Food Microbiology 71 (2018) 17E24

Food Microbiology 71 (2018) 17e24

Contents lists available at ScienceDirect

Food Microbiology

journal homepage: www.elsevier.com/locate/fm

A liquid bead array for the identification and characterization of fljB-positive and fljB-negative monophasic variants of Salmonella Typhimurium

* Cecile Boland a, b, , Mieke Van Hessche a, Jacques Mahillon b, Pierre Wattiau a a Veterinary and Agrochemical Research Centre (CODA-CERVA), Operational Direction Bacterial Diseases, Foodborne Bacterial Zoonoses & Antibiotic Resistance Unit, Groeselenbergstr. 99, B-1180 Brussels, Belgium b Universite catholique de Louvain (UCL), Faculty of Bioscience Engineering, Earth and Life Institute, Applied Microbiology Cluster (ELIM), Laboratory of Food and Environmental Microbiology, Croix du Sud, 2 - L7.05.12, 1348 Louvain-la-Neuve, Belgium article info abstract

Article history: Salmonella 1,4,[5],12:i:- accounts currently for one of the most common serotypes observed worldwide. Received 17 November 2016 These isolates do not express the FljB flagellin and mostly derive from Salmonella Typhimurium. They are Received in revised form therefore termed Salmonella Typhimurium monophasic variants (STMV) and are considered of compa- 31 March 2017 rable public health risk. Since serological identification of the somatic and flagellar antigens of STMV is Accepted 9 April 2017 not sufficient to demonstrate relatedness with Salmonella Typhimurium, additional assays detecting Available online 21 April 2017 genetic markers unique to Salmonella Typhimurium are required. In addition, identification of the mutations affecting expression of the flagellar gene fljB can be useful to support the monophasic character Keywords: Salmonella observed phenotypically. Finally, genetic subtyping of the various mono- and biphasic Salmonella Monophasic Typhimurium clonal groups can facilitate their epidemiological follow-up. Here, we present a home- Typhimurium made liquid bead array able to fulfill these requirements. This array confirmed the monophasic char- 1,4,[5],12:i:- acter of 240 STMV isolates collected in Belgium during 2014e2015 and identified 10 genetic subtypes. Array Microevolution in and around the fljB locus linked to IS26 insertions is probably one of the driven force Luminex accounting for STMV population diversity. Thanks to its open design, other genetic signatures could later be merged to the assay to subtype additional STMV clonal groups and to detect rare mutations. © 2017 Elsevier Ltd. All rights reserved.

1. Introduction United Kingdom from 2005 to 2010 (Petrovska et al., 2016), an outbreak associated with the consumption of dried pork sausage in Salmonella Typhimurium Monophasic Variants (STMV) strains Spain in 2011 (Arnedo-Pena et al., 2016) and an outbreak in Central serotyped as 1,4,[5],12:i:- account currently for one of the most Italy in 2013e2014 (Cito et al., 2016). Isolates serotyped as Salmo- common serotypes observed in many countries worldwide (Switt nella 1,4,[5],12:i:- can be monophasic variants of several serovars: et al., 2009). Such strains caused several outbreaks during the Typhimurium, Lagos, Agama, Farsta, Tsevie, Gloucester and Tumodi. recent years, including three foodborne outbreaks in France in 2010 The relatedness of Salmonella 1,4,[5],12:i:- strains to the Typhi- and 2011 (Anonymous, 2010; Bone et al., 2010; Gossner et al., 2012; murium serovar is important to determine due to the high risk for Raguenaud et al., 2012; Switt et al., 2009), an epidemic in the public health associated with Salmonella Typhimurium strains (Anonymous, 2011) and their monophasic variants (Anonymous, 2010). Since serological identification of the somatic and flagellar antigens is not sufficient to determine this relatedness, a duplex Abbreviations: STMV, Salmonella Typhimurium Monophasic Variants; STM, PCR assay is recommended by the European Food Safety Authority Salmonella Typhimurium. (EFSA) to discriminate between biphasic Salmonella Typhimurium * Corresponding author. Veterinary & Agrochemical Research Centre, Foodborne bacterial Zoonoses & Antibiotic Resistance Unit, Groeselenbergstr. 99, B-1180 strains, the monophasic variants of Salmonella Typhimurium and Brussels, Belgium. the strains belonging to other serovars expressing the O:4 and H:i E-mail addresses: [email protected] (C. Boland), mieke.vanhessche@ antigens (Anonymous, 2010; Tennant et al., 2010). This PCR assay coda-cerva.be (M. Van Hessche), [email protected] (J. Mahillon), targets (i) the fliB-fliA intergenic region hosting an IS200 element [email protected] (P. Wattiau). http://dx.doi.org/10.1016/j.fm.2017.04.006 0740-0020/© 2017 Elsevier Ltd. All rights reserved. 18 C. Boland et al. / Food Microbiology 71 (2018) 17e24 found only in the Typhimurium or Farsta serovars or their variants Two other probes, “LT2_2915584&IS26” and “IS26<2_2916036”, (among the serovars expressing the O:4 and H:i antigens) and (ii) are of particular interest to follow the presence of an IS26 com- fljB, the gene coding for the phase 2 flagellin. This PCR identifies posite transposon inserted between hin and iroB which was the STMV isolates lacking the fljB coding sequence but cannot differ- hallmark of most fljB-positive isolates observed in a previous study entiate fljB-positive STMV strains from phenotypically biphasic in Belgium from 2008 to 2011 (Boland et al., 2015). These probes Salmonella Typhimurium strains. STMV isolates harboring an fljB target the IS26 elements found at the left and right junctions of this coding sequence were reported in several countries: the United transposon, respectively (Boland et al., 2015). States (Zamperini et al., 2007), Germany (Hauser et al., 2010b), Italy (Barco et al., 2011, 2014), France (Bugarel et al., 2012), Poland 2.3.2. Ligase Chain Reaction (LCR) assay (Wasyl and Hoszowski, 2012), England and Wales (Hopkins et al., The molecular method developed for the identification and 2012), Ireland (Prendergast et al., 2013), Greece (Mandilara et al., characterization of STMV isolates is a multiplex assay based on a 2013), Denmark (Arguello et al., 2014) and Japan (Ido et al., 2014). Ligase Chain Reaction (LCR) of Padlock-shaped Probes (PLPs) hy- To our knowledge, the highest prevalence of fljB-positive STMV bridized to MagPlex-TAG™ microspheres coated with unique 24-nt isolates was reported in Belgian farmed animals during the period ® long capture tags and analyzed on a Luminex 200™ bead-array 2008 to 2011 with 43.8% of all Salmonella 4,[5]:i:- isolates being fljB- hybridization platform (Luminex, Austin, Texas). Sequences of positive (Boland et al., 2014). Next to fljB-negative isolates, detec- primers and probes used in the LCR assay are listed in Table 1. The tion and characterization of fljB-positive STMV isolates is thus 15 PLPs were designed as described by Wattiau et al. (2011). Only critical for the global monitoring of the various monophasic Sal- probes displaying no significant similarity between the target monella Typhimurium lineages circulating worldwide. sequence and the rest of the genome were kept. The LCR assay was Here, we describe a home-made liquid bead array able to (i) conducted in three successive steps according to the procedure of identify monophasic isolates as Typhimurium variants, (ii) detect Wattiau et al. (2011) with minor modifications. The first step the absence of an fljB coding sequence in fljB-negative isolates, (iii) (ligation) was conducted in a 10 ml mixture containing 1 ml of the identify the genetic mutations causing the monophasic character in DNA extracted as described above, 2 U of Pfu DNA ligase (Agilent, fljB-positive isolates, and (iv) further subtype the clonal groups of Santa Clara, CA), 20 mM Tris-HCl (pH 7.5), 20 mM KCl, 10 mM mono- and biphasic Salmonella Typhimurium isolates to help their MgCl , 0.1% Igepal, 0.01 mM rATP, 1 mM dithiothreitol (DTT), and molecular epidemiological follow-up. A collection of 241 isolates 2 200 pM of each PLP (or 800 pM for the PLP “LT2_1659055C”). serotyped as 4,[5]:i:- and collected in Belgium during 2014 and Ligation was conducted with a thermal cycler. After 3 min at 95 C, 2015 was used to assess the ability of the bead array to characterize 25 cycles of 30 s at 95 C and 5 min at 65 C were performed, fol- these isolates at genetic level. lowed by a 2-min final denaturation at 98 C. The second step (exonuclease treatment) started with the addition of 15 mlof 2. Materials and methods exonuclease mixture consisting of 67 mM glycine-KOH, pH 9.4, 2.5 mM MgCl ,50mg/ml bovine serum albumin (BSA), and 0.0015 U 2.1. Bacterial isolates 2 exonuclease l (New England BioLabs, Ipswich, MA). The resulting samples (25 ml) were incubated at 37 C for 45 min, followed by Two hundred forty-one Salmonella isolates collected in Belgium inactivation at 95 C for 10 min. Upon completion of the second during the years 2014 and 2015 at the National Reference Labora- step, PCR amplification was conducted by adding 25 ml of 2-fold tory for Animal Health and serotyped as 4,[5]:i:- after at least one real-time PCR mix (ABGene, Epsom, United Kingdom) supple- phase-inversion assay were analyzed with the home-made liquid mented with UR (0.05 mM) and 50Cy3-labeled UF (0.4 mM) primers. bead array described in point 2.3. Among these, 154 were isolated After 10 min at 95 C, 30 cycles of 45 s at 95 C, 45 s at 55 C, and from pig, 31 from poultry, 10 from cattle, 7 from food, 6 from feed 1 min at 72 C were performed, followed by a 15-min final elon- and 1 from horse. The remaining 32 isolates were from unreported gation at 72 C and denaturation at 98 C for 2 min. The samples origin. were then stored at 20 C until hybridization and reading on a bead-array platform. 2.2. DNA preparation

DNA was prepared from bacteria grown on Brilliant Green Agar 2.3.3. Detection of the LCR products on a bead-array platform ® plates (Oxoid, Aalst, Belgium). A few colonies were suspended in LCR products were hybridized with a mix of Luminex MagPlex- 400 ml of sterile Milli-Q water and vortexed. Bacterial concentration TAG™ microspheres including the 15 different beads presented in was adjusted to reach an absorbance at 600 nm between 1 and 2 Table 1. Prior to hybridization, the bead mix was pelleted on a and a final volume of 400 ml was kept. Samples were incubated at magnet and homogenized in 2X Hybridization Buffer (0.4 M NaCl, 100 C for 15min and centrifuged at room temperature for 5 min at 0.2 M Tris, 0.16% Triton X-100, pH 8.0) at a concentration of 100 10,000 g. The supernatant was collected and stored at 20 C beads of each type per ml. The hybridization mixture consisted of (Anonymous, 2010). 25 ml of this bead mix and 25 ml of the final LCR product. After denaturation at 96 C for 90 s, hybridization was conducted at 37 C 2.3. Liquid bead array for 30 min, immediately followed by three washes performed by pelleting the beads on a magnetic bead separation system (V&P 2.3.1. Genetic markers targeted by the 15-plex liquid bead array Scientific, San Diego, CA) for 1 min, removing the supernatant by Fifteen genetic markers were selected from previous works or forceful inversion, suspending the beads in 75 ml hybridization from the comparison of published genomic sequences (Table 1). buffer (0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0) and This selection was confirmed with a set of 20 Salmonella 4,[5]:i:- pipetting up and down. The plate was then incubated at 37 C for ® and 11 Salmonella Typhimurium Belgian isolates (Fig. S1). Among 15 min in the Luminex 200™ instrument and 50 ml of the final the 15 probes of the array, 2 probes target key genetic elements solution were analyzed at this temperature. Fluorescence signals required for phase 2 flagellin expression: the fljB gene and its were measured on at least 100 beads of each bead type and Median promoter. The lack of detection of one of these 2 markers is suffi- Fluorescence Intensities (MFI) were automatically generated in CSV cient to genetically confirm the monophasic character of an isolate. data. C. Boland et al. / Food Microbiology 71 (2018) 17e24 19

Table 1 ® Probes and primers used for the LCR assay and IDs of the corresponding Luminex MagPlex-TAG™ microspheres.

Probes and primers Aima Sequenceb Bead Sourcec ID

invA_1437d S. enterica subsp. I TCAAGCGCGTTCCGCAACACATAG-cUR-AA-UF- 62 (Lauri et al., 2011) positive control TAAACATACAAATACACATTTCAGCCAGACAGTGGTAAAGCTCA fliB-fliA_IS200e Identification of STM TGTCTATGGAAAACCCCCAGC-cUR-AA-UF- 74 (Tennant et al., 2010) ACACTCATTTAACACTATTTCATTGCGCATCCCGTTTAT mdh_F Identification of STM CCGGTGATTGGCGGGC-cUR-AA-UF- 75 (Amavisit et al., 2005; Bugarel (both mdh probes CATAAATCTTCTCATTCTAACAAATGCCAACGGAAGTTGAAGTG et al., 2012) must be detected)f mdh_R Identification of STM TCGCCCTGCAGAGCG-cUR-AA-UF- 77 (Amavisit et al., 2005; Bugarel (both mdh probes AATAACAACTCACTATATCATAACTCCACCACGCCCTTC et al., 2012) must be detected)f fljB_775to806d Presence/absence of TTGCGGCTGGCGC-cUR-AA-UF- 53 (Prendergast et al., 2013; the fljB gene of STM TTAACAACTTATACAAACACAAACTGACGGTACAGTAACCC Tennant et al., 2010) fljB_promoter Presence/absence of CCWGGATGACACAGGTAAGCCTG-cUR-AA-UF- 66 (Osuna et al., 1995) the fljB promoter TTACTAATTTCAATACTCTTACTAAAGTTTATGCCTCAAGTGTCGATAA LT2_2915584&IS26d,e IS26 element at the GGCACTGTTGCAAATAGTCGG-cUR-AA-UF- 56 (Boland et al., 2015) left junction of a TTAAACTCTACTTACTTCTAATTGGCCTATGTTACATCCAGC transposon inserted between hin and iroB IS26<2_2916036d,e IS26 element at right GGCACTGTTGCAAATAGTCGGTG-cUR-AA-UF- 37 (Boland et al., 2015) junction of a TACAACATCTCATTAACATATACAAGGAAACGTAGGGAGTAGTATTGAT transposon inserted between hin and iroB oafA_IS4e STM/STMV TGCTATGTATACAAGGCCGCCAG-cUR-AA-UF- 29 (Hauser et al., 2010a) subtyping TACTACTTCTATAACTCACTTAAATTAACTCAAGGAAATTATGAGGGGATCTCTCAG STM4104_990Gd STM/STMV CAGTCGCCGGTTGAGCTGAC-cUR-AA-UF- 36 Multiple alignment of genomes subtyping ATTAAACAACTCTTAACTACACAAAATCTTCTATCATCATCAGCAAACGGTGGCG published on NCBI LT2_1659055Cd STM/STMV ATATCTCCTCWTCGCGCCG-cUR-AA-UF- 38 Multiple alignment of genomes subtyping ATTCAATACTATCTAACACTTACTAATCTTTTTACAAATGGTAACAATTAAGAAACATC published on NCBI Fels2_LJg STM/STMV TATTTGGTGGAGCTGGCGG-cUR-AA-UF- 43 Multiple alignment of genomes subtyping AACTTTCTCTCTCTATTCTTATTTCACGTAACCCCTTGTTT published on NCBI and analysis of the PHAST prophages database (Zhou et al., 2011) P22like_RJg STM/STMV ATTCGTAATGCGAAGGTCGTAGG-cUR-AA-UF- 44 Analysis of the PHAST subtyping TCATCACTTTCTTTACTTTACATTGTTGTTGACTTAAAAGGTAGTTCTTATA prophages database (Zhou et al., 2011) LT2_4462523Ad STM/STMV CCACGCTTTACCGGACAGAG-cUR-AA-UF- 55 Multiple alignment of genomes subtyping ACATCAAATTCTTTCAATATCTTCAGGTGAAGTAATTCCTCCA published on NCBI LT2_2885619to2885652d,h STM/STMV GCGAGGGTTACAGCGTCC-cUR-AA-UF- 63 Multiple alignment of genomes subtyping TAAATCACATACTTAACAACAAAGGTACACGCAGAGCTG published on NCBI and a Belgian strain (KJ999732) UF GTAGACTGCGTACCAATTC - e UR GACGATGAGTCCTGAGTAA - (Wattiau et al., 2011) cUR TTACTCAGGACTCATCGTC - (Wattiau et al., 2011)

a STM¼Salmonella Typhimurium; STMV¼ Salmonella Typhimurium Monophasic Variants. b Nucleotide sequence of the probe (from 50 to 30). Bold characters highlight the sequence targeted on the template DNA, underlined characters indicate the sequence ® complementary to the Luminex MagPlex-TAG™ microspheres with the bead ID indicated in the fourth column; UF, UR and cUR, nucleotide sequence of the PCR amplification primers Universal Forward, Reverse and complementary UR, respectively; normal characters indicate nucleotides added to reach a final set of probes with evenly distributed sizes ranging from 90 to 120 nucleotides. c « Source » refers either to the selected marker reference or to the nucleotide sequences used to infer the marker. d Nucleotide position in the coding sequence or in the genome of Salmonella Typhimurium LT2 (template numbering in GenBank accession AE006468.1). For probes targeting a SNP, the name of the marker ends by the targeted nucleotide. e Presence/absence of an IS element. f The mdh gene was used to confirm the identification of the Typhimurium serovar in case IS200 is not found in the fliA-B intergenic region as reported for one Salmonella Typhimurium strain by Bugarel et al. (2012). g Presence/absence of a prophage (LJ/RJ ¼ attL/attR sites). h Indel.

2.3.4. Data analysis and LCR binary profiles of the array was validated with reference strains used as positive The fluorescence signal of the Salmonella positive control probe and negative controls (Table S1). For SNP markers, positive controls “invA_1437” was used as an internal standard to normalize the MFI were derived from strains displaying the exact nucleotide sequence signals observed for each sample following the rule: (MFI probe/ targeted by the probe at the polymorphic site and negative controls MFI invA_1437) X 100. The results expressed in normalized MFI were derived from strains displaying another nucleotide at this (nMFI) were evaluated against cut-offs and converted into binary place. Five reference strains, the Salmonella Typhimurium SGSC code (0 ¼ negative, 1 ¼ positive). Cut-offs were determined after 1412, Salmonella Agama 4650/1, Salmonella 4,5:i:- VAR-2009/ plotting experimental nMFI values obtained by testing 241 Salmo- 08643/1, Salmonella 4,12:i:- BfR-07-0009 and Escherichia coli nella 4,[5]:i:- isolates and 4 control strains separately for each probe ATCC25922, were used in each experiment. Together, these strains (a threshold plot is shown in Fig. 1 as an example). These cut-offs provide positive and negative controls for each probe. Binary LCR guaranteed a minimal ratio of 2 between nMFI signals assigned profiles were analyzed with BioNumerics v6.6 using cluster analysis as positive and negative results, respectively. Each of the 15 probes for binary values (simple matching) and unweighted pair group 20 C. Boland et al. / Food Microbiology 71 (2018) 17e24

Fig. 1. Threshold plot of fluorescence signals obtained with probe “fljB_775to806”. Normalized Median Fluorescence Intensities (nMFI) obtained for each of the 241 Salmonella 4,[5]:i:- field isolates and 4 control strains investigated in this study are shown. The dotted lines refer to the lower and upper thresholds. method with arithmetic averages (UPGMA). A summarized text these strains will therefore be differentiated from Salmonella profile was assigned to each binary code highlighting the main Typhimurium with the present assay (Bugarel et al., 2012; characteristics of the associated genetic profile i.e. presence/ Madajczak et al., 2015; Maurischat et al., 2015). The rare Farsta absence of fljB gene, fljB promoter and IS26 copies flanking the strains positive for the mdh gene and containing an IS200 copy in transposon inserted between hin and iroB. the fliA-B intergenic region could have emerged from a putative Typhimurium ancestor in which the fljB gene had recombined with that of a Farsta strain as suggested by the close relatedness of the 3. Results and discussion bead array profiles observed for Salmonella Farsta str. 5344/86 and Salmonella Typhimurium str. LT2 (Fig. 2). Achtman et al. (2012) also 3.1. Genetic relatedness with Salmonella Typhimurium reported that some Salmonella Farsta and Typhimurium isolates were closely related genetically but possessed distinct flagellar The developed assay successfully identified Salmonella Typhi- epitopes. These strains are therefore likely to pose a comparable murium isolates and their monophasic variants at serovar level, public health risk as compared to Salmonella Typhimurium. ruling out all other serovars expressing the O:4 and H:i antigens Among the 241 isolates serotyped as 4,[5]:i:- and collected in except some strains of the rare Farsta serovar (Table 2). From a Belgium in 2014 and 2015, 240 isolates (99.6%) displayed a bead practical point of view, discrimination between Salmonella Typhi- array profile characteristic of Salmonella Typhimurium and its murium and Salmonella Farsta is not that critical since no Salmo- monophasic variants, i.e. a positive signal for the 3 probes targeting nella Farsta strain was reported at the Belgian Salmonella National the IS200 inserted between fliB-fliA and two portions of the mdh Reference Laboratory for Animal Health for the last two decades. gene (Fig. 3). These strains are hereafter called Salmonella Typhi- Moreover, some Salmonella Farsta strains were reported as being murium Monophasic Variants (STMV). Our data showed that Sal- negative for the mdh and/or fliA-B intergenic region markers and monella 4,[5]:i:- isolates, not related to Salmonella Typhimurium, are circulating in Belgium (1/241 isolates). It confirmed the ne- Table 2 cessity to assess the genetic background of all Salmonella isolates Signal observed for the 3 probes “fliB-fliA_IS200”, “mdh_F” and “mdh_R” allowing the serotyped as 4,[5]:i:- to evaluate the associated public health risk. differentiation of Salmonella Typhimurium and its variants from all other serovars expressing the O:4 and H:i antigens, except some strains of the rare Farsta serotype. fi Serovar Strain fliB-fliA_IS200 mdh_F mdh_R 3.2. Genetic con rmation of the monophasic character

Typhimurium Typhimurium LT2a þþþ The monophasic character of all 240 STMV isolates tested in this Farsta Farsta 5344/86b þþþ Agama Agama 4650/1c eeestudy was genetically demonstrated with the present array. Deletion Gloucester Gloucester 646Kb eeeof fljB or its promoter explained the monophasic phenotype Lagos Lagos 1585Kb e þ e observed in all these isolates, with 153 isolates (63.7%) lacking fljB b eee Tsevie Tsevie 1141/72 and 87 isolates (36.3%) lacking only its promoter. In comparison, the Tumodi Tumodi 7211/89b eee duplex PCR recommended by EFSA would only confirm the mono- a Strain SGSC1412 from the Salmonella Genetic Stock Centre (University of Cal- phasic character for the 153 isolates lacking fljB. The lack of fljB gary, Canada). promoter was responsible for the monophasic character of all tested b Strain from the Pasteur Institute Paris. c fl Strain from the OIE Reference Laboratory for Salmonella (Istituto Zooprofilattico jB-positive STMV isolates. Using a real-time multiplex PCR assay Sperimentale delle Venezie). targeting both fljB and a nucleotide sequence lying between the hin C. Boland et al. / Food Microbiology 71 (2018) 17e24 21

Fig. 2. Array profiles of each serovar expressing the O:4 and H:i antigens. Raw fluorescence data gained from the 15 genetic markers assessed (column headers) were converted into binary data (black square ¼ detected marker; white square ¼ undetected marker). The last two columns refer to the serovar and to the name of the isolates. Salmonella Farsta 5344/86 displays an array profile closely similar to that of Salmonella Typhimurium LT2, suggesting a common genetic background for these two strains, except for fljB. All other non-Salmonella Typhimurium strains were successfully discriminated. Clustering was performed as described in 2.3.4.

Fig. 3. Clustering of profiles observed for 241 Salmonella 4,[5]:i:- isolates collected in Belgium during 2014e2015. Raw fluorescence data were converted into binary data (black square ¼ detected marker; white square ¼ undetected marker). Clustering was performed as described in 2.3.4. “Summarized profile” highlights the main characteristics of the bead array profile. “Binary profile” lists the successive binary codes of the corresponding bead array profile (from left to right). “N isolates” is the number of isolates displaying the binary profile. and iroB genes encompassing the fljB promoter, Maurischat et al. 3.3. Detection of an IS26 element at the same position in most (2015) similarly identified a higher proportion of monophasic Sal- STMV isolates monella Typhimurium (98.2% instead of 88.3% with the EFSA- recommended PCR). As observed for the Belgian isolates, most fljB- In 224/240 STMV isolates (93.3%), an IS26 copy was detected positive isolates collected in Germany also lacked the fljB promoter. upstream of iroB. The IS26 insertion location matched that of an The proportion of fljB-positive isolates among STMV isolates IS26 composite transposon previously reported in a monophasic collected in Belgian animals remained high during the last two variant frequently isolated in Belgium (Boland et al., 2015) and years (36.3% vs. 43.8% during 2008e2011). In a previous study mapping at position 2,916,036 of the Salmonella Typhimurium LT2 (Boland et al., 2014), occurrence of fljB-positive isolates seemed to reference genome (AE006468.1). The IS26 insertion at that position, be slightly higher in Belgium than in other countries and varied either alone or as part of a composite transposon (right junction) substantially depending on the source (43.8% from animals, 23.4% was detected by probe “IS26<2_2916036” in the present array from food and 5.2% from humans). However, the occurrence of fljB- (Fig. 3). A BLAST search on the NCBI database (September 23, 2016 positive STMV isolates could have been underestimated elsewhere release) revealed an IS26 copy inserted at the same place in the fljB- due to the apparent inconsistency between the monophasic negative European clone reported by Garcia et al. (2016) (GenBank phenotype observed by slide agglutination and fljB gene detection accession no. KR856283.1) and in the STMV clade observed by PCR (Tennant et al., 2010). currently in the United Kingdom (Petrovska et al., 2016) (GenBank 22 C. Boland et al. / Food Microbiology 71 (2018) 17e24 accession no. LN999997.1). An IS26 insertion was observed exactly LT2 (Fig. 3 and Fig. S1). at the same position in strains isolated from different countries in Europe (Belgium, Denmark, France, Italy, Portugal, Germany, 3.6. Absence of the Fels-2 prophage Switzerland and the United Kingdom), in the United States and in South Korea during the period 2004e2014 (BLAST search on the The Fels-2 prophage was not detected in any Belgian STM/STMV NCBI database - September 23, 2016 release; Garcia et al., 2016). while it was present in a single Salmonella 4,[5]:i:- isolate not These strains originated from different sources (humans, pigs, related to Salmonella Typhimurium (Fig. 3 and Fig. S1). The absence poultry, cattle, pig meat, food/feed samples and environmental of this prophage was also reported in the Spanish and US STMV swabs), suggesting that most STMV isolates observed globally clones, in the epidemic clade observed currently in the United during the last years could have emerged from a common ancestor Kingdom and in isolates from Italy and Japan (Garaizar et al., 2002; harboring an IS26 copy at that particular position. Alternatively, Ido et al., 2014; Lucarelli et al., 2012; Petrovska et al., 2016; Soyer several independent e yet identical - IS26 insertions may have et al., 2009). This prophage was found in several published ge- occurred, provided the existence of potential insertion hotspot at nomes of Salmonella Typhimurium and was also reported as var- that position, as already discussed elsewhere (Boland et al., 2015; iably present in Salmonella Typhimurium (Pang et al., 2013; Garcia et al., 2016; Lucarelli et al., 2012). The finding of an IS26 Porwollik, 2011). In future studies, the analysis of more Salmo- copy at that location in most (90.8%) fljB-negative STMV isolates nella Typhimurium and variants will determine if the Fels-2 pro- raises the question of whether these fljB-negative STMV would phage is present in any STMV isolate, since it has so far be detected belong to the European clonal lineage described by Garcia et al. in Salmonella Typhimurium only. (2016) or to other clades circulating in Europe. Improved characterization of the IS26-modified fljB region in this European clone 3.7. Deletion between loci STM2745 and STM2746 will be assessed in a next version of our array to further investigate the dissemination of this clone in Belgium and elsewhere. Nucleotides 2,885,619 to 2,885,652 of Salmonella Typhimurium LT2 (AE006468.1) map in an intergenic region between loci 3.4. A major fljB-positive STMV genotype persists since 2008 in STM2745 and STM2746 absent in all 241 Salmonella 4,[5]:i:- isolates Belgium from the period 2014e2015. It was found once in a collection of 20 Salmonella 4,[5]:i:- isolates from the period 2008e2011 and in 8/11 Most of the fljB-positive STMV isolates (61/87 i.e. 70.1%) Salmonella Typhimurium isolates from 2006 to 2011 (Fig. S1). This harbored an IS26 composite transposon inserted between hin and region is part of an 82-bp sequence of Salmonella Typhimurium LT2 iroB (targeted by probes “LT2_2915584&IS26” and (AE006468.1) deleted in the STMV isolate VAR-2009/08643/1 “IS26<2_2916036”)aswellasanfljB promoter deletion. This (KJ999732.1) (Fig. 4). The same deletion is observed in the STMV particular genotype was already the hallmark of most fljB-positive clade currently circulating in the United Kingdom (GenBank isolates issuing from the period 2008e2011 in Belgium (Boland accession LN999997.1; Petrovska et al., 2016) and in 6 Salmonella et al., 2015). One main subtype displaying a unique bead array Typhimurium isolates collected in the USA, Mexico or unreported profile was observed in 55/87 fljB-positive isolates (63.2%) and is countries (GenBank accessions CP014977.1, CP014965.1, called hereafter “fljB þ PfljB-IS26LJ þ IS26RJ þ type1”. This subtype CP014983.1, CP012681.1, CP011428.1 and CP006048.1, respectively). persisted over time in Belgian livestock (Boland et al., 2015; Fig. S1 This marker can therefore help to subtype the different clades of and Table S2), particularly in pigs, and its high prevalence could STM and STMV circulating worldwide. However, since the US STMV explain why fljB-positive STMV isolates were more frequently clonal group carries a large (76-gene long) deletion encompassing observed in Belgium. The prevalence of this subtype in other the loci STM2745 and STM2746, a specific marker should be added countries is currently unknown but could be assessed with the in future versions to discriminate the variants carrying the small array developed here. deletion between STM2745-2746 from the US clones.

3.5. Different subtypes among the ﬂjB-positive and ﬂjB-negative 3.8. A liquid bead array as alternative to PCRs or whole genome STMV isolates sequencing

Overall, 11 different bead array profiles were observed among A liquid bead array system was chosen to develop a custom- the 2014e2015 collection of 4,[5]:i:- isolates (Fig. 3). Ten profiles made assay aiming to identify and characterize fljB-positive and were observed among the STMV isolates (i.e. the isolates with a fljB-negative monophasic variants of Salmonella Typhimurium. This genotype of monophasic Salmonella Typhimurium). Two profiles methodology is rapid, easy to perform, to update and to analyze. were dominant with “ fljB-IS26RJ þ type2” accounting for 126/153 Compared with PCR assays, a bead array displays several advan- (82.4%) fljB-negative isolates and “ fljB þ PfljB- tages: (i) a single test can replace several PCR assays thanks to its ® IS26LJ þ IS26RJ þ type1” for 55/87 (63.2%) fljB-positive isolates. higher multiplexability (up to 80 markers on a Luminex 200™ Both profiles differed from each other only by the presence/absence platform), (ii) it allows the sensitive detection of SNP markers of fljB and the presence/absence of the junction of an IS26 com- valuable for subtyping, and (iii) it is able to track the insertion point posite transposon (“LT2_2915584&IS26”) and could therefore have of mobile elements (e.g. IS26 elements). Besides, such bead arrays originated from a single biphasic ancestor. No correlation between are still a cheaper alternative to whole genome sequencing for the origin of the isolates and particular bead array profiles could be answering specific research or diagnostic questions and allow fast observed (Table S2). Two markers (“oafA_IS4” and “P22like_RJ”) and simple data analysis. were discriminative among the STMV isolates collected in Belgium in 2014 and 2015 (Fig. 3). Both “LT2_4462523A” and 4. Conclusions “LT2_2885619to2885652” markers gave no signal when assayed on 4,[5]:i:- isolates from 2014 to 2015, while they did so on one 4,5:i:- The developed liquid bead array successfully identified Salmo- isolate from 2009 and on several biphasic STM isolates from 2007 nella Typhimurium isolates and their monophasic variants at to 2011 (Fig. S1). Marker “STM4104_990G” was positive in all tested serovar level, ruling out all other serovars expressing the O:4 and Belgian Salmonella Typhimurium and variants thereof but not in H:i antigens except some strains of the rare Farsta serovar. This C. Boland et al. / Food Microbiology 71 (2018) 17e24 23

Fig. 4. Alignment of the genomic sequences surrounding the 82-bp deletion observed in Salmonella 4,5:i:- VAR-2009/08643/1 (KJ999732.1) as compared to Salmonella Typhimurium LT2 (AE006468.1). Boxed nucleotides in the deleted region in KJ999732.1 are targeted by probe “LT2_2885619to2885652”. This deletion may have resulted from a homologous recombination between the two almost perfect direct repeats (only one mismatch) indicated in bold characters. array confirmed the monophasic character of all 240 STMV isolates STM2745-STM2746 intergenic region has a potentially interesting tested in this study. In comparison, the duplex PCR recommended subtyping value since it is unevenly distributed inside the various by EFSA would have only confirmed the monophasic character of STM and STMV clades circulating worldwide. 63.7% STMV isolates (corresponding to all fljB-negative isolates). Using the liquid bead array described herewith, a larger panel of The lack of an fljB promoter was responsible for the monophasic foreign STMV isolates can be assessed in future studies. This will character of all fljB-positive STMV isolates collected during the bring additional evidence about (i) the monophasic character of 2014e2015 period in Belgium. Targeting a sequence encompassing STMV isolates, particularly regarding the genetic mutations this promoter has also been reported to increase the percentage of impairing fljB expression and (ii) the different lineages circulating genetically confirmed monophasic Salmonella Typhimurium from worldwide. Small updates may be required to better subtype some 88.3 to 98.2% in Germany (Maurischat et al., 2015). STMV clones, noticeably the US and Spanish clones, and to detect The present 15-plex liquid bead array was able to discriminate 6 rare mutations, so far observed just occasionally in Belgium. Thanks subtypes among the fljB-positive STMV isolates and 4 among the to the open design of the array, such additional genetic markers can fljB-negative isolates observed during 2014e2015. Microevolution be merged smoothly without affecting its general performance, nor in and around the fljB locus linked to the insertion and recombi- requiring full re-validation of the system. nation of IS26 elements is probably one of the driven force of the genetic variability of the STMV population as suggested by the detection of an IS26 copy exactly at the same place in the genomes Acknowledgments of 93.3% of all STMV isolates and the propensity of IS26 to favor the adjacent insertion of additional IS26 copies carried on trans- This work was financed in part by a grant from the Belgian fi locatable units (Harmer et al., 2014). Interestingly, an IS26 element Scienti c Policy E1122-P1. The Authors thank D. Vandergheynst and was observed at the same place in strains isolated from different H. Vander Veken for technical assistance. We are very grateful to F.- countries in Europe, the United States and South Korea, raising X. Weill and S. Le Hello from the Pasteur Institute Paris, A. Lettini again the question of a common origin or a putative insertion from the OIE Reference Laboratory for Salmonella (Istituto Zoo- fi hotspot (Boland et al., 2015; Garcia et al., 2016; Lucarelli et al., pro lattico Sperimentale delle Venezie), B. Malorny from the 2012). Two major bead array profiles were observed, “fljB- German National Reference Laboratory for Salmonella (BfR) and N. IS26RJ þ type2” in 126/153 (82.4%) fljB-negative STMV isolates and Thomson from the Wellcome Trust Sanger Institute for sending us “fljB þ PfljB-IS26LJ þ IS26RJ þ type1” in 55/87 (63.2%) fljB-positive their strains. STMV isolates. The latter subtype remained over the years in Belgian livestock, particularly in pigs. The absence of the Fels-2 Appendix A. Supplementary data prophage in all STMV isolates from Belgium and elsewhere could also reflect a common origin of the different clades. However, this Supplementary data related to this article can be found at http:// assumption requires further investigation. A small deletion in the dx.doi.org/10.1016/j.fm.2017.04.006. 24 C. Boland et al. / Food Microbiology 71 (2018) 17e24

References Hauser, E., Tietze, E., Helmuth, R., Junker, E., Blank, K., Prager, R., Rabsch, W., Appel, B., Fruth, A., Malorny, B., 2010b. Pork contaminated with Salmonella enterica serovar 4,[5],12:i:-, an emerging health risk for humans. Appl. Environ. Achtman, M., Wain, J., Weill, F.X., Nair, S., Zhou, Z., Sangal, V., Krauland, M.G., Microbiol. 76, 4601e4610. Hale, J.L., Harbottle, H., Uesbeck, A., Dougan, G., Harrison, L.H., Brisse, S., Hopkins, K.L., de Pinna, E., Wain, J., 2012. Prevalence of Salmonella enterica serovar S. enterica MLST study group, 2012. Multilocus sequence typing as a replace- 4,[5],12:i:- in England and Wales, 2010. Euro Surveill. 17 pii¼20275. ment for serotyping in Salmonella enterica. PLoS Pathog. 8, e1002776. Ido, N., Lee, K., Iwabuchi, K., Izumiya, H., Uchida, I., Kusumoto, M., Iwata, T., Amavisit, P., Boonyawiwat, W., Bangtrakulnont, A., 2005. Characterization of Sal- Ohnishi, M., Akiba, M., 2014. Characteristics of Salmonella enterica serovar monella enterica serovar Typhimurium and monophasic Salmonella serovar 4,[5],12:i:- as a monophasic variant of serovar Typhimurium. PLoS One 9, 1,4,[5],12:i:- isolates in Thailand. J. Clin. Microbiol. 43, 2736e2740. e104380. Anonymous, 2010. Scientific opinion on monitoring and assessment of the public Lauri, A., Castiglioni, B., Mariani, P., 2011. Comprehensive analysis of Salmonella health risk of “Salmonella Typhimurium-like” strains, 2010 EFSA J. 8 (10), 1826. sequence polymorphisms and development of a LDR-UA assay for the detection [48 pp.]. and characterization of selected serotypes. Appl. Microbiol. Biotechnol. 91, Anonymous, 2011. COMMISSION REGULATION (EU) No 517/2011 of 25 May 2011 189e210. implementing Regulation (EC) No 2160/2003 of the European Parliament and of Lucarelli, C., Dionisi, A.M., Filetici, E., Owczarek, S., Luzzi, I., Villa, L., 2012. Nucleotide the Council as regards a Union target for the reduction of the prevalence of sequence of the chromosomal region conferring multidrug resistance (R-type certain Salmonella serotypes in laying hens of Gallus gallus and amending ASSuT) in Salmonella Typhimurium and monophasic Salmonella Typhimurium Regulation (EC) No 2160/2003 and Commission Regulation (EU) No 200/2010. strains. J. Antimicrob. Chemother. 67, 111e114. Official J. Eur. Union. L138/45. Madajczak, G., Dera-Tomaszewska, B., Wasiak, M., Chrost, A., Szych, J., 2015. Mo- Arguello, H., Sorensen, G., Carvajal, A., Baggesen, D.L., Rubio, P., Pedersen, K., 2014. lecular methods for identification of monophasic Salmonella Typhimurium Characterization of the emerging Salmonella 4,[5],12:i:- in Danish animal pro- strains. Pol. J. Microbiol. 64, 383e386. duction. Foodborne Pathog. Dis. 11, 366e372. Mandilara, G., Lambiri, M., Polemis, M., Passiotou, M., Vatopoulos, A., 2013. Arnedo-Pena, A., Sabater-Vidal, S., Herrera-Leon, S., Bellido-Blasco, J.B., Silvestre- Phenotypic and molecular characterisation of multiresistant monophasic Sal- Silvestre, E., Meseguer-Ferrer, N., Yague-Munoz, A., Gil-Fortuno, M., Romeu- monella Typhimurium (1,4,[5],12:i:-) in Greece, 2006 to 2011. Euro Surveill. 18 Garcia, A., Moreno-Munoz, R., 2016. An outbreak of monophasic and biphasic (22) pii¼20496. Salmonella Typhimurium, and Salmonella Derby associated with the con- Maurischat, S., Baumann, B., Martin, A., Malorny, B., 2015. Rapid detection and sumption of dried pork sausage in Castellon (Spain). Enferm. Infecc. Microbiol. specific differentiation of Salmonella enterica subsp. enterica Enteritidis, Clin. 34, 544e550. Typhimurium and its monophasic variant 4,[5],12:i:- by real-time multiplex Barco, L., Lettini, A.A., Ramon, E., Longo, A., Saccardin, C., Pozza, M.C., Ricci, A., 2011. PCR. Int. J. Food Microbiol. 193, 8e14. A rapid and sensitive method to identify and differentiate Salmonella enterica Osuna, R., Lienau, D., Hughes, K.T., Johnson, R.C., 1995. Sequence, regulation, and serotype Typhimurium and Salmonella enterica serotype 4,[5],12:i:- by functions of fis in Salmonella typhimurium. J. Bacteriol. 177, 2021e2032. combining traditional serotyping and multiplex polymerase chain reaction. Pang, S., Octavia, S., Feng, L., Liu, B., Reeves, P.R., Lan, R., Wang, L., 2013. Genomic Foodborne Pathog. Dis. 8, 741e743. diversity and adaptation of Salmonella enterica serovar Typhimurium from Barco, L., Longo, A., Lettini, A.A., Cortini, E., Saccardin, C., Minorello, C., Olsen, J.E., analysis of six genomes of different phage types. BMC Genomics 14, 1e12. Ricci, A., 2014. Molecular characterization of “inconsistent” variants of Salmo- Petrovska, L., Mather, A.E., AbuOun, M., Branchu, P., Harris, S.R., Connor, T., nella Typhimurium isolated in Italy. Foodborne Pathog. Dis. 11, 497e499. Hopkins, K.L., Underwood, A., Lettini, A.A., Page, A., Bagnall, M., Wain, J., Boland, C., Bertrand, S., Mattheus, W., Dierick, K., Jasson, V., Rosseel, T., Van Borm, S., Parkhill, J., Dougan, G., Davies, R., Kingsley, R.A., 2016. Microevolution of Mahillon, J., Wattiau, P., 2015. Extensive genetic variability linked to IS26 in- monophasic Salmonella Typhimurium during epidemic, United Kingdom, 2005- sertions in the fljB promoter region of atypical monophasic variants of Salmo- 2010. Emerg. Infect. Dis. 22, 617e624. nella enterica serovar Typhimurium. Appl. Environ. Microbiol. 81, 3169e3175. Porwollik, S., 2011. Salmonella: from Genome to Function. Caister Academic Press, Boland, C., Bertrand, S., Mattheus, W., Dierick, K., Wattiau, P., 2014. Molecular typing Norfolk, UK, pp. 43e44. of monophasic Salmonella 4,[5]:i:- strains isolated in Belgium (2008-2011). Vet. Prendergast, D.M., Hand, D., Ni Ghallchoir, E., McCabe, E., Fanning, S., Griffin, M., Microbiol. 168, 447e450. Egan, J., Gutierrez, M., 2013. A multiplex real-time PCR assay for the identifi- Bone, A., Noel, H., Le Hello, S., Pihier, N., Danan, C., Raguenaud, M.E., Salah, S., cation and differentiation of Salmonella enterica serovar Typhimurium and Bellali, H., Vaillant, V., Weill, F.X., Jourdan-da Silva, N., 2010. Nationwide monophasic serovar 4,[5],12:i:-. Int. J. Food Microbiol. 166, 48e53. outbreak of Salmonella enterica serotype 4,12:i:- infections in France, linked to Raguenaud, M., Le Hello, S., Salah, S., Weill, F., Brisabois, A., Delmas, G., dried pork sausage, March-May 2010. Euro Surveill. 15 pii¼19592. Germonneau, P., 2012. Epidemiological and microbiological investigation of a Bugarel, M., Vignaud, M.L., Moury, F., Fach, P., Brisabois, A., 2012. Molecular iden- large outbreak of monophasic Salmonella Typhimurium 4,5,12:i:- in schools tification in monophasic and nonmotile variants of Salmonella enterica serovar associated with imported beef in Poitiers, France, October 2010. Euro Surveill. Typhimurium. Microbiologyopen 1, 481e489. 17 pii¼20289. Cito, F., Baldinelli, F., Calistri, P., Di Giannatale, E., Scavia, G., Orsini, M., Iannetti, S., Soyer, Y., Moreno Switt, A., Davis, M.A., Maurer, J., McDonough, P.L., Schoonmaker- Sacchini, L., Mangone, I., Candeloro, L., Conte, A., Ippoliti, C., Morelli, D., Bopp, D.J., Dumas, N.B., Root, T., Warnick, L.D., Grohn, Y.T., Wiedmann, M., 2009. Migliorati, G., Barile, N.B., Marfoglia, C., Salucci, S., Camma, C., Marcacci, M., Salmonella enterica serotype 4,5,12:i:-, an emerging Salmonella serotype that Ancora, M., Dionisi, A.M., Owczartek, S., Luzzi, I., on behalf of the outbreak represents multiple distinct clones. J. Clin. Microbiol. 47, 3546e3556. investigation group, 2016. Outbreak of unusual Salmonella enterica serovar Switt, A.I., Soyer, Y., Warnick, L.D., Wiedmann, M., 2009. Emergence, distribution, Typhimurium monophasic variant 1,4,[5],12:i:-, Italy, June 2013 to September and molecular and phenotypic characteristics of Salmonella enterica serotype 2014. Euro Surveill. 21 pii¼30194. 4,5,12:i:-. Foodborne Pathog. Dis. 6, 407e415. Garaizar, J., Porwollik, S., Echeita, A., Rementeria, A., Herrera, S., Wong, R.M., Frye, J., Tennant, S.M., Diallo, S., Levy, H., Livio, S., Sow, S.O., Tapia, M., Fields, P.I., Usera, M.A., McClelland, M., 2002. DNA microarray-based typing of an atypical Mikoleit, M., Tamboura, B., Kotloff, K.L., Nataro, J.P., Galen, J.E., Levine, M.M., monophasic Salmonella enterica serovar. J. Clin. Microbiol. 40, 2074e2078. 2010. Identification by PCR of non-typhoidal Salmonella enterica serovars Garcia, P., Malorny, B., Rodicio, M.R., Stephan, R., Hachler, H., Guerra, B., Lucarelli, C., associated with invasive infections among febrile patients in Mali. PLoS Negl. 2016. Horizontal acquisition of a multidrug-resistance module (R-type ASSuT) is Trop. Dis. 4, e621. responsible for the monophasic phenotype in a widespread clone of Salmonella Wasyl, D., Hoszowski, A., 2012. Occurrence and characterization of monophasic serovar 4,[5],12:i:-. Front. Microbiol. 7, 680. Salmonella enterica serovar Typhimurium (1,4,[5],12:i:-) of non-human origin in Gossner, C.M., van Cauteren, D., Le Hello, S., Weill, F.X., Terrien, E., Tessier, S., Poland. Foodborne Pathog. Dis. 9, 1037e1043. Janin, C., Brisabois, A., Dusch, V., Vaillant, V., Jourdan-da Silva, N., 2012. Wattiau, P., Whatmore, A.M., Van Hessche, M., Godfroid, J., Fretin, D., 2011. Nucle- Nationwide outbreak of Salmonella enterica serotype 4,[5],12:i:- infection otide polymorphism-based single-tube test for robust molecular identification associated with consumption of dried pork sausage, France, November to of all currently described Brucella species. Appl. Environ. Microbiol. 77, December 2011. Euro Surveill. 17 pii¼20071. 6674e6679. Harmer, C.J., Moran, R.A., Hall, R.M., 2014. Movement of IS26-associated antibiotic Zamperini, K., Soni, V., Waltman, D., Sanchez, S., Theriault, E.C., Bray, J., Maurer, J.J., resistance genes occurs via a translocatable unit that includes a single IS26 and 2007. Molecular characterization reveals Salmonella enterica serovar 4,[5],12:i:- preferentially inserts adjacent to another IS26. MBio 5, e01801e01814. from poultry is a variant Typhimurium serovar. Avian Dis. 51, 958e964. Hauser, E., Junker, E., Helmuth, R., Malorny, B., 2010a. Different mutations in the Zhou, Y., Liang, Y., Lynch, K.H., Dennis, J.J., Wishart, D.S., 2011. PHAST: a fast phage oafA gene lead to loss of O5-antigen expression in Salmonella enterica serovar search tool. Nucleic Acids Res. 39 (Suppl. 2), W347eW352. Typhimurium. J. Appl. Microbiol. 110, 248e253.