The Role of RIPK3 Ubiquitylation and MLKL Signalling During Cell Death and Autophagy

The role of RIPK3 ubiquitylation and MLKL signalling during cell death and autophagy

Daniel Frank

ORCID: 0000-0003-4998-2220

Doctor of Philosophy

February, 2021

The Walter and Eliza Hall Institute of Medical Research (WEHI) Department of Medical Biology Faculty of Medicine, Dentistry and Health Science

Thesis submitted to the University of Melbourne in complete fulfilment for the requirements for the degree of Doctor of Philosophy

ABSTRACT

Receptor Interacting Serine/Threonine Kinase-3 (RIPK3) is essential for necroptosis, an inflammatory form of programmed cell death pathway implicated in innate immunity, kidney ischemia reperfusion injury, and systemic inflammatory response syndrome. In the classical model, cells committed to necroptosis phosphorylate RIPK1, which in turn drives RIPK3 phosphorylation and oligomerisation. Active RIPK3 oligomers subsequently phosphorylate mixed lineage kinase domain-like protein (MLKL) pseudokinase which induces its translocation to the plasma membrane. The necroptosis pathway culminates in MLKL perforating the plasma membrane as a prelude to cellular rupture and release of inflammatory cytokines and damage-associated molecular patterns to the extracellular milieu.

In addition to being a pro-necroptotic kinase, RIPK3 is also capable of triggering apoptosis when its kinase activity is restrained. Moreover, numerous death-independent roles of RIPK3 have been described in the context of inflammation such as arthritis, viral infection, or colitis whereby RIPK3 either promotes or dampens the secretion of pro- inflammatory cytokines. Understanding the molecular regulation of RIPK3 will thereby facilitate the ongoing pre-clinical development of RIPK3 inhibitors.

Like most proteins, post-translational modification (PTM) is a critical fine tuner of RIPK3 activities. Ubiquitylation, in particular, has recently garnered attention in the cell death field as loss of this PTM may result in hyperactive RIPK3 which consequently accelerates death and inflammation. However, the post-translational control of RIPK3 signalling is not fully understood. Using mass-spectrometry, I identified a novel ubiquitylation site on murine RIPK3 on lysine 469 (K469). Complementation of RIPK3-deficient cells with a RIPK3-K469R mutant demonstrated that the decoration of RIPK3 K469 by ubiquitin limits both RIPK3-mediated caspase-8 activation and apoptotic killing, in addition to RIPK3 autophosphorylation and MLKL-mediated necroptosis. Unexpectedly, the overall ubiquitylation of mutant RIPK3-K469R was enhanced, which largely resulted from additional RIPK3 ubiquitylation upstream on lysine 359 (K359). Loss of RIPK3-K359 ubiquitylation reduced RIPK3-K469R hyper-ubiquitylation and also RIPK3-K469R killing. Collectively, I therefore propose that ubiquitylation of RIPK3 on K469

ii functions to prevent RIPK3 hyper-ubiquitylation on alternate lysine residues, which otherwise promote RIPK3 oligomerisation and consequent cell death signalling.

I further investigated the consequence of abolishing RIPK3 K469 ubiquitylation by generating Ripk3K469R/K469R mice. In agreement with in vitro findings, primary fibroblasts with mutant RIPK3-K469R enhanced apoptosis, and in vivo studies demonstrate that RIPK3-K469 ubiquitylation contributes to pathogen clearance. Specifically, when Ripk3K469R/K469R mice were challenged with Salmonella enterica serovar Typhimurium, bacterial loads in the spleen and liver were significantly increased relative to wildtype control animals. The increased bacterial burden in the mutant mice was consistent with reduced IFN produced in the serum, while the elevated MCP-1 cytokine upon infection might be indicative of heightened immune infiltrates.

Although necroptosis signalling clearly triggers cell death, how it might impact other cellular responses remains unclear. Therefore, to further delineate the functional outcomes of necroptotic activity I examined how its signalling impacts autophagy. The autophagy pathway is triggered when cells are deprived of nutrients. Although regarded as a pro-survival pathway which acts to recycle and remove damaged organelles, studies have recognised that autophagic pathways can impact cell death processes. In apoptosis, for instance, autophagy acts to limit pro-inflammatory IFN- secretion, thus decreasing apoptotic immunogenicity. Nonetheless, little is known about the status of autophagy during necroptosis. I demonstrate through various genetic, imaging, and pharmacological approaches that active MLKL translocates to autophagic membranes during necroptosis. However, contrary to previous findings which reported the activation of autophagy upon necroptotic activity based on increased lipidated LC3B, a commonly used marker of autophagy induction, I challenged this conclusion by demonstrating that the accumulation of active LC3B during necroptosis is a consequence of reduced autophagic flux. Therefore, unlike apoptosis which proceeds in tandem with autophagy, the induction of necroptosis negates autophagy in an MLKL- dependent manner. While the function of MLKL-mediated autophagy inhibition warrants further investigation, I propose that attenuating autophagy during necroptosis contributes to the immunogenicity of this cell death modality by limiting the ability of the cell to clear damaged organelles and immunogenic molecules.

iii

Overall, my research has helped in outlining how a key necroptotic molecule RIPK3 is regulated post-translationally and how this is relevant in the context of microbial defence. I have also defined novel functional roles for necroptosis signalling in the regulation of autophagic responses. Understanding the molecular regulation of necroptosis signalling and how this cell death pathway is linked to other cellular responses, such as autophagy, is important for the accurate design of new therapeutics to target these pathways in pathological settings.

DECLARATION

This is to certify that:

(i) The thesis comprises only my original work towards the PhD except where clearly indicated in the preface and in the relevant sections,

(ii) due acknowledgement has been made in the text to all other material used,

(iii) the thesis is fewer than 100,000 words in length, exclusive of tables, maps, bibliographies and appendices.

Daniel Frank 22/02/2021

PREFACE

All experiments in this thesis were conducted at the Walter and Eliza Hall Institute of Medical Research, Australia. This research is only possible through the collaboration with others, and as such, I have provided a separate preface at the beginning of each chapter to acknowledge in detail the contributions of other researchers.

Chapter 3 contains results that will be submitted for publication. While most of the results presented in chapter 4 consists of unpublished work, some of the data in the chapter, in particular the Salmonella in vivo model, will also be submitted for publication as an extension to chapter 3 results. Finally, chapter 5 contains the work published in Journal of Cell Science, and is reproduced fully in this thesis.

I was supported by the Melbourne Research Scholarship (MRS) from University of Melbourne, and the Edith Moffat Postgraduate scholarship from the Walter and Eliza Hall Institute of Medical Research. This work was supported by Australian National Health and Medical Research Council (NHMRC) program grants (46122), project grants (1101405, 1145788), and ideas grant (1183070). In addition, support was also provided form an Independent Research Institutes Infrastructure Support Scheme Grant (361646 and 9000220) from the NHMRC and a Victorian State Government Operational Infrastructure Support Grant.

ACKNOWLEDGEMENTS

This research would not be possible without the continuing support of all my wonderful supervisors, past and present. First and foremost, I am grateful for the opportunity to work with James Vince who has provided me with an intellectually stimulating working environment and has made science a really fun endeavour for me. Thank you for your patience and for giving me the freedom to test my hypotheses, despite them being random and ended up wrong. I would like to thank James Murphy for always being very approachable and providing me feedback on my work; Jarrod Sandow who has provided tremendous assistance with the mass spec experiment. Finally, I would like to thank Lisa Lindqvist and David Vaux for giving me the opportunity in the lab to work on my first project on autophagy. In particular, I am indebted to Lisa for teaching me the lab techniques in my first few weeks I started in the lab.

I would like to thank all members of my PhD committee Gabrielle Belz, Rebecca Feltham, and Justine Mintern for their continuing support and feedback on my PhD progress.

To all the amazing Vince lab mates Daniel Simpson, Maryam Rashidi, Ashley Weir, Sebastian Hughes, and Jiyi Pang, thank you all for your feedback and inputs which have shaped me into a better scientist. It has been a great time working with you all.

To other members of the Inflammation division, Andre Samson who has provided numerous experimental ideas and feedback, and have trained me to be more critical of my data. To Lin Liu and Shelly, you guys have been such amazing lab mates, and I am grateful for your continuing support. I would like to thank Philippe Bouillet who has been very generous with sharing his reagent and lab equipment with me, and for helping me with the histology analysis. More importantly, I am indebted to your Madeleines which have kept me fuelled for lab work. Likewise, I am indebted to Elise Clayer for helping me enormously with the animal work, and multicolour FACS.

vii

The mutant mice would not be possible without Andrew Kueh and Marco Herold showcasing their CRISPR magic, and Cathrine Hall for helping me with the genotyping. Finally, I am amazed by the dedication of the lab technicians, Sophia Russo and Tom Kitson, who have taken care of the mice well.

All figures used in the introduction chapter were created with BioRender.com

viii

PUBLICATIONS

Below is the list of publications obtained during PhD:

Samson, A. L., Zhang, Y., Geoghegan, N. D., Gavin, X. J., Davies, K. A., Mlodzianoski, M. J., . . .[Frank, D.]. . .Murphy, J. M. (2020). MLKL trafficking and accumulation at the plasma membrane control the kinetics and threshold for necroptosis. Nat Commun, 11(1), 3151. doi:10.1038/s41467-020-16887-1

Rashidi, M., Simpson, D. S., Hempel, A., Frank, D., Petrie, E., Vince, A., . . . Vince, J. E. (2019). The Pyroptotic Cell Death Effector Gasdermin D Is Activated by Gout-Associated Uric Acid Crystals but Is Dispensable for Cell Death and IL-1beta Release. J Immunol, 203(3), 736-748. doi:10.4049/jimmunol.1900228

Erlich, Z., Shlomovitz, I., Edry-Botzer, L., Cohen, H., Frank, D., Wang, H., . . . Gerlic, M. (2019). Macrophages, rather than DCs, are responsible for inflammasome activity in the GM-CSF BMDC model. Nat Immunol, 20(4), 397-406. doi:10.1038/s41590-019-0313-5

Frank, D., Vaux, D.L., Murphy, J.M., Vince, J.E., and Lindqvist, L.M. (2019). Activated MLKL attenuates autophagy following its translocation to intracellular membranes. J Cell Sci 132.

Frank, D., & Vince, J. E. (2019). Pyroptosis versus necroptosis: similarities, differences, and crosstalk. Cell Death Differ, 26(1), 99-114. doi:10.1038/s41418-018-0212-6

Lindqvist, L. M., Frank, D., McArthur, K., Dite, T. A., Lazarou, M., Oakhill, J. S., . . . Vaux, D. L. (2017). Autophagy induced during apoptosis degrades mitochondria and inhibits type I interferon secretion. Cell Death Differ. doi:10.1038/s41418-017-0017-z

TABLE OF CONTENTS

Table of Contents Abstract ...... ii

Declaration ...... v

Preface ...... vi

Acknowledgements ...... vii

Publications ...... ix

Table of Contents ...... x

List of Figures ...... xv

List of Tables ...... xvii

List of Abbreviations ...... xviii

Chapter 1 – Introduction ...... 1

1.1 Summary ...... 1

1.2 Aims ...... 2

1.3 The numerous ways to cellular self-destruction ...... 3

1.4 The road to apoptosis ...... 3

1.4.1 BAX and BAK are the gatekeepers to death from within ...... 5

1.4.2 From bench to bedside: how elucidation of intrinsic apoptosis has led to drugs development ...... 6

1.4.3 Apoptosis via death receptor signalling ...... 6

1.4.4 Can DR signalling be exploited to defend against cancer? ...... 9

1.5 Necroptosis: a non-universal genetically programmed necrosis as an extra barrier against pathogen infections ...... 9

1.5.1 The yin and yang nature of RIPK3: how a kinase is both pro-survival and pro-death ...... 14

1.6 Pyroptosis is a gasdermin-mediated pro-inflammatory cell suicide triggered in response to infection and cellular stressors ...... 17

1.7 Diverse cell death pathways translate to maximum protection from infection ...... 21

1.8 Ubiquitylation as a critical regulator of cell death signalling ...... 22

1.8.1 The ubiquitin system involves building and breaking chains ...... 22

1.8.2 Ubiquitin ligases and DUBs control cell death signalling complexes ...... 25

1.9 Self-eating as a means of survival ...... 28

1.9.1 The autophagosome and Lysosome: the alpha and omega in cellular self-eating 29

1.9.1 When autophagy and cell death meet: friends or enemies? ...... 32

Chapter 2 – Materials and Methods ...... 35

2.1 In vivo studies ...... 35

2.1.1 Animal ethics ...... 35

2.1.2 Mice ...... 35

2.1.3 Mouse genotyping ...... 36

2.1.4 Blood analysis ...... 36

2.1.5 Mouse model of SMAC mimetic-mediated skin inflammation ...... 37

2.1.6 Mouse model of LPS endotoxic shock ...... 38

2.1.7 Mouse model of K/BxN serum transfer arthritis ...... 38

2.1.6 Mouse model of Salmonella infection ...... 39

2.2 Cell culture maintenance ...... 39

2.2.1 Mouse dermal fibroblasts (MDFs) ...... 40

2.2.2 Human colorectal adenocarcinoma cell line (HT-29) ...... 40

2.2.3 HEK293T cells ...... 40

2.2.4 Bone Marrow Derived Macrophages (BMDMs) ...... 40

2.2.5 Young adult mouse colonic epithelium (YAMC) ...... 40

2.2.6 immortalised BMDMs (iBMDMs) ...... 41

2.3 Plasmids, mutagenesis, and transfection ...... 41

2.3.1 GFP and Ubiquitin constructs ...... 41

2.3.2 Cloning of RIPK3 constructs ...... 41

2.3.3 Site-directed mutagenesis by overlap extension PCR ...... 41

2.2.4 Digestion, ligation and transformation of cDNAs ...... 43

2.4 Reagents and antibodies ...... 44

2.5 Cell viability assays ...... 47

2.5.1 Propidium iodide (PI) uptake by flow cytometry or Incucyte Live-Cell Imaging ... 47

2.5.2 LDH release assay ...... 47

2.5.3 Long term clonogenic survival assay ...... 48

2.6 In vitro Salmonella infection on BMDM ...... 48

2.7 Western blotting ...... 48

2.8 Subcellular fractionation ...... 49

2.9 FLAG and HA immunoprecipitation (IP) ...... 49

2.10 Blue-native PAGE ...... 50

2.11 Liquid chromatography–tandem mass spectrometry (LC-MS/MS) ...... 50

2.12. Recombinant protein purification of GST-UBA and GST-TUBE ...... 50

2.13 Purification of ubiquitylated proteome ...... 51

2.14 USP21 Assay ...... 52

2.15 Confocal imaging ...... 52

2.16 ELISA ...... 53

2.17 Statistical analysis ...... 53

Chapter 3 – Ubiquitylation of RIPK3 beyond-the-RHIM limits RIPK3 activity and cell death . 54

3.1 Preface ...... 54

3.2 Introduction ...... 54

3.3 Results ...... 56

xii

RIPK3 is ubiquitylated beyond-the-RHIM (BTR) on lysine 469 ...... 56

Loss of RIPK3-K469 ubiquitylation promotes RIPK3-induced necroptosis and apoptosis signalling in a cell type-dependent manner ...... 59

The surface-exposed RIPK3 residues K158, K287 and K307 restrict both apoptotic and necroptotic RIPK3 in a similar manner to RIPK3-K469 ...... 64

Loss of RIPK3-K469 ubiquitylation enhances its interaction with caspase-8 but does not impact RIPK3 turnover ...... 69

Loss of RIPK3-K469 ubiquitylation via arginine substitution enhances total RIPK3 ubiquitylation, which correlates with increased RIPK3 killing activity ...... 72

Loss of RIPK3-K469 ubiquitylation increases the transition of activated and ubiquitylated RIPK3 into detergent-insoluble fractions ...... 75

RIPK3-K469 ubiquitylation restricts apoptosis and necroptosis by preventing upstream ubiquitylation on K359 ...... 81

3.4 Discussion ...... 84

Chapter 4 – ANALYSIS OF Ripk3 K469R MUTANT MICE: LOSS OF RIPK3 K469 ubiquitylation in vivo ...... 87

4.1 Preface ...... 87

4.2. Results ...... 88

RIPK3 tissue expression and blood analysis in Ripk3K469R/K469R mice ...... 88

Loss of RIPK3-K469 ubiquitylation enhances apoptosis in primary MDFs ...... 90

RIPK3-K469 ubiquitylation in SMAC mimetic-mediated skin inflammation ...... 93

RIPK3-K469 ubiquitylation is potentially pro-inflammatory in LPS-induced endotoxic shock, but not K/BxN serum-mediated arthritis ...... 96

RIPK3-K469 ubiquitylation promotes Salmonella clearance in vivo ...... 98

Discussion ...... 102

Chapter 5 - Activated MLKL attenuates autophagy following its translocation to intracellular membranes ...... 105

xiii

5.1 Preface ...... 105

Chapter 6 –General Discussion and Future directions ...... 123

6.1 Ubiquitylation as an accelerator and brake on RIPK3 signalling ...... 123

6.2 The impact of losing RIPK3 ubiquitylation site in vivo ...... 127

6.3. Why autophagy matters in cells committing suicide ...... 128

References ...... 131

xiv

LIST OF FIGURES

Figure 1.1. Comparison between intrinsic and extrinsic apoptosis...... 4 Figure 1.2. TNFR1 signalling promotes cell survival under normal conditions, but has a deadly outcome when compromised...... 8 Figure 1.3. The blueprint for necroptosis...... 10 Figure 1.4. The dual nature of RIPK3 as pro-survival (yang) and pro-death (yin) kinase...... 15 Figure 1.5. Pyroptosis is a gasdermin-mediated mode of cell death...... 19 Figure 1.6. The mechanism of ubiquitylation...... 23 Figure 1.7. The 3 types of autophagy pathways: macroautophagy, chaperone-mediated autophagy (CMA), and microautophagy...... 29 Figure 1.8. Mechanism of autophagosome formation...... 31 Figure 2.1. Schematic of site-directed mutagenesis by overlap extension PCR...... 42 Figure 3.1. Identification of a diGly motif situated beyond-the-RHIM (BTR) on lysine 469 ... 57 Figure 3.2. Abolishing RIPK3-K469 drives apoptosis and necroptosis ...... 58 Figure 3.3. Loss of RIPK3-K469 ubiquitylation enhances caspase-8 and -3 processing, RIPK3 phosphorylation and MLKL activation ...... 62 Figure 3.4. Loss of RIPK3-K469 ubiquitylation increases RIPK3 phosphorylation and cell death in a cell type-dependent manner ...... 64 Figure 3.5. Conservation of mouse RIPK3 surface-exposed lysine residues ...... 65 Figure 3.6. Some, but not all, surface-exposed lysines on RIPK3 are required to limit RIPK3- induced cell death ...... 67 Figure 3.7. Surface-exposed K158, K287, and K307 of mouse RIPK3 restrict both apoptotic and necroptotic RIPK3 signalling ...... 68 Figure 3.8. Ubiquitylation of RIPK3-K469 limits caspase-8 association ...... 69 Figure 3.9. RIPK3-K469 ubiquitylation does not regulate RIPK3 turnover ...... 71 Figure 3.10. Ubiquitylation of RIPK3-K469 prevents overall increases in RIPK3 ubiquitylation independent of RIPK1 and RIPK3 kinase activity ...... 74 Figure 3.11. Loss of RIPK3-K158, -K287, -K307, and -K469 ubiquitylation promotes transition of active RIPK3 into a TX-100-insoluble fraction ...... 77 Figure 3.12. Endogenous RIPK3 is associated with a detergent-insoluble fraction during necroptosis ...... 79

Figure 3.13. Endogenous active RIPK3 is membraneless ...... 80 Figure 3.14. RIPK3-K359 is conserved across species ...... 81 Figure 3.15. RIPK3-K359 ubiquitylation limits RIPK3 hyperactivity ...... 83 Figure 4.1. RIPK3 expression between Ripk3+/+ and Ripk3K469R/K469R mice is similar...... 89 Figure 4.2. Advia hematology analysis of Ripk3+/+, Ripk3+/K469R, and Ripk3K469R/K469R mice. .... 90 Figure 4.3. Ubiquitylation on mouse RIPK3 K469 restricts apoptosis in primary MDFs but not BMDMs or BMDCs ...... 93 Figure 4.4. SMAC-mimetic mediated skin inflammation is similar in Ripk3+/+ and Ripk3K469R/K469R mice...... 96 Figure 4.5. Loss of RIPK3-K469 ubiquitylation potentially impacts LPS responses in vivo, but does not play a role in the K/BxN serum transfer arthritis model...... 98 Figure 4.6. RIPK3-K469 ubiquitylation promotes Salmonella clearance in vivo...... 100 Figure 4.7. RIPK3-K469 ubiquitylation potentially regulates IFN and MCP-1 cytokine levels in response to Salmonella infection ...... 101 Figure 6.1. The 2020 ubiquitin map of RIPK3...... 124

xvi

LIST OF TABLES

Table 2.1. Thermocycling conditions for validating integration of oligo donor ...... 35 Table 2.2. Primers used for Ripk3K469R/K469R mice genotyping ...... 36 Table 2.3. Thermocycling conditions for Ripk3K469R/K469R mice genotyping ...... 36 Table 2.4. Wound scoring criteria for SMAC mimetic injection model ...... 37 Table 2.5. Clinical scoring criteria for K/BxN serum transfer arthritis model ...... 38 Table 2.6. Primers used for mycoplasma testing by PCR method ...... 39 Table 2.7. Thermocycling conditions for mycoplasma testing ...... 39 Table 2.8. Primers used for overlap extension PCR ...... 42 Table 2.9. PCR reaction mix overlap extension PCR ...... 42 Table 2.10. Thermocycling conditions for overlap extension PCR ...... 43 Table 2.11. Ligation reaction mix ...... 44 Table 2.12. List of reagents ...... 44 Table 2.13. List of antibodies ...... 45

xvii

LIST OF ABBREVIATIONS

4HB 4 helical bundle AIM2 absent in melanoma 2 AMPK AMP-activated protein kinase APAF1 apoptotic protease activating factor 1 ASC apoptosis-associated speck-like protein containing a CARD ATG autophagy-related BafA1 bafilomycin A1 BAK Bcl-2 homologous antagonist killer BAX Bcl-2-associated X protein

BCL-XL BCL-long isoform BH BCL-2 homology BID BH3-interacting domain death agonist BIM BCL-2-interacting mediator of cell death BIR baculovirus inhibitor of apoptosis repeat domains BMDC bone marrow derived dendritic cells BMDM bone marrow derived macrophages CARD caspase activation and recruitment domain cFLIP cellular FLICE-like inhibitory protein CFU colony forming units cIAPs cellular Inhibitor of APoptosis proteins CMA chaperone-mediated autophagy Cp.A Smac-mimetic Compound A CYLD cylindromatosis DAI DNA-dependent activator of IFN-regulatory factors DAMP danger associated molecular pattern DD death domain DISC death inducing signalling complex DME Dulbecco’s modified Eagle’s medium

xviii

DR Death receptor DUB deubiquitylating enzyme EDTA ethylenediaminetetraacetic acid ELISA enzyme-linked immunosorbent assay FACS fluorescence assisted cell sorting FADD Fas associated death domain FasL Fas Ligand GFP green fluorescent protein GSDMD Gasdermin D H&E Haematoxylin and Eosin HLH hemophagocytic lymphohistiocytosis HMGB1 High-mobility group box 1 protein HOIL-1 Heme-oxidized IRP2 ubiquitin ligase 1 HOIP HOIL-1-interacting protein HSP heat shock protein IAPs Inhibitor of APoptosis proteins IF Immunofluorescence IFNRs Interferon receptors IFN Interferon-gamma IHC Immunohistochemistry IKK IB kinase IL Interleukin IL-1 interleukin-1 alpha IP Immunoprecipitation IRG1 immune-Responsive Gene 1 JNK c-Jun N-terminal kinase KO Knock-out LDH lactate dehydrogenase LPS Lipopolysaccharide LUBAC linear ubiquitin chain assembly complex MAPK mitogen-activated protein kinase

xix

MAP-LC3/LC3 microtubule-associated protein 1 light chain 3 MCL1 myeloid cell leukemia 1 MDF mouse dermal cells MEF mouse embryonic fibroblast MIB2 Mind Bomb-2 MINDY motif interacting with Ub-containing novel DUB family MJD Machado-Joseph disease protease MKRN1 makorin Ring Finger Protein 1 MLKL mixed lineage kinase-like MOI multiplicity of infection MOMP mitochondrial outer membrane permeabilisation mTORC1 mechanistic/mammalian target of rapamycin complex 1 NEK7 NIMA-related kinase 7 NK Natural Killer cell NLR NOD-like receptor NLRP NLR family pyrin domain containing protein OTU Otubain protease OTULIN OTU deubiquitylase with linear ubiquitin linkage specificity PAMP pathogen associated molecular pattern PBS Phosphate Buffered Saline PI propidium iodide PI3K phosphatidylinositol 3-kinase PI3P phosphatidylinositol 3-phosphate Poly I:C Polyinosinic:polycytidylic acid RHIM RIP homotypic interaction motif RIPK Receptor Interacting Protein Kinase ROS reactive oxygen species RSC receptor signalling complex SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis SEM Standard error of the mean SHARPIN shank-associated RH domain-interacting protein

SIRS systemic inflammatory response syndrome SMAC second mitochondria-derived activator of caspases TAK1 transforming growth factor-β-activated kinase 1 TNF tumour necrosis factor TNFR TNF Receptor TRADD TNF receptor associated death domain TRAF2 TNF Receptor Associated Factor-2 TRAIL TNF-related apoptosis-inducing ligand TRAM TRIF-related adaptor molecule TRIF TIR domain-containing adaptor inducing IFN-β TX-100 triton X-100 UBA ubiquitin-associated ULK unc-51-like kinase USP21 ubiquitin-specific protease vFLIP viral FLICE-inhibitory proteins WT wildtype XIAP X-link inhibitor of apoptosis protein YAMC young adult mouse colonic epithelium ZBP1 Z-DNA binding protein 1 ZUP1 zinc finger-containing ubiquitin peptidase 1

xxi

CHAPTER 1 – INTRODUCTION

1.1 Summary By the time I was born, more of me had died than survived. It was no wonder I cannot remember; during that time I went through brain after brain for nine months, finally contriving the one model that could be human, equipped for language. – Lewis Thomas, in The Fragile Species

Cells commit suicide as part of normal human development and physiology. Indeed, the most common trigger of cell death is not from accidental events such as mechanical injury, but from activation of a programmed self-destruction mechanism inherent in all cells (Kerr et al., 1972; Vaux et al., 1994). During embryonic development, cell death plays multiple key roles in removing superfluous structures and sculpting complex organs, which include pruning away unneeded neurons during neurogenesis (Burek and Oppenheim, 1996), removing the interdigital webbing in the limbs (Zakeri et al., 1994), and generating middle ear space (Roberts and Miller, 1998). By the time a person reaches adulthood and when growth has stopped, they shed around 50-70 billion cells each day to balance constant cell division. The homeostasis of cell division and cell death is paramount to human health. When the balance is tipped to favour cell division over cell suicide, pathologies can ensue, such as cancer (Strasser and Vaux, 2020).

Enormous interest in programmed cell death over the past 30 years has revealed numerous pathways on how cells commit suicide, of which apoptosis, necroptosis and pyroptosis are the three forms of cell death modes that have been most extensively studied. It is now established that each cell death mode has their own set of executioners which can be in the form of proteases (apoptosis and pyroptosis) or kinases (necroptosis) (Galluzzi et al., 2018). Despite receiving enormous interest, numerous questions remain unsolved in the cell death field. For example, although the central dogma of molecular biology has been expanded to include the post-transcriptional and post-translational machineries, which are important in fine-tuning genetic and protein signalling networks respectively, it remains incompletely understood how post-translational modifications regulate newly described cell death effectors, such as receptor-interacting serine/threonine protein kinase 3 (RIPK3) and mixed

1 lineage kinase domain-like (MLKL). Therefore, in this research project I sought to identify post- translational modification events, specifically ubiquitylation and its functional roles, in regulating the essential necroptotic cell death signalling component RIPK3.

Apart from programmed cell death, another equally important fundamental cellular mechanism is autophagy. Autophagy is a pro-survival mechanism that enables cells to recycle their cytoplasmic material in the lysosome to maintain homeostasis of amino acids, lipids and nucleotides (Galluzzi et al., 2017). Because autophagy is a cellular defense mechanism against various stressors such as nutrient deprivation, it raises the question on what happens to the cellular recycling process when cells commit to die? In other words, does the autophagy pathway intersect with the programmed cell death pathways? Interestingly, it was recently reported that activation of autophagy during cell death, specifically apoptosis, plays a role in reducing the cell death-triggering immunogenicity (Lindqvist et al., 2017; Lindqvist et al., 2014). Nevertheless, the crosstalk between autophagy observed in apoptosis may also be relevant to necroptosis signalling. Therefore, I examined how autophagy is impacted when the necroptotic cell death machinery, RIPK3 and MLKL, are activated.

To address the research questions raised above, I have used pharmacological and genetic methods to target the key players in programmed cell death and autophagy pathways, and study their impact in vitro. Furthermore, I generated a mouse model through CRISPR/Cas9 technology to study the impact of disrupting the post-translational control of RIPK3 in vivo. By understanding the basic cell biology of programmed cell death, we can translate this knowledge into therapeutic purposes to treat a broad range of pathologies that these pathways have been implicated in.

1.2 Aims Based on the rationale outlined in the preceding section, I have pursued the following aims in this research project:

1. To identify and functionally characterise novel ubiquitylation sites on RIPK3 in vitro and in vivo. 2. To characterise the impact of necroptosis signalling on autophagy.

Aim 1 is explored in chapters 3 and 4, while aim 2 is explored in chapter 5.

1.3 The numerous ways to cellular self-destruction The phenomenon of cell death had been dismissed for a long time as uncontrolled or accidental until researchers discovered the internal instruction manual for cells to die in 1972, and used the term apoptosis to distinguish the process from cell death caused by traumatic events such as mechanical injury, or changes in pH (Kerr et al., 1972). However, it was not until biologists began to elucidate the genetically encoded mechanisms of apoptosis that enormous scientific interest took hold (Vaux et al., 1988).

In recent years, a large body of experimental work has unveiled a number of cell death mechanisms in addition to apoptosis, including necroptosis, pyroptosis, ferroptosis, NETosis, and efferocytosis (Galluzzi et al., 2018). Apoptosis, necroptosis, and pyroptosis are the three commonly investigated forms, and better understood mechanisms, of programmed cell death, and are further explored below. Interestingly, the three cell death modes are not mutually exclusive and they can crosstalk in certain contexts. The plasticity and diversity in how cells end themselves allow the organism to adapt and counteract myriad pathogens which are constantly evolving strategies to hijack cells and manipulate the immune response.

1.4 The road to apoptosis Apoptosis is the predominant mode of cell death that governs embryonic development and tissue homeostasis in multicellular organisms. Morphologically, it is characterised by DNA fragmentation, cellular shrinkage, plasma membrane blebbing and formation of apoptotic bodies. Apoptosis also releases ‘eat me’ signals for phagocytic cells to engulf the dying cells, such as exposure of phosphatidylserine on the outer leaflet of the plasma membrane (Galluzzi et al., 2018). Although frequently regarded as a non-immunogenic form of cell death due to its rapid clearance by phagocytic cells, recent experimental data suggest that apoptosis can trigger the immune response by the release of damage-associated molecular patterns (DAMPS) into the tissue microenvironment, such as ATP and high-mobility group box 1 protein (HMGB1), in some contexts (Vandenabeele et al., 2016). In addition, apoptotic cells can undergo inflammatory secondary necrosis mediated by cell surface proteins known as gasdermin E (GSDME) (Rogers et al., 2017; Wang et al., 2017) and NINJ1 (Kayagaki et al., 2021).

Apoptosis is defined as intrinsic or extrinsic depending on the source of the activating stimulus (Figure 1.1). Regardless of how it is activated, both the so-called extrinsic and

3 intrinsic apoptotic signalling pathways converge on activation of the same Cysteine Aspartic acid proteases (caspases) to yield similar morphological and functional outcomes (Figure 1.1).

Figure 1.1. Comparison between intrinsic and extrinsic apoptosis.

The source of intrinsic apoptosis stems from within a cell, e.g. DNA damage or nutrient deprivation. The stimulus does not engage any membrane receptor, but activates BH3- only proteins which transmit the signal to induce BAX- BAK-mediated apoptosis. In contrast, extrinsic apoptosis begins with death receptor activation, for example FAS receptor, which activates caspase-8-mediated apoptosis independent of BAX and BAK. However, in some cell types, extrinsic stimulus also activates tBID which induces BAX and BAK. Both intrinsic and extrinsic apoptosis are mediated by the apoptotic caspase cascade, which converges on effector caspase-3 and caspase-7 activation. MOMP: mitochondrial outer membrane permeabilisation. Figure was adapted from “Apoptosis Extrinsic and Intrinsic Pathways”, by BioRender.com (2021). Retrieved from https://app.biorender.com /biorender-templates.

1.4.1 BAX and BAK are the gatekeepers to death from within Intrinsic apoptosis is governed by a family of B cell CLL/lymphoma-2 (BCL-2) proteins identifiable by presence of BCL-2 homology (BH) domains. Members of the family can be further classified as either anti-apoptotic or pro-apoptotic (Czabotar et al., 2014). The interplay between the two opposing groups ultimately dictates whether cells survive or commit suicide.

In healthy cells, the anti-apoptotic BCL-2 members keep the pro-apoptotic effectors Bcl-2-associated X protein (BAX) and Bcl-2 homologous antagonist killer (BAK) in their inactive states (Czabotar et al., 2014). The anti-apoptotic BCL-2 family consists of BCL-2 itself, BCL-2- related gene A1 (BFL-1), BCL-W, BCL-long isoform (BCL-XL), and myeloid cell leukemia 1 (MCL1). However, when cells are stressed from growth factor deprivation or DNA damage, pro-apoptotic BH3-only proteins, such as BH3-interacting domain death agonist (BID) and BCL-2-interacting mediator of cell death (BIM), become active and antagonise the anti- apoptotic proteins to release BAX and BAK from their off state—known as indirect activation model. Certain BH3-only proteins, such as truncated BID (tBID) and BIM, can directly interact with and activate BAX and BAK. In both indirect and direct models, active BAX and BAK oligomerise to induce mitochondrial outer membrane permeabilization (MOMP) which causes cytochrome c release from the mitochondrial intermembrane space to the cytoplasm.

MOMP is a point-of-no-return for the cell as cytochrome c rapidly binds to apoptotic protease activating factor-1 (APAF-1) to trigger its oligomerisation into an apoptosome, a platform for initiating activation of a cascade of caspases (Tait and Green, 2010). Beginning with caspase-9, its activation in the apoptosome leads the protease to cleave and promote caspase-3 and caspase-7 to further execute cleavage of numerous different substrates, ultimately resulting in the phenotypic changes occurred during apoptosis. Apart from cytochrome c, other mitochondria-resident proteins are also released into the cytoplasm to promote apoptotic death, in particular, second mitochondria-derived activator of caspases (SMAC) (Du et al., 2000; Verhagen et al., 2000). SMAC degrades Inhibitor of Apoptosis Proteins (IAPs) which consist of cellular IAP 1 (cIAP1), cIAP2, and X-linked Inhibitor of Apoptosis (XIAP) (Silke and Meier, 2013). The IAPs prevents apoptosis induction by inhibiting caspase activity (Deveraux et al., 1998). Therefore, SMAC-mediated removal of IAPs allows an unrestrained caspase cascade, resulting in the efficient cell death known as apoptosis.

1.4.2 From bench to bedside: how elucidation of intrinsic apoptosis has led to drugs development Activating mutations in anti-apoptotic BCL-2 family have been linked to diverse cancers. Indeed, approximately 10-15% human cancers exhibit amplifications of the genes encoding

MCL1 or BCL-XL (Beroukhim et al., 2010). In follicular lymphomas, at least 50% cases can be attributed to t14:18 chromosomal translocations, which drive overexpression of BCL-2 (Tsujimoto et al., 1985). In addition, high expression of oncogenic BCL-2 has been associated with chronic lymphocytic leukemias (CLLs) (Pekarsky et al., 2018). As such, targeting the BCL- 2 members to restore cellular apoptotic capability has been of therapeutic interest. One method is through the use of BH3 mimetics that mimic the pro-apoptotic BH3-only proteins in binding and inactivating BCL-2 members (Delbridge et al., 2016). The experimental BH3 mimetic ABT-737, and its orally active variant, Navitoclax, were the first generation of drugs used to inhibit BCL-2, BCL-XL, and BCL-W. Subsequently, a newer generation of BH3 mimetics, represented by Venetoclax, was developed to specifically target BCL-2 (Merino et al., 2018). Venetoclax is the only BH3 mimetic that has been approved for treatment of CLL and acute myeloid leukemia (AML) which has produced substantial responses, even in patients with relapsed or chemotherapy refractory cases (Konopleva et al., 2016; Roberts et al., 2016; Stilgenbauer et al., 2016).

1.4.3 Apoptosis via death receptor signalling Unlike the intrinsic pathway, which relies on BAX and BAK, cells can also undergo apoptosis extrinsically in a caspase-8-dependent manner through ligation of death receptors (DRs). The DRs are subgroup of the tumour necrosis factor (TNF) receptor superfamily (TNFRS) of cytokines characterized by the presence of a death domain (DD) in their cytoplasmic segments. There are six human DRs identified so far: TNF receptor 1 (TNF-R1), FAS (CD95), TRAMP (DR3), TNF-related apoptosis-inducing ligand (TRAIL) receptor 1 and 2 (TRAIL-R1 and TRAIL-R2, respectively), and DR6. The cognate ligands of these DRs are lymphotoxin-alpha (LT-α) and TNF, FASL (CD95L), TL1A, and TRAIL respectively, while the ligand for DR6 remains disputed (Walczak, 2013). All DRs utilise a primary platform adaptor to transduce their signals, either FADD (FAS Associated Death Domain) or TRADD (TNF Receptor Associated Death Domain).

The FAS, TRAIL-R1, and TRAIL-R2 receptors use the pro-apoptotic adaptor molecule FADD to directly recruit caspase-8 to their intracellular region, leading to a complex formation

6 known as death-inducing signalling complex (DISC). The DISC platform catalyses the activation of caspase-8 to initiate the caspase cascade which ultimately demolishes the cell (Walczak, 2013; Wertz and Dixit, 2010). Although, upon ligation, DRs can directly signal via the caspase- 8/3/7 axis to effectively kill cells, in some cell types, such as the hepatocytes, DR-mediated apoptosis requires additional caspase-8-induced activation of pro-apoptotic BID into tBID to activate BAX and BAK and thereby pass the death threshold (Li et al., 1998; Yin et al., 1999). tBID is therefore a key molecule which connects death receptors to the mitochondrial apoptosis pathway (Figure 1.1).

In contrast to FADD which generally commits a cell to apoptosis, the TRADD adaptor induces gene transcription for inflammatory response to infection, in addition to apoptotic signalling (Figure 1.2). The two DR members known to utilise the TRADD adaptor molecule are TNF-R1 and TRAMP. When these receptors are induced, TRADD initiates formation of a receptor signalling complex (RSC) at the plasma membrane, known as Complex I, by serving as an assembly platform for additional downstream effector proteins, such as receptor interacting protein kinase-1 (RIPK1), TNF receptor associated factor-2 (TRAF2), and cIAPs (Walczak, 2013). cIAPs subsequently ubiquitylate components of Complex I, such as RIPK1, to recruit a secondary ubiquitin ligase known as the linear ubiquitin chain assembly complex (LUBAC). Both cIAPs and LUBAC are crucial for decorating the Complex I with different ubiquitin linkages to serve as a platform for activating IB kinase (IKK) and TAB/TAK complexes. The IKK complex consists of IKK, IKK, and IKK (NEMO) subunits, while the TAB/TAK complex consists of transforming growth factor-β (TGFβ)-activated kinase 1 (TAK1). Both IKK and TAB/TAK complexes are effectors of the NF-B, mitogen-activated protein kinases (MAPKs), and c-Jun N-terminal kinase (JNK) pathways ultimately responsible for driving production of inflammatory cytokines during infection. Other key transcriptional targets of TNF-RSC include cellular FLICE-like inhibitory protein (cFLIP) and deubiquitylating enzyme A20. cFLIP is an enzymatically inactive homolog of caspase-8 which inhibits caspase- 8 activity, thus preventing it from inducing cell death (Tsuchiya et al., 2015). Meanwhile, A20 exerts an anti-inflammatory role by providing a negative feedback to the NF•B pathway and also restricts cell death (Boone et al., 2004; Duong et al., 2015; Lee et al., 2000; Wertz et al., 2004).

Figure 1.2. TNFR1 signalling promotes cell survival under normal conditions, but has a deadly outcome when compromised. TNF engagement of TNFR1 leads to recruitment of the adaptor protein TRADD and subsequent assembly of membrane-bound Complex I. The outcome of Complex I assembly is NF-B-mediated transcription of A20, cFLIP, and inflammatory cytokines. However, in conditions of reduced cIAP1/2, LUBAC, or cFLIP, Complex I dissociates and cytosolic RIPK1, in particular, proceeds to assemble Complex II for caspase-8 activation. Active caspase-8 subsequently triggers apoptosis.

The pro-survival role of TNF-RSC can switch to a death-promoting role when a promoter of the TNFR1-mediated NF-B pathway is disrupted. For example, loss of E3 ligases cIAPs or LUBAC (Peltzer et al., 2014; Silke and Vaux, 2015), or loss of TAK1 (Dondelinger et al., 2013) can lead to disintegration of Complex I. As a consequence, RIPK1, or TRADD, detaches from the complex and proceed in recruiting FADD and caspase-8 to assemble a cytosolic complex, dubbed Complex II, to trigger apoptosis (Figure 1.2). Under some circumstances and cell types, another member of RIP kinase family, RIPK3, can serve as a scaffold to facilitate Complex II formation and activation (Dondelinger et al., 2013). Other NF-B signalling

8 components, in particular IKK and IKK, are also involved in phosphorylating RIPK1 to prevent its activation (Dondelinger et al., 2015). As such, loss of either kinase is sufficient to induce RIPK1-driven apoptosis. Disruption of NF-B signalling also results in reduced cFLIP production so that the cell can no longer restrain caspase-8 activity, thus accelerating apoptosis (Wang et al., 2008). In addition to blocking apoptosis, cFLIP is also indispensable in restraining another form of regulated cell death known as necroptosis, and it does so by promoting the enzymatic activity of a FADD-caspase-8 complex which cleaves RIPK1 and RIPK3 to inactivate these two key players of the necroptotic death pathway (Tsuchiya et al., 2015). As such, cFLIP-/- lethality can only be reversed by combined deletion of FADD and RIPK3 (Dillon et al., 2012).

1.4.4 Can DR signalling be exploited to defend against cancer? Cell culture and animal studies have demonstrated the ability of TRAIL to kill certain cancer types such as fibrosarcoma, which raises the avenue of developing TRAIL agonists either in the form of TRAIL ligand or receptor-activating antibodies.(Yang et al., 2010). The anti-tumour effect of TRAIL is partly attributed to its role in promoting natural killer (NK) cell function in tumour surveillance. As such, TRAIL-deficient mice are susceptible to tumour development and metastasis (Cretney et al., 2002; Takeda et al., 2002). Although well-tolerated in healthy cells, the clinical trials of TRAIL agonists such as Dulanermin, Mapatumumab and Drozitumab have been stagnant, with progression of some agents halted due to lack of clinical response.

1.5 Necroptosis: a non-universal genetically programmed necrosis as an extra barrier against pathogen infections While apoptosis is the best studied form of cell suicide, many cell types are also equipped with another programmed, but inflammatory, form of cell death known as necroptosis (Figure 1.3). The term ‘necroptosis’ was coined in 2005 upon discovery of a novel compound, Necrostatin-1 (Nec-1), which could block RIPK1-dependent programmed necrotic death (Degterev et al., 2005; Holler et al., 2000). These early studies serve as a tipping point in necroptotic research, and in less than a decade, two additional core components of necroptosis downstream of RIPK1, namely RIPK3 and MLKL, have been identified through genetic studies (Cho et al., 2009; Sun et al., 2012).

Figure 1.3. The blueprint for necroptosis.

Activation of either TNFR1, TLR3/4, DAI (ZBP1), or IFNR serves as a gate to cellular demise by necroptosis when the levels of IAPs and caspase-8 catalytic activity are reduced. Depletion of both of these necroptotic brakes can be achieved by SMAC mimetic and pan- caspase inhibitor (e.g. IDN-6556, z-VAD or QVD) treatment. In the standard model, necroptosis induction requires RIPK1, RIPK3, and MLKL. This event is inhibitable by Nec-1 treatment. However, in some cases, such as viral dsDNA detection by DAI, RIPK1 is dispensable, and necroptosis can proceed through the DAI-RIPK3-MLKL axis instead.

Although the necroptosis pathway hinges on the RIPK1-RIPK3-MLKL molecular trio, phylogenetic analysis surprisingly reveals a poor conservation of RIPK3 and MLKL across the animal kingdom, challenging the universality of this cell death modality (Dondelinger et al., 2016; Newton and Manning, 2016). A number of vertebrates lack the RIPK3 and/or MLKL genes such as zebrafish, chicken, cat, dog, wallaby, and Tasmanian devil. This observation is surprising given that RIPK3 and MLKL are indispensable for necroptosis induction in human and mouse. Unlike RIPK3 and MLKL, RIPK1 is more ubiquitously expressed in the animal 10 kingdom. This might be potentially due to RIPK1 serving as a master regulator of other cell death and inflammatory signalling pathways, apart from its canonical role in necroptosis induction (Silke et al., 2015). Despite minimal conservation, some species such as the sea urchin and acorn worm possess RIPK3- or MLKL-like proteins which might represent RIPK3 or MLKL orthologues capable of triggering necroptosis (Dondelinger et al., 2016). Alternatively, it is possible that RIPK3- or MLKL-deficient animals can still induce necroptosis via a non- canonical signalling that is yet to be identified.

In organisms equipped with complete necroptotic machineries, several scenarios of non-canonical necroptosis induction have been identified. For example, overexpression of RIPK3 was reported to induce necroptosis in TNF-treated Ripk1-/- mouse embryonic fibroblasts (MEFs), suggesting that RIPK1 is dispensable for RIPK3 to activate MLKL in some contexts (Moujalled et al., 2013). RIPK1 is also not required in the context of cytomegalovirus infection whereby a cytosolic Z-DNA/Z-RNA sensor known as Z-DNA binding protein 1 (ZBP1/DAI/DLM-1) can bypass the requirement of RIPK1, and form an oligomer with RIPK3 via RIP homotypic interaction motif (RHIM)-RHIM domain interactions to activate MLKL and induce necroptosis (Figure 1.3) (Nailwal and Chan, 2019; Upton et al., 2012). In addition to RIPK1 dispensability in certain contexts, RIPK3 is also not required for cell death in a mouse strain exhibiting spontaneous MLKL activation resulting from a D139V missense mutation (Hildebrand et al., 2020).

The expression of necroptotic components can also vary across different cell types at the species level. This is best exemplified by the minimal expression of MLKL in the human central nervous system (Dermentzaki et al., 2019; Wang et al., 2020). The lack of necroptotic machinery in numerous species suggest that the necroptosis pathway likely serves as a backup defence mechanism in the event that a cell death pathway, such as apoptosis, is blocked. Indeed, many pathogens have evolved different strategies in inhibiting DR apoptotic components. For example, several types of herpesvirus encode a viral version of caspase-8, viral FLICE-inhibitory proteins (vFLIP), to facilitate their survival by interfering with host caspase-8 activation (Bertin et al., 1997; Thome et al., 1997). Bacterial pathogens have also developed elegant invasion mechanisms to promote their replication and survival, such as by activating the pro-survival NF-B signalling or by upregulating the anti-apoptotic players (Eng et al., 2021; Robinson and Aw, 2016).

Most studies to date have used genetic and/or pharmacological inhibition to block the E3 ligases cIAP1/2 and caspase-8 upon receptor activation to induce necroptosis (Grootjans et al., 2017). The use of SMAC mimetics, such as Compound A and Birinapant, mimic endogenous SMAC in targeting the IAPs for proteasomal degradation, while pan-caspase inhibitors such as IDN-6556, z-VAD, and Q-VD-OPh (QVD) can be used to deactivate the catalytic activity of most caspases (Brumatti et al., 2016; Vince et al., 2007). In conditions of reduced IAPs and caspase activity, stimulation from either DRs (e.g. TNFR1, FAS, TRAIL-R), Toll-like receptors (TLRs; e.g. TLR3 and TLR4), or Interferon receptors (IFNRs) promote formation of a RIPK1-RIPK3 cell-death inducing platform known as a necrosome (Cho et al., 2009; Tenev et al., 2011) (Figure 1.3). Necrosome formation is mediated via the RHIM-RHIM interaction between RIPK1 and RIPK3 which adopts a functional hetero-amyloidal structure (Mompean et al., 2018) with the RIPK3 kinase domain capable of phosphorylating the necroptotic executioner MLKL (Sun et al., 2012; Wang et al., 2014a; Zhao et al., 2012). Although MLKL is known to trigger cellular disintegration, it does not localise exclusively to the plasma membrane, and has been reported to bind to numerous organelles preceding cell death such as the endosome, mitochondria, endoplasmic reticulum (Samson et al., 2021; Wang et al., 2014a; Yoon et al., 2017), and potentially autophagic organelles including autophagosomes, autolysosomes and lysosomes (Frank et al., 2019).

The precise choreography of MLKL-mediated killing is unclear. This pseudokinase necroptotic executioner comprises of two functional domains bridged by a two-helix linker (known as the brace region): an N-terminal four-helix bundle (4HB) and a C-terminal pseudokinase domain (Petrie et al., 2017). The 4HB domain is dubbed the ‘killer’ domain as it is capable of rupturing membranes (Dondelinger et al., 2014; Quarato et al., 2016; Wang et al., 2014a), whereas the C-terminal pseudokinase domain functions as a molecular switch that is toggled by RIPK3 phosphorylation (Murphy et al., 2013; Sun et al., 2012). The current necroptotic model suggests that once RIPK3 triggers the pseudokinase switch via phosphorylation, MLKL undergoes a conformational change which leads to oligomerisation of the MLKL 4HB, and subsequent translocation to the plasma membrane to cause membrane rupture (Cai et al., 2014; Chen et al., 2014b; Dondelinger et al., 2014; Wang et al., 2014a). Nevertheless, numerous gaps in our understanding still exist. MLKL mutagenesis studies suggested, for instance, that MLKL oligomerisation and membrane association are insufficient

12 in itself to cause cell death, implying additional factors are needed to complete the killing process (Hildebrand et al., 2014). The action of MLKL at the plasma membrane remains elusive with at least 4 proposed models to date: (i) 4HB domain-mediated partial insertion, (ii) a scaffold for transporter/ion channel-driven osmolysis, (iii) reconfiguration of 4HB domain into a selective cation channel, and (iv) brace region-mediated MLKL oligomerisation (Petrie et al., 2017). In addition, it is unlikely that MLKL is a solo player in executing its cell death function. Activation of MLKL had been thought to be a point-of-no-return during necroptosis. However, the ESCRT-III complex was recently shown to extrude and/or allow repair of the MLKL-damaged plasma membrane, and is thereby capable of resuscitating cells containing activated MLKL (Gong et al., 2017). Similarly, an independent study also proposed the association of MLKL with the endosomal pathway, which culminates in the release of phospho-MLKL-containing exosomes into the extracellular space to promote cell survival (Fan et al., 2019; Yoon et al., 2017).

As a lytic form of cell death, necroptosis triggers release of multiple DAMPs into the extracellular environment to initiate inflammatory responses. These DAMPs include HMGB1 and interleukin-1 alpha (IL-1). Whether there exist DAMPs specific to the mode of cell death has been of tremendous interest to the field. One of the IL-1 family members, IL-33, has been suggested as a potential candidate for necroptotic-specific DAMP (Frank and Vince, 2019). Elevated IL-33 cytokine was reported in the plasma of Ripk1-/- mice (Rickard et al., 2014) and also necroptotic epidermal keratinocytes (Kovalenko et al., 2009). In an effort to distinguish between apoptosis and necroptosis, recent mass spectrometry-based proteomics have identified lysosomal components, such as cathepsin B and cathepsin D, which are released only in necroptotic but not in apoptotic cells (Tanzer et al., 2020). Whether these cathepsins are released during pyroptosis, another form of lytic cell death, warrants further investigation.

Several studies support the idea that necroptosis promotes host survival upon infection. The benefit is especially observable during viral invasion, as exemplified by vaccinia virus-infected cells which are incapable of undergoing apoptosis (Dobbelstein and Shenk, 1996; Wasilenko et al., 2003) and pyroptosis (Gerlic et al., 2013). To defend against viral hijacking, infected cells activate necroptosis to limit viral replication in vivo (Cho et al., 2009). Necroptosis as a mechanism of host antiviral defence was also observed in herpes simplex virus type 1 and type 2 infection, in which their respective viral ICP6 and ICP10 proteins

13 interacted with the RHIMs of RIPK1 and RIPK3 to trigger necroptotic cell death (Huang et al., 2015; Wang et al., 2014b). Consequently, mice lacking Ripk3 exhibited impaired control of viral replication and pathogenesis. In addition to providing antiviral defence, recent work has associated necroptotic cells in a tumour microenvironment with improved antitumour immunity (Snyder et al., 2019). Introducing necroptotic fibroblast resulting from RIPK3 overexpression showed significant reduction in tumour burden and improved survival across various cancer models such as ovarian and skin cancers. Interestingly, tumour control was not observed when apoptotic fibroblasts were introduced, suggesting the antitumour immunity was specific to necroptosis signalling.

Despite serving as an efficient back-up antimicrobial defence, engagement of RIPK1- RIPK3-MLKL signalling can also result in pathological outcomes. As a lytic form of cell death, necroptosis has been implicated in TNF-driven systemic inflammatory response syndrome (SIRS) (Duprez et al., 2011; Linkermann et al., 2012a; Newton et al., 2014) and kidney ischemia-reperfusion injury (Lau et al., 2013; Linkermann et al., 2012b). Loss of MLKL ameliorates RIPK1-driven SIRS and epidermal hyperplasia (Rickard et al., 2014), and potentially cerulean-induced acute pancreatitis (Wu et al., 2013). Moreover, although viral- induced necroptosis favours the host, recent work showed that influenza A virus (IAV) drives DAI-mediated host necroptosis in the lung epithelia which activates neutrophils and subsequent inflammatory pathology (Zhang et al., 2020).

1.5.1 The yin and yang nature of RIPK3: how a kinase is both pro-survival and pro-death RIPK3 is one of the seven members of the RIP kinases, and is composed of an N-terminal kinase domain and a C-terminal RHIM motif of 18 residues (Humphries et al., 2015). RIPK3, together with RIPK1, are the only two kinases in the family equipped with a RHIM motif to allow them to connect to form an active necrosome. Other mammalian proteins with identified RHIMs that can interact with RIPK1 and RIPK3 to drive necrosome formation and necroptosis are the TIR-domain-containing adapter-inducing interferon-β (TRIF) and DAI (Kaiser et al., 2013b). Notably, RIPK3 can also drive caspase-8 activation, and has therefore been implicated in apoptosis, in addition to numerous cell death-independent events (Figure 1.4).

Figure 1.4. The dual nature of RIPK3 as pro-survival (yang) and pro-death (yin) kinase.

Although RIPK3 has been traditionally dubbed as a pro-necroptotic kinase, silencing its kinase activity activates the scaffolding function of RIPK3 in ripoptosome-induced apoptosis. Moreover, numerous studies have unveiled the ‘yang (bright)’ form of RIPK3 in regulating numerous physiological processes to promote cell survival, independent of its ‘yin (dark)’ aspect in promoting cell death. The yin and yang nature of RIPK3 are interconnected as inducing inflammation also accompanies death in most cases (e.g. TLR4- caspase-8-induced apoptosis), and vice versa (e.g. DAI-mediated NF-B activation).

RIPK3 can switch from being a necroptosis inducer to a pro-apoptotic adaptor when its kinase activity is disrupted, or in certain cell types when IAPs are removed, such as macrophages (Lawlor et al., 2015). RIPK3-mediated apoptosis is readily observed in mice engineered to express a catalytically inactive RIPK3 D161N which die during embryogenesis

(Mandal et al., 2014; Newton et al., 2014). Alternatively, RIPK3 kinase inhibitors, GSK’843 or GSK’872, also trigger apoptosis, while at the same time blocking necroptosis (Mandal et al., 2014). In both genetic and pharmacological interventions, the kinase-dead RIPK3 serves as a scaffold for Complex II formation consisting of RIPK1-caspase-8-FADD-cFLIP capable of inducing apoptosis. Indeed, deletion of caspase-8 rescues the RIPK3 D161N mice from embryonic lethality (Newton et al., 2014). Mechanistically, both the kinase-inactive RIPK3 D161N and GSK’872-mediated RIPK3 kinase inhibition induces RIPK1-RIPK3 heterodimerisation that allows for FADD and caspase-8 binding (Raju et al., 2018). When the dimerisation is interrupted, for instance in kinase-dead RIPK3 K51A or RIPK3 R69H, apoptosis does not occur.

Independent of necroptosis or apoptosis induction, activated RIPK3 also promotes transcriptional responses (Figure 1.4). As previously mentioned, cytomegalovirus-induced DAI activation engages with RIPK3 directly to induce necroptosis. However, RIPK3 also allows for efficient DAI-induced NF-B activation (Rebsamen et al., 2009). In support of this pro- inflammatory role of RIPK3, another group demonstrated that when bone marrow derived macrophages (BMDMs) are subjected to lipopolysaccharide (LPS) treatment, a major component of the outer membrane of Gram-negative bacteria, RIPK3 upregulates expression of genes encoding inflammatory mediators, such as TNF, independent of its role in necroptosis (Najjar et al., 2016; Wong et al., 2014). This event occurs in a TLR4-TRIF- dependent manner and requires RIPK3 kinase activity, unveiling an additional function of the kinase domain independent of its phosphorylation of MLKL. Furthermore, in IAP-depleted BMDMs challenged with LPS, RIPK3 promotes activation of the pro-inflammatory cytokine IL- 1, and contributes to disease severity in a mouse model of autoantibody-mediated arthritis, which is driven by IL-1 signalling (Lawlor et al., 2015). In agreement with these studies, RIPK3-mediated expression of IL-1, IL-22, and IL-23 was reported in mice challenged with dextran sodium sulfate (DSS), a sulfated polysaccharide which triggers colon injury and used as a model for colitis (Moriwaki et al., 2014). Mechanistically, it was proposed that RIPK3 promotes the nuclear translocation of the NF-kB RelB-p50 dimer in bone marrow derived dendritic cells (BMDCs), which mediates the transcription of numerous cytokines, including IL-1, IL-22, and IL-23. Collectively, these observations suggest that whether RIPK3 ultimately

16 promotes host survival is a case-by-case situation; while having RIPK3 is detrimental in an arthritis model, its presence helps to alleviate DSS-induced colitis.

A recent study suggests that RIPK3 limits pathogenicity of Zika virus indirectly by altering cellular metabolism (Daniels et al., 2019). It was proposed that when DAI senses viral RNA, it activates RIPK1 and RIPK3 to induce nuclear translocation of interferon regulatory factor 1 (IRF1). Active IRF1 drives transcriptional responses, in particular, the Immune- Responsive Gene 1 (IRG1) mitochondrial enzyme which produces the metabolite, itaconate, that ultimately limits Zika viral replication (Figure 1.4). Importantly, these findings demonstrated that activation of DAI, RIPK1, and RIPK3 in the context of Zika virus infection does not trigger cell death.

1.6 Pyroptosis is a gasdermin-mediated pro-inflammatory cell suicide triggered in response to infection and cellular stressors Pyroptosis was first described in 1992 upon discovering that Shigella flexneri induced the suicide of infected macrophages (Zychlinsky et al., 1992). However, the term ‘pyroptosis’ (derived from the Greek roots to denote falling fire) was not coined until 2001 when it was revealed that caspase-1 is responsible for killing bacteria-infected macrophages (Cookson and Brennan, 2001). Similar to necroptosis, pyroptosis is a lytic form of programmed cell suicide which eventuates in the release of DAMPs to signal the immune system. These DAMPs include the broadly released HMGB1 and IL-1, but can also be potentially specific such as ASC specks, which are adaptor proteins required for caspase-1 recruitment to inflammasome sensor protein NLRP3 (Frank and Vince, 2019).

Cells are equipped with several types of multiprotein signalling complexes known as the inflammasomes. Some inflammasomes respond only to a specific cellular insult, while others recognise diverse stimuli. The absent in melanoma 2 (AIM2), and NOD-like receptor (NLR) family members such as NLRP3 and NLRC4 are among the best studied inflammasomes (Broz and Dixit, 2016; Latz et al., 2013). The AIM2 inflammasome binds and is activated by cytosolic double-stranded DNA (Fernandes-Alnemri et al., 2010; Jones et al., 2010; Rathinam et al., 2010), while the NLRP3 inflammasome can recognise a wide array of pathogen- associated molecular patterns (PAMPs), ranging from microbial and viral molecules, ATP, uric acid crystals and other particle types, such as silica and aggregated proteins. Detection of

17 these DAMPs and PAMPs is carried out indirectly via NLRP3 sensing decreased intracellular potassium levels which leads to NEK7 (NIMA-related kinase 7) association with NLRP3 to trigger its oligomerization and signaling (He et al., 2016; Munoz-Planillo et al., 2013).

Activation of inflammasome sensors results in recruitment and cleavage of the inflammatory caspase, caspase-1 (Figure 1.5). Most inflammasome sensor proteins, including NLRP3, recruit caspase-1 through the adaptor protein named apoptosis-associated speck-like protein containing a CARD (ASC). ASC serves as a platform for auto-processing of pro-caspase- 1 to its catalytically active full-length p46 and truncated p33/p10 subunits (Boucher et al., 2018). Interestingly, the p33/p10 subunits only exist transiently as they are rapidly auto- processed into p20/p10 units to terminate caspase-1 activity, thus preventing prolonged inflammasome signalling. Although caspase-1 is regarded as the canonical caspase in pyroptosis, recent research has uncovered the ability of other caspases such as caspase-11 (and its human orthologues caspases-4 and -5) to participate in pyroptotic suicide under certain conditions (Kayagaki et al., 2011). However, caspase-4/5/11 does not directly process IL-1 and IL-18 like caspase-1 does (Ramirez et al., 2018); their ability to activate these cytokines is an indirect consequence of gasdermin D (GSDMD)-triggered potassium efflux, which in turn induces NLRP3 inflammasome activation (Baker et al., 2015; Ruhl and Broz, 2015). In addition to caspase-1/4/5/11, the apoptotic caspase-3 is also capable driving pyroptosis upon treatment with chemotherapeutic drugs (Rogers et al., 2017; Wang et al., 2017), suggesting a potential crosstalk of caspases in multiple cell death pathways.

Figure 1.5. Pyroptosis is a gasdermin-mediated mode of cell death.

The most well-characterised gasdermin member is GSDMD, which executes pyroptosis upon its activation by caspase-1. While numerous stimuli have been identified to trigger GSDMD, the physiological context for activation of other gasdermin member GSDME is chemotherapy treatment and for GSDMC it is hypoxic stress. Under cisplatin or etoposide treatment, active caspase-3 directly cleaves GSDME. In contrast, hypoxia upregulates GSDMC which is cleaved by caspase-8 to trigger pyroptosis. Similarly, other caspases, caspase-4/5/8/11, serve as a direct sensor in response to LPS challenge which proceeds to cleave GSDMD. However, caspase-1 requires the NLRP3 inflammasome sensor to regulate its activity. Apart from executing death, active GSDMD and GSDME also trigger DAMPs release, with GSDMD also delivering additional pro-inflammatory IL-1 and IL-18 into the extracellular milieu.

Activated caspase-1 performs two major roles to complete the pyroptosis process (Figure 1.5). Firstly, active caspase-1 cleaves and induces the final executor of pyroptosis GSDMD, leading to perforation of the plasma membrane. There are 6 members of the gasdermin family that have been identified: GSDMA, GSDMA3, GSDMB, GSDMC, GSDMD, and

GSDME (Kovacs and Miao, 2017; Shi et al., 2017). However, only GSDMC, GSDMD and GSDME have been characterised as the substrates of caspases to date. Caspases-1, 4, 5, and 11 utilise GSDMD as their death executioner (Kayagaki et al., 2015; Shi et al., 2015). Unlike caspase-1 which needs the inflammasome sensor for its activation, caspase-4, 5, and 11 can directly sense intracellular LPS to activate GSDMD (Shi et al., 2014). In addition to the 4 caspases, caspase-8 has also been implicated in GSDMD-induced pyroptosis when cells are devoid of TAK1 (Orning et al., 2018). While there are multiple caspases which can activate GSDMD, only caspase-8 and caspase-3 are known to mediate GSDMC- and GSDME-induced pyroptosis respectively (Hou et al., 2020; Rogers et al., 2017; Wang et al., 2017). GSDMC is upregulated under hypoxia stress (Hou et al., 2020), while GSDME becomes active under cisplatin or etoposide treatment (Rogers et al., 2017; Wang et al., 2017). The second major role of active caspase-1 is to cleave precursors of pro-inflammatory cytokines IL-1 and IL-18 into their active forms ready to be released into the extracellular space (Fantuzzi and Dinarello, 1999; Kostura et al., 1989; Thornberry et al., 1992), thus contributing to the pro-inflammatory nature of pyroptosis.

Activated caspase-1 cleaves the linker region within GSDMD to free its N-terminal domain (GSDMD-N) from its inhibitory C-terminal domain (GSDMD-C), and the release of GSDMD-N is indispensable in forming oligomeric death-inducing pores on the inner leaflet of the plasma membrane (Ding et al., 2016; Kayagaki et al., 2015; Liu et al., 2016; Sborgi et al., 2016; Shi et al., 2015). Similar to MLKL, the monomer-to-oligomer transition of GSDMD-N is an essential step in pore formation (Chen et al., 2016). The N-GSDMD oligomers form pores with ring diameters of approximately 10-20 nm (Ding et al., 2016; Sborgi et al., 2016) to mediate ion flux, and release of DAMPs and pro-inflammatory cytokines IL-1 and IL-18 prior to complete cell lysis or, in some cases, even independent of cell death (Chen et al., 2014a; Conos et al., 2016; de Vasconcelos et al., 2019).

Similar to necroptosis, the pyroptosis pathway is also a double-edged sword whereby the impact on the host is cell-type and context-dependent. Pathogens can promote their survival by hijacking the pyroptotic machineries to trigger cell death. When the host is challenged with E. coli, for instance, GSDMD activity causes neutrophil death which leads to a diminished host antibacterial response (Kambara et al., 2018). In an HIV-infected host, more than 95% of CD4 T-cell death is driven by caspase-1-mediated pyroptosis (Doitsh et al., 2014).

The dying T-cell also contributes to chronic inflammation as they release pro-inflammatory cytokines, including IL-1, to attract more cells to die. Excessive pyroptosis in hematopoietic progenitor cells also accounts for leukopenia and immune suppression in mice carrying auto- activating NLRP1 (Masters et al., 2012). Nevertheless, pyroptosis is pivotal for optimal control of bacterial infections as evident from reduced survival in caspase-1-deficient mice upon infection with Salmonella typhimurium (Aachoui et al., 2013; Doerflinger et al., 2020; Miao et al., 2010), Burkholderia thailandensis (Aachoui et al., 2015; Aachoui et al., 2013), Chromobacterium violaceum (Maltez et al., 2015), and Legionella pneumophila (Aachoui et al., 2013).

1.7 Diverse cell death pathways translate to maximum protection from infection Why do cells have so many ways to die? Are the seemingly distinct cell death pathways interconnected? As alluded to earlier, the different flavours of cell death reflect the constant ongoing need from the host to adapt to the constantly evolving pathogen invasion strategy. Apart from providing more choice, recent studies have also unravelled the plastic feature of the cell death modes as an additional layer of protection. The high degree of flexibility is observable in Salmonella infection in vitro and in vivo (Doerflinger et al., 2020). Salmonella- infected macrophages primarily commit to caspase-1-driven pyroptosis, however, caspase-8 can substitute and drive apoptosis in the event that caspase-1 is unavailable. If both caspase- 1 and caspase-8 are absent, caspase-11 is in charge in ensuring infected cells are still able to undergo GSDMD-mediated pyroptosis. A similar compensation mechanism is also present in Legionella infection (Mascarenhas et al., 2017) and in caspase-1-deficient intestinal epithelial organoids (Van Opdenbosch et al., 2017). Furthermore, recent work has unveiled the flexible nature of caspase-1-mediated death; while inducing pyroptosis in the presence of GSDMD, caspase-1 can also activate caspase-3-dependent apoptosis in the event that GSDMD is unavailable (Tsuchiya et al., 2019). Together, these studies reveal the crosstalk between pyroptosis and apoptosis which ultimately translates to improved host survival.

Some of the cell death machinery is capable of executing a non-canonical death mode when their default route is compromised. As alluded in section 1.5.1, although RIPK3 plays a canonical role in necroptosis, its scaffolding function in caspase-8-dependent apoptosis is unleased when RIPK3 kinase activity is absent. Another example is caspase-8, which serves as an arbiter of cell fate signalling by deciding the cellular execution method in a context-

21 dependent manner. In cells incapable of executing apoptosis due to loss of caspase-8 catalytic activity, the enzymatically inactive caspase-8 can still trigger lethality by acting as a scaffold to facilitate caspase-1- or caspase-11-driven cell death (Fritsch et al., 2019; Newton et al., 2019) that is yet to be fully understood.

1.8 Ubiquitylation as a critical regulator of cell death signalling 1.8.1 The ubiquitin system involves building and breaking chains Covalent attachment of small functional groups or biomolecules to the side chains or termini of an amino acid, referred as post-translational modifications (PTMs), enables a living system to amplify the functional diversity and complexity of their proteome. Some of the most experimentally observed PTMs include phosphorylation, acetylation, N- and O-linked glycosylation, and ubiquitylation (Khoury et al., 2011). Importantly, PTMs are non-permanent which enable the modified substrate to return to its original state, and therefore, PTM machineries can be broadly classified based on whether they promote or antagonise the modification. For instance, while mouse RIPK3 triggers phosphorylation of itself on Thr231 and Ser232 to induce necroptosis, phosphatase 1B (Ppm1b) suppresses the autophosphorylation to prevent spontaneous activation of RIPK3 in resting cells, and hence, unwanted necroptosis (Chen et al., 2015). As such, the homeostasis between kinase and phosphatase activities decides whether cells live or die.

Ubiquitylation involves attaching one ubiquitin molecule to a substrate Lys residue through a three-step enzymatic cascade consisting of ubiquitin activators E1, ubiquitin conjugators E2, and E3 ubiquitin ligating enzymes (Figure 1.6) (Deol et al., 2019). Ubiquitin is a highly conserved 76 amino acid protein containing 7 Lys residues which can be further modified with additional ubiquitin molecules to generate isopeptide-linked ubiquitin chains of various lengths (Swatek and Komander, 2016). These 7 modifiable Lys residues on ubiquitin are Lys6, Lys11, Lys27, Lys29, Lys33, Lys48, and Lys63. In addition, an eighth chain type can be generated via a non-conventional Met residue on one ubiquitin attached to an N-terminus of a second ubiquitin, forming an Met1-linked or a linear ubiquitin chain type. With approximately 660 human E3 ubiquitin ligases but only 8 available ubiquitin linkage types, the ubiquitin system is therefore redundant in that multiple E3 ligases overlap in assembling the same Lys chain type (Komander and Rape, 2012; Zheng and Shabek, 2017). Which ubiquitin ligase is assigned to a target protein is, thus, context-dependent. Interestingly, however,

LUBAC is the only known ubiquitin ligase complex known to assemble linear ubiquitin chains. Altogether, the 8 ubiquitin linkages serve as a dictionary to modify proteins with different ubiquitin codes, which are recognisable by ubiquitin-binding proteins (Husnjak and Dikic, 2012; Komander and Rape, 2012; Swatek and Komander, 2016). The ubiquitin codes ultimately convey distinct cellular outcomes, including proteasomal degradation, induction of NF-B pathway, mitophagy, and DNA damage response.

Figure 1.6. The mechanism of ubiquitylation.

Attachment of one ubiquitin molecule on a substrate, exemplified by RIPK3 in the above figure, occurs via an enzymatic cascade from E1 to E3 ubiquitin ligase. The attached ubiquitin molecule either stays as a monoubiquitin or subsequently primes it for more ubiquitin assembly, forming a chain of various linkages. The outcome of ubiquitylation is diverse; one well-known role is to target a substrate for proteasomal degradation. Ubiquitin can be removed from proteins through the action of a DUB, which restores the substrate to its original state. Figure was adapted from “Ubiquitin Proteasome System”, by BioRender.com (2021). Retrieved from https://app.biorender.com/biorender- templates.

With respect to ubiquitin linkage abundance, the Lys48-linked ubiquitin chains represent the most dominant form in cells, accounting for at least 50% of ubiquitin linkages in mammalian cells, and acts to target proteins for proteasomal degradation (Dammer et al., 2011; Xu et al., 2009; Ziv et al., 2011). The second major ubiquitin chain type is Lys63, which comprises approximately 38% of ubiquitin linkages (Dammer et al., 2011), and has been characterised extensively for its role in NF-B activation (Kulathu and Komander, 2012). A small percentage of the ubiquitin linkage population is made up of atypical chains; HEK293 cells were reported to contain 2% Lys11, 8% Lys29, and less than 0.5% each of the Met1, Lys6, Lys27, and Lys33 linkage types (Dammer et al., 2011). Although the atypical ubiquitin linkages are less abundant, they play critical roles in regulating vast biological processes including DNA damage response, epigenetic regulation, protein trafficking, and cell cycle control (Swatek and Komander, 2016). Nevertheless, Lys27 remains the least understudied ubiquitin linkage type to date.

Recent discoveries have unveiled various PTMs on the ubiquitin molecule itself, in particular acetylation and phosphorylation, which provides an additional layer of regulation to the ubiquitin system. Ubiquitin acetylation has been observed on 6 of the Lys sites, however, the functional impact of this modification remains to be defined. In contrast, there are at least 9 Thr and Ser residues on ubiquitin that have been reported as phosphorylation sites (Swatek and Komander, 2016). Ubiquitin Ser65, for example, serves as a phosphorylation substrate for PINK1, and the PINK1 modified phospho-Ub activates the Parkin E3 ligase to promote mitophagy (Koyano et al., 2014; Wauer et al., 2015).

Like other PTMs, ubiquitin modification is reversible through the action of deubiquitylating enzymes (DUBs) which are located both in the cytoplasm and within different cellular organelles (Clague et al., 2019). The human genome only encodes approximately 100 DUBs (Clague et al., 2019), which is ~6 times less than the number of ubiquitin E3 ligases. DUBs play pivotal roles in maintaining the cellular ubiquitin pool, rescuing proteins which are en route for proteasomal or lysosomal degradation, and downregulating ubiquitylation-mediated assembly of signalling complexes. There are 7 families of DUBs which are broadly classified as cysteine proteases and metalloproteinases. The cysteine protease DUB family is further grouped based on the structural variations in their catalytic domain (Nijman et al., 2005): ubiquitin-specific protease (USP), ubiquitin C-terminal hydrolase (UCH),

Otubain protease (OTU), Machado-Joseph disease protease (MJD), Motif interacting with Ub- containing novel DUB family (MINDY), and Zinc finger-containing ubiquitin peptidase 1 (ZUP1). Meanwhile, DUB members reliant on zinc ion for proper function belong to the JAB1/MPN/Mov34 (JAMM) family. Similar to the redundant feature of E3 ligases, the trimming of each ubiquitin linkage type can be shared by members across different DUB families, although some DUBs display little redundancy, such as OTU deubiquitylase with linear ubiquitin linkage specificity (OTULIN). When OTULIN is rendered non-functional, Met1 polyubiquitin linkage accumulates globally and TNF-associated systemic inflammation ensues (Damgaard et al., 2016). Presence of Cylindromatosis (CYLD), an alternative Met1-removing DUB, is incapable of rescuing the OTULIN-deficient phenotypes, despite a similar role in regulating the TNF signalling complex (Draber et al., 2015; Hrdinka et al., 2016).

1.8.2 Ubiquitin ligases and DUBs control cell death signalling complexes Ubiquitin modification is ubiquitously involved in regulating cell death components to either promote or downregulate their activity. This process relies on the interplay between E3 ubiquitin ligases and DUBs, and is best exemplified by the TNF-mediated NF-κB signalling and its associated cell death pathways. When the balance is tipped to favour either the ligase or DUB activity due to loss-of-function mutation or deficiency, aberrant signalling ensues and might ultimately lead to lethality. Moreover, E3 ligases can regulate DUBs, and vice versa, as illustrated later by the LUBAC ligase-OTULIN DUB and MIB2 ligase-CYLD DUB pairs, which indirectly affect cell death signalling.

As briefly alluded to in section 1.4.2, the IAPs and LUBAC are pro-survival E3 ligases serving as an activation platform in the NF-κB signalling pathway by tagging Complex I with Lys63- and Met1-linked ubiquitin chains, respectively. The related IAP family members, cIAP1, cIAP2 and XIAP are characterised by the presence of three baculovirus IAP repeat (BIR) domains, a Ub-associated (UBA) domain, and a really interesting new gene (RING) domain. The BIR domain mediates protein-protein interactions, while the UBA domain captures ubiquitin chains to fuel the E3 ligase activity of the RING domain (Silke and Meier, 2013). Both cIAPs ubiquitylate RIPK1 with Lys63 chains to prevent its dissociation into the cytosol where it can trigger apoptosis or necroptosis. It is not surprising, therefore, that deletion of both cIAPs lead to embryonic lethality which can only be rescued by either TNFR1, RIPK1 or RIPK3 deletion (Moulin et al., 2012). Furthermore, deletions of cIAP1 and cIAP2, which result in

25 constitutive activation of non-canonical NF-B pathway, have been associated with multiple myeloma (Keats et al., 2007). On the other hand, XIAP loss in mice does not exhibit an obvious phenotype implying that the cIAPs play a more prominent role in inhibiting cell suicide during development. However, the death-suppressor role of XIAP is more dominant in myeloid cells, especially in macrophages and dendritic cells. Under TLR or TNF stimuli, loss of XIAP confers sensitivity to RIPK3-caspase-8-mediated apoptosis (Lawlor et al., 2017; Lawlor et al., 2015; Yabal et al., 2014). XIAP deficiency has been associated with a severe systemic inflammatory syndrome known as X-linked hemophagocytic lymphohistiocytosis (HLH) (Rigaud et al., 2006).

Assembly of Lys63 chains on the TNF-RSC is also a prerequisite for LUBAC-mediated linear ubiquitylation. LUBAC is a complex made of 3 subunits: Heme-oxidized IRP2 ubiquitin ligase 1 (HOIL-1), Shank-associated RH domain-interacting protein (SHARPIN), and HOIL-1- interacting protein (HOIP) (Rittinger and Ikeda, 2017). The ligase activity of LUBAC relies on HOIL-1 and HOIP, and therefore, loss of function of either subunit means an inability to generate linear ubiquitin chains. Similar to the removal of cIAPs, the absence of HOIP or HOIL-1 translates to embryonic lethality which can be prevented by TNFR1 deletion (Peltzer et al., 2018; Peltzer et al., 2014). Apart from ubiquitylating TNF-RSC components, LUBAC also decorates itself with linear chains. Interestingly, the DUB OTULIN can directly bind to HOIP to suppress LUBAC self-ubiquitylation (Elliott et al., 2014; Fiil et al., 2013; Heger et al., 2018). Although the role of LUBAC self-ubiquitylation is not fully understood, it was observed that OTULIN depletion leads to enhanced auto-ubiquitylation of LUBAC which is then targeted for degradation. Consequently, as LUBAC levels are decreased below the threshold required to sustain the TNF signalling complex, death by either apoptosis or necroptosis ensues (Heger et al., 2018). In addition to IAPs and LUBAC, other non-NF-κB-related ubiquitin ligases are capable of inhibiting apoptotic and necroptotic components directly by enhancing their turnover. The Makorin Ring Finger Protein 1 (MKRN1) E3 ligase, for instance, ubiquitylates FADD for proteasomal degradation and thus limits caspase-8-mediated apoptosis (Lee et al., 2012). Its death-suppressing role also extends to the necroptosis pathway as depletion of MKRN1 promotes necrosome formation, although the mechanistic detail of how this occurs remains to be determined.

Opposing the action of ubiquitin ligases in assembling the TNF-RSC are DUBs, in particular CYLD, A20, and OTULIN (Lork et al., 2017). This trio of DUBs is essential in trimming

26 polyubiquitin chains to disassemble the NF-κB signalling platform in a timely manner. The pro- death CYLD is part of the USP DUB family, which has a dual role in removing Lys63- and Met1- linked ubiquitin from NF-κB pathway substrates, such as TAK1 (Ahmed et al., 2011; Reiley et al., 2007) and RIPK1 (Draber et al., 2015; Harhaj et al., 2013) (Figure 1.2). While downregulating NF-κB, CYLD has also been implicated as a proponent of necroptosis because CYLD-mediated RIPK1 deubiquitylation correlates with enhanced necrosome formation (Harhaj et al., 2013). CYLD activity itself is regulated by E3 ligases; one such ligase is Mind Bomb-2 (MIB2), which targets CYLD for proteasomal degradation to strengthen NF-κB signalling (Uematsu et al., 2019) and RIPK1 (Feltham et al., 2018).

The NF-κB antagonist, A20, plays a dual role in the ubiquitin system as a DUB and an E3 ubiquitin ligase. The ubiquitin-trimming function of A20 is governed by its N-terminal OTU domain, whereas its zinc-finger domain at the C-terminal domain adds ubiquitin onto substrates (Evans et al., 2004; Komander and Barford, 2008). Cooperation of both domains enable A20 to prevent prolonged NF-κB signalling and protect against cell death in several ways. One method involves sequential Lys63 deubiquitylation of RIPK1 and Lys48 ubiquitylation to target RIPK1 for proteasomal degradation (Wertz et al., 2004). Another method of suppressing inflammation is by binding to Met1-ubiquitylated TNF-RSC substrates to prevent further recruitment of LUBAC and other ubiquitin-binding proteins. Although A20 was initially recognised as being anti-apoptotic (Opipari et al., 1992), others also suggest the contrary as a potential side-effect of negating NF-κB signalling (Tavares et al., 2010). As such, how A20 regulates cell death warrants further investigations. Nevertheless, mice with complete absence of A20 exhibit hyperinflammation and die prematurely (Lee et al., 2000; Onizawa et al., 2015; Polykratis et al., 2019; Razani et al., 2020; Wertz et al., 2015), which highlights the essential task of A20 in restricting cell death and inflammation.

The role of the OTU DUB family member OTULIN is not fully understood at this stage. Because Met1-ubiquitylation promotes Complex I formation, OTULIN overexpression sensitises cells to TNF-induced death (Keusekotten et al., 2013). However, reduced OTULIN also yields the same effect. A recent study using catalytically inactive OTULIN in vivo also demonstrated that the non-functional DUB causes mouse development to terminate at mid- gestation and triggers a pro-inflammatory cell death in adult mice (Heger et al., 2018). Nonetheless, the current consensus supports the anti-inflammatory role of OTULIN in

27 negating LUBAC-mediated linear ubiquitin chains in NF-κB activation (Lork et al., 2017), in addition to opposing LUBAC auto-ubiquitylation as indicated previously.

1.9 Self-eating as a means of survival Autophagy is derived from the Greek words Auto (self) and Phagein (to eat). It is a cellular self-eating mechanism that recycles cellular components to restore pools of amino acids, lipids and nucleotides (Galluzzi et al., 2017; Kroemer et al., 2010). Autophagy is triggered in response to diverse cellular stressors including pathogen invasion, damaged organelles, nutrient deprivation, and protein aggregates. As such, dysregulation of the autophagic responses has been associated with pathological conditions, including cancer and neurodegenerative diseases (Yang and Klionsky, 2020).

There are three broad classes of autophagy that have been characterised: macroautophagy, chaperone-mediated autophagy (CMA), and microautophagy (Figure 1.7) (Galluzzi et al., 2017). Cells are equipped with machinery to initiate macroautophagy that involve building dedicated vesicles to engulf and recycle bulky cytoplasmic materials. In contrast, CMA relies on heat shock protein family A member 8 (HSPA8 or Hsc70) as a chaperone to guide a cytosolic protein to the lysosome. Unlike macroautophagy, CMA is exclusive to soluble proteins with KFERQ motif, which implies that lipids, nucleic acids, organelles, or membrane proteins do not have access to this feature. Finally, while macroautophagy and CMA depend on autophagic machineries, microautophagic substrates are directly internalised within a vacuole which is subsequently sent to the lysosome. Irrespective of type, all autophagy processes involve engulfment of cytoplasmic material and are strictly reliant on lysosomal degradation. This section covers the process of macroautophagy as it is the focus of this research project and is the best characterised form of autophagy, and referred herein to as just autophagy.

Figure 1.7. The 3 types of autophagy pathways: macroautophagy, chaperone-mediated autophagy (CMA), and microautophagy. While macroautophagy uses autophagic vesicles to engulf cytoplasmic materials, CMA requires chaperone proteins and is only dedicated for KFERQ-containing proteins. Finally, microautophagy directly internalises substrates inside a vacuole. All forms of autophagy terminate in lysosomal degradation. Reprinted from “Three Main Types of Autophagy”, by BioRender.com (2020). Retrieved from https://app.biorender.com/biorender-templates.

1.9.1 The autophagosome and Lysosome: the alpha and omega in cellular self-eating The conventional pathway of mammalian autophagy includes a number of kinases and autophagy-related (ATG) proteins that participate in the engulfment of cellular components in double-membraned vesicles, termed autophagosomes, and culminates in their delivery to the lysosomes for degradation (Galluzzi et al., 2017). Two critical initiatory complexes are Unc- 51-like kinase (ULK)-1 and autophagy-specific Class III phosphatidylinositol 3-kinase (PI3K) which recruit an army of ATG proteins to build a curved isolation membrane, known as a phagophore, of which its constituents are believed to be sourced from the ER, mitochondria,

Golgi, and plasma membrane (Rubinsztein et al., 2012). Thus, the phagophore serves as a basic building block to a mature autophagosome.

Because ULK1 and Class III PI3K complexes are igniters of the autophagy pathway, both complexes are regulated by diverse autophagy-related stress sensors (Figure 1.8). In the context of glucose starvation, for example, two key regulators of the complexes are AMP- activated protein kinase (AMPK) and mechanistic/mammalian target of rapamycin complex 1 (mTORC1). When ATP levels are reduced or AMP levels accumulates, AMPK becomes active and phosphorylates ULK1 to initiate autophagy (Egan et al., 2011; Kim et al., 2011). In contrast, mTORC1 works against AMPK by phosphorylating ULK1 at different sites to interfere with its activity and interaction with AMPK (Kim et al., 2011). As such, when self-eating is needed, AMPK downregulates mTORC1 to ensure efficient ULK1 signalling (Gwinn et al., 2008; Kim et al., 2011). Active ULK1 positively regulates the Class III PI3K complex; a complex consisting of Beclin1, phosphatidylinositol 3-kinase catalytic subunit type 3 (VPS34), phosphoinositide-3- kinase regulatory subunit 4 (VPS15), and ATG14 (Galluzzi et al., 2017). Beclin1, VPS15 and ATG14 allosterically activates VPS34 to generate phosphatidylinositol 3-phosphate (PI3P) lipids to expand the phagophore.

Figure 1.8. Mechanism of autophagosome formation.

Autophagy is initiated when cells are deprived of glucose or amino acid, which leads to either activation of AMPK or inhibition of mTORC1. AMPK ensures efficient ULK complex signalling by phosphorylating ULK1 and downregulating mTORC1 activity. When cells are energy sufficient, mTORC1 phosphorylates ULK1 to downregulate its activity. Active ULK complex regulates the Class III PI3K complex in initiating phagophore formation. Completion of phagophore into a mature autophagosome requires the support of PE- lipidated form of LC3 (LC3II) and ATG5-ATG12-ATG16L1 complex.

Elongation of the phagophore completes autophagosome synthesis (Galluzzi et al., 2017; Rubinsztein et al., 2012). The elongation process involves recruitment of ATG5-ATG12- ATG16L1 complex to the growing phagophore, and ATG3 and ATG7 to assist in converting cytosolic microtubule-associated protein 1 light chain 3 (MAP-LC3/LC3), LC3I, into a phosphatidylethanolamine (PE)-lipidated form of LC3, LC3II (Figure 1.8). LC3II serves as a structural scaffold during the elongation process of the phagophore and guides membrane closure around the substrates, and associates permanently with the mature autophagosome until its degradation in the lysosome (Galluzzi et al., 2017; Geng and Klionsky, 2008). Therefore, LC3II is frequently used as a marker of the autophagic process (Klionsky et al.,

2016). Once the autophagosome matures, it can fuse with a late endosome to become an amphisome, or directly with a lysosome to become an autolysosome. The amphisome also eventually fuses with the lysosome to form the autolysosome. Autophagic substrates are digested upon encountering the active hydrolytic enzymes in acidic lysosomal lumen. The lysosomal lumen is maintained at the low pH of 4.5-5.0 owing to constant proton supply from an ATP-dependent proton pump known as a V-type ATPase (Mindell, 2012). Because removal of autophagic substrates relies on functional lysosomal hydrolases, bafilomycin A1 (BafA1) is commonly used to study the effect of inhibiting lysosomal acidification, which consequently induces an accumulation of cellular waste (Klionsky et al., 2016).

In addition to non-selective autophagy which does not discriminate its cargo, cellular autophagy also selectively targets unwanted or damaged organelles for clearance by using a set of dedicated sensors and/or receptors. In the case of mitophagy, for example, the Parkin ubiquitin ligase and the PINK1 mitochondrial kinase work cooperatively to induce autophagy- mediated delivery of damaged mitochondria to the lysosome (Green and Levine, 2014). Alternatively, BNIP3, FUNDC1, p62, and Nix proteins tag the dysfunctional mitochondria as “clear-me” signal which subsequently recruit LC3-II and autophagy tools to initiate engulfment of the organelle, a process that occurs in a Parkin- and PINK1-independent manner. Some of these receptors also partake in many other autophagy-related processes. The protein p62, for instance, also tags misfolded and aggregated proteins for degradation in a process known as aggrephagy, or initiates engulfment of cytoplasmic bacteria as part of xenophagy-mediated immunity (Lamark et al., 2017).

1.9.1 When autophagy and cell death meet: friends or enemies? While autophagy is generally regarded as a pro-survival mechanism, mounting evidence implicates a role for cell death signalling in regulating autophagy. Apart from triggering apoptosis, BAX and BAK are also capable of directly inducing autophagy to clear damaged mitochondria and restrict IFN- secretion by internalising the cytokine in the autophagosome, thereby, reducing inflammation and immunogenicity during apoptosis (Lindqvist et al., 2017). Opposing the role of BAX- and BAK-mediated autophagy is the pro-survival BCL-2 family members that inactivate BAX and BAK to indirectly inhibit autophagy (Lindqvist et al., 2014; Reljic et al., 2016). Importantly, enhanced autophagy during apoptosis does not contribute to death.

The role of autophagy in other cell death pathways, in particular necroptosis and pyroptosis, is less clear. In L929, 3T3, 4T1-luc2, and Jurkat cells, induction of necroptosis was associated with increase in LC3 lipidation (LC3-II formation) (Degterev et al., 2005; Lin et al., 2017; Ye et al., 2011). However, elevated LC3-II does not necessarily imply autophagy induction as it could reflect a block in lysosomal degradation (Klionsky et al., 2016). Moreover, it is not clear why autophagy is induced, if it was the case. Studies have suggested autophagy to be a cell death switch between apoptosis and necroptosis under certain contexts, such as when the pro-NF-B TAK1 is absent (Goodall et al., 2016). Mechanistically, it has been suggested that TRAIL induces RIPK1 to interact with p62 to assemble the necrosome which in turn bridges RIPK1 to the autophagosome to enhance necrosome activation. Consistent with this, knockdown of ATG5, which disrupts autophagosome formation, abolished TRAIL- induced MLKL phosphorylation (Goodall et al., 2016). Moreover, depletion of p62 in addition to TAK1 switches cellular commitment from necroptosis to apoptosis, suggesting a non- canonical role for p62 as an anti-apoptotic protein. Apart from ATG5, another group discovered an indirect role for ATG16L1 in preventing necroptosis in the intestinal epithelium as a result of its involvement in autophagy-mediated recycling of damaged mitochondria (Matsuzawa-Ishimoto et al., 2017). By maintaining healthy mitochondria, ATG16L1 prevents ROS build-up which could otherwise prime cells for necroptosis. In agreement with the role of ATG16L1 as a necroptosis suppressor, a recent finding has proposed a role for ATG16L1 in actively degrading RHIM-domain proteins via the autophagy pathway since loss of ATG16L1 leads to an accumulation of RIPK1, RIPK3, TRIF, and DAI (Lim et al., 2019). Collectively, these findings suggest that loss of ATG16L1 drives necroptosis in vitro and in vivo, and this has been associated with inflammatory bowel disease. However, these results are correlational at best as they are comparative studies based on genetic deletion. Whether autophagic flux is increased during necroptosis remains to be determined (Klionsky et al., 2016).

Autophagy has also been shown to prevent inflammasome activation and hence release of the pro-inflammatory cytokine IL-1 (Saitoh et al., 2008). Because IL-1 lacks a signal sequence, it does not undergo the conventional ER-Golgi secretory mechanism (Monteleone et al., 2015). It was proposed that autophagy also antagonises IL-1 secretion indirectly by targeting ubiquitylated inflammasomes for lysosomal degradation (Shi et al., 2012), which agrees with studies documenting hyper-inflammasome responses in autophagy-

33 deficient mice (Abdel Fattah et al., 2015; Shi et al., 2012). In contrast, in some cell types it has been proposed that the autophagy machinery can switch from its canonical degradative role into a secretory role which serves as a vehicle to facilitate IL-1 exit from the cell (Dupont et al., 2011; Kimura et al., 2017). Notably, most studies implicating autophagy in IL-1 secretion failed to detect cell death, which raises the hypothesis that IL-1 secretion in the absence of cell death is autophagy-mediated. However, whether or not GSDMD is required in this autophagy-dependent IL-1 release model is unknown. In addition, it remains unknown whether autophagy plays a role in limiting GSDMD-mediated pyroptotic death.

CHAPTER 2 – MATERIALS AND METHODS

2.1 In vivo studies

2.1.1 Animal ethics The Walter and Eliza Hall Institute of Medical Research (WEHI) Animal Ethics Committee approved all mouse experiments used in this research project which were conducted in accordance with the Prevention of Cruelty to Animals Act (1986) and the Australian National Health and Medical Research Council Code of Practice for the Care and Use of Animals for Scientific Purposes (1997). All mice were maintained at WEHI Bioservices facilities in Parkville and Kew (Victoria, Australia).

2.1.2 Mice The C57BL/6J mouse strain was used in this research project. Ripk3K46R/K469R mice were generated on WT strain using CRISPR/Cas9 technology by Melbourne Advanced Genome Editing Centre (MAGEC) laboratory at WEHI, following a similar methodology as previously published (Lalaoui et al., 2020). To introduce an arginine mutation on K469 within the Ripk3 gene (mouse chromosome 14), an sgRNA of the sequence GAACTGTGCTTGGTCATACT was used to create double stranded breaks within the Ripk3 locus and initiate homologous recombination. An oligo donor with the following sequence was subsequently used to introduce the K469R mutation:

TGCAGATTGGGAACTACAACTCCTTGGTAGCACCACCAAGAACTACTGCCTCAAGTTCGGCCCGTTA TGACCAAGCACAGTTCGGCAGGGGTAGGGGCTGGCAGCCCTTCCACAAGTAGACTTCA

Nucleotides in bold indicate the introduced K469R mutation. To validate the integration of the oligo donor, mice were genotyped using forward primer CGGCTCTCGTCTTCAACAAC and reverse primer TGATGCCCTGGATTGACACC employing the PCR conditions as listed in Table 2.1.

Table 2.1. Thermocycling conditions for validating integration of oligo donor

3-step protocol Cycle step Cycles Temperature Time Initial denaturation 95oC 2 min 1 Denaturation 95C 30 s 35

Annealing 60C 30 s Extension 72C 30 s Final extension 72C 5 min 1

Viable mice were genotyped by next-generation sequencing. Prior to conducting experiments, mice were backcrossed to WT C57BL/6J for at least 2 generations to remove any potential off- target mutations.

2.1.3 Mouse genotyping Ripk3K469R/K469R mice genotyping was performed by Cathrine Hall (WEHI) and was based on PCR method, using the primers and conditions summarised in Table 2.2 and Table 2.3, respectively.

Table 2.2. Primers used for Ripk3K469R/K469R mice genotyping

Pair Forward (5’-3’) Reverse (5’-3’) Note A CTCAAGTTCGGCCAAG GACTTTAAGGAGATGGGTC for recognising WT K469 B CTCAAGTTCGGCCCGT AAG for recognising mutant K469R

Table 2.3. Thermocycling conditions for Ripk3K469R/K469R mice genotyping

3-step protocol Cycle step Cycles Temperature Time Initial denaturation 95C 2 min 1 Denaturation 95C 30 s Annealing 49C 30 s 34 Extension 72C 30 s Final extension 72C 5 min 1

2.1.4 Blood analysis Sub-mandible bleed from Ripk3WT/WT, Ripk3WT/K469R, and Ripk3K469R/K469R mice were analysed for white and red blood cell composition using the Advia 2120i haematology system (WEHI) (Harris et al., 2005).

2.1.5 Mouse model of SMAC mimetic-mediated skin inflammation This experiment was performed in collaboration with Dr Holly Anderton (WEHI) who designed the protocol and assisted with tissue harvest at the experimental endpoint. Mice used in this experiment were not littermate controls, and aged 11 weeks. Mice were injected subcutaneous with 100 L of 1 mg/mL SMAC mimetic Compound A. All injections were completed by the animal technicians. The first injection was made at the right inguinal region for a 3-day time point, followed by the left inguinal region for a 1-day time point. Post-mortem mice were photographed for skin lesions and scored according to the published criteria (Anderton; Anderton et al., 2017) listed in Table 2.4. Skin lesions were collected for Western blot analysis (see section 2.7). Injections and analyses were done in a blinded manner.

Table 2.4. Wound scoring criteria for SMAC mimetic injection model

Time post- Scoring criteria injection Day 1 0 1 2 3 Oedema* None Mild – Moderate – Severe – <1 cm 1-1.5 cm >1.5 cm Redness none A few red spots Clear patch of Severe redness in whole redness, but area mild Nikolsky‘s None Slight epidermal Confluent, with epidermis is peeling away shift. Not clear area of without rubbing, or clear Sign** confluent. shift when presence of blister lateral pressure is applied.

Day 3 0 1 2 3 4 Oedema none mild moderate severe N/A Redness A few red spots Clear red ring Intense red N/A around the ring around none lesional area lesion and extending to peripheral tissue Lesion <0.25 cm 0.25-0.5 cm 0.5-1 cm >1 cm No lesional area lesional area. lesional area lesional lesion with no Epidermis with patches area with

scabbing/eschar. appears to be of eschar patches of Present of mild, separated but (scabby scabby patchy area. has not lifted looking) or looking or away from the severely severely dermis. Or small peeling peeling clear lesion with epidermis. epidermis. mild scabbing. *Size was assessed by putting index finger and thumb on either side of the suspected area **Detached epidermis upon rubbing

2.1.6 Mouse model of LPS endotoxic shock Mice used in this experiment were littermate controls aged 8-11 weeks. Experiment was conducted with the assistance of Sarah Garnish (WEHI). Sub-mandible bleeds were performed two weeks prior to LPS challenge as basal cytokine readout. Mice were injected with 2 mg/kg LPS (Invivogen; tlrl-3pelps) via an intraperitoneal route. Weight and temperature were monitored every hour post-injection for 6 h. At 2 h post-injection, sub-mandible bleeds were extracted as the peak of response. Finally, cardiac bleeds were performed at the experimental end-point. Injections and analyses were done in a blinded manner.

2.1.7 Mouse model of K/BxN serum transfer arthritis Mice used in this experiment were littermate controls aged 6-8 weeks. The K/BxN serum was kindly provided by Dr Cynthia Louis (WEHI). Approximately 300 L of serum from K/BxN mice was injected via an intraperitoneal route. Mice weight was monitored on a daily basis by the animal technicians. Daily clinical scoring and mice harvest were performed by Dr Kate Lawlor (Hudson Institute). Scoring was based on severity of paw/ankle joint inflammation on each limb; maximum score of 12 for 4 limbs (Table 2.5). Injections and analyses were done in a blinded manner.

Table 2.5. Clinical scoring criteria for K/BxN serum transfer arthritis model

Scoring Description 0 Normal 1 Mild swelling of the paw 2 Marked swelling of paw 3 Severe swelling of paw with joint distortion and/or joint stiffness on flexion

2.1.6 Mouse model of Salmonella infection Mice used in this experiment were a mix of littermates and non-littermates aged 7-9 weeks, and we have confirmed that both groups responded similarly. Ripk3K469R/K469R mice were infected with S. Typhimurium AroA at 109 CFU for oral gavage or 100 CFU with intravenous (iv) injection. Mice were harvested 14 days post-infection. Serum was extracted from the cardiac bleeds for multiple cytokine analysis by Cytometric Bead Array (BD Bioscience). All experiments and data analysis were performed by Dr Greg Ebert (WEHI) and Dr Jaclyn Pearson (Hudson Institute). Injections and analyses were done in a blinded manner.

2.2 Cell culture maintenance All cell lines used for in vitro studies were tested for mycoplasma contamination by PCR method using GoTaq Green Master Mix (Promega) with 9 different primers listed in Table 2.6.

Table 2.6. Primers used for mycoplasma testing by PCR method

Forward (5’-3’) Reverse (5’-3’) CGCCTGAGTAGTACGTTCGC GCGGTGTGTACAAGACCCGA CGCCTGAGTAGTACGTACGC GCGGTGTGTACAAAACCCGA TGCCTGAGTAGTACATTCGC GCGGTGTGTACAAACCCCGA TGCCTGGGTAGTACATTCGC - CGCCTGGGTAGTACATTCGC - CGCCTGAGTAGTATGCTCGC -

PCR was performed using the following program:

Table 2.7. Thermocycling conditions for mycoplasma testing

3-step protocol Cycle step Cycles Temperature Time Initial denaturation 95C 2 min 1 Denaturation I 94C 30 s Annealing I 50C 30 s 5 Extension I 72C 35 s Denaturation II 94C 15 s 30 Annealing II 56C 15 s

Extension II 72C 30 s

2.2.1 Mouse dermal fibroblasts (MDFs) WT, Ripk3-/-, and Mlkl-/- MDFs immortalized with SV40 large T antigen were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 8% (v/v) fetal calf serum

(FCS) at 37C and 10% (v/v) CO2. These MDFs were gift from Professor John Silke (Walter and Eliza Hall Institute of Medical Research; WEHI) derived from C57BL/6 mice, and have been described previously (Hildebrand et al., 2014; Murphy et al., 2013; Newton et al., 2004).

For generation of primary MDFs, the dermis layer of a whole skin tail was separated from the epidermis layer by incubating with 2.1 U/mL Dispase II (Sigma; D4693) in serum-free DMEM media at 37C for 2 h. The dermis was then incubated in 0.4 mg/mL Collagenase type IV (Sigma, C5138) in serum-free DMEM media at 4C for 24 h. The following day, the dermis was passed through a 100 μm yellow Falcon sieve by using a sterile plastic syringe plunger and washed thoroughly with 8% FCS-supplemented DMEM media. Cells were grown and used for experiments for up to 2 weeks before entering senescence.

2.2.2 Human colorectal adenocarcinoma cell line (HT-29) MLKL−/− HT-29 cells were gift from Ass. Prof. James Murphy (WEHI) which were generated using CRISPR/Cas9 technology as described previously (Petrie et al., 2018). Cells were cultured in DMEM supplemented with 8% (v/v) FCS at 37C and 10% (v/v) CO2.

2.2.3 HEK293T cells

Cells were cultured in DMEM supplemented with 8% (v/v) FCS at 37C and 10% (v/v) CO2.

2.2.4 Bone Marrow Derived Macrophages (BMDMs) BMDMs were generated from the femoral and tibial bone marrow cells of WT and Ripk3K469R/K469R C57BL/6 mice. Upon harvest, bone marrow cells were cultured on 15 cm bacterial Petri dishes for 7 days in DMEM supplemented with 20% L929 conditioned media and 8% (v/v) FCS at 37C and 10% (v/v) CO2. Fresh media was added on day 3, and cells harvested, counted and used in experiments on day 6 or 7.

2.2.5 Young adult mouse colonic epithelium (YAMC) YAMC cells were provided by Prof. Robert Ramsay (Peter MacCallum Cancer Centre), and were cultured in RPMI 1640 supplemented with 8% (v/v) FCS at 37C and 10% (v/v) CO2.

2.2.6 immortalised BMDMs (iBMDMs) Ripk3-/- BMDMs were immortalised with Cre-J2 virus, and cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 8% (v/v) fetal calf serum (FCS) at 37C and 10%

(v/v) CO2

2.3 Plasmids, mutagenesis, and transfection 2.3.1 GFP and Ubiquitin constructs HA-GFP was cloned into a pcDNA5.5 vector, while HA-Ubiquitin WT was cloned into pEF6/Myc-His vector. Both constructs were kind gifts from Pascal Meier (London). HA-Sumo2 WT (Addgene #48967) and HA-Sumo3 WT (Addgene #17361) constructs were kindly provided by Guy Salvesen (Bekes et al., 2011) and Edward Yeh (Kamitani et al., 1998), respectively. All constructs were transiently transfected into 293T cells following the Lipofectamine 2000 Transfection protocol (ThermoFisher 11668-019).

2.3.2 Cloning of RIPK3 constructs RIPK3-WT, -K5R, -K30R, -K56R, -K63R, -K145R, -K158R, -K264R, -K287R, and -K307R were synthesized by ATUM and supplied in the pJ204 vector (California, US). Constructs for RIPK3- K359R, -K469R, -K158R/K359R, and -K359R/K469R were generated by polymerase chain reaction (PCR)-driven overlap extension technique as previously published (Heckman and Pease, 2007), and summarised in section 2.3.3. All constructs were cloned into an N-terminal FLAG-tagged doxycycline-inducible, pFTRE3G PGK puro vector (Moujalled et al., 2014; Moujalled et al., 2013; Murphy et al., 2013). Lentivirus was generated using Effectene Transfection Reagent (QIAGEN) in HEK293T cells, and target cells were infected in 4 g/mL Polybrene. Cells were selected in 5 g/mL puromycin.

2.3.3 Site-directed mutagenesis by overlap extension PCR The overlap extension PCR was used for mutagenesis of lysine to arginine residue from a RIPK3-WT plasmid construct. Two primer pairs (AB and CD) were designed with 36-42C melting temperature on each side of the desired base pair change, assuming each A or T base pair is 2C, and G or C base pair is 4C (Figure 2.1). No software was used in calculating the flanking sequence Tm.

Tm= 36-42C Tm= 36-42C

Figure 2.1. Schematic of site-directed mutagenesis by overlap extension PCR.

Two primer pairs, AB and CD, were used to generate a point mutation in their overlapping region. A and D are the template primers, while B and C are the primers that introduce the mutation of interest as indicated by the red cross. The melting temperature (Tm) flanking the desired base pair change is kept within 36-42C.

Primer pairs AB and CD used to generate RIPK3 mutants were listed in Table 2.8.

Table 2.8. Primers used for overlap extension PCR

RIPK3 Target Forward (5’-3’) Reverse (5’-3’) K359R (pair AB) CGCGGATCCTCTGTCAAGTTATGG CCTCTCAGGACATCTTCCAGGAACT CCTAC GG K359R (pair CD) CCAGTTCCTGGAAGATGTCCTGAG GCGGAATTCACTTGTGGAAGGGCT AGG GC K469R (pair AB) GGATCTGCGCCACCATGGATTAC GTGCTTGGTCATACCTGGCCGAACT TG K469R (pair CD) CAAGTTCGGCCAGGTATGACCAAG CTAGTGAGACGTGCTACTTCCATTT CAC GTC

All PCR reactions were performed using Phusion polymerase (ThermoFisher) following the company’s protocol. Briefly, a 50 L reaction mix was prepared as follows:

Table 2.9. PCR reaction mix overlap extension PCR

Component Volume (L) DNA (0.3-1 g) X 5x Phusion HF Buffer 10 Forward primer (50 M) 0.5 Reverse primer (50 M) 0.5

42 dNTPs (10 mM) 1 Phusion polymerase 0.5 Water 37.5-X

The reaction was subsequently subjected to the following thermocycling program:

Table 2.10. Thermocycling conditions for overlap extension PCR

2-step protocol* 3-step protocol Cycle step Cycles Temperature Time Temperature Time Initial 98C 30 s 98C 30 s 1 denaturation Denaturation 98C 5 s 98C 5 s Annealing YC** 5 s 34 Extension 72C 25 s 98C 20 s Final 72C 5 min 72C 5 min 1 extension *The 2-step protocol was used for primer pair with annealing temperature of 72C. ** YC is a variable temperature relative to each primer pair.

To obtain the final DNA product containing the desired mutation, products from AB and CD primer pairs were purified using PCR Clean-Up System (Promega). The AB and CD pairs were then combined together with equal amount, and the reaction was repeated again to create AD product using primers A and D. All PCR products were separated by agarose gel electrophoresis with 1% agarose Tris-acetate gel containing ethidium bromide or GelRed® Nucleic Acid Gel Stain (Biotium). Gels were visualised with a UV trans-illuminator (Biorad), bands of the size corresponding to the sought amplicon were excised by scalpel, and DNA products were extracted with Wizard® SV Gel and PCR Clean-Up System (Promega) following the manufacturer’s protocol.

2.2.4 Digestion, ligation and transformation of cDNAs All RIPK3 cDNAs generated by overlap extension PCR were digested with BamHI and EcoRI, and ligated into pFTRE3G PGK puro construct using T4 DNA ligase (Promega). Reaction was set up as follows:

Table 2.11. Ligation reaction mix

Component Volume (L) Vector (25-50 ng)* X Insert (75-300 ng)* Y T4 DNA ligase 1 Water Adjust to 10 or 20 *The ratio between vector and insert was kept to 1:3 or 1:6. Concentration was estimated using NanoDrop (ThermoFisher).

The ligation reaction was performed at 25C for 16-18 h, then transformed into chemically competent DH10B E. coli (ThermoFisher) by the heat shock method at 42C for 45 seconds. Competent cells were kindly provided by Masters Lab (WEHI). Cells were subsequently plated on LB Agar plates containing 100 g/mL ampicillin. Plates were incubated at 37C for 16-18 h.

2.4 Reagents and antibodies All reagents and antibodies used throughout this research project are summarised in Table 2.12 and Table 2.13, respectively.

Table 2.12. List of reagents

Reagent Company Catalogue # 3x FLAG Peptide APExBio A6001 Bafilomycin A1 Enzo Life Sciences BML-CM110- 0100 Biotinylated Wheat Germ Agglutinin (WGA) Sigma-Aldrich L5142 CytoTox 96® Non-Radioactive Cytotoxicity Assay Promega G1780 Collagenase from Clostridium histolyticum Sigma-Aldrich C5138 Dispase II Sigma-Aldrich D4693 Doxycycline Sigma-Aldrich D3447 DyLight650-conjugated streptavidin ThermoFisher 84547 Gentamycin Sigma Aldrich G-1397 Glutathione Sepharose 4B GE Healthcare GEHE17-0756- 01 GSK’872 SynKinase SYN-5481

Hoechst 33342 ThermoFisher H3570 Human TNF-Fc WEHI (Bossen et al., 2006) IDN-6556 (Emricasan) Idun N/A Pharmaceuticals Immobilon Western Chemiluminescent HRP Merck WBKLS0500 Substrate Lipopolysaccharide from E. coli O111:B4 InvivoGen tlrl-3pelps Lipofectamine 2000 ThermoFisher 11668-019 MG132 Sigma-Aldrich M7449 MitoTracker™ Deep Red FM Invitrogen M22426 Mouse IL-1 beta/IL-1F2 DuoSet ELISA R&D Systems DY401 IL-6 Mouse Uncoated ELISA Kit Invitrogen 5017219 TNF Mouse Uncoated ELISA Kit Invitrogen 5017331 Nec-1s Merck 504297 Pierce™ BCA Protein Assay Kit ThermoFisher 23225 Polybrene Sigma-Aldrich 107689 Propidium iodide Sigma-Aldrich 81845 Puromycin Sigma-Aldrich p8833 Q-VD-OPh MP Biomedicals SKU 03OPH10901 SlowFade Gold Antifade reagent ThermoFisher S36937 SMAC mimetic Compound A TetraLogic N/A Pharmaceuticals Ultrapure lipopolysaccharide from E. coli K Invivogen tlrl-peklps

Table 2.13. List of antibodies

Antibody Company Catalogue # Anti--actin Sigma-Aldrich A1987 Anti-4E-BP1 Cell Signaling Technology 53H11 Anti-AMPK Cell Signaling Technology 2532

Anti-ATG5 Cell Signaling Technology D5F5U Anti-ATG7 Cell Signaling Technology 2631 Anti-Calreticulin Cell Signaling Technology 12238 Anti-Caspase-3 Cell Signaling Technology 9662 Anti-Cleaved Caspase-3 (D175) Cell Signaling Technology 9579 Anti-Cleaved Caspase-8 (D387) Cell Signaling Technology 8592 Anti-Flotilin-1 BD Transduction 610821 Laboratories Anti-GAPDH Merck MAB374 Anti-GSDMD Abcam ab209845 Anti-GM130 BD Transduction 610822 Laboratories Anti-HA Roche 11867423001 Anti-Lamin A/C Santa Cruz Sc-20681 Anti-LAMP 1 Santa Cruz 1D4B Anti-LC3B Cell Signaling Technology 2775 Anti-MLKL WEHI Clone 3H1 Anti-Mouse IgG (H+L) Secondary Southern Biotech 1010-05 Anti-Mouse IgG (H+L) Secondary, Alexa Fluor Invitrogen R37121 594 Anti-p62/SQSTM1 Cell Signaling Technology 5114 Anti-Phospho-4E-BP1 (S65) Cell Signaling Technology 9451 Anti-Phospho-AMPK (T172) Cell Signaling Technology 40H9 Anti-Phospho-MLKL (S345) Abcam Ab 196436 Anti-Phospho-MLKL (S345) Cell Signaling Technology 37333 Anti-Phospho-MLKL (S358) Abcam Ab 187091 Anti-Phospho-RIPK3 (T231/S232) Genentech, Inc GEN-135-35-9 Anti-Phospho-S6 (S240/244) Cell Signaling Technology D68F8 Anti-Phospho-ULK1 (S317) Cell Signaling Technology D2B6Y Anti-Phospho-ULK1 (S555) Cell Signaling Technology D1H4 Anti-Phospho-ULK1 (S757) Cell Signaling Technology D7O6U

Anti-Rabbit IgG (H+L) Secondary Southern Biotech 4010-05 Anti-Rabbit IgG (H+L) Secondary, Alexa Fluor Invitrogen A-11008 488 Anti-Rabbit IgG (H+L) Secondary, Alexa Fluor Invitrogen A31573 647 Anti-Rat IgG (H+L) Secondary Southern Biotech 3010-05 Anti-Rat IgG (H+L) Secondary, Alexa Fluor 594 Invitrogen A-11007 Anti-RIPK1 Cell Signaling Technology 3493 Anti-RIPK3 WEHI Clone 8G7 Anti-S6 Cell Signaling Technology 5G10 Anti-TGN 38 Santa Cruz sc-166594 Anti-Ubiquitin Cell Signaling Technology 3936 Anti-ULK1 Cell Signaling Technology D8H5

2.5 Cell viability assays 2.5.1 Propidium iodide (PI) uptake by flow cytometry or Incucyte Live-Cell Imaging Upon harvesting, cells were washed once with PBS, spun down at 300xg at 4C for 5 min, and resuspended in PBS containing 1 g/mL PI for analysis by flow cytometry on a FACSCalibur or LSR II W (BD Biosciences). Data were analysed using the FlowJo v10 software. For PI analysis using the Incucyte system, live cells treated with PI were analysed for PI positive cells using the software’s algorithm. The algorithm setting was adjusted to accurately detect the PI puncta.

2.5.2 LDH release assay The LDH assay was performed using CytoTox 96® Non-Radioactive Cytotoxicity Assay kit (Promega; G1780). On harvest, 50 L supernatant from each condition was incubated with 50 L of substrate solution at 37C for 20 min. The reaction was stopped with 50 L Stop solution and its absorbance was measured at 490 nm using the CLARIOstar microplate reader (BMG LABTECH). The % LDH release was calculated as:

(Experimental value/positive control)x100%.

The positive control was prepared according to the kit manual.

2.5.3 Long term clonogenic survival assay The clonogenic survival assay was performed as previously described (Franken et al., 2006). Briefly, approximately 1,000 cells were seeded in 6-well plate and grown for 1 week with or without Doxycycline (Dox) treatment at the concentration indicated to induce transgene expression. On harvesting, cells were fixed with 100% methanol for 5 min and subsequently stained with 0.1% w/v crystal violet for 30 min. The stain was removed and plates washed twice with distilled water.

2.6 In vitro Salmonella infection on BMDM Studies were performed as previously described using Salmonella Typhimurium strain SL1344 (Doerflinger et al., 2020). Bacteria were grown at 37C for 16-18h under 50 g/mL Streptomycin antibiotic selection. Multiplicity of infection (MOI) was calculated based on the

9 OD600 reading, whereby OD600 = 1 = 10 CFU of bacteria/mL. An MOI 10 with 50,000 cells, for example, equates to 0.5 L of the bacterial culture in the cell media. Cells were infected in antibiotic-free DMEM for 30 min. Then, cells were harvested for Western blotting for a 30 min time-point, or washed twice with PBS and replaced in DMEM supplemented with 20% L929 conditioned media, 8% (v/v) FCS, and 50 g/mL Gentamycin. Cells were incubated for a further 30 min for a 60 min time-point prior to Western blot analysis.

2.7 Western blotting For whole cell lysates, cells were lysed directly in 2x SDS lysis buffer (126 mM Tris-HCl pH 8, 20% v/v glycerol, 4% w/v SDS, 0.02% w/v bromophenol blue, 5% v/v 2-mercaptoethanol), boiled at 90C for 5 min, and resolved by reducing SDS-PAGE on either 4-12% NuPAGE Novex Bis-Tris (Invitrogen) or 4-15% Criterion TGX Stain-Free gels (Biorad). Gels were transferred onto nitrocellulose or PVDF membranes at 100 V for 1-2 h. For tissue lysate preparation, organs were firstly resuspended in DISC buffer (1% Triton X-100, 150 mM NaCl, 20 mM Tris pH 7.5, 10% glycerol, 2 mM EDTA) supplemented with complete protease inhibitor cocktail (Roche). A steel bead (Qiagen; 69989) was then inserted into the tube and tissue was lysed with TissueLyser II (Qiagen). Supernatant was carefully collected, while avoiding the top fat layer and pellet at the bottom, and was resuspended in SDS lysis buffer. The protein concentration was quantified by Pierce™ BCA Protein Assay Kit (ThermoFisher). Absorbance was measured at 570 nm using the CLARIOstar microplate reader (BMG LABTECH).

All membranes were blocked in 5% w/v skim milk in PBS containing 0.1% Tween-20 (PBST) for 5 min, and probed with the relevant primary antibodies overnight. Membranes were then incubated in secondary antibodies for 1 h, developed using ECL (Milipore), and detected using a X-OMAT film developer with Amersham Hyperfilm MP (GE Healthcare), or the ChemiDoc Touch Imaging System (BioRad).

All primary antibodies were diluted in 5% w/v BSA-containing PBST, while the secondary antibodies were diluted in 5% w/v skim milk in PBST. All membranes were washed 3 times with PBST after antibody incubations with a 5-minute wash in-between.

2.8 Subcellular fractionation Upon stimulation with Dox at the indicated concentration, cells were fractionated following published protocols (Holden and Horton, 2009) with modifications. The cytosol (C) was firstly extracted in 0.025% w/v digitonin in MELB buffer (20 mM HEPES pH 7.5, 100 mM sucrose, 2.5 mM MgCl2, 100 mM KCl) for 10 min on ice. After a 2000xg spin, the membrane-bound organelles (N) were extracted by resuspending the cell pellet in 1% NP40, 150 mM NaCl, 50 mM HEPES pH 7.4 for 30 min on ice. Lysates were centrifuged at 7000xg for 10 min, and the cell pellet resuspended in RIPA buffer [150 mM NaCl, 50 mM HEPES pH 7.4, 0.5% Sodium Deoxycholate, 0.1% SDS, 1 U/ml Benzonase (Sigma-Aldrich)] for 1 h at 4C with rotation. In the final step, after another centrifugation at 7000xg for 10 min, the cell pellet containing the insoluble aggregates (I) was resuspended directly in 2x SDS lysis buffer. All fractions collected (C, M, N, and I) were subsequently subjected to Western blotting. All buffers were supplemented with complete protease inhibitor cocktail (Roche).

2.9 FLAG and HA immunoprecipitation (IP) For FLAG IP analysis, MDFs were seeded in 2x15 cm plates at 80% confluency. After Dox stimulation, cells were harvested and lysed in DISC buffer (see section 2.7 for recipe). Sample was clarified by centrifugation at 15000xg for 5 min, and the soluble lysate was incubated with 20 l of packed magnetic anti-FLAG beads (Sigma) per 15 cm plate at 4C with rotation overnight. Upon 2 washes with DISC buffer, sample was eluted twice in 50 L 1 mg/ml 3x FLAG peptide (APExBio) in TBS pH 7.5. The combined eluate was mixed with SDS lysis buffer for further analysis by Western blotting.

For HA IP analysis, 293Ts were seeded in 6-well plates at 80% confluency. Cells were transiently co-transfected with 1 g HA construct and 1 g FLAG RIPK3-WT. Cells were stimulated with 20 ng/mL Dox overnight post-transfection, harvested and lysed in DISC buffer. Samples were processed similar to the FLAG IP, except that it was incubated with 20 l of packed magnetic anti-HA beads (ThermoFisher) at 4C with rotation overnight, and the beads were lysed directly in SDS lysis buffer after completing the incubation and wash steps.

2.10 Blue-native PAGE The method was performed following the guidelines described previously (Hildebrand et al., 2014). Cells were lysed in lysis buffer composing of 20 mM HEPES pH 7.5, 100 mM KCl, 2.5 mM MgCl2, 100 mM sucrose, and supplemented with 0.025% digitonin, 2 μM N-ethyl maleimide, complete protease inhibitors (Roche), and phosphatase inhibitors. Lysates were centrifuged at 11,000 g for 5 min to yield cytoplasmic and membrane fractions. The former was mixed with 1% w/v digitonin, while the latter was resuspended in lysis buffer containing 1% w/v digitonin. Lysed membrane fraction was centrifuged at 11,000 g for 5 min. Both the cytoplasmic and membrane fractions were resolved on a 4–16% BisTris native PAGE gel (ThermoFisher). Proteins were transferred onto PVDF membranes, and membrane was destained (in 50% methanol and 25% acetic acid) prior to denaturation in 6 M guanidine hydrochloride, 10 mM Tris-HCl pH 7.5 and 5 mM 2-mercaptoethanol for 1–2 h at room temperature, and Western blotting.

2.11 Liquid chromatography–tandem mass spectrometry (LC-MS/MS) MDFs were seeded in 4x15 cm plates at 80% confluency, stimulated with 20 ng/mL Dox overnight, lysed in DISC buffer, and FLAG-purified as described above, except that sample was washed twice in MS buffer (1% Triton X-100, 1 M urea, 500 mM NaCl, 20 mM Tris pH 7.5, 10% glycerol, 2 mM EDTA) at 4C with rotation for 15 min. Eluted sample was subjected to tryptic digestion, following the FASP protocol described previously (Wisniewski et al., 2009). Peptides were analyzed by LC-MS/MS on Q-Exactive Orbitrap mass spectrometer (ThermoFisher).

2.12. Recombinant protein purification of GST-UBA and GST-TUBE The recombinant GST-tagged Ubiquillin-UBA1x (UBA) and Ubiquillin-UBA4x (TUBE) were expressed from the pGEX-6P1 vector encoding the respective protein, and have been described elsewhere (Hjerpe et al., 2009). pGEX-6P1 plasmid encoding GST-TUBE was kindly

50 provided by Prof. David Komander (WEHI). Plasmids were transformed in E. coli BL21-Codon Plus (DE3) by electroporation method. Cells were subsequently plated on LB Agar plates containing 50 g/mL kanamycin. Plates were incubated at 37C for 16-18 h. The next day, a few colonies were selected and grown in 1-2 L Super broth with kanamycin. Once OD600 reached 0.8-1.0, proteins were induced with 0.3 mM IPTG on a shaker at 180 rpm, 18C overnight. On harvesting, bacteria were centrifuged using SLA-3000 rotor at 5000 rpm, 4C for 5 min. Bacterial pellets were lysed by sonication in GST buffer [50 mM Tris pH 8.0, 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 10% glycerol, and complete protease inhibitor cocktail (Roche)]. Lysates were clarified by centrifugation with SS34 rotor at 45000xg, 4C for 30 min prior to glutathione agarose beads (GE Healthcare) incubation with rotation at 4C for 1 h. Beads were washed twice with GST buffer, and elution was performed twice in 10 mM reduced glutathione (made in GST buffer) at 4C for 10 min.

2.13 Purification of ubiquitylated proteome To purify ubiquitylated substrates, 50 g/mL of GST-UBAs or GST-TUBEs per experimental condition was pre-bound to glutathione Sepharose beads (GE Healthcare) for 30 min at 4C with rotation. Approximately 2x106 cells per condition were lysed in urea lysis buffer (4 M urea, 50 mM Tris pH 7.5, 120 mM NaCl, 1% NP-40, 1 mM EDTA) for 10 min on ice for efficient extraction of active RIPK3. Samples were centrifuged to remove the remaining insoluble species, and supernatant was diluted in Wash buffer (50 mM Tris pH 7.5, 120 mM NaCl, 1% NP-40, 1 mM EDTA) at a ratio of 1:1 to dilute the urea to 2M prior to incubation in 10-20 L of packed GST-UBA or GST-TUBE beads at 4C with overnight rotation. Beads were then washed twice in Wash buffer, followed by resuspension in 2x SDS lysis buffer. Samples were heated at 56C or 65C for 15 min, followed by a 17000xg centrifugation for 1 min, prior to SDS-PAGE and Western blot analysis. In the case of GST-TUBE pulldown of TX-100- fractionated cells, cells were lysed in DISC buffer for 20 min on ice. Following centrifugation, the soluble cell lysate was directly incubated in 20 L GST-TUBE packed beads at 4C with overnight rotation, while the pellet was further lysed in 4M urea, and proceeded as above. All buffers were supplemented with 10 mM N-ethylmaleimide and complete protease Inhibitor Cocktail (Roche).

2.14 USP21 Assay Prior to the assay, USP21 DUB (kindly provided by Silke Lab) was activated in DUB reaction buffer (50 mM Tris pH 7.5, 50mM NaCl and 5 mM DTT) for 10 min at room temperature. Approximately 2 x 106 cells per condition were lysed and GST-UBA purified (50 g/mL per condition) to extract the ubiquitylated proteins as described above. After incubation and washing (see above), the packed beads were incubated in 3 M of activated USP21 at 37C for 1 h. The reaction was stopped by addition of 2x SDS lysis buffer and samples analysed by Western blot.

2.15 Confocal imaging Cells were seeded in 8-well μ-slides (Ibidi) and treated as indicated. For plasma membrane staining, 2 L of biotinylated wheat germ agglutinin (WGA; Sigma-Aldrich) was added to each well 10 min prior to harvest. For mitochondria staining, cells were incubated in 100 nM MitoTracker Deep Red FM (Invitrogen) for 30 min prior to fixation. On harvest, cells were fixed with 4% PFA in PBS for 10 min, washed with PBS, and permeabilized with 0.1% saponin, 10% donkey serum in TBS (0.2 m filtered) for 30 min. Fixed samples were then incubated in primary antibodies as indicated for overnight at 4C. The next day, samples were washed twice in PBS, incubated in secondary antibodies at 1:1000 dilution for 1 h at room temperature. For nuclear staining, 2 g/mL of Hoechst 33342 (ThermoFisher) was applied for 20 min, or with 1 g/mL DAPI (ThermoFisher) for 10 min. For WGA detection, 1-2 g/mL DyLight650-conjugated streptavidin (ThermoFisher) was used during the secondary antibody incubation step. After 2 washes with PBS, samples were mounted with SlowFade Gold Antifade reagent (ThermoFisher). All images were obtained using a 63x oil objective on a confocal laser scanning Leica TCS SP8 microscope with z-stacks, and subsequently analysed using FIJI software.

For live-cell imaging of autophagy, MDFs were seeded in a 35 mm μ-Dish (Ibidi), incubated in 75 nM LysoTracker Red DND-99 (ThermoFisher) for 2 h and 2 μg/ml Hoechst 33342 (ThermoFisher) for 20 min. Quantification was automated via the Green and Red Puncta Colocalization Macro for FIJI (D. J. Shiwarski), as performed previously (Pampliega et al., 2013).

2.16 ELISA Detection of TNF (Invitrogen), IL-6 (Invitrogen), and IL-1 (R&D Systems) cytokines were performed according to manufacturer’s instructions. Absorbance was measured at 490 nm using the CLARIOstar microplate reader (BMG LABTECH).

2.17 Statistical analysis For in vivo model of Salmonella infection, statistical analysis was performed with GraphPad Prism 8, implementing Mann-Whitney test to calculate significance values. A p-value of > 0.05 was considered not significant (ns), *indicates P ≤0.05, ** for P≤ 0.01, *** for P≤ 0.001 and **** for P<0.0001.

CHAPTER 3 – UBIQUITYLATION OF RIPK3 BEYOND-THE-RHIM LIMITS RIPK3 ACTIVITY AND CELL DEATH

3.1 Preface This chapter contains work which will be submitted for publication. I, the author of this thesis, am the first author of the manuscript. I contributed to the following:

• Experimental methodology, execution and validation, except for mass spectrometry data acquisition and analysis. • Compilation of figures • Writing of the original draft and incorporating changes to the manuscript as suggested by other co-authors

In addition, I would like to acknowledge the contribution of the following researchers:

• Jarrod Sandow one of my PhD supervisors, who assisted in mass spectrometry data acquisition and analysis, which resulted in the identification of two ubiquitylation sites and a number of phosphorylation sites on mouse RIPK3. • Maryam Rashidi and Ashley Weir (WEHI) for assisting with cell death analysis of RIPK3- WT, RIPK3-K359R, RIPK3-K469R, and RIPK3-K359R/K469R

3.2 Introduction Genetically-encoded caspase-independent necrosis, termed necroptosis, has emerged as an important host response against microbial infections and a potential disease-driver in conditions associated with exacerbated cell death-induced inflammation, such as kidney ischemia-reperfusion injury (Newton et al., 2016). Necroptotic killing of cancer cells has also been observed to elicit long-lasting anti-tumour immune responses (Aaes et al., 2016; Snyder et al., 2019). As such, there is significant interest in understanding the molecular determinants by which the necroptotic machinery is regulated, and how this might be therapeutically exploited to develop new treatments for infections, cancer and cell death-associated inflammatory conditions (Murphy and Vince, 2015).

Necroptosis is elicited by both Pathogen Recognition Receptors (PRRs), such as Toll- like Receptors (TLRs) and Z-DNA-binding protein 1 (ZBP1), and death receptors, such as TNF Receptor 1 (TNFR1). Upon pathogen or death ligand binding, these receptors engage Receptor

Interacting Serine/threonine Kinase-3 (RIPK3) (Cho et al., 2009; He et al., 2011; He et al., 2009; Kaiser et al., 2013a; Upton et al., 2012; Zhang et al., 2009). RIPK3 recruitment occurs through homotypic interactions of the RIPK3 receptor homotypic interaction motif (RHIM) that is also found in cytoplasmic necroptotic-inducing receptors (i.e. ZBP1), and TLR and TNFR1 cytoplasmic adaptor proteins and their signalling components (i.e. TRIF and RIPK1) (Silke et al., 2015). Subsequently, RHIM-mediated oligomerisation of RIPK3 and its autophosphorylation (T231/S232 in mouse or S227 in human) allows it to phosphorylate and thereby activate the terminal effector of necroptotic cell death, Mixed Lineage Kinase Domain-Like Protein (MLKL) (Chen et al., 2013; Murphy et al., 2013; Sun et al., 2012). Activated MLKL associates with, and damages the plasma membrane to cause osmotic swelling and the eventual cellular rupture that triggers the release of immunogenic damage- associated molecular patterns (Dondelinger et al., 2014; Hildebrand et al., 2014; Wang et al., 2014a).

Although RIPK3 kinase activity is essential for necroptosis, research has revealed that RIPK3 can also signal activation of apoptotic caspase-8. For example, genetic deficiency or chemical targeting of the Inhibitor of Apoptosis (IAP) proteins results in TLR- or TNFR1- induced RIPK3 signalling that promotes caspase-8-mediated apoptosis (Lawlor et al., 2015; Vince et al., 2012; Yabal et al., 2014). The use of RIPK3 kinase inhibitors or generation of RIPK3 kinase-dead mutants has documented that RIPK3-induced caspase-8 activation results from RIPK3 binding to RIPK1, leading to RIPK1 death domain recruitment of the adaptor FADD, which then engages the caspase-8; a complex often referred to as the ripoptosome (Feoktistova et al., 2011; Mandal et al., 2014; Newton et al., 2014; Tenev et al., 2011). Apart from its role in cell death, RIPK3 can also trigger inflammatory signalling pathways, such as the induction of NF-B (Moriwaki et al., 2014) and activation of the NLRP3 inflammasome to drive IL-1 maturation and inflammation (Conos et al., 2017; Duong et al., 2015; Kang et al., 2013; Lawlor et al., 2017; Lawlor et al., 2015; Polykratis et al., 2019; Vince et al., 2012; Yabal et al., 2014). In addition, numerous mouse models of disease, mostly through genetic deletion studies, have alluded to RIPK3-induced apoptotic and/or necroptotic death as an important mediator of tissue damage (Silke et al., 2015).

RIPK3 signalling is regulated by various post-translational modifications (PTMs), such as ubiquitylation (Choi et al., 2018; Lee et al., 2019; Moriwaki and Chan, 2016; Onizawa et al.,

2015; Seo et al., 2016), phosphorylation (Chen et al., 2013; Sun et al., 2012), S-nitrosylation (Miao et al., 2015), and O-GlcNAcylation (Li et al., 2019). Despite the discovery of numerous RIPK3 PTMs, the roles of these PTMs, in particular ubiquitylation, are not fully understood. Studies to date have identified a number of ubiquitylation sites on RIPK3 within its N-terminus and kinase domain, most of which are associated with RIPK3 turnover by the proteasome (Choi et al., 2018; Moriwaki and Chan, 2016) or the lysosome (Seo et al., 2016), while others suggest a role for ubiquitylation in tuning RIPK1-RIPK3 complex assembly (Lee et al., 2019; Onizawa et al., 2015; Roedig et al., 2020).

Here, we identify that mouse RIPK3 is decorated by ubiquitin on lysine 469 (K469), which is situated 8 amino acids beyond-the-RHIM motif (BTR) on the C-terminal end. The mouse RIPK3 BTR (residues 461-486) has recently been identified as ubiquitylation sites important to regulate RIPK3 lysosomal turnover (Blessing et al., 2014) and restrict necroptosis (Roedig et al., 2020). Here we found that loss of RIPK3 K469 ubiquitylation promoted RIPK3 ubiquitylation on another lysine, K359, which triggered enhanced RIPK3-mediated necroptosis and apoptosis signalling. Our results uncover an important functional role for RIPK3 ubiquitylation beyond the RHIM, and document how inhibitory ubiquitin modifications of one site can serve to block activating-ubiquitin events on distinct sites of the same protein.

3.3 Results RIPK3 is ubiquitylated beyond-the-RHIM (BTR) on lysine 469 To identify RIPK3 residues that are targeted for post-translational modification (PTM), we complemented immortalized Ripk3-/- mouse dermal fibroblasts (MDFs) with stably integrated, doxycycline (Dox)-inducible, FLAG-tagged wildtype (WT) RIPK3 (denoted hereafter as RIPK3- WT). Following the addition of Dox to induce RIPK3 expression, RIPK3 was isolated by anti- FLAG purification. Subsequent mass spectrometry analysis of trypsin-digested RIPK3-WT identified a Lys-ε-Gly-Gly (diGly) remnant on residue 469, which is situated 8 amino acids beyond the RHIM (BTR) of mouse RIPK3, RIPK3-K469 (Figure 3.1A and 3.1B). The diGly motif on RIPK3-K469 suggests that this lysine is targeted for ubiquitylation upon expression of RIPK3 alone in the absence of an external cell death stimulus. Alignment of RIPK3 sequences from different animals showed that K469 is conserved in mouse and rat RIPK3 but not human RIPK3, although nearby lysines exist in all species of RIPK3 examined (Figure 3.1C).

Figure 3.1. Identification of a diGly motif situated beyond-the-RHIM (BTR) on lysine 469 (A) LC-MS/MS analysis of FLAG-purified RIPK3-WT following doxycycline (Dox)-induced expression in Ripk3-/- MDFs for 16-18 h identified a diGly motif on K469. (B) The domain architecture of mouse RIPK3. The K469 diGly motif is situated at the C- terminus, 8 amino acids beyond-the-RHIM (BTR). No structural information is available for this region, although it is predicted to be disordered. (C) Sequence alignment of mouse RIPK3-K469 generated by Clustal Omega (EMBL-EBI).

We assessed whether the diGly remnant found on RIPK3-K469 represents ubiquitylation. We complemented Ripk3-/- MDFs with RIPK3-WT and induced the expression of the protein with Dox and performed a GST-Ubiquitin-associated (UBA) domain pulldown to purify the ubiquitylated proteome. Consistent with RIPK3 being ubiquitylated, the purified

57 ubiquitylated proteome contained a substantial level of high molecular weight RIPK3 laddering (Figure 3.2A). Importantly, treatment of the ubiquitylated proteome with USP21, a pan-deubiquitylating enzyme, collapsed the high molecular weight laddering of RIPK3, thereby demonstrating that RIPK3 is modified predominantly with ubiquitin chains (Figure 3.2A). Consistent with this idea, only the co-expression of HA-tagged ubiquitin with mouse RIPK3-WT in 293T cells, but not the other HA-tagged ubiquitin-like proteins, Sumo2 and Sumo3, could co-precipitate high molecular weight, laddered, RIPK3 (Figure 3.2B).

Figure 3.2. Abolishing RIPK3-K469 drives apoptosis and necroptosis (A) Stably integrated RIPK3-WT expression was induced with 20 ng/mL Dox for 16 h in Ripk3

-/- MDFs. A GST-UBA pulldown was subsequently performed, and lysate was incubated with 3 M Usp21 for 1 h where indicated prior to Western blotting. Data are representative of 3 independent experiments. (B) 293T cells were transiently transfected with the Dox-inducible mouse RIPK3-WT and either HA-GFP, ubiquitin, Sumo2, or Sumo3 constructs. After 16 h post-transfection, cells were harvested for HA immunoprecipitation (IP) and analysed by Western blotting. Data are representative of 4 independent experiments. (C) Stably integrated RIPK3-WT- or RIPK3-K469R-complemented Ripk3-/- MDFs were induced with Dox for 16-18 h and treated in the presence/absence of pan-caspase inhibitors IDN-6556 or QVD-OPh, or the RIPK3 kinase inhibitor GSK’872. Cell death was measured by propidium iodide (PI) uptake and flow cytometry. Results are represented as mean ± SEM of 3-4 independent experiments (symbols). (D) Clonogenic survival analysis or Ripk3-/- MDFs reconstituted with either RIPK3-WT or RIPK3- K469R post-dox induction for 7 days. Data are representative of 3 independent experiments.

Loss of RIPK3-K469 ubiquitylation promotes RIPK3-induced necroptosis and apoptosis signalling in a cell type-dependent manner To examine the functional impact of RIPK3-K469 ubiquitylation, we generated a RIPK3 lysine to arginine mutation, RIPK3-K469R, to abolish its ability to be ubiquitylated whilst retaining a positive charge. Ripk3-/- MDFs were complemented with stably integrated, Dox-inducible, RIPK3-WT or RIPK3-K469R. Strikingly, Dox treatment alone to induce RIPK3 expression resulted in accelerated cell death in RIPK3-K469R-expressing cells compared to RIPK3-WT- expressing cells, as measured by PI uptake at 16-18 h post Dox treatment (Figure 3.2C), and in long-term (7 days) clonogenic survival assays (Figure 3.2D). RIPK3 auto-phosphorylation on T231 and S232 allows RIPK3 to phosphorylate MLKL on S345, which causes MLKL activation and necroptosis (Chen et al., 2013). However, RIPK3 can also signal apoptosis independent of its kinase activity, via RHIM-mediated recruitment and activation of caspase-8 (Mandal et al., 2014). Therefore, to define the type of cell death induced by RIPK3-K469R expression, MDFs were treated with pan-caspase inhibitors, IDN- 6556 or QVD-OPh, which block apoptosis and promote necroptosis, or with the RIPK3 kinase inhibitor, GSK’872, which blocks necroptosis and allows RIPK3 to trigger caspase-8-mediated apoptosis. Both pan-caspase inhibition or RIPK3 kinase inhibition still resulted in enhanced

59 cell death in RIPK3-K469R when compared to RIPK3-WT (Figure 3.2C). Because neither inhibitor could restore RIPK3-K469R-induced death kinetics to a level similar to RIPK3-WT, the result suggests that Dox-induced RIPK3-K469R can accelerate cell death through both apoptosis and necroptosis. To further define the biochemical activation of apoptotic and necroptotic responses, we analysed key markers of each cell death pathway by Western blot and mass spectrometry. Consistent with RIPK3-K469R inducing both apoptotic and necroptotic killing, Dox induction of RIPK3-K469R alone resulted in increased apoptotic caspase-8 and -3 processing, in addition to increased necroptotic-associated RIPK3 and MLKL phosphorylation on T231/S232 and S345, respectively, when compared to RIPK3-WT (Figure 3.3A and 3.3B). Moreover, quantitative mass spectrometry of FLAG-purified RIPK3-WT and RIPK3-K469R identified numerous RIPK3 phosphorylation sites previously implicated in RIPK3 signalling (Chen et al., 2013). Notably, these sites were enriched 30 to 60-fold on RIPK3-K469R compared to RIPK3-WT, including T231/S232 (required for MLKL activation) and two novel sites, T386 and T407, of undetermined function (Figure 3.3C and 3.3D).

Figure 3.3. Loss of RIPK3-K469 ubiquitylation enhances caspase-8 and -3 processing, RIPK3 phosphorylation and MLKL activation (A and B) Stably-integrated RIPK3-WT or RIPK3-K469R was expressed in Ripk3-/- MDFs by 20 ng/mL Dox treatment for 16-18 h, and were subsequently analysed by Western blotting (A and B). Roman numerals to the left of blots (i, ii, and iii) indicate the membrane probed. Data are representative of three independent experiments. (C and D) Volcano plot (C) and schematic summary (D) of the level of phosphorylated RIPK3 peptides of RIPK3-WT or RIPK3-K469R expressed in Ripk3-/- MDFs following treatment with 20 ng/mL Dox for 16-18 h. Arrows indicate sites of particular interest. (E and F) Stably integrated RIPK3-WT or RIPK3-K469R was expressed in Ripk3-/- MDFs by 20 ng/mL Dox treatment for 16-18 h and were subsequently analysed by (E) confocal microscopy. Scale bars are 10 m. Results were quantified by measuring the average intensity of p- RIPK3T231/S232 staining (top panel) and average intensity of total RIPK3 staining (bottom panel) normalised to RIPK3-WT levels, and depicted as mean±SEM of 4 independent experiments (symbols). Approximately 20-50 cells were analysed in each experiment.

We next assessed the impact of abolishing RIPK3-K469 ubiquitylation on RIPK3 activity at the single-cell level by confocal microscopy. Consistent with the above data, expression of mutant RIPK3-K469R alone drove a significant increase in p-RIPK3T231/S232 puncta, while overall RIPK3 expression levels between RIPK3-WT and RIPK3-K469R remained comparable (Figure 3.3E and 3.3F). Of note, the p-RIPK3T231/S232 puncta were not present in all cells equally at any single time point. This suggests the kinetics of RIPK3 autophosphorylation varies between cells within the population, consistent with typical population-level cell death responses. Collectively, these data show that loss of RIPK3-K469 ubiquitylation leads to RIPK3 hyperactivation and resulting RIPK3-mediated apoptosis and necroptosis. It defines a functional role for the RIPK3 C-terminal BTR ubiquitylation in modulating RIPK3 signalling. To complement the findings in MDFs, we expressed both RIPK3-WT and RIPK3-K469R in young adult mouse colonic epithelium (YAMC) and immortalised bone marrow-derived macrophage (iBMDM) cell lines. Similar to MDFs, the expression of RIPK3-K469R in YAMC cells also enhanced cell death through apoptosis and necroptosis when treated with GSK’872 or necroptotic stimuli TSI (TNF, smac-mimetic, and IDN-6556) (Figure 3.4A). However, treatment of iBMDMs with apoptotic stimuli TS or necroptotic stimuli TSI did not yield any observable

62 difference in cell death between RIPK3-WT and RIPK3-K469R expressing cells (Figure 3.4B). In agreement with RIPK3-K469R being hyperactive in a cell type-dependent manner, RIPK3- K469R drives RIPK3 T231/S232 hyperphosphorylation in YAMC, but not in iBMDMs (Figure 3.4C and 3.4D). Expression of RIPK3 by Dox alone in iBMDMs did not trigger autophosphorylation. Phosphorylation only occurred when cells were challenged with necroptotic stimuli TSI. Altogether, these results suggest that in cell types capable of RIPK3 autophosphorylation by overexpression alone, such as MDFs and YAMCs, RIPK3-K469R increases its scaffolding activity which promotes both caspase-8 recruitment and apoptosis, in addition to RIPK3 autophoshorylation and necroptosis.

Figure 3.4. Loss of RIPK3-K469 ubiquitylation increases RIPK3 phosphorylation and cell death in a cell type-dependent manner (A-D) Stably integrated RIPK3-WT or RIPK3-K469R was expressed with 20 ng/mL Dox in Ripk3-/- mouse colonic epithelium (YAMC) cells (A and C) or 100 ng/mL Dox in iBMDMs (B and D) for 16-18 h, and were subsequently analysed by Western blotting or PI by FACS. In the case of YAMCs, cells were treated with or without 10 µM RIPK3 kinase inhibitor GSK’872, or in the last 1 hr stimulated with 100 ng/ml TNF (T), 1 µM Cp.A (S) and 5 µM IDN (I) (TSI), as indicated. For iBMDMs, cells were also treated with TS or TSI for 6 h (Western blot), or for 8 h (PI anlaysis). Data are represented as mean±SEM of 3 independent experiments (symbols; A and B), or representative of 3 independent experiments (C and D).

The surface-exposed RIPK3 residues K158, K287 and K307 restrict both apoptotic and necroptotic RIPK3 in a similar manner to RIPK3-K469 We next asked if other RIPK3 lysine residues, which are potential sites for ubiquitylation, might also influence RIPK3 activity and provide insight into the mechanism of RIPK3-K469R hyperactivation. Analysis of the mouse RIPK3 crystal structure, which incorporates only the kinase domain, revealed that there are 8 surface-exposed lysine residues that might be targeted for additional ubiquitin modifications (Figure 3.5A). Indeed, 3 of these lysines, K56, K264 and K307, in addition to K5, have been reported as being modified with ubiquitin to impact RIPK3 by i) targeting it for proteasomal (K264) or lysosomal (K56) turnover, ii) increasing RIPK1/RIPK3 complexation (K5), or iii) limiting RIPK1/RIPK3 complexation (K307) (Lee et al., 2019; Moriwaki and Chan, 2016; Onizawa et al., 2015; Seo et al., 2016) (Figure 3.5B). A multiple sequence alignment of these RIPK3 lysine residues revealed that they were conserved across different species (Figure 3.5C).

Figure 3.5. Conservation of mouse RIPK3 surface-exposed lysine residues

(A) Structure of the mouse RIPK3 kinase domain (PDB ID: 4M69) (Xie et al., 2013) showing 8 conserved surface-exposed lysine residues K30, K56, K63, K145, K158, K264, K287 and K307. (B) Domain architecture of mouse RIPK3 depicting 4 published ubiquitylation sites (K5, K56, K264, and K307) and 5 other conserved surfaced-exposed lysine residues. (C) Multiple sequence analysis of murine RIPK3-K5, -K30, -K56, -K63, -K145, -K158, -K287, and -K307. Alignment was generated using Clustal Omega (EMBL-EBI).

To examine the functional impact of the surface-exposed lysine residues on RIPK3 signalling, we generated a series of Dox-inducible FLAG-tagged lysine to arginine RIPK3 substitution mutants, including published ubiquitylated lysines (Figure 3.5B). All 9 RIPK3 65 mutants were used to complement Ripk3-/- MDFs and their expression levels were shown to be comparable upon Dox induction, with the exception of RIPK3-K307R which, when compared to RIPK3-WT, displayed moderately elevated levels when induced with 5 ng/ml of Dox, which was not evident upon induction with 20 ng/ml of Dox (Figure 3.6A).

Figure 3.6. Some, but not all, surface-exposed lysines on RIPK3 are required to limit RIPK3- induced cell death (A) Ripk3-/- MDFs containing the indicated stably integrated Dox inducible RIPK3 constructs were treated with 5 or 20 ng/mL Dox for 16-18 h, and harvested for Western blot. The results are representative of 3 independent experiments. (B) Ripk3-/- MDFs complemented with stably integrated, Dox-inducible RIPK3 constructs. Each cell line was induced with 3 different concentrations of Dox as indicated for 16-18 h and cell death was measured by PI uptake and flow cytometry. Results are represented as mean ± SEM of 4-5 independent experiments (symbols). (C) Clonogenic survival assay of Ripk3-/- MDFs containing the indicated stably integrated Dox inducible RIPK3 constructs were treated with 10 ng/mL Dox over 7 days. Two independent MDF cell lines were analysed and data are representative of 3 independent experiments.

To test RIPK3 killing activity, all RIPK3 lysine to arginine variants were treated with increasing doses of Dox, and subsequent cell death after 16 h was measured by PI uptake and quantified by flow cytometry, and long-term viability was assessed using a clonogenic survival assay. While RIPK3-WT, RIPK3-K56R, RIPK3-K63R and RIPK3-K264R induced a comparable low level of cell death upon expression (Figure 3.6B), RIPK3-K5R, RIPK3-K30R, RIPK3-K145R, RIPK3-K158R, RIPK3-K287R, and RIPK3-K307R resulted in markedly more cell death in both the short (Figure 3.6B) and long-term (Figure 3.6C) analyses. We subsequently focused on RIPK3-K145, -K158, -K287 and -K307 which were required to substantially restrict RIPK3 killing activity (Figure 3.6B). We did not further analyse the role of RIPK3-K30, as enhanced RIPK3-K30R killing was not re-capitulated when it was expressed in independently derived Ripk3-/- MDFs (data not shown). Upon Dox-induced expression alone, Western blot analysis demonstrated that RIPK3-K158R, RIPK3-K287R, and RIPK3-K307R variants led to enhanced p-RIPK3T231/S232 which correlated with enhanced p- MLKLS345 (Figure 3.7A). The only RIPK3 variant that displayed increased killing capacity that did not enhance RIPK3 phosphorylation was RIPK3-K145R. However, RIPK3-K145R, in addition to RIPK3-K158R, RIPK3-K287R, and RIPK3-K307R, all increased caspase-8 and -3 processing relative to RIPK3-WT when induced by Dox treatment alone (Figure 3.7B). Similar to RIPK3- K469R, Dox treatment over time demonstrated that the variants RIPK3-K158R, RIPK3-K287R, and RIPK3-K307R variants all substantially increased p-RIPK3T231/S232 within 4-6 hours prior to 67 the detection of cell death, while RIPK3-K145R behaved like RIPK3-WT (Figure 3.7C and 3.7D). Therefore, some, but not all, surface-exposed lysine residues on RIPK3 are important for restricting RIPK3-induced death.

Figure 3.7. Surface-exposed K158, K287, and K307 of mouse RIPK3 restrict both apoptotic and necroptotic RIPK3 signalling (A-D) Ripk3-/- MDFs containing stably integrated Dox-inducible RIPK3-WT, -K145R, -K158R, - K287R, -K307R, or -K469R were treated with 20 ng/mL Dox for 16-18 h (A and B) or for the timepoints indicated (C and D). Samples were analysed by Western blotting (A-C), or subjected cell death analysis by PI uptake and flow cytometry (D). Roman numerals to the left

68 of blots (i, ii, and iii) indicate the membrane probed. All data are representative of three independent experiments (A-C), or as mean±SEM of 3-4 independent (symbols) experiments (D).

Loss of RIPK3-K469 ubiquitylation enhances its interaction with caspase-8 but does not impact RIPK3 turnover The misfolding and aggregation of proteins induce stress responses that can precipitate cell death. Therefore, to define if the enhanced killing observed in the RIPK3 lysine to arginine variants, particularly RIPK3-K469R, results in specific binding to apoptotic and necroptotic components, we immunopurified FLAG-RIPK3 upon Dox-induction in Ripk3-/- MDFs. This analysis showed that, when compared to RIPK3-WT, RIPK3-K469R displayed enhanced binding to caspase-8 and, to a lesser extent, RIPK1 (Figure 3.8). Immunopurified RIPK3-K469R phosphorylation on residues required for MLKL activation, RIPK3 T231/S232, was also dramatically elevated. Despite this, RIPK3-WT and RIPK3-K469R bound equivalent levels of MLKL, indicating that when activated by phosphorylated RIPK3, membrane-damaging MLKL is likely to be rapidly released from the RIPK3 complex (Figure 3.8).

Figure 3.8. Ubiquitylation of RIPK3-K469 limits caspase-8 association

Ripk3-/- MDFs containing Dox-inducible stably integrated RIPK3-WT or RIPK3-K469R were induced with 20 ng/mL Dox for 6 h and subsequently subjected to FLAG immunoprecipitation

69 and analysis by Western blotting. Roman numerals to the left of blots (i, ii, and iii) indicate the membrane probed. Data are representative of 3 independent experiments. We next asked if the hyperactivation of RIPK3-K469R might be due to reduced protein turnover. The ubiquitylation of RIPK3 has been implicated in targeting it for both lysosomal and proteasomal degradation (Ali and Mocarski, 2018; Moriwaki and Chan, 2016; Seo et al., 2016). Therefore, to test if RIPK3-K469 ubiquitylation enhanced its degradation, Ripk3-/- MDFs complemented with Dox-inducible WT or mutant RIPK3-K469 were treated with Dox for 16- 18h and de novo RIPK3 transcription was subsequently prevented by removing Dox from the media prior to analysis by Western bloting. Both WT and mutant RIPK3-K469 were observed to diminish at a similar rate upon Dox removal, suggesting that RIPK3-K469 ubiquitylation does not play a role in regulating RIPK3 turnover (Figure 3.9A and 3.9B). Consistent with previous observations (Ali and Mocarski, 2018; Moriwaki and Chan, 2016), proteasomal inhibition with MG132 resulted in the accumulation of ubiquitylated RIPK3 suggesting that RIPK3 is targeted for proteasomal degradation under steady state conditions (Figure 3.9C). However, upon the activation of necroptotic signalling, pre- treatment of MDFs with MG132 attenuated cell death (Figure 3.9D), in agreement with previous studies (Ali and Mocarski, 2018). The inhibition of lysosome function using Bafilomycin A1, on the other hand, had no impact on steady-state, or ubiquitylated, RIPK3 levels (Figure 3.9E). Therefore, it is unlikely that RIPK3-K469 ubiquitylation limits RIPK3 killing activity by targeting RIPK3 for lysosomal or proteasomal degradation.

Figure 3.9. RIPK3-K469 ubiquitylation does not regulate RIPK3 turnover

(A) Ripk3-/- MDFs containing stably integrated Dox-inducible RIPK3-WT or mutant RIPK3- K469R were treated with 5 ng/mL Dox for 16-18 h. Cells were washed to remove Dox and subsequently RIPK3 levels analysed at the indicated time points by Western blotting. Data are representative of 3 independent experiments. (B) Densitometry analysis of (A). Levels of RIPK3 were quantified by Image Lab software (Biorad). Results are represented as mean±SEM of 4 independent experiments.

(C) Cell lysates from WT and Ripk3-/- MDFs treated with 20 µM MG132 for the indicated times were purified by a GST-UBA pulldown, and subsequently analysed by Western blotting. Data are representative of 3 independent experiments. (D) WT, Ripk3-/- and Mlkl-/- MDFs were pre-treated in the presence or absence of increasing concentrations of MG132 as indicated, prior to necroptotic challenge with 100 ng/ml TNF (T), 1 µM Cp.A (S) and 5 µM IDN (I) (TSI) for 3 h. Cell death was examined by PI uptake and flow cytometry. Results are represented as mean±SEM of 3-5 independent experiments (symbols). (E) WT and Ripk3-/- MDFs treated with 20 µM MG132 or 100 nM Baf-A1 for 3 h were harvested for GST-UBA pulldown, and subsequently analysed by Western blotting. Data are representative of 3 independent experiments.

Loss of RIPK3-K469 ubiquitylation via arginine substitution enhances total RIPK3 ubiquitylation, which correlates with increased RIPK3 killing activity Previous studies suggest that substitution of single lysine sites targeted for ubiquitylation with arginine reduces overall levels of RIPK3 modified with ubiquitin chains (Choi et al., 2018; Lee et al., 2019; Moriwaki and Chan, 2016; Seo et al., 2016). We therefore asked if loss of ubiquitylation on RIPK3-K469 also leads to a reduction in total ubiquitylation by purifying the ubiquitylated proteome using Tandem Ubiquitin Binding Entities (TUBEs) (Hjerpe et al., 2009). Unexpectedly, when compared to RIPK3-WT, the total ubiquitylation of RIPK3-K469R, including the ubiquitylation of T231/S232-phosphorylated RIPK3-K469R, was enhanced (Figure 3.10A), which correlated with its increased killing capacity (Figure 3.2C). Blocking RIPK3 kinase activity and T231/S232 autophosphorylation with GSK’872 did not prevent RIPK3 ubiquitylation and, if anything, increased high molecular weight RIPK3 ubiquitin modification (Figure 3.10B). This demonstrates that RIPK3 ubiquitylation can occur in the absence of RIPK3 kinase activity and that it might precede RIPK3 phosphorylation. Consistent with this idea, MLKL was also dispensable for endogenous RIPK3 ubiquitylation upon necroptosis induction (Figure 3.10C). Moreover, the total ubiquitylation of RIPK3-K469R was not impacted by the loss of RIPK1 kinase activity, as demonstrated upon treatment with RIPK1 kinase-specific inhibitor Nec-1s prior to Dox-induced RIPK3-K469R expression and TUBE purification (Figure 3.10D).

Figure 3.10. Ubiquitylation of RIPK3-K469 prevents overall increases in RIPK3 ubiquitylation independent of RIPK1 and RIPK3 kinase activity (A) Ripk3-/- MDFs containing stably integrated Dox-inducible RIPK3-WT or mutant RIPK3- K469R were treated with 10 ng/mL Dox for 16-18 h. A GST-TUBE pulldown was subsequently performed and analysed by Western blotting. Data are representative of 3 independent experiments. (B) Ripk3-/- MDFs containing stably integrated Dox-inducible RIPK3-WT or mutant RIPK3- K469R were treated with 20 ng/mL Dox for 16-18 h with or without 10 M RIPK3 kinase inhibitor GSK’872. A GST-TUBE pulldown was subsequently performed and analysed by Western blotting. Data are representative of 3 independent experiments. (C) WT and Mlkl-/- MDFs treated with 20 µM MG132 or necroptotic stimuli TSI for 3 h were harvested for GST-UBA pulldown, and subsequently analysed by Western blotting. Data are representative of 4 independent experiments. (D) Ripk3-/- MDFs containing stably integrated Dox-inducible RIPK3-WT or mutant RIPK3- K469R were treated with 20 ng/mL Dox for 16-18 h with or without 10 M RIPK1 kinase inhibitor Nec-1s. A GST-TUBE pulldown was subsequently performed and analysed by Western blotting. Data are representative of 3 independent experiments. (E) Ripk3-/- MDFs containing stably integrated Dox-inducible RIPK3-WT, -K145R, -K158R, - K287R, or -K307R was treated with 10 ng/mL Dox for 16-18 h. A GST-TUBE pulldown was subsequently performed and analysed by Western blotting. Data are representative of 3 independent experiments.

Next, we examined if the increased RIPK3 activation (i.e. phosphorylation) and killing activity of RIPK3-K158R, RIPK3-K287R, and RIPK3-K307R also correlated with enhanced RIPK3 ubiquitylation. Indeed, TUBE purification demonstrated that these RIPK3 variants were all ubiquitylated more than RIPK3-WT upon Dox-induced expression in Ripk3-/- MDFs, including ubiquitylation of phosphorylated RIPK3 (Figure 3.10E). In contrast, RIPK3-K145R, which causes a reduction in RIPK3 autophosphorylation upon complementation of RIPK3-deficient MDFs (Figure 3.7A), displayed reduced ubiquitylation when compared to RIPK3-WT (Figure 3.10E). Overall, these data suggest that RIPK3 decoration with ubiquitin chains and RIPK3 autophosphorylation go hand-in-hand, and that these events are required for MLKL activation and subsequent necroptosis.

Loss of RIPK3-K469 ubiquitylation increases the transition of activated and ubiquitylated RIPK3 into detergent-insoluble fractions Activated MLKL associates with the plasma membrane, and potentially other intracellular membranes, to induce cell death (Dondelinger et al., 2014; Wang et al., 2014a). To study if cytosolic RIPK3 might also change in cellular localisation upon ubiquitylation and activation, we initially examined RIPK3 partitioning into Triton-X-100 (TX-100) detergent-soluble and - insoluble fractions. Upon Dox-induced expression in Ripk3-/- MDF or YAMC cells, RIPK3-WT, RIPK3-K469R and MLKL were mainly detected in the TX-100-soluble fraction (Figure 3.11A and 3.11B). However, the majority of active and ubiquitylated RIPK3, and phosphorylated MLKL, were detected in the TX-100-insoluble membranes, and this transition was elevated upon loss of RIPK3-K469 ubiquitylation. Similar to RIPK3-K469R, expression of the hyper- necroptotic RIPK3-K158R, RIPK3-K287R, and RIPK3-K307R mutants in Ripk3-/- MDFs also resulted in enhanced migration of active RIPK3 into the TX-100-insoluble membranes alongside activated MLKL (Figure 3.11C).

Figure 3.11. Loss of RIPK3-K158, -K287, -K307, and -K469 ubiquitylation promotes transition of active RIPK3 into a TX-100-insoluble fraction (A-C) Ripk3-/- MDFs (A and C) or YAMCs (B) containing stably integrated Dox-inducible RIPK3- WT, -K145R, -K158R, -K287R, -K307R, or RIPK3-K469R were treated with 20 ng/mL Dox for 16- 18 h. Lysates were subsequently separated into 1% TX-100-soluble or -insoluble fractions prior to GST-TUBE pulldown and analysis by Western blotting. Roman numerals to the left of blots (i, ii) indicate the membrane probed. Data are representative of 3-4 independent experiments.

The activation of necroptosis in WT MDFs by TSI also resulted in the migration of endogenous ubiquitylated p-RIPK3T231/S232 into the TX-100 insoluble fraction within 90 minutes (Figure 3.12A), akin to hyperactivated RIPK3-K469R (Figure 3.11A). We performed a further fractionation of RIPK3-WT and RIPK3-K469R into digitonin-soluble, NP-40-soluble, RIPA-soluble, and RIPA-insoluble fractions, which allow examination of the cytosol, membrane-bound organelles, nuclei, and insoluble aggregates/lipid raft proteins, respectively (Holden and Horton, 2009). We detected the majority of the p-RIPK3T231/S232, but not inactive RIPK3, in the RIPA-insoluble fraction upon Dox expression, and this was enhanced in RIPK3-K469R-expressing MDF cells (Figure 3.12B). No notable p-RIPK3T231/S232 was found in the membrane-bound organelles or the RIPA-soluble fraction containing the nucleus. To complement the fractionation assay, we studied the localisation of activated p-RIPK3T231/S232 by confocal microscopy in WT MDFs. Notably, we did not find any remarkable colocalisation of TSI-induced endogenous p-RIPK3T231/S232 puncta with any specific organelle examined, including the nucleus (Hoechst 33342), golgi (GM130 and TGN38), lysosome (LAMP1), mitochondria (Mitotracker), and plasma membrane/endosomes (WGA) (Figure 3.13A-13E). Altogether, these results suggest that loss of RIPK3-K469 ubiquitylation, which normally restrains RIPK3, results in the re-distribution of activated RIPK3 into a TX-100- and RIPA- insoluble compartments. These results are in agreement with previous studies suggesting minimal association of the necrosome with any membrane-bound organelles; the complex is most likely a membraneless organelle (Chen et al., 2013; He et al., 2009; Samson et al., 2020).

Figure 3.12. Endogenous RIPK3 is associated with a detergent-insoluble fraction during necroptosis (A) Time-course analysis of WT MDFs treated with the necroptotic stimuli of 100 ng/ml TNF (T), 1 µM Cp.A (S) and 5 µM IDN (I) (TSI) as indicated. Lysates were subsequently separated into 1% TX-100-soluble or -insoluble fractions prior to GST-UBA pulldown and analysis by Western blotting. Roman numerals to the left of blots (i, ii) indicate the membrane probed. Data are representative of 3 independent experiments (B) Ripk3-/- MDFs containing the indicated stably integrated Dox inducible RIPK3-WT or RIPK3- K469R constructs were treated with Dox for 16-18 h. Cells were progressively fractionated into 0.025% Digitonin-soluble (cytosol; C), 1% NP-40-soluble (membrane; M), RIPA-soluble (nuclei; N), and RIPA-insoluble fraction (insoluble aggregates; I), and subsequently analysed by Western blotting. Roman numerals to the left of blots (i, ii, iii, and iv) indicate the membrane probed. Panel on the right depicts different subcellular markers of each fraction in untreated (UT) condition of RIPK3-WT and RIPK3-K469R. Data is from 1 experiment.

Figure 3.13. Endogenous active RIPK3 is membraneless

(A-E) MDFs were stimulated with the necroptotic stimuli 100 ng/ml TNF (T), 1 µM Cp.A (S), and 5 µM IDN (I) (TSI) for 90 min prior to immunofluorescence analysis with p- RIPK3T231/S232 and the organelle markers as indicated. Scale bars are 10 m. Data are representative of 3 independent experiments. WGA; wheat germ agglutinin.

RIPK3-K469 ubiquitylation restricts apoptosis and necroptosis by preventing upstream ubiquitylation on K359 Because loss of RIPK3-K469 ubiquitylation enhanced overall RIPK3 ubiquitylation and cell death, we tested the hypothesis that RIPK3-K469 ubiquitylation is required to prevent further ubiquitylation of RIPK3 on other residues, which otherwise promote RIPK3 activation. To address this, we performed mass spectrometry directly comparing RIPK3-WT and mutant RIPK3-K469R modifications upon Dox expression alone in Ripk3-/- MDFs. This analysis revealed a new ubiquitylation site on RIPK3-K359, that was only detected on RIPK3-K469R, but not in the RIPK3-WT sample (Figure 3.14A). Sequence alignment of RIPK3 from different animal species demonstrated that RIPK3-K359 is highly conserved (Figure 3.14B).

Figure 3.14. RIPK3-K359 is conserved across species

(A) LC-MS/MS analysis of FLAG-purified RIPK3-K469R following doxycycline (Dox)-induced expression in Ripk3-/- MDFs for 16-18 h identified a diGly motif on K359.

(B) Multiple sequence analysis of mouse RIPK3 K359 generated by Clustal Omega (EMBL-EBI).

To assess the significance of RIPK3-K359 ubiquitylation, we generated RIPK3-K359R alone or in combination with the RIPK3-K469R mutation (RIPK3-K359R/K469R). Strikingly, when expressed in Ripk3-/- MDFs, introduction of the RIPK3-K359R mutation on top of RIPK3- K469R was sufficient to suppress the increased cell death promoted by RIPK3-K469R to a level comparable to RIPK3-WT, either upon Dox treatment alone, or in combination with apoptotic stimuli TS, or the necroptotic stimuli TSI (Figure 3.15A). We next assessed the level of RIPK3 ubiquitylation by TUBE purification of the ubiquitylated proteome. Consistent with the level of RIPK3 ubiquitylation correlating with its activation, the reduced cell death observed in RIPK3-K359R/K469R-expressing cells also correlated with a reduction in total ubiquitylation of both p-RIPK3T231/S232 and RIPK3 to a level that was similar to RIPK3-WT-expressing cells (Figure 3.15B). In agreement with this, Dox time-course analysis over 8 hours suggested delayed p-RIPK3T231/S232 kinetics in RIPK3- K359R/K469R variant expressing cells (Figure 3.15C). These results demonstrate that RIPK3- K469 ubiquitylation prevents increased apoptosis and necroptosis signalling by inhibiting ubiquitin conjugation onto RIPK3-K359. We hypothesised that other lysines that are required to prevent increased RIPK3 activity, apart from RIPK3-K469, also suppress RIPK3-K359 ubiquitylation. To test this, we used one of the hyperactive variants, RIPK3-K158R (Figure 3.15C), and performed a site-directed mutagenesis on K359 to generate a double mutant of RIPK3-K158R/K359R. We found that, similar to the RIPK3-K359R/K469R variant, RIPK3-K158R/K359R also suppressed RIPK3-K158R hyperphosphorylation (Figure 3.15D) which translated to reduced p-MLKLS345 signalling and reduced cell death (Figure 3.15E and 3.15F). Altogether, these data suggest that RIPK3-K359 ubiquitylation is potentially prevented by multiple lysines, and that the ubiquitylation of RIPK3-K359 can trigger RIPK3 activity and cell death.

Figure 3.15. RIPK3-K359 ubiquitylation limits RIPK3 hyperactivity

(A-B) Ripk3-/- MDF cell line #1 containing stably integrated Dox-inducible RIPK3-WT, -K359R, - K469R, and -K359R/K469R were treated with 20 ng/mL Dox for 16-18 h prior to PI analysis (A) or GST-TUBE pulldown (B). For PI analysis, cells were also additionally treated with 100 ng/ml

TNF (T) and 1 µM Cp.A (S) to induce apoptosis (TS), or TS combined with 5 µM IDN (I) (TSI) to induce necroptosis for the duration as indicated. Results were depicted as mean ± SEM of 3- 5 independent experiments (A, symbols), or representative of 3 independent experiments (B). (C-F) Ripk3-/- MDF cell line #2 containing stably integrated Dox-inducible RIPK3-WT, -K158R, - K359R, -K469R, -K158R/K359R, and -K359R/K469R were treated with 10 ng/mL Dox in a time- course manner as indicated for Western blot analysis (C-E), or at varying concentration of Dox for 8 h prior to PI analysis (F). Data are representative of 3 independent experiments (C-E), or depicted as mean ± SEM of 4 independent experiments (F, symbols).

3.4 Discussion This chapter shows that murine RIPK3 is decorated by ubiquitin on the C-terminus region, 8 amino acids beyond its RHIM on lysine 469, RIPK3-K469. Mutation of lysine 469 to arginine (RIPK3-K469R) to block its ubiquitylation led to increased necroptotic and apoptotic killing capacity. Our analysis subsequently revealed that the increased RIPK3-K469R-mediated cell death was conferred due to the triggering of activating ubiquitylation on RIPK3 lysine 359. Hence, inhibitory ubiquitin modification of RIPK3 beyond the RHIM acts to prevent ubiquitin being attached to upstream lysine residues that can trigger RIPK3 killing.

RIPK3-K469 ubiquitylation was identified by mass spectrometry analysis upon the complementation of RIPK3-deficient MDFs with Dox-inducible RIPK3-WT. In short term overnight assays expression, RIPK3-WT displayed little, if any, capacity to induce cell death. This is consistent with our findings showing that RIPK3-K469 ubiquitylation limits increased RIPK3 killing activity. Although mouse RIPK3-K469 is not conserved in human RIPK3, the residue corresponding to mouse K469 in human RIPK3, T476, may be a target for non- canonical ubiquitylation modification, such as the oxyester-linked ubiquitylation mediated by the ubiquitin E3 ligase, HOIL-1 (Kelsall et al., 2019). Alternatively, it is possible that the site is conserved spatially should the RIPK3 BTR region be structured; although it is notable that both human and mouse RIPK3 BTR sequences are predicted to be unstructured regions. Finally, because the regulatory mechanism between RIPK3 phosphorylation and ubiquitylation is increasingly recognised (Choi et al., 2018), it is possible that human RIPK3 T476 represents a phosphorylation site which acts like mouse K469 in regulating the ubiquitylation of other RIPK3 residues.

Loss of RIPK3-K469 ubiquitylation correlated with enhanced p-RIPK3T231/S232, p-MLKLS345, cleaved caspase-8 and cleaved caspase-3, which translated to accelerated apoptosis and necroptosis. This is unusual in that RIPK3-induced apoptosis is typically induced following the inhibition of its kinase activity (Feoktistova et al., 2011; Mandal et al., 2014; Newton et al., 2014; Tenev et al., 2011). However, the overexpression of RIPK3 has been documented to activate apoptosis (Sun et al., 1999; Yu et al., 1999), while in bone marrow- derived macrophages and -dendritic cells, we and others have reported endogenous RIPK3- driven apoptotic signalling upon genetic or chemical targeting of IAP proteins (Feoktistova et al., 2011; Lawlor et al., 2015; Tenev et al., 2011; Vince et al., 2012; Vince et al., 2007), or influenza infection (Zheng et al., 2020).

Contrary to all RIPK3 ubiquitylation studies to date (Choi et al., 2018; Lee et al., 2019; Moriwaki and Chan, 2016; Onizawa et al., 2015; Roedig et al., 2020; Seo et al., 2016), we observed that loss of a RIPK3 ubiquitylation site does not always result in a reduction in total RIPK3 ubiquitylation levels. In fact, our results show that the loss of RIPK3 ubiquitylation at K469 triggered a substantial increase in the detection of ubiquitylated RIPK3 species. The pronounced increase in RIPK3-K469R ubiquitylation correlated with increased RIPK3- mediated death, and RIPK3-K469R ubiquitylation was not dependent on RIPK1 or RIPK3 kinase activity, MLKL, or caspase activity. Therefore, ubiquitylation of RIPK3 BTR may serve to attenuate its kinase activity and subsequent autophosphorylation, as evidenced by the increased RIPK3-K469R ubiquitylation correlating with a 30 to 60-fold increase in RIPK3 phosphorylated species, including phosphorylation of the residues T231/S232, which is required for MLKL activation. Alternatively, it is also possible that in cell types which are capable of RIPK3 autophosphorylation by overexpression alone, such as MDF and YAMC cells, loss of RIPK3 K469 ubiquitylation primes the system for hyperphosphorylation since this effect was not observed in iBMDMs, where expression of RIPK3 alone did not trigger phosphorylation. It remains unknown at this stage why certain cell types exhibit such difference in RIPK3 autophosphorylation status under overexpression condition. However, this finding is unsurprising as cell type-specific phenomena have also been reported previously in the context of TRADD regulation of RIPK1 function during TNFR1 and TLR3/4 signalling, whereby TRADD assists in RIPK1 ubiquitylation in fibroblasts, but not in macrophages (Ermolaeva et al., 2008).

Ubiquitylated RIPK3-K469R also increased RIPK3 binding and activation of apoptotic caspase-8. Because the RIPK3 RHIM is required for oligomerisation of RIPK3 to promote its kinase activation (Li et al., 2012), and also recruits RIPK1 and caspase-8 (Cho et al., 2009), we suggest that RIPK3-K469 ubiquitylation serves to keep the RIPK3 RHIM in an inactive confirmation; by preventing its exposure and hence propensity to form oligomers. In this regard, sequences flanking the RIPK3 RHIM, including K469, are thought to be intrinsically unstructured, and it has been suggested these regions may hide the RHIM to limit oligomerisation (Li et al., 2012). Moreover, recent finding shows that the flanking regions contribute to the RHIM structure and are indispensable for functional necrosome signalling. Therefore, it is possible that RIPK3-K469 ubiquitylation disrupts the structural integrity of the flanking regions to downregulate RHIM signalling (Wu et al., 2020). On the other hand, our data also suggest that RIPK3 K359 ubiquitylation acts in the opposite manner to promote RIPK3 RHIM exposure and activation, particularly upon loss of RIPK3-K469 ubiquitin modification. It is tempting to speculate that these mechanisms may be conserved in other RHIM-containing proteins. For example, RIPK1 BTR ubiquitylation has been documented to occur via the E3 ligase MIB2, and MIB2 also functions to limit RIPK1 killing activity (Feltham et al., 2018).

Enhanced RIPK3 ubiquitylation and increased cell death signalling were also observed wherein 3 other surface-exposed and conserved RIPK3 lysine residues were mutated to arginine, i.e. RIPK3-K158R, RIPK3-K287R, and RIPK3-K307R. Of note, RIPK3-K307 is the mouse homologue of human RIPK3-K302, which has been reported as one of the sites targeted by the PARKIN E3 ligase (Lee et al., 2019). Consistent with this report, RIPK3 killing was increased upon the loss of RIPK3-K307 ubiquitylation, however, we did not observe a reduction in overall RIPK3 ubiquitylation but, similar to RIPK3-K469R, found that RIPK3-K307R killing correlated with increased ubiquitylation. It is therefore possible that the other surface exposed-lysines we identified, RIPK3-K158 and RIPK3-K287, which result in increased ubiquitylated and active RIPK3 when mutated to arginine, also represent sites modified by ubiquitin to limit RIPK3 signalling. Importantly, mutating RIPK3-K359 in another hyperactive RIPK3-K158R variant (RIPK3-K158R/K359R) reduced its activity to a level that is comparable as RIPK3-WT; a phenomenon similar to our findings with RIPK3-K359R/K469R. Given that RIPK3-K359 is highly conserved across species, ubiquitin targeting of this site may act as

86 general RIPK3 activation mechanism. Identification of the E3 ligases required for ubiquitin targeting of the new, functional, RIPK3 sites that we have characterised, RIPK3-K469 and RIPK3-K359, may present new therapeutic avenues for toggling RIPK3 signalling.

CHAPTER 4 – ANALYSIS OF RIPK3 K469R MUTANT MICE: LOSS OF RIPK3 K469 UBIQUITYLATION IN VIVO

4.1 Preface This chapter is an extension to the in vitro work from the previous chapter. Because loss of RIPK3-K469 ubiquitylation enhanced apoptosis and necroptosis in vitro, Ripk3K469R/K469R mutant mice were generated to examine its physiological relevance in vivo. I began by assessing the impact of RIPK3-K469R ex vivo by generating primary mouse dermal fibroblast (MDFs), bone marrow-derived macrophage (BMDMs), and bone marrow-derived dendritic cell (BMDCs). All cell types were subjected to challenges akin to previous in vitro experiments, however, without the need for the induction of RIPK3 expression. Moreover, these ex vivo experiments also allowed me to study the role of RIPK3-K469 ubiquitylation in regulating inflammation. As outlined in section 1.5.1, activated RIPK3 can also drive inflammatory responses, such as the NLRP3-caspase-1-IL-1 signalling axis. Therefore, the cell types of the immune system, in particular BMDMs and BDMCs, are suitable to examine RIPK3-mediated inflammatory signalling in Ripk3K469R/K469R animals.

I subsequently explored in vivo models where RIPK3-K469R might impact the phenotype: skin inflammation by antagonism of IAPs (Anderton et al., 2017), LPS endotoxic shock (Newton et al., 2016), K/B x N serum-mediated arthritis (Lawlor et al., 2015), and Salmonella Typhimurium challenge (Doerflinger et al., 2020; Robinson et al., 2012). Although the published studies utilising these models, in particular IAP-driven skin inflammation and LPS- mediated endotoxic shock, reported minimal or no significant RIPK3 contribution, the findings were based on the Ripk3-null mouse background. Therefore, it does not exclude the potential for Ripk3K469R/K469R mice, where we expect RIPK3 to be hyperactive, to exhibit a difference when subjected to the challenge.

I would like to acknowledge the contributions of the following researchers:

• Andrew Kueh and Marco Herold (WEHI) for generating the Ripk3K469R mice via CRISPR/Cas9 technology • Najoua Lalaoui (WEHI) for advice on the breeding strategy of Ripk3K469R/K469R mice • Holly Anderton (WEHI) for assisting with IAP Smac mimetic injection model • Sarah Garnish (WEHI) for assisting with LPS endotoxic shock model and Incucyte experiments • Cynthia Louis (WEHI) for providing the K/BxN serum, and Kate Lawlor (Hudson Institute) for assisting with running the serum transfer arthritis model • Greg Ebert (WEHI) and Jaclyn Pearson (Hudson Institute) for assisting with Salmonella infection

4.2. Results RIPK3 tissue expression and blood analysis in Ripk3K469R/K469R mice We generated Ripk3K469R/K469R mice by CRISPR/Cas9 technology on a C57BL/6J background to study the impact of losing RIPK3-K469 ubiquitylation in vivo. Successful generation of founder RIPK3 mutant mice was confirmed by next-generation sequencing and these were subsequently backcrossed onto WT C57BL/6J mice for at least two generations prior to experiments. RIPK3 protein expression in organs and the composition of the blood compartment in Ripk3+/+ and Ripk3K469R/K469R mice, as well as Ripk3+/K469R to a certain extent, were initially assessed in the absence of any challenge. Tissue Western blot analysis suggested no difference in RIPK3 expression across the genotypes (Figure 4.1A-G). This is consistent with in vitro findings suggesting that loss of RIPK3-K469 ubiquitylation did not impact RIPK3 protein levels or stability (Figure 3.9A and 3.9B).

Advia hematology analysis of white and red blood cell compartments comparing Ripk3+/+, Ripk3+/K469R, and Ripk3K469R/K469R mice revealed no substantial differences across all genotypes (Figure 4.2). Collectively, these results indicate that abolishing K469 ubiquitylation on RIPK3 does not perturb basal physiology, although an age-related phenotype, as observed for other RIPK3 activating mutants (Lee et al., 2019; Seo et al., 2016), has yet to be ruled out.

Figure 4.1. RIPK3 expression between Ripk3+/+ and Ripk3K469R/K469R mice is similar. Western blot analysis of bone marrow, sub-mandible bleed, tongue, lung, large intestine, thymus, and spleen. Ripk3+/K469R mice were also included for sub-mandible bleed analysis. Where indicated, Ripk3-/- mice were also included as a control for RIPK3 antibody specificity. All data are representative of at least 3 mice.

Figure 4.2. Advia hematology analysis of Ripk3+/+, Ripk3+/K469R, and Ripk3K469R/K469R mice. Blood was collected by sub-mandible bleeds from mice of the indicated genotypes. Results are depicted as mean±SEM from 5-7 male mice aged 8-11 weeks (symbols).

Loss of RIPK3-K469 ubiquitylation enhances apoptosis in primary MDFs In vitro experiments complementing RIPK3-deficient cells with the overexpression of RIPK3- K469R suggested that ubiquitylation on K469 is important to restrict RIPK3-induced cell death, especially in MDFs (Figure 3.2C and 3.2D). Therefore, primary MDFs were isolated from 90

Ripk3K469R/K469R mice and challenged with death stimuli. Consistent with in vitro findings, treatment of primary MDFs with the apoptotic stimuli TNF and SMAC mimetic (TS) led to increased cleavage of caspases in the absence of K469 ubiquitylation (Figure 4.3A). However, both Ripk3+/+ and Ripk3K469R/K469R primary MDFs induced RIPK3 phosphorylation at a similar rate in response to treatment with the necroptotic stimuli TS combined with the pan-caspase inhibitor IDN-6556 (TSI) (Figure 4.3B). In agreement with the Western blot data, analysis of cell death kinetics in real time demonstrated increased PI uptake (indicative of enhanced death) in response to TS treatment over 12 hours when K469 ubiquitylation was abolished (Figure 4.3C). In contrast, TSI-induced necroptosis resulted in a similar rate of PI uptake in primary MDFs, regardless of the genotype (Figure 4.3D). These results suggest that endogenous RIPK3-K469 ubiquityaltion is important for restricting apoptosis, but not necroptosis, in primary MDFs.

My initial in vitro results demonstrated that regulation of RIPK3 through K469 ubiquitylation occurs in fibroblast and colonic cell lines, but not in phagocytic cells such as macrophages (Figure 3.4B and 3.4D). Therefore, to test if these observations translate to primary cell types, we generated BMDMs from Ripk3K469R/K469R mice. Indeed, BMDMs derived from Ripk3K469R/K469R mice died with kinetics similar to those observed for WT cells upon apoptosis and necroptosis induction using TS and TSI treatments, respectively (Figure 4.3E). As BMDMs also respond to LPS stimulation, which engages TLR4 and is capable of inducing apoptosis or necroptosis, these cells were treated with apoptotic stimuli LPS and SMAC mimetic (LS) or with necroptotic stimuli LS combined with the pan-caspase inhibitor IDN-6556 (LSI). However, the loss of RIPK3 K469 ubiquitylation did not impact LPS-triggered apoptosis or necroptosis (Figure 4.3E). Western blot analysis confirmed similar cleavage of caspase-3 and levels of p-RIPK3T231/S232 upon BMDMs challenged with apoptotic or necroptotic stimuli (Figure 4.3F-H). I also measured PI uptake in BMDCs forced to undergo apoptosis and necroptosis. Similar to BMDMs, no observable difference was found between Ripk3+/+ and Ripk3K469R/K469R cells (Figure 4.3I). These results support my in vitro findings (Figure 3.4B and 3.4D), which demonstrate a cell-type specific regulation of RIPK3-K469 ubiquitylation in preventing cell death.

Figure 4.3. Ubiquitylation on mouse RIPK3 K469 restricts apoptosis in primary MDFs but not BMDMs or BMDCs All cell types (primary MDF, BMDM, and BMDC) derived from Ripk3K469R/K469R mice were treated with either apoptotic stimuli or necroptotic stimuli for the indicated durations. Apoptotic stimuli consist of 100 ng/ml TNF (T) or 50 ng/mL LPS (L) combined with 1 µM Cp.A (S) (denoted as TS or LS). With necroptotic stimuli, 5 µM IDN (I) was added in addition to either LS (denoted LSI) or TS (denoted TSI). Cells were harvested for Western blot, or PI analysis by Incucyte imaging analysis or flow cytometry. Western blot results are representative of 3 independent experiments (A, B, F, G and H). Incucyte results are represented as mean±SEM of 4 mice per genotype (C and D), while PI results by FACS are depicted as mean±SD of 2-4 independent experiments (symbols).

RIPK3-K469 ubiquitylation in SMAC mimetic-mediated skin inflammation RIPK3 has recently been implicated in a mouse model of RIPK1-driven skin inflammation (Anderton et al., 2017). In this model, SMAC mimetics are injected into the skin to deplete the IAP proteins, which results in epidermal apoptosis and the release of inflammatory cytokines. Although RIPK3 appears dispensable for initial epidermal death, loss of RIPK3 was shown to reduce subsequent injury of the dermis. Because primary fibroblasts lacking RIPK3-K469 ubiquitylation exhibit enhanced apoptosis (Figure 4.3A and 4.3C), inflammation resulting from ectopic loss of IAPs in the skin might be amplified in Ripk3K469R/K469R mice.

SMAC mimetic was injected into WT and Ripk3K469R/K469R mice and skin lesions on mice examined after 1 day or 3 days, which is the reported timeframe for when these inflammatory lesions appear (Anderton et al., 2017). Both Ripk3+/+ and Ripk3K469R/K469R mice exhibited comparable skin lesion development on day 1 upon visual inspection or clinical scoring for redness, oedema, and Nikolsky’s Sign of detached epidermis upon rubbing, while on day 3 there was a mild trend for increased Ripk3K469R/K469R lesion severity (Figure 4.4A and 4.4B). Because primary injury to the keratinocytes is driven by apoptosis (Anderton et al., 2017), Western blot analysis was performed on proteins extracted from the skin lesion to assess for caspase-3 cleavage. Consistent with macroscopic analyses, there was no observable difference in overall levels of epidermal caspase-3 cleavage between genotypes; cleaved caspase-3 was highest 1 day post-SMAC mimetic injection and subsided by day 3, and was

93 similar in WT and Ripk3K469R/K469R mice (Figure 4.4C). Collectively, these results suggest that RIPK3 K469 ubiquitylation does not dramatically exacerbate the initial onset and progression of skin lesions resulting from IAP loss (Anderton et al., 2017). However, it will be interesting to repeat and extend these experiments in order to define if the trend towards increased lesion severity observed in Ripk3K469R/K469R mice on day 3 post Smac-mimetic injection is consistent, and if these differences might become more pronounced at later time points.

Figure 4.4. SMAC-mimetic mediated skin inflammation is similar in Ripk3+/+ and Ripk3K469R/K469R mice. (A) Photographs of skin lesions in 5 mice from each genotype 1 and 3 day post-injection on the left and right flanks, respectively. (B) Clinical scoring of the skin lesions. (C) Western blot analysis of the excised skin lesions from 4 mice of each genotype. Sample number corresponds to the indicated mouse number in (A). Mice #5 and #10 were not analysed.

RIPK3-K469 ubiquitylation is potentially pro-inflammatory in LPS-induced endotoxic shock, but not K/BxN serum-mediated arthritis Previous studies have demonstrated that RIPK3 deficiency significantly protected against TNF- induced SIRS, but was dispensable for LPS-induced shock (Newton et al., 2016) despite the fact that LPS can signal to RIPK3 via the adaptor TRIF (Najjar et al., 2016). Interestingly, in this study (Newton et al., 2016), a high LPS dosage of 20 mg/kg was used, which resulted in rapid mortality and may therefore mask any RIPK3-dependent phenotype. As such, LPS was intraperitoneally injected into Ripk3+/+ and Ripk3K469R/K469R mice at 2 mg/kg and serum cytokine levels assessed by ELISA at 2 h and 6 h post-injection. Heterozygous Ripk3+/K469R mice were also included in the LPS challenge model to assess a potential gene dosage effect.

Because LPS regulates transcription of IL-1, TNF and IL-6 (Kawai and Akira, 2010), serum analysis of these pro-inflammatory cytokines was used as a readout for the experiment. Serum analysis prior to LPS injection (prebleed) indicated similar levels of IL-1, TNF and IL-6 in Ripk3+/+, Ripk3+/K469R, and Ripk3K469R/K469R mice (Figure 4.5A-C). At 2 h and 6 h post-LPS injection, however, there was a trend towards reduced IL-1 and TNF, but increased IL-6 serum levels, in Ripk3K469R/K469R mice, while heterozygous Ripk3+/K469R mice displayed a partial reduction in IL-1 and TNF cytokines, suggestive of a gene dosage effect (Figure 4.5A and 4.5B). On the other hand, all genotypes displayed a comparable temperature drop following LPS injection (Figure 4.5D). Overall, these preliminary results suggest that loss of RIPK3-K469 ubiquitylation may act to limit inflammation in LPS-challenged mice, which based on my in vitro studies, may result from increased cell death of relevant cytokine-producing cells.

However, due to the large data spread, more experiments are required to draw any firm conclusions.

Figure 4.5. Loss of RIPK3-K469 ubiquitylation potentially impacts LPS responses in vivo, but does not play a role in the K/BxN serum transfer arthritis model. (A-C) IL-1, TNF and IL-6 ELISA analysis of serum from Ripk3+/+, Ripk3+/K469R and Ripk3K469R/K469R mice at steady state, 2 h, and 6 h post-LPS (2 mg/kg) intraperitoneal injection. (D) Rectal temperatures of mice post-LPS injection. All results (A-D) are from one experiment, represented as mean±SEM of 4-6 mice per genotype (symbols). (E-F) Assessment of arthritis severity (E) and weight change (in %; F) for the K/BxN serum transfer arthritis model. Results were from one experiment, represented as mean±SEM of 6- 7 mice per genotype.

To further assess the potential role of RIPK3-K469 ubiquitylation in regulating inflammation, I examined disease severity of Ripk3K469R/K469R mice using the inflammatory K/BxN serum-induced arthritis model. Injection of pathogenic K/BxN serum induces an innate immune response which recapitulates several features of rheumatoid arthritis (Ditzel, 2004). In the KBxN serum transfer arthritis model, pathology is primarily driven by IL-1 as well as TNF to a certain extent (Ji et al., 2002; Joosten et al., 2009). Importantly, RIPK3 has been found to contribute to the severity of disease by promoting IL-1 secretion in the ankle joint (Lawlor et al., 2015). However, an initial study did not reveal a role for RIPK3-K469 ubiquitylation in this model, as clinical signs of arthritis scored by paw/ankle inflammation, and weight change, in both Ripk3+/+ and Ripk3K469R/K469R mice assessed over 11-days was comparable (Figure 4.5E and 4.5F).

RIPK3-K469 ubiquitylation promotes Salmonella clearance in vivo RIPK3 has been previously implicated in Salmonella infection in which the pathogen was reported to induce RIPK3-mediated necroptosis in macrophages as an immune evasion strategy (Robinson et al., 2012). Therefore, Ripk3+/+ and Ripk3K469R/K469R mice were challenged with a growth-attenuated strain of Salmonella; Salmonella enterica serovar Typhimurium strain BRD509 (denoted hereafter as Salmonella). This Salmonella strain models the initial infection and recovery phases of disease. In both phases, the innate immune system and T- cells are critical to limit pathogen burden and eventually clear the pathogen (Benoun et al., 2018; Kupz et al., 2014). Mice were infected by oral gavage and bacterial load was analysed 2

98 weeks post-infection in the spleen, intestine (measured by bacterial burden in the faeces), and liver, all of which represent the major sites of bacterial replication. Preliminary data from this experiment suggest that Ripk3K469R/K469R mice had significantly increased bacterial burdens in the spleen and intestine, but not the liver (Figure 4.6A-C). There was also a significant difference in the spleen and liver weights between WT and Ripk3K469R/K469R mice (Figure 4.6D and 4.6E). Unfortunately, attempts to repeat this experiment were hampered by bacteria failing to colonise even WT animals upon oral gavage. Therefore, to bypass the gut barrier and ensure robust bacterial infection, mice were subsequently infected with Salmonella via intravenous (iv) injection. Notably, similar to oral challenge, Ripk3K469R/K469R mice also displayed increased bacterial numbers compared to WT animals in the spleen 2 weeks post-infection (Figure 4.6F). However, increased bacterial burden was also observed in the liver of Ripk3K469R/K469R mice compared to WT when challenged via iv, but not orally (Figure 4.7G). Both mouse genotypes did not display any significant difference in spleen or liver weights (Figure 4.7H and 4.7I). As mice were injected with a low dose of Salmonella (100 CFU), bacteria did not colonise the small intestine as none were found in the faeces (not shown). Nevertheless, the collective results of both these experiments suggest that RIPK3 K469 ubiquitylation is required for efficient clearance of Salmonella.

Figure 4.6. RIPK3-K469 ubiquitylation promotes Salmonella clearance in vivo.

(A-C) Analysis of bacterial load in spleen (A), faeces (B), and liver (C) of Salmonella-infected Ripk3+/+ and Ripk3K469R/K469R mice by oral gavage (109 CFU) at day 14. (D-E) Spleen and liver weights of A and C. (F-I) Analysis of bacterial load in spleen (F) and liver (G) with their respective weight (H and I) upon intravenous injection (100 CFU) at day 14. All results are depicted as mean±SEM of 5-6 mice per genotype for oral gavage challenge, or of 6 mice per genotype for iv challenge. *p<0.05; **p<0.01; ns: not significant (Mann-Whitney test).

To further elucidate the mechanism of perturbed Salmonella clearance in Ripk3K469R/K469R mice, I measured serum cytokine levels upon pathogen infection. Initial oral infection did not suggest any difference between Ripk3+/+ and Ripk3K469R/K469R mice in all serum cytokines analysed 2 weeks post-infection (Figure 4.7A-G). However, with iv injection, Ripk3K469R/K469R mice displayed reduced serum IFN and elevated MCP-1 (Figure 4.7H and 4.7I), while other serum cytokines were similar to WT animals (Figure 4.7J-M). In addition to cytokine levels, I also investigated if there was a difference in Salmonella-induced cell death. Recent finding demonstrates that macrophages undergo GSDMD-mediated pyroptosis to restrict Salmonella infectivity (Doerflinger et al., 2020). However, Western blot analysis did not reveal a difference in the generation of the GSDMD p30 active subunit in Salmonella- infected Ripk3+/+ and Ripk3K469R/K469R BMDMs (Figure 4.7N). Consistent with these data, macrophage cell death, as measured by LDH release, demonstrated that Salmonella triggers a similar level of macrophage killing in Ripk3+/+ and Ripk3K469R/K469R BMDMs (Figure 4.7O).

100

Figure 4.7. RIPK3-K469 ubiquitylation potentially regulates IFN and MCP-1 cytokine levels in response to Salmonella infection (A-M) Cytokine analysis of Salmonella-infected Ripk3+/+ and Ripk3K469R/K469R mice by oral gavage (A-G), or by iv challenge (H-M) at day 14 post-infection. Results were depicted as mean±SEM of 5-6 mice per genotype for oral gavage challenge, or of 6 mice per genotype for iv challenge. *p<0.05; ns: not significant (Mann-Whitney test). (N) Western blot analysis of Salmonella-infected BMDM (MOI = 25) isolated from Ripk3+/+ and Ripk3K469R/K469R mice. Duration of infection was either 30 or 60 minutes, as indicated. Data are representative of 2 independent experiments. (O) LDH release in the cell supernatant from Ripk3+/+ and Ripk3K469R/K469R BMDMs infected with Salmonella for 1 h (MOI = 25 or MOI = 50). MOI: multiplicity of infection. Results are depicted as mean±SD of 2 independent experiments.

101

Discussion Under basal conditions, Ripk3K469R/K469R mice do not exhibit anomalies with respect to blood composition and RIPK3 tissue expression. Comparable WT RIPK3 and RIPK3 K469R expression is consistent with in vitro data demonstrating that RIPK3-K469 ubiquitylation does not govern protein stability. Moreover, similar to in vitro MDF overexpression of RIPK3-K469R, Ripk3K469R/K469R primary MDFs displayed elevated sensitivity to apoptotic killing following RIPK3 activation by treatment with TNF and Smac-mimetic. However, whether necroptotic signalling is also enhanced in the absence of K469 ubiquitylation remains inconclusive as primary MDFs did not respond well to necroptotic stimuli. In this regard, the PI uptake observed at 36 h post-necroptotic TSI treatment may result from caspase-8-mediated apoptosis rather than necroptosis as the pan-caspase inhibitor IDN-6556 loses its activity when used long-term (Brumatti et al., 2016). One potential solution for future studies is to replenish the IDN-6556 at defined time intervals throughout incubation to counter any loss of activity.

Although our preliminary SMAC mimetic injection model indicates no difference between Ripk3+/+ and Ripk3K469R/K469R mice, it warrants further investigation due to several caveats. Firstly, due to limited breeding capacity and time constraints, the mice used in the experiment were not littermate controls. As the Ripk3+/+ mice were sourced from another facility they likely have a different skin microbiome and, hence, a potential for altered inflammatory responses upon SMAC mimetic treatment. Secondly, the timepoints chosen for SMAC mimetic injection (i.e. day 1 and day 3) in the experiment only address the onset and peak of the inflammatory skin lesion, and do examine disease resolution. It remains theoretically possible, therefore, that RIPK3 could assist in the wound healing process, which requires extending the experiment up to 11 days (Anderton et al., 2017).

Among the four in vivo models examined, we uncovered a role for RIPK3-K469 ubiquitylation in controlling Salmonella infection. Mice defective for RIPK3-K469 ubiquitylation had elevated bacterial load in their spleen regardless of the bacterial administration route - oral or intravenous (iv). We also observed significant bacterial burden in the liver of mice receiving Salmonella iv injection but not with oral administration. One possible explanation for the observed difference is that with iv administration, Salmonella is directly exposed to the circulatory system which allows immediate colonisation of the liver.

102

In contrast, when Salmonella is administered by oral gavage, the bacteria need to pass through the acidic environment of the stomach and the intestinal tract barrier, before accessing the blood and lymphatic system and, finally, the liver. The splenomegaly from iv injection was also likely to be attributed to direct exposure of the spleen to the Salmonella in a much higher quantity, hence, better colonisation compared to oral injection. While with the oral gavage method we also observed increased bacterial burden in the small intestine of Ripk3K469R/K469R mice based on the faecal CFU count, we could not detect bacteria in the faeces of mice infected through iv. This is most likely due to the low pathogen dose used in the iv route.

How perturbation of RIPK3 K469 ubiquitylation increases Salmonella bacterial levels remains unclear at this stage, although the in vitro studies suggest it should result from excess cell death of a cell type, such as intestinal epithelial cell line, important for controlling the infection. Preliminary results also suggest that RIPK3-K469 ubiquitylation potentially regulates IFN and MCP-1 cytokine levels in response to Salmonella infection, although this difference was only observed in mice exposed to the bacteria via intravenous administration. However, a more detailed analysis of cytokine and bacterial levels at earlier timepoints, not just in the recovery (day 14) phase of infection, may identify similar changes in IFN and MCP- 1 responses, and potentially other cytokines, in both infection models.

As IFN is critical for the initial control of Salmonella infection (Kupz et al., 2014), the reduced serum IFN of Ripk3K469R/K469R mice is consistent with their elevated bacterial burden. Meanwhile, the MCP-1 cytokine level was upregulated in Ripk3K469R/K469R mice which suggests increased immune infiltrates such as monocytes, T cells, and dendritic cells to the Salmonella- infected sites. With regard to the cell death response, Ripk3K469R/K469R BMDM induces GSDMD- mediated pyroptosis as efficiently as in Ripk3+/+ BMDM when infected with Salmonella, consistent with previous studies showing that GSDMD-induced death is the first line of defence in response to pathogen challenge (Doerflinger et al., 2020). However, it is premature to conclude that there is no altered cell death response resulting from absent RIPK3-K469 ubiquitylation in Salmonella-infected mice especially since our in vitro work demonstrates that RIPK3-K469R is hyperactive in a cell type-dependent manner, particularly in fibroblasts and colonic epithelial cell lines. Therefore, it is possible that Ripk3K469R/K469R mice do not clear Salmonella effectively due to an altered cell death response. Whether cell death is delayed or

103 accelerated upon infection is difficult to predict because of conflicting literature reports. On the one hand, Salmonella was proposed to activate RIPK3 to induce necroptosis in macrophages as part of their immune evasion strategy (Robinson et al., 2012), where loss of RIPK3 silences cellular necroptosis and therefore promotes bacterial control. On the other hand, recent findings demonstrate that activation of programmed cell death pathways is critical for Salmonella clearance (Doerflinger et al., 2020).

104

CHAPTER 5 - ACTIVATED MLKL ATTENUATES AUTOPHAGY FOLLOWING ITS TRANSLOCATION TO INTRACELLULAR MEMBRANES

5.1 Preface This chapter contains the following publication:

Frank, D., Vaux, D.L., Murphy, J.M., Vince, J.E., and Lindqvist, L.M. (2019). Activated MLKL attenuates autophagy following its translocation to intracellular membranes. J Cell Sci 132.

I, the author of this thesis, was the first and primary author of the above publication. I contributed 100% to the following:

• Experimental methodology, execution and validation. • Compilation of figures • Writing of the original draft and incorporating changes to the manuscript as suggested by other co-authors

I would like to acknowledge the contributions of the other co-authors to the manuscript as follows:

• David L. Vaux and James M. Murphy as PhD supervisors, and for reviewing and editing the manuscript. • James E. Vince and Lisa M. Lindqvist as PhD supervisors and co-senior author of the manuscript. Both authors were involved in the initial conceptualisation of the project, experimental methodology, analysis of the results, reviewing and editing of the manuscript, and response to the reviewers.

105

106

107

108

109

110

111

112

113

114

115

116

117

118

119

120

121

122

CHAPTER 6 –GENERAL DISCUSSION AND FUTURE DIRECTIONS

RIPK3 is decorated with several post-translational modifications to control its activities in the regulation of inflammatory and cell death processes. Ubiquitylation, in particular, is a modification that can result in several functional outcomes, such as increased protein turnover, altered protein trafficking or the regulation of signaling complex formation. The precise functions of RIPK3 ubiquitylation are of enormous interest to properly understanding how RIPK3 is regulated to control cell death and inflammation in health and disease. My research has demonstrated that the decoration of RIPK3-K469 by ubiquitin limits RIPK3 activity in inducing apoptosis and necroptosis upon expression in MDFs and YAMCs, and that K469 ubiquitylation helps to defend against Salmonella infection. Furthermore, I have demonstrated that ubiquitylation sites on RIPK3 are more interconnected than previously thought. RIPK3-K469 ubiquitylation downregulates RIPK3 activation indirectly by preventing ubiquitylation from occurring upstream on K359. Finally, in addition to the post-translational control of RIPK3 activity, I have also examined how necroptotic signalling impacts autophagy and discovered that active MLKL downregulates the autophagic flux.

6.1 Ubiquitylation as an accelerator and brake on RIPK3 signalling The function of RIPK3 ubiquitylation in overall RIPK3 signalling can be two-fold: either ubiquitylation targets RIPK3 for degradation, thus dampening its activity; or ubiquitylation alters the capability of RIPK3 to form efficient cell death signalling complexes. All ubiquitylation sites identified on RIPK3 (from 2015-2020), including RIPK3-K469, are mapped on the RIPK3 domain architecture in Figure 6.1. There are 23 and 24 lysine residues on mouse and human RIPK3 respectively, and based on the structure of the RIPK3 kinase domain (Xie et al., 2013), at least 8 of these are surface-exposed: K30, K56, K63, K145, K158, K264, K287, K307. While 3 lysines (K56, K264, and K307) have been validated as being modified by ubiquitin (Lee et al., 2019; Moriwaki and Chan, 2016; Seo et al., 2016), the remaining 5 surface-exposed lysines remain potential candidates. Nearly all identified RIPK3 ubiquitylation sites are clustered around the kinase domain and RHIM motif (Choi et al., 2018; Lee et al., 2019; Moriwaki and Chan, 2016; Onizawa et al., 2015; Seo et al., 2016).

123

Figure 6.1. The 2020 ubiquitin map of RIPK3.

Nearly all discovered ubiquitylated lysine (Lys; K) sites on RIPK3 are clustered around its N- terminal and RHIM domain, and have been identified in human cell lines. In contrast, only the discovery of K5 and K264 RIPK3 ubiquitylation were made in mouse cell lines. Mouse lysine sites indicated in black bold have not been experimentally validated, but are conserved in human RIPK3. Sites highlighted in blue are surface-exposed lysines which might serve as potential ubiquitylation sites. m: mouse; h: human.

Ubiquitylation has been reported to enhance RIPK3 turnover either by PELI1 E3 ubiquitin ligase-mediated K48 ubiquitylation, which delivers RIPK3 to the proteasome (Choi et al., 2018; Moriwaki and Chan, 2016), or via CHIP E3 ubiquitin ligase-dependent modification of RIPK3 which transports it to the lysosome (Seo et al., 2016). In both scenarios, the loss of the relevant RIPK3 ubiquitylation sites (K55, K89, K363, and K501) resulted in the accumulation of RIPK3 and increased RIPK3-mediated cell death. In contrast, it has also been suggested that RIPK3 ubiquitylation on the kinase domain, specifically on K5, accelerates RIPK1-RIPK3 necrosome formation and subsequent necroptosis (Onizawa et al., 2015). Although the E3 ligase responsible for RIPK3-K5 ubiquitylation remains to be identified, the deubiquitylating function of A20 was demonstrated in T cells and fibroblasts to play an essential role in countering K63 ubiquitin chain assembly on RIPK3-K5. It is unsurprising, therefore, that when RIPK3-K5 ubiquitylation occurs in the context of A20 deficiency, hyperactive RIPK3 contributes to enhanced cell death and inflammation. More recently, the

124 ubiquitin E3 ligase Parkin, which plays a conventional role in mitophagy, has been reported to negatively regulate human RIPK3 action via an atypical K33 ubiquitin linkage on K197, K302, and K364 (Lee et al., 2019) (Figure 6.1). Similar to A20-deficiency, the absence of Parkin also manifests in RIPK3 hyperactivity and severe inflammation.

My data suggest that RIPK3-K469 ubiquitylation does not impact its stability but limits its ability to signal for apoptosis and necroptosis. The death-restricting effect of mouse RIPK3- K469 ubiquitylation is, therefore, functionally similar to the impact of human RIPK3-K197, K302, and K364 ubiquitylation (Lee et al., 2019). However, my data further show that RIPK3- K469 ubiquitylation restrains RIPK3 hyperactivity in an indirect manner, by preventing RIPK3 activating ubiquitylation of K359. This means that it is RIPK3-K359 ubiquitylation that accelerates RIPK3 activity, and can drive caspase-8-mediated apoptosis and MLKL-mediated necroptosis. Moreover, these findings demonstrate that ubiquitylation sites are interconnected with each other so that when one site is ubiquitylated, it prevents another lysine site from being ubiquitylated elsewhere. A similar regulatory mechanism has also been reported between phosphorylation and ubiquitylation, whereby T182 phosphorylation on human RIPK3 primes PELI-1-mediated ubiquitylation on K363 as a signal for proteasomal degradation, hence, limiting RIPK3 toxicity (Choi et al., 2018). Nevertheless, precisely how RIPK3-K469 suppresses K359 ubiquitylation requires further investigation. One plausible mechanism is that RIPK3-K469 ubiquitylation induces a RIPK3 conformational change so that RIPK3-K359 is masked from being surface-exposed. To test this hypothesis, hydrogen deuterium exchange mass spectrometry (HDX-MS) experiments could be undertaken to examine and compare RIPK3-WT and RIPK3-K469R protein dynamics (Masson et al., 2019). In addition to suppressing RIPK3-K469R hyperactivity, I observed that loss of RIPK3-K359 ubiquitylation also limits killing by the RIPK3-K158R hyperactive variant. As such, future investigations to assess if RIPK3-K359 ubiquitin modification also contributes to the reported hyperactive phenotypes caused by loss of other RIPK3 ubiquitylation sites, such as RIPK3-K307, are warranted (Lee et al., 2019).

Mouse RIPK3-K359 is conserved in human as K364 (Figure 6.1), and RIPK3-K364 has been reported as a substrate for Parkin E3 ligase (Lee et al., 2019). However, the study did not specifically examine the loss of RIPK3-K364 ubiquitylation. Therefore, it remains unknown whether human RIPK3-K364 ubiquitylation leads to hyperactivity similar to mouse RIPK3-

125

K359. Although short-term cell viability (PI uptake) experiments suggest comparable cell death kinetics between RIPK3-WT and RIPK3-K359R, a long-term clonogenic survival assay would be useful in determining whether RIPK3-K359R limits apoptosis and necroptosis.

Among the RIPK3 lysine mutants examined, I found that RIPK3-K5R, K145R, K287R, and K307R confer hyperactivity, in addition to RIPK3-K158R and RIPK3-K469R. It is not clear at this stage why majority of these lysine mutants are hyperactive. One possibility is that mutating a lysine to arginine results in increased electrostatic interactions with neighbouring residues, which in some way, such as via an altered protein conformation, enhances RIPK3 capability in inducing apoptosis and necroptosis. However, it is worth noting that not all lysine to arginine variants increased RIPK3 killing activity, as RIPK3-K56R, -K63R, and -K264R did not impact RIPK3-induced cell death. In addition, while RIPK3-K145R enhanced RIPK3-mediated apoptosis, it did not lead to RIPK3 hyperphosphorylation. It is therefore also possible that the hyperactive lysine variants I discovered are also genuine ubiquitylation sites, which act to repress RIPK3 killing activity. Nonetheless, my mass spectrometry analysis did not detect any diGly motifs present on these previously uncharacterised lysine variants, in particular on RIPK3-K145, K158, and K287, or the confirmed ubiquitylation lysine sites, such as RIPK3-K307.

Two ubiquitylation sites beyond-the-RHIM (BTR) of RIPK3 have been identified to date: K501 and K518 (Roedig et al., 2020; Seo et al., 2016). These two lysine residues are only found in human RIPK3 and are not conserved with mouse RIPK3. RIPK3-K501 is an additional substrate for CHIP E3 ligase-mediated RIPK3 lysosomal degradation (Seo et al., 2016). The terminal RIPK3-K518 ubiquitylation site also served as a brake to limit RIPK3-induced death (Roedig et al., 2020), although the mechanism by which this occurs remains undefined. As such, when RIPK3-K518 is mutated to R, cell death is enhanced. Moreover, the DUB USP22 was reported to remove ubiquitin chains from RIPK3, including K518, and thereby increase necroptotic signaling.

Identifying the E3 ubiquitin ligase or DUB responsible for regulating RIPK3-K469 and RIPK3-K359 ubiquitylation will shed further insight into the mechanism of RIPK3-K469R hyperactivity. One experimental approach to address this is to perform an E3 ubiquitin ligase or DUB CRISPR screen to silence each ubiquitin ligase or DUB, and subsequently assess the impact on cell death in RIPK3-WT cells. The potential candidates would be the E3 ubiquitin ligases that, when deleted, result in accelerated RIPK3-mediated cell death and also alter 126

RIPK3 ubiquitylation. It is unlikely that the E3 ubiquitin ligase CHIP, or the DUB USP22, which both act on the BTR region, regulate RIPK3-K469 ubiquitylation. This is because CHIP ubiquitylation targets RIPK3 for lysosomal degradation rather than altering the capability of RIPK3 to form cell death signalling complexes. On the other hand, the pro-necroptotic USP22 is also unlikely to act on RIPK3-K469 as K469 ubiquitylation is detectable in WT cells. If USP22 removes K469 ubiquitylation during RIPK3-induced cell death, then K469 ubiquitylation would not be detectable by mass spectrometry in RIPK3-WT cells. Moreover, mutant RIPK3-K518R results in reduced total RIPK3 ubiquitylation (Roedig et al., 2020), contrary to RIPK3-K469R.

6.2 The impact of losing RIPK3 ubiquitylation site in vivo To date, the impact of RIPK3 ubiquitylation sites in vivo has been poorly characterised. The majority of studies assessing the role of RIPK3 ubiquitylation in mice have associated loss of RIPK3 ubiquitylation with spontaneous inflammation or tumour formation in the absence of any external challenge. However, a major caveat to these findings is that the in vivo phenotype attributed to losing RIPK3 ubiquitylation was assessed based on the deletion of the corresponding ubiquitin E3 ligase or DUB (which can have many protein targets), not mutation of specific RIPK3 residues modified by ubiquitin chains. In the case of CHIP-mediated RIPK3 ubiquitylation, for instance, loss of CHIP was shown to drive inflammation in the thymus and small intestine, and is lethal after birth (Seo et al., 2016). Although this phenotype was rescued by crossing the Chip-/- with Ripk3-/- mice, it remains undetermined if RIPK3-K55R, K89R, K363R, or K501R mutants would also achieve similar phenotypes to Chip-/- mice. A similar inflammatory profile was also reported for Parkin-mediated ubiquitylation of human RIPK3-K197, K302, and K364 whereby loss of Parkin enhances inflammation in the spleen and small intestine, which primes tumour formation (Lee et al., 2019). Neither study assessed the impact of ubiquitylation sites directly in vivo. Therefore, to directly assess the impact of RIPK3- K469 ubiquitylation in vivo, I generated Ripk3K469R/K469R mice. These mice breed normally and no tissue anomalies were observed, demonstrating that loss of RIPK3-K469 ubiquitylation does not result in spontaneous inflammation in unchallenged conditions.

Importantly, my work shows for the first time that under microbial stress, in this case Salmonella infection, RIPK3-K469 ubiquitylation aids in clearing the pathogen in vivo. It will be intriguing to test if this ubiquitylation site also offers protection against other bacterial infections, particularly in cases where RIPK3 signalling has previously been shown to play a

127 significant role. For instance, RIPK3 was reported to promote Staphylococcus aureus infection, and though not fully understood, the increased bacterial burden upon loss of RIPK3 was proposed to result from RIPK3 crosstalk with the IL-1 signalling pathway, which ultimately drives excessive inflammatory responses (Kitur et al., 2016). As my preliminary LPS endotoxic model experiment indicates that RIPK3-K469 ubiquitylation is potentially pro-inflammatory, it would be interesting to challenge Ripk3K469R/K469R mice with Staphylococcus aureus to test the hypothesis that loss of K469 ubiquitylation ameliorates the inflammation induced by bacteria.

The mechanism of how RIPK3-K469 ubiquitylation promotes Salmonella clearance in mice requires further investigation. Because Ripk3K469R/K469R mice display altered IFN and MCP-1 levels upon encountering Salmonella, it is possible that RIPK3-K469 ubiquitylation regulates the transcriptional response of cytokines in addition to its role in restricting cell death. Previous findings have implicated RIPK3 in regulating the NF-B pathway and the NLRP3-IL-1 signalling axis (Lawlor et al., 2015; Moriwaki et al., 2014; Wong et al., 2014). Therefore, a thorough transcriptional analysis in the organs of WT and Ripk3K359R/K469R mice that are primary targets for Salmonella infection (e.g. splenocytes and hepatocytes) is worth considering. In addition, histological studies of the liver, spleen, and small intestine are required to understand why Ripk3K359R/K469R mice respond poorly upon infection. These would include hematoxylin and eosin stain to assess for potential disruption in tissue architecture or the presence of necrosis, TUNEL staining to assess cell death, and CD45 staining to gauge the level of immune infiltrates. Ultimately, generating a Ripk3K359RRipk3K469R double mutant mouse would allow in vivo testing of whether the loss of activating RIPK3-K359 ubiquitylation, which is triggered upon loss of RIPK3 K469 ubiquitylation, restores the capability of Ripk3K469R/K469R mice to combat Salmonella infection.

6.3. Why autophagy matters in cells committing suicide The status of pre-mortem autophagy varies depending on which death pathway the cell is committed to. Regardless of the cell death modality, it is increasingly appreciated that autophagy modulates the immunogenicity of dying cells. In BAX/BAK-mediated apoptosis, autophagy is activated to clear damaged mitochondria and to internalise pro-inflammatory IFN- (Lindqvist et al., 2017). Whether other pro-inflammatory cytokines are also internalised during apoptosis to further dampen apoptotic immunogenicity remain to be investigated.

128

Contrary to the activation of autophagy in apoptotic cells, my research findings suggest that MLKL is responsible for shutting down the autophagy pathway during necroptosis (Frank et al., 2019). How MLKL silences autophagy requires further experimental work, although I propose that MLKL may directly perforates the lysosomal, autolysosomal and autophagosomal membranes. One method to address this question is by undertaking live cell imaging with lattice-light sheet microscopy to examine whether fluorescently-labelled active MLKL perforates the LC3B-associated organelles or LAMP1-stained lysosomes. A subcellular fractionation assay could also be performed to complement the imaging studies to determine if active MLKL is located in the same fraction as the autophagic organelles and the lysosome, although this method does not provide a direct examination of MLKL action at these membranes.

In addition to elucidating the mechanism underlying MLKL-mediated inhibition of autophagy, the significance of autophagy silencing during necroptosis also requires further investigation. If active autophagy dampens inflammatory responses during apoptosis (Lindqvist et al., 2017), then it would be intriguing to test if MLKL extinguishes autophagy to maintain necroptotic immunogenicity. I demonstrated through genetic deletion that canonical autophagy does not influence the kinetics of necroptosis, thus allowing one to assess the cytokine response without being confounded by the difference in death. Immune cell lines, such as BMDMs or THP-1 cells, could be used to test the idea. Cells could be transfected with a Doxycyline (Dox)-inducible transcription factor EB (TFEB), a master regulator of autophagosome and lysosomal biogenesis, to enhance the cellular autophagy rate (Settembre et al., 2011). Cells could then be subjected to necroptotic challenge with or without Dox, and the production of various cytokines, such as TNF and IL-1, could be subsequently assessed by ELISA. The overexpression system should theoretically overwhelm the ability of endogenous active MLKL to inhibit autophagy, thus allowing one to test the hypothesis that necroptotic cells with active autophagy secrete less DAMPs compared to when autophagy is silenced. Nevertheless, the alternative scenario is also possible in which the inhibition of autophagy prevents necroptotic cells from eliciting an excessive immune response, which would otherwise be detrimental to the host. For example, it was reported that autophagy assists in IL-1 secretion by incorporating the cytokine into the lumen of autophagosomes (Zhang et al., 2015). As such, since active MLKL also induces NLRP3-

129 mediated IL-1 secretion (Conos et al., 2017; Kang et al., 2015; Kang et al., 2013; Lawlor et al., 2015), it is possible that MLKL simultaneously attenuates autophagy to limit release of IL-1 during necroptosis.

Apart from its role in modulating the immune system, autophagy also plays an antibacterial role—a process known as xenophagy (Sharma et al., 2018). In Salmonella- infected cells, autophagy aids in degrading approximately 20% of the pathogens to limit their intracellular growth (Birmingham et al., 2006). Because loss of RIPK3-K469 ubiquitylation drives MLKL activity, it is possible that the autophagy pathway is impaired in Ripk3K469R/K469R mice which compromises their ability to clear Salmonella.

Finally, although the status of autophagy in other inflammatory cell death pathways, in particular pyroptosis, remain poorly defined, it is tempting to speculate that autophagy is also inhibited similar to its downregulation during necroptosis to maximise the immunogenic potential of lytic cell death signalling. As such, it is tempting to speculate that the pyroptotic effector, GSDMD, might also perforate autophagic organelles to block autophagy during pyroptosis.

130

REFERENCES

Aachoui, Y., Kajiwara, Y., Leaf, I.A., Mao, D., Ting, J.P., Coers, J., Aderem, A., Buxbaum, J.D., and Miao, E.A. (2015). Canonical Inflammasomes Drive IFN-gamma to Prime Caspase-11 in Defense against a Cytosol-Invasive Bacterium. Cell Host Microbe 18, 320-332.

Aachoui, Y., Leaf, I.A., Hagar, J.A., Fontana, M.F., Campos, C.G., Zak, D.E., Tan, M.H., Cotter, P.A., Vance, R.E., Aderem, A., et al. (2013). Caspase-11 protects against bacteria that escape the vacuole. Science 339, 975-978.

Aaes, T.L., Kaczmarek, A., Delvaeye, T., De Craene, B., De Koker, S., Heyndrickx, L., Delrue, I., Taminau, J., Wiernicki, B., De Groote, P., et al. (2016). Vaccination with Necroptotic Cancer Cells Induces Efficient Anti-tumor Immunity. Cell Rep 15, 274-287.

Abdel Fattah, E., Bhattacharya, A., Herron, A., Safdar, Z., and Eissa, N.T. (2015). Critical role for IL-18 in spontaneous lung inflammation caused by autophagy deficiency. J Immunol 194, 5407-5416.

Ahmed, N., Zeng, M., Sinha, I., Polin, L., Wei, W.-Z., Rathinam, C., Flavell, R., Massoumi, R., and Venuprasad, K. (2011). The E3 ligase Itch and deubiquitinase Cyld act together to regulate Tak1 and inflammation. Nature Immunology 12, 1176-1183.

Ali, M., and Mocarski, E.S. (2018). Proteasome inhibition blocks necroptosis by attenuating death complex aggregation. Cell Death Dis 9, 346.

Anderton, H. Inhibitor of APoptosis proteins (IAPs) and SHARPIN regulate the immune response in the skin to limit inflammation and maintain homeostasis.

Anderton, H., Rickard, J.A., Varigos, G.A., Lalaoui, N., and Silke, J. (2017). Inhibitor of Apoptosis Proteins (IAPs) Limit RIPK1-Mediated Skin Inflammation. J Invest Dermatol 137, 2371-2379.

Baker, P.J., Boucher, D., Bierschenk, D., Tebartz, C., Whitney, P.G., D'Silva, D.B., Tanzer, M.C., Monteleone, M., Robertson, A.A., Cooper, M.A., et al. (2015). NLRP3 inflammasome activation downstream of cytoplasmic LPS recognition by both caspase-4 and caspase-5. Eur J Immunol 45, 2918-2926.

Benoun, J.M., Peres, N.G., Wang, N., Pham, O.H., Rudisill, V.L., Fogassy, Z.N., Whitney, P.G., Fernandez-Ruiz, D., Gebhardt, T., Pham, Q.M., et al. (2018). Optimal protection against Salmonella infection requires noncirculating memory. Proc Natl Acad Sci U S A 115, 10416- 10421.

Beroukhim, R., Mermel, C.H., Porter, D., Wei, G., Raychaudhuri, S., Donovan, J., Barretina, J., Boehm, J.S., Dobson, J., Urashima, M., et al. (2010). The landscape of somatic copy-number alteration across human cancers. Nature 463, 899-905.

Bertin, J., Armstrong, R.C., Ottilie, S., Martin, D.A., Wang, Y., Banks, S., Wang, G.H., Senkevich, T.G., Alnemri, E.S., Moss, B., et al. (1997). Death effector domain-containing

131 herpesvirus and poxvirus proteins inhibit both Fas- and TNFR1-induced apoptosis. Proc Natl Acad Sci U S A 94, 1172-1176.

Birmingham, C.L., Smith, A.C., Bakowski, M.A., Yoshimori, T., and Brumell, J.H. (2006). Autophagy controls Salmonella infection in response to damage to the Salmonella- containing vacuole. J Biol Chem 281, 11374-11383.

Blessing, N.A., Brockman, A.L., and Chadee, D.N. (2014). The E3 ligase CHIP mediates ubiquitination and degradation of mixed-lineage kinase 3. Mol Cell Biol 34, 3132-3143.

Boone, D.L., Turer, E.E., Lee, E.G., Ahmad, R.C., Wheeler, M.T., Tsui, C., Hurley, P., Chien, M., Chai, S., Hitotsumatsu, O., et al. (2004). The ubiquitin-modifying enzyme A20 is required for termination of Toll-like receptor responses. Nat Immunol 5, 1052-1060.

Bossen, C., Ingold, K., Tardivel, A., Bodmer, J.L., Gaide, O., Hertig, S., Ambrose, C., Tschopp, J., and Schneider, P. (2006). Interactions of tumor necrosis factor (TNF) and TNF receptor family members in the mouse and human. J Biol Chem 281, 13964-13971.

Boucher, D., Monteleone, M., Coll, R.C., Chen, K.W., Ross, C.M., Teo, J.L., Gomez, G.A., Holley, C.L., Bierschenk, D., Stacey, K.J., et al. (2018). Caspase-1 self-cleavage is an intrinsic mechanism to terminate inflammasome activity. J Exp Med 215, 827-840.

Broz, P., and Dixit, V.M. (2016). Inflammasomes: mechanism of assembly, regulation and signalling. Nat Rev Immunol 16, 407-420.

Brumatti, G., Ma, C., Lalaoui, N., Nguyen, N.Y., Navarro, M., Tanzer, M.C., Richmond, J., Ghisi, M., Salmon, J.M., Silke, N., et al. (2016). The caspase-8 inhibitor emricasan combines with the SMAC mimetic birinapant to induce necroptosis and treat acute myeloid leukemia. Sci Transl Med 8, 339ra369.

Burek, M.J., and Oppenheim, R.W. (1996). Programmed cell death in the developing nervous system. Brain Pathol 6, 427-446.

Cai, Z., Jitkaew, S., Zhao, J., Chiang, H.C., Choksi, S., Liu, J., Ward, Y., Wu, L.G., and Liu, Z.G. (2014). Plasma membrane translocation of trimerized MLKL protein is required for TNF- induced necroptosis. Nat Cell Biol 16, 55-65.

Chen, K.W., Gross, C.J., Sotomayor, F.V., Stacey, K.J., Tschopp, J., Sweet, M.J., and Schroder, K. (2014a). The neutrophil NLRC4 inflammasome selectively promotes IL-1beta maturation without pyroptosis during acute Salmonella challenge. Cell Rep 8, 570-582.

Chen, W., Wu, J., Li, L., Zhang, Z., Ren, J., Liang, Y., Chen, F., Yang, C., Zhou, Z., Su, S.S., et al. (2015). Ppm1b negatively regulates necroptosis through dephosphorylating Rip3. Nat Cell Biol 17, 434-444.

Chen, W., Zhou, Z., Li, L., Zhong, C.Q., Zheng, X., Wu, X., Zhang, Y., Ma, H., Huang, D., Li, W., et al. (2013). Diverse sequence determinants control human and mouse receptor interacting protein 3 (RIP3) and mixed lineage kinase domain-like (MLKL) interaction in necroptotic signaling. J Biol Chem 288, 16247-16261.

132

Chen, X., He, W.T., Hu, L., Li, J., Fang, Y., Wang, X., Xu, X., Wang, Z., Huang, K., and Han, J. (2016). Pyroptosis is driven by non-selective gasdermin-D pore and its morphology is different from MLKL channel-mediated necroptosis. Cell Res 26, 1007-1020.

Chen, X., Li, W., Ren, J., Huang, D., He, W.T., Song, Y., Yang, C., Li, W., Zheng, X., Chen, P., et al. (2014b). Translocation of mixed lineage kinase domain-like protein to plasma membrane leads to necrotic cell death. Cell Res 24, 105-121.

Cho, Y.S., Challa, S., Moquin, D., Genga, R., Ray, T.D., Guildford, M., and Chan, F.K. (2009). Phosphorylation-driven assembly of the RIP1-RIP3 complex regulates programmed necrosis and virus-induced inflammation. Cell 137, 1112-1123.

Choi, S.W., Park, H.H., Kim, S., Chung, J.M., Noh, H.J., Kim, S.K., Song, H.K., Lee, C.W., Morgan, M.J., Kang, H.C., et al. (2018). PELI1 Selectively Targets Kinase-Active RIP3 for Ubiquitylation-Dependent Proteasomal Degradation. Mol Cell 70, 920-935 e927.

Clague, M.J., Urbe, S., and Komander, D. (2019). Breaking the chains: deubiquitylating enzyme specificity begets function. Nat Rev Mol Cell Biol 20, 338-352.

Conos, S.A., Chen, K.W., De Nardo, D., Hara, H., Whitehead, L., Nunez, G., Masters, S.L., Murphy, J.M., Schroder, K., Vaux, D.L., et al. (2017). Active MLKL triggers the NLRP3 inflammasome in a cell-intrinsic manner. Proc Natl Acad Sci U S A 114, E961-E969.

Conos, S.A., Lawlor, K.E., Vaux, D.L., Vince, J.E., and Lindqvist, L.M. (2016). Cell death is not essential for caspase-1-mediated interleukin-1beta activation and secretion. Cell Death Differ 23, 1827-1838.

Cookson, B.T., and Brennan, M.A. (2001). Pro-inflammatory programmed cell death. Trends Microbiol 9, 113-114.

Cretney, E., Takeda, K., Yagita, H., Glaccum, M., Peschon, J.J., and Smyth, M.J. (2002). Increased susceptibility to tumor initiation and metastasis in TNF-related apoptosis-inducing ligand-deficient mice. J Immunol 168, 1356-1361.

Czabotar, P.E., Lessene, G., Strasser, A., and Adams, J.M. (2014). Control of apoptosis by the BCL-2 protein family: implications for physiology and therapy. Nat Rev Mol Cell Biol 15, 49- 63.

Damgaard, R.B., Walker, J.A., Marco-Casanova, P., Morgan, N.V., Titheradge, H.L., Elliott, P.R., McHale, D., Maher, E.R., McKenzie, A.N.J., and Komander, D. (2016). The Deubiquitinase OTULIN Is an Essential Negative Regulator of Inflammation and Autoimmunity. Cell 166, 1215-1230 e1220.

Dammer, E.B., Na, C.H., Xu, P., Seyfried, N.T., Duong, D.M., Cheng, D., Gearing, M., Rees, H., Lah, J.J., Levey, A.I., et al. (2011). Polyubiquitin linkage profiles in three models of proteolytic stress suggest the etiology of Alzheimer disease. J Biol Chem 286, 10457-10465.

Daniels, B.P., Kofman, S.B., Smith, J.R., Norris, G.T., Snyder, A.G., Kolb, J.P., Gao, X., Locasale, J.W., Martinez, J., Gale, M., Jr., et al. (2019). The Nucleotide Sensor ZBP1 and Kinase RIPK3

133

Induce the Enzyme IRG1 to Promote an Antiviral Metabolic State in Neurons. Immunity 50, 64-76 e64.

de Vasconcelos, N.M., Van Opdenbosch, N., Van Gorp, H., Parthoens, E., and Lamkanfi, M. (2019). Single-cell analysis of pyroptosis dynamics reveals conserved GSDMD-mediated subcellular events that precede plasma membrane rupture. Cell Death Differ 26, 146-161.

Degterev, A., Huang, Z., Boyce, M., Li, Y., Jagtap, P., Mizushima, N., Cuny, G.D., Mitchison, T.J., Moskowitz, M.A., and Yuan, J. (2005). Chemical inhibitor of nonapoptotic cell death with therapeutic potential for ischemic brain injury. Nat Chem Biol 1, 112-119.

Delbridge, A.R., Grabow, S., Strasser, A., and Vaux, D.L. (2016). Thirty years of BCL-2: translating cell death discoveries into novel cancer therapies. Nat Rev Cancer 16, 99-109.

Deol, K.K., Lorenz, S., and Strieter, E.R. (2019). Enzymatic Logic of Ubiquitin Chain Assembly. Front Physiol 10, 835.

Dermentzaki, G., Politi, K.A., Lu, L., Mishra, V., Perez-Torres, E.J., Sosunov, A.A., McKhann, G.M., 2nd, Lotti, F., Shneider, N.A., and Przedborski, S. (2019). Deletion of Ripk3 Prevents Motor Neuron Death In Vitro but not In Vivo. eNeuro 6.

Deveraux, Q.L., Roy, N., Stennicke, H.R., Van Arsdale, T., Zhou, Q., Srinivasula, S.M., Alnemri, E.S., Salvesen, G.S., and Reed, J.C. (1998). IAPs block apoptotic events induced by caspase-8 and cytochrome c by direct inhibition of distinct caspases. EMBO J 17, 2215-2223.

Dillon, C.P., Oberst, A., Weinlich, R., Janke, L.J., Kang, T.B., Ben-Moshe, T., Mak, T.W., Wallach, D., and Green, D.R. (2012). Survival function of the FADD-CASPASE-8-cFLIP(L) complex. Cell Rep 1, 401-407.

Ding, J., Wang, K., Liu, W., She, Y., Sun, Q., Shi, J., Sun, H., Wang, D.C., and Shao, F. (2016). Pore-forming activity and structural autoinhibition of the gasdermin family. Nature 535, 111-116.

Ditzel, H.J. (2004). The K/BxN mouse: a model of human inflammatory arthritis. Trends Mol Med 10, 40-45.

Dobbelstein, M., and Shenk, T. (1996). Protection against apoptosis by the vaccinia virus SPI- 2 (B13R) gene product. J Virol 70, 6479-6485.

Doerflinger, M., Deng, Y., Whitney, P., Salvamoser, R., Engel, S., Kueh, A.J., Tai, L., Bachem, A., Gressier, E., Geoghegan, N.D., et al. (2020). Flexible Usage and Interconnectivity of Diverse Cell Death Pathways Protect against Intracellular Infection. Immunity 53, 533-547 e537.

Doitsh, G., Galloway, N.L., Geng, X., Yang, Z., Monroe, K.M., Zepeda, O., Hunt, P.W., Hatano, H., Sowinski, S., Munoz-Arias, I., et al. (2014). Cell death by pyroptosis drives CD4 T-cell depletion in HIV-1 infection. Nature 505, 509-514.

134

Dondelinger, Y., Aguileta, M.A., Goossens, V., Dubuisson, C., Grootjans, S., Dejardin, E., Vandenabeele, P., and Bertrand, M.J. (2013). RIPK3 contributes to TNFR1-mediated RIPK1 kinase-dependent apoptosis in conditions of cIAP1/2 depletion or TAK1 kinase inhibition. Cell Death Differ 20, 1381-1392.

Dondelinger, Y., Declercq, W., Montessuit, S., Roelandt, R., Goncalves, A., Bruggeman, I., Hulpiau, P., Weber, K., Sehon, C.A., Marquis, R.W., et al. (2014). MLKL compromises plasma membrane integrity by binding to phosphatidylinositol phosphates. Cell Rep 7, 971-981.

Dondelinger, Y., Hulpiau, P., Saeys, Y., Bertrand, M.J.M., and Vandenabeele, P. (2016). An evolutionary perspective on the necroptotic pathway. Trends Cell Biol 26, 721-732.

Dondelinger, Y., Jouan-Lanhouet, S., Divert, T., Theatre, E., Bertin, J., Gough, P.J., Giansanti, P., Heck, A.J., Dejardin, E., Vandenabeele, P., et al. (2015). NF-kappaB-Independent Role of IKKalpha/IKKbeta in Preventing RIPK1 Kinase-Dependent Apoptotic and Necroptotic Cell Death during TNF Signaling. Mol Cell 60, 63-76.

Draber, P., Kupka, S., Reichert, M., Draberova, H., Lafont, E., de Miguel, D., Spilgies, L., Surinova, S., Taraborrelli, L., Hartwig, T., et al. (2015). LUBAC-Recruited CYLD and A20 Regulate Gene Activation and Cell Death by Exerting Opposing Effects on Linear Ubiquitin in Signaling Complexes. Cell Rep 13, 2258-2272.

Du, C., Fang, M., Li, Y., Li, L., and Wang, X. (2000). Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell 102, 33-42.

Duong, B.H., Onizawa, M., Oses-Prieto, J.A., Advincula, R., Burlingame, A., Malynn, B.A., and Ma, A. (2015). A20 restricts ubiquitination of pro-interleukin-1beta protein complexes and suppresses NLRP3 inflammasome activity. Immunity 42, 55-67.

Dupont, N., Jiang, S., Pilli, M., Ornatowski, W., Bhattacharya, D., and Deretic, V. (2011). Autophagy-based unconventional secretory pathway for extracellular delivery of IL-1beta. EMBO J 30, 4701-4711.

Duprez, L., Takahashi, N., Van Hauwermeiren, F., Vandendriessche, B., Goossens, V., Vanden Berghe, T., Declercq, W., Libert, C., Cauwels, A., and Vandenabeele, P. (2011). RIP kinase- dependent necrosis drives lethal systemic inflammatory response syndrome. Immunity 35, 908-918.

Egan, D.F., Shackelford, D.B., Mihaylova, M.M., Gelino, S., Kohnz, R.A., Mair, W., Vasquez, D.S., Joshi, A., Gwinn, D.M., Taylor, R., et al. (2011). Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy. Science 331, 456-461.

Elliott, Paul R., Nielsen, Sofie V., Marco-Casanova, P., Fiil, Berthe K., Keusekotten, K., Mailand, N., Freund, Stefan M.V., Gyrd-Hansen, M., and Komander, D. (2014). Molecular Basis and Regulation of OTULIN-LUBAC Interaction. Molecular Cell 54, 335-348.

Eng, V.V., Wemyss, M.A., and Pearson, J.S. (2021). The diverse roles of RIP kinases in host- pathogen interactions. Semin Cell Dev Biol 109, 125-143.

135

Ermolaeva, M.A., Michallet, M.C., Papadopoulou, N., Utermohlen, O., Kranidioti, K., Kollias, G., Tschopp, J., and Pasparakis, M. (2008). Function of TRADD in tumor necrosis factor receptor 1 signaling and in TRIF-dependent inflammatory responses. Nat Immunol 9, 1037- 1046.

Evans, P.C., Ovaa, H., Hamon, M., Kilshaw, P.J., Hamm, S., Bauer, S., Ploegh, H.L., and Smith, T.S. (2004). Zinc-finger protein A20, a regulator of inflammation and cell survival, has deubiquitinating activity. Biochem J 378, 727-734.

Fan, W., Guo, J., Gao, B., Zhang, W., Ling, L., Xu, T., Pan, C., Li, L., Chen, S., Wang, H., et al. (2019). Flotillin-mediated endocytosis and ALIX-syntenin-1-mediated exocytosis protect the cell membrane from damage caused by necroptosis. Sci Signal 12.

Fantuzzi, G., and Dinarello, C.A. (1999). Interleukin-18 and interleukin-1 beta: two cytokine substrates for ICE (caspase-1). J Clin Immunol 19, 1-11.

Feltham, R., Jamal, K., Tenev, T., Liccardi, G., Jaco, I., Domingues, C.M., Morris, O., John, S.W., Annibaldi, A., Widya, M., et al. (2018). Mind Bomb Regulates Cell Death during TNF Signaling by Suppressing RIPK1's Cytotoxic Potential. Cell Rep 23, 470-484.

Feoktistova, M., Geserick, P., Kellert, B., Dimitrova, D.P., Langlais, C., Hupe, M., Cain, K., MacFarlane, M., Hacker, G., and Leverkus, M. (2011). cIAPs block Ripoptosome formation, a RIP1/caspase-8 containing intracellular cell death complex differentially regulated by cFLIP isoforms. Mol Cell 43, 449-463.

Fiil, Berthe K., Damgaard, Rune B., Wagner, Sebastian A., Keusekotten, K., Fritsch, M., Bekker-Jensen, S., Mailand, N., Choudhary, C., Komander, D., and Gyrd-Hansen, M. (2013). OTULIN Restricts Met1-Linked Ubiquitination to Control Innate Immune Signaling. Molecular Cell 50, 818-830.

Frank, D., Vaux, D.L., Murphy, J.M., Vince, J.E., and Lindqvist, L.M. (2019). Activated MLKL attenuates autophagy following its translocation to intracellular membranes. J Cell Sci 132.

Frank, D., and Vince, J.E. (2019). Pyroptosis versus necroptosis: similarities, differences, and crosstalk. Cell Death Differ 26, 99-114.

Franken, N.A., Rodermond, H.M., Stap, J., Haveman, J., and van Bree, C. (2006). Clonogenic assay of cells in vitro. Nat Protoc 1, 2315-2319.

Fritsch, M., Gunther, S.D., Schwarzer, R., Albert, M.C., Schorn, F., Werthenbach, J.P., Schiffmann, L.M., Stair, N., Stocks, H., Seeger, J.M., et al. (2019). Caspase-8 is the molecular switch for apoptosis, necroptosis and pyroptosis. Nature 575, 683-687.

Galluzzi, L., Baehrecke, E.H., Ballabio, A., Boya, P., Bravo-San Pedro, J.M., Cecconi, F., Choi, A.M., Chu, C.T., Codogno, P., Colombo, M.I., et al. (2017). Molecular definitions of autophagy and related processes. EMBO J 36, 1811-1836.

Galluzzi, L., Vitale, I., Aaronson, S.A., Abrams, J.M., Adam, D., Agostinis, P., Alnemri, E.S., Altucci, L., Amelio, I., Andrews, D.W., et al. (2018). Molecular mechanisms of cell death:

136 recommendations of the Nomenclature Committee on Cell Death 2018. Cell Death Differ 25, 486-541.

Geng, J., and Klionsky, D.J. (2008). The Atg8 and Atg12 ubiquitin-like conjugation systems in macroautophagy. 'Protein modifications: beyond the usual suspects' review series. EMBO Rep 9, 859-864.

Gerlic, M., Faustin, B., Postigo, A., Yu, E.C., Proell, M., Gombosuren, N., Krajewska, M., Flynn, R., Croft, M., Way, M., et al. (2013). Vaccinia virus F1L protein promotes virulence by inhibiting inflammasome activation. Proc Natl Acad Sci U S A 110, 7808-7813.

Gong, Y.N., Guy, C., Olauson, H., Becker, J.U., Yang, M., Fitzgerald, P., Linkermann, A., and Green, D.R. (2017). ESCRT-III Acts Downstream of MLKL to Regulate Necroptotic Cell Death and Its Consequences. Cell 169, 286-300 e216.

Goodall, M.L., Fitzwalter, B.E., Zahedi, S., Wu, M., Rodriguez, D., Mulcahy-Levy, J.M., Green, D.R., Morgan, M., Cramer, S.D., and Thorburn, A. (2016). The Autophagy Machinery Controls Cell Death Switching between Apoptosis and Necroptosis. Dev Cell 37, 337-349.

Green, D.R., and Levine, B. (2014). To be or not to be? How selective autophagy and cell death govern cell fate. Cell 157, 65-75.

Grootjans, S., Vanden Berghe, T., and Vandenabeele, P. (2017). Initiation and execution mechanisms of necroptosis: an overview. Cell Death Differ 24, 1184-1195.

Gwinn, D.M., Shackelford, D.B., Egan, D.F., Mihaylova, M.M., Mery, A., Vasquez, D.S., Turk, B.E., and Shaw, R.J. (2008). AMPK phosphorylation of raptor mediates a metabolic checkpoint. Mol Cell 30, 214-226.

Harhaj, Edward W., Moquin, D.M., McQuade, T., and Chan, F.K.-M. (2013). CYLD Deubiquitinates RIP1 in the TNFα-Induced Necrosome to Facilitate Kinase Activation and Programmed Necrosis. PLoS ONE 8.

Harris, N., Kunicka, J., and Kratz, A. (2005). The ADVIA 2120 hematology system: flow cytometry-based analysis of blood and body fluids in the routine hematology laboratory. Lab Hematol 11, 47-61.

He, S., Liang, Y., Shao, F., and Wang, X. (2011). Toll-like receptors activate programmed necrosis in macrophages through a receptor-interacting kinase-3-mediated pathway. Proc Natl Acad Sci U S A 108, 20054-20059.

He, S., Wang, L., Miao, L., Wang, T., Du, F., Zhao, L., and Wang, X. (2009). Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha. Cell 137, 1100-1111.

He, Y., Zeng, M.Y., Yang, D., Motro, B., and Nunez, G. (2016). NEK7 is an essential mediator of NLRP3 activation downstream of potassium efflux. Nature 530, 354-357.

137

Heckman, K.L., and Pease, L.R. (2007). Gene splicing and mutagenesis by PCR-driven overlap extension. Nat Protoc 2, 924-932.

Heger, K., Wickliffe, K.E., Ndoja, A., Zhang, J., Murthy, A., Dugger, D.L., Maltzman, A., de Sousa e Melo, F., Hung, J., Zeng, Y., et al. (2018). OTULIN limits cell death and inflammation by deubiquitinating LUBAC. Nature 559, 120-124.

Hildebrand, J.M., Kauppi, M., Majewski, I.J., Liu, Z., Cox, A.J., Miyake, S., Petrie, E.J., Silk, M.A., Li, Z., Tanzer, M.C., et al. (2020). A missense mutation in the MLKL brace region promotes lethal neonatal inflammation and hematopoietic dysfunction. Nat Commun 11, 3150.

Hildebrand, J.M., Tanzer, M.C., Lucet, I.S., Young, S.N., Spall, S.K., Sharma, P., Pierotti, C., Garnier, J.M., Dobson, R.C., Webb, A.I., et al. (2014). Activation of the pseudokinase MLKL unleashes the four-helix bundle domain to induce membrane localization and necroptotic cell death. Proc Natl Acad Sci U S A 111, 15072-15077.

Hjerpe, R., Aillet, F., Lopitz-Otsoa, F., Lang, V., England, P., and Rodriguez, M.S. (2009). Efficient protection and isolation of ubiquitylated proteins using tandem ubiquitin-binding entities. EMBO Rep 10, 1250-1258.

Holden, P., and Horton, W.A. (2009). Crude subcellular fractionation of cultured mammalian cell lines. BMC Res Notes 2, 243.

Holler, N., Zaru, R., Micheau, O., Thome, M., Attinger, A., Valitutti, S., Bodmer, J.L., Schneider, P., Seed, B., and Tschopp, J. (2000). Fas triggers an alternative, caspase-8- independent cell death pathway using the kinase RIP as effector molecule. Nat Immunol 1, 489-495.

Hou, J., Zhao, R., Xia, W., Chang, C.W., You, Y., Hsu, J.M., Nie, L., Chen, Y., Wang, Y.C., Liu, C., et al. (2020). PD-L1-mediated gasdermin C expression switches apoptosis to pyroptosis in cancer cells and facilitates tumour necrosis. Nat Cell Biol 22, 1264-1275.

Hrdinka, M., Fiil, B.K., Zucca, M., Leske, D., Bagola, K., Yabal, M., Elliott, P.R., Damgaard, R.B., Komander, D., Jost, P.J., et al. (2016). CYLD Limits Lys63- and Met1-Linked Ubiquitin at Receptor Complexes to Regulate Innate Immune Signaling. Cell Rep 14, 2846-2858.

Huang, Z., Wu, S.Q., Liang, Y., Zhou, X., Chen, W., Li, L., Wu, J., Zhuang, Q., Chen, C., Li, J., et al. (2015). RIP1/RIP3 binding to HSV-1 ICP6 initiates necroptosis to restrict virus propagation in mice. Cell Host Microbe 17, 229-242.

Humphries, F., Yang, S., Wang, B., and Moynagh, P.N. (2015). RIP kinases: key decision makers in cell death and innate immunity. Cell Death Differ 22, 225-236.

Husnjak, K., and Dikic, I. (2012). Ubiquitin-binding proteins: decoders of ubiquitin-mediated cellular functions. Annu Rev Biochem 81, 291-322.

138

Ji, H., Pettit, A., Ohmura, K., Ortiz-Lopez, A., Duchatelle, V., Degott, C., Gravallese, E., Mathis, D., and Benoist, C. (2002). Critical roles for interleukin 1 and tumor necrosis factor alpha in antibody-induced arthritis. J Exp Med 196, 77-85.

Joosten, L.A., Netea, M.G., Fantuzzi, G., Koenders, M.I., Helsen, M.M., Sparrer, H., Pham, C.T., van der Meer, J.W., Dinarello, C.A., and van den Berg, W.B. (2009). Inflammatory arthritis in caspase 1 gene-deficient mice: contribution of proteinase 3 to caspase 1- independent production of bioactive interleukin-1beta. Arthritis Rheum 60, 3651-3662.

Kaiser, W.J., Sridharan, H., Huang, C., Mandal, P., Upton, J.W., Gough, P.J., Sehon, C.A., Marquis, R.W., Bertin, J., and Mocarski, E.S. (2013a). Toll-like receptor 3-mediated necrosis via TRIF, RIP3, and MLKL. J Biol Chem 288, 31268-31279.

Kaiser, W.J., Upton, J.W., and Mocarski, E.S. (2013b). Viral modulation of programmed necrosis. Curr Opin Virol 3, 296-306.

Kambara, H., Liu, F., Zhang, X., Liu, P., Bajrami, B., Teng, Y., Zhao, L., Zhou, S., Yu, H., Zhou, W., et al. (2018). Gasdermin D Exerts Anti-inflammatory Effects by Promoting Neutrophil Death. Cell Rep 22, 2924-2936.

Kang, S., Fernandes-Alnemri, T., Rogers, C., Mayes, L., Wang, Y., Dillon, C., Roback, L., Kaiser, W., Oberst, A., Sagara, J., et al. (2015). Caspase-8 scaffolding function and MLKL regulate NLRP3 inflammasome activation downstream of TLR3. Nat Commun 6, 7515.

Kang, T.B., Yang, S.H., Toth, B., Kovalenko, A., and Wallach, D. (2013). Caspase-8 blocks kinase RIPK3-mediated activation of the NLRP3 inflammasome. Immunity 38, 27-40.

Kawai, T., and Akira, S. (2010). The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat Immunol 11, 373-384.

Kayagaki, N., Kornfeld, O.S., Lee, B.L., Stowe, I.B., O'Rourke, K., Li, Q., Sandoval, W., Yan, D., Kang, J., Xu, M., et al. (2021). NINJ1 mediates plasma membrane rupture during lytic cell death. Nature 591, 131-136.

Kayagaki, N., Stowe, I.B., Lee, B.L., O'Rourke, K., Anderson, K., Warming, S., Cuellar, T., Haley, B., Roose-Girma, M., Phung, Q.T., et al. (2015). Caspase-11 cleaves gasdermin D for non-canonical inflammasome signalling. Nature 526, 666-671.

Kayagaki, N., Warming, S., Lamkanfi, M., Vande Walle, L., Louie, S., Dong, J., Newton, K., Qu, Y., Liu, J., Heldens, S., et al. (2011). Non-canonical inflammasome activation targets caspase- 11. Nature 479, 117-121.

Keats, J.J., Fonseca, R., Chesi, M., Schop, R., Baker, A., Chng, W.J., Van Wier, S., Tiedemann, R., Shi, C.X., Sebag, M., et al. (2007). Promiscuous mutations activate the noncanonical NF- kappaB pathway in multiple myeloma. Cancer Cell 12, 131-144.

Kelsall, I.R., Zhang, J., Knebel, A., Arthur, J.S.C., and Cohen, P. (2019). The E3 ligase HOIL-1 catalyses ester bond formation between ubiquitin and components of the Myddosome in mammalian cells. Proc Natl Acad Sci U S A 116, 13293-13298.

139

Kerr, J.F., Wyllie, A.H., and Currie, A.R. (1972). Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer 26, 239-257.

Keusekotten, K., Elliott, P.R., Glockner, L., Fiil, B.K., Damgaard, R.B., Kulathu, Y., Wauer, T., Hospenthal, M.K., Gyrd-Hansen, M., Krappmann, D., et al. (2013). OTULIN antagonizes LUBAC signaling by specifically hydrolyzing Met1-linked polyubiquitin. Cell 153, 1312-1326.

Khoury, G.A., Baliban, R.C., and Floudas, C.A. (2011). Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database. Sci Rep 1.

Kim, J., Kundu, M., Viollet, B., and Guan, K.L. (2011). AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat Cell Biol 13, 132-141.

Kimura, T., Jia, J., Kumar, S., Choi, S.W., Gu, Y., Mudd, M., Dupont, N., Jiang, S., Peters, R., Farzam, F., et al. (2017). Dedicated SNAREs and specialized TRIM cargo receptors mediate secretory autophagy. EMBO J 36, 42-60.

Kitur, K., Wachtel, S., Brown, A., Wickersham, M., Paulino, F., Penaloza, H.F., Soong, G., Bueno, S., Parker, D., and Prince, A. (2016). Necroptosis Promotes Staphylococcus aureus Clearance by Inhibiting Excessive Inflammatory Signaling. Cell Rep 16, 2219-2230.

Klionsky, D.J., Abdelmohsen, K., Abe, A., Abedin, M.J., Abeliovich, H., Acevedo Arozena, A., Adachi, H., Adams, C.M., Adams, P.D., Adeli, K., et al. (2016). Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy 12, 1-222.

Komander, D., and Barford, D. (2008). Structure of the A20 OTU domain and mechanistic insights into deubiquitination. Biochem J 409, 77-85.

Komander, D., and Rape, M. (2012). The ubiquitin code. Annu Rev Biochem 81, 203-229.

Konopleva, M., Pollyea, D.A., Potluri, J., Chyla, B., Hogdal, L., Busman, T., McKeegan, E., Salem, A.H., Zhu, M., Ricker, J.L., et al. (2016). Efficacy and Biological Correlates of Response in a Phase II Study of Venetoclax Monotherapy in Patients with Acute Myelogenous Leukemia. Cancer Discov 6, 1106-1117.

Kostura, M.J., Tocci, M.J., Limjuco, G., Chin, J., Cameron, P., Hillman, A.G., Chartrain, N.A., and Schmidt, J.A. (1989). Identification of a monocyte specific pre-interleukin 1 beta convertase activity. Proc Natl Acad Sci U S A 86, 5227-5231.

Kovacs, S.B., and Miao, E.A. (2017). Gasdermins: Effectors of Pyroptosis. Trends Cell Biol 27, 673-684.

Kovalenko, A., Kim, J.C., Kang, T.B., Rajput, A., Bogdanov, K., Dittrich-Breiholz, O., Kracht, M., Brenner, O., and Wallach, D. (2009). Caspase-8 deficiency in epidermal keratinocytes triggers an inflammatory skin disease. J Exp Med 206, 2161-2177.

Koyano, F., Okatsu, K., Kosako, H., Tamura, Y., Go, E., Kimura, M., Kimura, Y., Tsuchiya, H., Yoshihara, H., Hirokawa, T., et al. (2014). Ubiquitin is phosphorylated by PINK1 to activate parkin. Nature 510, 162-166.

140

Kroemer, G., Marino, G., and Levine, B. (2010). Autophagy and the integrated stress response. Mol Cell 40, 280-293.

Kulathu, Y., and Komander, D. (2012). Atypical ubiquitylation - the unexplored world of polyubiquitin beyond Lys48 and Lys63 linkages. Nat Rev Mol Cell Biol 13, 508-523.

Kupz, A., Bedoui, S., and Strugnell, R.A. (2014). Cellular requirements for systemic control of Salmonella enterica serovar Typhimurium infections in mice. Infect Immun 82, 4997-5004.

Lalaoui, N., Boyden, S.E., Oda, H., Wood, G.M., Stone, D.L., Chau, D., Liu, L., Stoffels, M., Kratina, T., Lawlor, K.E., et al. (2020). Mutations that prevent caspase cleavage of RIPK1 cause autoinflammatory disease. Nature 577, 103-108.

Lamark, T., Svenning, S., and Johansen, T. (2017). Regulation of selective autophagy: the p62/SQSTM1 paradigm. Essays Biochem 61, 609-624.

Latz, E., Xiao, T.S., and Stutz, A. (2013). Activation and regulation of the inflammasomes. Nat Rev Immunol 13, 397-411.

Lau, A., Wang, S., Jiang, J., Haig, A., Pavlosky, A., Linkermann, A., Zhang, Z.X., and Jevnikar, A.M. (2013). RIPK3-mediated necroptosis promotes donor kidney inflammatory injury and reduces allograft survival. Am J Transplant 13, 2805-2818.

Lawlor, K.E., Feltham, R., Yabal, M., Conos, S.A., Chen, K.W., Ziehe, S., Grass, C., Zhan, Y., Nguyen, T.A., Hall, C., et al. (2017). XIAP Loss Triggers RIPK3- and Caspase-8-Driven IL-1beta Activation and Cell Death as a Consequence of TLR-MyD88-Induced cIAP1-TRAF2 Degradation. Cell Rep 20, 668-682.

Lawlor, K.E., Khan, N., Mildenhall, A., Gerlic, M., Croker, B.A., D'Cruz, A.A., Hall, C., Kaur Spall, S., Anderton, H., Masters, S.L., et al. (2015). RIPK3 promotes cell death and NLRP3 inflammasome activation in the absence of MLKL. Nat Commun 6, 6282.

Lee, E.G., Boone, D.L., Chai, S., Libby, S.L., Chien, M., Lodolce, J.P., and Ma, A. (2000). Failure to regulate TNF-induced NF-kappaB and cell death responses in A20-deficient mice. Science 289, 2350-2354.

Lee, E.W., Kim, J.H., Ahn, Y.H., Seo, J., Ko, A., Jeong, M., Kim, S.J., Ro, J.Y., Park, K.M., Lee, H.W., et al. (2012). Ubiquitination and degradation of the FADD adaptor protein regulate death receptor-mediated apoptosis and necroptosis. Nat Commun 3, 978.

Lee, S.B., Kim, J.J., Han, S.A., Fan, Y., Guo, L.S., Aziz, K., Nowsheen, S., Kim, S.S., Park, S.Y., Luo, Q., et al. (2019). The AMPK-Parkin axis negatively regulates necroptosis and tumorigenesis by inhibiting the necrosome. Nat Cell Biol 21, 940-951.

Li, H., Zhu, H., Xu, C.J., and Yuan, J. (1998). Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell 94, 491-501.

141

Li, J., McQuade, T., Siemer, A.B., Napetschnig, J., Moriwaki, K., Hsiao, Y.S., Damko, E., Moquin, D., Walz, T., McDermott, A., et al. (2012). The RIP1/RIP3 necrosome forms a functional amyloid signaling complex required for programmed necrosis. Cell 150, 339-350.

Li, X., Gong, W., Wang, H., Li, T., Attri, K.S., Lewis, R.E., Kalil, A.C., Bhinderwala, F., Powers, R., Yin, G., et al. (2019). O-GlcNAc Transferase Suppresses Inflammation and Necroptosis by Targeting Receptor-Interacting Serine/Threonine-Protein Kinase 3. Immunity 50, 1115.

Lim, J., Park, H., Heisler, J., Maculins, T., Roose-Girma, M., Xu, M., McKenzie, B., van Lookeren Campagne, M., Newton, K., and Murthy, A. (2019). Autophagy regulates inflammatory programmed cell death via turnover of RHIM-domain proteins. Elife 8.

Lin, S.Y., Hsieh, S.Y., Fan, Y.T., Wei, W.C., Hsiao, P.W., Tsai, D.H., Wu, T.S., and Yang, N.S. (2017). Necroptosis promotes autophagy-dependent upregulation of DAMP and results in immunosurveillance. Autophagy, 1-18.

Lindqvist, L.M., Frank, D., McArthur, K., Dite, T.A., Lazarou, M., Oakhill, J.S., Kile, B.T., and Vaux, D.L. (2017). Autophagy induced during apoptosis degrades mitochondria and inhibits type I interferon secretion. Cell Death Differ.

Lindqvist, L.M., Heinlein, M., Huang, D.C., and Vaux, D.L. (2014). Prosurvival Bcl-2 family members affect autophagy only indirectly, by inhibiting Bax and Bak. Proc Natl Acad Sci U S A 111, 8512-8517.

Linkermann, A., Brasen, J.H., De Zen, F., Weinlich, R., Schwendener, R.A., Green, D.R., Kunzendorf, U., and Krautwald, S. (2012a). Dichotomy between RIP1- and RIP3-mediated necroptosis in tumor necrosis factor-alpha-induced shock. Mol Med 18, 577-586.

Linkermann, A., Brasen, J.H., Himmerkus, N., Liu, S., Huber, T.B., Kunzendorf, U., and Krautwald, S. (2012b). Rip1 (receptor-interacting protein kinase 1) mediates necroptosis and contributes to renal ischemia/reperfusion injury. Kidney Int 81, 751-761.

Liu, X., Zhang, Z., Ruan, J., Pan, Y., Magupalli, V.G., Wu, H., and Lieberman, J. (2016). Inflammasome-activated gasdermin D causes pyroptosis by forming membrane pores. Nature 535, 153-158.

Lork, M., Verhelst, K., and Beyaert, R. (2017). CYLD, A20 and OTULIN deubiquitinases in NF- κB signaling and cell death: so similar, yet so different. Cell Death & Differentiation 24, 1172- 1183.

Maltez, V.I., Tubbs, A.L., Cook, K.D., Aachoui, Y., Falcone, E.L., Holland, S.M., Whitmire, J.K., and Miao, E.A. (2015). Inflammasomes Coordinate Pyroptosis and Natural Killer Cell Cytotoxicity to Clear Infection by a Ubiquitous Environmental Bacterium. Immunity 43, 987- 997.

Mandal, P., Berger, S.B., Pillay, S., Moriwaki, K., Huang, C., Guo, H., Lich, J.D., Finger, J., Kasparcova, V., Votta, B., et al. (2014). RIP3 induces apoptosis independent of pronecrotic kinase activity. Mol Cell 56, 481-495.

142

Mascarenhas, D.P.A., Cerqueira, D.M., Pereira, M.S.F., Castanheira, F.V.S., Fernandes, T.D., Manin, G.Z., Cunha, L.D., and Zamboni, D.S. (2017). Inhibition of caspase-1 or gasdermin-D enable caspase-8 activation in the Naip5/NLRC4/ASC inflammasome. PLoS Pathog 13, e1006502.

Masson, G.R., Burke, J.E., Ahn, N.G., Anand, G.S., Borchers, C., Brier, S., Bou-Assaf, G.M., Engen, J.R., Englander, S.W., Faber, J., et al. (2019). Recommendations for performing, interpreting and reporting hydrogen deuterium exchange mass spectrometry (HDX-MS) experiments. Nat Methods 16, 595-602.

Masters, S.L., Gerlic, M., Metcalf, D., Preston, S., Pellegrini, M., O'Donnell, J.A., McArthur, K., Baldwin, T.M., Chevrier, S., Nowell, C.J., et al. (2012). NLRP1 inflammasome activation induces pyroptosis of hematopoietic progenitor cells. Immunity 37, 1009-1023.

Merino, D., Kelly, G.L., Lessene, G., Wei, A.H., Roberts, A.W., and Strasser, A. (2018). BH3- Mimetic Drugs: Blazing the Trail for New Cancer Medicines. Cancer Cell 34, 879-891.

Miao, E.A., Leaf, I.A., Treuting, P.M., Mao, D.P., Dors, M., Sarkar, A., Warren, S.E., Wewers, M.D., and Aderem, A. (2010). Caspase-1-induced pyroptosis is an innate immune effector mechanism against intracellular bacteria. Nat Immunol 11, 1136-1142.

Miao, W., Qu, Z., Shi, K., Zhang, D., Zong, Y., Zhang, G., Zhang, G., and Hu, S. (2015). RIP3 S- nitrosylation contributes to cerebral ischemic neuronal injury. Brain Res 1627, 165-176.

Mindell, J.A. (2012). Lysosomal acidification mechanisms. Annu Rev Physiol 74, 69-86.

Mompean, M., Li, W., Li, J., Laage, S., Siemer, A.B., Bozkurt, G., Wu, H., and McDermott, A.E. (2018). The Structure of the Necrosome RIPK1-RIPK3 Core, a Human Hetero-Amyloid Signaling Complex. Cell 173, 1244-1253 e1210.

Monteleone, M., Stow, J.L., and Schroder, K. (2015). Mechanisms of unconventional secretion of IL-1 family cytokines. Cytokine 74, 213-218.

Moriwaki, K., Balaji, S., McQuade, T., Malhotra, N., Kang, J., and Chan, F.K. (2014). The necroptosis adaptor RIPK3 promotes injury-induced cytokine expression and tissue repair. Immunity 41, 567-578.

Moriwaki, K., and Chan, F.K. (2016). Regulation of RIPK3- and RHIM-dependent Necroptosis by the Proteasome. J Biol Chem 291, 5948-5959.

Moujalled, D.M., Cook, W.D., Okamoto, T., Murphy, J., Lawlor, K.E., Vince, J.E., and Vaux, D.L. (2013). TNF can activate RIPK3 and cause programmed necrosis in the absence of RIPK1. Cell Death Dis 4, e465.

Moulin, M., Anderton, H., Voss, A.K., Thomas, T., Wong, W.W., Bankovacki, A., Feltham, R., Chau, D., Cook, W.D., Silke, J., et al. (2012). IAPs limit activation of RIP kinases by TNF receptor 1 during development. EMBO J 31, 1679-1691.

143

Munoz-Planillo, R., Kuffa, P., Martinez-Colon, G., Smith, B.L., Rajendiran, T.M., and Nunez, G. (2013). K(+) efflux is the common trigger of NLRP3 inflammasome activation by bacterial toxins and particulate matter. Immunity 38, 1142-1153.

Murphy, J.M., Czabotar, P.E., Hildebrand, J.M., Lucet, I.S., Zhang, J.G., Alvarez-Diaz, S., Lewis, R., Lalaoui, N., Metcalf, D., Webb, A.I., et al. (2013). The pseudokinase MLKL mediates necroptosis via a molecular switch mechanism. Immunity 39, 443-453.

Murphy, J.M., and Vince, J.E. (2015). Post-translational control of RIPK3 and MLKL mediated necroptotic cell death. F1000Res 4.

Nailwal, H., and Chan, F.K. (2019). Necroptosis in anti-viral inflammation. Cell Death Differ 26, 4-13.

Najjar, M., Saleh, D., Zelic, M., Nogusa, S., Shah, S., Tai, A., Finger, J.N., Polykratis, A., Gough, P.J., Bertin, J., et al. (2016). RIPK1 and RIPK3 Kinases Promote Cell-Death-Independent Inflammation by Toll-like Receptor 4. Immunity 45, 46-59.

Newton, K., Dugger, D.L., Maltzman, A., Greve, J.M., Hedehus, M., Martin-McNulty, B., Carano, R.A., Cao, T.C., van Bruggen, N., Bernstein, L., et al. (2016). RIPK3 deficiency or catalytically inactive RIPK1 provides greater benefit than MLKL deficiency in mouse models of inflammation and tissue injury. Cell Death Differ 23, 1565-1576.

Newton, K., Dugger, D.L., Wickliffe, K.E., Kapoor, N., de Almagro, M.C., Vucic, D., Komuves, L., Ferrando, R.E., French, D.M., Webster, J., et al. (2014). Activity of protein kinase RIPK3 determines whether cells die by necroptosis or apoptosis. Science 343, 1357-1360.

Newton, K., and Manning, G. (2016). Necroptosis and Inflammation. Annu Rev Biochem 85, 743-763.

Newton, K., Sun, X., and Dixit, V.M. (2004). Kinase RIP3 is dispensable for normal NF-kappa Bs, signaling by the B-cell and T-cell receptors, tumor necrosis factor receptor 1, and Toll-like receptors 2 and 4. Mol Cell Biol 24, 1464-1469.

Newton, K., Wickliffe, K.E., Maltzman, A., Dugger, D.L., Reja, R., Zhang, Y., Roose-Girma, M., Modrusan, Z., Sagolla, M.S., Webster, J.D., et al. (2019). Activity of caspase-8 determines plasticity between cell death pathways. Nature 575, 679-682.

Nijman, S.M., Luna-Vargas, M.P., Velds, A., Brummelkamp, T.R., Dirac, A.M., Sixma, T.K., and Bernards, R. (2005). A genomic and functional inventory of deubiquitinating enzymes. Cell 123, 773-786.

Onizawa, M., Oshima, S., Schulze-Topphoff, U., Oses-Prieto, J.A., Lu, T., Tavares, R., Prodhomme, T., Duong, B., Whang, M.I., Advincula, R., et al. (2015). The ubiquitin-modifying enzyme A20 restricts ubiquitination of the kinase RIPK3 and protects cells from necroptosis. Nat Immunol 16, 618-627.

Opipari, A.W., Jr., Hu, H.M., Yabkowitz, R., and Dixit, V.M. (1992). The A20 zinc finger protein protects cells from tumor necrosis factor cytotoxicity. J Biol Chem 267, 12424-12427.

144

Orning, P., Weng, D., Starheim, K., Ratner, D., Best, Z., Lee, B., Brooks, A., Xia, S., Wu, H., Kelliher, M.A., et al. (2018). Pathogen blockade of TAK1 triggers caspase-8-dependent cleavage of gasdermin D and cell death. Science 362, 1064-1069.

Pekarsky, Y., Balatti, V., and Croce, C.M. (2018). BCL2 and miR-15/16: from gene discovery to treatment. Cell Death Differ 25, 21-26.

Peltzer, N., Darding, M., Montinaro, A., Draber, P., Draberova, H., Kupka, S., Rieser, E., Fisher, A., Hutchinson, C., Taraborrelli, L., et al. (2018). LUBAC is essential for embryogenesis by preventing cell death and enabling haematopoiesis. Nature 557, 112-117.

Peltzer, N., Rieser, E., Taraborrelli, L., Draber, P., Darding, M., Pernaute, B., Shimizu, Y., Sarr, A., Draberova, H., Montinaro, A., et al. (2014). HOIP deficiency causes embryonic lethality by aberrant TNFR1-mediated endothelial cell death. Cell Rep 9, 153-165.

Petrie, E.J., Hildebrand, J.M., and Murphy, J.M. (2017). Insane in the membrane: a structural perspective of MLKL function in necroptosis. Immunol Cell Biol 95, 152-159.

Petrie, E.J., Sandow, J.J., Jacobsen, A.V., Smith, B.J., Griffin, M.D.W., Lucet, I.S., Dai, W., Young, S.N., Tanzer, M.C., Wardak, A., et al. (2018). Conformational switching of the pseudokinase domain promotes human MLKL tetramerization and cell death by necroptosis. Nat Commun 9, 2422.

Polykratis, A., Martens, A., Eren, R.O., Shirasaki, Y., Yamagishi, M., Yamaguchi, Y., Uemura, S., Miura, M., Holzmann, B., Kollias, G., et al. (2019). A20 prevents inflammasome- dependent arthritis by inhibiting macrophage necroptosis through its ZnF7 ubiquitin-binding domain. Nat Cell Biol 21, 731-742.

Quarato, G., Guy, C.S., Grace, C.R., Llambi, F., Nourse, A., Rodriguez, D.A., Wakefield, R., Frase, S., Moldoveanu, T., and Green, D.R. (2016). Sequential Engagement of Distinct MLKL Phosphatidylinositol-Binding Sites Executes Necroptosis. Mol Cell 61, 589-601.

Raju, S., Whalen, D.M., Mengistu, M., Swanson, C., Quinn, J.G., Taylor, S.S., Webster, J.D., Newton, K., and Shaw, A.S. (2018). Kinase domain dimerization drives RIPK3-dependent necroptosis. Sci Signal 11.

Ramirez, M.L.G., Poreba, M., Snipas, S.J., Groborz, K., Drag, M., and Salvesen, G.S. (2018). Extensive peptide and natural protein substrate screens reveal that mouse caspase-11 has much narrower substrate specificity than caspase-1. J Biol Chem 293, 7058-7067.

Razani, B., Whang, M.I., Kim, F.S., Nakamura, M.C., Sun, X., Advincula, R., Turnbaugh, J.A., Pendse, M., Tanbun, P., Achacoso, P., et al. (2020). Non-catalytic ubiquitin binding by A20 prevents psoriatic arthritis-like disease and inflammation. Nat Immunol 21, 422-433.

Rebsamen, M., Heinz, L.X., Meylan, E., Michallet, M.C., Schroder, K., Hofmann, K., Vazquez, J., Benedict, C.A., and Tschopp, J. (2009). DAI/ZBP1 recruits RIP1 and RIP3 through RIP homotypic interaction motifs to activate NF-kappaB. EMBO Rep 10, 916-922.

145

Reiley, W.W., Jin, W., Lee, A.J., Wright, A., Wu, X., Tewalt, E.F., Leonard, T.O., Norbury, C.C., Fitzpatrick, L., Zhang, M., et al. (2007). Deubiquitinating enzyme CYLD negatively regulates the ubiquitin-dependent kinase Tak1 and prevents abnormal T cell responses. Journal of Experimental Medicine 204, 1475-1485.

Reljic, B., Conos, S., Lee, E.F., Garnier, J.M., Dong, L., Lessene, G., Fairlie, W.D., Vaux, D.L., and Lindqvist, L.M. (2016). BAX-BAK1-independent LC3B lipidation by BH3 mimetics is unrelated to BH3 mimetic activity and has only minimal effects on autophagic flux. Autophagy 12, 1083-1093.

Rickard, J.A., O'Donnell, J.A., Evans, J.M., Lalaoui, N., Poh, A.R., Rogers, T., Vince, J.E., Lawlor, K.E., Ninnis, R.L., Anderton, H., et al. (2014). RIPK1 regulates RIPK3-MLKL-driven systemic inflammation and emergency hematopoiesis. Cell 157, 1175-1188.

Rigaud, S., Fondaneche, M.C., Lambert, N., Pasquier, B., Mateo, V., Soulas, P., Galicier, L., Le Deist, F., Rieux-Laucat, F., Revy, P., et al. (2006). XIAP deficiency in humans causes an X- linked lymphoproliferative syndrome. Nature 444, 110-114.

Rittinger, K., and Ikeda, F. (2017). Linear ubiquitin chains: enzymes, mechanisms and biology. Open Biol 7.

Roberts, A.W., Davids, M.S., Pagel, J.M., Kahl, B.S., Puvvada, S.D., Gerecitano, J.F., Kipps, T.J., Anderson, M.A., Brown, J.R., Gressick, L., et al. (2016). Targeting BCL2 with Venetoclax in Relapsed Chronic Lymphocytic Leukemia. N Engl J Med 374, 311-322.

Roberts, D.S., and Miller, S.A. (1998). Apoptosis in cavitation of middle ear space. Anat Rec 251, 286-289.

Robinson, K.S., and Aw, R. (2016). The Commonalities in Bacterial Effector Inhibition of Apoptosis. Trends Microbiol 24, 665-680.

Robinson, N., McComb, S., Mulligan, R., Dudani, R., Krishnan, L., and Sad, S. (2012). Type I interferon induces necroptosis in macrophages during infection with Salmonella enterica serovar Typhimurium. Nat Immunol 13, 954-962.

Roedig, J., Kowald, L., Juretschke, T., Karlowitz, R., Ahangarian Abhari, B., Roedig, H., Fulda, S., Beli, P., and van Wijk, S.J. (2020). USP22 controls necroptosis by regulating receptor- interacting protein kinase 3 ubiquitination. EMBO Rep, e50163.

Rogers, C., Fernandes-Alnemri, T., Mayes, L., Alnemri, D., Cingolani, G., and Alnemri, E.S. (2017). Cleavage of DFNA5 by caspase-3 during apoptosis mediates progression to secondary necrotic/pyroptotic cell death. Nat Commun 8, 14128.

Rubinsztein, D.C., Shpilka, T., and Elazar, Z. (2012). Mechanisms of autophagosome biogenesis. Curr Biol 22, R29-34.

Ruhl, S., and Broz, P. (2015). Caspase-11 activates a canonical NLRP3 inflammasome by promoting K(+) efflux. Eur J Immunol 45, 2927-2936.

146

Saitoh, T., Fujita, N., Jang, M.H., Uematsu, S., Yang, B.G., Satoh, T., Omori, H., Noda, T., Yamamoto, N., Komatsu, M., et al. (2008). Loss of the autophagy protein Atg16L1 enhances endotoxin-induced IL-1beta production. Nature 456, 264-268.

Samson, A.L., Garnish, S.E., Hildebrand, J.M., and Murphy, J.M. (2021). Location, location, location: A compartmentalized view of TNF-induced necroptotic signaling. Sci Signal 14.

Samson, A.L., Zhang, Y., Geoghegan, N.D., Gavin, X.J., Davies, K.A., Mlodzianoski, M.J., Whitehead, L.W., Frank, D., Garnish, S.E., Fitzgibbon, C., et al. (2020). MLKL trafficking and accumulation at the plasma membrane control the kinetics and threshold for necroptosis. Nat Commun 11, 3151.

Sborgi, L., Ruhl, S., Mulvihill, E., Pipercevic, J., Heilig, R., Stahlberg, H., Farady, C.J., Muller, D.J., Broz, P., and Hiller, S. (2016). GSDMD membrane pore formation constitutes the mechanism of pyroptotic cell death. EMBO J 35, 1766-1778.

Seo, J., Lee, E.W., Sung, H., Seong, D., Dondelinger, Y., Shin, J., Jeong, M., Lee, H.K., Kim, J.H., Han, S.Y., et al. (2016). CHIP controls necroptosis through ubiquitylation- and lysosome- dependent degradation of RIPK3. Nat Cell Biol 18, 291-302.

Settembre, C., Di Malta, C., Polito, V.A., Garcia Arencibia, M., Vetrini, F., Erdin, S., Erdin, S.U., Huynh, T., Medina, D., Colella, P., et al. (2011). TFEB links autophagy to lysosomal biogenesis. Science 332, 1429-1433.

Sharma, V., Verma, S., Seranova, E., Sarkar, S., and Kumar, D. (2018). Selective Autophagy and Xenophagy in Infection and Disease. Front Cell Dev Biol 6, 147.

Shi, C.S., Shenderov, K., Huang, N.N., Kabat, J., Abu-Asab, M., Fitzgerald, K.A., Sher, A., and Kehrl, J.H. (2012). Activation of autophagy by inflammatory signals limits IL-1beta production by targeting ubiquitinated inflammasomes for destruction. Nat Immunol 13, 255-263.

Shi, J., Gao, W., and Shao, F. (2017). Pyroptosis: Gasdermin-Mediated Programmed Necrotic Cell Death. Trends Biochem Sci 42, 245-254.

Shi, J., Zhao, Y., Wang, K., Shi, X., Wang, Y., Huang, H., Zhuang, Y., Cai, T., Wang, F., and Shao, F. (2015). Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature 526, 660-665.

Shi, J., Zhao, Y., Wang, Y., Gao, W., Ding, J., Li, P., Hu, L., and Shao, F. (2014). Inflammatory caspases are innate immune receptors for intracellular LPS. Nature 514, 187-192.

Silke, J., and Meier, P. (2013). Inhibitor of apoptosis (IAP) proteins-modulators of cell death and inflammation. Cold Spring Harb Perspect Biol 5.

Silke, J., Rickard, J.A., and Gerlic, M. (2015). The diverse role of RIP kinases in necroptosis and inflammation. Nat Immunol 16, 689-697.

147

Silke, J., and Vaux, D.L. (2015). IAP gene deletion and conditional knockout models. Semin Cell Dev Biol 39, 97-105.

Snyder, A.G., Hubbard, N.W., Messmer, M.N., Kofman, S.B., Hagan, C.E., Orozco, S.L., Chiang, K., Daniels, B.P., Baker, D., and Oberst, A. (2019). Intratumoral activation of the necroptotic pathway components RIPK1 and RIPK3 potentiates antitumor immunity. Sci Immunol 4.

Stilgenbauer, S., Eichhorst, B., Schetelig, J., Coutre, S., Seymour, J.F., Munir, T., Puvvada, S.D., Wendtner, C.M., Roberts, A.W., Jurczak, W., et al. (2016). Venetoclax in relapsed or refractory chronic lymphocytic leukaemia with 17p deletion: a multicentre, open-label, phase 2 study. Lancet Oncol 17, 768-778.

Strasser, A., and Vaux, D.L. (2020). Cell Death in the Origin and Treatment of Cancer. Mol Cell 78, 1045-1054.

Sun, L., Wang, H., Wang, Z., He, S., Chen, S., Liao, D., Wang, L., Yan, J., Liu, W., Lei, X., et al. (2012). Mixed lineage kinase domain-like protein mediates necrosis signaling downstream of RIP3 kinase. Cell 148, 213-227.

Sun, X., Lee, J., Navas, T., Baldwin, D.T., Stewart, T.A., and Dixit, V.M. (1999). RIP3, a novel apoptosis-inducing kinase. J Biol Chem 274, 16871-16875.

Swatek, K.N., and Komander, D. (2016). Ubiquitin modifications. Cell Res 26, 399-422.

Tait, S.W., and Green, D.R. (2010). Mitochondria and cell death: outer membrane permeabilization and beyond. Nat Rev Mol Cell Biol 11, 621-632.

Takeda, K., Smyth, M.J., Cretney, E., Hayakawa, Y., Kayagaki, N., Yagita, H., and Okumura, K. (2002). Critical role for tumor necrosis factor-related apoptosis-inducing ligand in immune surveillance against tumor development. J Exp Med 195, 161-169.

Tanzer, M.C., Frauenstein, A., Stafford, C.A., Phulphagar, K., Mann, M., and Meissner, F. (2020). Quantitative and Dynamic Catalogs of Proteins Released during Apoptotic and Necroptotic Cell Death. Cell Rep 30, 1260-1270 e1265.

Tavares, R.M., Turer, E.E., Liu, C.L., Advincula, R., Scapini, P., Rhee, L., Barrera, J., Lowell, C.A., Utz, P.J., Malynn, B.A., et al. (2010). The ubiquitin modifying enzyme A20 restricts B cell survival and prevents autoimmunity. Immunity 33, 181-191.

Tenev, T., Bianchi, K., Darding, M., Broemer, M., Langlais, C., Wallberg, F., Zachariou, A., Lopez, J., MacFarlane, M., Cain, K., et al. (2011). The Ripoptosome, a signaling platform that assembles in response to genotoxic stress and loss of IAPs. Mol Cell 43, 432-448.

Thome, M., Schneider, P., Hofmann, K., Fickenscher, H., Meinl, E., Neipel, F., Mattmann, C., Burns, K., Bodmer, J.L., Schroter, M., et al. (1997). Viral FLICE-inhibitory proteins (FLIPs) prevent apoptosis induced by death receptors. Nature 386, 517-521.

148

Thornberry, N.A., Bull, H.G., Calaycay, J.R., Chapman, K.T., Howard, A.D., Kostura, M.J., Miller, D.K., Molineaux, S.M., Weidner, J.R., Aunins, J., et al. (1992). A novel heterodimeric cysteine protease is required for interleukin-1 beta processing in monocytes. Nature 356, 768-774.

Tsuchiya, K., Nakajima, S., Hosojima, S., Thi Nguyen, D., Hattori, T., Manh Le, T., Hori, O., Mahib, M.R., Yamaguchi, Y., Miura, M., et al. (2019). Caspase-1 initiates apoptosis in the absence of gasdermin D. Nat Commun 10, 2091.

Tsuchiya, Y., Nakabayashi, O., and Nakano, H. (2015). FLIP the Switch: Regulation of Apoptosis and Necroptosis by cFLIP. Int J Mol Sci 16, 30321-30341.

Tsujimoto, Y., Cossman, J., Jaffe, E., and Croce, C.M. (1985). Involvement of the bcl-2 gene in human follicular lymphoma. Science 228, 1440-1443.

Uematsu, A., Kido, K., Takahashi, H., Takahashi, C., Yanagihara, Y., Saeki, N., Yoshida, S., Maekawa, M., Honda, M., Kai, T., et al. (2019). The E3 ubiquitin ligase MIB2 enhances inflammation by degrading the deubiquitinating enzyme CYLD. Journal of Biological Chemistry 294, 14135-14148.

Upton, J.W., Kaiser, W.J., and Mocarski, E.S. (2012). DAI/ZBP1/DLM-1 complexes with RIP3 to mediate virus-induced programmed necrosis that is targeted by murine cytomegalovirus vIRA. Cell Host Microbe 11, 290-297.

Van Opdenbosch, N., Van Gorp, H., Verdonckt, M., Saavedra, P.H.V., de Vasconcelos, N.M., Goncalves, A., Vande Walle, L., Demon, D., Matusiak, M., Van Hauwermeiren, F., et al. (2017). Caspase-1 Engagement and TLR-Induced c-FLIP Expression Suppress ASC/Caspase-8- Dependent Apoptosis by Inflammasome Sensors NLRP1b and NLRC4. Cell Rep 21, 3427- 3444.

Vandenabeele, P., Vandecasteele, K., Bachert, C., Krysko, O., and Krysko, D.V. (2016). Immunogenic Apoptotic Cell Death and Anticancer Immunity. Adv Exp Med Biol 930, 133- 149.

Vaux, D.L., Cory, S., and Adams, J.M. (1988). Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature 335, 440-442.

Vaux, D.L., Haecker, G., and Strasser, A. (1994). An evolutionary perspective on apoptosis. Cell 76, 777-779.

Verhagen, A.M., Ekert, P.G., Pakusch, M., Silke, J., Connolly, L.M., Reid, G.E., Moritz, R.L., Simpson, R.J., and Vaux, D.L. (2000). Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell 102, 43-53.

Vince, J.E., Wong, W.W., Gentle, I., Lawlor, K.E., Allam, R., O'Reilly, L., Mason, K., Gross, O., Ma, S., Guarda, G., et al. (2012). Inhibitor of apoptosis proteins limit RIP3 kinase-dependent interleukin-1 activation. Immunity 36, 215-227.

149

Vince, J.E., Wong, W.W., Khan, N., Feltham, R., Chau, D., Ahmed, A.U., Benetatos, C.A., Chunduru, S.K., Condon, S.M., McKinlay, M., et al. (2007). IAP antagonists target cIAP1 to induce TNFalpha-dependent apoptosis. Cell 131, 682-693.

Walczak, H. (2013). Death receptor-ligand systems in cancer, cell death, and inflammation. Cold Spring Harb Perspect Biol 5, a008698.

Wang, H., Sun, L., Su, L., Rizo, J., Liu, L., Wang, L.F., Wang, F.S., and Wang, X. (2014a). Mixed lineage kinase domain-like protein MLKL causes necrotic membrane disruption upon phosphorylation by RIP3. Mol Cell 54, 133-146.

Wang, L., Du, F., and Wang, X. (2008). TNF-alpha induces two distinct caspase-8 activation pathways. Cell 133, 693-703.

Wang, T., Perera, N.D., Chiam, M.D.F., Cuic, B., Wanniarachchillage, N., Tomas, D., Samson, A.L., Cawthorne, W., Valor, E.N., Murphy, J.M., et al. (2020). Necroptosis is dispensable for motor neuron degeneration in a mouse model of ALS. Cell Death Differ 27, 1728-1739.

Wang, X., Li, Y., Liu, S., Yu, X., Li, L., Shi, C., He, W., Li, J., Xu, L., Hu, Z., et al. (2014b). Direct activation of RIP3/MLKL-dependent necrosis by herpes simplex virus 1 (HSV-1) protein ICP6 triggers host antiviral defense. Proc Natl Acad Sci U S A 111, 15438-15443.

Wang, Y., Gao, W., Shi, X., Ding, J., Liu, W., He, H., Wang, K., and Shao, F. (2017). Chemotherapy drugs induce pyroptosis through caspase-3 cleavage of a gasdermin. Nature 547, 99-103.

Wasilenko, S.T., Stewart, T.L., Meyers, A.F., and Barry, M. (2003). Vaccinia virus encodes a previously uncharacterized mitochondrial-associated inhibitor of apoptosis. Proc Natl Acad Sci U S A 100, 14345-14350.

Wauer, T., Swatek, K.N., Wagstaff, J.L., Gladkova, C., Pruneda, J.N., Michel, M.A., Gersch, M., Johnson, C.M., Freund, S.M., and Komander, D. (2015). Ubiquitin Ser65 phosphorylation affects ubiquitin structure, chain assembly and hydrolysis. EMBO J 34, 307-325.

Wertz, I.E., and Dixit, V.M. (2010). Regulation of death receptor signaling by the ubiquitin system. Cell Death Differ 17, 14-24.

Wertz, I.E., Newton, K., Seshasayee, D., Kusam, S., Lam, C., Zhang, J., Popovych, N., Helgason, E., Schoeffler, A., Jeet, S., et al. (2015). Phosphorylation and linear ubiquitin direct A20 inhibition of inflammation. Nature 528, 370-375.

Wertz, I.E., O'Rourke, K.M., Zhou, H., Eby, M., Aravind, L., Seshagiri, S., Wu, P., Wiesmann, C., Baker, R., Boone, D.L., et al. (2004). De-ubiquitination and ubiquitin ligase domains of A20 downregulate NF-kappaB signalling. Nature 430, 694-699.

Wisniewski, J.R., Zougman, A., Nagaraj, N., and Mann, M. (2009). Universal sample preparation method for proteome analysis. Nat Methods 6, 359-362.

150

Wong, W.W., Vince, J.E., Lalaoui, N., Lawlor, K.E., Chau, D., Bankovacki, A., Anderton, H., Metcalf, D., O'Reilly, L., Jost, P.J., et al. (2014). cIAPs and XIAP regulate myelopoiesis through cytokine production in an RIPK1- and RIPK3-dependent manner. Blood 123, 2562-2572.

Wu, J., Huang, Z., Ren, J., Zhang, Z., He, P., Li, Y., Ma, J., Chen, W., Zhang, Y., Zhou, X., et al. (2013). Mlkl knockout mice demonstrate the indispensable role of Mlkl in necroptosis. Cell Res 23, 994-1006.

Wu, X.-l., Hu, H., Dong, X.-q., Zhang, J., Wang, J., Schwieters, C.D., Liu, J., Wu, G.-x., Li, B., Lin, J.-y., et al. (2020).

Xie, T., Peng, W., Yan, C., Wu, J., Gong, X., and Shi, Y. (2013). Structural insights into RIP3- mediated necroptotic signaling. Cell Rep 5, 70-78.

Xu, P., Duong, D.M., Seyfried, N.T., Cheng, D., Xie, Y., Robert, J., Rush, J., Hochstrasser, M., Finley, D., and Peng, J. (2009). Quantitative proteomics reveals the function of unconventional ubiquitin chains in proteasomal degradation. Cell 137, 133-145.

Yabal, M., Muller, N., Adler, H., Knies, N., Gross, C.J., Damgaard, R.B., Kanegane, H., Ringelhan, M., Kaufmann, T., Heikenwalder, M., et al. (2014). XIAP restricts TNF- and RIP3- dependent cell death and inflammasome activation. Cell Rep 7, 1796-1808.

Yang, A., Wilson, N.S., and Ashkenazi, A. (2010). Proapoptotic DR4 and DR5 signaling in cancer cells: toward clinical translation. Curr Opin Cell Biol 22, 837-844.

Yang, Y., and Klionsky, D.J. (2020). Autophagy and disease: unanswered questions. Cell Death Differ 27, 858-871.

Ye, Y.-C., Yu, L., Wang, H.-J., Tashiro, S.-i., Onodera, S., and Ikejima, T. (2011). TNFα-Induced Necroptosis and Autophagy via Supression of the p38–NF-κB Survival Pathway in L929 Cells. Journal of Pharmacological Sciences 117, 160-169.

Yin, X.M., Wang, K., Gross, A., Zhao, Y., Zinkel, S., Klocke, B., Roth, K.A., and Korsmeyer, S.J. (1999). Bid-deficient mice are resistant to Fas-induced hepatocellular apoptosis. Nature 400, 886-891.

Yoon, S., Kovalenko, A., Bogdanov, K., and Wallach, D. (2017). MLKL, the Protein that Mediates Necroptosis, Also Regulates Endosomal Trafficking and Extracellular Vesicle Generation. Immunity 47, 51-65 e57.

Yu, P.W., Huang, B.C., Shen, M., Quast, J., Chan, E., Xu, X., Nolan, G.P., Payan, D.G., and Luo, Y. (1999). Identification of RIP3, a RIP-like kinase that activates apoptosis and NFkappaB. Curr Biol 9, 539-542.

Zakeri, Z., Quaglino, D., and Ahuja, H.S. (1994). Apoptotic cell death in the mouse limb and its suppression in the hammertoe mutant. Dev Biol 165, 294-297.

151

Zhang, D.W., Shao, J., Lin, J., Zhang, N., Lu, B.J., Lin, S.C., Dong, M.Q., and Han, J. (2009). RIP3, an energy metabolism regulator that switches TNF-induced cell death from apoptosis to necrosis. Science 325, 332-336.

Zhang, M., Kenny, S.J., Ge, L., Xu, K., and Schekman, R. (2015). Translocation of interleukin- 1beta into a vesicle intermediate in autophagy-mediated secretion. Elife 4.

Zhang, T., Yin, C., Boyd, D.F., Quarato, G., Ingram, J.P., Shubina, M., Ragan, K.B., Ishizuka, T., Crawford, J.C., Tummers, B., et al. (2020). Influenza Virus Z-RNAs Induce ZBP1-Mediated Necroptosis. Cell 180, 1115-1129 e1113.

Zhao, J., Jitkaew, S., Cai, Z., Choksi, S., Li, Q., Luo, J., and Liu, Z.G. (2012). Mixed lineage kinase domain-like is a key receptor interacting protein 3 downstream component of TNF- induced necrosis. Proc Natl Acad Sci U S A 109, 5322-5327.

Zheng, M., Karki, R., Vogel, P., and Kanneganti, T.D. (2020). Caspase-6 Is a Key Regulator of Innate Immunity, Inflammasome Activation, and Host Defense. Cell.

Zheng, N., and Shabek, N. (2017). Ubiquitin Ligases: Structure, Function, and Regulation. Annu Rev Biochem 86, 129-157.

Ziv, I., Matiuhin, Y., Kirkpatrick, D.S., Erpapazoglou, Z., Leon, S., Pantazopoulou, M., Kim, W., Gygi, S.P., Haguenauer-Tsapis, R., Reis, N., et al. (2011). A perturbed ubiquitin landscape distinguishes between ubiquitin in trafficking and in proteolysis. Mol Cell Proteomics 10, M111 009753.

Zychlinsky, A., Prevost, M.C., and Sansonetti, P.J. (1992). Shigella flexneri induces apoptosis in infected macrophages. Nature 358, 167-169.

152

Minerva Access is the Institutional Repository of The University of Melbourne

Author/s: Frank, Daniel

Title: The role of RIPK3 ubiquitylation and MLKL signalling during cell death and autophagy

Date: 2021

Persistent Link: http://hdl.handle.net/11343/274764

File Description: Final thesis file

Terms and Conditions: Terms and Conditions: Copyright in works deposited in Minerva Access is retained by the copyright owner. The work may not be altered without permission from the copyright owner. Readers may only download, print and save electronic copies of whole works for their own personal non-commercial use. Any use that exceeds these limits requires permission from the copyright owner. Attribution is essential when quoting or paraphrasing from these works.