On the Red Algal Genus Grateloupia in the Gulf of Mexico

Home , Bangiophyceae, Cyanidiophyceae, Grateloupia turuturu, Porphyra purpurea, Pyropia tenera

ON THE RED ALGAL GENUS GRATELOUPIA IN THE GULF OF MEXICO,

FEATURING THE ORGANELLAR GENOMES

OF GRATELOUPIA TAIWANENSIS

MICHAEL SCOTT DEPRIEST, JR.

JUAN M. LÓPEZ-BAUTISTA, COMMITTEE CHAIR DEBASHISH BHATTACHARYA PHILLIP M. HARRIS MARTHA J. POWELL AMELIA K. WARD

A DISSERTATION

Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Biological Sciences in the Graduate School of The University of Alabama

TUSCALOOSA, ALABAMA

2015

ABSTRACT

Red algae (Rhodophyta) are economically useful for their gelling compounds,

ecologically critical to marine benthic systems, and evolutionarily poised at the intersection of

primary and secondary endosymbiotic lineages. Molecular sequencing has transformed our understanding of red algae, revealing genetic and genomic characteristics that had once been completely unknown. In Grateloupia, a red algal genus that is morphologically simple and notoriously difficult-to-identify, sequencing has greatly assisted in identification of species and phylogenetic placement of troublesome taxonomic groups. However, analysis of DNA has also proven useful for genomic comparisons on a larger scale, in order to resolve deep evolutionary questions in terms of overall genome architecture and gene content. Grateloupia is a prime candidate for genomic research, representing an order that had previously not been explored. In this study, sequencing-based analyses were applied at both levels, examining species of

Grateloupia both within the genus and from a greater phylogenetic perspective. Phylogenetic analysis of the rbcL marker revealed the previously unknown species Grateloupia taiwanensis, first reporting this non-native alga from the Gulf of Mexico, and it showed that the species previously known as Grateloupia filicina in the Gulf of Mexico actually includes several species.

The organellar genomes of Grateloupia taiwanensis were also sequenced and annotated; both the plastid and mitochondrial genome are typical of florideophyte red algae in size, gene content, and structure. Mauve genome alignments demonstrated a pattern of genomic rearrangements expected given the overall phylogeny of Rhodophyta.

LIST OF ABBREVIATIONS aa Amino acid(s) BI Bayesian inference (of phylogeny) bp Base pair(s) cox1 Cytochrome c oxidase subunit alpha gene DCJ Double-cut-and-join (in Mauve alignments) e or e-value Expect value, used as a statistical significance threshold in BLAST results GC Guanine-cytosine content kb, kbp Kilobase-pairs (1,000 bp) LCB Locally collinear block (in Mauve alignments) ML Maximum likelihood (phylogenetic analysis) ORF Open reading frame rbcL Rubisco-1,5-bisphosphate carboxylase gene s.l. Sensu lato; in the broad sense (in taxonomy) s.s. Sensu stricto; in the strict sense (in taxonomy)

iii

ACKNOWLEDGMENTS

First and foremost, I would like to thank the chairperson of this dissertation, Juan López-

Bautista, for inspiring me with the fascinating world of algae since 2008, for his always useful advice on algal and academic issues, and for his patience with me during the preparation of this and other manuscripts. I thank my Ph.D. committee members—Debashish Bhattacharya, Phillip

Harris, Martha Powell, and Amy Ward—all of whom have provided unique perspectives and recommendations for my graduate career, and from whom I have learned very much. I also thank my labmates Gabriela Garcia-Soto, Daryl Lam, Trey Melton, Ana Tronholm, and David Ward, who have graciously assisted me with collection trips, new samples of Grateloupia, and/or phylogenetic and genomic analyses. I thank all of my past undergraduate assistants in the

PhycoLab, who spent many hours helping me with DNA extractions and reactions. Finally, I sincerely thank Mike Wynne, for his friendly and very detailed advice on the taxonomy of various groups of algae over the years.

CONTENTS

ABSTRACT ...... ii

LIST OF ABBREVIATIONS ...... iii

ACKNOWLEDGMENTS ...... iv

LIST OF TABLES ...... vi

LIST OF FIGURES ...... vii

1. Sequencing of the rbcL Marker Reveals the Nonnative Red Alga Grateloupia taiwanensis (Halymeniaceae, Rhodophyta) in Alabama ...... 1

2. Grateloupia filicina Revisited: Molecular Phylogenetics of Grateloupia (Halymeniaceae, Rhodophyta) from the Gulf of Mexico ...... 14

3. The Plastid Genome of the Red Macroalga Grateloupia taiwanensis (Halymeniaceae) ...... 27

4. The Mitochondrial Genome of Grateloupia taiwanensis (Halymeniaceae, Rhodophyta) and Comparative Mitochondrial Genomics of Red Algae ...... 46

APPENDIX ...... 70

LIST OF TABLES

1.1. List of Species Included in Phylogenetic Analysis of Grateloupia taiwanensis ...... 13

2.1. List of Species Included in Phylogenetic Analysis of Grateloupia filicina ...... 25

2.2. rbcL Pairwise Distances for Selected Grateloupia Species ...... 26

3.1. Characteristics of Selected Red Algal Plastid Genomes ...... 42

3.2. List of genes in G. taiwanensis Plastid Genome...... 43

3.3. Comparison of tRNA Sequences in Red Algal Plastid Genomes ...... 44

3.4. Novel ORFs in the G. taiwanensis Plastid Genome ...... 45

4.1 Characteristics of Selected Red Algal Mitochondrial Genomes ...... 68

4.2. Comparison of Protein-coding Genes in Red Algal Mitochondrial Genomes ...... 69

LIST OF FIGURES

1.1. Phylogenetic Tree of G. taiwanensis and Related Taxa ...... 11

1.2. Photograph of G. taiwanensis ...... 12

2.1. Phylogenetic Tree of G. filicina and Related Taxa ...... 24

3.1. Phylogenetic Tree of Division Rhodophyta ...... 39

3.2. G. taiwanensis Plastid Genome ...... 40

3.3. Pairwise Mauve Genome Alignments of Red Algal Plastid Genomes ...... 41

4.1. G. taiwanensis Mitochondrial Genome ...... 62

4.2. Mauve Genome Alignment of G. taiwanensis and G. angusta ...... 63

4.3. Mauve Genome Alignment of G. taiwanensis with Rhodymeniophycidae ...... 64

4.4. Mauve Genome Alignment of G. taiwanensis and Sporolithon durum ...... 65

4.5. Mauve Genome Alignment of G. taiwanensis and Pyropia haitanensis ...... 66

4.6. Mauve Genome Alignment of G. taiwanensis and Cyanidioschyzon merolae ...... 67

vii

Sequencing of the rbcL Marker Reveals the Nonnative Red Alga Grateloupia taiwanensis (Halymeniaceae, Rhodophyta) in Alabama

ABSTRACT

Mobile Bay, AL has been the site for the introduction of several terrestrial and freshwater invasive species, including red imported fire ants (Solenopsis invicta) and spike-topped apple snails (Pomacea bridgesii). The Gulf of Mexico has also been invaded by several marine animal

species, such as zebra mussels (Dreissena polymorpha). To date, no invasive marine macroalga

has been reported in the Mobile Bay area. However, recent collections of an unusual species of

Grateloupia (Halymeniaceae, Rhodophyta) in Alabama indicate that an introduction has been

made. On the basis of phylogenetic analysis of the large subunit of ribulose-1,5-bisphosphate

carboxylase/oxygenase (rbcL) marker, the species has been identified as Grateloupia

taiwanensis S.M. Lin & H.Y. Liang. This is the first report of G. taiwanensis outside its native

range.

INTRODUCTION

Grateloupia C. Agardh is a genus of benthic marine red algae (Rhodophyta), currently containing about 90 species (Guiry and Guiry, 2012). It is the largest genus in the family

Halymeniaceae. Species of this genus occur throughout the world in warm temperate to tropical

marine waters. Several Grateloupia species are known in the Gulf of Mexico, specifically

Grateloupia gibbesii Harvey and Grateloupia pterocladina (M.J. Wynne) S. Kawaguchi & H.W.

Wang, as well as many reports of unidentified Grateloupia species (see Fredericq et al., 2009).

Wynne (2011) listed a total of 11 species in the western Atlantic, including G. gibbesii, G.

pterocladina, and Grateloupia filicina (J.V. Lamouroux) C. Agardh. Wynne, however, remarked that past identifications of G. filicina in the western Atlantic, including the Gulf of

Mexico, are doubtful due to the results of De Clerck et al. (2005b), which indicated that true G. filicina may be restricted to the Mediterranean Sea and Macaronesia. This suggests that tropical collections of G. filicina actually belong to a different species.

The genus Grateloupia is known for having simple morphologies that make distinguishing species difficult, and DNA sequencing has been instrumental in generic and species-level circumscriptions (e.g. Wang et al., 2001; De Clerck et al., 2005b; Lin et al., 2008).

Specimens previously identified as G. filicina, frequently reported throughout the world, actually show an unexpectedly high amount of genetic diversity and are therefore morphologically static.

As a result of G. filicina being demonstrated to be polyphyletic, several new species have been split from the group (e.g., Kawaguchi et al., 2001; De Clerck et al., 2005b). Even in the past few years, the genus has gained many new species, including Grateloupia huangiae S.-M. Lin & H.-

Y. Liang, Grateloupia dalianensis H.W. Wang & D. Zhao, and Grateloupia yinggehaiensis H.W.

Wang & R.X. Luan. The publications in which these species are described (Lin and Liang, 2011;

Zhao et al., 2012) include molecular phylogenetic analyses to more clearly delineate these taxa.

Additional taxonomic work is definitely necessary to continue to resolve systematic inconsistencies and to account for unexpected, newly discovered diversity in the genus

Grateloupia.

In addition to these taxonomic concerns, it is important to consider that Grateloupia contains species that are known to be aggressively invasive, most notably Grateloupia turuturu

Yamada. Grateloupia turuturu, along with several other Grateloupia species, has been introduced in Italy (Cecere et al, 2011), New Zealand (D’Archino et al., 2007), Great Britain

(Farnham and Irvine, 1973), France (Cabioch et al., 1997; Verlaque, 2001; Verlaque et al., 2005;

Figueroa et al, 2007), and the Atlantic coast of the United States (Villalard-Bohnsack and Harlin,

1997; Gavio and Fredericq, 2002; Marston and Villalard-Bohnsack, 2002). Due to the difficulty

and cost of stopping an invasive marine algal species—for example, the 2000 accidental

introduction of the green alga Caulerpa taxifolia (M. Vahl) C. Agardh in California (Anderson,

2005)—efforts to prevent species introductions or to detect the presence of a potential species are

imperative for conservation of native diversity. Recent collections of Grateloupia made by the

authors on the Alabama coast have included specimens that could not be morphologically identified according to known taxa from the area. The current paper presents the identification of

a previously unknown nonnative species of Grateloupia from the Alabama Gulf Coast using

large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcL) sequence analysis, demonstrates its position within Grateloupia using phylogenetics, and suggests hypotheses regarding the possible causes and circumstances of its colonization.

MATERIALS AND METHODS

Twenty-one samples of Grateloupia of unknown species and four samples of G. gibbesii were collected from the locations listed in Table 1.1. Individuals were found growing in the intertidal or higher subtidal zone on rocks or cast ashore. Upon collection, a small portion of thallus was taken from each individual and desiccated in a plastic bag with silica gel for later molecular analysis. The remainder of each individual was vouchered on a herbarium sheet; specimens were deposited in The University of Alabama Herbarium. DNA extraction of the desiccated samples was performed using the DNEasy Plant Mini Kit (Qiagen, Valencia, CA).

The manufacturer’s recommendations were followed until the final elutions, which were performed with deionized water preheated to 65°C instead of the elution buffer.

The rbcL marker, widely used for red algae in both species identification (e.g., Saunders,

2009) and phylogenetics (e.g. De Clerck et al., 2005a), was amplified for all specimens.

Polymerase chain reaction (PCR) followed the methods of Rindi et al. (2009). Primer sequences

were provided by G.W. Saunders (University of New Brunswick, Fredericton, Canada, pers.

comm.) after standard primers failed to amplify. Procedures for agarose gel electrophoresis,

cleaning, quantification of DNA, and capillary sequencing were carried out according to Rindi et

al. (2009). Sequences were assembled using Geneious Pro v5.1.7 (Drummond et al., 2010) and

added to a database of published rbcL sequences from GenBank

for 18 Grateloupia samples selected as an accurate

representation of genetic diversity in the genus (Table 1.1). The species Yonagunia formosana

(Okamura) Kawaguchi & Masuda was selected as the outgroup after Lin and Liang (2011).

Sequences were aligned using MUSCLE sequence alignment (Edgar, 2004) in Geneious. After

alignment, sequences were manually checked for accuracy and truncated to uniform length to

avoid including “missing” data due to incomplete and partial published sequences. Other than

trimming, no adjustments were made to the alignment. Pair-wise distances between sequences

were calculated in Geneious when applicable.

Parameters for maximum likelihood (ML) and Bayesian inference (BI) were determined

using jModelTest 2.1 (Guindon and Gascuel, 2003; Posada, 2008). ML analysis was executed in

GARLI v2.0 (Zwickl, 2006) with 500 bootstrap replicates, starting from a random tree. Bootstrap confidence values were obtained via Consense (Felsenstein, 2005) on the CIPRES Science

Gateway (Miller et al., 2010). Values obtained from Consense were converted to a percentage value and rounded down. BI was executed in MrBayes v3.1.2 (Huelsenbeck and Ronquist, 2001;

Ronquist and Huelsenbeck, 2003). The final tree was obtained in the NEXUS file format, rooted

with Y. formosana, and processed in FigTree v1.3.1 and Adobe Illustrator CS3 (Adobe Systems Incorporated, San Jose, CA) for publication.

RESULTS

After alignment, the rbcL data set consisted of 20 taxa with 1,195 base pairs each. All 21

sequences of Grateloupia from Alabama were identical, and all four sequences of G. gibbesii were identical; therefore, only one sequence was included in the alignment for each taxon. The alignment contained no gaps, reflecting an accurate alignment and the absence of insertions and deletions in rbcL of red algae. The TrN + G model was selected by ModelTest. Nucleotide frequencies, substitution rates, and gamma shape parameter were estimated by GARLI. The resulting phylogram, with bootstrap confidence values, is given in Figure 1.1. The alignment and tree produced in this analysis are available in TreeBASE:

DISCUSSION

The current study presents samples from an unidentified Grateloupia population in

Alabama. The rbcL sequences for the Alabama Grateloupia samples are identical to each other and nearly identical (<0.1% divergent) to G. taiwanensis S.-M. Lin & H.Y. Liang in Lin et al.

(2008). Near-complete similarity indicates that these specimens are conspecific. The unidentified

Grateloupia in Alabama is therefore determined to be G. taiwanensis. This assertion is supported

by the sequence divergences among G. taiwanensis and some of its most closely related taxa

(>3.1% divergent from G. huangiae and relatives) in this analysis and previously published phylogenies. Grateloupia taiwanensis has not been previously reported from the Gulf of Mexico

(Fredericq et al., 2009) or the western Atlantic (Wynne, 2011). Before the current study, the

distribution of G. taiwanensis was known to include only Taiwan (Lin et al., 2008). Therefore,

we consider G. taiwanensis to be a nonnative species in the Gulf of Mexico. We also consider

the introduction of G. taiwanensis to be recent; this is supported by the lack of previous reports

of Grateloupia specimens from the Gulf of Mexico with the morphological features typical of G.

taiwanensis (large size and proliferous blades, see Figure 1.2, which make it very conspicuous in

intertidal habitats) and the previous experience of the authors collecting in the Gulf of Mexico.

On the basis of its rbcL sequence, G. gibbesii does not appear to be conspecific with any species in this analysis or with any species with a published rbcL sequence in GenBank. The samples collected of this species are very close (~5 km) to the type locality of this alga, Sullivan’s Island,

SC (Harvey, 1853). Therefore, we conclude that our identification is correct and that G. gibbesii represents a unique evolutionary lineage. Before the current study’s publication, the authors became aware of the possibility that the unknown Grateloupia found in Alabama might not be G. taiwanensis but G. gibbesii because this species had already been known in the Gulf of Mexico and sequence data had not been generated for it. However, because these two species show a sequence divergence of 6.8% in rbcL, this is not the case. Future collections and sequencing of G. gibbesii from the Gulf of Mexico are needed to confirm its presence.

The phylogeny reconstructed in the current study shows that G. taiwanensis is closely related to other taxa known primarily from the Pacific Ocean. Of the species included in the analysis, G. huangiae was described most recently (Lin and Liang, 2011) and is found in Taiwan.

Grateloupia sparsa is widely distributed in the Asian Pacific, along with G. turuturu. However,

G. turuturu is found throughout the world as an invasive species. None of these species has been found in the Gulf of Mexico, and of these, only G. turuturu is known outside the Pacific Ocean.

On the basis of these distributions, it appears likely that the most recent common ancestor of this

group occurred in Asia and that G. taiwanensis was introduced to Alabama from Taiwan, rather

6 than vice versa. This is concordant with the pattern of introductions of species of Grateloupia from Asia, most notably G. turuturu but including other species (Verlaque et al., 2005).

Apart from the current study, which reports G. taiwanensis for the first time from

Alabama, the extent of the occurrence of G. taiwanensis in the Gulf of Mexico is currently unknown. Additional collections are being made to Grateloupia taiwanensis to determine their current expansion and any possible detrimental effects this introduction might have on marine communities.

ACKNOWLEDGMENTS

This study was funded by the U.S. National Science Foundation (NSF) Assembling the

Tree of Life Program (DEB 0937978 to JLB) and the NSF Research Experiences for

Undergraduates (DEB 1027012 to JLB). The authors express sincere thanks to Dr. Showe-Mei

Lin (National Taiwan Ocean University, Keelung, Taiwan) for providing samples and sequences of Grateloupia taiwanensis; to Dr. Michael J. Wynne (University of Michigan Herbarium, Ann

Arbor, MI) for his insightful comments on this manuscript; and to Dr. D. Reid Wiseman (College of Charleston, Charleston, SC) for providing samples of Grateloupia gibbesii and for collection assistance in Charleston.

This work is reprinted with permission (Appendix 1) from Gulf of Mexico Science,

Volume 30, Nos. 1&2, pp. 7–13 (2012).

REFERENCES

ANDERSON, L. W. J. 2005. California’s reaction to Caulerpa taxifolia: a model for invasive species rapid response. Biol. Invasions 7:1003–1016.

CABIOCH, J., A. CASTRIC-FEY, M.-T. L’HARDY-HALOS, AND A. RIO. 1997. Grateloupia doryphora et Grateloupia filicina var. luxurians (Rhodophyta, Halymeniaceae) sur les côtes de Bretagne (France). Cryptogamie Algol. 18:117–137.

CECERE, E., I. MORO, M. A. WOLF, A. PETROCELLI, M. VERLAQUE, AND A. SFRISO. 2011. The introduced seaweed Grateloupia turuturu (Rhodophyta, Halymeniales) in two Mediterranean transitional water systems. Bot. Mar. 54:23–33.

D’ARCHINO, R., W. A. NELSON, AND G. C. ZUCCARELLO. 2007. Invasive marine red alga introduced to New Zealand waters: first record of Grateloupia turuturu (Halymeniaceae, Rhodophyta). N. Z. J. Mar. Freshw. Res. 41:35–42.

DE CLERCK, O., B. GAVIO, S. FREDERICQ, I. BÁRBARA, AND E. COPPEJANS. 2005b. Systematics of Grateloupia filicina (Halymeniaceae, Rhodophyta) based on rbcL sequence analyses and morphological evidence, including the reinstatement of G. minima and the description of G. capensis sp. nov. J. Phycol. 41:391–410.

———, ———, ———, E. COCQUYT, AND E. COPPEJANS. 2005a. Systematic reassessment of the red algal genus Phyllymenia (Halymeniaceae, Rhodophyta). Eur. J. Phycol. 40:169–178.

DRUMMOND, A. J., B. ASHTON, S. BUXTON, M. CHEUNG, A. COOPER, C. DURAN, M. FIELD, J. HELED, M. KEARSE, S. MARKOWITZ, R. MOIR, S. STONES-HAVAS, S. STURROCK, T. THIERER, AND A. WILSON. 2010. Geneious v5.0, available from http://www.geneious.com, accessed 12 September 2012.

EDGAR, R. C. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucl. Acids Res. 32:1792–1797.

FARNHAM, W. F., AND L. M. IRVINE. 1973. The addition of a foliose species of Grateloupia in the British marine flora. Br. Phycol. J. 14:208–209.

FAYE, E. J., H. W. WANG, S. Kawaguchi, S. Shimada, and M. Masuda. 2004. Reinstatement of Grateloupia subpectinata (Rhodophyta, Halymeniaceae) based on morphology and rbcL sequences. Phycol. Res. 52:59–67.

FELSENSTEIN, J. 2005. PHYLIP (phylogeny inference package). Department of Genome Sciences, University of Washington, Seattle, WA.

FIGUEROA, F. L., N. KORBEE, O. DE CLERCK, I. BÁRBARA, AND E. A. R. GALL. 2007. Characterization of Grateloupia lanceola (Halymeniaceae, Rhodophyta), an obscure foliose Grateloupia from the Iberian Peninsula, based on morphology, comparative sequence analysis and mycosporine-like amino acid composition. Eur. J. Phycol. 42:231– 242.

FREDERICQ, S., T. O. CHO, S. A. EARLE, C. F. GURGEL, D. M. KRAYESKY, L. E. MATEO-CID, A. M. MENDOZA-GONZÁLEZ, J. N. NORRIS, AND A. M. SUÁREZ. 2009. Seaweeds of the Gulf of Mexico, p. 187–259. In: Gulf of Mexico: its origins, waters and biota. I. Biodiversity. D. L. Felder and D. K. Camp (eds.), Texas A&M University Press, College Station, TX.

GAVIO, B., AND S. FREDERICQ. 2002. Grateloupia turuturu (Halymeniaceae, Rhodophyta) is the correct name for the non-native species in the Atlantic known as Grateloupia doryphora. Eur. J. Phycol. 37:349–359.

GUINDON, S., AND O. GASCUEL. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52:696–704.

GUIRY, M. D., AND G. M. GUIRY. 2012. AlgaeBase. World-wide electronic publication, National University of Ireland, Galway. http://www.algaebase.org; searched on 6 September 2012.

HARVEY, W. H. 1853. Nereis Boreali-Americana; or, Contributions to a History of the Marine Algae of North America. Part II, Rhodospermae. V. Cryptonemiaceae, XXII. Grateloupia. Smithsonian Contributions to Knowledge 5(5). Reprint in Bibliotheca Phycologica Band 20, p. 199–200. J. Cramer Publishing, Lubrecht & Cramer LTD, Port Jervis, NY.

HUELSENBECK, J. P., AND F. RONQUIST. 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17:754–755.

KAWAGUCHI, S., H. W. WANG, T. HORIGUCHI, G. SARTONI, AND M. MASUDA. 2001. A comparative study of the red alga Grateloupia filicina (Halymeniaceae) from the northwestern Pacific and Mediterranean with the description of Grateloupia asiatica sp. nov. J. Phycol. 37:433–442.

LIN, S.-M., AND H.-Y. LIANG. 2011. Grateloupia huangiae (Halymeniaceae, Rhodophyta), a new species from Taiwan previously confused with Polyopes lancifolius, with emphasis on the development of the auxiliary cell ampullae. Phycologia 50:232–240.

———, ———, AND M. H. HOMMERSAND. 2008. Two types of auxiliary cell ampullae in Grateloupia (Halymeniaceae, Rhodophyta), including G. taiwanensis sp. nov. and G. orientalis sp. nov. from Taiwan based on rbcL gene sequence analysis and cystocarp development. J. Phycol. 44:196–214.

MARSTON, M., AND M. VILLALARD-BOHNSACK. 2002. Genetic variability and potential sources of Grateloupia doryphora (Halymeniaceae, Rhodophyta), an invasive species in Rhode Island waters (USA). J. Phycol. 38:649–658.

MILLER, M. A., W. PFEIFFER, AND T. SCHWARTZ. 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees, p. 1–8. In: Proceedings of the Gateway Computing Environments Workshop (GCE), 14 Nov. 2010, New Orleans, LA.

POSADA, D. 2008. jModelTest: phylogenetic model averaging. Mol. Biol. Evol. 25:1253–1256.

RINDI, F., D. W. LAM, AND J. M. LÓPEZ-BAUTISTA. 2009. Phylogenetic relationships and species circumscription in Trentepohlia and Printzina (Trentepohliales, Chlorophyta). Mol. Phylogen. Evol. 52:329–339.

RONQUIST, F., AND J. P. HUELSENBECK. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–1574.

SAUNDERS, G. W. 2009. Routine barcoding of Canadian Gracilariales (Rhodophyta) reveals the invasive species Gracilaria vermiculophylla in British Columbia. Mol. Ecol. Resourc. 9(s1):140–150.

VERLAQUE, M. 2001. Checklist of the macroalgae of Thau Lagoon (He´rault, France), a hot spot of marine species introduction in Europe. Oceanol. Acta 24:29–49.

———, P. M. BRANNOCK, T. KOMATSU, M. VILLALARD-BOHNSACK, AND M. MARSTON. 2005. The genus Grateloupia C. Agardh (Halymeniaceae, Rhodophyta) in the Thau Lagoon (France, Mediterranean): a case study of marine plurispecific introductions. Phycologia 44:477–496.

VILLALARD-BOHNSACK, M., AND M. M. HARLIN. 1997. The appearance of Grateloupia doryphora (Halymeniaceae, Rhodophyta) on the northeast coast of North America. Phycologia 36:324–328.

WANG, H. W., S. KAWAGUCHI, T. HORIGUCHI, AND M. MASUDA. 2000. Reinstatement of Grateloupia catenata (Rhodophyta, Halymeniaceae) on the basis of morphology and rbcL sequences. Phycologia 39:228–237.

———, ———, ———, AND ———. 2001. A morphological and molecular assessment of the genus Prionitis J. Agardh (Halymeniaceae, Rhodophyta). Phycol. Res. 49:251–261.

WYNNE, M. 2011. A checklist of benthic marine algae of the tropical and subtropical western Atlantic: third revision. Nova Hedwigia Beih. 140:166.

ZHAO, D., H. WANG, Y. SHENG, J. LÜ, AND R. LUAN. 2012. Morphological observation and rbcL gene sequences studies of two new species, Grateloupia dalianensis H.W. Wang et D. Zhao, sp. nov. and G. yinggehaiensis H.W. Wang et R.X. Luan, sp. nov. (Halymeniaceae, Rhodophyta) from China. Acta Oceanol. Sin. 31:109–120.

ZWICKL, D. J. 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological sequence data sets under the maximum likelihood criterion. Ph.D. diss., The University of Texas at Austin.

Figure 1.1. Maximum likelihood (ML) phylogram of Grateloupia taiwanensis and related taxa. Numbers above and below branches represent ML bootstrap percentages and Bayesian posterior probabilities, respectively. An “x” indicates support less than 50 percent. Taxa in bold are new sequences generated in this study. Scale bar = 0.02 substitutions per site.

Figure 1.2. Grateloupia taiwanensis herbarium specimen, collected from Orange Beach, Alabama.

Table 1.1. List of species included in this study, with collection information, GenBank accession numbers, and references.

Grateloupia filicina Revisited: Molecular Phylogenetics of an Unidentified Grateloupia sp. (Halymeniaceae, Rhodophyta) from the Gulf of Mexico

ABSTRACT

Although the red algal genus Grateloupia is well known in the Gulf of Mexico, most past reports lack an accurate species-level identification. This has led to uncertainty in the actual number of Grateloupia species present in the Gulf of Mexico, which has been further complicated by numerous taxonomic reassessments of the genus in recent years. A sample of

Grateloupia sp. was collected from Cape San Blas, FL, and the rbcL marker was sequenced and analyzed for identification. This unknown Grateloupia sp. clusters with several named species in the rbcL phylogeny, including G. hawaiiana and G. yangjiangensis. A very low rbcL sequence divergence suggests that all of these species are conspecific; however, morphological and molecular investigations of G. hawaiiana, G. yangjiangensis, and this Grateloupia sp. from

Florida are needed to confirm or dispute this hypothesis.

INTRODUCTION

Grateloupia C. Agardh, a genus of red benthic macroalgae occurring in temperate to tropical marine waters worldwide, is notoriously challenging to taxonomists, owing to the morphological simplicity and plasticity exhibited by these algae. Considering Grateloupia sensu lato (s.l.), this genus has over 90 species (Guiry and Guiry, 2015), making it the largest genus in the family Halymeniaceae. Many taxonomic changes in the family has resulted in sinking several genera in Halymeniaceae into synonymy with Grateloupia, including Pachymeniopsis Y.

Yamada ex S. Kawabata (Kawaguchi, 1997), Prionitis J. Agardh (Wang et al., 2001),

Phyllymenia J. Agardh (De Clerck et al., 2005a), and Dermocorynus H. Crouan & P. Crouan

(Wilkes et al., 2005). Except for Pachymeniopsis, all of these genera were subsumed under

Grateloupia based almost completely on molecular sequence analysis. However, Gargiulo et al.

(2013) found distinct morphological features corresponding to phylogenetic lineages,

resurrecting the aforementioned genera and suggesting that several new genera have yet to be described. Since that publication, two new genera based on former Grateloupia species have

indeed been described—Neorubra M. S. Calderon, G. H. Boo, & S. M. Boo (Calderon et al.,

2014a) and Ramirezia M. S. Calderon, G. H. Boo, A. Mansilla & S. M. Boo (Calderon et al.,

2014b)—but many groups of Grateloupia s.l. identified by Gargiulo et al. (2013) are still unnamed. In light of these ongoing major taxonomic revisions, the name Grateloupia must be

used carefully in order to avoid confusion between Grateloupia sensu stricto (s.s.) (the lineage of

Grateloupia including the type species, G. filicina) and Grateloupia s.l. (the entire phylogenetic group including Grateloupia s.l., the aforementioned other genera, and the numerous species not yet classified into a new genus).

Within Grateloupia s.s., Grateloupia filicina (Lamouroux) C. Agardh has presented its own taxonomic problems. Originally described from the Mediterranean Sea, this species has been identified all over the world and was once considered truly cosmopolitan (Saunders and

Kraft, 1996). De Clerck et al. (2005b) revealed extensive cryptic diversity in G. filicina, stating

that G. filicina occurs strictly in the Mediterranean Sea. Therefore, algae identified as G. filicina

from other waters represent different species. Some collections formerly considered G. filicina

have been renamed as new species, for example Grateloupia asiatica Kawaguchi & Wang

(Kawaguchi et al., 2001) and Grateloupia luxurians (A. Gepp & E. S. Gepp) R. J. Wilkes, L. M.

McIvor, & Guiry (Wilkes et al., 2005). However, many tropical specimens remain to be

described, including several from Hawaii and the Gulf of Mexico (De Clerck et al., 2005b).

Three known species of Grateloupia s.l. occur in the Gulf of Mexico: Grateloupia

gibbesii Harvey and Grateloupia pterocladina (M. J. Wynne) S. Kawaguchi & H. W. Wang

(Fredericq et al., 2009), as well as the recently discovered Grateloupia taiwanensis S.-M. Lin &

H. Y. Liang (DePriest and López-Bautista, 2012). Fredericq et al. (2009) also list numerous

records of “Grateloupia sp.”, which includes specimens formerly thought to be G. filicina. This

represents a noticeable gap in our understanding of the biodiversity of the Gulf of Mexico. As one of these species (G. taiwanensis) is thought to be non-native and possibly invasive (DePriest and López-Bautista, 2012), the diversity of Grateloupia in the Gulf of Mexico should be

investigated in depth in order to predict or prevent any possible ecological consequences of

potential invasions. The current study examines one such Grateloupia sp. from the Gulf of

Mexico collected in Cape San Blas, FL, USA.

MATERIALS AND METHODS

Samples of an unknown Grateloupia sp. were collected from Cape San Blas, FL, USA on

9 August 2012 and preserved in silica gel. Genomic DNA was extracted using the E.Z.N.A. Plant

DNA Kit (Omega Bio-Tek, Norcross, GA) following the manufacturer’s instructions. To amplify

the rbcL marker, PCR was performed following Rindi et al. (2009), using primers from

Freshwater et al. (1994) and another primer, R864 (5’–GCGAGCCCAAACACCCATAG–3’).

Sequences representing the diversity of Grateloupia sensu stricto, following Gargiulo et al.

(2013), as well as various sequences of G. filicina, were downloaded from GenBank (Table 2.1)

and imported to Geneious (Geneious version 7.1.7; available from http://www.geneious.com/).

Grateloupia huertana Mateo-Cid, Mendoza-González, & Gavio was selected as the outgroup,

occurring outside Grateloupia s.s. in phylogenetic analyses (Gargiulo et al., 2013). Multiple

sequence alignment was performed using MUSCLE (Edgar, 2004) via the plugin in Geneious.

Pairwise distances between species were also calculated in Geneious. The appropriate model of sequence evolution was determined using jModelTest 2.1 (Guindon and Gascuel, 2003; Posada,

2008). Maximum likelihood (ML) phylogenetic analysis was performed using GARLI v2.0

(Zwickl, 2006), starting from a random tree, using 100 bootstrap replicates. Bootstrap results were summarized using SumTrees, part of the DendroPy package (v3.12.0; Sukumaran and

Holder, 2010). Bayesian inference of phylogeny (BI) was performed in MrBayes v3.1.2

(Huelsenbeck and Ronquist, 2001; Ronquist and Huelsenbeck, 2003). The resulting phylogenetic tree was edited in FigTree v1.4.0 (available from http://tree.bio.ed.ac.uk/software/figtree) and

Adobe Illustrator CC (available from http://www.adobe.com/products/illustrator.html).

RESULTS

The complete aligned dataset consisted of 1,560 bp in length and contained 28 taxa. The

TrN+G model of evolution was selected based on the Bayesian information criterion in jModelTest, and the ML phylogram is given in Figure 2.1. Pairwise distances among the unknown Grateloupia sp. from Florida and the most closely related taxa according to the phylogeny are given in Table 2.2. The rbcL sequences of the unknown Grateloupia sp. from

Florida and a sequence named Grateloupia hawaiiana Dawson (sequenced by De Clerck et al.,

2005a) were identical, strongly suggesting that the two are conspecific. Additionally, these two specimens were placed in a clade, herein G. hawaiiana-clade, of six specimens, along with three

G. “filicina” sequences and Grateloupia yangjiangensis W.-X. Li & D.-F. Ding, with full statistical support (Figure 2.1). All six shared more than 99.5% rbcL sequence identity (Table

2.2).

DISCUSSION

If these specimens are conspecific, according to the International Code of Nomenclature

for algae, fungi, and plants (McNeill et al., 2012), the oldest name should be applied, which in

this case would be Grateloupia hawaiiana E.Y. Dawson (1958), reducing Grateloupia

yangjiangensis W.-X. Li & Z.-F. Ding in B.-M. Xia (2004) to synonymy. It is known that

Grateloupia species from tropical regions show significantly less divergence in rbcL than those from temperate regions, varying by a maximum of around 5% interspecific divergence for tropical entities, contrasting with up to 10% for temperate lineages (De Clerck et al., 2005b).

However, the divergence less than 0.5% in our G. hawaiiana-clade strongly suggests that these entities are conspecific.

The rbcL phylogeny generated in the current study, as in many previous studies, lacks significant statistical support at higher-order branches, suggesting a need for more extensive taxon sampling and/or a different phylogenetic marker to resolve them. A faster-evolving marker, such as the COI-5P DNA barcoding marker, appears to be necessary for distinguishing species in

Grateloupia s.s. This marker was successfully used by Yang and Kim (2014) to differentiate species of Grateloupia s.l. in Korea.

The G. hawaiiana-clade contains specimens representing a single species from many distant geographical regions, from Malaysia and China in the western Pacific, to Hawaii, to

Florida and Texas in the Gulf of Mexico. This disjunct distribution may reflect a series of species introductions; many nonindigenous algae have been introduced to Hawaii (Smith et al., 2002), and this species of Grateloupia identified from Cape San Blas, FL may represent another example. The species Grateloupia hawaiiana has been thought to be endemic to Hawaii and morphologically distinct from “G. filicina” (Abbott, 1999). Sequences from G. filicina from the

type locality are not found in the G. hawaiiana-clade (Figure 2.1) and are restricted to the

Mediterranean Sea, but the name “Grateloupia filicina” has been applied to specimens from

Hawaii. All these “G. filicina” sequences from Hawaii are nested with the G. hawaiiana samples

and our specimen from Florida in the same G. hawaiiana-clade. It is clear that G. filicina is not

found in Hawaii, and the Hawaiian “G. filicina” may represent morphological variants of G.

hawaiiana.

Currently, no species of Grateloupia are considered to be invasive to Hawaii (Carlton and

Eldredge, 2015; Carlton and Eldredge, 2009; Abbott, 1999), in contrast, an introduced

Grateloupia is known to the Gulf of Mexico (DePriest and Lopez-Bautista, 2012). At this time it cannot be established whether the Grateloupia sp. found in Florida is an introduced species.

Until confirmed sequences from type material belonging to the species G. hawaiiana are obtained, conclusive statements cannot be made on the origin and distribution of this G. hawaiiana-clade.

It is also possible that this alga is simply a widespread subtropical species, occurring naturally in both the Pacific and the Gulf of Mexico, as G. filicina was once thought to be. In fact, most published reports of Grateloupia in the Gulf of Mexico were labeled G. filicina (Fredericq et al., 2009), which means that the Florida Grateloupia sp. may have been collected in the past but simply overlooked. A population-level study including samples throughout the world may also be useful to elucidate the genetic distribution of this species (or species complex), which would be similar to a study comparing mitochondrial haplotypes in invasive Grateloupia turuturu (as G. doryphora; Marston and Villalard-Bohnsack, 2002).

Until more appropriate phylogenetic analyses can be performed, along with detailed morphological observations, the unknown Grateloupia sp. from Florida cannot be identified as G.

19 hawaiiana. In any case, it is clear that this species is not G. filicina s.s. Tropical specimens previously identified as G. filicina should continue to be re-evaluated using appropriate genetic markers in order to determine the full distribution of these species. As these algae occur throughout the world, international collaboration is crucial for resolving these and other taxonomic questions.

ACKNOWLEDGMENTS

This study was funded by the U.S. National Science Foundation (NSF) Assembling the

Tree of Life Program (DEB 0937978 to JLB). The authors would also like to express thanks to

Dr. Michael J. Wynne (University of Michigan, Ann Arbor, MI) and Gabriela Garcia-Soto (The

University of Alabama, Tuscaloosa, AL) for helpful comments and suggestions on this project.

REFERENCES

ABBOTT, I. A. 1999. Marine red algae of the Hawaiian Islands. Bishop Museum Press, Honolulu, HI.

CALDERON, M. S., G. H. BOO, AND S. M. BOO. 2014b. Neorubra decipiens gen. & comb. nov. and Phyllymenia lancifolia comb. nov. (Halymeniales, Rhodophyta) from South America. Phycologia 53:409–422.

———, ———, AND ———. 2014a. Morphology and phylogeny of Ramirezia osornoensis gen. & sp. nov. and Phyllymenia acletoi sp. nov. (Halymeniales, Rhodophyta) from South America. Phycologia 53:23-36.

CARLTON, J. T., AND L. G. ELDREDGE. 2015. Update and revisions of: The marine bioinvasions of Hawai‘i: the introduced and cryptogenic and marine and estuarine animals and plants of the Hawaiian archipelago. Bishop Museum Bulletin in Zoology 9:25–47.

———, AND ———. 2009. Marine bioinvasions of Hawai‘i: the introduced and cryptogenic marine and estuarine animals and plants of the Hawaiian archipelago. Bishop Museum Bulletin in Cultural and Environmental Studies 4:153–161.

DAWSON, E. Y. 1958. A new gigartinoid Grateloupia (red alga) from Hawaii. Pacific Naturalist 1:3–5.

———, ———, ———, E. COCQUYT, AND E. COPPEJANS. 2005a. Systematic reassessment of the red algal genus Phyllymenia (Halymeniaceae, Rhodophyta). Eur. J. Phycol. 40:169–178.

DEPRIEST, M. S., AND J. M. LÓPEZ-BAUTISTA. 2012. Sequencing of the rbcL marker reveals the non-native red alga Grateloupia taiwanensis (Halymeniaceae, Rhodophyta) in Alabama. Gulf of Mexico Science 2012:7–13.

EDGAR, R. C. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucl. Acids Res. 32:1792–1797.

GARGIULO, G. M., M. MORABITO, AND A. MANGHISI. 2013. A re-assessment of reproductive anatomy and postfertilization development in the systematics of Grateloupia (Halymeniales, Rhodophyta). Cryptogamie Algol. 34:3–35.

GUINDON, S., AND O. GASCUEL. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52:696–704.

KAWAGUCHI, S., H. W. WANG, T. HORIGUCHI, G. SARTONI, AND M. MASUDA. 2001. A comparative study of the red alga Grateluopia filicina (Halymeniaceae) from the northwestern Pacific and Mediterranean with the description of Grateloupia asiatica, sp. nov. J. Phycol. 37:433–442.

———. 1997. Taxonomic notes on the Halymeniaceae (Gigartinales, Rhodophyta) from Japan. III. Synonymization of Pachymeniopsis Yamada in Kawabata with Grateloupia C. Agardh. Phycol. Res. 45:9–21.

LIN, S. M., H. Y. LIANG, AND M. H. HOMMERSAND. 2008. Two types of auxiliary cell ampullae in Grateloupia (Halymeniaceae, Rhodophyta), including G. taiwanensis sp. nov. and G. orientalis sp. nov. from Taiwan based on rbcL gene sequence analysis and cystocarp development. J. Phycol. 44:196–214.

MATEO-CID, L. E., A. C. MENDOZA-GONZÁLEZ, B. GAVIO, AND S. FREDERICQ. 2005. Grateloupia huertana sp. nov. (Halymeniaceae, Rhodophyta), peculiar new prostrate species from tropical Pacific Mexico. Phycologia 44:4–16.

MCNEILL, J., F. R. BARRIE, W. R. BUCK, V. DEMOULIN, W. GREUTER, D. L. HAWKSWORTH, P. S. HERENDEEN, S. KNAPP, K. MARHOLD, J. PRADO, W. F. PRUD’HOMME VAN REINE, G. F. SMITH, J. H. WEIRSMA, AND N. J. TURLAND. 2012. Regnum vegetabile 154. Koeltz Scientific Books, Koenigstein, Germany.

POSADA, D. 2008. jModelTest: phylogenetic model averaging. Mol. Biol. Evol. 25:1253–1256.

SAUNDERS, G. W., AND G. T. KRAFT. 1996. Small-subunit rRNA gene sequences from representatives of selected families of the Gigartinales and Rhodymeniales (Rhodophyta). 2. Recognition of the Halymeniales ord. nov. Can. J. Bot. 74:694–707.

SMITH, J. E., C. L. HUNTER, AND C. M. SMITH. 2002. Distribution and reproductive characteristics of nonindigenous and invasive marine algae in the Hawaiian Islands. Pac. Sci. 56:299–315.

SUKUMARAN, J., AND M. T. HOLDER. 2010. DendroPy: a Python library for phylogenetic computing. Bioinformatics 26:1569–1571.

WANG, H., S. GUO, X. ZHANG, D. ZHAO, W. ZHANG, AND R. LUAN. 2014. Re- identifying Grateloupia yangjiangensis (Rhodophyta, Halymeniaceae) based on morphological observations, life history and rbcL sequence analyses. Acta Oceanol. Sin. 33:77–84.

———, S. KAWAGUCHI, T. HORIGUCHI, AND M. MASUDA. 2001. A morphological and molecular assessment of the genus Prionitis J. Agardh (Halymeniaceae, Rhodophyta). Phycol. Res. 49:251–261.

———, ———, ———, AND ———. 2000. Reinstatement of Grateloupia catenata (Rhodophyta, Halymeniaceae) on the basis of morphology and rbcL sequences. Phycologia 39:228–237.

WILKES, R. J., L. M. MCIVOR, AND M. D. GUIRY. 2005. Using rbcL sequence data to reassess the taxonomic position of some Grateloupia and Dermocorynus species (Halymeniaceae, Rhodophyta) from the north-eastern Atlantic. Eur. J. Phycol. 40:53–60.

XIA, B.-M. 2004. Flora algarum marinarum sinicarum, Tomus II: Rhodophyta, no. III: Gelidiales Cryptonemiales Hildenbrandiales. Beijing: Science Press.

YANG, M. Y., AND M. S. KIM. 2014. Taxonomy of Grateloupia (Halymeniales, Rhodophyta) by DNA barcode marker analysis and a description of Pachymeniposis volvita sp. nov. J. Appl. Phycol. October 2014 [Online]. http://link.springer.com/article/10.1007/s10811- 014-0432-1 accessed 12 March 2015.

ZHAO, D., H. WANG, Y. SHENG, J. LU, AND R. LUAN. 2012. Morphological observation and rbcL gene sequences studies of two new species, Grateloupia dalianensis H. W. Wang et D. Zhao, sp. nov. and G. yinggehaiensis H. W. Wang et R. X. Luan, sp. nov. (Halymeniaceae, Rhodophyta) from China. Acta Oceanol. Sin. 31:109–120.

Figure 2.1. Maximum likelihood (ML) phylogeny of Grateloupia s.s., including Grateloupia sp. from Florida. Numbers above and below branches represent ML bootstrap percentages and Bayesian posterior probabilities, respectively. A dash indicates support less than 50 percent, while an asterisk indicates full support. Scale bar = 0.02 substitutions per site.

Species Accession Locality Reference Grateloupia carnosa AB038608 Oryuzako, Miyazaki Wang et al., 2000 Prefecture, Japan Grateloupia catenata AB038613 Hakodate, Hokkaido, Japan Wang et al., 2000 Grateloupia catenata AB038618 Dalian, Liaoning Province, Wang et al., 2000 China Grateloupia dichotoma AF488823 Marataizes, Espírito Santo, Gavio and Fredericq, 2002 Brazil Grateloupia doryphora AF488817 Playa de San Francisco, Gavio and Fredericq, 2002 Bahia de Ancon, Lima, Peru Grateloupia filicina AJ868473 Banyuls, France De Clerck et al., 2005b Grateloupia filicina AM422893 Corsica, Calvi, France Figueroa et al., 2007 Grateloupia filicina JX070629 Livorno, Italy Gargiulo et al., 2013 Grateloupia “filicina” AB038612 Pulau Bai, Sandakan, Sabah, Wang et al., 2000 Malaysia Grateloupia “filicina” AY772029 Dikwella, Sri Lanka De Clerck et al., 2005a Grateloupia “filicina” AJ868478 Coquina rocks south of De Clerck et al., 2005b Marineland, FL, USA Grateloupia “filicina” AJ868479 Opunohu bay, Moorea, De Clerck et al., 2005b French Polynesia Grateloupia “filicina” AJ868480 Puppuka, Hawaii, HI, USA De Clerck et al., 2005b Grateloupia “filicina” AJ868481 Punta Ceiba, Tabasco, De Clerck et al., 2005b Mexico Grateloupia “filicina” AJ868483 Port Aransas, TX, USA De Clerck et al., 2005b Grateloupia “filicina” AJ868485 Lae, Papua New Guinea De Clerck et al., 2005b Grateloupia “filicina” AJ868486 Dutch West Indies De Clerck et al., 2005b Grateloupia “filicina” AJ868487 Madrizavi Island, Los De Clerck et al., 2005b Roques, Venezuela Grateloupia “filicina” AJ868488 Tulér, Madagascar De Clerck et al., 2005b Grateloupia filiformis AF488822 Marataizes, Espirito Santo, Gavio and Fredericq, 2002 Brazil Grateloupia hawaiiana AY772030 Maui, HI, USA De Clerck et al., 2005a Grateloupia huertana AY178761 Playa Agua Blanca, Oaxaca, Mateo-Cid et al., 2005 Brazil Grateloupia orientalis EU292744 Linping, Taiwan Lin et al., 2008 Grateloupia ramosissima AF488810 Ho Ping Island, Keelung, Gavio and Fredericq, 2002 Taiwan Grateloupia yangjiangensis HQ324236 Yangjiang, Guangdong Wang et al., 2014 Province, China Grateloupia yinggehaiensis HQ332513 Yinggehai, Hainan Province, Zhao et al., 2012 China Grateloupia sp. AF488827 Sea Lion Island, Falkland Gavio and Fredericq, 2002 Islands Grateloupia sp. Cape San Blas, FL, USA This study

Table 2.1. List of sequences included in phylogenetic analysis of Grateloupia filicina, with collection information, GenBank accession numbers, and references.

1. 2. 3. 4. 5. 6. 1. G. “filicina” Mexico 99.761% 99.682% 99.682% 99.680% 99.682% 2. G. yangjiangensis 3 99.761% 99.767% 99.760% 99.761% 3. G. “filicina” Malaysia 4 3 99.923% 99.844% 100% 4. G. hawaiiana 4 3 1 99.767% 100% 5. Grateloupia sp. Florida 4 3 2 3 100% 6. G.”filicina” Hawaii 4 3 0 0 0

Table 2.2. Pairwise divergences in rbcL for selected taxa. Values above the diagonal are percent divergences; below the diagonal, base-pair differences.

The Plastid Genome of the Red Macroalga Grateloupia taiwanensis (Halymeniaceae)

ABSTRACT

The complete plastid genome sequence of the red macroalga Grateloupia taiwanensis S.-

M.Lin & H.-Y.Liang (Halymeniaceae, Rhodophyta) is presented here. Comprising 191,270 bp, the circular DNA contains 233 protein-coding genes and 29 tRNA sequences. In addition, several genes previously unknown to red algal plastids are present in the genome of G. taiwanensis. The plastid genomes from G. taiwanensis and another florideophyte, Gracilaria tenuistipitata var. liui, are very similar in sequence and share significant synteny. In contrast, less synteny is shared between G. taiwanensis and the plastid genome representatives of

Bangiophyceae and Cyanidiophyceae. Nevertheless, the gene content of all six red algal plastid genomes here studied is highly conserved, and a large core repertoire of plastid genes can be discerned in Rhodophyta.

INTRODUCTION

The red algae (division Rhodophyta) comprise over 6,300 species (Guiry and Guiry,

2013) of mostly multicellular, marine, photosynthetic organisms. Along with Viridiplantae

(green algae and higher plants) and Glaucophyta, Rhodophyta is one of the three lineages of eukaryotes originating from primary endosymbiosis of an ancient cyanobacterium, forming the supergroup Plantae sensu lato. The monophyly of Plantae s.l. is well supported in several analyses (Rodríguez-Ezpeleta et al., 2005; Reyes-Prieto and Bhattacharya, 2007; Price et al.,

2012). Subsequent secondary endosymbioses have occurred, resulting in a great diversity of plastid-bearing eukaryotes throughout the tree of life. The chlorarachniophytes and euglenoids

27 separately acquired green algal endosymbionts, whereas the numerous “brown” lineages

(including haptophytes, cryptophytes, stramenopiles, and alveolates) acquired red algal endosymbionts. It remains unclear, however, at which point (or points) in evolutionary history the acquisition of those red algal plastids took place, and several hypotheses have been suggested to explain the pattern, which have been tested and supported to varying degrees (Gross et al.,

2012). However, it is clear that additional data collection and analysis are needed for both the hosts and endosymbionts in this partnership, that is, for brown algal lineages and the red algae from which their plastids originated.

Molecular phylogenetic analysis has divided the red algae into seven classes (Yoon et al.,

2010; Yoon et al., 2006). This phylogeny is given in Figure 3.1. Almost all red algal species— over 6,000—belong to the class Florideophyceae, which is most closely related to the class

Bangiophyceae (~150 species; Guiry and Guiry, 2013). These two classes have been grouped in the subphylum Eurhodophytina. The most anciently diverged of the classes, the

Cyanidiophyceae, consists of very few species divided into three genera of extremophilic unicellular algae known to inhabit acidic hot springs. Five red algal plastid genomes have been published thus far, including representatives of these three classes: Gracilaria tenuistipitata var. liui Zhang & Xia (Florideophyceae); Porphyra purpurea (Roth) C.Agardh and Pyropia yezoensis (Ueda) M.S.Hwang & H.G.Choi (Bangiophyceae); and Cyanidium caldarium (Tilden) Geitler and Cyanidioschyzon merolae P.De Luca, R.Taddei & L.Varano strain 10D (Cyanidiophyceae). Because almost all known red algal diversity is found in the

Florideophyceae, the plastid genome sequence of a single species (G. tenuistipitata var. liui) is clearly insufficient information to understand the whole spectrum of characteristics that are shared by florideophycean plastids. A thorough understanding of present-day red algal plastids,

with sufficient coverage across the red algal tree of life, can help demonstrate the characteristics

of ancestral red algae and their plastids, which would have been the source of the secondary

endosymbiotic plastids of the brown algal lineages.

The florideophycean genus Grateloupia C. Agardh contains around 90 species (Guiry

and Guiry, 2013) of benthic macroalgae that are distributed in warm temperate to tropical waters

worldwide. Some species of Grateloupia are known invasive species. Grateloupia

taiwanensis S.-M.Lin & H.-Y. Liang was first described in 2008 by Lin et al. (2008) but it has since been recorded in the Gulf of Mexico (DePriest and López-Bautista, 2012).The genus is

currently being split into several genera based on combined molecular and morphological

analysis (Gargiulo et al., 2013), and it is possible that G. taiwanensis will be placed into a new

genus.

Grateloupia belongs to the order Halymeniales, whereas Gracilaria

tenuistipitata var. liui is in the order Gracilariales. Both orders are classified in the subclass

Rhodymeniophycidae, but their phylogenetic relationships within the subclass are unresolved,

due to consistent ambiguity in the phylogenetic position of Gracilariales (Harper and Saunders,

2001; Withall and Saunders, 2006; Le Gall and Saunders, 2007). Comparisons between the

plastid genomes of Gracilaria tenuistipitata and Grateloupia taiwanensis will establish a basis for contrasting the common characteristics of the plastid in Florideophyceae with those of the

other classes, as well as comparing the plastids of Rhodymeniophycidae with the other

subclasses of Florideophyceae, which have yet to be published.

MATERIALS AND METHODS

An individual of Grateloupia taiwanensis from Orange Beach, AL, USA, which was collected in a previous study (DePriest and López-Bautista, 2012) was selected for genome

sequencing. DNA was extracted from the field-collected sample using the QIAGEN DNEasy

Plant Mini Kit (QIAGEN, Valencia, CA, USA) following the manufacturer's instructions. The

sequencing library was prepared using the Nextera DNA Sample Prep Kit (Illumina, San Diego,

CA, USA) per the manufacturer's protocol and sequenced on one-half lane of an Illumina

Genome Analyzer IIX using the TruSeq SBS Kit v5 (Illumina) in a 150×150 bp paired-end run.

The data were adapter- and quality-trimmed (error threshold = 0.05, n ambiguities = 2) using

CLC Genomics Workbench (CLC Bio, Aarhus, Denmark) prior to de-novo assembly with same

(automatic bubble size, minimum contig length = 100 bp). The raw reads were then mapped to

the assembly contigs (similarity = 90%, length fraction = 75%), and regions with no evidence of

short-read data were removed. The resulting assembly included one large contig 191,270 bp in

size, which was determined to be the plastid genome by several criteria: (1) BLAST

searches (Altschul et al., 1997) of commonly known plastid genes against the entire assembly

produced hits on this contig with significant e-values (e ≤ 10−20); (2) a genome size of 191,270 bp is congruent with the sizes of other red algal plastid genomes, which range from 150 to 191 kbp (López-Bautista, 2010); (3) because each cell contains many plastids and therefore many copies of the plastid genome, it follows that cpDNA will be relatively over-represented in the short sequence reads.

The G. taiwanensis plastid genome was imported to Geneious (Geneious version 5.1.7; available from http://www.geneious.com/) and set to circular topology. Using the Geneious ORF

Finder and the standard genetic code, the start codons ATG and GTG, and a minimum length of

90 bp, the genome contained 768 ORFs. Preliminary annotation was performed using

DOGMA (Wyman et al., 2004) with an e-value cutoff of 10−20 for BLAST hits. After alignments

for each gene, these were checked manually and the corresponding ORF in the genome sequence

was annotated. The remaining ORFs were translated using the standard genetic code and submitted to phmmer (http://hmmer.janelia.org/), searching against the UniProtKB database

(http://www.uniprot.org). After including the additional start codon TTG, any ORFs occurring outside any annotation were searched for functional domains using the InterProScan Geneious plugin version 1.0.5 (Zdobnov and Apweiler, 2001). Annotations for those ORFs with putative functional domains were included in the genome.

To determine tRNA sequences, the plastid genome was submitted to the tRNAscan-SE version 1.2.1 server (Schattner et al., 2005; Lowe and Eddy, 1997). The genome was searched with default settings using the “Mito/Chloroplast” model. To determine rRNA sequences, a set of known plastid rRNA sequences was extracted from the Gracilaria tenuistipitata var. liui genome and used as a query sequence to search the G. taiwanensis genome using BLAST. A search for tmRNA sequences was performed using BRUCE v1.0 (Laslett et al.,

2002). The genome was visualized using GenomeVx (Conant and Wolfe, 2007) and edited using

Adobe Illustrator CS2 (http://www.adobe.com/products/illustrator.html).

The five published red algal plastid genomes, with annotations, were downloaded from

GenBank. Gene names were checked with the preferred name in UniProtKB and revised in order to make the most accurate comparisons between genomes. In situations where one gene had multiple names, if all were orthologous according to BLAST (e ≤ 10−10) against UniProtKB, the name used by the majority of species was used. Names of known and putative protein-coding genes (i.e., excluding tRNAs or rRNAs) were extracted from the genomes, and the sets were compared using VENNTURE (Martin et al., 2012). Genes found to be missing from a certain species or group of species were checked using BLAST in order to ensure that this gene is not present. For structure and arrangement comparisons, the genomes were aligned using the Mauve

Genome Alignment version 2.2.0 (Darling et al., 2004) Geneious plugin using the progressiveMauve algorithm (Darling et al., 2010) and default settings. To aid in visualization, we designated the beginning of the rbcL marker as position 1 in each genome.

RESULTS

The Grateloupia taiwanensis plastid genome

The 191,270 bp plastid genome (Figure 3.2) includes 233 ORFs identified as protein- coding genes, of which 35 are found only in G. taiwanensis and not in the other red algae examined in this study. Additionally, it contains 29 tRNA sequences, 3 rRNA sequences, and 1 tmRNA sequence (Table 3.1). The rRNA operon is not repeated. The tmRNA sequence appears to be homologous to the ssrA tmRNA of Gracilaria tenuistipitata var. liui. The GC-content of the G. taiwanensis plastid genome is 30 1). The proportion of intergenic space in G. taiwanensis was 18.1%, which is comparable to the other Eurhodophytina and higher than the

Cyanidiophyceae (Table 3.1). The sequence was deposited in GenBank (accession number

KC894740).

Gene content

All of the plastid genomes considered in this study share a set of 140 protein-coding genes, and an additional 21 genes are shared among the Eurhodophytina (Table 3.2). Five additional genes are shared only between G. taiwanensis and G. tenuistipitata var. liui. In total,

167 of the protein-coding genes found in the plastid of G. taiwanensis are shared with G.tenuistipitata var. liui. Of the 35 putative genes found only in G. taiwanensis, one is a gene for glutaredoxin (grx). This grx gene is 104 aa in length and is most similar to that of the cyanobacterium Arthrospira platensis (UniProt blastx, match length 107 aa, 78.0% positives, e =

8.0 × 10−38). The remaining 34 genes are unique ORFs with functional domains indicated by

InterProScan (Table 3.3). G. taiwanensis and G. tenuistipitata var. liui share the same 29 plastid tRNA genes (Table 3.4). Porphyra purpurea and Pyropia yezoensis contain more tRNA genes than the others, with 37 and 38, respectively; two tRNA genes – trnI(GAT) and trnA(TGC) – occur inside the repeated rRNA operon. In terms of tRNA gene content, the Florideophyceae and

Cyanidiophyceae are more similar to each other than to the Bangiophyceae.

Plastid genome rearrangements

Pairwise Mauve genome alignments for G. taiwanensis along with each other five plastid genomes used in this study are given in Figure 3.3. We calculated the double-cut-and-join (DCJ) genome distance, indicative of the number of rearrangements that have taken place between two genomes. The alignment of G. taiwanensis and Gracilaria tenuistipitata var. liui shows a DCJ distance of 3; G. taiwanensis and Porphyra purpurea, 4; G. taiwanensis and Pyropia yezoensis,

8; G. taiwanensis and Cyanidioschyzon merolae, 20; G. taiwanensis and Cyanidium caldarium,

21.

DISCUSSION

The plastid genome of G. taiwanensis is similar to that of G. tenuistipitata var. liui in terms of size, GC%, gene content, and overall structure. However, there are several notable differences; G. taiwanensis contains 67 putative protein-coding genes not present in G. tenuistipitata var. liui, including 32 previously named genes and 34 novel ORFs. When additional plastid genome sequences for Florideophyceae become available, it is possible that many of these novel ORFs will be found in other red algae.

The results of the current study are generally consistent with the phylogeny of

Rhodophyta proposed by Yoon et al. (2006). Unlike in Porphyra purpurea and Porphyra yezoensis, in which the rRNA operon is repeated directly, G. taiwanensis has only one rRNA

33 operon. This is consistent with the hypothesis of Hagopian et al. (2004) that the repeated rRNA operon was lost separately in the Cyanidiophyceae and the Florideophyceae. A similar pattern arose in the tRNA genes in Cyanidiophyceae and Florideophyceae. The reason for this is unclear, but because it is commonly accepted that the Cyanidiophyceae is the sister group to the rest of the red algae, we suggest that this is an example of convergent gene loss.

As expected, our analyses show that pairs of plastid genomes of red algae found in the same taxonomic class demonstrate the most structural and functional similarity

(Cyanidioschyzon/Cyanidium, Porphyra/Pyropia, and Grateloupia/Gracilaria), which decreases with the degree of relatedness. The presence of 140 “core” plastid genes reflects high conservation in the plastids of red algae, compared to green algal plastids, which show much more variability in genome size, GC%, and other attributes (Lang and Nedelcu, 2012). Despite their similar sizes, red algal plastid genomes contain many more genes than green algal genomes, and the genes are packed tightly together with much less intergenic sequence. Thus far, G. taiwanensis shows the most intergenic sequence of any red algal plastid (18.1%), but this value is relatively low compared to those of green algal plastids.

As more and more genomes are annotated and published, comparative genomics of primary and secondary plastids will provide new insights into the pattern and process of endosymbiosis, especially in those lineages with red-derived plastids. The genes shared among all red algal plastids are likely to be essential for plastid function in Rhodophyta and offer a useful starting point for future annotation of plastid genomes. Several previous studies focused on red-derived plastids (Petersen et al., 2006; Cattolico et al., 2008; Le Courgillé et al.,

2009) have shown the potential of plastid genome research in answering unresolved questions in the history of these lineages. For these reasons, red algal plastid genomes remain a highly

interesting subject for research. Forthcoming sequence data will advance our understanding of the evolution of the red algal plastid.

ACKNOWLEDGMENTS

The authors acknowledge support from NSF Red Algal Tree of Life (grant DEB

0937978) and from the College of Arts and Sciences and Research Office of The University of

Alabama. The authors would like express gratitude to Dana C. Price (Rutgers University) for

technical assistance.

This work is reprinted from PLOS ONE, Volume 8, No. 7, e68246 (2013), under the

Creative Commons Attribution License,

REFERENCES

ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHAFFER, J. ZHANG, Z. ZHANG, W. MILLER, AND D. J. LIPMAN. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nuc. Acids Res. 25:3389–3402.

CATTOLICO, R.A., M. A. JACOBS, Y. ZHOU, J. CHANG, M. DUPLESSIS, T. LYBRAND, J. MCKAY, H. C. ONG, E. SIMS, AND G. ROCAP. 2008. Chloroplast genome sequencing of Heterosigma akashiwo CCMP452 (West Atlantic) and NIES293 (West Pacific) strains. BMC Genomics 9:211.

CONANT, G.C., AND K. H. WOLFE. 2007. GenomeVx: simple web-based creation of editable circular chromosome maps. Bioinformatics 24:861–862.

DARLING, A. E., B. MAU, F. R. BLATTER, AND N. T. PERNA. 2004. Mauve: multiple alignment of conserved genomic sequence with rearrangements. Genome Res. 14:1394– 1403.

———, ———, AND N. T. PERNA. 2010. progressiveMauve: multiple genome alignment with gene gain, loss, and rearrangement. PLOS ONE 5:e11147.

GROSS, J., D. BHATTACHARYA, K. N. PELLETREAU, M. E. RUMPHO, AND A. REYES- PRIETO. 2012. Secondary and tertiary endosymbiosis and kleptoplasty. In: Genomics of Chloroplasts and Mitochondria, Advances in Photosynthesis and Respiration vol. 35, R. Bock and V. Knoop (eds.), Springer.

GUIRY, M. D., AND G. M. GUIRY. 2013 AlgaeBase. World-wide electronic publication, National University of Ireland, Galway. Available: http://www.algaebase.org.

HAGOPIAN, J., M. REIS, J. KITAJIMA, D. BHATTACHARYA, AND M. C. DE OLIVEIRA. 2004. Comparative analysis of the complete chloroplast genome of the red alga Gracilaria tenuistipitata var. liui provides insights into the evolution of rhodoplasts and their relationship to other chloroplasts. J. Mol. Evol. 59:464–477.

HARPER, J. T., AND G. W. SAUNDERS. 2001. Molecular systematics of the Florideophyceae (Rhodophyta) using nuclear large and small subunit rDNA sequence data. J. Phycol. 37:1073–1082.

LANG, B. F., AND A. M. NEDELCU. 2012. Plastid genomes of algae. In: Genomics of Chloroplasts and Mitochondria, Advances in Photosynthesis and Respiration vol. 35, R. Bock and V. Knoop (eds.), Springer.

LASLETT, D., B. CANBACK, AND S. ANDERSSON. 2002. BRUCE: a program for the detection of transfer-messenger RNA genes in nucleotide sequences. Nuc. Acids Res. 30:3449–3453.

LE COURGILLÉ, G., G. PEARSON, M. VALENTE, C. VIEGAS, B. GSCHLOESSL, E. CORRE, X. BAILLY, A. F. PETERS, C. JUBIN, B. VACHERIE, J. M. COCK, AND C. LEBLANC. 2009. Plastid genomes of two brown algae, Ectocarpus siliculosus and Fucus vesiculosus: further insights on the evolution of red-algal derived plastids. BMC Evol. Biol. 9:253.

LE GALL, L., AND G. W. SAUNDERS. 2007. A nuclear phylogeny of the Florideophyceae (Rhodophyta) inferred from combined EF2, small subunit and large subunit ribosomal DNA: establishing the new red algal subclass Corallinophycidae. Mol. Phylogenet. Evol. 43:1118–1130.

LIN, S.-M., H.-Y. LIANG, AND M. HOMMERSAND. 2008. Two types of auxiliary cell ampullae in Grateloupia (Halymeniaceae, Rhodophyta), including G. taiwanensis sp. nov. and G. orientalis sp. nov. from Taiwan based on rbcL gene sequence analysis and cystocarp development. J. Phycol. 44:196–214.

LÓPEZ-BAUTISTA, J. M. 2010. Red algal genomics: a synopsis. In: Red Algae in the Genomic Age, Cellular Origin, Life in Extreme Habitats and Astrobiology vol. 13, J. Seckbach and D.J. Chapman (eds.), Springer.

LOWE, T. M., AND S. R. EDDY. 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nuc. Acids Res. 25:955–964.

MARTIN, B., W. CHADWICK, T. YI, S. S. PARK, D. LU, B. NI, S. GADKAREE, K. FARHANG, K. G. BECKER, AND S. MAUDSLEY. 2012. VENNTURE – a novel Venn diagram investigational tool for multiple pharmacological dataset analysis. PLOS ONE 7:e36911.

OHTA, N., M. MATSUZAKI, O. MISUMI, S. MIYAGISHIMA, H. NOZAKI, K. TANAKA, S. TADASU, Y. KOHARA, AND T. KUROIWA. 2003. Complete sequence and analysis of the plastid genome of the unicellular red alga Cyanidioschyzon merolae. DNA Res. 10:67–77.

PETERSEN, J., R. TEICH, H. BRINKMANN, AND R. CERFF. 2006. A “green” phosphoribulokinase in complex algae with red plastids: evidence for a single secondary endosymbiosis leading to haptophytes, cryptophytes, heterokonts, and dinoflagellates. J. Mol. Evol. 62:143–157.

PRICE, D.C., C. X. CHAN, H. S. YOON, E. C. YANG, H. QIU, A. P. WEBER, R. SCHWACKE, J. GROSS, N. A. BLOUIN, C. LANE, A. REYES-PRIETO, D. G. DURNFORD, J. A. NEILSON, B. F. LANG, G. BURGER, J. M. STEINER, W. LÖFFELHARDT, J. E. MEUSER, M. C. POSEWITZ, S. BALL, M. C. ARIAS, B. HENRISSAT, P. M. COUTINHO, S. A. RENSING, A. SYMEONIDI, H. DODDAPANENI, B. R. GREEN, V. D. RAJAH, J. BOORE, AND D. BHATTACHARYA. 2012. Cyanophora paradoxa genome elucidates origin of photosynthesis in algae and plants. Science 335:843–847.

REYES-PRIETO, A., AND D. BHATTACHARYA. 2007. Phylogeny of Calvin cycle enzymes supports Plantae monophyly. Mol. Phylogenet. Evol. 45:384–391

RODRÍGUEZ-EZPELETA, N., H. BRINKMANN, S. C. BUREY, B. ROURE, G. BURGER, W. LÖFFELHARDT, H. J. BOHNERT, H. PHILIPPE, AND B. F. LANG. 2005 Monophyly of primary photosynthetic eukaryotes: green plants, red algae, and glaucophytes. Curr. Biol. 15:1325–1330.

SCHATTNER, P., A. N. BROOKS, AND T. M. LOWE. 2005. The tRNAscan-SE, snoscan and snoGPS web servers for the detection of tRNAs and snoRNAs. Nuc. Acids Res. 33:W686–W689.

WITHALL, R. D., AND G. W. SAUNDERS. 2006. Combining small and large subunit ribosomal DNA genes to resolve relationships among orders of the Rhodymeniophycidae

(Rhodophyta): recognition of the Acrosymphytales ord. nov. and Sebdeniales ord. nov. Eur. J. Phycol. 41:379–384.

WYMAN, S. K., R. K. JANSEN, AND J. L. BOORE. 2004. Automatic annotation of organellar genomes with DOGMA. Bioinformatics 20:3252–3255.

YOON, H. S., K. M. MÜLLER, R. G. SHEATH, F. D. OTT, AND D. BHATTACHARYA. 2006. Defining the major lineages of red algae (Rhodophyta). J. Phycol. 42:482–492. ———, G. C. ZUCCARELLO, AND D. BHATTACHARYA. 2010. Evolutionary history and taxonomy of red algae. In: Red Algae in the Genomic Age, Cellular Origin, Life in Extreme Habitats and Astrobiology vol. 13, J. Seckbach and D.J. Chapman (eds.), Springer.

ZDOBNOV, E. M., AND R. APWEILER. 2001. InterProScan – an integration platform for the signature-recognition methods in InterPro. Bioinformatics 17(9):847–848.

Figure 3.1. Generalized phylogeny of Rhodophyta, following Yoon et al. (2006), indicating species examined in this study. Numbers of species are from AlgaeBase (Guiry and Guiry, 2013).

Figure 3.2. Map of the Grateloupia taiwanensis plastid genome. Colors indicate different gene classifications, as listed in Table 2.2.

Figure 3.3. Pairwise Mauve genome alignments of linearized plastid genomes for Grateloupia taiwanensis (set as reference) and related taxa: A, Gracilaria tenuistipitata var. liui; B, Porphyra purpurea; C, Pyropia yezoensis; D, Cyanidioschyzon merolae; E, Cyanidium caldarium. Colored boxes indicate locally collinear blocks (LCBs), which represent homologous gene clusters. LCBs below the horizontal line indicate reversals. Heights of vertical bars within LCBs indicate relative sequence conservation at that position.

Florideophyceae Bangiophyceae Cyanidiophyceae Grateloupia Gracilaria Porphyra Pyropia Cyanidioschyzon Cyanidium caldarium taiwanensis tenuistipitata var. liui purpurea yezoensis merolae strain 10D General characteristics Size (bp) 191,270 183,883 191,028 191,952 149,987 164,921 G+C (%) 30.6 29.2 33.0 33.1 37.6 32.7 Intergenic space (%) 18.1 15.5 15.3 15.9 9.3 10.5 Protein-coding genes Number of protein-coding genes 234 204 207 207 193 199 Unique gene annotations 35 13 0 0 4 15 Number of ribosomal proteins 47 47 47 46 46 45 Start codon usage (%) ATG 87.6 89.7 91.8 92.3 97.9 98.5 GTG 6.0 2.0 5.8 5.3 2.1 1.0 TTG 6.4 7.8 2.4 1.4 - 0.5 others - 0.5 - 1.0 - - RNAs Number of tRNAs 29 29 37 38 31 30 Number of rRNA operons 1 1 2 2 1 1 GenBank accession KC894740 AY673996 PPU38804 AP006715 AB002583 AF022186

Table 3.1. Characteristics of red algal plastid genomes analyzed in this study. Intergenic space is defined as any portion of the genome that does not bear a gene or RNA annotation.

Classification Number Genes Genetic systems Maintenance 2 dnaB rne RNA polymerase 5 rpoA rpoB rpoC1 rpoC2 rpoZ Transcription factors 4 ntcA ompR rbcR ycf29 Translation 4 infB infC tsf tufA Ribosomal proteins Large subunit 28 rpl1 rpl2 rpl3 rpl4 rpl5 rpl6 rpl9 rpl11 rpl12 rpl13 rpl14 rpl16 rpl18 rpl19 rpl20 rpl21 rpl22 rpl23 rpl24 rpl27 rpl28 rpl29 rpl31 rpl32 rpl33 rpl34 rpl35 rpl36 Small subunit 19 rps1 rps2 rps3 rps4 rps5 rps6 rps7 rps8 rps9 rps10 rps11 rps12 rps13 rps14 rps16 rps17 rps18 rps19 rps20 tRNA processing 1 tilS Protein quality control 4 clpC dnaK ftsH groEL Photosystems Phycobilisomes 12 apcA apcB apcD apcE apcF cpcA cpcB cpcG cpcS cpeA cpeB nblA Photosystem I 13 psaA psaB psaC psaD psaE psaF psaI psaJ psaK psaL psaM ycf3 ycf4 Photosystem II 19 psbA psbB psbC psbD psbE psbF psbH psbI psbJ psbK psbL psbN psbT psbV psbX psbY psbZ psb28 ycf12 Cytochrome complex 11 ccs1 ccsA petA petB petD petF petG petJ petL petM petN Redox system 7 acsF bas1 dsbD ftrB grx pbsA trxA ATP synthesis ATP synthase 8 atpA atpB atpD atpE atpF atpG atpH atpI Metabolism Carbohydrates 6 cfxQ odpA odpB pgmA rbcL rbcS Lipids 5 accA accB accD acpP fabH Nucleotides 2 carA upp Amino acids 8 argB gltB ilvB ilvH syfB syh trpA trpG Cofactors 4 chlI moeB preA thiG Transport Transport 9 cemA secA secG secY ycf16 ycf24 ycf38 ycf43 ycf63 Unknown Conserved ORFs 28 ORF58 ORF65 ORF83 ORF621 ycf17 ycf19 ycf20 ycf21 ycf22 ycf26 ycf33 ycf34 ycf35 ycf36 ycf37 ycf39 ycf40 ycf45 ycf46 ycf52 ycf53 ycf54 ycf55 ycf56 ycf60 ycf65 ycf80 ycf92 Unique ORFs 34 Gtai_orf01, Gtai_orf02, … , Gtai_orf34

Table 3.2. Genes found in the G. taiwanensis plastid genome.

trnW(CCA) trnM(CAT) trnM(CAT) trnV(GAC) trnV(GAC) trnA(GGC) trnA(GGC) trnY(GTA) trnY(GTA) trnC(GCA) trnG(GCC) trnH(GTG) trnL(GAG) trnR(ACG) trnV(TAC) trnV(TAC) trnA(TGC) trnA(TGC) trnD(GTC) trnF(GAA) trnL(CAA) trnR(CCG) trnS(GGA) trnS(CGA) trnS(CGA) trnT(GGT) trnT(GGT) trnG(TCC) trnL(TAA) trnL(TAG) trnN(GTT) trnQ(TTG) trnR(CCT) trnS(TGA) trnP(TGG) trnP(TGG) trnT(TGT) trnT(TGT) trnK(TTT) trnK(TTT) trnR(TCT) trnS(GCT) trnE(TTC) trnE(TTC) trnI(GAT) trnI(GAT)

Cyanidium caldarium 1 1 1 1 1 1 1 1 1 1 1 1 1 1 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Cyanidioschyzon merolae 1 1 1 1 1 1 1 1 1 1 1 1 1 1 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Porphyra purpurea 1 2 1 1 1 1 1 1 1 2 1 1 1 1 1 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Pyropia yezoensis 1 2 1 1 1 1 1 1 1 2 1 1 1 1 2 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Gracilaria tenuistipitata var. liui 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Grateloupia taiwanensis 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1

Table 3.3. tRNA sequences in red algal plastid genomes. Numbers indicate how many of each tRNA gene are present, while a blank indicates the gene’s absence.

Name Strand Start Stop Length (aa) InterPro terms and positions (aa) Gtai_orf01 + 70306 70428 40 Signal_peptide (1-38); transmembrane_regions (19-39) Gtai_orf02 - 70176 69994 60 Signal_peptide (1-26); transmembrane_regions (28-46) Gtai_orf03 + 69560 69697 35 Signal_peptide (1-16) Gtai_orf04 + 69168 69326 52 Signal_peptide (1-42); transmembrane_regions (22-40) Gtai_orf05 + 69026 69133 35 Signal_peptide (1-20) Gtai_orf06 - 68933 68727 68 Signal_peptide (1-36) Gtai_orf07 - 68371 68234 45 Signal_peptide (1-42); transmembrane_regions (21-41) Gtai_orf08 - 68273 68169 34 Signal_peptide (1-32); transmembrane_regions (12-32) Gtai_orf09 - 24162 23983 59 Signal_peptide (1-48); transmembrane_regions (37-57) Gtai_orf10 - 16593 16402 63 Signal_peptide (1-17); transmembrane_regions (34-52) Gtai_orf11 + 187730 187831 33 Signal_peptide (1-28) Gtai_orf12 + 186114 187463 449 RVT_N (12-94) Gtai_orf13 - 186082 185957 41 Signal_peptide (1-26) Gtai_orf14 - 185982 185860 40 Signal_peptide (1-26) Gtai_orf15 + 140795 140905 36 Signal_peptide (1-22) Gtai_orf16 - 140163 140044 39 Signal_peptide (1-23) Gtai_orf17 + 136471 136569 32 Signal_peptide (1-26) Gtai_orf18 - 101463 100945 172 Transmembrane_regions (43-63 and 84-104) Gtai_orf19 - 94129 93992 45 Signal_peptide (1-33); transmembrane_regions (15-37) Gtai_orf20 - 93893 93756 45 Signal_peptide (1-19) Gtai_orf21 - 93659 93558 33 Transmembrane_regions (14-32) Gtai_orf22 - 93209 93072 45 Signal_peptide (1-15); transmembrane_regions (5-25) Gtai_orf23 - 87274 87164 36 Signal_peptide (1-16); transmembrane_regions (9-29) Gtai_orf24 + 86893 87087 64 Signal_peptide (1-21); transmembrane_regions (23-43) Gtai_orf25 - 80539 80387 50 Transmembrane_regions (20-40) Gtai_orf26 + 80181 80324 47 Transmembrane_regions (14-34) Gtai_orf27 + 75209 75304 31 Signal_peptide (1-27) Gtai_orf28 + 75105 75194 29 Signal_peptide (1-23); transmembrane_regions (10-28) Gtai_orf29 + 74647 74787 46 Signal_peptide (1-32) Gtai_orf30 - 74186 74079 35 Signal_peptide (1-22); transmembrane_regions (14-34) Gtai_orf31 - 73946 73824 40 Signal_peptide (1-30); transmembrane_regions (15-37) Gtai_orf32 + 73194 73592 132 DUF1368 (17-121) Gtai_orf33 - 73063 72899 54 Signal_peptide (1-21); transmembrane_regions (4-22 and 31-51) Gtai_orf34 + 71228 71341 37 Signal_peptide (1-29); transmembrane_regions (15-35) Table 3.4. Positions, sizes, and domains of novel ORFs in the G. taiwanensis plastid genome.

The Mitochondrial Genome of Grateloupia taiwanensis (Halymeniaceae, Rhodophyta) and Comparative Mitochondrial Genomics of Red Algae

ABSTRACT

Although red algae are economically highly valuable for their gelatinous cell wall

compounds as well as being integral parts of marine benthic habitats, very little genome data are

currently available. We present mitochondrial genome sequence data from the red

alga Grateloupia taiwanensis S.-M. Lin & H.-Y. Liang. Comprising 28,906 nucleotide positions,

the mitochondrial genome contig contains 25 protein-coding genes and 24 transfer RNA genes. It

is highly similar to other red algal genomes in gene content as well as overall structure. An intron

in the cox1 gene was found to be shared by G. taiwanensis and Grateloupia angusta (Okamura)

S. Kawaguchi & H. W. Wang. We also used whole-genome alignments to compare G.

taiwanensis to different groups of red algae, and these results are consistent with the currently accepted phylogeny of Rhodophyta.

INTRODUCTION

Red algae (division Rhodophyta) are a monophyletic group of mostly multicellular photosynthetic eukaryotes. They occur primarily in tropical to temperate marine habitats, though

freshwater and extremophilic species are known. Currently around 7000 species of red algae

have been named, and the total number of red algal species on Earth has been estimated at

around 14,000 (Guiry, 2012). Economically, red algae are the source for agar and carrageenan,

industrially valuable hydrocolloids (Bixler and Porse, 2011); ecologically, red algae serve as

primary producers as well as providing microhabitats and substrates for other organisms.

On the tree of life, the red algae occupy a distinctive position, serving as a link between primary and secondary endosymbiosis. They bear plastids of primary endosymbiotic origin, having arisen after an ancient phagotrophic eukaryote engulfed a cyanobacterium. Consequently they are grouped with Viridiplantae (green algae and land plants) and Glaucophyta (glaucophytes, a small unicellular group) in the supergroup Plantae, all of which are characterized by primary plastids. In addition, they are the source of the secondary plastids found in the numerous “brown” algal lineages, such as heterokonts, cryptophytes, and dinoflagellates, although it is unclear exactly how the secondary plastid of red algal origin was inherited among these groups (Keeling,

2013). Red algae are a link between these primary and secondary endosymbiotic lineages, which

has allowed for many gene transfer events between these groups (Qiu et al., 2013). Thus,

genomic methods have been used to test various hypotheses regarding the inheritance of the “red”

secondary plastid (e.g., Baurain et al., 2010; Burki et al., 2012), necessitating a large amount of

sequence data for red algae as well as for other groups.

Red algal genomic research is progressing rapidly with increasing computational capacity

and falling sequencing costs. The first fully sequenced red algal genome, Cyanidioschyzon merolae P. De Luca, R. Taddei, & L. Varano (Matsuzaki et al., 2004), was shown to be highly

compact, with unusually low numbers of introns, transfer RNA genes, and ribosomal RNA genes

compared to other eukaryotes. These findings reflect the specialized ecological niche of C.

merolae, a unicellular extremophile found in very hot and acidic environments. Compact

genomes were also found in Porphyridium purpureum (Bory de Saint-Vincent) K. M. Drew & R.

Ross (Bhattacharya et al., 2013), Pyropia yezoensis (Ueda) M. S. Hwang & H. G. Choi

(Nakamura et al., 2013), and Chondrus crispus Stackhouse (Collén et al., 2013), suggesting that

the common ancestor of red algae lived in an extreme environment, which led to a reduction of

the genome that was subsequently inherited by its non-extremophilic descendants.

In addition, many red algal organellar genomes have been published in recent years.

These genomes are functional remnants of the original bacterial endosymbionts, retaining only a

few genes related to cellular respiration or photosynthesis in a single circular chromosome.

Genes that were not retained were either transferred to the nucleus via endosymbiotic gene transfer or simply lost (Timmis et al., 2004). The remaining mitochondrial and plastid genes are useful for studying organellar function as well as for phylogenetic analysis. Since next- generation sequencing technologies have become more accessible, many red algal genomics researchers have used these techniques to generate sequence data for organellar genomes

(e.g., Hwang et al., 2013; Campbell et al., 2014; S. Y. Kim et al., 2014). However, relative to the total number of red algae, few mitochondrial and plastid genomes have been sequenced, with many large taxonomic groups unrepresented.

At present, the phylogeny of Rhodophyta is unresolved at deep nodes. Molecular systematics studies of red algae, using single or several phylogenetic markers, have not produced an unambiguous topology, and the branching pattern is unclear at the class and ordinal levels, despite numerous studies dealing with this issue (Freshwater et al., 1994; Ragan et al.,

1994; Oliveira and Bhattacharya, 2000; Saunders and Hommersand, 2004; Yoon et al., 2006; Le

Gall and Saunders, 2007). The paucity of sequence data available for red algae is a major limiting factor for resolving the phylogeny, both in taxon sampling and character (i.e., marker) sampling. Next-generation sequencing technologies can generate very large amounts of sequence data in a short time, making them highly valuable in improving phylogenetic resolution for

Rhodophyta.

The current study presents mitochondrial genome sequence data from Grateloupia

taiwanensis S.-M. Lin & H.-Y. Liang, a mesophilic, multicellular benthic red alga that grows on

rocks in the shallow subtidal zone and has a disjunct distribution. It was first described in the

Pacific (Lin et al., 2008), but it was later identified as a non-native species in the Gulf of Mexico,

closely related to the aggressive invasive species Grateloupia turuturu Yamada (DePriest and

López-Bautista, 2012). More generally, the genus Grateloupia is used as food and in

pharmaceutical research, making Grateloupia an interesting target for future study. The plastid genome of G. taiwanensis was published by DePriest et al. (2013), who demonstrated patterns of gene retention and genome structure among red algal plastids. Similar methods are used in the current study to examine the mitochondrial genome of G. taiwanensis, synthesizing data from a selection of the 17 mitochondrial genomes previously available for red algae.

MATERIALS AND METHODS

Sample collection and DNA extraction

The Grateloupia taiwanensis specimen used in this study was collected in April 2011 from a jetty in Orange Beach, Alabama (30°16′27.6″N 87°33′34.0″W). A large portion of the thallus (approximately 60 cm2) was removed and preserved in silica gel for DNA extraction, and

the remainder was vouchered on a herbarium sheet and deposited in The University of Alabama

Herbarium. DNA was extracted from the silica-preserved sample using the QIAGEN DNEasy

Plant mini kit (QIAGEN, Valencia, CA). To maximize DNA yield, the large sample was

separated into eight pieces, and DNA was extracted from each piece individually. DNA samples

were then pooled for genome sequencing.

Whole-genome sequencing

Whole genomic DNA from G. taiwanensis was sequenced in the laboratory of Debashish

Bhattacharya (Rutgers University, New Jersey). The procedure for whole-genome sequencing of

this sample was described in DePriest et al. (2013): The sequencing library was prepared using

the Nextera DNA Sample Prep kit (Illumina, San Diego, CA) per the manufacturer's protocol

and sequenced on one-half lane of an Illumina Genome Analyzer IIX using the TruSeq SBS kit

v5 (Illumina) in a 150 × 150-bp paired-end run. The data were adapter- and quality-trimmed

(error threshold = 0.05, n ambiguities = 2) using CLC Genomics Workbench (CLC Bio, Aarhus,

Denmark) prior to de-novo assembly with the same software (automatic bubble size, minimum

contig length = 100 bp). The raw reads were then mapped to the assembly contigs (similarity =

90%, length fraction = 75%), and regions with no evidence of short-read data were removed.

Identification of mitochondrial genome

The assembly contained about 62.7 Mbp separated into 130,269 contigs. The N50

statistic, defined as the sequence length for which 50% of the total base pairs in the assembly are

contained in contigs at least as long, was 4703 bp. Despite the somewhat poor assembly results,

one contig of length 28,906 was identified as the mitochondrial genome, on the basis of several criteria. First, when the assembly was queried for known red algal mitochondrial genes using

BLAST (Altschul et al., 1997), the resulting significant hits (e ≤ 10−20) were found in this contig.

Second, the size of the contig (28,906 bp) is similar to the lengths of other red algal

mitochondrial genomes (Table 4.1). Third, multicellular red algae are known to have large numbers of mitochondria per cell (Garbary and Pei, 2006) and, therefore, many copies of the

mitochondrial genome per cell, causing relative enrichment of the mitochondrial genome in the

extracted DNA. Thus it is reasonable that the mitochondrial genome resolved as a single contig

after assembly.

Annotation of genes

The goal of annotation is to indicate the start and stop positions of genes, including

protein-coding genes, tRNAs, and rRNAs, in the mitochondrial genome. These data will be

compared between taxa in the analysis. The mitochondrial genome contig was then isolated from

the assembly, imported to Geneious R7 (Geneious, 2014), and set to represent a circular topology for visualization and genome comparison purposes only. To detect open reading frames

(ORFs), the Geneious ORF Finder was used. For the genetic code, the Mold/Protozoan

Mitochondrial option was selected; this codon translation scheme has been shown in red algae of the classes Florideophyceae and Bangiophyceae (Boyen et al., 1994; Leblanc et al.,

1995; Burger et al., 1999), but not Cyanidiophyceae (Ohta et al., 1998). Only one codon is different between the Standard genetic code and the Mold/Protozoan Mitochondrial code: in the

Standard code, the codon UGA is a “stop” codon, but in the Mold/Protozoan Mitochondrial code,

UGA codes for the amino acid tryptophan.

To determine which ORFs likely represented actual mitochondrial genes, the G. taiwanensis mitochondrial genome was aligned with that of Grateloupia angusta (Okamura) S.

Kawaguchi & H. W. Wang (S. Y. Kim et al., 2014), using the Mauve genome alignment ver.

2.3.1 (Darling et al., 2004) plugin in Geneious with the progressiveMauve algorithm (Darling et al., 2010) and default settings. Protein-coding gene annotations in G. angusta that corresponded to an ORF in G. taiwanensis were annotated on the G. taiwanensis mitochondrial genome. These annotations were confirmed with a BLAST search against the UniProtKB sequence database

(UniProt, 2014), with e ≤ 10−10 as the cutoff for a positive identification.

To find tRNA sequences, the mitochondrial genome sequence was submitted to the tRNAscan-SE ver. 1.21 server (Lowe and Eddy, 1997; Schattner et al., 2005). The tRNA annotations were then annotated on the genome. To locate ribosomal RNA sequences, rRNA sequences were extracted from the G. angusta mitochondrial genome and queried against the G. taiwanensis genome using BLAST; after finding the location of each gene, it was annotated.

Comparison with other mitochondrial genomes

Selected red algal mitochondrial genomes for comparison of gene content were downloaded from NCBI GenBank (https://www.ncbi.nlm.nih.gov/genbank/). Lists of gene annotations in Geneious were copied and compared manually. Names of apparently unmatched genes were checked by searching UniProt for the gene name and using the preferred name only, in order to avoid using multiple names for each species. Uncharacterized ORFs were not included.

Mauve genome alignment

Mauve genome alignments are useful because they show conserved regions and rearrangements in the genome between taxa. For this analysis, several Mauve alignments were performed using default settings, with several selected combinations of red algae, based on their taxonomic relationships: (1) G. taiwanensis and G. angusta; (2) G. taiwanensis and various

Rhodymeniophycidae—Chondrus crispus, Gelidium vagum Okamura, Gracilaria salicornia (C.

Agardh) E. Y. Dawson, and Rhodymenia pseudopalmata (J. V. Lamouroux) P. C. Silva; (3) G. taiwanensis and Sporolithon durum (Foslie) R. A. Townsend & Woelkerling, subclass

Corallinophycidae; (4) G. taiwanensis and Pyropia haitanensis (T. J. Chang & B. F. Zheng) N.

Kikuchi & M. Miyata, class Bangiophyceae; and (5) G. taiwanensis and Cyanidioschyzon merolae, class Cyanidiophyceae. To aid in visualization, the cox1 gene, a commonly used

phylogenetic and barcoding marker, was designated as position 1 of each circular genome, as

Mauve requires sequences to be linearized. Images of Mauve alignments were exported from

Geneious in PNG format and edited for publication.

RESULTS

General characteristics and gene content

The mitochondrial genome contig is 28,906-bp long and has a GC content of 31.4%. It includes 25 protein-coding genes, 24 tRNAs, and 2 rRNA subunits (Fig. 4.1). The Grateloupia taiwanensis mitochondrial genome is most similar to that of G. angusta and Chondrus crispus in these aspects (Table 4.1). Two introns were found in genes in the G. taiwanensis genome: one

in cox1 and one in trnI(GAT). A set of 20 named protein-coding genes (that is, excluding

uncharacterized open reading frames [ORFs]) is shared across all species in the analysis (Table

4.2). When considering only named genes, G. taiwanensis, G. angusta, and Gracilaria

salicornia are identical in gene content, containing the 20 “core” genes in addition to rpl20, rps11, secY, and ymf39. With minor differences, species of the subphylum

Eurhodophytina (containing Florideophyceae and Bangiophyceae) are mostly alike in

mitochondrial gene content. The mitochondrial genome of Cyanidioschyzon merolae, however,

contains 30 genes, including 6 that are not present in any of the Eurhodophytina.

Genomic structure and rearrangements

The genomes of G. taiwanensis and G. angusta are highly similar with no rearrangements

(Fig. 4.2); full bars represent higher similarity between the two genomes, and lower or absence

of bars represents lower or absent similiarity between the G. taiwanensis and G.

angusta mitochondrial genomes. Sequence similarity is consistent throughout, but a region of

reduced similarity can be observed roughly between positions 1800 and 3000 in the alignment

(all base pair positions given in this section refer to positions in the alignment, rather than positions in either genome). This region corresponds to the intron found in the cox1 gene. From

positions 21,108 to 21,859, G. taiwanensis was found to have a region including three additional

tRNA genes—trnY(GTA), trnR(TCT), and trnS(GCT); this region absent in G. angusta also

includes the gap created when the contig was circularized for representational purposes.

When compared to other members of subclass Rhodymeniophycidae (Fig. 4.3), G.

taiwanensis again appears highly similar. The group II intron shared by G. taiwanensis and G.

angusta in cox1 is now represented by a large gap, as this intron is not present in Chondrus

crispus, Gelidium vagum, Gracilaria salicornia, or Rhodymenia pseudopalmata. The three tRNA

genes found in G. taiwanensis but missing from G. angusta are also missing from these four

Rhodymeniophycidae species. A small region from bases 24,454 to 24,491 in Gelidium

vagum (18,420 to 18,454 reverse in Gracilaria salicornia) may be an alignment artifact and is

unlikely to represent homology, as this region occurs inside different genes between the two

species. Excluding this tiny block, the Mauve alignment resulted in three locally collinear blocks

(LCBs) shared across all five species, but no evidence of rearrangements was found.

Sporolithon durum, belonging to a different subclass (Corallinophycidae), is still highly similar

to G. taiwanensis (Fig. 4.4). The group II cox1 intron and the three additional tRNA genes of G.

taiwanensis are absent in S. durum as well. At position 21,163 in G. taiwanensis, a gap

corresponding to the G. taiwanensis orf172 is evident; this gene is not present in S. durum, which

has a different annotation, orf-Sdur34, immediately after this gap, at its position 21,621. These

two ORFs do not appear to be homologous.

Several rearrangements are evident between G. taiwanensis and Pyropia haitanensis

(class Bangiophyceae) (Fig. 4.5). The alignment recognized four LCBs, with three large-scale

rearrangements, indicated by the double-cut-and-join (DCJ) distance value of 3. The cox1 gene

contains many introns in P. haitanensis, indicated by gaps in the alignment inside this gene,

which is located in the LCB at position 1. Two intronic ORFs are found within the P.

haitanensis cox1 gene, but it is unclear whether either of these ORFs correspond to the one found

in G. taiwanensis. A small LCB located at position 32,540 in P. haitanensis (21,111 in G.

taiwanensis) contains two of the three tRNA genes—trnR(TCT) and trnY(GTA)—previously found in G. taiwanensis but none of the other Florideophyceae species. A region of genes from positions ∼30,500 to the end of the P. haitanensis genome, excluding the aforementioned small

LCB, is located outside any LCB. These genes are present in G. taiwanensis, but they are contained in the larger LCBs. This may indicate genome rearrangements of a small scale—that is, of single genes.

Between G. taiwanensis and Cyanidioschyzon merolae (class Cyanidiophyceae), the same number of rearrangements are apparent (Fig. 4.6), again with a DCJ distance of 3, but with five LCBs. The cox1 intron of G. taiwanensis is not present in C. merolae. A large gap region between positions ∼9,500 and ∼20,000 in C. merolae includes several genes that are not present in G. taiwanensis.

DISCUSSION

The mitochondrial genome of Grateloupia taiwanensis is typical of red algae, especially

Florideophyceae, in overall structure and characteristics. Red algal mitochondria seem to vary less in their genomes than in their plastids; however, these genomes are very different in size, with plastid genomes about five times larger than mitochondrial genomes. Larger genomes with more genes would hypothetically have more possibilities for gene losses and genome rearrangements, but a definitive conclusion on this topic cannot be drawn from these results.

On the other hand, the mitochondrial genome of Cyanidioschyzon merolae is very different from that of the other taxa in our analysis, being largest in size (32,211 bp) and containing the most protein-coding genes (34). It may seem counter-intuitive that an extremophilic organism with a highly reduced nuclear genome retains a relatively large mitochondrial genome. But this supports the hypothesis that the common ancestor of Rhodophyta was itself an extremophile, occurring in acidic hot springs as do present-day Cyanidiophyceae. Cyanidioschyzon merolae may possess many characteristics of this ancestor, including several mitochondrial

genes that are not present in other groups of red algae, as over time these genes have been either

lost or transferred out of the mitochondrion. However, of the seven classes of red algae, only

three (Cyanidiophyceae, Bangiophyceae, and Florideophyceae) currently have mitochondrial

genomes available, and the unrepresented classes are all phylogenetically placed between

Cyanidiophyceae and the others. Additional sequencing is necessary so that patterns of gene

retention may be further investigated.

Besides several additional tRNA genes found in Grateloupia taiwanensis, the

mitochondrial genome of G. taiwanensis is highly similar to that of Grateloupia angusta, which

would be expected of species belonging to the same genus. It should be noted, though,

that Grateloupia is a genus undergoing extensive taxonomic revision. Gargiulo et

al. (2013) split Grateloupia s.l. into several genera, on the basis of both morphological and

sequence data. This includes several resurrected taxa and some new genera, which the authors

intend to describe in a forthcoming paper. Grateloupia taiwanensis was not included in their

analysis, but considering previous phylogenetic analyses (Lin et al., 2008; DePriest and López-

Bautista, 2012), G. taiwanensis appears to belong to a clade that Gargiulo et al. (2013) suggest

should become a new genus based on Grateloupia subpectinata Holmes. Grateloupia

56 angusta does not belong to this clade, instead belonging to a clade corresponding to the genus Pachymeniopsis Y. Yamada ex S. Kawabata (Gargiulo et al., 2013). Therefore, although we refer to two species of Grateloupia in the current study, it is most likely that neither one actually belongs to Grateloupia s.s. In this case, the unique cox1 intron shared by these two species would have a wider taxonomic distribution than simply one genus, possibly present in the entire family or order.

We have demonstrated a simple set of methods for investigating a new organellar genome, from sequencing and annotation to large-scale comparisons among species. With the increasing popularity and efficiency of next-generation sequencing, many red algal organellar genomes have recently been quickly published in short papers simply to make the data available.

However, we have shown that a more in-depth characterization of a new organellar genome can produce scientifically interesting results, such as the differences in gene content between Grateloupia taiwanensis and Grateloupia angusta, with simple methods based on next- generation sequencing technology and publicly available software. Future genome sequencing efforts in red algae should focus on unsampled taxonomic groups so that the full potential of red algal organellar genomes can be revealed and allow for a better understanding of deeper phylogenomic relationships among red algal groups.

ACKNOWLEDGMENTS

This study was funded by the National Science Foundation (ATOL/DEB 0937978 and

ATOL/DEB 1036495) to JLB. Additional funding was provided by the Dean of the College of

Arts & Sciences, the Office of Research, the Graduate School, and the Department of Biological

Sciences at The University of Alabama. MSD would also like to express his gratitude to the 2013

E. O. Wilson Biodiversity Fellowship.

This work is reprinted with permission (Appendix 2) from The Biological Bulletin,

Volume 227, No. 2, pp. 191–200 (2014).

REFERENCES

ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHÄFFER, J. ZHANG, AND Z. ZHANG. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389–3402.

BAURAIN, D., H. BRINKMANN, J. PETERSEN, N. RODRÍGUEZ-EZPELETA, A. STECHMANN, V. DEMOULIN, A. J. ROGER, G. BURGER, B. F. LANG, AND H. PHILIPPE. 2010. Phylogenomic evidence for separate acquisition of plastids in cryptophytes, haptophytes, and stramenopiles. Mol. Biol. Evol. 27: 1698–1709.

BHATTACHARYA, D., D. C. PRICE, C. X. CHAN, H. QIU, N. ROSE, S. BALL, A. P. M. WEBER, M. C. ARIAS, B. HENRISSAT, P. M. COUTINHO, A. KRISHNAN, S. ZÄUNER, S. MORATH, F. HILLIOU, A. EGIZI, M.-M. PERRINEAU, AND H. S. YOON. 2013. Genome of the red alga Porphyridium purpureum. Nat. Commun. 4: 1941.

BIXLER, H. J., AND H. PORSE. 2011. A decade of change in the seaweed hydrocolloids industry. J. Appl. Phycol. 23: 321–335.

BOCK, R., M. LOHSE, AND O. DRECHSEL. 2007. OrganellarGenomeDraw (OGDRAW): a tool for the easy generation of high-quality custom graphical maps of plastid and mitochondrial genomes. Curr. Genet. 52: 267–274.

BOYEN, C., C. LEBLANC, G. BONNARD, J. M. GRIENENBERGER, AND B. KLOAREG. 1994. Nucleotide sequence of the cox3 gene from Chondrus crispus: evidence that UGA encodes tryptophan and evolutionary implications. Nucleic Acids Res. 22: 1400–1403.

BURGER, G., D. SAINT-LOUIS, M. W. GRAY, AND B. F. LANG. 1999. Complete sequence of the mitochondrial DNA of the red alga Porphyra purpurea: cyanobacterial introns and shared ancestry of red and green algae. Plant Cell 11: 1675–1694.

BURKI, F., N. OKAMOTO, J.-F. POMBERT, AND P. J. KEELING. 2012. The evolutionary history of haptophytes and cryptophytes: phylogenomic evidence for separate origins. Proc. R. Soc. B 279: 2246–2254.

CAMPBELL, M. A., G. PRESTING, M. S. BENNETT, AND A. R. SHERWOOD. 2014. Highly conserved organellar genomes in the Gracilariales as inferred using new data from the Hawaiian invasive alga Gracilaria salicornia (Rhodophyta). Phycologia 53: 109–116.

COLLÉN, J., B. PORCEL, W. CARRÉ, S. G. BALL, C. CHAPARRO, T. TONON, T. BARBEYRON, G. MICHEL, B. NOEL, K. VALENTIN, M. ELIAS, F. ARTIGUENAVE, A. ARUN, J.-M. AURY, J. F. BARBOSA-NETO, J. H. BOTHWELL, F.-Y. BOUGET, L. BRILLET, F. CABELLO-HURTADO, S. CAPELLA-GUTIÉRREZ, B. CHARRIER, L. CLADIÈRE, J. M. COCK, S. M. COELHO, C. COLLEONI, M. CZJZEK, C. DA SILVA, L. DELAGE, F. DENOEUD, P. DESCHAMPS, S. M. DITTAMI, T. GABALDÓN, C. M. M. GACHON, A. GROISILLIER, C. HERVÉ, K. JABBARI, M. KATINKA, B. KLOAREG, N. KOWALCZYK, K. LABADIE, C. LEBLANC, P. J. LOPEZ, D. H. MCLACHLAN, L. MESLET-CLADIERE, A. MOUSTAFA, Z. NEHR, P. N. COLLÉN, O. PANAUD, F. PARTENSKY, J. POULAIN, S. A. RENSING, S. ROUSVOAL, G. SAMSON, A. SYMEONIDI, J. WEISSENBACH, A. ZAMBOUNIS, P. WINCKER, AND C. BOYEN. 2013. Genome structure and metabolic features in the red seaweed Chondrus crispus shed light on evolution of the Archaeplastida. Proc. Natl. Acad. Sci. USA 13: 5247–5252.

DARLING, A. E., B. MAU, F. R. BLATTER, AND N. T. PERNA. 2004. Mauve: multiple alignment of conserved genomic sequence with rearrangements. Genome Res. 14: 1394– 1403.

———, ———, and N. T. Perna. 2010. progressiveMauve: multiple genome alignment with gene gain, loss, and rearrangement. PLoS One 5: e11147.

DEPRIEST, M. S., AND J. M. LÓPEZ-BAUTISTA. 2012. Sequencing of the rbcL marker reveals the nonnative red alga Grateloupia taiwanensis (Halymeniaceae, Rhodophyta) in Alabama. Gulf Mex. Sci. 2012: 8–13.

———, D. BHATTACHARYA, AND J. M. LÓPEZ-BAUTISTA. 2013. The plastid genome of the red macroalga Grateloupia taiwanensis (Halymeniaceae). PLoS One 8: e68246.

FRESHWATER, D. W., S. FREDERICQ, B. S. BUTLER, M. H. HOMMERSAND, AND M. W. CHASE. 1994. A gene phylogeny of the red algae (Rhodophyta) based on plastid rbcL. Proc. Natl. Acad. Sci. USA 91: 7281–7285.

GARBARY, D. J., AND Z. PEI. 2006. Mitochondrial dynamics in red algae. 3. Filament apices in Colaconema caespitosum (Acrochaetales) and Antithamnion cruciatum (Ceramiales). Algae 23: 323–332.

GENEIOUS. 2014. Bioinformatics software platform. [Online]. Available: http://www.geneious.com/ [2014, October 7].

GUIRY, M. D. 2012. How many species of algae are there? J. Phycol. 48: 1057–1063.

HWANG, M. S., S.-O. KIM, D.-S. HA, J. E. LEE, AND S.-R. LEE. 2013. Complete sequence and genetic features of the mitochondrial genome of Pyropia tenera. Plant Biotechnol. Rep. 7: 435–443.

KEELING, P. J. 2013. The number, speed, and impact of plastid endosymbioses in eukaryotic evolution. Annu. Rev. Plant Biol. 64: 583– 607.

KIM, K. M., E. C. YANG, J. H. KIM, W. A. NELSON, AND H. S. YOON. 2013. Complete mitochondrial genome of a rhodolith, Sporolithon durum (Sporolithales, Rhodophyta). Mitochondrial DNA. [Online]. Available: http://informahealthcare.com/doi/abs/10.3109/19401736. 2013.819500 [2014, October 7].

———, ———, G. YI, AND H. S. YOON. 2014. Complete mitochondrial genome of sublittoral macroalga Rhodymenia pseudopalmata (Rhodymeniales, Rhodophyta). Mitochondrial DNA 25: 273– 274. KIM, S. Y., E. C. YANG, S. M. BOO, AND H. S. YOON. 2014. Complete mitochondrial genome of the marine red alga Grateloupia angusta (Halymeniales). Mitochondrial DNA 25: 269–270.

LEBLANC, C., C. BOYEN, O. RICHARD, G. BONNARD, J. M. GRIENENBERGER, AND B. KLOAREG. 1995. Complete sequence of the mitochondrial DNA of the rhodophyte Chondrus crispus (Gigartinales). Gene content and genome organization. J. Mol. Biol. 250: 484–495.

LE GALL, L., AND G. W. SAUNDERS. 2007. A nuclear phylogeny of the Florideophyceae (Rhodophyta) inferred from combined EF2, small subunit and large subunit ribosomal DNA: establishing the new algal subclass Corallinophycidae. Mol. Phylogenet. Evol. 43: 1118–1130.

LIN, S.-M., H.-Y. LIANG, AND M. H. HOMMERSAND. 2008. Two types of auxiliary cell ampullae in Grateloupia (Halymeniaceae, Rhodophyta), including G. taiwanensis sp. nov. and G. orientalis sp. nov. from Taiwan based on rbcL gene sequence analysis and cystocarp development. J. Phycol. 44: 196–214.

LOWE, T. M., AND S. R. EDDY. 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25: 955–964.

MAO, Y., B. ZHANG, F. KONG, AND L. WANG. 2012. The complete mitochondrial genome of Pyropia haitanensis Chang et Zheng. Mitochondrial DNA 23: 344–346.

MATSUZAKI, M., O. MISUMI, T. SHIN-I, S. MARUYAMA, M. TAKAHARA, S.-Y MIYAGISHIMA, T. MORI, K. NISHIDA, F. YAGISAWA, K. NISHIDA, F. YAGISAWA, K. NISHIDA, Y. YOSHIDA, Y. NISHIMURA, S. NAKAO, T. KOBAYASHI, Y. MOMOYAMA, T. HIGASHIYAMA, A. MINODA, M. SANO, H. NOMOTO, K. OISHI, H. HAYSHI, F. OHTA, S. NISHIZAKA, S. HAGA, S. MIURA, T. MORISHITA, Y. KABEYA, K. TERASAWA, Y. SUZUKI, Y. ISHII, S. ASAKAWA,

H. TAKANO, N. OHTA, H. KUROIWA, K. TANAKA, N. SHIMIZU, S. SUGANO, N. SATO, H. NOZAKI, N. OGASAWARA, Y. KOHARA, AND T. KUROIWA. 2004. Genome sequence of the ultrasmall unicellular red alga Cyanidioschyzon merolae 10D. Nature 428: 653–657.

NAKAMURA, Y., N. SASAKI, M. KOBAYASHI, N. OJIMA, M. YASUIKE, Y. SHIGENOBU, M. SATOMI, Y. FUKUMA, K. SHIWAKU, A. TSUJIMOTO, T. KOBAYASHI, I. NAKAYAMA, F. ITO, K. NAKAJIMA, M. SANO, T. WADA, S. KUHARA, K. INOUYE, T. GOJOBORI, AND K. IKEO. 2013. The first symbiont-free genome sequence of the marine red alga, susabi-nori (Pyropia yezoensis). PLoS One 8(3): e57122.

OHTA, N., N. SATO, AND T. KUROIWA. 1998. Structure and organization of the mitochondrial genome of the unicellular red alga Cyanidioschyzon merolae deduced from the complete nucleotide sequence. Nucleic Acids Res. 26: 5190–5198.

OLIVEIRA, M. C., AND D. BHATTACHARYA. 2000. Phylogeny of the Bangiophyceae (Rhodophyta) and the secondary endosymbiotic origin of algal plastids. Am. J. Bot. 87: 482–492.

QIU, H., H. S. YOON, AND D. BHATTACHARYA. 2013. Algal endosymbionts as vectors of horizontal gene transfer in photosynthetic eukaryotes. Front. Plant Sci. 4: 366.

RAGAN, M. A., C. J. BIRD, E. L. RICE, R. R. GUTELL, C. A. MURPHY, AND R. K. SINGH. 1994. A molecular phylogeny of the marine red algae (Rhodophyta) based on the nuclear small-subunit rRNA gene. Proc. Natl. Acad. Sci. USA 91: 7276–7280.

SAUNDERS, G. W., AND M. H. HOMMERSAND. 2004. Assessing red algal supraordinal diversity and taxonomy in the context of contemporary systematic data. Am. J. Bot. 91: 1494–1507.

SCHATTNER, P., A. N. BROOKS, AND T. M. LOWE. 2005. The tRNAscanSE, snoscan and snoGPS web servers for the detection of tRNAs and snoRNAs. Nucleic Acids Res. 33: W686–W689.

TIMMIS, J. N., M. A. AYLIFFE, C. Y. HUANG, AND W. MARTIN. 2004. Endosymbiotic gene transfer: organelle genomes forge eukaryotic chromosomes. Nat. Rev. Genet. 5: 123–136. UniProt. 2014. UniProtKB sequence database. [Online]. Available: http://www.uniprot.org [2014, October 7].

YANG, E. C., K. M. KIM, G. H. BOO, J.-H. LEE, S. M. BOO, AND H. S. YOON. 2014. Complete mitochondrial genome of the agarophyte red alga Gelidium vagum (Gelidiales). Mitochondrial DNA 25: 267–268.

YOON, H. S., K. M. MÜLLER, R. G. SHEATH, F. D. OTT, AND D. BHATTACHARYA. 2006. Defining the major lineages of red algae (Rhodophyta). J. Phycol. 42: 482–492.

Figure 4.1. The Grateloupia taiwanensis mitochondrial genome. Functional categories are color coded.

Figure 4.2. Mauve genome alignment of G. taiwanensis and G. angusta linearized mitochondrial genomes.

Figure 4.3. Mauve genome alignment of linearized mitochondrial genomes of G. taiwanensis and other Rhodymeniophycidae.

Figure 4.4. Mauve genome alignment of G. taiwanensis and Sporolithon durum linearized mitochondrial genomes.

Figure 4.5. Mauve genome alignment of G. taiwanensis and Pyropia haitanensis linearized mitochondrial genomes.

Figure 4.6. Mauve genome alignment of G. taiwanensis and Cyanidioschyzon merolae linearized mitochondrial genomes.

Grateloupia Grateloupia Chondrus Gelidium Gracilaria Rhodymenia Sporolithon Pyropia Cyanidioschyzon taiwanensis angusta crispus vagum salicornia pseudopalmata durum haitanensis merolae Size (bp) 28,907 27,943 25,836 24,901 25,272 26,166 26,202 37,023 32,211 G+C (%) 29.9 30.2 28.9 30.4 28.4 29.5 28.4 30.7 27.2 Protein- 25 26 26 23 25 24 24 23 34 coding genes tRNAs 24 19 23 18 20 21 19 24 25 GenBank KC875853 NC_001677 KC875754 KF824534 KC875752 KF186230 JQ736808 NC_000887 Accession Reference This study S. Y. Kim et Leblanc et Yang et al. Campbell et K. M. Kim et al. K. M. Kim Mao et al. Ohta et al. al. (2013) al. (1995) (2013) al. (2014) (2013a) et al. (2012) (1998) (2013b)

Table 4.1. Characteristics of red algal mitochondrial genomes used in this study.

6 yejV yejV atp atp8 atp9 rps3 rps4 rps8 secY cox1 cox2 cox3 yejU nad1 nad2 nad3 nad4 nad5 nad6 rpl16 rpl16 rpl20 rps11 rps12 rps14 nad4l ymf16 ymf39 cob (cytB) sdh2 (sdhB) sdh3 (sdhC) ccmF (yejR) sdh4 (sdhD) ccmA (yejW) Grateloupia taiwanensis ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ● ● ● - - ● ● - ● ● ● ● - - - ● Grateloupia angusta ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ● ● ● - - ● ● - ● ● ● ● - - - ● Chondrus crispus ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ● ● ● - - ● ● - ● ● ● - - - ● ● Gelidium vagum ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ● - ● - - ● ● - ● ● ● ● - - - ● Gracilaria salicornia ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ● ● ● - - ● ● - ● ● ● ● - - - ● Rhodymenia ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ● - ● - - ● ● - ● ● ● ● - - - - pseudopalmata Sporolithon durum ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ● - ● - - ● - ● ● ● ● - - - ● Pyropia haitanensis ● ● ● - - ● ● ● ● ● ● ● ● ● ● ● ● - ● - - ● ● - ● ● ● - - - ● ● Cyanidioschyzon merolae ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● - ● ● - ●

Table 4.2. Comparison of named protein-coding genes in red algal mitochondria; presence is indicated by a dot, absence by a dash.

APPENDIX

1. Permission from Gulf of Mexico Science to reprint “Sequencing of the rbcL Marker Reveals the Nonnative Red Alga Grateloupia taiwanensis (Halymeniaceae, Rhodophyta) in Alabama”, Gulf of Mexico Science 30:7–13, by M. S. DePriest and J. M. Lopez-Bautista ...... 71

2. Permission from Biological Bulletin to reprint “The Mitochondrial Genome of Grateloupia taiwanensis (Halymeniaceae, Rhodophyta) and Comparative Mitochondrial Genomics of Red Algae”, The Biological Bulletin 227:191–200, by M. S. DePriest, D. Bhattacharya, and J. M. Lopez-Bautista ...... 72

71 Michael Depriest

Dissertation permission

Carol Schachinger Tue, Feb 24, 2015 at 3:33 PM To: "M. Scotty DePriest" Dear Mr. DePriest:

We are happy to grant you permission to re-use your article, "The Mitochondrial Genome of Grateloupia taiwanensis (Halymeniaceae, Rhodophyta) and Comparative Mitochondrial Genomics of Red Algae" Biol. Bull. 227(2):191-200, as part of your dissertation.

Please use the following acknowledgment to The Biological Bulletin as the place of original publication:

DePriest, M. S. et al. 2014. Biol. Bull. 227: 191-200. Reprinted with permission from the Marine Biological Laboratory, Woods Hole, MA.

Sincerely yours, Carol Schachinger

Managing Editor The Biological Bulletin Marine Biological Laboratory 7 MBL Street Woods Hole, MA 02543 U.S.A. ([email protected]) 508-289-7149 voice 508-289-7922 fax www.biolbull.org

From: "M. Scotty DePriest" < [email protected]> To: [email protected] Sent: Tuesday, February 3, 2015 1:30:10 PM Subject: Dissertation permission [Quoted text hidden]