CYP2C9*3 Allelic Variant Is Associated with Metabolism of Irbesartan in Chinese Population

Eur J Clin Pharmacol (2005) 61: 627–634 DOI 10.1007/s00228-005-0976-8

PHARMACOGENETICS

Xiumei Hong Æ Shanchun Zhang Æ Guangyun Mao Shanqun Jiang Æ Yan Zhang Æ Yunxian Yu Genfu Tang Æ Houxun Xing Æ Xiping Xu CYP2C9*3 allelic variant is associated with metabolism of irbesartan in Chinese population

Received: 18 March 2005 / Accepted: 28 June 2005 / Published online: 11 August 2005 Springer-Verlag 2005

Abstract Objective: There is considerable variability in (Taihu: P<0.0001; Dongzhi: P=0.00013) after dosing. the individual pharmaceutical dosages required to No significant association was found between the achieve optimal therapeutic effects, which may be due to CYP2C9*3 allelic variant and the therapeutic effect of environmental or genetic factors. The objective of this irbesartan on essential hypertension. Conclusion: Our study was to test the presence of the CYP2C9*3 allelic study suggests that the CYP2C9*3 plays an important variant in the Chinese population and to investigate the role in the metabolism of irbesartan and/or is in linkage association of this variant with both metabolism and disequilibrium with another potential CYP2C9 allele, therapeutic efficacy of irbesartan on essential hyperten- both of which possibly modify the pharmacokinetics of sion. Methods: In this study, we enrolled 711 subjects irbesartan. from Taihu County and 376 subjects from Dongzhi County in Anhui Province, China. All subjects received Keywords CYP2C9*3 allele Æ Irbesartan Æ a single oral dose of 150 mg irbesartan daily for 28 days. Pharmacokinetics The plasma concentration of irbesartan at 24 h after dosing on the 27th day and at 6 h after dosing on the 28th day was detected using fluorescence-high-performance liquid chromatography. CYP2C9 genotypes were Introduction determined using polymerase chain reaction—restriction fragment length polymorphism. Results:NoCYP2C9*2 Irbesartan is a potent, long-acting angiotensin-II recep- allele was found in 235 Chinese samples and was re- tor blocker [4]. This new class of antihypertensive agent moved from further study. The mean frequency of the selectively blocks the angiotensin type-I (AT1) receptor CYP2C9*3 allele was 3.65%, while no CYP2C9*3/*3 [23], which is responsible for most, if not all, of the genotype was detected. Multiple linear regression anal- classic action of angiotensin II in the cardiovascular yses revealed that the CYP2C9*3 allele carriers had system, including vasoconstriction, aldosterone secre- significantly higher irbesartan concentrations in plasma tion, renal sodium re-absorption, and others. Some at 6 h (Taihu: P<0.0001; Dongzhi: P=0.03) and 24 h controlled, blinded clinical trials have demonstrated that irbesartan is very effective in reducing blood pressure in X. Hong Æ S. Zhang Æ S. Jiang Æ Y. Yu patients with essential hypertension and the effect is dose Life Science School, University of Science and Technology of related [16]. China, Huangshan Road, Hefei City, The pharmacokinetic profile of irbesartan is relatively Anhui Province, China well known. It has high oral absorption, and the average X. Xu absolute bioavailability is about 60–80% [24]. It can be Program for Population Genetics, absorbed well in the presence or absence of food or Harvard School of Public Health FXB-101, co-administration of other drugs. Furthermore, the 665 Huntington Avenue, Boston, MA 02115-6096, USA pharmacokinetics of irbesartan is not altered in patients X. Hong Æ S. Zhang Æ G. Mao Æ S. Jiang Æ Y. Zhang with renal or hepatic impairment [10]. It does not rely on Y. Yu Æ G. Tang Æ H. Xing Æ X. Xu (&) biotransformation for its pharmacological effect. The Institute of Biomedicine, Anhui Medical University, results of in vitro studies indicate that glucuronidation Meishan Road, Hefei City, and oxidation are the major routes of metabolism of Anhui Province, China E-mail: [email protected] irbesartan and that the cytochrome P450 isoform 2C9 Tel.: +1-617-4322958 (CYP2C9) is the primary pathway for oxidation [3], Fax: +1-617-432-2956 while the effect of CYP3A4 is negligible [3]. 628

CYP2C9 is expressed predominantly in the human examination including measurements of both SBP and liver [12], although it has also been detected in various DBP in a seated position after a 15-min rest period. On extrahepatic tissues. It is an important drug-metaboliz- the next morning, blood pressure was measured again. ing enzyme that catalyzes the biotransformation of Subjects with blood pressure meeting the criterion (SBP: many clinically useful drugs, such as phenytoin, S-war- 140–200 mmHg and/or DBP: 90–115 mmHg) were in- farin, tolbutamide, glipizide, and glibenclamide [14]. To cluded in the study and then the first dose of irbesartan date, several allelic variants of CYP2C9 have been 150 mg (Sanofi-Synthelabo Minsheng, Hangzhou, Chi- identified [7, 18]. Among them, CYP2C9*2(Cy- na) was administered orally. During the 28-day treat- s144&Ile359) [6] and CYP2C9*3 (Arg144 & Leu359) ment period, the study subjects were asked to take [21] are the most important because of their influences irbesartan 150 mg daily in the morning and keep diaries on in vitro and in vivo metabolic activities [13, 17, 20]. It about the daily use of irbesartan as well as all other has been reported that allelic frequencies of the CYP2C9 medication (if any) and about all possible adverse gene vary across different ethnic groups. The respective events. They were also asked to visit our regional study allelic frequencies of CYP2C9*2 and CYP2C9*3 in site once a week for measurement of blood pressure. Our African-Americans (1–3.6% and 0.5–1.5%, respectively) trained investigators visited the home of each subject and Asians [28, 30] (0% and 1.7–5%, respectively) ten- four times without notifying them beforehand and ver- ded to be lower than those in Caucasians (8–191% and ified that subjects had taken the dose and kept diaries as 5.3–10%, respectively) [13, 20]. Studies on the metabo- required. On the 27th day, subjects returned to the re- lism of anti-coagulant warfarin suggest that dose search center, stayed overnight, and began fasting at adjustment is required in patients carrying the 2000 hours. On the 28th day, blood pressure was mea- CYP2C9*3 allele because elimination of the drug is sured and a blood sample was drawn 24 h after the 27th slower. Other studies also found that CYP2C9*3 sig- day morning dose. After that, subjects were adminis- nificantly decreased the metabolism of losartan [1]. tered the last dose. Blood pressure was measured at 0.5, Although in vitro studies have established a role for the 2, 4 and 6 h post-dosing. Blood samples were drawn CYP2C9 enzyme in oxidation and intrinsic clearance of again at 6 h post-dosing. irbesartan [3], it is not known whether the CYP2C9 All of the blood pressure measurements mentioned genetic polymorphism influences the metabolism of irbe- above were measured using standardized mercury sartan. Therefore, the objectives of the present study were: sphygmomanometers with suitable cuffs, after the sub- (1) to explore the association of the CYP2C9*3 allelic jects had rested for 15 min in a seated position. We variant with irbesartan metabolism and (2) to investigate defined SBP as Korotkoff phase I (appearance of sound) whether the therapeutic efficacy of irbesartan on essential and DBP as Korotkoff phase V (disappearance of hypertension is modified by the CYP2C*3 allele. sound). Blood pressure was measured in triplicate in the left arm, at 30-s intervals. The mean of the three blood pressure values was used in statistical analyses. Materials and methods Weight and height measurement Study subjects All measurements were finished by trained nurses. The study reported here was conducted in Dongzhi and Height was measured to the nearest 0.1 cm using a Taihu counties of Anhui Province in China, from Feb- portable stadiometer. Body weight was measured to the ruary 2003 to January 2004. Subjects who met the fol- nearest 0.1 kg with subjects standing motionless on the lowing inclusion criteria were enrolled: (1) systolic blood scale after removing shoes and outerwear. Body mass pressure (SBP) between 140 mmHg and 200 mmHg or index (BMI) was calculated as body weight (kg)/height2 diastolic blood pressure (DBP) between 90 mmHg and (m2). 115 mmHg, (2) 35–60 years old, and (3) not taking any antihypertensive medications during the 4 weeks prior to this study. In addition, those currently taking daily Questionnaire data medications with a possible interaction with irbesartan would be excluded from the study. The study procedure After blood pressure measurement, the trained research and the purpose of the study would be explained to the staff conducted a standard questionnaire interview. The participants, and written consent was obtained from each information included: socio-demographic characteristics subject. The study procedures were approved by the (e.g., age, gender, education, and marital status), general institutional review board at Anhui Medical University. health status (including past medical history and use of medications), and lifestyle factors (e.g., current/former/ never smoking, and alcohol use). Current smoker was Study protocol and blood pressure measurement ‘‘smoking more than one cigarette per day regularly for at least 3 months before the study’’ and former smoker Volunteers who met the inclusion criteria were invited to was defined as ‘‘those who had stopped smoking for visit the research center. They underwent a physical more than 6 months before the study’’. 629

Plasma concentration of irbesartan measurement ATATCATG (forward) and CTAACAACCAGACTCA- TAATG (reverse) for the CYP2C9*2 allelic variant and Blood samples drawn at 24 h after dosing on the 27th primers: GAACGTGTGATTGGCAGAAA (forward) and day and 6 h after dosing on the 28th day were centri- CAGGCTGGTGGGGAGAAGGcCAA (reverse) for the fuged, and the plasma samples were collected to measure CYP2C9*3 allelic variant, while the second reverse pri- concentrations of irbesartan by means of fluorescence mer had a mismatched base so as to introduce a styI site high-performance liquid chromatography (HPLC). in the CYP2C9*3 (or Leu359) allele. The PCR amplifi- Plasma samples were centrifuged at 4000 g for 10 min cation was carried out in a volume of 10 ll containing after thawing at room temperature. An aliquot (400 ll) 30 ng of genomic DNA, 2.5 mM MgCl2, 200 lM of each of plasma together with 4 lg (0.1 lg/ll, 40 ll) internal deoxynucleotide triphosphate, 200 nM of each primer, standard flunarizine (Di-Nuo, Hunan, China) and 0.5 U Gold Taq DNA polymerase, and one time reaction 560 ll acetonitrile were pipetted into a 1.5-ml polypro- buffer by touchdown thermal cycler programming [hold pylene tube. The mixture was vortexed for 30 s, incu- (94C 7 min), 18 cycles (94C30s;65C45s;72C45s; bated for 5 min at room temperature, and then reducing the annealing temperature by 0.5C each cycle), centrifuged at 4000 g for 20 min. The supernatant was 35 cycles (94C30s;56C45s;72C 45 s) and hold pipetted and injected into the HPLC system. Solution (72C 7 min, 4C ¥)]. The PCR amplicons were digested and mobile phases were prepared at the time of use. The with three units AvaII for CYP2C9*2 or three units of mobile phase used was acetonitrile:aqueous phosphoric StyI for CYP2C9*3 at 37C for 15 h. Digested products acid-triethylamine solution (39:61, v/v). The aqueous were separated by means of electrophoresis on 3% aga- phosphoric acid-triethylamine solution was prepared by rose gels (FMC Bioproducts, Rockland, ME) and visu- adding 1 ml of triethylamine to 1 l water, then adjusting alized with ethidium bromide staining under ultraviolet the pH value to 4.2 with phosphoric acid. The analytical illumination. We found no CYP2C9*2 allele in 235 column was a Diamosil C18 (5 lm, 150·4.6 mm) col- Chinese samples. So only the CYP2C9*3 allelic variant umn. The flow-rate was 1.5 ml minÀ1, and the column was genotyped and analyzed in further study. temperature was 30C. A fluorescence detector set at an exciting wavelength of 250 nm and an emission wavelength of 375 nm were used to detect the analytes. Statistic analysis Quantification of the irbesartan was performed by comparing HPLC peak areas with those of authentic The unit of plasma irbesartan concentration is nano- standards, with reference to an internal standard. grams per milliliter. As an initial step of our statistical Standard curve of irbesartan was constructed using a analysis, we plotted the distribution of plasma irbesartan series of standard working solutions dissolved in meth- concentration and found that it was approximately an anol. The concentration of each sample was 20.0, 30.0, exponential distribution. After log transformation, it 50.0, 80.0, 160.0, 320.0, 800.0, 2000.0, and 5000.0 ng/ml. was close to normal distribution. So we chose to use log- A linear relationship was observed between the peak area transformed plasma concentration for the subsequent of irbesartan and the corresponding concentration of this statistical analysis. The outcome variables of interest range. The lower limit of quantification is 5 ng/ml. were the log concentrations of irbesartan in plasma at The accuracy and precision of the assay were deter- 24 h post-dosing on the 27th day (LOGC24 h)andat6h mined based on analysis of three plasma quality control post-dosing on the 28th day (LOGC6h), and the SBP samples. These duplicate samples at each concentration reduction (D SBP) and DBP reduction (D SBP) after were analyzed on five consecutive days and were also 27 days of treatment. After routine data checking and analyzed in five replicates within one day. The mean descriptive analyses, we applied t tests to compare means accuracy ranged from 97% to 104%. Within- and and standard deviations of continuous social-demo- between-run precision (% RSD) were less than 8% for graphic characteristics and chi square tests to compare all concentration levels. During a typical week, the the distribution of categorical variables between study slopes of plasma standard curves were quite reproduc- subjects from the two study sites. Significant differences ible with a CV of less than 5%, further supporting the existed in the social-demographic characteristics of precision of the assay. subjects from the different study sites, so the following analyses were done based on stratification by study site. Using the CYP2C*1/*1 genotype as the reference, we Genotyping method performed multivariate linear regression analyses using generalized estimating equations (GEE) to explore the A venous blood sample was collected from each subject, associations of C24 h and C6hwith the variant alleles of and DNA was extracted according to a standard proto- the CYP2C9 gene. We then explored interactions col .CYP2C9*2 and CYP2C9*3 allelic variants were between the CYP2C9 genotype and gender, age, BMI, genotyped using the polymerase chain reac- and smoking status. Similar analyses were also applied tion—restriction fragment length polymorphism (PCR- to explore the relationships of D SBP and D DBP with RFLP) technique. Genomic flanking sequence was CYP2C9 genotype. All regression analyses were done amplified using primers [19]: TACAAATACAATGAAA with adjustment for age, age squared, BMI, BMI 630 squared, sex, education level, smoking status, and Table 1 Characteristics of study subjects. SD standard deviation. SBP systolic blood pressure, DBP diastolic blood pressure, C24 h alcohol consuming status and co-administration with plasma concentration of irbesartan at 24 h post-dosing, LOG other drugs. (C24 h) the log scale of C24 h, C6h plasma concentration of irbesartan at 6 h post-dosing, LOG (C6 h) the log scale of C6h, D SBP_24 h SBP at 24 h post-dosing on 27th day—baseline SBP Results before treatment, D DBP_24 h DBP at 24 h post-dosing on 27th day—baseline DBP before treatment, D SBP_6 h SBP at 6 h post- dosing on 28th day–baseline SBP before treatment, D DBP_6 h The total sample size in this report is 1,087, with 711 DBP at 6 h post-dosing on 28th day—baseline DBP before treat- from Taihu County and 376 from Dongzhi County. The ment epidemiological and clinical characteristics are summa- Taihu (n=711) Dongzhi (n=376) rized in Table 1.TheCYP2C9*2 allele was not detected in 235 subjects and was removed from further analysis. Mean±SD The allelic frequency of the CYP2C9*3 allele was Age (year) 53.7±7.2 50.1±6.3** Weight (kg) 54.0±8.5 58.3±9.8** 3.65%, which was similar between subjects from the two ** counties (3.8% versus 3.3%; P>0.05). The mean fre- Height (cm) 156.5±7.7 158.4±7.5 Baseline SBP (mmHg) 165.9±16.8 161.5±15.8** quency of the CYP2C9*1/CYP2C9*3 genotype was Baseline DBP (mmHg) 91.8±10.5 93.1±9.5* ** 7.6% for the Taihu subpopulation and 6.6% for the C24 h (ng/ml) 76.8±49.5 60.6±41.0 ** Dongzhi subpopulation. No CYP2C9*3/*3 genotype LOG (C24 h) 4.1±0.7 3.9±0.7 ** C6h(ng/ml) 402.6±195.8 355.6±187.7 was detected in the total samples. The predicted fre- ** LOG (C6h) 5.9±0.5 5.8±0.5 quencies of CYP2C9*1/*3 and CYP2C9*3/*3 were D SBP_24 h (mmHg) 19.1±16.3 18.6±16.4 7.2% and 1.03% for the Taihu and 6.4% and 0.1% for D DBP_24 h (mmHg) 6.0±8.6 7.7±7.5** the Dongzhi subpopulation. So the distribution of D SBP_6 h (mmHg) 32.5±16.8 28.5±16.1** genotypes observed in all subjects or in subjects from D DBP_6 h (mmHg) 14.6±9.2 14.0±8.0 either county obeyed the Hardy–Weinberg equilibrium. n (%) When compared with those from Dongzhi, subjects Sex (male) 386 (54.3) 221(58.8) from Taihu were older (53.7±7.2 years versus 50.1± Smoking status 6.3 years, P<0.01), had lower weight (54.0±8.5 kg No smoking or 429 (60.3) 265(73.1) versus 58.3±9.8 kg, P<0.01), and lower height (156.5± former smoking ** 7.7 cm versus 158.4±7.5 cm, P<0.01), but had a higher Current smoking 282 (39.7) 101(26.9) concentration of irbesartan in plasma (C24 h: 76.8± Alcohol drinking status 49.5 ng/ml versus 60.6±41.0 ng/ml, P<0.01; C6h: No drinking or 567 (79.7) 252(67.0) 402.6±195.8 ng/ml versus 355.6±187.7 ng/ml, former drinking Current drinking 144 (20.3) 124(33.0)** P<0.01), and a higher proportion of current smokers Co-therapy with 29 (4.08) 8(2.2) (39.7% versus 26.9%, P<0.01) and current alcohol other drugs consumers (20.3% versus 33.9%, P<0.01). They also CYP 2C 9 had higher baseline SBP (165.9±16.8 mmHg versus *1/*1 657 (92.4) 351(93.4) 161.5±15.8 mmHg, P<0.01), but lower baseline DBP *1/*3 54 (7.6) 25(6.6)

(91.8±10.5 mmHg versus 93.1±9.5 mmHg, P=0.047). * ** As showed in Table 2, CYP2C9*3 allele carriers from P<0.05; P<0.01 either county had a higher log concentration of irbesartan at 24 h post-dosing on the 27th day and also at No significant differences were found between indi- 6 h post-dosing on the 28th day. After adjustment of viduals with CYP2C9*1/*1 genotype and those with covariates based on generalized estimating equations, CYP2C9*1/*3 with regard to the efficacy of irbesartan the similar relationship still existed (Table 2). In Taihu treatment as measured by reduction in SBP (Taihu County, the log concentration at 24 h post-dosing is 0.53 County: 18.9±16.2 mmHg versus 21.0±16.8 mmHg, log ng/ml higher (P<0.0001) and the log concentration P=0.38; Dongzhi County: 18.2±14.4 mmHg versus at 6 h post-dosing is 0.28 log ng/ml higher (P<0.0001) 20.0±17.5 mmHg, P=0.56) or DBP(Taihu County: in CYP2C9*1/ *3 carriers than in CYP2C9*1/*1 carri- 6.0±8.4 mmHg versus 5.7±8.2 mmHg; P=0.67; Don- ers; in Dongzhi County, the log concentration at 24 h gzhi County: 7.7±7.6 mmHg versus 7.6±7.4 mmHg, post-dosing is 0.54 log ng/ml higher (P=0.00013), and P=0.93). Such a relationship between Ile359Leu poly- the log concentration at 6 h post-dosing is 0.21 log ng/ morphism and the efficacy of irbesartan treatment on ml higher (P=0.033) in CYP2C9*1/ *3 carriers than in hypertension remained insignificant when covariates CYP2C9*1/*1 carriers. were adjusted (Table 3). We investigated interactions between CYP2C9 polymorphisms and several environmental variables (including age, gender, BMI, and smoking status) in Discussion their associations with plasma concentrations of irbesartan. We did not find any significant interactions (data Our study indicated that the CYP2C9*2 allele is rare in not shown). the Chinese population since no polymorphisms were 631

Table 2 Relative mean plasma concentrations of irbesartan by in subjects carrying CYP2C9*1/*3, when compared with those CYP2C9 genotype. LOG(C24 h) log scale of plasma concentration carrying CYP2C9*1/*1; SE ‘‘standard error’’, which is the devia- of irbesartan at 24 h post-dosing; LOG(C6h) log scale of plasma tion of the observed b from the predicted b. The unit of plasma concentration of irbesartan at 6 h post-dosing; b regression coef- concentration of irbesartan is ng/ml ﬁcient, which means the change of log concentration of irbesartan

Yvar n Genotype Mean±SD Adjusted#

b±SE P value

Taihu LOG (C24 h) 657 *1/*1 4.10±0.64 0.00 54 *1/*3 4.63±0.60 0.53±0.09 <0.0001** LOG (C6h) 657 *1/*1 5.86±0.49 0.00 54 *1/*3 6.12±0.37 0.28±0.05 <0.0001** Dongzhi LOG (C24 h) 334 *1/*1 3.85±0.70 0.00 24 *1/*3 4.39±0.62 0.54±0.13 0.00013** LOG (C6h) 334 *1/*1 5.73±0.51 0.00 24 *1/*3 5.92±0.45 0.21±0.10 0.033* Total LOG (C24 h) 1,008 *1/*1 4.01±0.67 0.00 79 *1/*3 4.55±0.61 0.55±0.07 <0.0001** LOG (C6h) 1,008 *1/*1 5.82±0.50 0.00 79 *1/*3 6.06±0.41 0.25±0.05 <0.0001**

# Adjusted for age, age squared, body mass index (BMI), BMI squared, sex, education level, smoking status (current smoking or not, former smoking or not), and alcohol consuming status (current alcohol consuming or not, former alcohol consuming or not), and co-administration with other drugs, and study site (just for total population) * P value <0.05, ** P value<0.01 detected in 235 random samples, which is consistent with study supported the hypothesis that the CYP2C9*3 previous studies in Chinese [28, 30] and Korean [27] allele is associated with a higher plasma concentration of subjects. The mean frequency of the CYP2C9*3 allele irbesartan, which suggests that the CYP2C9*3 allele was 3.65% in our subjects, which is somewhat lower possibly moderates the metabolism of irbesartan. The than frequencies reported previously in Caucasians and underlying pathophysiological mechanism may be due Canadian Native Indians but similar to those reported in to the lower activity of the CYP2C9 enzyme caused by Asians [13]. We found that, in both counties studied, the CYP2C9*3 allele. Previous studies also provided CYP2C9*3 allele carriers had a significantly higher evidence that the CYP2C9*3 allele can modify the irbesartan concentration in plasma (C24 h and C6h) than CYP2C9 activity. For example, in vitro studies indicate those with the CYP2C9*1/CYP2C9*1 genotype, given that CYP2C9*3 has significantly impaired catalytic the therapy regimen. But no significant associations were activity to various CYP2C9 substrates relative to the found between genotype and the therapeutic efficacy of wild type [21]. In vivo studies also show that individuals irbesartan on essential hypertension. heterozygous and homozygous for CYP2C9*3 have re- The population in this study consisted of two geo- duced intrinsic clearance of different drugs, including graphically distinct subpopulations of the same ethnic- warfarin [17, 20], losartan [1], and valproic acid [11]. The ity. We found that subjects from Taihu County had a extent of the reduction in activity and changes of the higher plasma concentration of irbesartan than subjects kinetic parameters caused by CYP2C9*3 varies among from Dongzhi County. The reason for this difference is substrates [21]. Another explanation for our results is not clear. We suspect that either genetic characteristics, that the CYP2C9*3 allele is in linkage disequilibrium demographic or environmental variables, or a combi- with one potential CYP2C9 allele, which actually leads nation of the two may play some role. For instance, to the reduced activity of the CYP2C9 enzyme. subjects from Taihu County are older, thinner, and have As a kind of insurmountable antagonist, irbesartan more current smokers, which may lead to slow clearance has been reported to concomitantly produce a rightward of irbesartan[25, 29]. shift of angiotensin II concentration–response curves As mentioned before, the CYP2C9 enzyme is in the with increasing concentrations [8]. Richard et al. [16] primary pathway of oxidization, which is a major route found that irbesartan presents a clear dose-response of metabolism of irbesartan. Chando et al. [5] found that relationship in the treatment of hypertension and the the predominant metabolite in urine was the omega-1 maximal-effect dose appears to be 300 mg daily. How- hydroxylated metabolite, which is biotransformed via ever, to date, the concentration–response relationship oxidation. So the activity of the CYP2C9 enzyme can for irbesartan in a wide range of plasma concentrations possibly modify the oxidization of irbesartan and then has not been well established. In our study, no signifi- further affect its metabolism and intrinsic clearance. Our cant relationships between the CYP2C9*3 allele and 632

Table 3 Relative blood pressure drop by CYP2C9 genotype, CYP2C9*1/*3, when compared with those carrying CYP2C9*1/*1. stratiﬁed by study site. b is the regression coeﬃcient, which means SE ‘‘standard error’’, which is the deviation of the observed b from the change of log concentration of irbesartan in subjects carrying the predicted b

Yvar Genotype n Mean±SD Adjusteda Adjustedb

b±SE P-value b±SE P value

TaiHu D SBP_6 h *1/*1 657 32.82±18.30 – – – – *1/*3 54 31.93±16.74 À1.91±1.86 0.30 À2.27±1.89 0.23 D DBP_6 h *1/*1 657 14.69±9.14 *1/*3 54 14.04±9.81 À1.14±1.13 0.32 À1.25±1.14 0.28 D SBP_24 h *1/*1 657 19.02±17.81 *1/*3 54 20.07±18.02 À0.12±2.13 0.95 À1.09±2.21 0.62 D DBP_24 h *1/*1 657 6.04±8.64 *1/*3 54 5.74±8.23 À0.72±1.04 0.71 À1.37±1.07 0.20 Dongzhi D SBP_6 h *1/*1 351 28.21±16.33 – – – – *1/*3 25 33.00±11.83 2.05±2.36 0.38 1.99±2.41 0.41 D DBP_6 h *1/*1 351 13.92±8.07 – – – – *1/*3 25 15.40±6.19 1.02±1.10 0.36 0.89±1.12 0.43 D SBP_24 h *1/*1 351 18.53±16.39 – – – – *1/*3 25 20.08±17.18 À0.04±3.22 0.99 À0.06±3.27 0.99 D DBP_24 h *1/*1 351 7.70±7.49 – – – – *1/*3 25 7.52±7.21 À0.48±1.31 0.71 À1.01±1.30 0.44 Total D SBP_6 h *1/*1 976 31.22±17.77 – – – – *1/*3 78 32.27±15.29 À0.71±1.52 0.64 À0.93±1.55 0.54 D DBP_6 h *1/*1 991 14.42±8.79 – – – – *1/*3 78 14.47±8.81 À0.48±0.87 0.58 À0.55±0.88 0.53 D SBP_24 h *1/*1 991 18.85±17.32 – – – – *1/*3 77 20.08±17.65 À0.20±1.79 0.91 À0.78±1.83 0.67 D DBP_24 h *1/*1 991 6.62±8.29 – – – – *1/*3 78 6.30±7.92 À0.63±0.83 0.45 À1.21±0.84 0.15 a Adjusted by: age, age squared, body mass index (BMI), BMI squared, sex, education level, smoking status (current smoking or not, former smoking or not), alcohol consuming status (current alcohol consuming or not, former alcohol consuming or not), and co- administration with other drugs, baseline SBP, baseline DBP and study site (just for total population) b Adjusted variables also included log scale of plasma concentration of irbesartan at 6 h post-dosing (for D DBP_6 h and D SBP_6 h) OR log scale of plasma concentration of irbesartan at 24 h post-dosing (for D DBP_24 h and D SBP_24 h) therapeutic efficacy of irbesartan were identified, al- The clinical importance of this fact has been demon- though CYP2C9*3 was highly related to higher plasma strated previously [22]. Further studies on the CYP2C9 concentration of irbesartan. One possible explanation polymorphism and the therapeutic efficacy of irbesartan for this result is that CYP2C9*1/*1 carriers have enough on essential hypertension in different populations should irbesartan in plasma (68 ng/ll at 24 h post-dosing) to be carried out. produce the maximal effect on blood pressure reduction. The present study had some strengths: (i) it was Actually, we found that in our population, irbesartan conducted in two geographically distinct subpopulations showed a concentration–response relationship on blood of the same ethnicity, so we could evaluate whether the pressure reduction only when the concentration was no results found in one site could be replicated in another more than 40 ng/ll. Another study in China [30]also site; (ii) both the plasma concentrations of irbesartan found no relationship between the therapeutic outcome and genotypes were objective measurements, and neither of irbesartan and CYP2C9*3 allelic variant, although a the subjects nor the research staff were aware of either of study in Swedish subjects suggested that the CYP2C9 these values at the time of interview; and (iii) the sample genotype can predict a DBP response to irbesartan [9]. size was relatively large compared with other studies. This inconsistency may be due to: (1) the sample size for However, in this study, the irbesartan level was the Swedish study was lower, as only 45 subjects were measured only in plasma at 6 h and 24 h post-dosing. involved in the study; (2) the alleles studied in the dif- No analysis can be done with regard to the relationship ferent studies were not the same—our study mainly of the AUC (the area under the plasma concentration– focused on Ile359Leu, while the study in Swedish sub- time curve), Cmax (the highest observed concentration), jects tried to explore the effect of CYP2C9*2 alleles, and t1/2 (the terminal elimination half-life) with which focus on Arg144Cys; and (3) the activity of CYP2C9 allelic variants. The irbesartan metabolite via CYP2C9 and the magnitude of the effect of the CYP2C9 CYP2C9 was not measured directly, so the observed polymorphism may be different among ethnic groups. association between the CYP2C9*3 allele and plasma 633 irbesartan concentration may be affected by other met- nonpeptide AT1 subtype angiotensin II receptor antagonist. abolic pathways such as glucuronidation. Morever, only J Pharmacol Exp Ther 265:826–834 5. Chando TJ, Everett DW, Kahle AD et al (1998) Biotransfor- CYP2C9*2 and CYP2C9*3 alleles were studied in this mation of irbesartan in man. Drug Metab Dispos 26(5):408–417 report. Further work should to be carried out to explore 6. Crespi CL, Miller VP (1997) The R144C change in the the effect of all CYP2C9 alleles on the full pharmaco- CYP2C9*2 allele alters interaction of the cytochrome P450 kinetics of irbesartan. with NADPH: Cytochrome P450 oxidoreductase. Pharmaco- genetics 7:203–210 The study of pharmacokinetics has its clinical impli- 7. Dickmann LJ, Rettie AE, Kneller MB, Kim RB, Wood AJ, cations. Although some clinical studies support that Stein CM, Wilkinson GR, Schwarz UI (2001) Identification irbesartan is well tolerated and is absent of dose-limiting and functional characterization of a new CYP2C9 variant side effects, such studies are based on relatively smaller (CYP2C9*5) expressed among African-Americans. Mol Phar- sample sizes or shorter periods of administration. Thus, macol 60:382–387 8. Fierens FLP, Vanderheyden PML, De Backer J-P, Vauquelin G knowledge of individualized dose requirements is still (1999) Insurmountable angiotensin AT1 receptor antagonist: the clinically useful because it can provide a rational basis role of tight antagonist binding. Eur J Pharmacol 372:199–206 for tailored therapy, which has the promise of maxi- 9. Hallberg P, Karlsson J, Kurland L, Lind L, Kahan T, mizing therapeutic efficacy and minimizing adverse Malmqvist K, Ohman KP, Nystrom F, Melhus H (2002) The CYP2C9 genotype predicts the blood pressure response to reactions. Our study indicated that administration of irbesartan: result from the Swedish Irbesartan Left Ventricular 150 mg daily may be an over-dose for individuals car- Hypertrophy Investigation vs. Atenolol(SILVHIA) trial. rying the CYP2C9*3 allele, since such carriers have a J Hypertens 20(10):2089–2093 higher concentration of irbesartan in plasma without a 10. Hans R, Brunner (1997) The new angiotensin II receptor antagonist, irbesartan. pharmacokinetic and pharmacodynamic significantly better therapeutic efficacy, when compared considerations. Am J Hypertens 10:311S–317S with those with the CYP2C9*1/*1 genotype. But our 11. Ho PC, Abbott FS, Zanger UM, Chang TK (2003) Influence of study prepresents the very first step in our effort to CYP2C9 genotypes on the formation of a hepatotoxic metab- understand individual genetic variability in relation to olite of valproic acid in human liver microsomes. Pharmacog- metabolism and therapeutic efficacy of irbesartan. Lots enomics J 3(6):335–342 12. Klose TS, Blaisdell JA, Goldstein JA (1999) Gene structure of of work remains to be done in this research area. CYP2C8 and extrahepatic distribution of the hyman CYP2Cs. In summary, our study found that CYP2C9*3 carri- J Biochem Mol Toxicol 13:289–295 ers have a higher plasma concentration of irbesartan. No 13. Lee CR, Goldstein JA, Pieper JA(2003) Cytochrome P450 2C9 relationship was found between the CYP2C9*3 allelic polymorphisms: a comprehensive review of the in-vitro and human data. Pharmacogenetics 12:251–263 variant and the therapeutic effect of irbesartan. Our 14. Miners JO, Birkett DJ (1998) Cytochrome P4502C9: an enzyme study suggests that CYP2C9*3 plays an important role of major importance in human drug metabolism. Br J Clin in metabolism of irbesartan and/or is in linkage dis- Pharmacol 45:525–538 equilibrium with another potential CYP2C9 allele, both 15. Perrier L, Bourrie M, Marti E (1994) In vitro N-glucuronidation of SR 47436(BMS 186295), a new AT1 nonpeptide of which modify the pharmacokinetics of irbesartan. angiotensin II receptor antagonist, by rat, monkey and human hepatic microsomal fractions. J Pharmacol Exp Ther 271:91–99 Acknowledgements This study was supported in part by Anhui 16. Reeves RA, Lin CS, Kassler-Taub K, Pouleur H (1998) Dose- Provincial Ministry of Education, Anhui Medical University related efficacy of irbesartan for hypertension. Integrated Anal Biomedical Institute. We would like to thank the faculty and staff Hypertens 31(6):1311–1316 of the Anhui Medical University and of the Program of Population 17. Scordo MG, Pengo V, Spina E (2002) Influence of CYP2C9 Genetics at Harvard School of Public Health. We are also grateful and CYP2C19 genetic polymorphism on warfarin maintenance to all study participants and their families for their assistance and dose and metabolic clearance. Clin Pharmacol Ther 72:702–710 cooperation. We would like to thank Dr. Scott Venners and Dr. 18. Sim SC, Ingelman-Sunberg M, Daly AK et al (2005) Human Xiaobin Wang for their careful editing of the manuscript. This cytochrome P450 (CYP) allele nomenclature committee (web- study was conducted in accordance with the current regulations of site); http://www.imm.ki.se/CYPalleles/ People’s Republic of China and was approved by the institutional 19. Sullivan-Klose TH, Ghanayem BI, Bell DA et al (1996) J.A. review board at Anhui Medical University. None of the authors The role for the CYP2C9-Leu359 allelic variant in the tolbu- claims any conflict of interest. tamide polymorphism. Pharmacogenetics 6:341–349 20. Takahashi H, Echizen H (2001) Pharmacogenetics of warfarin elimination and its clinical implications. Clin Pharmacokinet References 40:587–603 21. Takanashi K, Tainaka H, Kobayashi K, Yasumori T, Hosak- awa M, Chiba K (2000) CYP2C9Ile359 and Leu359 variants: 1. Babaoglu MO, Yasar U, Sandberg M, Eliasson E, Dahl ML, enzyme kinetic study with seven substrates. Pharmacogenetics Kayaalp SO, Bozkurt A (2004) CYP2C9 genetic variants and 10:95–104 losartan oxidation in a Turkish population. Eur J Clin Phar- 22. Takahashi H, Wilkinson GR, Caraco Y et al (2003) Population macol 60(5):337–342 differences in (S)-warfarin metabolism between CYP2C9 2. Bhasker CR, Miners JO, Coulter S, Birkett DJ (1997) Allelic genotype-matched Caucasian and Japanese. Clin Pharmacol and functional variability of cytochrome P4502C9. Pharma- Ther 73:253–263 cogenetics 7:51–58 23. Timmermans PBMWM, Smith RD (1994) Angiotensin II 3. Bourrie´M, Meunier V, Berger Y, Fabre G (1999) Role of receptor subtypes: selective antagonists and functional corre- Cytochrome P-450 2C9 in irbesartan oxidation by human liver lates. Eur Heart J 15(Suppl D):79–87 microsomes. Drug Metab and Dispos 27(2):288–296 24. Vachharajani NN, Shyu WC, Chando TJ, Everett DW, Greene 4. Cazaubon C, Gougat J, Bousquet F, Guiraudou P, Gayraud R, DS, Barbhaiya RH (1998) Oral bioavailability and disposition Lacour C, Roccon A, Galindo G, Barthelemy G, Gautret B characteristics of irbesartan, an angiotensin antagonist, in (1993) Pharmacological characterization of SR 47436, a new healthy volunteers. J Clin Pharmacol 38(8):702–707 634

25. Vachharajani NN, Shyu WC, Smith RA, Greene DS (1998) 28. Yu BN, Luo CH, Wang D, Wang A, Li Z, Zhang W, Mo W, The eﬀects of age and gender on the pharmacokinetics of ir- Zhou HH (2004) CYP2C9 allele variants in Chinese hypertension besartan. Br J Clin Pharmacol 46(6):611–613 patients and healthy controls. Clin Chim Acta 348(1–2):57–61 26. Wen SY, Wang H, Sun OJ, Wang SQ (2003) Rapid detection of 29. Zhang S, Liu P, Jiang S, Hong X, Xing H, Xu X (2005) the known SNPs of CYP2C9 using oligonucleotide microarray. Association of cigarette smoking with steady-state plasma World J Gastroenterol 9(6):1342–1346 concentration of irbesartan in male Chinese with hypertension. 27. Yoon YR, Shon JH, Kim MK, Lim YC, Lee HR, Park JY, Methods Find Exp Clin Pharmacol 27(3):173–178 Cha IJ, Shin JG (2001). Frequency of cytochrome P450 2C9 30. Zhao F, Loke C, Rankin SC et al (2004) Novel CYP2C9 ge- mutant alleles in a Korean population. Br J Clin Pharmacol netic variants in Asian subjects and their inﬂuence on Main- 51:277–280 tenance warfarin dose. Clin Pharmacol Thr 76(3):210–219