Expression of a Retinoid-Inducible Tumor Suppressor, Tazarotene- Inducible Gene-3, Is Decreased in Psoriasis and Skin Cancer1

Vol. 6, 3249–3259, August 2000 Clinical Cancer Research 3249

Expression of a Retinoid-inducible Tumor Suppressor, Tazarotene- inducible Gene-3, Is Decreased in Psoriasis and Skin Cancer1

Madeleine Duvic,2 Bharati Helekar, Aggressive SCCs (median, 1.0) were lower in TIG-3 mRNA .(0.07 ؍ Claudia Schulz, Mimi Cho, Dan DiSepio, staining than nonaggressive SCCs (median, 1.5; P Carina Hager, Dominique DiMao, Three aggressive tumors had no TIG-3 mRNA staining. TIG-3 protein as shown by immunohistochemistry was high- Parul Hazarika, Brooke Jackson, est in the suprabasal epidermis of normal skin, just under Joan Breuer-McHam, John Young, the stratum corneum, and was decreased in basal and squa- Gary Clayman, Scott M. Lippman, mous cell carcinomas, similar to the mRNA staining. Reduc- Roshandra A. S. Chandraratna, tion in TIG-3 mRNA expression in psoriasis and basal car- Nancy A. Robinson, Anne Deucher, cinomas and loss in some aggressive SCCs support the hypothesis that TIG-3 may function as a tumor suppressor Richard L. Eckert, and Sunil Nagpal in both normal and malignant epidermal differentiation. Section of Dermatology, Department of Internal Medical Specialties [M. D., B. H., C. S., M. C., C. H., D. DiM., P. H., B. J., J. B-M., J. Y.], Department of Head and Neck Surgery [G. C.], Division of INTRODUCTION Cancer Prevention [S. M. L.], M. D. Anderson Cancer Center, The protective skin barrier arises from a tightly controlled Houston, Texas 77030; Allergan Research, Irvine, California 92612 genetic differentiation program resulting in keratinocyte apo- [D. DiS., R. A. S. C., S. N.]; and Department of Physiology/ Biophysics, Case Western Reserve, Cleveland, Ohio 44106 ptosis and stratum corneum formation (1, 2). Despite the fact [N. A. R., A. D., R. L. E.] that most keratinocytes undergo apoptosis, malignancies of keratinocytes (basal, SCC,3 or basosquamous cell carcinomas) commonly arise and are the most common malignancies in ABSTRACT humans (3). The molecular basis of some squamous carcinomas Tazarotene-induced gene-3 (TIG-3), isolated from hu- is related to mutations in p53 and in H-ras, induced by UV light man keratinocytes treated with the retinoic acid receptor- (4, 5). Mutations in genes of the sonic-hedgehog or patched selective retinoid Tazarotene, is homologous to H-rev, a class pathway have been implicated recently in the formation of II tumor suppressor. TIG-3 gene localized to chromosome BCCs, although phenotypic variation is complex (6–9). Many 11q23, a site of loss of heterozygosity in several malignan- other genes may contribute to the pathogenesis of skin cancers cies. Retinoids influence epidermal differentiation and are because of the complexity of the epidermal differentiation path- used to treat and prevent skin cancer. Therefore, we studied way and the need for chronic repair of DNA damage (10–12). TIG-3 mRNA expression in psoriasis and in basal and SCCs Benign epidermal hyperplasia may also result in the pres- by in situ hybridization and a quantitative QT-RT-PCR ence of a cutaneous inflammatory reaction, such as psoriasis, in assay. Psoriasis lesions had significantly lower staining (me- genetically susceptible individuals (13). The genetic programs controlling epidermal differentiation, although only partially ؍ dian, 3) than paired normal control skin (median, 4; P 0.012). TIG-3 mRNA was significantly higher in normal understood, are known to be regulated in part by steroid hor- ;in paired adjacent skin (median, 3; mones, including vitamin A (retinoids) and vitamin D (deltoids ,(0.001 ؍ control skin (P Ref. 14). Retinoids exert their effects in part through binding to ؍ and in overlying epidermis (median, 3.0; P ,(0.007 ؍ P 0.0001) than in 21 SCC specimens as a group (median, 1.5). differentially expressed RAR or retinoid X receptors (15–17). Retinoids and their receptors also interact with specific DNA transcription factors, including AP1, AP2, CBP300, and nuclear factor-interleukin 6, thought to regulate epidermal differentia- Received 9/3/99; revised 4/25/00; accepted 5/4/00. tion (18–21). The cytokine-inducible nuclear transcription fac- The costs of publication of this article were defrayed in part by the tor, nuclear factor-␬B, has also been implicated in control of payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to epidermal proliferation (22). Topical retinoid treatment is indicate this fact. known to alter the expression of epidermal keratin and other 1 This work was supported in part by a clinical research grant from differentiation markers (23). Allergan, by the Dermatology Foundation as a Fellowship sponsored by Retinoids are active clinically in psoriasis (24–26) and for Ortho Dermatological (to C. S.), and an American Society for Derma- tologic Surgery Dermatology Foundation Grant (to B. J.); by the NIH both chemoprevention and therapy of squamous carcinomas and Grants PO1-CA16672-22 (to M. D., G. C., S. L.), R21-CA74117 (to oral leukoplakia (27).). Tazarotene, a new synthetic RAR ␤,␥- B. H. and M. D.), the M. D. Anderson Cancer Center Core Grant CA16672, and The M. D. Anderson Skin Cancer Research Fund. This work was presented in part at the SID Meeting, Chicago, Illinois, May 5–8, 1999. 2 To whom requests for reprints should be addressed, at Section of 3 The abbreviations used are: SCC, squamous cell carcinoma; RAR, Dermatology, Box 28, M. D. Anderson Cancer Center, Houston, Texas retinoic acid receptor; BCC, basal cell carcinoma; ISH, in situ hybrid- 77030. Phone: (713) 745-1113; Fax: (713) 745-3597; E-mail: mduvic ization; TIG, Tazarotene-induced gene; QT-RT-PCR, quantitative real- @mdanderson.org. time PCR; BCE, basal cell epithelioma; IHC, immunohistochemistry.

selective retinoid, is effective topically for treatment of psoriasis normal adjacent skin for mRNA isolation were taken from and acne (28–30). Tazarotene treatment is associated with de- Moh’s surgery cases and snap frozen at Ϫ70°C (Table 2). All creased expression of epidermal genes overexpressed in psori- patients signed informed consent under approved protocols. asis, including type I keratinocyte transglutaminase, epidermal Specimens were fixed in 4% paraformaldehyde at 4°C for growth factor receptor, MRP-8, and scalp/elafin (29, 31, 32). In 16–24 h, processed in alcohol, and embedded in paraffin as addition, Tazarotene reduces the expression of inflammatory described previously (1, 11). Sections of 4 ␮m were mounted on markers including intercellular adhesion molecule-1 and sialinated, nuclease-free glass slides (CEL Associates, Houston, HLA-DR on cells in psoriasis lesions and increases the reex- TX) for in situ hybridization. pression of profilaggrin, a marker of terminal differentiation Preparation of Riboprobes. Plasmid (pAGN-TIG 3) (31, 33). Recently, a clinical study has suggested that topical containing a 600-bp 3Ј cDNA from TIG-3 was inserted in Tazarotene may induce remissions of basal cell carcinomas (34). reverse orientation in EcoRI in a PCRII vector. One ␮gof To understand the mechanism of action of Tazarotene and cDNA template was linearized with NotIorHindIII and tran- its effect on epidermal gene expression, novel TIG cDNAs were scribed using either Sp6 or T7 polymerase to yield antisense and isolated by differential display PCR from mRNA collected from sense riboprobes, respectively. The riboprobes were transcribed treated or mock-treated human keratinocytes (35–37). TIG-3 in the presence of UTP-digoxigenin using a Genius 4 kit, ac- (RANTES-3; Ref. 38), a cDNA of 736 bp, was induced 4-fold cording to the manufacturer’s instructions (Boehringer-Mann- in treated human keratinocyte cultures. The cDNA isolated heim, Indianapolis, IN) as described previously (44). The em-

predicted an Mr 18,000 protein of 164 amino acids with 52% pirical concentration of the probes was estimated using a dot homology to H-rev 107, a known class II tumor suppressor (39). blot method involving serial dilutions with a Dig DNA labeling H-rev 107 is down-regulated by ras transfection into rat fibro- and detection kit (Boehringer Mannheim). blasts, up-regulated in fibroblasts that spontaneously revert after ISH and Detection of Riboprobes. ISH was performed ras transfection, and is induced by IFN-␥ in astrocytes (40, 41). according to a modified procedure of Xu et al. (44). Deparaf- TIG-3 has been expressed with an inducible promoter causing finized and rehydrated tissue sections were washed in PBS (pH growth retardation in EcR-293 kidney cell lines (38). Similar 7.2), followed by 0.2 N HCl at room temperature for 10 min. studies done in a SCC line show growth inhibition by TIG-3 They were treated with proteinase K in 10 mM Tris and 2 mM 4 sense constructs in vitro. These studies suggest that the func- CaCl2 (pH 8.0) for 20 min at 37°C. After three washes in PBS, tion of TIG-3 is as a tumor suppressor (38). Of interest, TIG-3 sections were postfixed with 4% paraformaldehyde for 5 min at maps to chromosome 11q23 that has been reported previously to room temperature, washed three times in PBS, and acetylated at show loss of heterozygosity in a number of different tumors and pH 8.0. After a final PBS wash, sections were dehydrated in is suspected to contain a tumor suppressor (42, 43). ethanol and air-dried. Cell culture studies have shown that TIG-3 is up-regulated Prehybridization was carried out in a humidification cham- by all RAR-selective retinoids including Tazarotene and was in- ber in 50% deionized formamide, 2ϫ SSC solution, 2ϫ Den- ducible in keratinocytes and in the spontaneously transformed hardt’s solution (0.02% Ficoll 400, 0.02% polyvinylpyrrolidone, keratinocytes, the HaCat cell line (38). Psoriasis is a disease char- and 0.2% BSA), 10% dextran sulfate, 400 ␮g/ml yeast tRNA, acterized by rapid epidermal proliferation in response to T-cell 250 ␮g/ml salmon sperm DNA, and 20 mM DTT in diethyl inflammation, which is inhibited by topical Tazarotene (28). Thus, pyrocarbonate-treated water. Sense or antisense riboprobes we hypothesized that: (a) TIG-3 expression may also be associated added at 400 ng/ml were hybridized for4hat42°C. Posthy- with growth inhibition in normal as well as inflamed epidermis; bridization washes were in 2ϫ SSC and 0.1% SDS at room and (b) loss of TIG-3 expression could result in epidermal malig- temperature for 1 h and 40 min, followed by another wash with nancies. We examined the level and pattern of expression of TIG-3 0.1ϫ SSC and 0.1% SDS for 20 min at room temperature. Probe mRNA and protein as a putative tumor suppressor in normal skin, binding was detected using a Fab fragment of anti-digoxigenin compared with psoriasis and BCCs and SCCs. antibody and chromogen substrate solution (45 ␮l of nitroblue tetrazolium and 35 ␮l of 5-bromo-4-chloro-3-indolyl-phosphate MATERIALS AND METHODS solution in 10 ml of buffer 3 containing 10 mM Tris, 0.1 M NaCl, Patient Specimens. Skin biopsy specimens were taken and 50 mM MgCl2 pH 9.5). The color reaction was for 1 h. from unaffected, normal skin and from 29 psoriasis patients’ Analysis of in Situ Hybridization. The sections were lesions at baseline prior to their use of an investigational 0.1% graded for intensity by three blinded observers using a semi- Tazarotene gel and at 3 and 14 days of treatment. Aggressive quantitative scale (11, 31). Staining intensity was graded as 0 (n ϭ 11) and nonaggressive (n ϭ 10) SCCs and BCCs (n ϭ 6) (no staining), 1 (light blue, faint staining), 2 (blue staining), 3 of the skin and paired normal skin specimens from overlying (moderate staining, purple color, 4 (strong, very deep purple), and/or adjacent normal skin, as available, were obtained from and 5 (dark black staining obscuring the architecture). The data patients undergoing surgery in Dermatology Section and the did not fit a Poisson distribution and therefore were analyzed Department of Head and Neck Surgery, M. D. Anderson Cancer using nonparametric comparisons. Median scores were com- Center (Table 1). Additional specimens from BCCs, SCCs, and pared using Wilcoxon signed ranks or Mann-Whitney with an SSPS software package. IHC. IHC was performed on paraffin-embedded tissue sections from all tumors studied by ISH by methods described previously (11, 31). TIG ␦ C rabbit polyclonal antibody raised to 4 C. Schulz et al., manuscript in preparation. recombinant TIG-his tag protein was used as the primary antibody

Table 1 TIG-3 mRNA hybridization in SCC tumors compared with normal overlying or adjacent skin specimens Aggressive SCCs Differentiation TIG-3 levels compared with tumor Site/Metastasis Tumor no. Well Moderate Poor Overlying skin Adjacent skin ? 96-36569 ϩϪϪMarked patchy NAa increase Ear 96-34065A24 ϪϩϪ2-fold increase NA Parotid, LN, PN Upper lip, Cheek 96-38303A4 ϪϩϪ2.66-fold increase NA Ear 96-54304 ϪϩϪ2.33-fold increase NA ? 97-4570C13 ϪϩϪMarked increase NA Nose 96-39845A8 ϪϩϪ1.2-fold increase No change Scalp/skull, multiple tumors 96-41288A7 ϪϩϪ2-fold increase 1.5-fold increase Face, multiple tumors 96-51845A11 ϪϩϪNo change NA Infraorbital/PN 96-38787A1 ϪϪϩ2-fold increase NA Dermis/parotid, L, V 96-35269A21 ϪϪϩ2.33-fold increase NA Parotid/LN 97-38951E16 ϪϪϩNA NA Non-aggressive squamous cell carcinomas Elbow 96-05316A1 ϩϪϪ1.2-fold increase 1.4-fold increase Retroauricular 96-51337A2 ϩϪϪNo change No change Forehead 97-00664D2 ϩϪϪNo change 1.5-fold increase Ear 96-46239A6 ϪϩϪ1.25-fold increase 1.5-fold increase Forehead 97-09809A6 ϪϩϪ2-fold increase 2.66-fold increase Forehead 97-20557A3 ϪϩϪ1.2-fold increase 1.6-fold increase Nose 96-35773A6 ϪϪϩ1.5-fold increase 1.5-fold increase Forehead 97-53342A2 ϪϪϩ1.5-fold increase 2-fold increase Forehead 97-02450A1 ϪϪϩ1.5-fold increase 1.5-fold increase a NA, not available; LN, lymph node; PN, perineural invasion; L, lymphatics; V, vasculature.

at a dilution of 1:1000 and was detected with horse antirabbit bated at 50°C for 30 min and then terminated by incubation at secondary antibody at 1:100 using a Vector Stain ABC kit (Vector 72°C for 5 min. After reverse transcription, 1ϫ PCR buffer, 4 mM ␮ Labs, Burlingame, California). Preimmune rabbit serum (1:1000) MgCl2, 500 M deoxynucleotide triphosphates, 300 nM forward 5 was used as a negative control for TIG-3 antibody staining. and reverse primer, 100 nM fluorescent oligonucleotide probe, and QT-RT-PCR mRNA Analysis. Total RNA was ex- Taq polymerase were added to make a final volume of 50 ␮l. tracted from normal and tumor specimens (Table 2) using Trizol PCR was performed in an ABI 7700 Prizm Sequence reagent (Life Technologies, Inc., Gaithersburg, MD). Contam- Detector (Perkin-Elmer) with preheating at 95°C for 1 min, inating DNA was removed by DNase I treatment in 4 mM MgCl2 followed by 40 cycles of melting (95°C for 12 s) and annealing at 37°C for 30 min and then terminated at 72°C for 5 min. The and extension (60°C for 60 s). Dequenching of the fluorescent PCR primers (45F-CAAGAGCCCAAACCTGGAG and 111R hybridization probe was continuously monitored, and the Ct TATACAGGGCCCAGTGCTCAT) and fluorescent oligonu- (PCR cycles to threshold) were calculated using Sequence De- cleotide probe (65T-CCTGATTGAGATTTTCCGCCTTGGC) tector 1.6 software (Perkin-Elmer). Unknown RNA samples for the TIG-3 QT-RT-PCR assay were designed from the pub- were analyzed in triplicate with a control that lacked reverse lished sequence, accession no. AR060228 (38), using the Primer transcriptase (ϪRT control). Samples were run in parallel with Express software (Perkin-Elmer). Primers were purchased from 10-fold dilutions of mRNA from tumor line 22B HNSCC Integrative DNA Technologies (Coralville, IA). RNA samples (Ref. 45; 600 ng to 600 pg) and assigned arbitrary number of (100 ng) were reverse transcribed with SuperScript reverse molecules to generate a standard curve (Ct versus arbitrary RNA transcriptase (1 unit/␮l; Boehringer Mannheim) in a 20-␮l total template molecules). The number of template molecules in the volume reaction that included either Tig3 or 36B4 reverse samples were calculated by interpolation of the Ct against the ϫ primer (750 nM), 1 PCR buffer (Perkin-Elmer), 4 mM MgCl2, 22B HNSCC RNA standard curve. 36B4 mRNA was also and 500 ␮M deoxynucleotide triphosphates. The 36B4 forward measured by QT-RT-PCR and used to normalize as a standard, primer-AGATGCAGCAGATCCGCAT and reverse primer- using the primers described previously (46). ATATGAGGCAGCAGTTTCACCAG were used to amplify cDNA for 36B4 standard and detected with the probe-AGGCT- GTGGTGCTGATGGGCAAGAAC. The reaction was incu- RESULTS TIG-3 mRNA and Protein Is Expressed Highly in the Suprabasalar Epidermis and Adnexa of Normal Skin. If TIG-3 acts as a tumor suppressor and controls normal epithelial 5 R. L. Eckert, N. A. Robinson, and A. Deucher, manuscript in prepa- differentiation, then it would be expressed in normal epidermis. ration. The intensity of the antisense riboprobe staining was strongest

Table 2 Specimens from adjacent normal skin and tumors for QT-RT-PCR RNA measurements Patient no. Age/sex Diagnosis Sites of biopsies TIG-3 levels: normal vs. tumor 1 65 WM BCE Left back Similar to NLa skin 2 62 WM Well-differentiated SCC Nasal root Tumor Ͼ NL 3 70 WF BCE Left forehead Both low 4 77 WF Benign lichenoid keratosis Right leg Similar to NL control 5 61 WF BCC Right upper cheek Normal Ͼ tumor 6 66 WM SCC in situ Right upper cheek Both low 7 71 WM BCE Right preauricular Nl skin low BCE Left preauricular N1 skin low BCE Posterior neck N1 skin low a NL, normal; W, white; M, male; F, female.

by in situ hybridization throughout the epidermis, hair follicles, pared with untreated lesions by a quantitative assay (38). In the and sebaceous glands of normal control skin (Fig. 1, A and B). analysis done by considering responding and nonresponding In thinner epidermis of normal skin (Fig. 1, A and G), all layers patients together, the median staining intensities after Tazaro- stained strongly with the antisense probe. The sense probe tene treatment for 3 or 14 days, as judged by ISH, were not showed only faint background staining intensity (Fig. 1C). significantly different from baseline (Fig. 2). Where the epidermis was thicker, staining intensity was more TIG-3 Expression Is Significantly Decreased in Both pronounced in the suprabasal layers than in the basal layers in Basal and SCCs Compared with Adjacent and Overlying normal skin (Fig. 1B) and in hyperproliferative psoriatic epider- Normal Skin. BCCs and SCCs studied by ISH were derived mis (Fig. 1, H and I). from sun-exposed areas (except one case) from subjects be- Immunoreactive TIG-3 protein staining in the upper layers tween 50 and 80 years of age (Table 1). All except 2 patients of normal skin (Fig. 1, D and E) was similar to the pattern of the were males. SCCs of the skin were defined as aggressive if they mRNA seen by in situ hybridization (Fig. 1, A and B). TIG-3 were Ͼ2 cm in size, had neural invasion, and/or were metastatic protein was more restricted than the mRNA because it was most to regional lymph nodes. Aggressive tumors studied extended intense in the most well-differentiated layers of the normal into deeper structures including auricle, periauricular soft tis- suprabasal epidermis, just under the stratum corneum (Fig. 1, D sues, parotid glands, intraorbital nerves, scalp, nose, and intrapa- and E). The hair follicles, sebaceous glands, and small blood rotid lymph nodes. As indicated in Table 1, some tumors did not vessels of the dermis also stained prominently with TIG-3 have paired overlying or adjacent skin available to study. Non- antibody. The immunoreactivity was cytoplasmic in appearance aggressive tumors were restricted to scalp and superficial facial in keratinocytes. Preimmune rabbit serum gave only background tissues and were Ͻ2 cm in size. reactivity in normal skin (Fig. 1F). We examined the median intensity of TIG-3 mRNA in TIG-3 mRNA Expression Is Significantly Decreased in situ staining comparing normal skin from psoriasis patients Psoriatic Epidermis Compared with Paired Normal, Unin- as well as overlying and adjacent paired normal skin from volved Skin. Normal, uninvolved skin from psoriasis pa- skin cancer patients to their tumors (Fig. 2). As shown in tients was similar in intensity and pattern of mRNA staining Figs. 2–4, the median staining intensity of the TIG-3 anti- to normal controls without skin cancer in mRNA in situ sense probe was decreased in BCCs, basosquamous carcino- hybridization intensity (Fig. 1G). Psoriasis lesions prior to mas, and SCCss when compared with normal skin from psoriasis treatment (Fig. 1H) were severalfold thicker than normal skin patients and from paired tumor patients. Psoriasis control normal because of epidermal acanthosis and increased numbers of skin and paired adjacent normal suprabasalar layers of skin had suprabasalar keratinocytes. The intensity of staining for similar staining (median, 4.0). Both were significantly higher in TIG-3 antisense probe was reduced in the basal layers of TIG-3 mRNA staining than basal cell carcinomas (median, 1.33; psoriasis lesions (Fig. 1H) compared with normal control P ϭ 0.045, Mann-Whitney; n ϭ 6). BCCs studied by ISH showed skin (Fig. 1G). As shown in Fig. 2, normal, uninvolved paired reduction in TIG-3 mRNA staining in the tumor that was similar to skin from 30 psoriasis patients (median, 4.0) had signifi- the normal overlying basal cell layer (Fig. 3A). IHC staining cantly more intense TIG-3 antisense staining than the basal intensity in the suprabasal layer of adjacent skin (Fig. 3B) was and suprabasal layers of psoriasis lesions (median, 3.0; P ϭ higher than in the basal layer of normal skin and in basal cell 0.012, Wilcoxon signed ranks test). Suprabasal TIG-3 stain- carcinomas shown in Fig. 3, D and E. Normal skin showed no ing was more intense in paired, uninvolved normal skin specific reactivity with preimmune serum and secondary antibody specimens compared with baseline psoriasis lesions in 16 of (Fig. 3C). 30 patients’ lesions examined, was less intense in 4, and did The staining intensity of the TIG-3 antisense riboprobe by not differ by more than 1 degree in 10 patients. ISH was also significantly higher in normal skin specimens Pooled mRNA had been analyzed previously from lesions from all sources, compared with all SCCs as a group. As shown in this clinical study from the 15 responding patients who had in Fig. 2, TIG-3 mRNA staining was stronger in normal skin from Ͼ50% decrease in plaque elevation by 8 weeks (38). In the psoriasis controls (median, 4.0; P ϭ 0.001), in normal skin over- responders, topical Tazarotene gel application was associated lying SCCs (median, 3.0; P ϭ 0.0001), and in the adjacent skin to with increased levels of total TIG-3 mRNA transcripts as com- SCCs (median, 3.0; P ϭ 0.007) compared with staining intensity in

Fig. 1 TIG-3 mRNA and protein levels are high in normal skin and reduced in psoriasis lesions. TIG-3 mRNA was detected in paraffin-embedded specimens of skin by ISH, using digoxigenin-labeled cRNA probes (Boehringer Mannheim) and antibody to digoxigenin (35, 44). TIG-3 immunoreactivity was assayed using a rabbit polyclonal antibody raised to recombinant TIG-3 protein at a dilution of 1:1000 and was detected by horse antirabbit secondary antibody with a Vector Stain ABC kit (Vector Laboratories, Burlingame, CA). A, normal skin specimen shows dense purple signal in epidermis, hair follicles, and sebaceous glands with antisense probe (ϫ40). B, high power view of epidermis from normal skin specimen adjacent to tumor with ISH signal to antisense probe (ϫ400). C, normal skin specimen by in situ hybridization to sense riboprobe as negative control (ϫ100). D, normal skin from patient without skin cancer stained with antibody to TIG-3 protein (1:1000) detected with horse antirabbit IgG (1:100; ϫ40). E, specimen in D at high magnification (ϫ100). F, specimen in D stained with preimmune rabbit serum (1:1000) and detected with horse antirabbit secondary antibody (1:100) as negative control (ϫ100). G, ISH of normal unaffected skin from a psoriasis patient before treatment with antisense riboprobe probe (ϫ100). H, same patient’s psoriasis lesion at baseline, antisense probe (ϫ100). I, psoriasis lesion from G at day 3 of Tazarotene application, antisense probe (ϫ100).

21 aggressive and nonaggressive SCC specimens as a group (me- The variation in staining intensities found in normal skin dian, 1.5). Examples of aggressive SCCs shown in Fig. 4 had either overlying both aggressive and nonaggressive SCC tumors, from overlying or adjacent normal skin. Aggressive SCCs were Ͼ2cm which the tumors arose, was greater than the variation seen in and had neural invasion or metastasis to parotid gland or regional normal control skin as well as in adjacent skin (Fig. 2). Fig. 4 lymph nodes. For this reason, they were not always available with shows examples of overlying normal skin with high TIG-3 (B normal adjacent or overlying skin (Table 1). and D), moderate TIG-3 (A), and low TIG-3 (E, L) mRNA All SCC specimens were studied both by ISH and by IHC. staining. Pseudoepitheliomatous hyperplasia found in two tu- There is reduced TIG-3 mRNA signal in SCC tumors compared mors (D and E) could be either high or low in staining intensity. with overlying normal skin with higher expression in adjacent Adjacent skin at a distance from tumors (Fig. 4, G, I, and K) skin. All tumors showed correlation in the levels of mRNA showed very strong TIG-3 mRNA and protein staining as a rule, staining and TIG-3 protein reactivity. (Examples of specimens but the intensity was decreased at the site where tumors arose studied by both techniques are found in Fig. 4, B and C, E and (Fig. 4, G–J and K–N). The mRNA and protein staining patterns F, I and J, M and N). We did not quantitate the IHC staining but were similar, as shown. found it to be at least 2-fold or greater in the suprabasal epider- TIG-3 Expression Is Less in Aggressive SCCs Com- mis than in tumor specimens. The most highly differentiated pared with Nonaggressive SCC Tumors. The median stain- areas of keratin pearls were highest in both TIG-3 mRNA and ing intensity in 11 aggressive SCCs (median, 1.0) was also protein (Fig. 4, H, M, and N). decreased compared with 10 nonaggressive SCCs (median,

Fig. 2 Median values of staining intensity of ISH antisense TIG-3 riborobes; normal skin is higher than psoriasis lesions and SCCs. Paired normal skin, psoriasis lesions, and tumors mRNA staining intensities were graded in the suprabasal epidermis or in the tumor using a semiquantitative scale of 0–5 with 0.5 increments: 0, no staining; 1, faint; 2, light; 3, moderate; 4, dark; and 5, most intense, black dense staining. Wilcoxon signed ranks of related or independent variables were performed on nonparametric data from each group. Comparisons are shown as standard box plots of each group: psoriasis patients’ normal skin (black hatch), and lesions at baseline (PsL0), after 3 days of Tazarotene (PsL3), and at day 14 of therapy (PsL14, white boxes) are at the left side. Skin cancer specimens of normal overlying skin (nl_over) and nonaggressive SCC (nl_nonaggr) are shown by gray hatched boxes in middle. All SCCs (Scc_all), aggressive SCCs (SCC_agg), and nonaggressive SCCs (SCC_nagg) are indicated at the right side with gray boxes. The black horizontal bars within the boxes represent the median values for ISH staining intensities. The X axis shows the number of specimens analyzed in each group. The Y-axis shows the intensity of mRNA staining intensity from 0 to 5. The boxes surrounding the medians indicate the values falling between the 25th and 75th percentiles. Ranges are shown by the vertical bars. Outliers, shown by circles, are included in calculation of the medians.

1.5; P ϭ 0.038, Mann-Whitney; Fig. 2). Ten of 11 aggressive imens taken at the time of Moh’s surgery (Table 2; Fig. 5). SCC versus 7 of 10 nonaggressive SCCs showed decreased TIG-3 mRNA levels from triplicate samples of reverse-tran- TIG-3 mRNA ISH signals compared with paired normal skin. scribed mRNA were normalized to 36B4. Two specimens from All tumors studied showed reduced TIG-3 mRNA and protein normal abdomen skin of patients without skin cancer (Fig. 5, A staining compared with normal control donor skin specimens. and B) were similar and showed highest TIG-3 mRNA levels, Three aggressive SCCs and a metastatic SCC lesion to the similar to the levels measured in HaCat keratinocytes (not lymph node had no staining present for TIG-3 mRNA, sug- shown). High levels of TIG-3 mRNA were also found in one gesting that complete loss of gene expression may have occurred. very well-differentiated SCC (patient 2) and in a lichenoid In three nonaggressive SCCs, overlying skin and tumor were sim- actinic keratosis with epidermal acanthosis (patient 4). A small, ilarly both reduced (compared with normal skin). Two of these well-localized BCE on the infraorbital cheek had reduced TIG-3 three tumors were interpreted by the pathologist as well-differen- transcripts compared with the normal adjacent skin specimen tiated, and the third was poorly differentiated. (patient 5). Similar to the in situ findings, three patients had low Development of QT-RT-PCR Assay to Measure TIG-3 TIG-3 levels in both tumor and adjacent normal skin. Patient 7, mRNA Transcripts. A quantitative fluorescent real time QT- with lowest TIG-3 in normal adjacent skin, also had multiple RT-PCR assay (47) was developed to measure TIG-3 mRNA facial basal cell carcinoma occurring in the setting of severe, transcripts in paired patient specimens (Table 2). The cDNA for extensive photodamage over the whole area. 36B4, encoding a ribosomal protein, was used to normalize levels of TIG-3 mRNA, expressed as a ratio. Levels of TIG-3 mRNA transcripts were determined from two samples of nor- DISCUSSION mal, non-sun-exposed abdominal skin from patients without TIG-3 (RANTES-3) is a newly described, retinoid-inducible cancer and from 7 skin tumors with paired adjacent skin spec- putative tumor suppressor that was isolated from Tazarotene-

Fig. 3 TIG-3 staining is higher in suprabasalar normal skin than in BCCs. A, BCC with overlying skin studied by ISH, as described in Fig. 1, using antisense riboprobe (ϫ100). B, normal skin adjacent to BCE showing TIG-3 protein by IHC, as in A,in epidermis and dermal vessels (ϫ40). C, same section as B, with preimmune serum as negative control (ϫ40). D, diffuse BCC in dermis stained with antibody to TIG-3 (ϫ100). E, well-demar- cated nodule of BCE with adjacent normal skin stained with TIG-3 antibody (ϫ100).

treated keratinocytes. TIG-3 has been shown to inhibit cellular Treatment of hyperproliferative psoriasis lesions with top- proliferation when expressed and is associated with retinoid ical Tazarotene gel induces 4-fold increased expression of responsiveness in malignant cell lines in vitro (38). This study TIG-3 mRNA in epidermis of responding patients compared shows for the first time that TIG-3 mRNA and protein expres- with pretreatment levels (38). In psoriasis lesions, inflammation sion are significantly reduced in basal and SCCs arising from is present that affects epidermal differentiation, and the skin is able sun-exposed skin, compared with normal skin. Lower TIG-3 to normalize after topical retinoid therapy (28, 33). Up-regulation mRNA and loss of expression are seen in aggressive SCCs of TIG-3 expression may be part of the normalization process, and compared with nonaggressive SCCs in this study. low TIG-3 expression may contribute to the increased rate of The highest levels of TIG-3 mRNA by ISH and TIG-3 epidermal proliferation that characterizes psoriasis (48). protein by IHC are found within the normal suprabasal epider- Recently, topical Tazarotene gel treatment has also been mis, hair follicles, and sebaceous glands. TIG-3 in normal skin shown to induce clinical remission of 47% of basal cell carci- may be, therefore, associated with terminal keratinocyte differ- nomas treated over a period of months (34). Whereas loss of entiation and growth arrest occurring in the suprabasal layers. In TIG-3 may be an important event leading to skin cancer, ex- hyperproliferative epidermis, as in psoriasis lesions and overly- pression of TIG-3 in suprabasalar epidermis may help to regu- ing SCCs, TIG-3 mRNA by ISH and protein by IHC are reduced late normal terminal differentiation. TIG-3 mRNA levels are relative to skin of normal thickness. highest in normal skin and differed significantly between non-

Fig. 4 Expression of TIG-3 mRNA by ISH and protein by IHC is reduced in paired adjacent and overlying normal skin compared with SCCs. Specimens were studied as in Fig. 1 by either ISH or IHC. A, moderately well-differentiated, aggressive SCC in dermis with normal overlying skin by ISH (ϫ40). B, moderately well-differentiated, aggressive SCC (34065) in dermis with normal overlying skin by ISH (ϫ40). C, same tumor B by IHC with normal epidermis to left, perpendicular to the base of photo and tumor nodules to the left (ϫ40). D, moderately well-differentiated aggressive SCC (38303) from face studied by ISH. Tumor is throughout the dermis with pseudoepithelomatous hyperplasia in overlying normal skin (ϫ40). E,

aggressive SCC is also confirmed by IHC. Analysis of the TIG-3 promoter, coding sequences, and gene sequences will be required to understand the basis of this finding. Loss of heterozygosity in tumors reflects deletion of a large portion of the genomic DNA containing one allele and should be associated with a 50% reduction of the mRNA transcripts. Complete inactivation of a tumor suppressor requires that the second allele also acquire a second mutation within the tumor tissue. It is possible that inactivation of both copies of TIG-3 may be associated with the development of more aggressive skin cancers, and this would agree with studies demonstrating loss of chromosome 11q23 in head and neck SCCs (55). In contrast, mutations may be subtle and may arise without con- Fig. 5 QT-RT-PCR measurement of TIG-3 mRNA transcripts in normal skin and tumor specimens. Total RNA was prepared from fresh skin sistently altering mRNA levels (56). Loss of TIG-3 expression samples from tumor and paired normal skin taken from surgery cases may also result from mutations or small deletions in the retinoid (Table 2). One hundred ng of mRNA were reverse transcribed with response elements (38) or hypermethylation of the gene’s pro- reverse transcriptase. Triplicates were subjected to PCR using forward moter. More direct measures of mRNA levels, such as the and reverse primers with a fluorogenic primer. The release of the fluorescence by 5Ј nuclease activity was measured in real time using an QT-RT-PCR assay we report, and sequence information are ABI 7700 prism sequence detector. TIG-3 signals were normalized ultimately required to understand the importance of tumor sup- against the standard 36B4, and the graphs represent the ratios. Columns pressors in carcinogenesis. ISH localized mRNA expression A and B, TIG-3 mRNA levels from normal abdominal skin taken from within tumor specimens, but it is only semiquantitative. surgery in two older patients without skin cancer. Paired normal and tumor samples were compared from seven patients undergoing surgery Basal cell carcinomas, generally nonaggressive, localized in Table 2. Normalized values for TIG-3: f, in normal skin; and ,in tumors arising from differentiated hair follicle keratinocytes, tumors. express levels of TIG-3 similar to the basal layer of normal epidermis. In keeping with the hypothesis that TIG-3 is a tumor suppressor, basal layers have less TIG-3 mRNA and protein than aggressive and aggressive SCCs. Therefore, with further inves- more differentiated epidermal layers. A quantitative, sensitive tigation, TIG-3 may become the first molecular marker of ag- QT-RT-PCR assay was developed to measure TIG-3 transcripts gressiveness and of retinoid action during treatment or within specimens. By this assay, normalized TIG-3 mRNA chemoprevention studies. These new data support the rational of levels are 2–4-fold higher in normal non-sun-exposed skin from using retinoids for both prevention and treatment of skin cancer. controls without cancer than in normal skin adjacent to three TIG-3 is homologous to a class II tumor suppressor found basal cell carcinomas and one SCC. One BCE and one SCC in H-ras revertant lines, H-rev 107 (40, 49). TIG-3 mapped to showed only slightly lower levels, and one very well-differen- chromosome 11q23, which has long been hypothesized to con- tiated, nonaggressive SCC was 3-fold increased in tumor com- tain a tumor suppressor (38). This region has shown loss of pared with normal skin. In these studies, there was no opportu- heterozygosity and poor prognosis in cancers of the head and nity to study mRNA transcripts in aggressive SCCs and no neck, melanoma, cervix, breast, lung, and ovarian malignancies mechanism to control for the relative amount of tumor and and also leukemias, lymphomas, and rhabdomyosarcomas (38, normal skin contributing material to total mRNA transcript 42, 43, 50–54). With respect to head and neck tumors, 25% pools. Microdissection may be required to dissociate tumor showed loss of heterozygosity at 11q23 with a significant asso- specimen from normal skin. Increased TIG-3 mRNA levels may ciation with persistent or recurrent disease after radiation (55). be measured from a large tumor mass, even if the relative levels The expression of TIG-3 mRNA in most aggressive SCC tumors are low, in comparison with normal skin. is reduced by at least 50% compared with paired specimens of Overlying normal skin has more variable expression of adjacent or overlying normal skin by in situ hybridization stud- TIG-3 compared with adjacent skin specimens; therefore, we ies, suggesting that loss of heterozygosity may be present. All also used normal skin specimens from psoriasis patients as 11 aggressive SCC tumors have markedly reduced TIG-3 ex- controls. Skin overlying tumors may have low TIG-3 mRNA by pression levels compared with overlying or adjacent normal ISH and low protein by IHC. In some SCCs where the point of skin. In three aggressive skin tumors, one a metastasis to node, tumor origin was present, the normal skin at the tumor origin has TIG-3 mRNA expression is absent. Loss of TIG-3 protein in low TIG-3 staining. These observations, although preliminary,

poorly differentiated aggressive SCC (38787) of the infraorbital area studied by ISH. Overlying skin shows decreased TIG-3 and pseudoepithelomatous hyperplasia (ϫ40). F, same tumor as in E by IHC (ϫ40). G, moderately well-differentiated aggressive SCC (412288) by ISH shows normal adjacent skin to left, take off point to tumor (middle) and tumor mass (left; ϫ40). H, same patient, SCC in dermis by ISH. Keratin pearls are present in dermis (ϫ40). I, same patient with BCC next to normal epidermis and hair follicle (left) by ISH (ϫ40). J, same section by IHC with TIG-3 antibody (ϫ40). K, ISH of normal adjacent skin with hair follicle in patient with tumor (39845) that is shown in L–N (ϫ40). L, ISH of normal overlying skin and moderately well-differentiated SCC (39845; ϫ40). M, same tumor by ISH (ϫ40) showing normal adjacent skin (left) and point of tumor origin middle (ϫ40). N, same tumor section as M, by IHC (ϫ40).

do suggest that loss of TIG-3 in normal skin may be associated 5. Glick, A. B., Sporn, M. B., and Yuspa, S. H. Altered regulation of with the development of SCC tumors. The QT-RT-PCR assay TGF-B1 and TGF-␣ in primary keratinocytes and papillomas expressing showed that TIG-3 mRNA transcripts are low in both the per- v-Ha-ras. Mol. Carcinog., 4: 210–219, 1991. 6. Gailini, M. R., Bale, S. J., Leffell, D. J., DiGiovanna, J. J., Peck, G. ilesional photodamaged skin and in several basal cell carcino- L., Poliak, S., Drum, M. A., Pastakia, B., McBride, O. W., Kase, R., et mas. One patient with SCC had low TIG-3 mRNA both in normal al. Developmental defects in Gorlin syndrome related to a putative skin and tumor by QT-RT-PCR. If TIG-3 is lost or reduced in tumor suppressor gene on chromosome 9. Cell, 69: 111–117, 1992. overlying normal skin, there could be a field effect, as reported for 7. Ananthaswamy, H. N., Loughlin, S. M., Cox, P., Evans, R. L., loss of p53 both in sun-damaged skin and resulting tumors (57, 58). Ullrich, S. E., and Kripke, M. L. Sunlight and skin cancer: inhibition of p53 mutations in UV-irradiated mouse skin by sunscreens. Nat. Med., 3: Mutations in p53 are reported in 90% of SCCs and 50% of basal 510–514, 1997. cell carcinomas and result from UV light-induced pyrimidine- 8. Quinn, A. G., Campbell, C., Healy, E., and Rees, J. L. Chromosome cytosine photoproducts (57). Whether these types of changes and 9 allele loss occurs in both basal and squamous cell carcinomas of the this kind of frequency will also be found in skin cancers with skin. J. Investig. Dermatol., 102: 300–303, 1994. respect to TIG-3 is not yet determined. 9. Wiching, C., Shanley, S., Smyth, I., Gillies, S., Negus, K., Graham, Heterogeneity of mRNA expression is present in some S., Suthers, G., Haites, N., Edwards, M., Wainwright, B., and Chenevix- tumors, especially when there was mixed differentiation. This was Trench, G. Most germ-line mutations in the nevoid basal cell carcinoma syndrome lead to a premature termination of the PATCHED protein, confirmed using IHC showing high TIG-3 within areas of kerati- and no genotype-phenotype correlations are evident. Am. J. Hum. nization (keratin pearl formation). Heterogeneity in TIG-3 expres- Genet., 60: 21–26, 1997. sion and ability to be induced by retinoid treatment might help to 10. Scott, R. E., Wilke, M. S., Wille, J. J., Pittelkow, M. R., Hsu, B. M., explain the clinical heterogeneity in response to retinoids. and Kasperbauer, J. L. Human squamous carcinoma cells express com- It is well known that retinoids may prevent or retard the plex defects in the control of proliferation and differentiation. Am. J. growth of some SCCs, although the mechanisms are not well Pathol., 133: 374–380, 1988. established (27, 59, 60). Whereas loss of heterozygosity at the 11. Duvic, M., Chema, D., Annarella, M., Cho, M., Esgleyes-Ribot, T., chromosome 11q23 region has been found in 25% of recurrent Remenyik, E., Ulmer, R., Rapini, R., Sacks, P. G., Clayman, G. L., SCCs of the head and neck, no specific gene has been implicated Davies, P. J. A., and Thacher, S. Keratinocyte transglutaminase expres- until now (55). On the basis of these new data, TIG-3 is a lead sion varies in squamous cell carcinomas. J. Investig. Dermatol., 102: candidate tumor suppressor explaining loss of heterozygosity at 462–469, 1994. this locus. Irreversible loss or decrease in TIG-3 mRNA and 12. Alkemade, H. A. C., Molhuizen, H. O. F., Vlijmen-Wilems, M. J. J., protein in SCCs may be associated with more aggressive tu- Haelst, U. J. G. M., and Schalkwijk, J. Differential expression of mors, loss of retinoid response, and ultimately tumor progres- SKALP/elafin in human epidermal tumors. Am. J. Pathol., 143: 1679– sion or invasion. Mutations in TIG-3 that alter its function could 1687, 1993. also occur without influencing the mRNA levels. It should be 13. Baker, B. S., and Fry, L. The immunology of psoriasis. Br. J. noted that the expression of TIG-3 is significantly lower in Dermatol., 126: 1–9, 1992. aggressive compared with nonaggressive SCCs, unlike DNA 14. Aneskievich, B. J., and Fuchs, E. Terminal differentiation in kera- repair or p53 mutations (58, 61). TIG-3 is thus a possible tinocytes involves positive and negative regulation by retinoic acid biomarker for distinguishing between nonaggressive and ag- receptors and retinoid X receptors at retinoid response elements. Mol. gressive biological behavior. Further studies involving the reg- Cell. Biol., 12: 4862–4871, 1992. ulation of TIG-3 by retinoids and elucidating the structure of the 15. Kliewer, S. A., Umesono, K., Mangelsdorf, D. J., and Evans, R. M. TIG-3 protein and the identification of key functional mutations Retinoid receptor X interacts with nuclear receptors in retinoic acid, will be important to understand the role of TIG-3 in squamous thyroid hormone, and vitamin D3 signalling. Nature (Lond.), 355: carcinogenesis and epidermal differentiation. 446–449, 1992. 16. Chambon, P. The molecular and genetic dissection of the retinoid signaling pathway. Recent Prog. Horm. Res., 50: 317–332, 1995. ACKNOWLEDGMENTS 17. Elder, J. T., Astrom, A., Pettersson, U., Tavakkol, A., Griffiths, We acknowledge the participation of Dr. Margaret Kripke, Dr. C. E. M., Krust, A., Kastner, P., Chambon, P., and Voorhees, J. J. Differential regulation of retinoic acid receptors and binding proteins in Sarah Strom Lori Buschman, Dr. Adan El-Nagaar, Dr. Stephen Mays, human skin. J. Investig. Dermatol., 98: 673–679, 1992. Dr. Kendra Woods, and Annette Basey in obtaining and/or processing 18. Chakravarti, D., LaMorte, V., J., Nelson, M. C., Nakajima, T., Schul- the clinic specimens and lines for analysis. Dr. Peter Davies, Depart- man, I. G., Juguilon, H., Montminy, M., and Evans, R. M. Role of CBP/ ment of Integrative Biology, University of Texas Medical School, was P300 in nuclear receptor signalling. Nature (Lond.), 383: 99–102, 1996. responsible for the creation of the QT-RT-PCR assay. 19. Nagpal, S., Athanikar, J., and Chandraratna, R. A. S. Separation of transactivation and AP1 antagonism functions of retinoic acid receptor ␣. J. Biol. Chem., 270: 923–927, 1995. REFERENCES 20. Saiki, R. K., Scharf, S. , Faloona, F., Mullis, K. B., Horn, G. T., 1. Stoler, A., Kopan, R., Duvic, M., and Fuchs, E. The use of mono- Erlich, H. A., and Arnheim, N. Enzymatic amplification of ␤-globin specific antisera and cRNA probes to localize the major changes in genomic sequences and restriction site analysis for diagnosis of sickle keratin expression during normal and abnormal epidermal differentia- cell anemia. Science (Washington DC), 230: 1350–1354, 1985. tion. J. Cell Biol., 107: 427–446, 1988. 21. DiSepio, D., Malhotra, M., Chandraratna, R. A. S., and Nagpal, S. 2. Eckert, R. L., Crish, J. F., Banks, E. B., and Welter, J. F. The epidermis: Retinoic acid receptor nuclear-factor interleukin 6 antagonism: a novel genes on, genes off. J. Investig. Dermatol., 109: 501–509, 1997. mechanism of retinoid dependent inhibition of a keratinocyte hyperprolif- 3. Kanjali, S., and Duvic, M. Cutaneous carcinogenesis: molecular erative differentiation marker. J. Biol. Chem., 272: 25555–25559, 1997. model of cancer development. In: S. Miller (ed.), Cutaneous Oncology. 22. Seitz, C. S., Lin, Q., Deng, H., and Khavari, P. A. Alterations in NF-␬B Cambridge: Blackwell Scientific Publications, Inc., 1998. function in transgenic epithelial tissue demonstrate a growth inhibitory role 4. Ziegler, A., Leffel, D. F., Kunala, S., Sharma, H., Gailani, M., for NF-␬B. Proc. Natl. Acad. Sci. USA, 95: 2307–2313, 1998. Simon, J. A., Halperin, A. J., Baden, H. P., Shapiro, P. E., Bale, A. E., 23. Eichner, R., Kahn, M., Capetola, R. J., Gendimenico, G. J., and and Brash, D. E. Mutation hotspots due to sunlight in the p53 gene of Mezick, J. A. Effects of topical retinoids on cytoskeletal proteins: non-melanoma skin cancer. Proc. Natl. Acad. Sci. USA, 90: 4216– implications for retinoid effects on epidermal differentiation. J. Investig. 4220, 1993. Dermatol., 98: 154–161, 1992.

24. Gunther, S. The therapeutic value of retinoic acid in chronic, acute, 43. Murakami, Y., Nobukuni, T., Tamura, K., Maruyama, T., Sekiya, guttate, and erythrodermic psoriasis. Dermatology, 89: 515–517, 1973. T., Arai, Y., Gomyou, H., Tanigami, A., Ohki, M., Cabin, D., Frisch- 25. Ellis, C. N., and Voorhees, J. J. Etretinate therapy. J. Am. Acad. myer, P., Hunt, P., and Reeves, R. H. Localization of tumor suppressor Dermatol., 16: 267–291, 1987. activity important in non-small cell lung carcinoma on chromosome 26. Ranki, A., Lauharanta, J., and Keanerva, L. Effect of etretinate on 11q. Proc. Natl. Acad. Sci. USA, 95: 8153–8157, 1998. the distribution of Langerhans cells and T lymphocytes in psoriatic skin. 44. Xu, X. C., Clifford, J. L., Hong, W. K., and Lotan, J. R. Detection Arch. Dermatol. Res., 276: 102–104, 1984. of nuclear retinoic acid receptor mRNAs in histological tissue sections 27. Lippman, S. M., Lotan, R., and Clayman, G. L. Systemic prevention using non-radioactive in situ hybridization histochemistry. Diagn. Mol. and treatment of skin cancer. In: R. S. Weber, M. J. Miller, and H. Pathol., 3: 122–131, 1994. Goepfert (eds.), Basal and Squamous Skin Cancers of the Head and 45. Carey, T. Head and neck tumor cell lines. In: Atlas of Human Neck, pp. 351–355. Baltimore: Williams and Wilkins, 1996. Tumor Cell Lines, pp. 79–120. New York: Academic Press, Inc., 1994. 28. Duvic, M., Nagpal, S., Asano, A., and Chandraratna, R. A. S. 46. Ritter, S. J., and Davies, P. J. A. Identification of a TGF-B1/BMP4 Molecular mechanisms of Tazarotene action. J. Am. Acad. Dermatol., response element within the mouse tissue transglutaminase gene pro- 37: 85–92, 1997. moter. J. Biol. Chem., 273: 12798–12806, 1998. 29. Weinstein, G., Krueger, G. G., Lowe, N. J., Duvic, M., Friedman, 47. Gibson, U. E. M., Heid, C. A., and Williams, P. M. A novel method D. J., Jegasothy, B. V., Shmunes, E., Tschen, E. H., Lew-Kaya, D., Lue, for real time quantitative RT-PCR. Genome Res., 6: 995–1001, 1996. J. C., Sefton, J., Gibson, J. R., and Chandraratna, R. A. S. Tazarotene 48. Greaves, M. W., and Weinstein, G. D. Treatment of psoriasis. gel, a new retinoid, for topical therapy of psoriasis. Vehicle-controlled N. Engl. J. Med., 332: 581–588, 1995. study of safety, efficacy, and duration of therapeutic effect. J. Am. Acad. 49. Husman, K., Sers, C., Fietze, E., Mincheva, A., Lichter, P., and Dermatol., 37: 85–92, 1997. Schafer, R. Transcription and translational down-regulation of H-Rev- 30. Duvic, M. The pharmacologic profile of Tazarotene. Cutis, 61: 107, a class II tumour suppressor gene located on human chromosome 22–26, 1998. 11q11–12. Oncogene, 17: 1305–1312, 1998. 31. Esgleyes-Ribot, T., Chandraratna, R. A., Lew-Kaya, D. A., Sefton, 50. Herbst, R. A., Gutzmer, R., Matiaske, F., Mommert, S., Casper, U., J., and Duvic, M. Response of psoriasis to a new topical retinoid, AGN Kapp, A., and Weiss, J. Identification of two distinct deletion targets at 190168. J. Am. Acad. Dermatol., 30: 581–590, 1994. 11q23 in cutaneous malignant melanoma. Int. J. Cancer, 80: 205–209, 32. Thacher, S. M., Krasinski, G., Malhotra, M., Duvic, M., Nagpal, S., 1999. and Chandraratna, R. A. S. Coordinate regulation of keratinocyte dif- 51. Hampton, G. M., Mannerman, A., Winquist, R., Alavaikko, M., ferentiation markers by retinoids in cell culture and in psoriasis. J. In- Blanco, G., Taskinen, P. J., Kiviniemi, H., Newsham, I., Cavenee, vestig. Dermatol., 106: 819, 82, 1996. W. K., and Evans, G. A. Loss of heterozygosity in sporadic human 33. Duvic, M., Asano, A. T., Hager, C., and Mays, S. The pathogenesis breast carcinoma: a common region between 11q22 and 11q23.3. Can- of psoriasis and mechanism of action of Tazarotene. J. Am. Acad. cer Res., 54: 4586–4589, 1994. Dermatol., 39: S126–S129, 1998. 52. Gabra, H., Watson, J. E., Taylor, K. J., Mackay, J., Leonard, R. C., 34. Peris, K., Fargnoli, M. C., and Chimenti, S. Preliminary observa- Steel, C. M., Porteous, D. J., and Smyth, J. F. Definition and refinement of tions on the use of topical Tazarotene to treat basal-cell carcinoma. a region of loss of heterozygosity at 11q23.3-q24.3 in epithelial ovarian N. Engl. J. Med., 341: 1767–1768, 1999. cancer associated with poor prognosis. Cancer Res., 56: 950–954, 1996. 35. Nagpal, S., Patel, S., Asano, A. T., Johnson, A. T., Duvic, M., and 53. Bethwaite, P. B., Koreth, J., Herrington, C. S., and McGee, J. O. Loss Chandraratna, R. A. S. Tazarotene-induced gene 1 (TIG1), a novel of heterozygosity occurs at the D11S29 locus on chromosome 11q23 in retinoic acid receptor-responsive gene in skin. J. Investig. Dermatol., invasive cervical carcinoma. Br. J. Cancer, 71: 814–818, 1995. 106: 269–274, 1996. 54. Launonen, V., Stenboack, F., Pusitola, U., Bloigu, R., Huusko, P., 36. Nagpal, S., Patel, S., Jacobe, H., DiSepio, D., Ghosn, C., Malhotra, Kytola, S., Kauppila, A., and Winquist, R. Chromosome 11q22.3–q25 M., Teng, M., Duvic, M., and Chandraratna, R. A. S. Tazarotene- LOH in ovarian cancer: association with a more aggressive disease induced gene 2 (TIG-2), a novel retinoid responsive gene in skin. course and involved subregions. Gynecol. Oncol., 71: 299–304, 1998. J. Investig. Dermatol., 109: 91–95, 1997. 55. Lazar, A. D., Winter, M. R., Nogueira, C. P., Larson, P. S., 37. Nagpal, S., Thacher, S. M., Patel, S., Friant, S., Malhotra, M., Finnemore, E. N., Dolan, R. W., Fulcihan, N., Chakravarti, A., Zietman, Shafer, J., Krasinski, G., Asano, R. T., Teng, M., Duvic, M., and A., and Rosenberg, C. L. Loss of heterogeneity at 11q23 in squamous Chandraratna R. A. S. Negative regulation of two hyperproliferative cell carcinoma of the head and neck is associated with recurrent disease. keratinocyte differentiation markers by an RAR-selective retinoid: in- Clin. Cancer Res., 4: 2787–2793, 1998. sight into the mechanism of retinoid action in psoriasis. Cell Growth 56. Weinberg, R. A. Tumor suppressor genes. Science (Washington Differentiation, 7: 1783–1791, 1996. DC), 254: 1138–1146, 1991. 38. DiSepio, D., Ghosn, C., Eckert, R. L., Deucher, A., Robinson, N., 57. Brash, D. E., Ziegler, A., Jonason, A. S., Simon, J. A., Kunala, S., Duvic, M., Chandraratna, R. A. S., and Nagpal, S. Identification and and Leffell, D. J. Sunlight and sunburn in human skin cancer: p53, characterization of a retinoid-inducible class II tumor suppressor/anti- apoptosis, and tumor promotion. J. Investig. Dermatol. Symp. Proc., 1: proliferative gene. Proc. Natl. Acad. Sci. USA, 95: 14811–14815, 1998. 136–142, 1996. 39. Hajnal, A., Klemenz, R., and Schafer, R. Subtraction cloning of 58. Kanjilal, S., Strom, S., Clayman, G. L., Weber, R. S., El-Naggar, H-rev107, a gene specifically expressed in H-ras resistant fibroblasts. A. K., Kapur, V., Cummings, K. K., Hill, L. A., Spitz, M. R., Kripke, Oncogene, 9: 419–490, 1994. M. L., and Ananthaswamy, H. N. p53 mutations in non-melanoma skin 40. Szpiere, C., Szpiere, J., Riviere, M., Hajnal, A., Kiess, M., Scharm, cancer of the head and neck: molecular evidence for field cancerization. B., and Schafer, R. Chromosomal assignment of three rat and human Cancer Res., 55: 3604–3609, 1995. H-rev genes, putative tumor suppressors, down-regulated in malignantly 59. Kraemer, K. H., DiGiovanna, J. J., Moshell, A. N., Tarone, R. E., and HRAS-transformed cells. Mamm. Genome, 7: 701–793, 1996. Peck, G. L. Prevention of skin cancer in xeroderma pigmentosum with the 41. Kuchinke, W., Hart, R. P., and Jonakait, G. M. Identification of use of oral isotretinoin. N. Engl. J. Med., 318: 1633–1637, 1988. mRNAs regulated by interferon-␥ in cultured rat astrocytes by PCR 60. Lippman, S. M., and Meyskens, F. L. Results of the use of vitamin differential display. Neuroimmunomodulation, 2: 347–355, 1995. A and retinoids in cutaneous malignancies. Pharmacol. Ther., 40: 107– 42. di Iasio, M. G., Calin, G., Tibiltti, M. G., Vorchovsky, I., Benedikts- 122, 1989. son, K. P., Taramelli, R., Barbanti-Brodano, G., and Negrini, M. Re- 61. Wei, A., Cheng, L., Wang, L., Guo, Z., Strom, S. S., Spitz, M. R., finement of the LOH region 1 at 11q23.1 deleted in human breast Lippman, S. M., Duvic, M., and Kripke, M. L. Role of DNA repair for carcinomas and sublocalization of 11 expressed sequence tags within the UV damage in non-melanoma skin cancer progression. Proc. Am. As- refined region. Oncogene, 18: 1635–1638, 1999. soc. Cancer Res., 39: 477, 1998.

Downloaded from clincancerres.aacrjournals.org on September 29, 2021. © 2000 American Association for Cancer Research. Expression of a Retinoid-inducible Tumor Suppressor, Tazarotene-inducible Gene-3, Is Decreased in Psoriasis and Skin Cancer

Madeleine Duvic, Bharati Helekar, Claudia Schulz, et al.

Clin Cancer Res 2000;6:3249-3259.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/6/8/3249

Cited articles This article cites 56 articles, 17 of which you can access for free at: http://clincancerres.aacrjournals.org/content/6/8/3249.full#ref-list-1

Citing articles This article has been cited by 10 HighWire-hosted articles. Access the articles at: http://clincancerres.aacrjournals.org/content/6/8/3249.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/6/8/3249. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.