker gene: extensive dorsal root ganglia transduction (Foust, et al. 2009) (Duque, scAAV9-CB-GFP spinal motor neurons, et al. 2009) transduction of brain neurons (neocortex, hippocampus, cerebellum)

Marker gene: transduction of cardiomyocytes (Pacak, et al. 2006) AAV9-GFP

Neonates Marker gene: Same results as neonatal IV (Bostick, et al. 2007) single intraarterial AAV9-GFP left ventricular cavity

Adult single IV cardiac and skeletal muscle lower (Pacak, et al. 2006) jugular vein expression at the same dose compared to neonates

114 Adult Marker gene: equal to neonates: striated muscles, heart (Bostick, et al. 2007) single IV AAV9-RSV-AP and lung transduction; aorta, liver and tail vein kidney-specific transduction, no smooth muscle transduction Marker gene: All organs, brain, (Zincarelli, et al. 2008) AAV2/9-CMV-luc Testes

Marker gene: CNS astrocytes -specific transduction (Foust, et al. 2009) scAAV9-CB-GFP

Mouse Pompe disease model Neonates Therapeutic vector: Improvement of shortened PR interval in (Pacak, et al. 2006) Gaa-/- single IV AAV2/9-CMV-hGaa ECG

SMA mouse model P2, P5 and P10 Therapeutic vector: improved lifespan; (Foust, et al. 2010) single IV scAAV9-SMN P2 - rescue motor function, facial vein neuromuscular physiology P5 - modest increase of survival P10 - no effect

Porcine model of heart failure Adult Therapeutic vector: cardiac tissue-restricted expression; (Pleger, et al. 2011) (myocardial infarction) single IV AAV9-S100A1 heart function improved, cardiac coronary vain contractile function rescued, markers of mitochondrial energy improved, no toxic effects

Cat LIX1 -/- Neonates Marker gene: 39 % of motoneurons (MNs) in cervical (Duque, et al. 2009) SMA model single IV scAAV9-GFP enlargement, 34% in the lumbar jugular vein segment, nerve fasciculi gracilis and cuneatus dorsal significantly transduced

Adult transduction efficiency lower than in the (Duque, et al. 2009) single IV neonates, up to 15% of MNs transduced jugular vein

115 Canine normal Beagle and Neonates Marker gene: AAV9- body-wide skeletal muscle transduction, (Yue, et al. 2008) Golden Retriever/Beagle cross single IV RSV-AP no immune suppression, normal growth; poor transduction of internal organs (heart) and smooth muscle

Neonates Marker gene: robust transduction at the site of (Yue, et al. 2008) single IM AAV9-RSV-AP injection cranial sartorius muscle

Adult Marker gene: No transduction, strong cellular immune (Yue, et al. 2008) single IM AAV9-RSV-AP response cranial sartorius muscle

NHP wild-type Neonates Marker gene: preference for cardiac tissue over skeletal (Pacak, et al. 2006) Rhesus macaque single IV AAV2/9-CMV-lacZ muscle, expression of transgene in heart Macaca Mulatta peripheral vessel

Juvenile ( 3-4 y) Marker gene: reduction in transduction of peripheral (Gray, et al. 2011b) without pre-existing neutralizing scAAV9/CBh-GFP organ and brain compared to mice antibodies (NAbs) mostly glial transduction single IV saphenous vein

Juvenile ( 3-4 y) Marker gene: No NAb: reduction in transduction of (Gray, et al. 2011b) with /without pre-existing NAbs scAAV9/CBh-GFP peripheral organ and brain compared to single intra-arterial mice, better than IV results carotid artery mostly glial transduction NAbs: very low transduction

NHP wild-type In utero Marker gene: neurons (67-97%), motoneurons (35- (Mattar, et al. 2013) Cynomolgus macaque single IV scAAV2/9-CMV-GFP 91%), oligodendrocytes (22-90%), lower Macaca Fascicularis intrahepatic vein rate of transduction in astrocytes, photoreceptors and neuronal cell bodies in the plexiform and ganglionic retinal layer

116

Neonates Marker gene: majority of targeted glial rather than (Foust, et al. 2010) single IV scAAV9-GFP neuronal robust expression in dorsal root ganglia and motorneurons along the entire neuraxis

Table 8: Results obtained by different gene transfer approaches using recombinant AAV9 vectors

117 In our study, we used a self-complementary form of AAV9 (scAAV9), as it was documented to be the most efficient vector for transduction of neurons (Foust, et al. 2009). Moreover, also the spinal cord motoneurons could be transduced after single intravenous delivery (up to 28% compared to failed transduction with previous serotypes in adult mice, but also possible in cays), and transgene expression was stable at long-term (Duque, et al. 2009).

Figure 25 : Advantages of the use of scAAV leading to immediate and efficient expression of the gene of interest

In ssAAV vectors, single-to-double stranded conversion of the DNA goes through the inter-molecular annealing or second strand synthesis in host cells. scAAV vector, with half the size of ssAAV genome, has a mutation in the terminal resolution site (TRS) to form a vector genome with wild-type ITRs at the both ends and mutated ITR at the center of symmetry therefore after uncoating in the target cell nucleus, this DNA structure can readily fold into transcriptionally active double-stranded form through intra-molecular annealing. This results in immediate and efficient expression on sc AAV form.

Although the scAAV9 has major advantages for our project focused on a neurological disorder, it has a strong limit concerning cloning capacity. Therefore, we choose the phosphoglycerate kinase (PGK) promoter, a strong small-sized promoter to drive transgene expression in a potentially ubiquitous manner (Figure 26).

118

Figure 26 : AAV9-Hexb vector coding for mouse Hexb gene under the PGK promoter control

The size of recombinant AAV was decreased to 2.5 kb compared to 5.2 kb in its natural, single strand form due to the complementary strand incorporation. This restrains the choice of promoter and limits the transgene size. Mouse Hexb gene (1.7 kb) fills the available cloning space almost completely. PGK: phosphoglycerate kinase, ITR: inverted terminal repeat.

119

Article 3

120

Note :

This version of the paper is the first one. It can be considered as a preliminary version, as it has still not been corrected by the different partners of the work. Therefore, it will be highly improved in the near future in order to submit it before the end of the year.

121 Intravenous administration of an AAV2/9-Hexb vector prolongs lifespan and improves phenotype in Sandhoff mice

Natalia Niemir1, Aurore Besse2, Marie Vanier3, Laura Rouvière1, Jasmin Dmytrus4, Thibaut

Marais2, Stéphanie Astord2, Jean-Philippe Puech5, Matthieu Benard, Jonathan D. Cooper4,

Martine Barkats2 and Catherine Caillaud1,5,*

1INSERM U845, Université Paris Descartes, Sorbonne Paris Cité, Paris, France.

2INSERM U974, Institut de Myologie, Paris, France.

3INSERM U820, Lyon, France.

4Department of Neuroscience, James Black Centre, Institute of Psychiatry, King's College,

London, UK.

5Service de Biochimie, Métabolomique et Protéomique, Hôpital Necker-Enfants Malades,

Assistance Publique-Hôpitaux de Paris, Paris, France.

Corresponding author :

* Dr Catherine CAILLAUD, Laboratoire de Biochimie, Métabolomique et Protéomique,

Hôpital Necker-Enfants Malades, 149 rue de Sèvres, 75015 Paris, France.

Phone : +33 1 71 39 69 74, Fax : +33 1 44 49 51 30

E-mail : [email protected]

122 ABSTRACT

Sandhoff disease is a rare genetic disorder due to mutations in the HEXB gene. It is characterized by a double Hex A (αβ) and B (ββ) deficiency, responsible for a GM2 accumulation, mainly in the central nervous system. An AAV2/9-Hexb specific vector was constructed and tested in the Sandhoff murine model, mimicking the human disease. Its intravenous administration in neonatal Hexb-/- mice significantly prolonged their lifespan compared to non-treated Sandhoff mice (> 500 days instead of 117 days in naive Sandhoff animals). Treated mice are still alive and phenotypically comparable to normal mice. They have no loss of weight and no tremor. Behavioral tests performed regularly using rotarod, activmeter and inverted screen test showed that AAV2/9-treated mice are able to perform the tests with results comparable to controls. Hexosaminidase activities were tested at 2 and 4 months in treated mice by comparison with naive Sandhoff and normal mice. Assays performed with artificial substrates showed that total hexosaminidases were not restored to normal into the brain after intravenous administration of the AAV2/9-Hexb, but they reached around 15% of normal in the brain and 40% in the liver, a level that can be considered as therapeutic. Some other lysosomal enzymes were found elevated in Sandhoff mice and their activities were significantly decreased in treated mice. GM2 storage found in Sandhoff mice was absent in normal as well as in AAV2/9-treated Sandhoff mice brain at 2 and 4 months post-injection. Different immunohistochemical methods were used to study brain lesions. Lamp-1 staining showed a significant storage in Sandhoff mice, but not in AAV2/9-treated and control mice. A profound thalamic reactive gliosis and a thalamocortical neuron loss were found in naive Sandhoff mice. They were completely absent in normal and AAV2/9-treated mice. These results suggest a protective effect of the therapeutic vector administered intravenously in affected mice during the neonatal period.

KEYWORDS

Sandhoff disease, GM2 gangliosidosis, hexosaminidases, Hexb gene, gene transfer, AAV2/9 vector, intravenous injection

123

MATERIAL AND METHODS

Animals

All animal experiments were carried out in accordance with European guidelines for the care and use of experimental animals. The Sandhoff mouse model was generated by targeted disruption of the Hexb gene in the C57BL/6J strain (Hexb-/- mice) [1]. Wild-type (+/+) and heterozygous (+/-) C57BL/6J littermates were used as controls in the study. The Hexb-/- strain was maintained by two types of breeding: heterozygous females with affected males, and affected females with affected males. To determine the status of newborn mice, total β- hexosaminidase activity was measured from clipped toes using a standard enzymatic assay protocol. Briefly, biopsies were mechanically homogenized in sterile water, incubated on ice for

20 minutes for cell lysis and the β-hexosaminidases and β-galactosidase (control enzyme) activities were measured using the artificial β-N-acetylglucosaminide (MUG) and 4-MU-β-D- galactopyranoside, respectively. The genotype was double-checked by polymerase chain reaction (PCR) on tail sample, as described previously [1]. DNA was extracted by phenol technique and ethanol precipitation. Briefly, samples were incubated at 37°C overnight in urea buffer containing proteinase K (10 mg/ml). Next, phenol was added, followed by 5 minutes centrifugation in order to separate the aqueous and organic phase, which was further discarded.

Furthermore, glycogen (20 mg/ml), ammonium acetate (7.5M) and pure ethanol were added to the aqueous phase and the solution was incubated at -80°C for 1 hour for DNA precipitation, and DNA was recovered by centrifugation (13000 rpm for 30 minutes at 4°C). After supernatant removal, 3 washes with 70% ethanol were performed and DNA was resuspended in sterile TE 10:1. The final DNA concentration was evaluated on a Nanodrop (Thermo

Scientific, Wilmington, USA). PCR genotyping was performed using three different previously described primers [1]. PCR samples (50 ml total volume) were preheated at 95°C for 5 min.

124 Forty PCR cycles were performed, composed of 30 s denaturation at 95°C, 30 s annealing at

55°C, and 1 min extension at 72°C. Products were analysed on a 2% agarose gel.

Production of scAAV vectors

Self-complementary genome-containing plasmids were constructed by deleting the D sequence and the terminal resolution site from one of the inverted terminal repeats. The production of serotype 9 AAV has been described elsewhere [2]. Briefly, AAV9 vectors were generated by packaging AAV2-based recombinant self-complementary (sc) genomes into the AAV9 capsids.

Virions were produced by transfecting HEK293 cells with (i) the adenovirus helper plasmid

(pXX6-80), (ii) the AAV packaging plasmid encoding the rep2 and the cap2 or the cap9 genes, and (iii) the AAV2 shuttle plasmid containing the gene encoding mouse Hexb under the control of the phosphoglycerate kinase promoter (PGK) in sc genome. Recombinant vectors

(rAAV) were purified by double-CsCl ultracentrifugation followed by dialysis against the formulation buffer of the vector stocks, namely phosphate-buffered saline containing 0.5 mM

MgCl2 and 1.25 mM KCl (PBS-MK; five buffer changes, 3 hours per round of dialysis).

Physical particles were quantified by realtime PCR. Vector titers are expressed as viral genomes per milliliter (vg/ml).

In vivo scAAV2/9-Hexb injections

The injections were performed in newborn Hexb-/- female mice (day one or two after birth).

Injections of scAAV2/9-PGK-Hexb were made through the temporal vein (3.5E+13 vg/kg in each mouse, n = 8 for survival, n = 4 for each other subgroup: enzymatic assays, ganglioside analysis, histology).

Behavioral tests

The animals were housed at 25°C during a 12h light/dark cycle, with food and water made available ad libitum throughout the experiments. Animals were first evaluated on physical

125 criteria: weight, general health and tremor. The tests were carried out on a weekly basis between 11 a.m and 5 p.m (except Activmeter). Studies were performed using AAV2/9-treated

Hexb-/- mice, wild-type and homozygous Sandhoff littermates or age-matched progeny.

Rotarod test

To test the influence of motor paralysis on the activity of animals, the rotarod test was performed. The rotarod (Bioseb, Vitrolles, France) comprises a rotating drum, which speed rises from 4 to 40 rpm over the course of 2 min. The animals (up to 5) were placed on accelerating drum in order to test balance and coordination. The time at which each animal felt from the drum was noted. Each animal received three consecutive trials, the first one was treated as the test and was not taken into account for final results.

Inverted screen test

The inverted screen test was used for grip strength acquisition. Single animal was placed on clean cage metal grid screen. After placement, the animal was allowed to grip the grid before it was inverted 180° over a plastic cage containing fresh bedding. The latency to fall from the grid was recorded in 10 seconds lasting trail after which mice were removed from the apparatus and returned to the home cage.

Righting reflex test

In order to test the muscular abilities, the righting reflex was analysed. The time necessary for animals to right themselves after laid back position within 10 seconds period was measured.

Activmeter test

AAV2/9-Hexb-injected mice were compared for spontaneous activity with age-matched WT and Hexb-/- untreated mice at 2, 4, 8 and 12 months. The cage was placed on an Activmeter

126 platform system (Activmeter, Bioseb, Vitrolles, France). Single animal per test was placed in the cage and the apparatus used balance system and vibrations within the cage to measure locomotion. The distance (cm) and the global movement (s) parameters were measured over a

10 hours night period (8 p.m - 6 a.m).

Footprint test

Footprint test was performed for a qualitative analysis of gait. Front and hind mice paws were painted with red and blue ink, respectively. Next, mice were allowed to walk in a tunnel of transparent plexiglas placed on a white sheet of paper (40 cm long) and the footprint was recorded. WT, Hexb-/- and AAV2/9-treated animals were tested at 4, 8 and 12 months post- treatment.

Sample collection

In order to analyse efficacy of the AAV2/9 treatment in Hexb deficient mice, the organs of

AAV2/9-treated, Hexb deficient animals and age-matched controls (4 per group) were examined at 2 time points representing early symptomatic (2 months) and late symptomatic (4 months) stages of the disease. Mice were sacrificed with a lethal dose of 10 mg.kg-1 xylazine and 100 mg.kg-1 ketamine by intraperitoneal injection.

Further samples treatment varied according to the future use. The samples were weight and snap frozen for immunohistochemistry, enzymatic assays and ganglioside analysis or placed in freshly prepared solution of 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer, pH 7.4 for immunohistochemistry techniques. Samples were stocked at -80°C till use.

Histology

Brains of AAV2/9-treated mice, Sandhoff animals and age-matched controls (4 per group) were examined at 2 and 4 months post-injection. The samples were collected as described

127 above and placed in freshly prepared and filtered solution of 4% paraformaldehyde (PFA) in 0.1

M phosphate buffer, pH 7.4, for 24h. Next, brains were bisected along the midline. Single hemispheres were cryoprotected in 30% sucrose, 0.5% sodium azide in 50 mM tris buffered saline (TBS), pH 7.6 prior to sectioning on frozen microtome. 40 µm coronal sections through the rostrocaudal extent of the cortical mantle were collected one per well in 96 well plates containing a cryoprotective solution (30% ethylene glycol (Sigma-Aldrich), 15% sucrose, 0.05% sodium azide in TBS [3]. All subsequent histological analyses were performed blind to genotype.

Nissl staining

For direct visualization of neuronal morphology, a series of every sixth section through each brain was slide mounted and Nissl stained with cresyl violet [3]. Briefly, slides were incubated in 0.05% cresyl fast violet (Merck, Darmstadt, DE), 0.05% acetic acid in water for 30 min at

60°C, rinsed in deionised water, then differentiated through an ascending series of alcohols before clearing in xylene and coverslipped with DPX (VWR, Poole, UK).

Immunochemistry

A standard immunohistochemical protocol was used to examine the distribution of markers of interest [3, 4] using 3,3’-diaminobenzidine tetrahydrochloride (DAB) for visualisation.

Endogenous peroxidase activity was quenched in 1% hydrogen peroxidase (VWR) in TBS for

15 min. Sections were then rinsed in TBS and blocked in 15% normal serum in TBS with 0.3%

Triton-X (TBS-T), before incubation in the appropriate primary antibody; polyclonal rabbit anti-GFAP (Dako 1:4000, Ely, UK), rat anti-CD68 (Serotec 1:2000), polyclonal rabbit anti-

Lamp-1 (1:1000, Abcam), diluted in 10% normal serum in TBS-T overnight at 4°C. Sections were rinsed in TBS and incubated with the appropriate biotinylated secondary antibodies: swine anti-rabbit (Dako 1:1000), rabbit anti-rat (Vector 1:1000) for 2h at room temperature

128 and subsequently rinsed in TBS. They are then incubated in avidin-biotin-peroxidase complex

(Vectastain Elite ABC kit, Vector, Northampton, UK; 1:1000) in TBS for 2h, and rinsed in

TBS. To visualize immunoreactivity, sections were incubated in 0.05% DAB containing

0.001% hydrogen peroxide in TBS for up to 25 min, depending on antigen. Finally, sections were rinsed in ice-cold TBS and then mounted on gelatine-chrome-coated microscope slides

(VWR), air-dried overnight, cleared in xylene and coverslipped with DPX (VWR).

Quantification analysis of immunoreactivity

The optical density of immunoreactivity visualised using DAB was assessed using semi- automated thresholding image analysis, as previously described [4,5]. Using a x40 objective, a number of non-overlapping images representing the entire region of interest (30 images for

VPM/VPL region and 18 for LGNd) were taken from 3 consecutive sections starting from defined anatomical landmarks [6]. Image Pro Plus image analysis software (Media Cybernetics,

Chicago, IL), was used to determine the area of immunoreactivity for each antigen in each region by applying a threshold that discriminated staining from background in each image.

Data were plotted as the mean percentage area of immunoreactivity per field ± SEM for each region.

Cell number estimation

The optical fractionator probe was used to estimate cell number [7] in Nissl stained sections of thalamic relay nuclei: Ventral Posteromedial Nucleus/ Ventral Posterolateral Nucleus

(VPM/VPL), lamina IV Somatosensory Barrelfield Cortex (S1BF), brainstem Spinal Nucleus

V (SPV) and Reticular Rormation (RF) and Cerebellum with Deep Cerebellar Nuclei (DCN) region [8,9]. Nissl stained cells were counted, using a 100x objective and counted as neurons if they had a neuronal morphology and a clearly identifiable nucleus ignoring astrocytes and microglia with their small soma, or cells with indistinct morphology. A line was traced around

129 the boundary of the region of interest, a grid was superimposed and cells were counted within a series of dissector frames placed according to the sampling grid size. Different grid and dissector sizes were used in each brain region using a coefficient of error (CE) value of less than

0.1 to indicate sampling efficiency [10]. For thalamic VPM/VPL region, a 1:6 series was sampled using grid 175 x 175 µm, frame 74 x 42 µm; for lamina IV of S1BF cortical region a

1:12 series was sampled with grid 150 x 150 µm and frame 41 x 26 µm; for brainstem regions

1:6 periodicity was used, and the dimensions for the optical fractionator were as follow: DCN - grid: 140 x 140 µm frame: 70 x 40 µm; SPV - grid: 270 x 270 µm, frame 70 x 40 µm.

Statistical Analysis

Microsoft Excel (Redmond, WA, USA) was used for data collection and for statistical analysis and graph representation was conducted using GraphPad Prism for Mac Version 6 (GraphPad

Software, La Jolla, USA). To test for significance between groups, the Student’s t-test or

ANOVA test with post hoc Bonferroni analysis were used as appropriate. All graphs are plotted as the mean ± the standard error of the mean (SEM).

Enzymatic Assays

Each sample (50 mg) was ground in 300 mL of 0.1 M citrate phosphate buffer, pH 4.5 and homogenates were lysed by 3 cycles of rapid freezing and thawing, followed by centrifugation at

4°C for 5 min at 10,000 g. The protein content of each supernatant was determined using the

BCA kit (Assay Protein Quantitation Bicinchoninic acid, Pierce reagents) according to the manufacturer's recommendations. The enzyme activities (β-galactosidase, β-glucuronidase, α- fucosidase, total β-hexosaminidases and β-hexosaminidase A) were measured using supernatants (1/10 dilution). In a black 96-well plate with clear bottom: 10 µL of diluted supernatant was added to 50 µL of the fluorimetric corresponding substrate. The samples were incubated for 1 h at 37°C with gentle agitation and enzymatic reactions were stopped by adding

130 200 µl of a 1M glycine buffer, pH 10. The released fluorescence was read on a CytoFluor 4000 fluorimeter (PerSeptive Biosystems), excitation: 360 +/- 40 nm, emission: 460 +/- 40 nm. The data obtained were compared with the fluorescence of a 4-methyl-umbelliferone standard (10 nmol/well). All enzyme activities are expressed as nmol/h/mg cell protein. Substrates used were

: for β−galactosidase: 4-methyl-umbelliferyl-β-D-galactopyranoside (Sigma M1633) 1 mM in

0.1M citrate phosphate buffer at pH 4.5, for β-glucuronidase: 4-methyl-umbelliferyl-β-D- glucuronide (Sigma M9130) 1 mM in a 0.1M citrate phosphate buffer at pH 5, for α- fucosidase: 4-methyl-umbelliferyl-α-L-fucopyranoside (Sigma M8527) 1 mM in 0.1M citrate phosphate buffer at pH 4.5, for total β-hexosaminidases: 4-methylumbelliferyl-2-acetamido-2- deoxy-β-D-glucopyranoside (Sigma M2133) (MUG) 1 mM in 0.1M citrate phosphate buffer at pH 4.5, for β-hexosaminidase A : 4-methyl-umbelliferyl-7-(6-Sulfo-2-Acetamido-2-deoxy-

β-D-glucopyranoside), (Calbiochem 454428) (MUGS) 1 mM in 0.1M citrate phosphate buffer at pH 4.5, for standard : 4-methyl-umbelliferone (Sigma M1381) 1mM in deionized water.

Biochemical analysis of gangliosides and other glycosphingolipids

Analyses were performed on frozen cerebral hemispheres and dissected cerebella which have been stored at -80°C prior to use. Total lipid extraction, separation and purification of main lipid fractions were done using previously described procedures [11,12]. Briefly, total lipids were extracted from 20% tissue homogenates in water using chloroform-methanol 1:2 (v/v).

For gangliosides studies, part of the extract (corresponding to 20-50 mg tissue) was desalted and separated into two fractions on reverse-phase 100 mg Bond Elut C18 columns (Varian) using a downscaling of a published procedure [13]. The methanol-water 12:1 (v/v) eluate which contained all the gangliosides was used without further purification. An aliquot corresponding to 1.5 or 3 mg of tissue was spotted (Linomat 5 device, Camag) on silica gel 60 high- performance thin layer chromatography (HPTLC) plates (Merck, Darmstadt). Plates were

131 developed in chloroform–methanol–0.2% CaCl2 55:45:10 (v/v/v) and sprayed with resorcinol-

HCl reagent to visualize the sialic acid moiety of individual gangliosides. Densitometric quantification was performed at 580 nm (Camag TLCII scanner, Cats software). The data were normalized to the number of sialic acids per individual ganglioside and expressed as % of total gangliosides. For gangliotriaosylceramide (GA2) studies, part of the total lipid extract was saponified, desalted by phase partition, and suitable aliquots spotted on HPTLC plates. After development in chloroform–methanol–water 65:25:4 (v/v/v), hexose-containing compounds were visualized by orcinol-sulphuric acid reagent and densitometric quantification done at 650 nm.

RESULTS

A single intravenous injection of AAV2/9-Hexb vector partially restores the β-hexosaminidase enzymatic activity

An AAV2/9 vector encoding the mouse β -hexosaminidase β subunit transgene under the control of the PGK (phosphoglycerate kinase) constitutive promoter (AAV2/9-Hexb) was intravenously injected in female Hexb-/- mice during the neonatal period (J1-J2) with a dose of

3.5E+13 vg/kg. The restored β -hexosaminidases activities were tested in the brain, brainstem and liver of treated mice by comparison with naive Sandhoff mice and wild-type (WT) mice at

2 and 4 months. The age of 2 months was chosen as an early symptomatic stage, where animals slowly start to show modest pathological signs, like beginning of tremor. At 4 months, deficient mice are usually in the terminal phase of the disease. The assays were performed using the artificial substrates in order to analyse either the total Hex (A+B) or the specific Hex A activities (MUG and MUGS, respectively). Untreated Sandhoff mice exhibit almost no β- hexosaminidase activity neither in brain nor in liver (less than 2% of normal enzymatic activity detected in Hexb-/- mice for Hex A+B, and less than 10 % for Hex A) (Figure 1a-b, e-f). After a single intravenous injection of AAV2/9-Hexb at a dose of 3.5E+13 vector genomes (vg/kg) just after birth, a significant increase of enzymatic activity was observed (Figure 1a-f). In the

132 cerebrum, hexosaminidase A reached a level around 15 % of normal (Figure 1b). Similar results were obtained within brainstem and liver, showing even higher (till 30%) storage-degrading

Hex A activity (Figure 1d, f). Moreover, enzyme expression was sustained, as very modest differences were observed between animals analyzed 2 or 4 months after the vector injection.

AAV vector tends to limit secondary elevation of lysosomal enzymes

In order to determine if the AAV2/9-Hexb vector can influence the activity of other lysosomal enzymes in murine tissues, β-glucuronidase, α-fucosidase and β-galactosidase were tested using synthetic fluorogenic substrates. The corresponding enzymatic activities (expressed as % of

WT) were highly elevated in cerebrum, brainstem and liver of untreated Sandhoff mice (Figure

2), reaching nine times the normal level in the brainstem (Figure 2f). After AAV2/9-Hexb injection, a significant decrease of the enzymatic activities was observed in the CNS, brainstem and liver (Figure 2). At 4 months, all the tested enzymes showed significant differences (p value

<0.05) in the cerebrum and brainstem after the AAV2/9 treatment (Figure 2a-f). This effect was also seen for β-galactosidase in liver (Figure 2i). For β-glucuronidase and α-fucosidase, a strong tendency to reduction exists in the liver, even if the differences were not statistically significant (Figure 2g and 2h, respectively).

β-Hexosaminidase expression prevents glycosphingolipid storage

As the accumulation of lipid storage is a major hallmark of Sandhoff disease, we therefore investigated the effect of AAV2/9 treatment on this aspect of the disease physiopathology.

First, neuron morphology was studied using Nissl staining that is able to visualize neuronal cytoarchitecture. Neurons were found to have an abnormal aspect in all areas of the brain in 4 month-old Hexb-/- mice (Figure 3). They appeared enlarged and filled with storage.

Conversely, AAV2/9-Hexb-treated animals showed complete correction of pathological accumulation of material throughout the brain.

133 Moreover, the Lamp-1 expression was used to indirectly evaluate the storage. The brain of 4 months old Hexb-/- animals manifested a visible accumulation within numerous regions like hypothalamus, cortex, and hippocampus (Figure 4a), indicating a pathologic upregulation of the number of lysosomes. Higher magnification revealed the cell bodies with dark staining throughout the entire sections (Figure 4b). No upregulation of the Lamp-1 marker could be observed in treated animals which were comparable to WT.

Analysis of brain lipids shows drastic reduction of GM2 and GA2 accumulation in AAV2/9- treated mice

Lipid extraction, ganglioside purification and HPTLC (high-performance thin-layer chromatography) analysis were performed on cerebral and cerebellar tissues from Sandhoff WT and vector-treated mice, in order to evaluate the specific accumulation of gangliosides. While in cerebrum of WT animals, the GM2 and GM3 gangliosides were almost absent, cerebrum of untreated mice exhibited an increased level of these components at 2 and 4 months (Figure 5a).

Conversely, little or no GM2 and GM3 gangliosides could be detected in age-matched

AAV2/9-treated mice. Next, GM2 ganglioside was more precisely quantified in cerebrum and cerebellum of WT, Hexb-/- and AAV2/9-treated animals. In SD mice, GM2 ganglioside

(evaluated as percentage of total gangliosides) was already elevated at 2 months and the accumulation progresses with disease development (at 4 months, mean of 41% ± 2.4, n = 4). In the cerebrum of AAV2/9-treated animals, GM2 was nearly normal at 4 months (mean 4.3% ±

0.3, n = 4) when compared to WT (mean 1.6 % ± 0.2, n = 2). In the cerebellum, the reduction was also significant even if incomplete (Figure 5b). GA2 glycolipid was also evaluated in the same tissues. In agreement with the previous correction of GM2 storage, a complete absence of

GA2 was noted in the cerebrum of AAV2/9-treated Sandhoff mice at 2 and 4 months post- injection and GA2 was dramatically reduced in the cerebellum (Figure 5c).

134 Survival of affected mice is prolonged following i.v. AAV2/9-Hexb delivery

AAV2/9-Hexb gene therapy was initially performed by using different dose of vector. Hexb-/- mice injected with the 1.34E+13 vg/kg dose survived around 193 days (extremes : 170-230) by comparison with untreated littermates (mean survival : 117 days) (Figure 6). The life expectancy of animals treated with 3.5E+13 vg/kg of AAV2/9-Hexb was significantly longer

(>500 days). To date, all injected mice are still alive and phenotypically comparable to control

WT mice (study ongoing). Moreover, they are active and in good health (no tremor).

Weight of the animals was also analyzed. In the late stages of the disease, the weight of

Sandhoff mice decreased about 40% within few weeks from the apparition of pathological symptoms (Figure 7). After AAV2/9-Hexb gene therapy, the weight remained stable, reflecting a maintenance of well-being, foraging, and feeding activity.

A functional correction was obtained in treated Sandhoff mice

In order to test paralysis development and muscular abilities, animals were tested for their locomotion skills. The main tests used were rotarod, righting reflex and inverted screen test, all performed for each animal on a weekly basis. Rodents were subjected to the inverted screen test and the latency of fall from metal returned grid was recorder. At the beginning of the test period (8-12 weeks), mice from all three groups were able to maintain on the grid without falling for the whole duration of the test. Then, Hexb-/- mice developed a progressive loss of their muscular strength and time on the grip decreased to finally reach zero with complete paralysis of front and hind paws (16 weeks) (Figure 8). Conversely, animals treated with the higher viral titer (3.5E+13 vg/kg) obtained results completely identical to WT throughout the entire experience spanning more than one year.

Mice gait was evaluated using the footprint test (Supplementary Data: Figure S1). Hexb deficient animals showed significant paralysis and characteristic “dragged” pattern at 4 months possibly due to reduced muscular tone, impaired cerebellar motor or peripheral neurological

135 function [14,15]. Treated animals showed a similar to WT pattern at 4 and 12 months with no visible gait aberrations.

Additionally, mice were evaluated by using a rotarod. Mean time on rotating rod at accelerating speed was high in healthy controls and dramatically reduced in untreated Sandhoff mice

(Figure 9). Results in treated mice were completely comparable to normal. Data were similar for mean speed (not shown).

Finally, animals were also tested using an activmeter, a behavioural test performed in the house-cage environment. The test was conducted at 2, 4, 8 and 12 months in all three groups of animals. The collected data correspond to the locomotor activity recorded during 10h (from

8 p.m. to 6 a.m.). The global activity of Hexb-/- mice was first slightly above the normal values, but a subsequent rapid decrease could be observed culminating in death at 4 months (Figure

10). In treated mice, this parameter was similar to control mice (Figure 10a). Moreover, the distance travelled during the 10h test period in animals evaluated at 12 months, was almost identical in normal and treated mice (Figure 10b).

Correction of neuroinflammation in thalamocortical system following the intravenous administration of AAV2/9-Hexb therapeutic vector

In order to evaluate the impact of AAV2/9 treatment on the onset and progression of the pathology, histopathological analyses were performed with a special focus on sites showing the most significant pathological features within the brain. It has previously been observed that neuroinflammation in Hexb-/- mice was most prominent in regions of the thalamocortical system. The earliest neuron loss was evident in the feedback neurons of lamina VI, subsequently progressing to the thalamus and lamina IV cortical neurons (Pressey S, unpublished data). Therefore, the thalamus and the somatosensory barrelfield cortex (S1BF) were particularly analysed in our study.

136

Astrocytosis clearance

Immunostaining for the astrocytic marker GFAP (glial fibrillary acidic protein) revealed an intense astrocyte immunoreactivity in Hexb-/- mice within thalamic regions (Figure 11a; b2,3).

The ventral posterior nucleus (VPM/VPL) region of the thalamus showed the highest reactive astrocytosis, which was already visible at 2 months (Figure 11a). This phenomenon increased with the course of disease. Contrarily, the GFAP staining in AAV2/9-treated animals was comparable to age-matched WT animals and very limited. In Hexb-/- at 4 months of age, dorsal lateral geniculate nucleus (LGNd) also had significant GFAP staining while nearly no staining was present on both other groups (Supplementary Data: Figure S2a).

While analysing the somatosensory barrelfield cortex (S1BF) (Figure 11c; b1), at 2 months,

Hexb-/- animals also presented a GFAP immunohistochemical staining progressively increasing throughout the disease course. At 4 months, the dense astrocytosis was evident within all lamina of the S1BF region in Hexb-/- mice, but no such phenomenon could be observed in WT or AAV2/9-treated groups. Quantitative thresholding image analysis of

GFAP immunoreactivity in thalamus and cortex of Hexb-/- mice demonstrated the upregulation of this marker, compared to age-matched controls (Figure 11d;11e). Treated-mice showed significantly lower level of astrocytosis, comparable to WT littermates.

Immunostaining for microglia marker CD68 reveals the absence of microgliosis

Since microglial activation was described as an important pathologic process in Sandhoff animals, CD68 immunostaining and its quantification were performed in the thalamus and cortex of AAV2/9 treated mice. A progressive microglial activation was observed within each region even if the distribution of microglial cells was more localized than for astrocytosis. A strong staining was visible in the thalamus of Hexb deficient mice at 2 and 4 months while

AAV2/9-treated mice were completely comparable to control mice (Figure 12a). In the cortex

137 of Sandhoff mice, activated microglia is uniformly distributed at both ages and similarly to thalamus, the AAV2/9-treated mice showed no CD68 staining (Figure 12c).

The quantitative analysis of CD68 immunoreactivity in AAV2/9-treated animals demonstrated a level similar to wild type in VPM/VPL and LGNd regions of thalamus (Figure 12b;

Supplementary Data: Figure S2b) by comparison with age-matched Hexb-/- mice exhibiting acute microglial activation. Similar results were obtained for S1BF region (Figure 12d).

Neuroprotective role of AAV2/9 vector

We decided to check if the AAV2/9-Hexb treatment can protect neurons of VPM/VPL region of the thalamus and lamina IV of the S1BF region from apoptosis. The neuron number in untreated animals drastically decreased in the VPM/VPL region by comparison to WT (Figure

13a) and a strong tendency to neuron loss could be seen in the cortex (Figure 13b). The number of neurons in AAV2/9 receiving animals was similar to WT suggesting a protective effect of the therapeutic vector on neuronal cells of the thalamocortical system.

AAV2/9-Hexb systemic administration efficiently corrects the astrogliosis and microgliosis in other parts of Sandhoff mice CNS

Given that AAV2/9 is delivered intravenously, it could potentially have more global effects.

Therefore, two other brain regions, i.e. brainstem and cerebellum, known as exhibiting a significant pathology, were evaluated for microglial and astrocytic immunoreactivity (Figure 14;

Supplementary Data: Figure S3 and S4). Reticular formation (RF) and spinal trigeminal nucleus V (SPV) regions were analysed for the brainstem (Figure 14b-1,2). For the cerebellum, the study was focused on the deep cerebral nuclei (DCN) region including molecular and granular layers of the cerebellar cortex and white matter (Figure 14b-3 and insert).

An increased CD68 immunoreactivity was found in Hexb-/- mice in all analysed regions at both ages, with many intensely stained CD68-positive cells present, compared to age-matched

138 WT mice. In AAV2/9-treated animals as in WT control mice, weakly stained CD68-positive microglial cells with a small cell soma and thin processes were apparent in all of the analysed regions (Figure 14a,c; Figure 15a,b,e,f). This needs to be compared to the activated CD68- positive microglial cells in Hexb-/- mice which were bigger, more intensely stained and had short thickened processes in SPV, RF, DCN, and in the molecular and granular layer of the cerebellar cortex and white matter. These morphological changes were already apparent in

Hexb-/- tissues at 2 months, becoming more apparent as the disease progressed in 4 months old mice.

To quantify the level of microglial activation in hindbrain, thresholding image analysis was used. There was a significant difference in the level of microglial activation between Hexb-/- mice and age-matched WT controls at 2 and 4 months in SPV, RF, DCN and in all cortical layers tested (Figure 14d,e and Figure 15c,d,g,h). The results of treated mice were completely comparable to WT, confirming that AAV2/9 administration leaded to a significant reduction of microglial activation within all tested regions at both ages.

GFAP-immunohistochemical staining in Hexb-/- mice revealed that astrocytosis became more intense in all the brainstem and cerebellar regions analysed (SPV, RF and DCN), as well as in molecular, granular layers and white matter, whby the disease progresses (Supplementary Data:

Figures S3 and S4). Indeed, 4 months old Hexb-/- mice showed a pronounced activation of astrocytes in these nuclei, by comparison with age-matched WT controls. In treated animals, no astrocyte activation was seen, neither at 2 nor at 4 months.

This was confirmed by quantitative threshold image analysis. This study performed within cerebellar layers revealed the absence of significantly elevated GFAP expression within the molecular layer of the cerebellar cortex or white matter of 2 months old mice (Supplementary

Data: Figures S4d and h). There was also no significant increase of GFAP expression within the granular layer of the cerebellar cortex (Supplementary Data: Figure S4g) of 2 and 4 month- old Hexb-/- mice compared to age matched control (WT) mice. The astrocytosis was corrected

139 in SPV and RF nuclei (Supplementary Data: Figures S3c,d). A change in morphology and staining intensity could also be observed on activated astrocytes within Hexb-/- hindbrain nuclei. Astrocytes were hypotrophied and had darkly stained thickened processes. These differences first occurred in 2 months old Hexb-/- mice and became more pronounced in 4 months old Hexb-/-. This process was absent in AAV2/9 treated and WT at both ages.

Rescue of the loss of spinal trigeminal and deep cerebellar nuclei neurons in 4 month old

Hexb-/- mice as a result of AAV2/9 treatment

Given the significant astrocytosis and microglial activation in several hindbrain regions of

Hexb-/- mice at 4 months of age, neuron counts were undertaken within two of these regions to measure the impact on neuron survival. Neuron counts were obtained from SPV and DCN region and significant loss of Nissl stained neurons in both the spinal trigeminal and deep cerebellar nuclei of 4 month old Hexb-/- mice was visible compared to age-matched WT mice

(Figure 15a,b).

Overall, the results from brainstem and cerebellum confirm the global transduction pattern of the AAV2/9-Hexb vector and the widespread therapeutic effect throughout the entire brain.

Furthermore, the AAV2/9 also prevents the neuron loss in brainstem (Figure 16a) and cerebellum (Figure 16b).

DISCUSSION

Systemic gene therapy in the Sandhoff murine model using a specific AAV2/9-Hexb vector administered intravenously during the neonatal period resulted in enzymatic correction and substrate storage prevention. Moreover, this approach permitted a functional restoration of histological parameters and behavioural rescue with a significant lifespan increase of treated animals.

140 Prevention of the disease after gene therapy

In Hexb-/- mice, GM2 storage has already been detected in some parts of the CNS at 2-3 postnatal weeks [1] and a low level of astrocytosis and microglial activation was evident in 1 month-old animals (Pressey S, unpublished). As behavioural symptoms of the disease, like head tremor, are visible around 10 weeks [16,17], an early intervention is crucial. For this purpose, the AAV2/9 therapeutic vector was administered 1 or 2 days after birth. Moreover, a self- complementary (sc) AAV2/9 vector was specifically used, as it is known to have an increased vascular permeability and a rapid maximal transgene expression thanks to its ability to bypass obligatory host cell-mediated second strand DNA synthesis. The injection of the therapeutic vector early after birth may offer some additional advantages, such as incomplete blood-brain barrier formation in neonatal mice, promoting brain transduction. Moreover, during this period, no silencing of the transgene has been noted at 2 and 4 months, probably due to the absence of AAV pre-immunisation. Late development of immune reactions beyond 4 months is unlikely, as the behavioral normality and absence of disease symptoms, like tremor or ataxia, are persistent (Supplementary Data: Figure S1). However, some older AAV2/9-treated animals need to be sacrificed in order to confirm this hypothesis by histology, enzymatic assay and

HPTLC techniques. Finally, the early administered vector target neurons that are mainly involved in Sandhoff disease permitting to prevent their pathology. Indeed, a differential targeting has been previously observed in the CNS after intravenous delivery of AAV2/9 vectors. In neonates, systemic injection resulted in widespread neuronal targeting with an apparent tropism toward neurons, including lower motor neurons (LMNs) residing within the spinal cord [18], while a predominant astrocyte transduction was seen in adult animals.

Dose-dependent effect of the therapeutic vector

We show here for the first time a long-term rescue of GM2 gangliosidosis in the forebrain, but also in the hind parts of the brain, i.e. cerebellum and brainstem after AAV2/9-mediated gene

141 transfer in the acute Sandhoff mouse model. It was stated that the dose of AAV2/9 required to achieve effective transduction via systemic vascular delivery in mice was approximately 1.0E+13 vg/kg [19-21]. In our study, two doses of the therapeutic vector (1.34E+13 vg/kg and 3.5E+13 vg/kg) were tested. In a subset of mice receiving the lower dose, the mean lifespan was 193 days

(longest recorded lifespan for this subgroup 230 days; mean ± 24, n = 6) compared to 117 days in non-treated Hexb-/- mice. With this dose, Sandhoff mice continued to obtain normal results on the rotarod till 17 weeks. The onset of tremor was delayed by 8 weeks compared to

Hexb-/- naive animals and mean time on rotarod started to decrease at 17 weeks. High-dose of

AAV2/9-Hexb vector (3.5E+13 vg) induced prolonged expression of β-hexosaminidase transgene without cytotoxicity, as therapeutic vector expression was stable at long-term.

Treated mice survived far beyond 1 year of age (mean survival >500 days) and till date, they show no disease symptoms. This illustrates clearly the dose effect and the threshold that needs to be obtained to prevent of symptoms apparition.

Expression of one β-hexosaminidase subunit permits enzymatic correction

It has previously been shown in adult SD mice that intrastratial delivery of recombinant adeno- associated viral vectors (rAAV2/2 or rAAV2/1) expressing the human β -subunit (rAAV β) alone delayed the disease and results were similar to those obtained with both subunits [22].

Another recent study has shown that the infusion of 1-month-old Hexb-/- mice with rAAV2/1 β + rAAV2/1 β (human transgenes) at a single site into the striatum enabled an abundant expression of the Hex A, Hex B, and Hex S isozymes, but the single rAAV2/1β infusion leads only to Hex B expression [22]. In our study, both β-hexosaminidase isozymes

Hex A and Hex B were generated as a result of a single systemic injection of an AAV2/9 β- coding vector in newborn mice, which induced a widespread and long-lasting expression of β- hexosaminidases throughout the brain and cerebellum. The synthesized β-subunit was functional and able to form the αβ heterodimer with endogenous α monomers as the clearance

142 of GA2 degraded by Hex B and of GM2 metabolized by Hex A were comparable in the forebrain and the cerebellum. Although hexosaminidases were not restored to normal, Hex A specifically required for GM2 ganglioside metabolism was increased to around 15% of WT within the cerebrum and almost 30% within the cerebellum and liver after the therapeutic vector administration. The level restored is likely therapeutic, if we consider the longer lifespan and behavioural improvement. In fact, the production of a small percentage of wild-type activity probably reached a threshold level which can be sufficient for normal GM2 degradation

[23,24]. A secondary elevation of lysosomal enzymes other than the deficient enzyme has also been observed in tissues from LSD patients and in some animal models i.e. MPS VII [25,26].

It has been shown to provide biochemical markers of the pathology and of potentially positive therapeutic response [27,28]. In the Sandhoff model, a dramatic increase of some other enzymes was noted as well as a drastic reduction after AAV2/9 vector administration confirming the effectiveness of our approach.

Expression of the therapeutic protein reduces ganglioside storage

The enzymatic restoration was accompanied by a reduction of the ganglioside storage. In LSD, accumulation of undegraded material within the lysosome can increase number and size of lysosomes from >1% to as much as 50% of total cellular volume. Therefore, the concentration of certain lysosomal proteins is upregulated as a result of storage [29]. Lamp-1 is a highly glycosylated protein participating in the lysosomal membrane stabilization against hydrolytic degradation [30], and as such, it would have an essential role in the structural integrity of the storage vacuoles. Here, the increase of Lamp-1 expression is used as an indirect storage marker and it clearly showed no storage within the forebrain in treated animals. Although the effect of the AAV2/9 systemic delivery was impressive within the neuronal tissues in the cerebrum, it seems to have a slightly lower impact on the cerebellum, as the HPTLC shows very modest accumulation of GA2 and GM2 lipids in this tissue. However, the results for brainstem and

143 cerebellum confirm the global transduction pattern of the AAV2/9-Hexb vector and the widespread therapeutic effect throughout the entire CNS. This is probably due to the

AAV2/9-specific vascular permeability, to the early injection and to the fact that transduced neurons promote secretion of active β-hexosaminidase and subsequent recapture by distant cells, a mechanism common in lysosomal storage disorders [22,31].

Cachon-Gonzalez et al. reported that gene therapy in Sandhoff mice after intracranial administration of a therapeutic AAV2/1 vector showed a possible discrimination between tremor and ataxic signs, and the spastic manifestations. CNS long-term rescue enabled the expression of secondary disease manifestations associated with low β-hexosaminidase expression in certain sites, possibly due to the presence of the blood-brain barrier [23]. Even though local enzyme activity was clearly sufficient to avoid accumulation or neuroinflammation in neighbouring neurons and glial cells, the Hexb-/- endothelium of treated mice older than 6 months showed accumulation. Moreover, accumulation of undegraded glycoconjugates was also found in liver and kidney in human patients and in AAV2/1-treated mice [32]. In our study based on the intravenous administration of an AAV2/9-Hexb vector, enzymatic tests performed in the liver showed a significant increase (30%) of Hex A specific activity, permitting the correction of other disease manifestations than CNS symptoms.

Reduction of hindbrain pathology after AAV2/9 treatment

Hexb-/- mice display significant pathology within the forebrain [33] including the thalamocortical system (Pressey S, unpublished). Moreover, neuronal apoptosis and microglial activation was also mentioned within the spinal cord and the brainstem of Sandhoff mice, but no detailed analysis of this pathology was reported [34]. In our study, glial activation was described in several pathological sites within these hindbrain regions. A profound degeneration of neurons was found within SPV and DCN nuclei, resulting from astrocytosis and glial activation in these regions in Hexb-/- mice [33]. Neuroinflammation can therefore be

144 considered as an indicator for the loss of specific neuron populations. These findings are valuable for directing future therapeutic approaches, and in particular the site and way of administration of therapeutic vectors, as the hindbrain is a diseased region in Sandhoff mice.

Our results suggest that the single intravenous administration of an elevated dose of AAV2/9 vector can rescue the severe neuroinflammation within the cerebellum and the brainstem and drastically reduces lipid storage within the cerebellum.

Conclusion

Finally, all these results are in favour of a real therapeutic effect after intravenous administration of an AAV2/9-Hexb vector in newborn Hexb-/- mice, showing no GM2 ganglioside accumulation in brain and peripheral organs and improvement of survival and behaviour in treated mice. However, treatment in mice at postnatal day 1-2 could correspond to second trimester of the human embryonic growth [35,36]. Therefore, in an effort to translate these encouraging results to the clinic, the feasibility and tolerability of our approach need now to be tested in adult mice.

ACKNOWLEDGMENTS

N.N. was supported by a doctoral fellowship from the Association Française contre les Myopathies

(AFM) and the association Vaincre les Maladies Lysosomales (VML).

FIGURE LEGENDS

Figure 1: Partial restoration of total hexosaminidases and hexosaminidase A specific activities in brain, brainstem and liver of WT, Hexb-/- and AAV2/9-treated animals at 2 and 4 months

145 Enzymatic assays were performed by using the synthetic substrates MUG and MUGS. Results are presented as percentage of WT total hexosaminidase activity (a,c,e) and WT hexosaminidase A specific activity (b,d,f). Error bars show SEM, n =3-4, *p<0.05,

**p<0.01,*** p<0.001, **** p<0.0001 using one way ANOVA.

Figure 2: Reduction of secondary elevation of lysosomal enzymes after the AAV2/9-Hexb treatment

The cerebrum, brainstem and liver of WT, Hexb-/- and AAV2/9-treated animals at 2 and 4 months were tested for β-glucuronidase, α-fucosidase and β-galactosidase activities. Results are presented as percentage of WT activities of each enzyme. Error bars show SEM, n =3-4,

*p<0.05, **p<0.01,*** p<0.001, **** p<0.0001 using one way ANOVA.

Figure 3: Rescue of abnormal neuronal morphology after intravenous AAV2/9 treatment

Cerebrum sections were stained with Nissl solution. An abnormal swollen morphology of neuron cell bodies (arrows) can be observed in the thalamus of 4 months old Hexb-/- mice. The

AAV2/9-treated animals are similar to WT and show no such pattern. Scale bars: 50 µm.

Figure 4: Lamp-1 staining showing absence of storage in cerebrum of 4 months old

AAV2/9-treated mice a. Brain sections of 4 month-old Hexb-/- animals manifest a visible accumulation within hypothalamus, cortex, and hippocampus. No upregulation of the Lamp-1 marker can be observed in WT or in AAV2/9 samples. b. The higher magnification of S1BF lamina IV showing homogenous distribution of Lamp-1 in untreated mice and absence of staining in WT and AAV2/9 animals. Scale bars: full sections (a)-500 µm; higher magnification (b)-100 µm.

Figure 5: HPTLC analysis of gangliosides and glycosphingolipids within cerebrum and cerebellum of 2 and 4 month-old WT, Hexb-/- and AAV2/9-treated mice

146 Study of gangliosides (a,b) and other glycosphingolipids (c) in cerebrum and cerebellum of 2 and 4 month-old wild type, untreated Hexb-/- and AAV2/9-treated mice. (a) Chromatographic profiles of total gangliosides (resorcinol-HCl staining), showing a drastic and selective reduction of the GM2 ganglioside accumulation in AAV2/9-treated mice, compared to the massive storage observed in age-matched untreated SD animals. Each lane corresponds to 3 mg wet weight tissue. (b) Quantitative data for GM2 ganglioside (expressed as percentage of total gangliosides) in cerebrum and cerebellum. (c) Other glycosphingolipids (2 mg tissue/lane), separated on HPTLC plates and visualized by orcinol-sulfuric reagent. A huge accumulation of

GA2 is noticeable in SD mice by comparison with WT and AAV2/9-treated animals. Gal-Cer, galactosylceramide; GA2, gangliotriaosylceramide.

Figure 6: AAV2/9 significantly prolongs the life expectancy of treated animals

Kaplan-Meier survival curve is shown for WT (n = 6), low dose AAV2/9 (n = 6) high dose

AAV2/9 (n = 8), Hexb-/- (n = 8) mice. Animals injected with lower dose of therapeutic vector obtained the maximal lifespan of 230 days. Animals treated with 3.5E+13 vg/kg have now 500 days compared with around 120 days in untreated Sandhoff mice. Till date, all animals treated with high dose of vector are still alive.

Figure 7: AAV2/9 guaranties the maintenance of body weight of animals treated with the highest tested dose

Figure 8: Improved performance of AAV2/9-injected animals on inverted screen test

WT animals (n = 6), Hexb-/- (n = 8), AAV2/9, dose: 1.34E10+13 (n = 6) or AAV2/9, dose:

3.5E10+13 (n = 8) were subjected to inverted screen test. Latency to fall from metal grid within

10s test decreases progressively in Hexb-/- mice, whereas the animals treated with 3.5E10+13 vg/kg obtain results identical to WT controls throughout entire experience.

Figure 9: Better performance on rotarod of AAV2/9-injected animals

147 Mice were subjected to increasing rotarod RPM, the time at which mice fell from accelerating rod was recorded for all 4 groups: WT (n = 6), Hexb-/- (n = 8), AAV2/9, 1.34E10+13 (n = 6) or AAV2/9, 3.5E10+13 (n = 8).

Figure 10: Correction of behavioural deficits following intravenous AAV2/9-Hexb delivery a. Activmeter acquisition on a 10 h night period at different time points (2, 4, 8 and 12 months) shows hyperactivity of Hexb-/- mice at 2 months compared to WT and subsequent drastic decline at 4 months. The AAV2/9 mice global movement at 2 months demonstrates intermediate value compared to Hexb-/- and WT group, but similar to the WT at all other tested time points (mean ± SEM of n = 3 per group). b. There is no significant difference of the total distance travelled at 12 months between AAV2/9 and WT animals (error bars show SEM, n =

3-4, p>0.5, t-test).

Figure 11: Correction of astrocytosis in thalamocortical system following the intravenous administration of AAV2/9-Hexb therapeutic vector

GFAP immunostaining was performed on cerebrum sections of WT, Hexb-/- and AAV2/9- treated animals at 2 and 4 months. b - Representative Nissl stained section, with brain regions of interest highlighted: 1 - somatosensory barrelfield cortex (S1BF), 2 - dorsal lateral geniculate nucleus (LGNd) 3 - ventral posteromedial / posterolateral nuclei (VPM/VPL). Hexb-/- mice show the highest GFAP immunoreactivity in VPM/VPL of the thalamus (a) already at 2 months and the reactivity builds up with time in thalamus (a) and cortex (S1BF) (c). Astrocytosis in

WT and AAV2/9 animals is absent within both analysed regions (a,c). Quantification of GFAP immunoreactivity shows the significant reduction of astrocytosis in 4 months AAV2/9-treated mice in thalamus and cortex (b,d). Error bars show SEM, n = 3-4, *** p<0.001, **** p<0.0001 using one way ANOVA.

148 Figure 12: Clearance of microgliosis in thalamocortical system following treatment with the AAV2/9-Hexb therapeutic vector

CD68 immunostaining was done on sections of cerebrum of WT, Hexb-/- and AAV2/9-treated animals at 2 and 4 months. Thalamus (a) and cortex (c) of WT controls and AAV2/9 treated animals show very rare activated microglia whereas the Hexb-/- mice present a time-dependent accumulation of microgliosis throughout cerebrum (a,c), and especially in VPM/VPL thalamic region. The quantification of CD68 immunoreactivity (b,d) shows the significant reduction of astrocytosis already in 2 mo AAV2/9-treated animals and the treatment has a long-term effect

(4 mo) both in thalamus and cortex. Error bars show SEM, n = 3-4, *** p<0.001, **** p<0.0001 using one way ANOVA.

Figure 13: Neuroprotective function of AAV2/9 treatment on the thalamocortical system of treated mice

Neuron number estimation in the thalamocortical system of 4 months old AAV2/9 treated mice revealed no significant loss of Nissl stained neurons, neither in VPM/VPL (a) nor in lamina IV of S1BF (b) in AAV2/9-treated animals. Error bars show SEM, n = 3-4, *** p<0.001, **** p<0.0001 using one way ANOVA. Scale bar: thalamus 500 µm, insert 50 µm; cortex 100 µm, insert 50 µm.

Figure 14: Significant correction of microglial activation in brainstem after AAV2/9-Hexb treatment

Quantitative thresholding image analysis of CD68 immunoreactivity in brainstem of Hexb-/- mice show consistent upregulation of this marker at 2 and 4 months compared to age-matched controls.

AAV2/9-treated mice show absence of microgliosis in every region of brainstem. This expression is comparable to WT littermates. b - Representative Nissl stained section, with brain regions of interest highlighted, Cb-Cerebellum; Bs-Brainstem; RF- reticular formation; SPV - spinal trigeminal nucleus V; DCN-deep cerebral nuclei. Higher magnification: cerebellar layers: ML-

Molecular Layer; GL-Granular Layer; WM-White Matter. Error bars show SEM, n = 3-4,

149 *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 using one-way ANOVA. Scale bar: 50 µm.

Figure 15: Significant correction of microglial activation in brainstem after AAV2/9-Hexb treatment

As for cerebrum, sections of cerebellum were stained with CD68 antibody and correction of microgliosis was seen in the case of AAV2/9 treated animals in comparison to Hex deficient mice at 2 and 4 months (a,b,e,f). Quantitative thresholding image analysis of CD68 expression within DCN (c) and all 3 layers of cerebellum (c,d,g,h) reveals significantly increased CD68 expression in Hexb-/-mice and no significant microgliosis in the case of WT and AAV2/9 receiving animals. Error bars show SEM, n = 3-4, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 using one-way ANOVA. Scale bar: 50 µm.

Figure 16: Neuron count in SPV region of brainstem and DCN region of cerebellum of 4 months old animals

Unbiased optical fractionator estimates of number of Nissl stained neurons in the brainstem and cerebellum of Hexb-/- mice, age-matched WT and AAV2/9-treated mice reveal a significant loss of neurons within spinal nucleus of the trigeminal nerve SPV (a), deep cerebellar nuclei

DCN (b), compared to WT mice. At the age of 4 months, there was no significant loss of neurons within all the analysed regions in the case of AAV2/9 samples.

SUPPLEMENTARY DATA

Figure S1: Qualitative gait analysis reveals absence of ataxic or paralysed pattern in

AAV2/9-treated mice

Footprint test was performed in WT, Hexb-/- and AAV2/9-treated animals at 4, 8 and 12 months. While Hexb-/- mice were paralysed at 4 months, AAV2/9 animals showed no gait aberrations even at 12 months.

150 Figure S2: Drastic neuroinflammation reduction in LGNd thalamic region in AAV2/9- treated mice a - Astrocytosis reduction in AAV2/9-treated animals at 4 months in comparison with significant increase of immunoreactivity. b- Microgliosis clearance in AAV2/9-treated animals at 4 months in comparison with significant increase of immunoreactivity. Error bars show SEM, n = 3-4, *p<0.05,

**p<0.01, ***p<0.001, ****p<0.0001 using one way ANOVA.

Figure S3: Astrocytosis reduction in brainstem of AAV2/9-treated mice

GFAP-immunostaining was performed on brainstem sections from WT, Hexb-/- and AAV2/9- treated animals at 2 and 4 months. In SPV and RF region of AAV2/9-treated mice as in WT animals, no significant reactive astrocytosis could be observed at both ages tested. Error bars show SEM, n = 3-4, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 using one way ANOVA.

Scale bar: 50 µm.

Figure S4: Astrocytosis reduction in cerebellum of AAV2/9-treated mice

GFAP immunostaining was performed for cerebellum sections of WT, Hexb-/- and AAV2/9- treated animals at 2 and 4 months. SEM, n = 3-4, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 using one way ANOVA. Scale bar: 50 µm.

151 %' &' ** ** * 25 10 20 8 A activity activity A 15 6 10 4 % vs WT vs % % vs WT vs %

!).)&.1,' 5 2 0 0 2 mo 4 mo Hexosaminidase 2 mo 4 mo Total Hexosaminidases activity activity Hexosaminidases Total '' (' ** 40 80

30 60

ases activity activity ases ¢

20 40 % vs WT vs % % vs WT vs %

.%+-/0),' 10 20 Hexosamini

¡ 0 0

2 mo 4 mo activity A Hexosaminidase 2 mo 4 mo Tota )' **** *' *** 50 15 ***

40 ***

ases activity activity ases 10 d 30 ase A activity activity A ase

#+2).'

20 5 % vs WT vs % % vs WT vs % 10

exosamini H

0 l 0

2 mo 4mo Hexosamini 2 mo 4mo Tota ")3&545' 11$6'

Figure 1: Partial restoration of total hexosaminidases and hexosaminidase A specific activities in brain, brainstem and liver of WT, Hexb-/- and AAV2/9-treated animals at 2 and 4 months

152

!)0)&03.' 0%-/12).' #-4)0' %' +' (' * 800 1500 ** * 400

600 300 1000 400 200 % vs WT vs % 500 WT vs % % vs WT vs % 200 100 - glucuronidase activity activity glucuronidase - - glucuronidase activity activity glucuronidase - - glucuronidase activity activity glucuronidase - ! ! ! 0 0 0 2 mo 4 mo 2 mo 4 mo 2 mo 4 mo Total Total Total Total Total Total &' )' ,'

1000 ** * * 800 400 800 600 300 600 400 200 400 % vs WT vs % % vs WT vs % % vs WT vs % 200 100 - fucosidase activity activity fucosidase - - fucosidase activity activity fucosidase -

200 activity fucosidase - ! ! !

0 0 0 2 mo 4 mo 2 mo 4 mo Total 2 mo 4 mo Total Total Total '' *' -'

1500 250 800 **** *** *** **** *** ** 200 600 1000 150 400 100 500 % vs WT vs % % vs WT vs % % vs WT vs % 200 ")5&767'

galactosidase activity activity galactosidase 50 - - - galactosidase activity activity galactosidase - - galactosidase activity activity galactosidase - ! ! ! 99$8' 0 0 0 2 mo 4 mo 2 mo 4 mo 2 mo 4 mo Total Total Total Total Total Total

Figure 2: Reduction of secondary elevation of lysosomal enzymes after the AAV2/9-Hexb treatment

153

#!# %&$('(# **")#

Figure 3: Rescue of abnormal neuronal morphology after intravenous AAV2/9 treatment

154

!" "

WT -

/ -

AAV9 Hexb

Figure 4: Lamp-1 staining showing absence of storage in cerebrum of 4 months old AAV2/9-treated mice

155

!'2-0/36/*+6" '" +5+(591"" +5+(+0091" &$" "+:(>=>" &&%A" "+:(>=>" &&%A" &$" "+:(>=>" &&%A" "+:(>=>" &&%A" GM3

GM2 GM1

GD1a

GD1b GT1b

?"13" @"13" ?"13" @"13"

(" +5+(591"" +5+(+0091"

)" !0;)364./2-30/4/*6" +5+(591"" +5+(+0091" &$" "+:(>=>" &&%A" "+:(>=>" &&%A" &$" "+:(>=>" &&%A" "+:(>=>" &&%A"

!'0> +5"

#90,'7*+6"

"!$

?"13" @"13" ?"13" @"13"

Figure 5: HPTLC analysis of gangliosides and glycosphingolipids within cerebrum and cerebellum of 2 and 4 month-old WT, Hexb-/- and AAV2/9-treated mice

156

",+-)-&*( 100

60 %#( !(.'101( 40 //$6(2/34 723( Survival (%) Survival //$6(3/5 723( 20

0 0 100 200 300 400 500 Time (days)

Figure 6: AAV2/9 significantly prolongs the life expectancy of treated animals

! #!"$'

(g) weight 10

0 8 12 16 20 24 28 32 36 40 44 48 52

Age (weeks)

Figure 7: AAV2/9 guaranties the maintenance of body weight of animals treated with the highest tested dose

157

"*.)+-)((,'+))*(-),-(

%#( !)/&212( 5 00$7(3045 834( 00$7(406 834( time on grid (seconds) grid on time 0 8 12 16 20 24 28 32 36 40 44 48 52

Age (weeks)

Figure 8: Improved performance of AAV2/9-injected animals on inverted screen test

Rotarod!"$ #"!' time 120

100

80 60

time (sec) time 40 20 0 8 12 16 20 24 28 32 36 40 44 48 52

Age (weeks)

Figure 9: Better performance on rotarod of AAV2/9-injected animals

158

15000 WT Hexb-/- AAV9 10000

5000

(s) time movement Global 0 2 mo 4 mo 8 mo 12 mo

" 80000

60000 AAV9

40000

(cm) Distance 20000

Figure 10: Correction of behavioural deficits following intravenous AAV2/9-Hexb delivery

159

+& *(& "/2,434& 55)8& ,& !"

601& " !" )&%3)&$& .& *** 100 2 mo 701& 80 4 mo

40 601& 701& -& 20

#& 0 WT Hexb-/- AAV9

##3###& Immunoreactivity % Mean GFAP

#)& /& **** 2.0 )& 2 mo

'5 !& 4 mo 1.5 )#& 1.0

0.5

0.0 WT Hexb-/- AAV9 GFAP Mean % Immunoreactivity % Mean GFAP

*(& "/2,434& 55)8& *(& "/2,434& 55)8& Figure 11: Correction of astrocytosis in thalamocortical system following the intravenous administration of AAV2/9-Hexb therapeutic vector

160

+# *(# "/2,434# **)8#

,# 80 601# **** 2 mo 4 mo 60 ***

)&%3)&$# 20

701# WT Hexb-/- AAV9 CD68 Mean % Immunoreactivity % Mean CD68

-# 601# 701# ## ##3#### .#

1.5 *** #)# 2 mo '5 !# **** 4 mo )# 1.0

)## 0.5

0.0 WT Hexb-/- AAV9 CD68 Mean % Immunoreactivity % Mean CD68

*(# "/2,434# **)8# *(# "/2,434# **)8# Figure 12: Clearance of microgliosis in thalamocortical system following treatment with the AAV2/9-Hexb therapeutic vector

161

3 %#"(%#!" $)+ " &" '" 40 * * 180 150 30 120 WT 20 90 Hexb-/- AAV9 60 10 30 0 0 WT Hexb-/- AAV9 WT Hexb-/- AAV9 Estimated neuron number x 10 x number neuron Estimated

Figure 13: Neuroprotective function of AAV2/9 treatment on the thalamocortical system of treated mice

162

(" '%" !,/)101" 00&4" )"

%# #"#

2-." )# !"# $"&" $## )&# '# (# 3-."

*" +" ," **** $"&" **** # " ** 15 * 8 2-." 2"-." 6 10 3"-." # " 4 5 2 3-." 0 0 WT Hexb-/- AAV9 WT Hexb-/- AAV9 CD68 Mean % Immunoreactivity % Mean CD68

Figure 14: Significant correction of microglial activation in brainstem after AAV2/9-Hexb treatment

163

*# .# )'# #.;+>=># **(A# )'# #.;+>=># **(A#

?46# ?46#

&# !

@46# "7*5:3*7#$*<.7# @46#

+# /#

?46# ?46#

@46# @46# )128.#%*9.7#

%63.,:3*7#$*<.7# ,# -# 0# ! &# %63.,:3*7#$# "7*5:3*7#$# 1# )128.#%*9.7## *** ** **** **** ** 1.0 * 4 ** 8 3 *** 0.8 ?#46# 6 3 @#46# 2 0.6 4 2 0.4 1 1 2 0.2 0 0 0.0 0 WT Hexb-/- AAV9 WT Hexb-/- AAV9 WT Hexb-/- AAV9 WT Hexb-/- AAV9 CD68 Mean % Immunoreactivity % Mean CD68 Immunoreactivity % Mean CD68

Figure 15: Significant correction of microglial activation in brainstem after AAV2/9-Hexb treatment

164

3 #"$" (!" %" &"

25 6 *** *** 20 4 15 WT 10 Hexb-/- 2 AAV9 5

0 0 WT Hexb-/- AAV9AAV9 WT Hexb-/- AAV9 Estimated neuron number x 10 x number neuron Estimated

Figure 16: Neuron count in SPV region of brainstem and DCN region of cerebellum of 4 months old animals

165

#!#-#&'# %($*)*#-#&'# --".##-#&'# --".##+,#&'#

Figure S1: Qualitative gait analysis reveals absence of ataxic or paralysed pattern in AAV2/9- treated mice

"!$%

"% #%

*** 100 25 ** WT 80 20 Hexb-/- AAV9 60 15

40 10

20 5

0 0 CD68 Mean % Immunoreactivity % Mean CD68 GFAP Mean % Immunoreactivity % Mean GFAP

Figure S2: Drastic neuroinflammation reduction in LGNd thalamic region in AAV2/9- treated mice

166

(# '%# !,/)101# **&4# 2-.# $"&# 3-.# )# 2-.# # # 3-.#

*# +# $"&# ** **** 5 # # 2.5 * 4 2.0 3 1.5 2#-.# 1.0 2 3#-.# 0.5 1

0.0 0 WT Hexb-/- AAV9 WT Hexb-/- AAV9

GFAP Mean % Immunoreactivity % Mean GFAP

Figure S3: Astrocytosis reduction in brainstem of AAV2/9-treated mice

167

*" ." )'" #.;+=<=" 00(@" )'" #.;+=<=" 00(@"

>46"

! &" !

"7*5:3*7"$" ?46" ?46"

+" /"

>46" >46"

%63.,:3*7"$" ?46" ?46" )128."%*9.7"

0" ," -" "7*5:3*7"$" 1" ! &" %63.,:3*7"$" )128."%*9.7""* ** 1.5 0.8 5 2.0 ** *

4 0 £ ¤ >"46" 1.5 1.0 3 ?"46" 1.0 0.4 2 0.5 0.2 1 0.5 0 0.0 0.0 0.0 WT Hexb-/- AAV9 WT Hexb-/- AAV9 WT Hexb-/- AAV9 WT Hexb-/- AAV9 GFAP Mean % Immunoreactivity % Mean GFAP GFAP Mean % Immunoreactivity % Mean GFAP

Figure S4: Astrocytosis reduction in cerebellum of AAV2/9-treated mice

168

REFERENCES

1. Phaneuf, D., et al., Dramatically different phenotypes in mouse models of human Tay-Sachs and Sandhoff diseases. Hum Mol Genet, 1996. 5(1): p. 1-14. 2. Duque, S., et al., Intravenous administration of self-complementary AAV9 enables transgene delivery to adult motor neurons. Mol Ther, 2009. 17(7): p. 1187-96. 3. Bible, E., et al., Regional and cellular neuropathology in the palmitoyl protein thioesterase-1 null mutant mouse model of infantile neuronal ceroid lipofuscinosis. Neurobiol Dis, 2004. 16(2): p. 346-59. 4. Pontikis, C.C., et al., Late onset neurodegeneration in the Cln3-/- mouse model of juvenile neuronal ceroid lipofuscinosis is preceded by low level glial activation. Brain Res, 2004. 1023(2): p. 231-42. 5. Pontikis, C.C., et al., Thalamocortical neuron loss and localized astrocytosis in the Cln3Deltaex7/8 knock-in mouse model of Batten disease. Neurobiol Dis, 2005. 20(3): p. 823-36. 6. Franklin, K.B.J., Paxinos, G., The Mouse Brain in Stereotaxic Coordinates. 3rd ed. 2007, Amsterdam: Elsevier, 2008. 7. West, M.J., L. Slomianka, and H.J. Gundersen, Unbiased stereological estimation of the total number of neurons in thesubdivisions of the rat hippocampus using the optical fractionator. Anat Rec, 1991. 231(4): p. 482-97. 8. Kielar, C., et al., Successive neuron loss in the thalamus and cortex in a mouse model of infantile neuronal ceroid lipofuscinosis. Neurobiol Dis, 2007. 25(1): p. 150-62. 9. Pressey, S.N., et al., Distinct neuropathologic phenotypes after disrupting the chloride transport proteins ClC-6 or ClC-7/Ostm1. J Neuropathol Exp Neurol. 69(12): p. 1228- 46. 10. Gundersen, H.J., et al., The efficiency of systematic sampling in stereology--reconsidered. J Microsc, 1999. 193(Pt 3): p. 199-211. 11. Fujita, N., et al., Targeted disruption of the mouse sphingolipid activator protein gene: a complex phenotype, including severe leukodystrophy and wide-spread storage of multiple sphingolipids. Hum Mol Genet, 1996. 5(6): p. 711-25. 12. Reid, P.C., et al., Partial blockage of sterol biosynthesis with a squalene synthase inhibitor in early postnatal Niemann-Pick type C npcnih null mice brains reduces neuronal cholesterol accumulation, abrogates astrogliosis, but may inhibit myelin maturation. J Neurosci Methods, 2008. 168(1): p. 15-25. 13. Kyrklund, T., Two procedures to remove polar contaminants from a crude brain lipid extract by using prepacked reversed-phase columns. Lipids, 1987. 22(4): p. 274-7. 14. Tourtellotte, W.G. and J. Milbrandt, Sensory ataxia and muscle spindle agenesis in mice lacking the transcription factor Egr3. Nat Genet, 1998. 20(1): p. 87-91. 15. Reimold, A.M., et al., Chondrodysplasia and neurological abnormalities in ATF-2- deficient mice. Nature, 1996. 379(6562): p. 262-5. 16. Jeyakumar, M., et al., Central nervous system inflammation is a hallmark of pathogenesis in mouse models of GM1 and GM2 gangliosidosis. Brain, 2003. 126(Pt 4): p. 974-87. 17. Gulinello, M., F. Chen, and K. Dobrenis, Early deficits in motor coordination and cognitive dysfunction in a mouse model of the neurodegenerative lysosomal storage disorder, Sandhoff disease. Behav Brain Res, 2008. 193(2): p. 315-9. 18. Foust, K.D., et al., Intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes. Nat Biotechnol, 2009. 27(1): p. 59-65. 19. Gray, S.J., et al., Preclinical differences of intravascular AAV9 delivery to neurons and glia: a comparative study of adult mice and nonhuman primates. Mol Ther, 2011. 19(6): p. 1058-69. 20. Pulicherla, N., et al., Engineering liver-detargeted AAV9 vectors for cardiac and musculoskeletal gene transfer. Mol Ther, 2011. 19(6): p. 1070-8.

169

21. Forsayeth, J.R. and K.S. Bankiewicz, AAV9: over the fence and into the woods. Mol Ther, 2011. 19(6): p. 1006-7. 22. Cachon-Gonzalez, M.B., et al., Effective gene therapy in an authentic model of Tay- Sachs-related diseases. Proc Natl Acad Sci U S A, 2006. 103(27): p. 10373-8. 23. Cachon-Gonzalez, M.B., et al., Gene transfer corrects acute GM2 gangliosidosis--potential therapeutic contribution of perivascular enzyme flow. Mol Ther, 2012. 20(8): p. 1489-500. 24. Conzelmann, E. and K. Sandhoff, Partial enzyme deficiencies: residual activities and the development of neurological disorders. Dev Neurosci, 1983. 6(1): p. 58-71. 25. Sands, M.S., et al., Murine mucopolysaccharidosis type VII: long term therapeutic effects of enzyme replacement and enzyme replacement followed by bone marrow transplantation. J Clin Invest, 1997. 99(7): p. 1596-605. 26. Vogler, C., et al., Transgene produces massive overexpression of human beta -glucuronidase in mice, lysosomal storage of enzyme, and strain-dependent tumors. Proc Natl Acad Sci U S A, 2003. 100(5): p. 2669-73. 27. Birkenmeier, E.H., et al., Increased life span and correction of metabolic defects in murine mucopolysaccharidosis type VII after syngeneic bone marrow transplantation. Blood, 1991. 78(11): p. 3081-92. 28. Sands, M.S., et al., Enzyme replacement therapy for murine mucopolysaccharidosis type VII. J Clin Invest, 1994. 93(6): p. 2324-31. 29. Meikle, P.J., et al., Diagnosis of lysosomal storage disorders: evaluation of lysosome- associated membrane protein LAMP-1 as a diagnostic marker. Clin Chem, 1997. 43(8 Pt 1): p. 1325-35. 30. Fukuda, M., Lysosomal membrane glycoproteins. Structure, biosynthesis, and intracellular trafficking. J Biol Chem, 1991. 266(32): p. 21327-30. 31. Sands, M.S. and B.L. Davidson, Gene therapy for lysosomal storage diseases. Mol Ther, 2006. 13(5): p. 839-49. 32. Cachon-Gonzalez, M.B., et al., Reversibility of neuropathology in Tay-Sachs related diseases. Hum Mol Genet. 33. Sango, K., et al., Mouse models of Tay-Sachs and Sandhoff diseases differ in neurologic phenotype and ganglioside metabolism. Nat Genet, 1995. 11(2): p. 170-6. 34. Wada, R., C.J. Tifft, and R.L. Proia, Microglial activation precedes acute neurodegeneration in Sandhoff disease and is suppressed by bone marrow transplantation. Proc Natl Acad Sci U S A, 2000. 97(20): p. 10954-9. 35. Workman, A.D., et al., Modeling transformations of neurodevelopmental sequences across mammalian species. J Neurosci, 2013. 33(17): p. 7368-83. 36. Clancy, B., et al., Extrapolating brain development from experimental species to humans. Neurotoxicology, 2007. 28(5): p. 931-7.

170

Discussion and perspectives

171

The previously presented results were based on a single systemic injection using a specific AAV9 vector in the mouse model of Sandhoff disease during the neonatal period. Contrarily to the intraparenchymal administration that requires multiple injections of the AAV vector for distributing lysosomal enzymes globally into the brain (Passini, et al. 2002), our approach offers the potential advantages of 1) a single injection and 2) a systemic delivery, resulting in a global brain (hindbrain, cerebellum, brainstem) and body (liver) transduction. However, some questions still need to be addressed.

What is the critical period for an efficient administration of the AAV9 vector ?

The moment of injection can dramatically influence the delivery of a transgene carried by an AAV vector (Bostick, et al. 2007). In several lysosomal storage diseases, such as mucopolysaccharidoses, Hurler disease, Tay-Sachs disease or globoid cell leukodystrophy, even if pathology already begins in fetal period, substantial therapeutic benefits were observed after neonatal gene therapy in mouse and dog models (Kamata, et al. 2003; Ponder, et al. 2002; Xu, et al. 2002). When using AAV9 vectors, the age of recipient seems to play a minimal role in striated muscles and lungs. However, important differences do exist when considering aorta, liver, kidney, retina (Bostick, et al. 2007) and brain (Foust, et al. 2009). Indeed, intravenously administered AAV9 has demonstrated its efficacy in targeting CNS (Foust, et al. 2009; Rahim, et al. 2011), but with age-related transduction efficiency and cell-specific tropism (Foust, et al. 2010). Thus, neonatal systemic administration produced global delivery to the central (brain, spinal cord, and all layers of the retina) and peripheral (myenteric plexus and innervating nerves) nervous system, with mainly neuronal transduction while adult AAV9-treated animals show rather astroglial expression (Duque, et al. 2009; Foust, et al. 2009; Rahim, et al. 2011). This data suggests an increased vascular permeability in the early postnatal period and therefore, a capacity to cross BBB actively rather than by passive endocytosis through the tight junctions of endothelial cells. Studies imply that the “switch” in targeted cell types occurs within the first 10 days of life as demonstrated by a progressive decline in mice motoneuron transduction between P2 and P10 (Foust, et al. 2010). BBB crossing capacities are also influenced by the route of administration. AAV9 injected intraparenchymally in mice displays a nearly exclusive neuronal tropism (Cearley, et al. 2008; Foust, et al. 2009; Gray, et al. 2010), contrarily to systemic delivery. This could be potentially explained by the fact that, when

172 crossing the BBB, the vector is firstly exposed to endothelium, pericytes, and astrocytic cells before it has access to neurons (Rubin and Staddon 1999). In adult mice, different transduction profiles were observed for the AAV9 vector. The extensive transduction of neural tissue throughout the brain and spinal cord showed neurons outnumbering astrocytes ~2:1 in the hippocampus and striatum, and 1:1 in the cortex (Gray, et al. 2011b). In juvenile non-human primates, following an intravascular AAV9 treatment, mostly astrocytic transduction with considerably lower neuronal expression was observed (Gray, et al. 2011b). This was supposedly due to the maturity of CNS at time of vector administration and it could hypothetically influence future potential treatment. Since patients at different stages of the disease evolution are the potential candidates for a gene therapy treatment, it is essential to determine the extent to which the disease can be stopped, prevented or reversed. Usually, children with GM2 gangliosidosis are born from parents unaware of their carrier status and months or years may pass before the first manifestations are recognized and diagnosed. As a result, patients present diverse signs of the disease as well as varying degrees of disability, and early intervention is problematic. Therefore, in an effort to translate our encouraging results to the clinic, the feasibility and tolerability of our approach need now to be evaluated in adult Hexb-/- mice and further in large animal model, in order to test a condition closer to the clinic. It has already been shown that many traits of the Sandhoff mouse phenotype, such as motor function, histopathological features and premature death can be prevented and/or reversed by the expression of human β-hexosaminidase after gene transfer in young adult mouse brain (Cachon-Gonzalez, et al. 2006; Cachon-Gonzalez, et al. 2012). Therefore, the lack of β- hexosaminidase A and B during brain development possibly does not have an irreversible negative impact on brain functions. Moreover, when the Hexb gene is silenced at five weeks of age in an inducible Sandhoff model, disease progresses similarly as in the germline Hexb knock-out mouse, pointing to the absence of developmental events modifying the course of the disease (Sargeant, et al. 2012). However, some difficulties are present when considering adult mice delivery, among which irreversible pathophysiological changes. The upregulation of inflammatory markers is already detectable by one month of age in SD mice (Jeyakumar, et al. 2003; Wada, et al. 2000). The recent results of Cachon-Gonzalez et al. (Cachon-Gonzalez, et al. 2013) showed that animals intracranially treated with rAAV2/1α + rAAV2/1β in adulthood manifested reduction of glycoconjugates storage and clearance of neuroinflammation. Mice injected bilaterally into the striatum and cerebellum at 4, 8, 10 or 12 weeks of age presented significant lifespan increase (615, 233, 292 and 126 days respectively) indicating that in order to rescue the

173 pathologic phenotype, such treatment should be given as early as possible. Moreover, the presented results clearly stated the presence of a restricted temporal opportunity in which function and survival can be improved, but when a critical point is reached, the functional deterioration and death cannot be prevented even if phenotypic features such as storage or neuroinflammation are cleared (Cachon-Gonzalez, et al. 2013). Furthermore, large amounts of vector are required to obtain a sufficient expression of the therapeutic protein in order to ameliorate or prevent the disease, since from birth to adulthood, the human body mass in approximately 20-fold higher than in mice.

Is it necessary to administer one or both hexosaminidase subunits ?

In physiological conditions, the α and β subunits dimerize in order to create the functional β-hexosaminidase isoenzymes. It has been shown that co-transduction of AdHEXA and AdHEXB is required for an effective Hex A production in the mouse model of Tay-Sachs disease (Guidotti, et al. 1999). The α–subunit produced in excess has been described was not able to heterodimerize with endogenous β-subunit that was present at low limiting level. In the adult Sandhoff model, after the single stratial administration of an AAV2/2α+β or AAV2/2β leaded to widespread sustained activity (Cachon-Gonzalez, et al. 2006). Enzymatic activity was extended rostrally to the olfactory bulbs and caudally to spinal cord. β-hexosaminidase staining was seen in neuronal cell bodies and axonal tracts (spinal cord) and no difference in the distribution or staining intensity were observed between animals analysed after 3 or 30 weeks after injection. Reduction of the storage was evident in the ipsilateral cerebral hemisphere, but GM2 and GA2 storage continued after single injection of the vector and only multiple injections permitted greater decrease of ganglioside. The stereotaxic treatment with single stratial injection resulted only in unilateral preservation of motor function, correlated directly with the high expression of β-hexosaminidase within the injection site (right sensorimotor cortex) and the retrograde axonal transport region (left pyramidal tract, grey matter). Although the hexosaminidase expression was induced by single vector harbouring the β-subunit alone, the longest survival (a mean of 304 days) and delayed onset of the disease was observed in animals receiving four inoculations of rAAV2/2 β vector. Moreover, even after multiple cerebral injections, animals developed bradykinesia, ataxia, and impaired motor function. Even if the weight has been maintained for over a year, it started to decrease after this point. More recent study shows that the infusion of 1-month-old Hexb-/- mice with rAAV2/1α + rAAV2/1β (human transgenes) at a single site into the striatum enables the

174 abundant expression of Hex A, Hex B, and Hex S isozymes, but the single rAAV2/1β infusion leads only to Hex B expression (Cachon-Gonzalez, et al. 2012). However, the single-site intervention were insufficient to secure long-term rescue of the disease with global effects in the nervous system even if mean total hexosaminidase activity was 15-fold greater than wild type, and isozyme analysis indicated 95% Hex A. In our approach based on the intravenous injection of AAV2/9-Hexb, the amount of produced enzyme from the vector is significantly lower. The increase of Hex A specific activity was around 15% of WT within the hemispheres and 30% in brainstem and liver, a level which offers more physiological levels of the enzyme and possibly could be sufficient.

Are they still unknown aspects in the neurohistopathology of Sandhoff disease ? Although known for over 15 years, the Sandhoff murine model is still not fully understood. Investigation of the progressive CNS pathology has provided insights into the mechanisms of disease, as well as on the impact on different cell types, populations of neurons or parts of the brain. It offers robust landmarks useful for assessing the beneficial effects of new therapies in preclinical studies. There is increasing evidence pointing towards an innate inflammatory response within the nervous system. Microglial and astroglial cells play a key role in the development and maintenance of this response. Their enhanced proliferation and activation negatively contributes to disease progression. Recently, novel hallmarks of the pathology have been examined by our collaborators in the Sandhoff model (Pressey S., unpublished data). Few conclusions can be made according to this study and some of them will be discussed briefly.

Thalamus as a focus point of the pathology

There is a complex relationship between the thalamic and cortical neurons in the murine brain, two parts being structurally and functionally linked (Jones 1998). Normally, in the thalamocortical system, the majority of thalamic relay neurons project to lamina IV granule cells in the cortex, with collateral innervations to lamina VI. Subsequently, cortical feedback neurons, which project to the thalamus, originate in lamina VI.

175

a b Figure 26 : Representation of the thalamocortical system in mouse brain. a. In physiological conditions, the majority of thalamic nervous fibers project to lamina IV of the cortex, with collateral innervations to lamina VI where the feedback neurons originate connecting the cortex with the thalamus. b. In Sandhoff mice, the earliest neuron loss was evident in the feedback neurons of lamina VI, subsequently progressing to the thalamus and lamina IV cortical neurons. Adapted from (von Schantz et al., 2009).

In Hexb-/- mice, the neuropathological alterations of the CNS seem to be particularly pronounced within the thalamocortical system. As soon as 4 weeks after birth, lamina VI of the somatosensory cortex, showed reduced neuron number compared to controls and, by the age of 2 months, this process was subsequently followed by the significant loss in several thalamic nuclei and lamina IV cortical neurons, illustrating the staging of neuron apoptosis occurring in interconnected regions. The progressive neuron loss in Hexb-/- mice, already evident from 2 months of age, was present in several nuclei of the thalamus displaying the earliest and most profound gliosis. Before the apoptosis is evident, presynaptic markers are aggregated in the region of thalamus acting as a hallmark of early neuronal loss events. The neurons are lost very early in disease progression and this phenomenon is accompanied or followed by profound reactive gliosis in specific regions of the brain.

Synaptic impairment

The synapse is the site of close interaction between neurons and glia where astrocytes play essential roles in development of the healthy brain and disease (Benarroch 2005). Asrocytes have been implicated in the elimination of excess synapses throughout the normal brain during development (Stevens, et al. 2007). In neurodegenerative diseases, the complement proteins activation, together with other molecules of the immune response are involved in pathological processes through the initiation of the complement cascade (Schafer and Stevens 2010) which in turn drives the subsequent phagocytic microglia activation, loss of neurons and disease progression (Gasque 2004; Stephan, et al. 2012). In fact, those pathways

176 have been reported to play a role in early synapses targeting in Alzheimer disease (Fonseca, et al. 2004) or amyotrophic lateral sclerosis (ALS) Fonseca, et al. 2004)Alexander et al., 2008). Axonal abnormalities have previously been described in feline (Walkley, et al. 1990a; Walkley, et al. 1991; Walkley, et al. 1990b) and human GM2 gangliosidosis (Walter and Goebel 1988). In Sandhoff patients, the elevation of complement components was evident in gene expression analysis (Myerowitz, et al. 2002) (Myerowitz et al., 2002) and in Hexb-/- mice (Wada, et al. 2000) and synaptic rearrangements were reported to occur at sites of glial activation suggesting that pronounced reactive gliosis might contribute to synaptic pathology. The synaptic alterations are also present in deficient animals showing localised redistribution of presynaptic proteins in subcortical structures of grey and white matter. This aspect implies possible perturbations in regional neurotransmission, as it seems that some presynaptic markers fail to reach the nerve terminals due to aggregation within axonal spheroids in the white matter, especially in brain regions with the most abundant microgliosis. Therefore, the axonal transport of these proteins seems to be profoundly disturbed in SD mice, even early in disease development (Pressey S, unpublished 2013).

Figure 27: Distinct staging of pathology in the thalamus and cortex of Hexb-/- mice.

Cortex: A low level of astrocytosis and microglial activation was already evident in 1 month old Hexb-/- mice, which was accompanied by neuron loss in lamina VI. Subsequently, neuron loss also became evident in lamina IV at 2 months of age and only much later in disease progression, localised more intense astrocytosis became evident in lamina IV and VI of the S1BF. Thalamus: a low level of glial activation was also apparent in 1 month old Hexb-/- mice, which was accompanied by presynaptic rearrangements. In this case, localised patches of more intense reactive gliosis became evident concurrently with neuron loss. (lam : lamina).

177

Can immunity alter the success of gene transfer in Sandhoff disease ?

Administration of AAV vectors in rodents induces a strong humoral immune response directed toward capsid proteins (Baker, et al. 2005; Xiao, et al. 2000). For several serotypes, a way of delivery was described determining the qualitative nature of the host organism immune response. The intramuscular injection of AAV2 results in transduction of muscle fibers without activating destructive T-cell responses even with transgenes encoding foreign proteins (Fisher, et al. 1997; Jooss, et al. 1998; Xiao, et al. 1996), but parenteral administration of AAV induces neutralizing antibodies blocking efficient delivery of the transgene. Moreover, the AAV-2 vector directed to the liver in rodents and nonhuman primates by intravenous injection or by splenic injections leads to a T-cell-independent or T-cell-dependent B cells response, respectively (Xiao, et al. 2000). Additionally, it has been documented that the route of delivery of AAV-based vaccines influences the outcome of the subsequent immune response (Xin, et al. 2001) (Brockstedt, et al. 1999). When the intranasal, subcutaneous, intramuscular and intraperitoneal routes of delivery of AAV carrying HIV antigens were compared for their responses, all cell-mediated and humoral immunity reactions had equal efficiencies, although the intramuscular route was shown to produce the highest IgG antibody titres, whereas the intranasal route produced the highest IgA responses. The systemic administration of AAV vectors offers clinical challenges, including different immune responses that can unable efficient gene transfer. AAVs can induce capsid- specific cytotoxic T lymphocyte (CTL) responses, resulting in the elimination of transgene- bearing cells and the subsequent loss of transgene expression due to prior exposure to wild-type AAV and to “memory” T cells (Manno, et al. 2006). The AAV capsid epitopes being presented on the major histocompatibility complex class I (MHC-I) molecules cause the T cell–mediated clearance (Mingozzi, et al. 2007). Although in our work, the immune response toward the transgene and/or the capsid is unlikely since the results of the transgene expression were visible at long-term, this needs to be confirmed by direct evidence. To overcome those potential difficulties, transient immune suppression can be applied. However, this technique does not guarantee the efficiency for all subjects and all vector doses. In severe hemophilia B patients, a single-stranded AAV2 vector coding for the factor IX transgene was delivered through the hepatic artery (Nathwani, et al. 2011), but the positive results (factor IX plasma levels up to ~10% of normal rate) were only observed in one subject receiving the highest vector dose. In the other patients, a significant level of anti-AAV neutralizing antibodies (NAb) was detected prior to therapy and the gene was silenced pointing to the importance of the immune response in transgene expression. In second clinical trial, a

178 self-complementary AAV8 vector expressing the factor IX transgene was administered through peripheral vein infusion (Manno, et al. 2006). All subjects enrolled had evidence of transgene expression above baseline levels, even though some of the subjects had low, but detectable levels of anti-AAV8 NAbs (Nathwani, et al. 2011). The difference between the two approaches was issued from the preparation protocol. The AAV2 vector preparation was done in empty capsid– free manner (Wright 2008), whereas the AAV8 vector contained a 5-fold to 10-fold excess of empty capsids (Allay, et al. 2011). This indicates that the empty capsids could have an impact on the immune response and transgene efficiency. This hypothesis has been recently tested by Mingozzi and coll. (Mingozzi, et al. 2013) showing how to overcome the preexisting humoral immunity to AAV, thanks to the use of capsid decoys. By introducing the empty capsids with the gene therapy vector, the neutralizing antibody response to AAV would be directed to the decoy, allowing for successful gene therapy even in the presence of AAV preexisting antibodies. It has been found that varying the ratio of empty capsid to gene therapy vector could successfully inhibit the neutralizing antibody response in both human serum and a mouse model. By mutating the receptor-binding site of AAV capsid, its affinity to the antibody stayed intact, while the affinity towards target cells was inhibited, increasing the safety profile of this technique. The authors stated several advantages like no need for chemical modification of the AAV vector or AAV empty capsids, the ability to produce highly concentrated mutant capsids while keeping good manufacturing practice rules, no mutant capsids competition between receptor binding vector and therapeutic vector. Furthermore, the technique provides a simple adjustment system in a dose-dependent manner: empty capsid content can be regulated according to the subject NAb titer. This approach is potentially effective with a wide range of AAV serotypes. It has already been tested with success in mouse and rhesus macaque and needs now to be tested in AAV9-mediated transduction.

179

ABBREVIATIONS

180

AAV Adeno-associated virus

ALS Amyotrophic lateral sclerosis

Ad Adenovirus

ANOVA Anaysis of variance

BBB Blood-brain barrier

BCR B cell receptors

BMT Bone marrow transplantation bp base pairs

CB Chicken β Actin promoter

CBA β-actin/CMV promoter

CBh Chicken β Actin Short promoter

CC Corticosterone

CCR2 C-C chemokine receptor type 2

CD-MPR Cation-dependent-MPR cDNA Complementary DNA

CE Coefficient of error

CED Convection-enhanced delivery

Cer Ceramide

CHO Chineese hamster ovary

CI-MPR Cation-independent M6P receptor

CMV Cytomegalovirus

CNS Central nervous system

CR Caloric restriction

CSF Cerebrospinal fluid

CTL Cytotoxic T lymphocyte

181 DAB 3,3’- diaminobenzidine tetrahydrochloride

DBS Dried blood spots

DCN Deep cerebellar nuclei

DGJ Deoxygalactonojirimycine

DNA Deoxyrybonucleic acid

DNJ Deoxynojirimycine

DRG Dorsal root ganglion

EMG Electromyography

ER Endoplasmic reticulum

ERAD Endoplasmic reticulum associated degradation pathway

ERT Enzyme replacement therapy

EtDO-PIP2 Ethylenedioxy-PIP2 Oxalate

FcRγ Fc receptor γ

FDA Federal drug agency

FGFR1 Fibroblast growth factor receptor 1

FUS Focused ultrasound

Gal Galactose

GalNac N-acetyl galactosamine

GCS Glucosylceramide synthase

GFAP Glial fibrillary acidic protein

GFP Green flurescent protein

Glc Glucose

GM2A GM2 activator

GM2AP GM2 activator protein

GSL Glycosphingolipid

GUSB β-glucuronidase

HEX β-hexosaminidase

182 hHGFR Human hepatocyte growth factor receptor

HIV Human immunodeficiency virus

HU Hydroxyurea icv Intracerebroventricular

IDUA α-L-iduronidase

IFN-γ Interferon γ

IGb3 Isoglobotrihexosylceramide

IGF II Insulin like growth factor II

IL1β Interleukin-1 β iNKT Invariant natural killer T-cells

IRES Internal ribosome entry site

ITR Inverted terminal repeat kb kilobase

KD-R Restricted ketogenic diet

KO Knock-out

LamR Laminin receptor

LGNd Dorsal lateral geniculate nucleus

LIMP-2 Lysosomal integral membrane protein type 2

LSD Lysosomal storage disease

Lys Lysosome

M6PR Mannose-6-phosphate receptors

ManR Mannose receptor

MBP Myelin basic protein (promoter)

MDR1 Multidrug Resistance 1

MeCP2 Methyl CpG binding protein 2 (promoter)

MeP Miniversion of MeCP2 (promoter)

MHC Major histocompatibility complex

183 MIP-1α Macrophage inflammatory protein 1 α

MLD Metachromatic leukodystrophy

MLPA Multiplex ligation dependent probe amplification

MN Motoneuron

MPS Mucopolysaccharidose mRNA Messenger Ribonucleic acid

MUG 4-methylumbelliferyl-β-N-acetyl glucosaminide

MUGS 4-methylumbelliferyl-β-N-acetylglucosaminide-6-sulfate

NAb Neutralising antibodies

NB-DGJ N-butyldeoxygalactonojirimycin

NB-DNJ N-butyldeoxynojirimycin

NCL Neuronal ceroid lipofuscinosis

Neu4 Neuraminidase 4

NeuAc N-acetylneuraminic acid

NF-κB Noncanonical nuclear factor κ-light-chain-enhancer of activated B cells

NHP Non-human primate

NIK NF-kappa-B-inducing kinase

NSAID Non-steroid anti-inflammatory drugs

NSE Neuron-specific enolase

ORF Open reading frame

PAS Periodic-acid-Schiff

PBMC Peripheral blood mononuclear cell

PC Pharmacological chaperones

PCR Polymerase chain reaction

PDGF-β Platelet-derived growth factor subunit B

PDMP D,L-threo-1-phenyl-2-decanoylamino-3-morpholino-1-propanol

184 PFA Paraformaldehyde

PGK Phosphoglycerate kinase

PNS Peripheral nervous system

PPMP 1-phenyl-2-palmitoylamino-3-morpholino-1-propanol

PYR Pyrimethamine rAAV Recombinant AAV

RE Reticuloendothelial system

RF Reticular formation

RNA Ribonucleic acid

S1BF Somatosensory barrelfield cortex

SAPs Sphingolipid activator proteins scAAV Self-complementary AAV

SD Sandhoff disease

SEM Standard error of the mean

SERCA Sarco/endoplasmic reticulum Ca++ATPase

SIV Simian immunodeficiency virus

SMA Spinal muscular atrophy

SPV Spinal Nucleus V

SRT Substrate reduction therapy ssAAV Single-stranded AAV

ST-I LacCer α2–3 sialyltransferase

ST-II GM3 α2–8 sialyltransferase

ST-III GD3 α2–8 sialyltransferase

TBS Tris buffered saline

TGFβ1 Transforming growth factor β 1

TNFα Tumor necrosis factor α

185 TR Terminal repeats trs Terminal resolution site

TSD Tay-Sachs disease

UTR Untranslated region vg Viral genomes

VP1 Viral protein 1

VPM/VPL Ventral Posteromedial Nucleus/Ventral Posterolateral Nucleus

WPRE Woodchuck hepatitis virus element posttranscriptional regulator

WT Wild-type

186

REFERENCES

187

Abbott, N. J., L. Ronnback, and E. Hansson 2006 Astrocyte-endothelial interactions at the blood-brain barrier. Nat Rev Neurosci 7(1):41-53. Abe, A., et al. 2000 Use of sulfobutyl ether beta-cyclodextrin as a vehicle for D-threo-1-phenyl-2- decanoylamino-3-morpholinopropanol-relat ed glucosylceramide synthase inhibitors. Anal Biochem 287(2):344-7. Abo-Ouf, H., et al. 2013 Deletion of tumor necrosis factor-alpha ameliorates neurodegeneration in Sandhoff disease mice. Hum Mol Genet. Adachi, M., E. W. Keefer, and F. S. Jones 2005 A segment of the Mecp2 promoter is sufficient to drive expression in neurons. Hum Mol Genet 14(23):3709-22. Akache, B., et al. 2006 The 37/67-kilodalton laminin receptor is a receptor for adeno-associated virus serotypes 8, 2, 3, and 9. J Virol 80(19):9831-6. Akerman, B. R., et al. 1992 A mutation common in non-Jewish Tay-Sachs disease: frequency and RNA studies. Hum Mutat 1(4):303-9. Akli, S., et al. 1996 Restoration of hexosaminidase A activity in human Tay-Sachs fibroblasts via adenoviral vector-mediated gene transfer. Gene Ther 3(9):769-74. Alfonso, P., et al. 2005 Miglustat (NB-DNJ) works as a chaperone for mutated acid beta-glucosidase in cells transfected with several Gaucher disease mutations. Blood Cells Mol Dis 35(2):268- 76. Allay, J. A., et al. 2011 Good manufacturing practice production of self-complementary serotype 8 adeno-associated viral vector for a hemophilia B clinical trial. Hum Gene Ther 22(5):595-604. Andersson, U., et al. 2000 N-butyldeoxygalactonojirimycin: a more selective inhibitor of glycosphingolipid biosynthesis than N-butyldeoxynojirimycin, in vitro and in vivo. Biochem Pharmacol 59(7):821-9. Andersson, U., et al. 2004 Improved outcome of N-butyldeoxygalactonojirimycin-mediated substrate reduction therapy in a mouse model of Sandhoff disease. Neurobiol Dis 16(3):506-15. Arfi, A., et al. 2005 Bicistronic lentiviral vector corrects beta-hexosaminidase deficiency in transduced and cross-corrected human Sandhoff fibroblasts. Neurobiol Dis 20(2):583- 93. Arfi, A., et al. 2006 Reversion of the biochemical defects in murine embryonic Sandhoff neurons using a bicistronic lentiviral vector encoding hexosaminidase alpha and beta. J Neurochem 96(6):1572-9. Arthur, J. R., et al. 2012 Therapeutic effects of stem cells and substrate reduction in juvenile Sandhoff mice. Neurochem Res 37(6):1335-43. Aryan, H., et al. 2012 Novel Mutations in Sandhoff Disease: A Molecular Analysis among Iranian Cohort of Infantile Patients. Iran J Public Health 41(3):112-8. Baek, R. C., et al.

188 2009 Comparative analysis of brain lipids in mice, cats, and humans with Sandhoff disease. Lipids 44(3):197-205. Baker, A. H., et al. 2005 Cell-selective viral gene delivery vectors for the vasculature. Exp Physiol 90(1):27-31. Baker, A. H., et al. 2007 The influence of blood on in vivo adenovirus bio-distribution and transduction. Mol Ther 15(8):1410-6. Baker, H. J., et al. 1979 The gangliosidoses: comparative features and research applications. Vet Pathol 16(6):635-49. Banerjee, P., et al. 1994 Preferential beta-hexosaminidase (Hex) A (alpha beta) formation in the absence of beta-Hex B (beta beta) due to heterozygous point mutations present in beta-Hex beta-chain alleles of a motor neuron disease patient. J Biol Chem 269(7):4819-26. Bankiewicz, K. S., et al. 2000 Technique for bilateral intracranial implantation of cells in monkeys using an automated delivery system. Cell Transplant 9(5):595-607. Bantel-Schaal, U., and H. zur Hausen 1984 Characterization of the DNA of a defective human parvovirus isolated from a genital site. Virology 134(1):52-63. Batista, L., et al. 2010 Induced secretion of beta-hexosaminidase by human brain endothelial cells: a novel approach in Sandhoff disease? Neurobiol Dis 37(3):656-60. Bayleran, J., P. Hechtman, and W. Saray 1984 Synthesis of 4-methylumbelliferyl-beta-D-N-acetylglucosamine-6-sulfate and its use in classification of GM2 gangliosidosis genotypes. Clin Chim Acta 143(2):73-89. Bemelmans, A. P., et al. 2013 A Single Intravenous AAV9 Injection Mediates Bilateral Gene Transfer to the Adult Mouse Retina. PLoS One 8(4):e61618. Benarroch, E. E. 2005 Neuron-astrocyte interactions: partnership for normal function and disease in the central nervous system. Mayo Clin Proc 80(10):1326-38. Benjamin, E. R., et al. 2012 Co-administration with the pharmacological chaperone AT1001 increases recombinant human alpha-galactosidase A tissue uptake and improves substrate reduction in Fabry mice. Mol Ther 20(4):717-26. Bennett, D., et al. 2012 Further Reduction in Adenovirus Vector-Mediated Liver Transduction without Largely Affecting Transgene Expression in Target Organ by Exploiting MicroRNA- Mediated Regulation and the Cre-loxP Recombination System. Mol Pharm. Bernales, S., F. R. Papa, and P. Walter 2006 Intracellular signaling by the unfolded protein response. Annu Rev Cell Dev Biol 22:487-508. Berns, K. I., and S. Adler 1972 Separation of two types of adeno-associated virus particles containing complementary polynucleotide chains. J Virol 9(2):394-6. Bikker, H., et al. 1989 Demonstration of a Sandhoff disease-associated autosomal 50-kb deletion by field inversion gel electrophoresis. Hum Genet 81(3):287-8. Bikker, H., et al. 1990 Distribution and characterization of a Sandhoff disease-associated 50-kb deletion in the gene encoding the human beta-hexosaminidase beta-chain. Hum Genet 85(3):327-9. Blankinship, M. J., et al. 2004 Efficient transduction of skeletal muscle using vectors based on adeno- associated virus serotype 6. Mol Ther 10(4):671-8.

189 Bobo, R. H., et al. 1994 Convection-enhanced delivery of macromolecules in the brain. Proc Natl Acad Sci U S A 91(6):2076-80. Bolhuis, P. A., and H. Bikker 1992 Deletion of the 5'-region in one or two alleles of HEXB in 15 out of 30 patients with Sandhoff disease. Hum Genet 90(3):328-9. Bolhuis, P. A., et al. 1993 Molecular basis of an adult form of Sandhoff disease: substitution of glutamine for arginine at position 505 of the beta-chain of beta-hexosaminidase results in a labile enzyme. Biochim Biophys Acta 1182(2):142-6. Bosch, A., et al. 2000a Long-term and significant correction of brain lesions in adult mucopolysaccharidosis type VII mice using recombinant AAV vectors. Mol Ther 1(1):63- 70. Bosch, A., et al. 2000b Reversal of pathology in the entire brain of mucopolysaccharidosis type VII mice after lentivirus-mediated gene transfer. Hum Gene Ther 11(8):1139-50. Bossis, I., and J. A. Chiorini 2003 Cloning of an avian adeno-associated virus (AAAV) and generation of recombinant AAAV particles. J Virol 77(12):6799-810. Bostick, B., et al. 2007 Systemic AAV-9 transduction in mice is influenced by animal age but not by the route of administration. Gene Ther 14(22):1605-9. Bourgoin, C., et al. 2003 Widespread distribution of beta-hexosaminidase activity in the brain of a Sandhoff mouse model after coinjection of adenoviral vector and mannitol. Gene Ther 10(21):1841-9. Brockstedt, D. G., et al. 1999 Induction of immunity to antigens expressed by recombinant adeno-associated virus depends on the route of administration. Clin Immunol 92(1):67-75. Broekman, M. L., et al. 2006 Adeno-associated virus vectors serotyped with AAV8 capsid are more efficient than AAV-1 or -2 serotypes for widespread gene delivery to the neonatal mouse brain. Neuroscience 138(2):501-10. Brown, C. A., and D. J. Mahuran 1993 beta-Hexosaminidase isozymes from cells cotransfected with alpha and beta cDNA constructs: analysis of the alpha-subunit missense mutation associated with the adult form of Tay-Sachs disease. Am J Hum Genet 53(2):497-508. Brown, C. A., et al. 1992 Characterization of two HEXB gene mutations in Argentinean patients with Sandhoff disease. Biochim Biophys Acta 1180(1):91-8. Brownstein, S., et al. 1980 Sandhoff's disease (GM2 gangliosidosis type 2). Histopathology and ultrastructure of the eye. Arch Ophthalmol 98(6):1089-97. Brumshtein, B., et al. 2007 Crystal structures of complexes of N-butyl- and N-nonyl-deoxynojirimycin bound to acid beta-glucosidase: insights into the mechanism of chemical chaperone action in Gaucher disease. J Biol Chem 282(39):29052-8. Burg, J., A. Banerjee, and K. Sandhoff 1985 Molecular forms of GM2-activator protein. A study on its biosynthesis in human skin fibroblasts. Biol Chem Hoppe Seyler 366(9):887-91. Cachon-Gonzalez, M. B., et al. 2006 Effective gene therapy in an authentic model of Tay-Sachs-related diseases. Proc Natl Acad Sci U S A 103(27):10373-8. Cachon-Gonzalez, M. B., et al. 2012 Gene transfer corrects acute GM2 gangliosidosis--potential therapeutic contribution of perivascular enzyme flow. Mol Ther 20(8):1489-500. Cachon-Gonzalez, M. B., et al.

190 2013 Reversibility of neuropathology in Tay-Sachs related diseases. Hum Mol Genet. Cairns, L. J., W. R. Green, and H. S. Singer 1984 GM1 gangliosidosis, type 2: ocular clinicopathologic correlation. Graefes Arch Clin Exp Ophthalmol 222(2):51-62. Cao, Z., et al. 1997 Benign HEXA mutations, C739T(R247W) and C745T(R249W), cause beta- hexosaminidase A pseudodeficiency by reducing the alpha-subunit protein levels. J Biol Chem 272(23):14975-82. Cashman, N. R., et al. 1986 N-acetyl-beta-hexosaminidase beta locus defect and juvenile motor neuron disease: a case study. Ann Neurol 19(6):568-72. Cearley, C. N., et al. 2008 Expanded repertoire of AAV vector serotypes mediate unique patterns of transduction in mouse brain. Mol Ther 16(10):1710-8. Chamoles, N. A., et al. 2002 Tay-Sachs and Sandhoff diseases: enzymatic diagnosis in dried blood spots on filter paper: retrospective diagnoses in newborn-screening cards. Clin Chim Acta 318(1- 2):133-7. Chen, H., et al. 1998 Gene transfer and expression in oligodendrocytes under the control of myelin basic protein transcriptional control region mediated by adeno-associated virus. Gene Ther 5(1):50-8. Chen, Y. H., M. Chang, and B. L. Davidson 2009 Molecular signatures of disease brain endothelia provide new sites for CNS- directed enzyme therapy. Nat Med 15(10):1215-8. Cheng, B., et al. 2012 Development of optimized AAV3 serotype vectors: mechanism of high-efficiency transduction of human liver cancer cells. Gene Ther 19(4):375-84. Cherukuri, A., et al. 2004 Isolation of lipid rafts from B lymphocytes. Methods Mol Biol 271:213-24. Clarke, J. T., et al. 2011 An open-label Phase I/II clinical trial of pyrimethamine for the treatment of patients affected with chronic GM2 gangliosidosis (Tay-Sachs or Sandhoff variants). Mol Genet Metab 102(1):6-12. Conzelmann, E., and K. Sandhoff 1978 AB variant of infantile GM2 gangliosidosis: deficiency of a factor necessary for stimulation of hexosaminidase A-catalyzed degradation of ganglioside GM2 and glycolipid GA2. Proc Natl Acad Sci U S A 75(8):3979-83. Cork, L. C., et al. 1977 GM2 ganglioside lysosomal storage disease in cats with beta-hexosaminidase deficiency. Science 196(4293):1014-7. Cox, T., et al. 2000 Novel oral treatment of Gaucher's disease with N-butyldeoxynojirimycin (OGT 918) to decrease substrate biosynthesis. Lancet 355(9214):1481-5. Cox, T. M. 2010 Eliglustat tartrate, an orally active glucocerebroside synthase inhibitor for the potential treatment of Gaucher disease and other lysosomal storage diseases. Curr Opin Investig Drugs 11(10):1169-81. Crameri, A., et al. 1998 DNA shuffling of a family of genes from diverse species accelerates directed evolution. Nature 391(6664):288-91. Cunningham, S. C., et al. 2008 Gene delivery to the juvenile mouse liver using AAV2/8 vectors. Mol Ther 16(6):1081-8. Daly, T. M., et al. 2001 Prevention of systemic clinical disease in MPS VII mice following AAV-mediated neonatal gene transfer. Gene Ther 8(17):1291-8. Davidson, B. L., et al.

191 2000 Recombinant adeno-associated virus type 2, 4, and 5 vectors: transduction of variant cell types and regions in the mammalian central nervous system. Proc Natl Acad Sci U S A 97(7):3428-32. Delnooz, C. C., et al. 2010 New cases of adult-onset Sandhoff disease with a cerebellar or lower motor neuron phenotype. J Neurol Neurosurg Psychiatry 81(9):968-72. Denny, C. A., et al. 2007 Neurochemical, morphological, and neurophysiological abnormalities in retinas of Sandhoff and GM1 gangliosidosis mice. J Neurochem 101(5):1294-302. Denny, C. A., et al. 2010 Restricted ketogenic diet enhances the therapeutic action of N- butyldeoxynojirimycin towards brain GM2 accumulation in adult Sandhoff disease mice. J Neurochem 113(6):1525-35. Denny, C. A., et al. 2006 Influence of caloric restriction on motor behavior, longevity, and brain lipid composition in Sandhoff disease mice. J Neurosci Res 83(6):1028-38. Desmaris, N., et al. 2004 Prevention of neuropathology in the mouse model of Hurler syndrome. Ann Neurol 56(1):68-76. Desnick, R. J., and E. H. Schuchman 2002 Enzyme replacement and enhancement therapies: lessons from lysosomal disorders. Nat Rev Genet 3(12):954-66. Di Pasquale, G., et al. 2003 Identification of PDGFR as a receptor for AAV-5 transduction. Nat Med 9(10):1306-12. Dlott, B., et al. 1990 Two mutations produce intron insertion in mRNA and elongated beta-subunit of human beta-hexosaminidase. J Biol Chem 265(29):17921-7. Dominguez, E., et al. 2011 Intravenous scAAV9 delivery of a codon-optimized SMN1 sequence rescues SMA mice. Hum Mol Genet 20(4):681-93. dos Santos, M. R., et al. 1991 GM2-gangliosidosis B1 variant: analysis of beta-hexosaminidase alpha gene mutations in 11 patients from a defined region in Portugal. Am J Hum Genet 49(4):886- 90. Duque, S., et al. 2009 Intravenous administration of self-complementary AAV9 enables transgene delivery to adult motor neurons. Mol Ther 17(7):1187-96. Elliger, S. S., et al. 1999 Elimination of lysosomal storage in brains of MPS VII mice treated by intrathecal administration of an adeno-associated virus vector. Gene Ther 6(6):1175-8. Elliger, S. S., et al. 2002 Enhanced secretion and uptake of beta-glucuronidase improves adeno- associated viral-mediated gene therapy of mucopolysaccharidosis type VII mice. Mol Ther 5(5 Pt 1):617-26. Ellis, B. L., et al. 2013 A survey of ex vivo/in vitro transduction efficiency of mammalian primary cells and cell lines with Nine natural adeno-associated virus (AAV1-9) and one engineered adeno-associated virus serotype. Virol J 10:74. Elstein, D., et al. 2004 Sustained therapeutic effects of oral miglustat (Zavesca, N- butyldeoxynojirimycin, OGT 918) in type I Gaucher disease. J Inherit Metab Dis 27(6):757-66. Erles, K., P. Sebokova, and J. R. Schlehofer 1999 Update on the prevalence of serum antibodies (IgG and IgM) to adeno- associated virus (AAV). J Med Virol 59(3):406-11. Fisher, K. J., et al.

192 1997 Recombinant adeno-associated virus for muscle directed gene therapy. Nat Med 3(3):306-12. Fitterer, B. B., et al. 2012 A polymerase chain reaction-based genotyping assay for detecting a novel Sandhoff disease-causing mutation. Genet Test Mol Biomarkers 16(5):401-5. Flanagan, J. J., et al. 2009 The pharmacological chaperone 1-deoxynojirimycin increases the activity and lysosomal trafficking of multiple mutant forms of acid alpha-glucosidase. Hum Mutat 30(12):1683-92. Fonseca, M. I., et al. 2004 Absence of C1q leads to less neuropathology in transgenic mouse models of Alzheimer's disease. J Neurosci 24(29):6457-65. Foust, K. D., et al. 2009 Intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes. Nat Biotechnol 27(1):59-65. Foust, K. D., et al. 2008 Neonatal intraperitoneal or intravenous injections of recombinant adeno- associated virus type 8 transduce dorsal root ganglia and lower motor neurons. Hum Gene Ther 19(1):61-70. Foust, K. D., et al. 2010 Rescue of the spinal muscular atrophy phenotype in a mouse model by early postnatal delivery of SMN. Nat Biotechnol 28(3):271-4. Fox, M. F., et al. 1984 Regional localization of alpha-galactosidase (GLA) to Xpter----q22, hexosaminidase B (HEXB) to 5q13----qter, and arylsulfatase B (ARSB) to 5pter----q13. Cytogenet Cell Genet 38(1):45-9. Frustaci, A., et al. 2001 Improvement in cardiac function in the cardiac variant of Fabry's disease with galactose-infusion therapy. N Engl J Med 345(1):25-32. Fu, H., et al. 2007 Significantly increased lifespan and improved behavioral performances by rAAV gene delivery in adult mucopolysaccharidosis IIIB mice. Gene Ther 14(14):1065- 77. Fujimaru, M., et al. 1998 Two mutations remote from an exon/intron junction in the beta-hexosaminidase beta-subunit gene affect 3'-splice site selection and cause Sandhoff disease. Hum Genet 103(4):462-9. Furihata, K., et al. 1999 Novel splice site mutation at IVS8 nt 5 of HEXB responsible for a Greek-Cypriot case of Sandhoff disease. Hum Mutat 13(1):38-43. Gadola, S. D., et al. 2006 Impaired selection of invariant natural killer T cells in diverse mouse models of glycosphingolipid lysosomal storage diseases. J Exp Med 203(10):2293-303. Gaignard, P., et al. 2013 Characterization of seven novel mutations on the HEXB gene in French Sandhoff patients. Gene 512(2):521-6. Gao, G., et al. 2004 Clades of Adeno-associated viruses are widely disseminated in human tissues. J Virol 78(12):6381-8. Gasque, P. 2004 Complement: a unique innate immune sensor for danger signals. Mol Immunol 41(11):1089-98. Germain, D. P., et al. 2012 Safety and pharmacodynamic effects of a pharmacological chaperone on alpha-galactosidase A activity and globotriaosylceramide clearance in Fabry disease: report from two phase 2 clinical studies. Orphanet J Rare Dis 7:91. Ghosh, A., et al.

193 2007 Efficient whole-body transduction with trans-splicing adeno-associated viral vectors. Mol Ther 15(4):750-5. Ghosh, P., N. M. Dahms, and S. Kornfeld 2003 Mannose 6-phosphate receptors: new twists in the tale. Nat Rev Mol Cell Biol 4(3):202-12. Giraud, C., et al. 2010 Rapid identification of HEXA mutations in Tay-Sachs patients. Biochem Biophys Res Commun 392(4):599-602. Gomez-Lira, M., et al. 2001 A novel 4-bp deletion creates a premature stop codon and dramatically decreases HEXB mRNA levels in a severe case of Sandhoff disease. Mol Cell Probes 15(2):75-9. Gomez-Lira, M., et al. 1995a A 48-bp insertion between exon 13 and 14 of the HEXB gene causes infantile- onset Sandhoff disease. Hum Mutat 6(3):260-2. Gomez-Lira, M., et al. 1995b A common beta hexosaminidase gene mutation in adult Sandhoff disease patients. Hum Genet 96(4):417-22. Gort, L., et al. 2012a GM2 gangliosidoses in Spain: analysis of the HEXA and HEXB genes in 34 Tay- Sachs and 14 Sandhoff patients. Gene 506(1):25-30. Gort, L., et al. 2012b GM2 gangliosidoses in Spain: analysis of the HEXA and HEXB genes in 34 Tay- Sachs and 14 Sandhoff patients. Gene 506(1):25-30. Graber, D., R. Salvayre, and T. Levade 1994 Accurate differentiation of neuronopathic and nonneuronopathic forms of Niemann-Pick disease by evaluation of the effective residual lysosomal sphingomyelinase activity in intact cells. J Neurochem 63(3):1060-8. Gravel R. A., Kaback M. M., Proia R. L., Sandhoff K., Suzuki K., Suzuki K. 2001 The Metabolic and Molecular Bases of Inherited Disease. Volume 3. Gray, S. J., et al. 2010 Directed evolution of a novel adeno-associated virus (AAV) vector that crosses the seizure-compromised blood-brain barrier (BBB). Mol Ther 18(3):570-8. Gray, S. J., et al. 2011a Optimizing promoters for recombinant adeno-associated virus-mediated gene expression in the peripheral and central nervous system using self-complementary vectors. Hum Gene Ther 22(9):1143-53. Gray, S. J., et al. 2011b Preclinical differences of intravascular AAV9 delivery to neurons and glia: a comparative study of adult mice and nonhuman primates. Mol Ther 19(6):1058-69. Gray, S. J., et al. 2013 Global CNS gene delivery and evasion of anti-AAV-neutralizing antibodies by intrathecal AAV administration in non-human primates. Gene Ther 20(4):450-9. Grebner, E. E., and L. G. Jackson 1985 Prenatal diagnosis for Tay-Sachs disease using chorionic villus sampling. Prenat Diagn 5(5):313-20. Gregorevic, P., et al. 2004 Systemic delivery of genes to striated muscles using adeno-associated viral vectors. Nat Med 10(8):828-34. Griffiths, G., et al. 1988 The mannose 6-phosphate receptor and the biogenesis of lysosomes. Cell 52(3):329-41. Guidotti, J. E., et al. 1999 Adenoviral gene therapy of the Tay-Sachs disease in hexosaminidase A- deficient knock-out mice. Hum Mol Genet 8(5):831-8. Gulinello, M., F. Chen, and K. Dobrenis

194 2008 Early deficits in motor coordination and cognitive dysfunction in a mouse model of the neurodegenerative lysosomal storage disorder, Sandhoff disease. Behav Brain Res 193(2):315-9. Hahn, C. N., et al. 1997 Generalized CNS disease and massive GM1-ganglioside accumulation in mice defective in lysosomal acid beta-galactosidase. Hum Mol Genet 6(2):205-11. Halbert, C. L., J. M. Allen, and A. D. Miller 2001 Adeno-associated virus type 6 (AAV6) vectors mediate efficient transduction of airway epithelial cells in mouse lungs compared to that of AAV2 vectors. J Virol 75(14):6615-24. Handa, A., et al. 2000 Adeno-associated virus (AAV)-3-based vectors transduce haematopoietic cells not susceptible to transduction with AAV-2-based vectors. J Gen Virol 81(Pt 8):2077- 84. Hara, Y., et al. 1994 Mutation analysis of a Sandhoff disease patient in the Maronite community in Cyprus. Hum Genet 94(2):136-40. Hauck, B., L. Chen, and W. Xiao 2003 Generation and characterization of chimeric recombinant AAV vectors. Mol Ther 7(3):419-25. Hauck, B., and W. Xiao 2003 Characterization of tissue tropism determinants of adeno-associated virus type 1. J Virol 77(4):2768-74. Haurigot, V., et al. 2013 Whole body correction of mucopolysaccharidosis IIIA by intracerebrospinal fluid gene therapy. J Clin Invest. Hendriksz, C. J., et al. 2004 Juvenile Sandhoff disease--nine new cases and a review of the literature. J Inherit Metab Dis 27(2):241-9. Heng, H. H., et al. 1993 Refined mapping of the GM2 activator protein (GM2A) locus to 5q31.3-q33.1, distal to the spinal muscular atrophy locus. Genomics 18(2):429-31. Hollak, C. E., et al. 2009 Miglustat (Zavesca) in type 1 Gaucher disease: 5-year results of a post- authorisation safety surveillance programme. Pharmacoepidemiol Drug Saf 18(9):770- 7. Hou, Y., et al. 1998 A Pro504 --> Ser substitution in the beta-subunit of beta-hexosaminidase A inhibits alpha-subunit hydrolysis of GM2 ganglioside, resulting in chronic Sandhoff disease. J Biol Chem 273(33):21386-92. Hsu, P. H., et al. 2013 Noninvasive and targeted gene delivery into the brain using microbubble- facilitated focused ultrasound. PLoS One 8(2):e57682. Huang, J. Q., et al. 1997 Apoptotic cell death in mouse models of GM2 gangliosidosis and observations on human Tay-Sachs and Sandhoff diseases. Hum Mol Genet 6(11):1879-85. Huang, Q., et al. 2012 Targeted gene delivery to the mouse brain by MRI-guided focused ultrasound- induced blood-brain barrier disruption. Exp Neurol 233(1):350-6. Igisu, H., and K. Suzuki 1984 Progressive accumulation of toxic metabolite in a genetic leukodystrophy. Science 224(4650):753-5. Inagaki, K., et al. 2006 Robust systemic transduction with AAV9 vectors in mice: efficient global cardiac gene transfer superior to that of AAV8. Mol Ther 14(1):45-53. Ishii, S. 2012 Pharmacological chaperone therapy for Fabry disease. Proc Jpn Acad Ser B Phys Biol Sci 88(1):18-30.

195 Ishikawa, Y., et al. 1987 Biochemical basis of type AB GM2 gangliosidosis in a Japanese spaniel. J Neurochem 48(3):860-4. Jennemann, R., et al. 2005 Cell-specific deletion of glucosylceramide synthase in brain leads to severe neural defects after birth. Proc Natl Acad Sci U S A 102(35):12459-64. Jeyakumar, M., et al. 1999 Delayed symptom onset and increased life expectancy in Sandhoff disease mice treated with N-butyldeoxynojirimycin. Proc Natl Acad Sci U S A 96(11):6388-93. Jeyakumar, M., et al. 2002 Glycosphingolipid lysosomal storage diseases: therapy and pathogenesis. Neuropathol Appl Neurobiol 28(5):343-57. Jeyakumar, M., et al. 2001 Enhanced survival in Sandhoff disease mice receiving a combination of substrate deprivation therapy and bone marrow transplantation. Blood 97(1):327-9. Jeyakumar, M., et al. 2004 NSAIDs increase survival in the Sandhoff disease mouse: synergy with N- butyldeoxynojirimycin. Ann Neurol 56(5):642-9. Jeyakumar, M., et al. 2003 Central nervous system inflammation is a hallmark of pathogenesis in mouse models of GM1 and GM2 gangliosidosis. Brain 126(Pt 4):974-87. Jones, E. G. 1998 Viewpoint: the core and matrix of thalamic organization. Neuroscience 85(2):331-45. Jooss, K., et al. 1998 Transduction of dendritic cells by DNA viral vectors directs the immune response to transgene products in muscle fibers. J Virol 72(5):4212-23. Kaback, M. M., et al. 1974 Approaches to the control and prevention of Tay-Sachs disease. Prog Med Genet 10:103-34. Kaludov, N., et al. 2001 Adeno-associated virus serotype 4 (AAV4) and AAV5 both require sialic acid binding for hemagglutination and efficient transduction but differ in sialic acid linkage specificity. J Virol 75(15):6884-93. Kamata, Y., et al. 2003 Long-term normalization in the central nervous system, ocular manifestations, and skeletal deformities by a single systemic adenovirus injection into neonatal mice with mucopolysaccharidosis VII. Gene Ther 10(5):406-14. Kanzaki, S., et al. 2010 Thymic alterations in GM2 gangliosidoses model mice. PLoS One 5(8). Kashiwakura, Y., et al. 2005 Hepatocyte growth factor receptor is a coreceptor for adeno-associated virus type 2 infection. J Virol 79(1):609-14. Kasperzyk, J. L., et al. 2005 Substrate reduction reduces gangliosides in postnatal cerebrum-brainstem and cerebellum in GM1 gangliosidosis mice. J Lipid Res 46(4):744-51. Kasperzyk, J. L., et al. 2004 N-butyldeoxygalactonojirimycin reduces neonatal brain ganglioside content in a mouse model of GM1 gangliosidosis. J Neurochem 89(3):645-53. Kaya, N., et al. 2011 GM2 gangliosidosis in Saudi Arabia: multiple mutations and considerations for future carrier screening. Am J Med Genet A 155A(6):1281-4. Khanna, R., et al. 2010a The pharmacological chaperone isofagomine increases the activity of the Gaucher disease L444P mutant form of beta-glucosidase. FEBS J 277(7):1618-38. Khanna, R., et al. 2010b The pharmacological chaperone 1-deoxygalactonojirimycin reduces tissue globotriaosylceramide levels in a mouse model of Fabry disease. Mol Ther 18(1):23-33.

196 Kivlin, J. D., G. E. Sanborn, and G. G. Myers 1985 The cherry-red spot in Tay-Sachs and other storage diseases. Ann Neurol 17(4):356-60. Kleiman, F. E., et al. 1994 Sandhoff disease in Argentina: high frequency of a splice site mutation in the HEXB gene and correlation between enzyme and DNA-based tests for heterozygote detection. Hum Genet 94(3):279-82. Kleiman, F. E., et al. 1998 A frequent TG deletion near the polyadenylation signal of the human HEXB gene: occurrence of an irregular DNA structure and conserved nucleotide sequence motif in the 3' untranslated region. Hum Mutat 12(5):320-9. Klein, R. L., et al. 2002 Dose and promoter effects of adeno-associated viral vector for green fluorescent protein expression in the rat brain. Exp Neurol 176(1):66-74. Klein, R. L., et al. 1999 Prevention of 6-hydroxydopamine-induced rotational behavior by BDNF somatic gene transfer. Brain Res 847(2):314-20. Klein, R. L., et al. 1998 Neuron-specific transduction in the rat septohippocampal or nigrostriatal pathway by recombinant adeno-associated virus vectors. Exp Neurol 150(2):183-94. Kolstad, K. D., et al. 2010 Changes in adeno-associated virus-mediated gene delivery in retinal degeneration. Hum Gene Ther 21(5):571-8. Kolter, T., R. L. Proia, and K. Sandhoff 2002 Combinatorial ganglioside biosynthesis. J Biol Chem 277(29):25859-62. Kolter, T., and K. Sandhoff 2006 Sphingolipid metabolism diseases. Biochim Biophys Acta 1758(12):2057-79. Kolter, T., et al. 2005 Lipid-binding proteins in membrane digestion, antigen presentation, and antimicrobial defense. J Biol Chem 280(50):41125-8. Kornfeld, R., and S. Kornfeld 1985 Assembly of asparagine-linked oligosaccharides. Annu Rev Biochem 54:631-64. Kotin, R. M. 1994 Prospects for the use of adeno-associated virus as a vector for human gene therapy. Hum Gene Ther 5(7):793-801. Kudoh, T., M. A. Velkoff, and D. A. Wenger 1983 Uptake and metabolism of radioactively labeled sphingomyelin in cultured skin fibroblasts from controls and patients with Niemann-Pick disease and other lysosomal storage diseases. Biochim Biophys Acta 754(1):82-92. Kuhn, R., and H. Wiegandt 1963 [THE CONSTITUTION OF GANGLIOSIDES G-II, G-III AND G-IV]. Z Naturforsch B 18:541-3. Kuroki, Y., et al. 1995 A novel missense mutation (C522Y) is present in the beta-hexosaminidase beta- subunit gene of a Japanese patient with infantile Sandhoff disease. Biochem Biophys Res Commun 212(2):564-71. Kyrkanides, S., et al. 2008 Peripheral blood mononuclear cell infiltration and neuroinflammation in the HexB-/- mouse model of neurodegeneration. J Neuroimmunol 203(1):50-7. Kytzia, H. J., U. Hinrichs, and K. Sandhoff 1984 Diagnosis of infantile and juvenile forms of GM2 gangliosidosis variant 0. Residual activities toward natural and different synthetic substrates. Hum Genet 67(4):414-8. Larsen, S. D., et al. 2012 Property-based design of a glucosylceramide synthase inhibitor that reduces glucosylceramide in the brain. J Lipid Res 53(2):282-91. Lee, E. H., et al.

197 2000 A novel mutation in the beta-hexosaminidase beta-subunit gene in a 14-month- old Korean boy with Sandhoff disease: first reported Korean case. Hum Mutat 16(2):180-1. Leinekugel, P., et al. 1992 Quantitative correlation between the residual activity of beta-hexosaminidase A and arylsulfatase A and the severity of the resulting lysosomal storage disease. Hum Genet 88(5):513-23. Leone, P., et al. 2000 Aspartoacylase gene transfer to the mammalian central nervous system with therapeutic implications for Canavan disease. Ann Neurol 48(1):27-38. Leport, C., et al. 1996 Pyrimethamine for primary prophylaxis of toxoplasmic encephalitis in patients with human immunodeficiency virus infection: a double-blind, randomized trial. ANRS 005-ACTG 154 Group Members. Agence Nationale de Recherche sur le SIDA. AIDS Clinical Trial Group. J Infect Dis 173(1):91-7. LeWitt, P. A., et al. 2011 AAV2-GAD gene therapy for advanced Parkinson's disease: a double-blind, sham-surgery controlled, randomised trial. Lancet Neurol 10(4):309-19. Li, W., et al. 2008 Engineering and selection of shuffled AAV genomes: a new strategy for producing targeted biological nanoparticles. Mol Ther 16(7):1252-60. Liu, Y., et al. 1999 A genetic model of substrate deprivation therapy for a glycosphingolipid storage disorder. J Clin Invest 103(4):497-505. Loeb, J. E., et al. 1999 Enhanced expression of transgenes from adeno-associated virus vectors with the woodchuck hepatitis virus posttranscriptional regulatory element: implications for gene therapy. Hum Gene Ther 10(14):2295-305. Lowden, J. A., et al. 1973 Automated assay of hexosaminidases in serum. Clin Chem 19(12):1345-9. Lyon, G ; Adams, RD; Kolodny, EH 1996 Early infantile progressive metabolic encephalopathies: clinical problems and diagnostic considerations. In Neurology of hereditary metabolic diseases of children. 2 edition. Pp. 45–123. New York: McGraw-Hill. Machaczka, M., et al. 2012 Substrate reduction therapy with miglustat for type 1 Gaucher disease: a retrospective analysis from a single institution. Ups J Med Sci 117(1):28-34. Maegawa, G. H., et al. 2006 The natural history of juvenile or subacute GM2 gangliosidosis: 21 new cases and literature review of 134 previously reported. Pediatrics 118(5):e1550-62. Maegawa, G. H., et al. 2007 Pyrimethamine as a potential pharmacological chaperone for late-onset forms of GM2 gangliosidosis. J Biol Chem 282(12):9150-61. Maegawa, G. H., et al. 2009 Pharmacokinetics, safety and tolerability of miglustat in the treatment of pediatric patients with GM2 gangliosidosis. Mol Genet Metab 97(4):284-91. Maheshri, N., et al. 2006 Directed evolution of adeno-associated virus yields enhanced gene delivery vectors. Nat Biotechnol 24(2):198-204. Mahuran, D. J. 1999 Biochemical consequences of mutations causing the GM2 gangliosidoses. Biochim Biophys Acta 1455(2-3):105-38. Mandel, R. J., et al. 2006 Recombinant adeno-associated viral vectors as therapeutic agents to treat neurological disorders. Mol Ther 13(3):463-83. Manno, C. S., et al. 2006 Successful transduction of liver in hemophilia by AAV-Factor IX and limitations imposed by the host immune response. Nat Med 12(3):342-7.

198 Mark, B. L., et al. 2003 Crystal structure of human beta-hexosaminidase B: understanding the molecular basis of Sandhoff and Tay-Sachs disease. J Mol Biol 327(5):1093-109. Martin, D. R., et al. 2004 An inversion of 25 base pairs causes feline GM2 gangliosidosis variant. Exp Neurol 187(1):30-7. Marugan, J. J., et al. 2010 Evaluation of 2-thioxo-2,3,5,6,7,8-hexahydropyrimido[4,5-d]pyrimidin-4(1H)- one analogues as GAA activators. Eur J Med Chem 45(5):1880-97. Masciullo, M., et al. 2010 Substrate reduction therapy with miglustat in chronic GM2 gangliosidosis type Sandhoff: results of a 3-year follow-up. J Inherit Metab Dis. Matsuda, J., et al. 1997 Beta-galactosidase-deficient mouse as an animal model for GM1- gangliosidosis. Glycoconj J 14(6):729-36. Matsuda, J., et al. 2003 Chemical chaperone therapy for brain pathology in G(M1)-gangliosidosis. Proc Natl Acad Sci U S A 100(26):15912-7. Matsuoka, K., et al. 2011a Therapeutic potential of intracerebroventricular replacement of modified human beta-hexosaminidase B for GM2 gangliosidosis. Mol Ther 19(6):1017-24. Matsuoka, K., et al. 2011b Thymic involution and corticosterone level in Sandhoff disease model mice: new aspects the pathogenesis of GM2 gangliosidosis. J Inherit Metab Dis 34(5):1061-8. Mattar, C. N., et al. 2013 Systemic delivery of scAAV9 in fetal macaques facilitates neuronal transduction of the central and peripheral nervous systems. Gene Ther 20(1):69-83. McBride, J. L., et al. 2011 Preclinical safety of RNAi-mediated HTT suppression in the rhesus macaque as a potential therapy for Huntington's disease. Mol Ther 19(12):2152-62. McCarty, D. M., et al. 2003 Adeno-associated virus terminal repeat (TR) mutant generates self- complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther 10(26):2112-8. McCarty, D. M., P. E. Monahan, and R. J. Samulski 2001 Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis. Gene Ther 8(16):1248- 54. McCown, T. J., et al. 1996 Differential and persistent expression patterns of CNS gene transfer by an adeno-associated virus (AAV) vector. Brain Res 713(1-2):99-107. McEachern, K. A., et al. 2007 A specific and potent inhibitor of glucosylceramide synthase for substrate inhibition therapy of Gaucher disease. Mol Genet Metab 91(3):259-67. McInnes, B., C. A. Brown, and D. J. Mahuran 1992a Two small deletion mutations of the HEXB gene are present in DNA from a patient with infantile Sandhoff disease. Biochim Biophys Acta 1138(4):315-7. McInnes, B., et al. 1992b An unusual splicing mutation in the HEXB gene is associated with dramatically different phenotypes in patients from different racial backgrounds. J Clin Invest 90(2):306-14. McNally, M. A., et al. 2007 Peripheral nervous system manifestations in a Sandhoff disease mouse model: nerve conduction, myelin structure, lipid analysis. J Negat Results Biomed 6:8. Meikle, P. J., et al. 1999 Prevalence of lysosomal storage disorders. JAMA 281(3):249-54. Merrill, A. H., Jr.

199 2002 De novo sphingolipid biosynthesis: a necessary, but dangerous, pathway. J Biol Chem 277(29):25843-6. Miao, C. H., et al. 1998 The kinetics of rAAV integration in the liver. Nat Genet 19(1):13-5. Miller, D. S. 2010 Regulation of P-glycoprotein and other ABC drug transporters at the blood- brain barrier. Trends Pharmacol Sci 31(6):246-54. Miller, D. S., B. Bauer, and A. M. Hartz 2008 Modulation of P-glycoprotein at the blood-brain barrier: opportunities to improve central nervous system pharmacotherapy. Pharmacol Rev 60(2):196-209. Mingozzi, F., et al. 2013 Overcoming preexisting humoral immunity to AAV using capsid decoys. Sci Transl Med 5(194):194ra92. Mingozzi, F., et al. 2007 CD8(+) T-cell responses to adeno-associated virus capsid in humans. Nat Med 13(4):419-22. Montalvo, A. L., et al. 2005 Molecular analysis of the HEXA gene in Italian patients with infantile and late onset Tay-Sachs disease: detection of fourteen novel alleles. Hum Mutat 26(3):282. Muldoon, L. L., et al. 1994 Characterization of the molecular defect in a feline model for type II GM2- gangliosidosis (Sandhoff disease). Am J Pathol 144(5):1109-18. Muschol, N., et al. 2002 Secretion of phosphomannosyl-deficient arylsulphatase A and cathepsin D from isolated human macrophages. Biochem J 368(Pt 3):845-53. Myerowitz, R., and F. C. Costigan 1988 The major defect in Ashkenazi Jews with Tay-Sachs disease is an insertion in the gene for the alpha-chain of beta-hexosaminidase. J Biol Chem 263(35):18587-9. Myerowitz, R., and N. D. Hogikyan 1987 A deletion involving Alu sequences in the beta-hexosaminidase alpha-chain gene of French Canadians with Tay-Sachs disease. J Biol Chem 262(32):15396-9. Myerowitz, R., et al. 2002 Molecular pathophysiology in Tay-Sachs and Sandhoff diseases as revealed by gene expression profiling. Hum Mol Genet 11(11):1343-50. Nagahara, A. H., et al. 2009 Neuroprotective effects of brain-derived neurotrophic factor in rodent and primate models of Alzheimer's disease. Nat Med 15(3):331-7. Nakano, T., and K. Suzuki 1989 Genetic cause of a juvenile form of Sandhoff disease. Abnormal splicing of beta-hexosaminidase beta chain gene transcript due to a point mutation within intron 12. J Biol Chem 264(9):5155-8. Nathwani, A. C., et al. 2011 Adenovirus-associated virus vector-mediated gene transfer in hemophilia B. N Engl J Med 365(25):2357-65. Navon, R., Z. Argov, and A. Frisch 1986 Hexosaminidase A deficiency in adults. Am J Med Genet 24(1):179-96. Navon, R., and R. L. Proia 1989 The mutations in Ashkenazi Jews with adult GM2 gangliosidosis, the adult form of Tay-Sachs disease. Science 243(4897):1471-4. — 1991 Tay-Sachs disease in Moroccan Jews: deletion of a phenylalanine in the alpha- subunit of beta-hexosaminidase. Am J Hum Genet 48(2):412-9. Nemerow, G. R., et al. 2009 Insights into adenovirus host cell interactions from structural studies. Virology 384(2):380-8. Neote, K., et al. 1990 Structure and distribution of an Alu-type deletion mutation in Sandhoff disease. J Clin Invest 86(5):1524-31.

200 Neufeld, E. F. 1973 Replacement of genotype-specific proteins in mucopolysaccharidoses. Birth Defects Orig Artic Ser 9(2):27-30. Neuwelt, E. A., et al. 1985 Characterization of a new model of GM2-gangliosidosis (Sandhoff's disease) in Korat cats. J Clin Invest 76(2):482-90. Nilsson, O., et al. 1982 The occurrence of psychosine and other glycolipids in spleen and liver from the three major types of Gaucher's disease. Biochim Biophys Acta 712(3):453-63. Norby, S., O. A. Jensen, and M. Schwartz 1980 Retinal and cerebellar changes in early fetal Sandhoff disease (GM2- gangliosidosis type 2). Metab Pediatr Ophthalmol 4(3):115-9. Norflus, F., et al. 1998 Bone marrow transplantation prolongs life span and ameliorates neurologic manifestations in Sandhoff disease mice. J Clin Invest 101(9):1881-8. Norflus, F., S. Yamanaka, and R. L. Proia 1996 Promoters for the human beta-hexosaminidase genes, HEXA and HEXB. DNA Cell Biol 15(2):89-97. O'Dowd, B. F., et al. 1986 Molecular heterogeneity in the infantile and juvenile forms of Sandhoff disease (O-variant GM2 gangliosidosis). J Biol Chem 261(27):12680-5. Ohno, K., and K. Suzuki 1988 Mutation in GM2-gangliosidosis B1 variant. J Neurochem 50(1):316-8. Ohsawa, M., et al. 2005 Establishment of immortalized Schwann cells from Sandhoff mice and corrective effect of recombinant human beta-hexosaminidase A on the accumulated GM2 ganglioside. J Hum Genet 50(9):460-7. Osher, E., et al. 2011 Pyrimethamine increases beta-hexosaminidase A activity in patients with Late Onset Tay Sachs. Mol Genet Metab 102(3):356-63. Pacak, C. A., et al. 2006 Recombinant adeno-associated virus serotype 9 leads to preferential cardiac transduction in vivo. Circ Res 99(4):e3-9. Paduraru, C., et al. 2013 Role for lysosomal phospholipase A2 in iNKT cell-mediated CD1d recognition. Proc Natl Acad Sci U S A 110(13):5097-102. Passini, M. A., et al. 2002 Distribution of a lysosomal enzyme in the adult brain by axonal transport and by cells of the rostral migratory stream. J Neurosci 22(15):6437-46. Passini, M. A., et al. 2003 Intraventricular brain injection of adeno-associated virus type 1 (AAV1) in neonatal mice results in complementary patterns of neuronal transduction to AAV2 and total long-term correction of storage lesions in the brains of beta-glucuronidase- deficient mice. J Virol 77(12):7034-40. Paterna, J. C., et al. 2000 Influence of promoter and WHV post-transcriptional regulatory element on AAV-mediated transgene expression in the rat brain. Gene Ther 7(15):1304-11. Patnaik, S., et al. 2012 Discovery, structure-activity relationship, and biological evaluation of noninhibitory small molecule chaperones of glucocerebrosidase. J Med Chem 55(12):5734-48. Paw, B. H., et al. 1990 Frequency of three Hex A mutant alleles among Jewish and non-Jewish carriers identified in a Tay-Sachs screening program. Am J Hum Genet 47(4):698-705. Pelled, D., et al. 2003 Inhibition of calcium uptake via the sarco/endoplasmic reticulum Ca2+-ATPase in a mouse model of Sandhoff disease and prevention by treatment with N- butyldeoxynojirimycin. J Biol Chem 278(32):29496-501.

201 Penaud-Budloo, M., et al. 2008 Adeno-associated virus vector genomes persist as episomal chromatin in primate muscle. J Virol 82(16):7875-85. Perabo, L., et al. 2006 Combinatorial engineering of a gene therapy vector: directed evolution of adeno-associated virus. J Gene Med 8(2):155-62. Petty, M. A., and E. H. Lo 2002 Junctional complexes of the blood-brain barrier: permeability changes in neuroinflammation. Prog Neurobiol 68(5):311-23. Phaneuf, D., et al. 1996 Dramatically different phenotypes in mouse models of human Tay-Sachs and Sandhoff diseases. Hum Mol Genet 5(1):1-14. Platt, F. M., et al. 1994a N-butyldeoxynojirimycin is a novel inhibitor of glycolipid biosynthesis. J Biol Chem 269(11):8362-5. Platt, F. M., et al. 1994b N-butyldeoxygalactonojirimycin inhibits glycolipid biosynthesis but does not affect N-linked oligosaccharide processing. J Biol Chem 269(43):27108-14. Platt, F. M., et al. 1997 Prevention of lysosomal storage in Tay-Sachs mice treated with N- butyldeoxynojirimycin. Science 276(5311):428-31. Pleger, S. T., et al. 2011 Cardiac AAV9-S100A1 gene therapy rescues post-ischemic heart failure in a preclinical large animal model. Sci Transl Med 3(92):92ra64. Ponder, K. P., et al. 2002 Therapeutic neonatal hepatic gene therapy in mucopolysaccharidosis VII dogs. Proc Natl Acad Sci U S A 99(20):13102-7. Popa, I., et al. 2011 Production of multiple brain-like ganglioside species is dispensable for fas- induced apoptosis of lymphoid cells. PLoS One 6(5):e19974. Porto, C., et al. 2009 The pharmacological chaperone N-butyldeoxynojirimycin enhances enzyme replacement therapy in Pompe disease fibroblasts. Mol Ther 17(6):964-71. Porto, C., et al. 2012 Synergy between the pharmacological chaperone 1-deoxygalactonojirimycin and the human recombinant alpha-galactosidase A in cultured fibroblasts from patients with Fabry disease. J Inherit Metab Dis 35(3):513-20. Porubsky, S., et al. 2007 Normal development and function of invariant natural killer T cells in mice with isoglobotrihexosylceramide (iGb3) deficiency. Proc Natl Acad Sci U S A 104(14):5977- 82. Porubsky, S., et al. 2012 Globosides but not isoglobosides can impact the development of invariant NKT cells and their interaction with dendritic cells. J Immunol 189(6):3007-17. Proia, R. L., and Y. P. Wu 2004 Blood to brain to the rescue. J Clin Invest 113(8):1108-10. Pulicherla, N., et al. 2011 Engineering liver-detargeted AAV9 vectors for cardiac and musculoskeletal gene transfer. Mol Ther 19(6):1070-8. Qing, K., et al. 1999 Human fibroblast growth factor receptor 1 is a co-receptor for infection by adeno-associated virus 2. Nat Med 5(1):71-7. Rabinowitz, J. E., et al. 2004 Cross-dressing the virion: the transcapsidation of adeno-associated virus serotypes functionally defines subgroups. J Virol 78(9):4421-32. Rabinowitz, J. E., et al.

202 2002 Cross-packaging of a single adeno-associated virus (AAV) type 2 vector genome into multiple AAV serotypes enables transduction with broad specificity. J Virol 76(2):791-801. Radin, N. S. 1996 Treatment of Gaucher disease with an enzyme inhibitor. Glycoconj J 13(2):153- 7. Rahim, A. A., et al. 2011 Intravenous administration of AAV2/9 to the fetal and neonatal mouse leads to differential targeting of CNS cell types and extensive transduction of the nervous system. FASEB J 25(10):3505-18. Rastegar, M., et al. 2009 MECP2 isoform-specific vectors with regulated expression for Rett syndrome gene therapy. PLoS One 4(8):e6810. Ratko, T. A., et al. 2013 Enzyme-Replacement Therapies for Lysosomal Storage Diseases. Rockville MD. Reczek, D., et al. 2007 LIMP-2 is a receptor for lysosomal mannose-6-phosphate-independent targeting of beta-glucocerebrosidase. Cell 131(4):770-83. Redonnet-Vernhet, I., et al. 1996 Significance of two point mutations present in each HEXB allele of patients with adult GM2 gangliosidosis (Sandhoff disease) homozygosity for the Ile207-->Val substitution is not associated with a clinical or biochemical phenotype. Biochim Biophys Acta 1317(2):127-33. Rickmeyer, T., et al. 2013 GM2 gangliosidosis in an adult pet rabbit. J Comp Pathol 148(2-3):243-7. Rose, J. A., et al. 1969 Evidence for a single-stranded adenovirus-associated virus genome: formation of a DNA density hybrid on release of viral DNA. Proc Natl Acad Sci U S A 64(3):863- 9. Rose, J. A., and F. Koczot 1972 Adenovirus-associated virus multiplication. VII. Helper requirement for viral deoxyribonucleic acid and ribonucleic acid synthesis. J Virol 10(1):1-8. Rubin, L. L., and J. M. Staddon 1999 The cell biology of the blood-brain barrier. Annu Rev Neurosci 22:11-28. Ruffer, C., et al. 2004 Cell-cell junctions of dermal microvascular endothelial cells contain tight and adherens junction proteins in spatial proximity. Biochemistry 43(18):5360-9. Rusinol, A. E., et al. 1994 A unique mitochondria-associated membrane fraction from rat liver has a high capacity for lipid synthesis and contains pre-Golgi secretory proteins including nascent lipoproteins. J Biol Chem 269(44):27494-502. Russell, D. W., and M. A. Kay 1999 Adeno-associated virus vectors and hematology. Blood 94(3):864-74. Samulski, R. J., L. S. Chang, and T. Shenk 1987 A recombinant plasmid from which an infectious adeno-associated virus genome can be excised in vitro and its use to study viral replication. J Virol 61(10):3096-101. Sanders, D. N., et al. 2013 GM2 gangliosidosis associated with a HEXA missense mutation in Japanese Chin dogs: a potential model for Tay Sachs disease. Mol Genet Metab 108(1):70-5. Sandhoff K, Conzelmann E, Neufeld EF, Kaback MM, Suzuki K 1989 The GM2 gangliosidosis: Scriver CR, Beaudet AL, Sly WS, Valle D, . Sandhoff, K., and K. Harzer 2013 Gangliosides and gangliosidoses: principles of molecular and metabolic pathogenesis. J Neurosci 33(25):10195-208. Sandhoff, K., et al. 1971 Enzyme alterations and lipid storage in three variants of Tay-Sachs disease. J Neurochem 18(12):2469-89. Sands, M. S., and B. L. Davidson

203 2006 Gene therapy for lysosomal storage diseases. Mol Ther 13(5):839-49. Sango, K., et al. 1996 Mice lacking both subunits of lysosomal beta-hexosaminidase display gangliosidosis and mucopolysaccharidosis. Nat Genet 14(3):348-52. Sango, K., et al. 2005 Impaired neurite outgrowth in the retina of a murine model of Sandhoff disease. Invest Ophthalmol Vis Sci 46(9):3420-5. Sango, K., et al. 1995 Mouse models of Tay-Sachs and Sandhoff diseases differ in neurologic phenotype and ganglioside metabolism. Nat Genet 11(2):170-6. Santoro, M., et al. 2007 Chronic GM2 gangliosidosis type Sandhoff associated with a novel missense HEXB gene mutation causing a double pathogenic effect. Mol Genet Metab 91(1):111- 4. Sargeant, T. J., et al. 2012 Characterization of inducible models of Tay-Sachs and related disease. PLoS Genet 8(9):e1002943. Sargeant, T. J., et al. 2011 Adeno-associated virus-mediated expression of beta-hexosaminidase prevents neuronal loss in the Sandhoff mouse brain. Hum Mol Genet 20(22):4371-80. Sato, K., H. Saito, and N. Matsuki 1996 HSP70 is essential to the neuroprotective effect of heat-shock. Brain Res 740(1- 2):117-23. Sawkar, A. R., et al. 2005 Gaucher disease-associated glucocerebrosidases show mutation-dependent chemical chaperoning profiles. Chem Biol 12(11):1235-44. Schafer, D. P., and B. Stevens 2010 Synapse elimination during development and disease: immune molecules take centre stage. Biochem Soc Trans 38(2):476-81. Schmidt, M., and J. A. Chiorini 2006 Gangliosides are essential for bovine adeno-associated virus entry. J Virol 80(11):5516-22. Schmidt, M., et al. 2004 Cloning and characterization of a bovine adeno-associated virus. J Virol 78(12):6509-16. Scriver, C R 2001 the Metabolic and Molecular Bases of Inherited Disease. Sentelle, R. D., et al. 2012 Ceramide targets autophagosomes to mitochondria and induces lethal mitophagy. Nat Chem Biol 8(10):831-8. Seyrantepe, V., et al. 2008 Mice deficient in Neu4 sialidase exhibit abnormal ganglioside catabolism and lysosomal storage. Hum Mol Genet 17(11):1556-68. Seyrantepe, V., et al. 2010 Mice doubly-deficient in lysosomal hexosaminidase A and neuraminidase 4 show epileptic crises and rapid neuronal loss. PLoS Genet 6(9):e1001118. Shapiro, B. E., et al. 2009 Miglustat in late-onset Tay-Sachs disease: a 12-month, randomized, controlled clinical study with 24 months of extended treatment. Genet Med 11(6):425-33. Shayman, J. A. 2010 ELIGLUSTAT TARTRATE: Glucosylceramide Synthase Inhibitor Treatment of Type 1 Gaucher Disease. Drugs Future 35(8):613-620. Shen, J. S., et al. 2008 Isofagomine increases lysosomal delivery of exogenous glucocerebrosidase. Biochem Biophys Res Commun 369(4):1071-5. Shen, S., et al. 2011 Terminal N-linked galactose is the primary receptor for adeno-associated virus 9. J Biol Chem 286(15):13532-40.

204 Simonato, M., et al. 2013 Progress in gene therapy for neurological disorders. Nat Rev Neurol 9(6):298. Simons, K., and G. van Meer 1988 Lipid sorting in epithelial cells. Biochemistry 27(17):6197-202. Singer, H. S., and L. C. Cork 1989 Canine GM2 gangliosidosis: morphological and biochemical analysis. Vet Pathol 26(2):114-20. Sobek, A. K., C. Evers, and G. Dekomien 2013 Integrated multiplex ligation dependent probe amplification (MLPA) assays for the detection of alterations in the HEXB, GM2A and SMARCAL1 genes to support the diagnosis of Morbus Sandhoff, M. Tay-Sachs variant AB and Schimke immuno-osseous dysplasia in humans. Mol Cell Probes 27(1):32-7. Sonderfeld-Fresko, S., and R. L. Proia 1988 Synthesis and assembly of a catalytically active lysosomal enzyme, beta- hexosaminidase B, in a cell-free system. J Biol Chem 263(26):13463-9. Stephan, A. H., B. A. Barres, and B. Stevens 2012 The complement system: an unexpected role in synaptic pruning during development and disease. Annu Rev Neurosci 35:369-89. Stevens, B., et al. 2007 The classical complement cascade mediates CNS synapse elimination. Cell 131(6):1164-78. Strous, G. J., et al. 1985 Effect of lysosomotropic amines on the secretory pathway and on the recycling of the asialoglycoprotein receptor in human hepatoma cells. J Cell Biol 101(2):531-9. Summerford, C., J. S. Bartlett, and R. J. Samulski 1999 AlphaVbeta5 integrin: a co-receptor for adeno-associated virus type 2 infection. Nat Med 5(1):78-82. Summerford, C., and R. J. Samulski 1998 Membrane-associated heparan sulfate proteoglycan is a receptor for adeno- associated virus type 2 virions. J Virol 72(2):1438-45. Takeda, K., et al. 1990 Fine assignment of beta-hexosaminidase A alpha-subunit on 15q23-q24 by high resolution in situ hybridization. Tohoku J Exp Med 160(3):203-11. Tallaksen, C. M., and J. E. Berg 2009 Miglustat therapy in juvenile Sandhoff disease. J Inherit Metab Dis 32 Suppl 1:S289-93. Tanaka, A., et al. 1990 GM2-gangliosidosis B1 variant: analysis of beta-hexosaminidase alpha gene abnormalities in seven patients. Am J Hum Genet 46(2):329-39. te Vruchte, D., et al. 2010 Glycosphingolipid storage leads to the enhanced degradation of the B cell receptor in Sandhoff disease mice. J Inherit Metab Dis 33(3):261-70. Tenenbaum, L., et al. 2004 Recombinant AAV-mediated gene delivery to the central nervous system. J Gene Med 6 Suppl 1:S212-22. Tenenbaum, L., et al. 2000 Tropism of AAV-2 vectors for neurons of the globus pallidus. Neuroreport 11(10):2277-83. Tessitore, A., et al. 2004 GM1-ganglioside-mediated activation of the unfolded protein response causes neuronal death in a neurodegenerative gangliosidosis. Mol Cell 15(5):753-66. Thomas, C. E., et al. 2004 Rapid uncoating of vector genomes is the key to efficient liver transduction with pseudotyped adeno-associated virus vectors. J Virol 78(6):3110-22. Thomas, G. H., et al. 1982 Nonuniform deficiency of hexosaminidase A in tissues and fluids of two unrelated individuals. Pediatr Res 16(3):232-7. Thompson, E. B.

205 1999 Mechanisms of T-cell Apoptosis Induced by Glucocorticoids. Trends Endocrinol Metab 10(9):353-358. Tominaga, L., et al. 2001 Galactonojirimycin derivatives restore mutant human beta-galactosidase activities expressed in fibroblasts from enzyme-deficient knockout mouse. Brain Dev 23(5):284-7. Towne, C., et al. 2008 Systemic AAV6 delivery mediating RNA interference against SOD1: neuromuscular transduction does not alter disease progression in fALS mice. Mol Ther 16(6):1018-25. Trasler, J., et al. 1998 Characterization of the testis and epididymis in mouse models of human Tay Sachs and Sandhoff diseases and partial determination of accumulated gangliosides. Endocrinology 139(7):3280-8. Triggs-Raine, B. L., et al. 1991 Sequence of DNA flanking the exons of the HEXA gene, and identification of mutations in Tay-Sachs disease. Am J Hum Genet 49(5):1041-54. Triggs-Raine, B., D. J. Mahuran, and R. A. Gravel 2001 Naturally occurring mutations in GM2 gangliosidosis: a compendium. Adv Genet 44:199-224. Tsuji, D., et al. 2005 Specific induction of macrophage inflammatory protein 1-alpha in glial cells of Sandhoff disease model mice associated with accumulation of N-acetylhexosaminyl glycoconjugates. J Neurochem 92(6):1497-507. Valenzano, K. J., et al. 2011 Identification and characterization of pharmacological chaperones to correct enzyme deficiencies in lysosomal storage disorders. Assay Drug Dev Technol 9(3):213- 35. Valori, C. F., et al. 2010 Systemic delivery of scAAV9 expressing SMN prolongs survival in a model of spinal muscular atrophy. Sci Transl Med 2(35):35ra42. van Echten, G., and K. Sandhoff 1993 Ganglioside metabolism. Enzymology, Topology, and regulation. J Biol Chem 268(8):5341-4. Venugopalan, P., and S. N. Joshi 2002 Cardiac involvement in infantile Sandhoff disease. J Paediatr Child Health 38(1):98-100. Vidgoff, J., N. R. Buist, and J. S. O'Brien 1973 Absence of -N-acetyl-D-hexosaminidase A activity in a healthy woman. Am J Hum Genet 25(4):372-81. Vite, C. H., et al. 2005 Effective gene therapy for an inherited CNS disease in a large animal model. Ann Neurol 57(3):355-64. von Specht, B. U., et al. 1979 Enzyme replacement in Tay-Sachs disease. Neurology 29(6):848-54. Vunnam, R. R., and N. S. Radin 1980 Analogs of ceramide that inhibit glucocerebroside synthetase in mouse brain. Chem Phys Lipids 26(3):265-78. Wada, R., C. J. Tifft, and R. L. Proia 2000 Microglial activation precedes acute neurodegeneration in Sandhoff disease and is suppressed by bone marrow transplantation. Proc Natl Acad Sci U S A 97(20):10954-9. Wakamatsu, N., et al. 1992 A novel exon mutation in the human beta-hexosaminidase beta subunit gene affects 3' splice site selection. J Biol Chem 267(4):2406-13. Walkley, S. U., H. J. Baker, and M. C. Rattazzi

206 1990a Initiation and growth of ectopic neurites and meganeurites during postnatal cortical development in ganglioside storage disease. Brain Res Dev Brain Res 51(2):167-78. Walkley, S. U., et al. 1991 Neuroaxonal dystrophy in neuronal storage disorders: evidence for major GABAergic neuron involvement. J Neurol Sci 104(1):1-8. Walkley, S. U., et al. 1990b Distribution of ectopic neurite growth and other geometrical distortions of CNS neurons in feline GM2 gangliosidosis. Brain Res 510(1):63-73. Walter, S., and H. H. Goebel 1988 Ultrastructural pathology of dermal axons and Schwann cells in lysosomal diseases. Acta Neuropathol 76(5):489-95. Walters, R. W., et al. 2001 Binding of adeno-associated virus type 5 to 2,3-linked sialic acid is required for gene transfer. J Biol Chem 276(23):20610-6. Wang, C., et al. 2003 Recombinant AAV serotype 1 transduction efficiency and tropism in the murine brain. Gene Ther 10(17):1528-34. Wang, S. Z., et al. 2008 A novel HEXB mutation and its structural effects in juvenile Sandhoff disease. Mol Genet Metab 95(4):236-8. Wang, Z., et al. 2005 Adeno-associated virus serotype 8 efficiently delivers genes to muscle and heart. Nat Biotechnol 23(3):321-8. Watson, D. J., M. A. Passini, and J. H. Wolfe 2005 Transduction of the choroid plexus and ependyma in neonatal mouse brain by vesicular stomatitis virus glycoprotein-pseudotyped lentivirus and adeno-associated virus type 5 vectors. Hum Gene Ther 16(1):49-56. Watson, G., et al. 2006 Intrathecal administration of AAV vectors for the treatment of lysosomal storage in the brains of MPS I mice. Gene Ther 13(11):917-25. Weiss, L. M., et al. 1988 Pyrimethamine concentrations in serum and cerebrospinal fluid during treatment of acute Toxoplasma encephalitis in patients with AIDS. J Infect Dis 157(3):580-3. Weiss, L. M., et al. 1992 Pyrimethamine concentrations in serum during treatment of acute murine experimental toxoplasmosis. Am J Trop Med Hyg 46(3):288-91. Weksler, B. B., et al. 2005 Blood-brain barrier-specific properties of a human adult brain endothelial cell line. FASEB J 19(13):1872-4. Wiegers, G. J., et al. 2001 CD4(+)CD8(+)TCR(low) thymocytes express low levels of glucocorticoid receptors while being sensitive to glucocorticoid-induced apoptosis. Eur J Immunol 31(8):2293-301. Worgall, S., et al. 2008 Treatment of late infantile neuronal ceroid lipofuscinosis by CNS administration of a serotype 2 adeno-associated virus expressing CLN2 cDNA. Hum Gene Ther 19(5):463-74. Wortmann, S. B., et al. 2009 Substrate deprivation therapy in juvenile Sandhoff disease. J Inherit Metab Dis 32 Suppl 1:S307-11. Wright, J. F. 2008 Manufacturing and characterizing AAV-based vectors for use in clinical studies. Gene Ther 15(11):840-8. Wu, Y. P., and R. L. Proia 2004 Deletion of macrophage-inflammatory protein 1 alpha retards neurodegeneration in Sandhoff disease mice. Proc Natl Acad Sci U S A 101(22):8425- 30.

207 Wu, Z., et al. 2006a Single amino acid changes can influence titer, heparin binding, and tissue tropism in different adeno-associated virus serotypes. J Virol 80(22):11393-7. Wu, Z., A. Asokan, and R. J. Samulski 2006b Adeno-associated virus serotypes: vector toolkit for human gene therapy. Mol Ther 14(3):316-27. Wu, Z., et al. 2006c Alpha2,3 and alpha2,6 N-linked sialic acids facilitate efficient binding and transduction by adeno-associated virus types 1 and 6. J Virol 80(18):9093-103. Xiao, W., et al. 2000 Route of administration determines induction of T-cell-independent humoral responses to adeno-associated virus vectors. Mol Ther 1(4):323-9. Xiao, X., J. Li, and R. J. Samulski 1996 Efficient long-term gene transfer into muscle tissue of immunocompetent mice by adeno-associated virus vector. J Virol 70(11):8098-108. Xie, B., et al. 1991 Isolation and expression of a full-length cDNA encoding the human GM2 activator protein. Biochem Biophys Res Commun 177(3):1217-23. Xie, J., et al. 2011 MicroRNA-regulated, systemically delivered rAAV9: a step closer to CNS- restricted transgene expression. Mol Ther 19(3):526-35. Xin, K. Q., et al. 2001 A novel recombinant adeno-associated virus vaccine induces a long-term humoral immune response to human immunodeficiency virus. Hum Gene Ther 12(9):1047-61. Xu, H., et al. 1999 Characterization of the human Forssman synthetase gene. An evolving association between glycolipid synthesis and host-microbial interactions. J Biol Chem 274(41):29390-8. Xu, L., et al. 2002 Evaluation of pathological manifestations of disease in mucopolysaccharidosis VII mice after neonatal hepatic gene therapy. Mol Ther 6(6):745-58. Xu, R., et al. 2001 Quantitative comparison of expression with adeno-associated virus (AAV-2) brain-specific gene cassettes. Gene Ther 8(17):1323-32. Yakobson, B., et al. 1989 Replication of adeno-associated virus in cells irradiated with UV light at 254 nm. J Virol 63(3):1023-30. Yakobson, B., T. Koch, and E. Winocour 1987 Replication of adeno-associated virus in synchronized cells without the addition of a helper virus. J Virol 61(4):972-81. Yalkinoglu, A. O., et al. 1988 DNA amplification of adeno-associated virus as a response to cellular genotoxic stress. Cancer Res 48(11):3123-9. Yamada, K., et al. 2013 Characterization of the mutant beta-subunit of beta-hexosaminidase for dimer formation responsible for the adult form of Sandhoff disease with the motor neuron disease phenotype. J Biochem 153(1):111-9. Yamaguchi, A., et al. 2004 Possible role of autoantibodies in the pathophysiology of GM2 gangliosidoses. J Clin Invest 113(2):200-8. Yamaguchi, A., et al. 2003 Plasmid-based gene transfer ameliorates visceral storage in a mouse model of Sandhoff disease. J Mol Med (Berl) 81(3):185-93. Yamato, O., et al. 2002 Sandhoff disease in a golden retriever dog. J Inherit Metab Dis 25(4):319-20. Yasui, N., et al.

208 2013 Molecular pathology of Sandhoff disease with p.Arg505Gln in HEXB: application of simulation analysis. J Hum Genet 58(9):611-7. Yoshizawa, T., et al. 2002 Compound heterozygosity with two novel mutations in the HEXB gene produces adult Sandhoff disease presenting as a motor neuron disease phenotype. J Neurol Sci 195(2):129-38. Yu, R. K., et al. 2011 Structures, biosynthesis, and functions of gangliosides--an overview. J Oleo Sci 60(10):537-44. Yue, Y., et al. 2008 A single intravenous injection of adeno-associated virus serotype-9 leads to whole body skeletal muscle transduction in dogs. Mol Ther 16(12):1944-52. Zampieri, S., et al. 2012 Sequence and copy number analyses of HEXB gene in patients affected by Sandhoff disease: functional characterization of 9 novel sequence variants. PLoS One 7(7):e41516. Zampieri, S., et al. 2009 Molecular and functional analysis of the HEXB gene in Italian patients affected with Sandhoff disease: identification of six novel alleles. Neurogenetics 10(1):49-58. Zhang, Z. X., et al. 1995 A second, large deletion in the HEXB gene in a patient with infantile Sandhoff disease. Hum Mol Genet 4(4):777-80. Zhang, Z. X., et al. 1994 Impact of premature stop codons on mRNA levels in infantile Sandhoff disease. Hum Mol Genet 3(1):139-45. Zhou, D., et al. 2004 Lysosomal glycosphingolipid recognition by NKT cells. Science 306(5702):1786-9. Zhou, J., et al. 1998 Evaluation of GM1 ganglioside-mediated apoptosis in feline thymocytes. Vet Immunol Immunopathol 66(1):25-42. Zincarelli, C., et al. 2008 Analysis of AAV serotypes 1-9 mediated gene expression and tropism in mice after systemic injection. Mol Ther 16(6):1073-80.

209