Phylogenetic Analysis of the Family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

MSc

2.º CICLO FCUP CIBIO InBio

2017

(NE ( Phylogenetic

Mollusca

Atlantic

: :

Gastropoda ) )

analysis Phylogenetic of

) ) in analysis of the

the

the familyy

Azores family Rissoidae Rissoidae Archipelago (Mollusca: Gastropoda) in the Azores Archipelago LaraValéria Baptista Couto (NE Atlantic)

Lara Valéria Couto Baptista Dissertação de Mestrado apresentada à Faculdade de Ciências da Universidade do Porto em Biodiversidade, Genética e Evolução

2017

Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Lara Valéria Couto Baptista MSc in Biodiversity, Genetics and Evolution Department of Biology 2017

Supervisor Sérgio P. Ávila (Ph.D), Researcher, University of Azores, CIBIO-Azores

Co-supervisors António Múrias dos Santos (Ph.D), Assistant Professor, Faculty of Sciences of the University of Porto, CIBIO-InBIO M. Pilar Cabezas (Ph.D), PostDoc Researcher, CIBIO-InBIO

Todas as correções determinadas pelo júri, e só essas, foram efetuadas.

O Presidente do Júri,

Porto, ______/______/______

“Science never solves a problem without creating ten more.” George Bernard Shaw

FCUP i Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Acknowledgments

Before ending this chapter of my life and presenting the work developed for this dissertation, I would like to acknowledge all the people that, somehow, contributed for my personal and professional enrichment:

To my supervisor, Sérgio Ávila, firstly, for giving me the opportunity to see what “real- life” scientists do in fieldwork back in 2009, definitely influencing my choice on following Genetics and Evolution as a study area in university; secondly, for accepting my request to supervise this master dissertation, accepting me in the Marine PaleoBiogeography (MPB) research group and handing me such an interesting and challenging theme about marine life in “my” archipelago; finally, for all the support and knowledge shared throughout these past years.

To my co-supervisor, António Múrias dos Santos, for sharing his experience, teaching me how to deal with the bioinformatics component of this work and helping me to overcome the difficulties that appeared throughout the analyses with insightful comments and explanations. I also thank him the funding for all laboratorial work.

To my co-supervisor, Pilar Cabezas Rodriguez, for the incredible support since day one, all the patience and tips about laboratorial procedures and analyses performed posteriorly. I would also like to express my gratitude for all the productive discussions to clear my doubts and for always been available to help me when I needed. It would have been very hard to finish this work without you.

To the members of the MPB research group for welcoming me so well in São Miguel Island and helping me with everything in your reach. To Ricardo Cordeiro, for collecting samples used in this work and for the precious tips about laboratorial procedures and molecular analyses in family Rissoidae, after warning me about the “headaches” I would probably get with it. To Carlos Melo, for being the best “coleguinha” ever, all the jokes, the helpful discussions and, also, for his patience in creating some of the figures presented in this dissertation.

To my master course colleagues, for these amazing two years, for the friendship, funny dinners, knowledge and experience shared. A special acknowledgment to Filipa and Sophia, which became close friends, for all the memorable sunsets, incredible nights out and all the laughter that helped us relax during the past year.

To Beatriz and Bruna, for always be by my side even in different cities, for the craziest daily talks about everything, for making me see the results of this work from different FCUP ii Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) perspectives, for the enthusiasm with breakthroughs and, of course, for helping me maintaining my mental health, especially in the past year. Thank you for being such amazing friends!

To Sara, for supporting me in every situation ever since we were little girls. No more words are needed to express my gratitude towards you.

Finally, to my family, for being the most important pillar in my life. Thanks for always encouraging me to follow my dreams and making me see “beyond today”. To my grandparents, Humberto and Gilda, for believing that the almost-microscopic organisms studied in this work are real and for supporting me unconditionally. To my sister, Joana, for all her affection and craziness, for making my life funnier and for making an effort to understand the life I wish to live. I would also like to acknowledge her skills in finishing the edition of shell’s images in 15 minutes, whilst I would take 2 hours. To my parents, Paulo and Ivone, for their unconditional love, for trusting me, for the incredible opportunities provided throughout my life and for raising me not to fear the future, but also for staying by my side in case I tremble, holding reservations about the “unknown”.

To all those who directly or indirectly contributed for the realization of this work…

Obrigada!

FCUP iii Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Abstract

The mollusc caenogastropod family Rissoidae Gray, 1847 comprises the largest number of microgastropod species, which can be found occupying distinct marine environments worldwide. The systematic classification of this family has been considered a difficult task due to the minute size of individuals, their diverse morphology and the convergence of shell characters, encouraging several attempts to revise classification schemes throughout the years. The most recent revision was based in molecular data and resulted on the reorganization of the Rissoidae into 20 presently recognized genera. A total of 12 of these genera are presently found in the Azores Archipelago and no phylogenetic studies about their taxonomic status are available. This study aims to analyse molecular phylogenies of the family Rissoidae and to establish the systematic position of the Azorean rissoids, which is lacking in the current scientific knowledge. Furthermore, the reconstruction of a Rissoidae species tree, calibrated with palaeontological observations in Santa Maria Island, was performed, allowing to infer the evolutionary history of the family in the Azores Archipelago and to test a theoretical biogeographical hypothesis. The results from phylogenetic analyses of nDNA 28S gene and mtDNA Cytochrome C Oxidase Subunit I (COI) and 16S genes, both by Bayesian and Maximum Likelihood methods performed using sequences of 11 rissoid species from Azorean waters and others retrieved from GenBank database, emphasize the need of a detailed revision of the genera assigned to Rissoidae. Moreover, Botryphallus ovummuscae, Setia alexandrae and S. ermelindoi displayed a considerable degree of genetic differentiation regarding the remaining rissoids, suggesting that the relationships established with other rissoids are not in accordance with the current classification of the family Rissoidae. Therefore, a systematic reclassification of the former species is proposed. Molecular similarities of Rissoa guernei and some haplotypes of Setia subvaricosa, despite some minor morphological differences, were depicted in the analyses and interpreted as a possible occurrence of sexual dimorphism in R. guernei. A theoretical biogeographical hypothesis, already sustained by ecological and palaeontological observations, was tested in this study with two non-planktotrophic species, currently reported for the Azores and Madeira and differing in their bathymetrical range, included in the species tree reconstruction. According to this hypothesis proposed by Ávila (2013, 2006), the simultaneous existence of two congeneric non-planktotrophic species, only differing in their bathymetrical range, in two nearby archipelagos can be explained if the deeper, subtidal/circalittoral species is longer-lived, in a geological FCUP iv Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) sense, than the shallower, intertidal species. The estimation of an older split event between the subtidal and intertidal lineages provides, for the first time based on genetic data, support to this theoretical hypothesis as the subtidal species Alvania sleursi is indeed longer-lived than the intertidal Alvania mediolittoralis. The integration of palaeoceanographical data and life-traits of Azorean rissoids in the interpretation of the results obtained throughout this study led to hypothesise the potential role of Southern Azores Seamounts Chain as stepping-stones in the colonisation process of the Azores Archipelago by rissoids and littoral benthic fauna in general. The privileged setting of the Azores Archipelago in the middle of the Atlantic Ocean and the presence of fossil rissoids specimens in Santa Maria Island, make this archipelago an ideal location to study the evolution of the family Rissoidae, to hypothesise plausible processes of colonisation of these islands by marine littoral benthic gastropods, as well as to test biogeographical hypotheses.

Keywords

Phylogenetics, Mollusca, Gastropoda, Rissoidae, Azores Archipelago, COI, 16S rRNA, 28S rRNA, Theoretical biogeographical hypothesis, Colonization

FCUP v Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Resumo

A família Rissoidae Gray, 1847 engloba o maior número de espécies de moluscos microgastrópodes marinhos, que podem ser encontrados globalmente em diversos ambientes marinhos. A classificação sistemática desta família é considerada uma tarefa árdua devido às reduzidas dimensões dos indivíduos, diversidade de morfologias e convergência de caracteres concológicos. Tais dificuldades instigaram várias tentativas de revisão dos esquemas para a sua classificação nos últimos anos. A revisão mais recente baseou-se em dados moleculares e resultou na reorganização da família Rissoidae em 20 géneros hoje reconhecidos. Atualmente, doze destes géneros são encontrados no Arquipélago dos Açores, mas estudos filogenéticos relativamente ao seu status taxonómico não estão disponíveis. O presente estudo tem como objetivos uma análise de filogenias moleculares da família Rissoidae e o estabelecimento da posição sistemática dos rissoídeos açoreanos, contribuindo para o conhecimento científico sobre o tema. Além disso, a reconstrução de uma árvore de espécies calibrada de acordo com a observação de espécimes fósseis em Santa Maria foi levada a cabo, permitindo inferir a história evolutiva da família Rissoidae no Arquipélago dos Açores e testar uma hipótese biogeográfica. Os resultados das análises filogenéticas do gene nuclear 28S e dos mitocondriais Citocromo C Oxidase subunidade I (COI) e 16S, aplicando métodos Bayesianos e de Máxima Verosimilhança em sequências de 11 espécies de rissoídeos dos Açores e outras obtidas na base de dados GenBank, enfatizam a necessidade de rever detalhadamente os géneros atribuídos à família Rissoidae. Além disso, Botryphallus ovummuscae, Setia alexandrae and S. ermelindoi apresentaram níveis consideráveis de diferenciação genética em relação aos restantes rissoídeos analisados, sugerindo que as relações estabelecidas não estão em conformidade com a classificação da família Rissoidae atualmente aceite. Assim sendo, é proposta a reclassificação sistemáticas destas três espécies. Similaridades moleculares entre Rissoa guernei e alguns haplótipos de Setia subvaricosa, aliadas a diferenças morfológicas subtis, foram detetadas nas análises filogenéticas e interpretadas como possível ocorrência de dimorfismo sexual em R. guernei. Uma hipótese biogeográfica, já suportada por dados ecológicos e observações paleontológicas, foi testada no presente estudo com a inclusão na árvore de espécies de dois rissoídeos não-planctotróficos com diferente zonação batimétrica, os quais são atualmente encontrados nos Açores e Madeira. De acordo com a hipótese proposta por Ávila (2013, 2006), a existência simultânea de duas espécies congenéricas não- FCUP vi Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) planctotróficas, diferindo na zonação batimétrica, em dois arquipélagos subjacentes pode ser explicada se a espécie subtidal/circalitoral, que ocupa águas mais profundas for mais antiga, do ponto de vista geológico, do que a espécie intertidal. A ocorrência de um primeiro evento de divergência entre as linhagens subtidal e intertidal confirma, pela primeira vez usando dados genéticos, esta hipótese biogeográfica, uma vez que a espécie subtidal Alvania sleursi é mais antiga do que a intertidal Alvania mediolittoralis. Adicionalmente, a integração de informação paleoceanográfica, dados relativos a características biológicas dos rissoídeos e vários dos resultados obtidos no decorrer deste trabalho conduziram à proposta do papel potencialmente desempenhado pela Cadeia de Montes Submarinos a Sul dos Açores como “pontes” na colonização do Arquipélago dos Açores por rissoídeos e fauna bentónica marinha litoral no geral. A localização privilegiada dos Açores no meio do Oceano Atlântico e a presença de espécimes fósseis de rissoídeos em jazidas fossilíferas da ilha de Santa Maria, fazem deste arquipélago o local perfeito para estudar a evolução da família Rissoidae nesta área, para inferir e propôr processos plausíveis de colonização do arquipélago por estes gastrópodes marinhos litorais, bem como para testar a hipóteses biogeográficas.

Palavras-chave

Filogenética, Mollusca, Gastropoda, Rissoidae, Arquipélago dos Açores, COI, RNAr 16S, RNAr 28S, Hipótese teórica biogeográfica, Colonização

FCUP vii Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Table of Contents

Acknowledgments ...... i

Abstract ...... iii

Resumo ...... v

List of Tables...... ix

List of Figures ...... x

List of Appendices ...... xi

List of Abbreviations ...... xii

Chapter I – Introduction ...... 1 I.1. The Azores Archipelago ...... 1 I.1.1. Geographic setting of the Azores Archipelago ...... 1 I.1.2. Geological formation of the Azores plateau and vicinities ...... 2 I.2. Marine molluscan fauna in the Azores Archipelago ...... 3 I.3. Family Rissoidae ...... 4 I.3.1. Geographical and bathymetrical distribution of Rissoidae ...... 4 I.3.2. General characteristics of rissoids...... 5 I.3.3. Systematic classification of Rissoidae ...... 8 I.3.4. Rissoidae in the Northeast Atlantic Ocean ...... 10 I.4. Rissoidae in the Azores Archipelago ...... 11 I.5. A link among modes of larval development, geographical distribution, bathymetry/ecological zonation and evolutionary time in oceanic islands ...... 12 I.5.1. Theoretical hypothesis ...... 12 I.5.2. Practical implications ...... 14 I.6. Molecular tools in phylogenetic inferences ...... 16 I.6.1. Mitochondrial markers ...... 16 I.6.2. Nuclear markers...... 17 I.7. Objectives ...... 18 Chapter II – Methodologies ...... 19 II.1. Taxon sampling and outgroup choice ...... 19 II.2 Molecular analysis ...... 20 II.2.1. DNA extraction ...... 20 II.2.2. DNA amplification ...... 21 FCUP viii Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

II.2.3. Sequencing and analysis of sequences ...... 22 II.2.4. Phylogenetic analyses ...... 24 II.2.5. Species tree reconstruction and estimation of divergence times ...... 26 Chapter III – Results ...... 29 III.1. DNA amplification and sequence data ...... 29 III.2. Phylogenetic analyses ...... 34 III.2.1. Analyses performed on total Rissoidae dataset...... 34 III.2.2. Analyses performed on Rissoidae dataset, excluding Botryphallus ovummuscae and cluster ‘Setia’ ...... 37 III.2.3. Species tree reconstruction and estimation of divergence times ...... 43 III.3. Estimates of pairwise distances ...... 45 III.3.1. p-distances for the mtDNA COI marker ...... 46 III.3.2. p-distances for the mtDNA 16S marker ...... 46 III.3.3. p-distances for the nDNA 28S marker ...... 47 Chapter IV – Discussion ...... 49 IV.1. Gene phylogenetic trees ...... 49 IV.2. Systematic position of Botryphallus ovummuscae, Setia alexandrae and Setia ermelindoi ...... 49 IV.3. Phylogenetic relationships within the family Rissoidae ...... 51 IV.3.1. Are they the same species? ...... 54 IV.4 Species tree reconstruction and estimation of divergence times ...... 55 IV.4.1. Inference of the species tree ...... 55 IV.4.2. Evolutionary history of the family Rissoidae in the Azores Archipelago ..... 57 IV.4.2.1. Occurrence of endemic and non-endemic rissoid species in the Azores Archipelago ...... 57 IV.4.2.2. Influence of the mode of larval development in the colonisation of remote areas by Rissoidae ...... 59 Planktotrophic rissoid species with broad distributions ...... 59 Non-planktotrophic rissoid species with broad distribution ...... 60 Non-planktotrophic rissoid species distributed in Atlantic archipelagos ...... 61 IV.4.2.3. Possible colonisation routes of the Azores Archipelago by rissoids .... 62 IV.4.3. Testing the theoretical hypothesis...... 66 Chapter V – Conclusions and future perspectives ...... 69

References ...... 71

FCUP ix Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

List of Tables

Table I.1 – Summary of geographical location, plateau area and summit depth of guyots integrated in the Southern Azores Seamounts Chain (SASC) ...... 3

Table II.2 – Target gene, primer name and sequence (5’-3’), source and PCR conditions applied ...... 22

Table II.3 – Sequences of COI, 16S and 28S genes amplified for other Rissoidae species from the North Atlantic Ocean and outgroup Anabathron contabulatum ...... 23

Table III.1 – Mean p-distances of the pairwise comparison of Botryphallus ovummuscae and cluster ‘Setia’ with representatives of the genera in study, for COI, 16S and 28S markers...... 45

FCUP x Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

List of Figures

Figure I.1 – Azores geographic framework ...... 1

Figure I.2 – Morphological diversity within family Rissoidae ...... 6

Figure I.3 – Setia subvaricosa in Caloura, São Miguel Island ...... 7

Figure I.4 – Protoconchs of Rissoidae species ...... 8

Figure I.5 – Timeline showing the main events regarding the appearance of the first Rissoidae-like organisms (170.3-182.7 Ma) and diversification of the family Rissoidae 8

Figure III.4 – Polar tree layout of the Maximum Likelihood tree obtained for the: a) mitochondrial COI marker; b) mitochondrial 16S rRNA marker; c) nuclear 28S rRNA marker ...... 36

Figure III.5 – Maximum Likelihood tree obtained for mtDNA COI gene ...... 40

Figure III.6 – Maximum Likelihood tree obtained for nDNA 28S rRNA gene ...... 41

Figure III.7 – Maximum Likelihood tree obtained for mtDNA 16S rRNA gene ...... 42

Figure IV.1 – Shell shape characteristics of Rissoa guernei and Setia subvaricosa ... 55

Figure IV.2 – Geographical setting of the Azores plateau and Southern Azores Seamounts Chain in the Northeast Atlantic Ocean ...... 65

FCUP xi Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

List of Appendices

Appendix 1 – Colour code intending to facilitate the visual identification of the species included in the phylogenetic analyses...... 89

Appendix 2 – Estimates of evolutionary divergence between COI sequences, conducted on MEGA7 (Kumar et al., 2016) and involving 58 nucleotide sequences after elimination of all positions containing gaps and missing data. Pairwise comparisons with Botryphallus ovummuscae are highlighted in light blue, whereas pairwise comparisons with cluster ‘Setia’ are highlighted in red...... 90

Appendix 3 – Estimates of evolutionary divergence between 16S sequences, conducted on MEGA7 (Kumar et al., 2016) and involving 64 nucleotide sequences after elimination of all positions containing gaps and missing data. Pairwise comparisons with Botryphallus ovummuscae are highlighted in light blue...... 91

Appendix 4 – Estimates of evolutionary divergence between 28S sequences, conducted on MEGA7 (Kumar et al., 2016) and involving 42 nucleotide sequences after elimination of all positions containing gaps and missing data. Pairwise comparisons with Botryphallus ovummuscae are highlighted in light blue, whereas pairwise comparisons with cluster ‘Setia’ are highlighted in red...... 92

FCUP xii Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

List of Abbreviations

The following list contemplates all the abbreviations used throughout this dissertation, intending to facilitate its reading. Units and symbols from the metric system and following the International System of Units will not be included in the list, since publications from recognized authorities can be consulted regarding these topics.

AIC – Akaike’s Information Criterion BI – Bayesian Inference bp – base pairs BS – Bootstrap Support BSA – Bovine Serum Albumin ca. – circa cf. – confer COI – Cytochrome C Oxidase subunit I cont. – continued DBUA – Department of Biology of the University of the Azores

ddH2O – Double Distilled Water DNA – Deoxyribonucleic Acid dNTP – Deoxynucleotide e.g. – exempli gratia (for example) EMBL-EBI – European Bioinformatics Institute EML – Estimated Marginal Likelihood ESS – Effective Sample Size gDNA – Genomic DNA GTR – General Time Reversible hap - Haplotype HKY – Hasegawa-Kishino-Yano HPD – Highest Posterior Density i.e. – id est (that is) ky – Thousand years Ma – Million years MAR – Mid-Atlantic Ridge MCMC – Markov Chain Monte Carlo

MgCl2 – Magnesium Chloride ML – Maximum Likelihood FCUP xiii Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) mtDNA – Mitochondrial DNA NCBI – National Centre for Biotechnology Information nDNA – Nuclear DNA PCR – Polymerase Chain Reaction pers. comm. – Personal communication PP – Posterior Probability s.l. – sensu lato s.s. – sensu strictum SASC – Southern Azores Seamounts Chain TD – Touchdown WoRMS – World Register of Marine Species

FCUP 1 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Chapter I – Introduction

I.1. The Azores Archipelago

I.1.1. Geographic setting of the Azores Archipelago

Located in the middle of Northeast Atlantic Ocean, between latitudes 36º 55’ and 39º 43’ N, and longitudes 24º 46’ and 31º 16’ W, the Azores Archipelago comprises nine volcanic oceanic islands and several islets, which first appeared in the Late Miocene (ca. 6.01 Ma, Ramalho et al., 2017). Geographically, this archipelago is divided in three island groups: an Eastern Group including Santa Maria and São Miguel islands; a Central Group composed by Terceira, Graciosa, São Jorge, Pico and Faial islands; and a Western Group including Flores and Corvo islands. The nine islands are distributed following a west-northwest to east-southeast orientation, through an axis with a length of approximately 650 km (Figure I.1).

Figure I.1 – Azores geographic framework. Coastline from the Portuguese Hydrographic Institute (2014). Santa Maria Island (highlighted in bold) is the only Azorean island with fossiliferous outcrops.

The Azores Archipelago is located at approximately 1,300 km from mainland Portugal and 1,700 km from the American Continent. At approximately 840 km southeastern from Santa Maria Island, Madeira Island is the closest place. Consequently, the distance between the Azores and other land masses contributes to the isolation of these islands,

FCUP 2 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) particularly in terms of proximity to potential colonisation sources as it constrains genetic interchange. The Azorean Islands are one of the four Atlantic Archipelagos that constitute the Macaronesian biogeographical province (s.s.). The other three are: the Portuguese archipelagos of Madeira and Selvagens; and the Canary Islands’ Spanish archipelago. Although many authors – mainly those working with terrestrial flora and fauna (e.g., Triantis et al., 2010) – also consider that Cabo Verde Archipelago is part of the Macaronesian biogeographical province, from a marine biogeographic point of view this is not true: Cabo Verde is located in the Mauritanian-Senegalese biostratigraphic molluscan Province, whereas Canary Islands, Selvagens, Madeira and the Azores are located in the Mediterranean-Moroccan biostratigraphic molluscan Province (Ávila et al., 2016). Despite the wide range of climate conditions that shape the floristic and faunistic composition of the Macaronesian Islands (s.l.), the five archipelagos are located far enough from continental source areas so that long-distance dispersal was required for animals and plants to reach them. The distance to continental landmasses, coupled with the volcanic origin of the archipelagos, contributes to the unusual patterns of colonisation and diversification found both in the marine and terrestrial realms, which are easily observed in the Azores (Ávila, 2005; Triantis et al., 2010).

I.1.2. Geological formation of the Azores plateau and vicinities

Geologically, the formation of the Azores plateau is estimated to have started 20 Ma and finished around seven Ma (Adam et al., 2013; Silveira et al., 2006). This area, spanning approximately 400,000 km2 on both sides of the Mid-Atlantic ridge (MAR) close to the triple junction of American, Eurasian and African plates, is characterized by elevated topography and thickened oceanic crust (Adam et al., 2013; Métrich et al., 2014; Silveira et al., 2006). The mechanism behind the formation of this plateau is still debatable, but one of the most widely accepted ideas is that the archipelago might be a complex case of ridge-hotspot interaction (Adam et al., 2013; Gente et al., 2003; Silveira et al., 2006; Yang et al., 2006). Southern Azores Seamounts Chain (SASC), located 1,500 km from mainland and approximately 600 km from the Azores Archipelago, rise from the seafloor as extinct submarine volcanoes with diverse sizes and topographies, likely formed by the action of the Azores hotspot as well (Gente et al., 2003). Some structures display smooth, flat- topped topography – guyot – which might indicate a former subaerial stage, followed by erosion and degradation of the island to form a submarine seamount (Ramalho et al., 2017), or formation of the structure near the sea surface (Tucholke and Smoot, 1990)

FCUP 3 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

(Table I.1). Cruiser, Plato and Tyro seamounts – not classified as guyots – and other smaller structures of SASC are mostly steep peaks or round-topped elevations (Tucholke and Smoot, 1990) unlikely to have been emerged any time in the past. The precise age determination of these submerged structures is difficult, as they experienced complex geological histories (Gofas, 2007). Nonetheless, constructive volcanic activity is estimated to started 50-76 Ma in the Cruiser plateau and ended 11-16 Ma (Gofas, 2007) or 22 Ma (Von Rad, 1974) in the Great Meteor, but these estimations are not precise (Gente et al., 2003; Gofas, 2007; Ribeiro et al., 2017). Despite the uncertainty and lack of knowledge on the origin and evolution of this area of the ocean (Ribeiro et al., 2017), the seamounts definitely exist in the NE Atlantic Ocean for a long time.

Table I.1 – Summary of geographical location, plateau area and summit depth of guyots integrated in the Southern Azores Seamounts Chain (SASC): Great Meteor (Fock et al., 2002; Lavelle and Mohn, 2010; Verhoef, 1984), Hyéres (Ávila, 2005; Gofas, 2007), Irving (Gofas, 2007; Lavelle and Mohn, 2010) and Atlantis (Pusch et al., 2004).

Coordinates Plateau area Summit depth

Great Meteor Seamount 30º N 28º 30’ W 1,465 km2 275 m Hyéres Seamount 31º 28.80’ N 28º 57.90’ W 350 km2 21 m Irving Seamount 31º 58.20’ N 28º 03’ W 750 km2 265 m Atlantis Seamount 34°09' N 30°15' W 410 km2 250-400 m

I.2. Marine molluscan fauna in the Azores Archipelago

Since the 19th century, the Azores Archipelago has become the “arena” of major scientific expeditions (Dautzenberg, 1889; Drouët, 1858; MacAndrew, 1856; Simroth,

1888) and studies (Ávila and Azevedo, 1997; Ávila and Sigwart, 2013; Ávila, 2003, 2000a, 2000b; Ávila et al., 2005; Cordeiro et al., 2015; Gofas, 1990; Malaquias et al., 2009; Martins, 1980; Martins et al., 2009; Martins, 1995; Morton, 1995, 1990, 1967; Morton et al., 2014, 1998). Such publications provided new insights to the knowledge about the biodiversity in the archipelago, characterized by its high molluscan species richness. According to the most updated checklists and recent records, a total of 385 molluscan species currently inhabit the shallow-waters of the Azores Archipelago: Bivalvia – 90 (Ávila, 2005); Cephalopoda – 8 (Ávila, 2016, pers. comm.); Polyplacophora – 6 (Ávila and Sigwart, 2013); and Gastropoda – 281 (Cordeiro et al., 2015). The family Rissoidae (Mollusca: Gastropoda) is the most species-rich molluscan family in the Azores (Cordeiro and Ávila 2015). For decades, studies focusing on this family contributed to increase the knowledge on these gastropods, making it probably the most well-studied family of marine invertebrates on the archipelago (Ávila, 2000a;

FCUP 4 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Ávila et al., 2015c, 2012a, 2008b, 2005, 2002; Cordeiro and Ávila, 2015; Nobre, 1930, 1924).

I.3. Family Rissoidae

Marine microgastropods constitute an important component of gastropod diversity worldwide (Criscione et al., 2016). Nevertheless, much of the literature focuses on macrogastropods; thus the smaller species of molluscs, such as rissoids, tend to be overlooked, particularly in large scale field surveys, as they require special attention when being collected and sorted, not to mention the taxonomic classification issues associated to this group (Albano et al., 2011). Although a significant part of marine microgastropods are still poorly known, the family Rissoidae has become an interesting subject of research in the past decades (Ávila, 2003, 2000a; Ávila et al., 2015c, 2012a, 2008b; Cordeiro et al., 2015; Costa and Ávila, 2001; Criscione and Ponder, 2013; Criscione et al., 2016; Davis et al., 1998; Gofas, 2007, 1990; Ponder and De Keyzer, 1998; Ponder, 1984a).

I.3.1. Geographical and bathymetrical distribution of Rissoidae

The caenogastropod family Rissoidae Gray, 1847, belongs to the superfamily Rissooidea and comprises the largest number of small-sized, marine gastropod mollusc species (Criscione et al., 2016; Ponder, 1984a) that can be found throughout the world, from polar waters (Ponder, 1983a; Warén, 1974, 1973) to tropical regions (Faber and Moolenbeek, 2004). Some genera of Rissoidae are distributed worldwide (e.g., Alvania Risso, 1826, Manzonia Brusina, 1870 and Rissoina d'Orbigny, 1840), whereas others are geographically restricted (e.g., Lucidestea Laseron, 1956 and Boreocingula Golikov & Kussakin, 1974) (Ávila et al., 2012a; Ponder, 1984a). A total of 546 species of rissoids (s.l.), belonging to 33 genera, are currently reported from the Atlantic Ocean and the Mediterranean Sea (Ávila et al., 2012a). This number reflects only Atlantic and Mediterranean species and does not take into account the species occurring in other oceans and seas, thus reflecting the global diversity of rissoids (Ávila et al., 2012a; Cordeiro and Ávila, 2015). Representatives of this highly diverse family occupy distinct marine environments from the intertidal to the deep-sea, where rissoids inhabit the continental shelf and upper bathyal regions, behaving as micro-algal grazers on hard substrates or as detritivores on softer substrates (Ávila et al., 2012a; Criscione et al., 2016; Kowalke and Harzhauser, 2004). Shallower littoral waters enclose the greatest diversity of Rissoidae species, the majority occurring on algae, corals, stones or other objects providing shelter (Ponder,

FCUP 5 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

1984a). Therefore, according to their bathymetrical zonation, Rissoidae species are classified in shallow-water species – those inhabiting from the intertidal down to 50 m depth – and deep-water species – those living below 50 m depth. Three main reasons are pointed out to the establishment of a 50 m depth threshold for the bathymetrical zonation of rissoids: (i) below 50 m depth, algal species to which rissoids are usually associated are almost absent and, when present, they are dominated by just a few species; (ii) direct sampling of Rissoidae specimens, by scuba-diving, is more frequently performed in waters less than 50 m depth since different diving techniques are required in deeper waters; (iii) indirect sampling methodologies (e.g., grabs) are applied in waters deeper than 50 m (Ávila et al., 2012a). Benthonella Dall, 1889, Frigidoalvania Warén, 1974 and Pseudosetia Monterosato, 1884 genera are examples of deep-water species, whereas Alvania spp., Botryphallus spp. Ponder, 1990, Crisilla spp. Monterosato, 1917, Manzonia spp., Pusillina spp.Monterosato, 1884, Rissoa spp. Desmarest, 1814 and Setia spp. H. Adams & A. Adams, 1852 mostly inhabit shallow-waters (Ávila, 2005; Ávila et al., 2012a).

I.3.2. General characteristics of rissoids

Morphologically, Rissoidae species are very diverse, exhibiting a typical ovate to elongate-conic shell with a maximum length of 5 mm, along with smooth texture or detailed sculptured patterns (Figure I.2; 1-12). Moreover, the aperture of the shell is oval to D-shaped and might be simple or with an apertural channel, as observed in some genera. Although a few rissoid genera retain the primitive thick operculum with a peg, the majority displays a simple, thin, paucispiral operculum (Ponder and De Keyzer, 1998). The opercular lobe is simple in all genera and the foot is typically extended in front with pointed or angled anterolateral corners. Highly similarity in the radula is observed between most of Rissoidae genera: the central teeth display a single pair of basal tentacles arising from their face and the cutting edge is curved forward and down; the lateral teeth exhibit multiple cusps in the cutting edge; plus, the marginal teeth are long and narrow, also presenting small cusps (Figure I.2; 13-15).

FCUP 6 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Figure I.2 – Morphological diversity within family Rissoidae. 1 – Alvania angioyi DBUA 173. Apertural view; 2 – Alvania cancellata DBUA 173. Apertural view; 3 – Alvania formicarum DBUA 335. Apertural view; 4 – Alvania mediolittoralis DBUA 455. Apertural view; 5 – Alvania poucheti DBUA 499. Apertural view; 6 – Botryphallus ovummuscae DBUA 499. Apertural view; 7 – Cingula trifasciata DBUA Capelas. Apertural view; 8 – Crisilla postrema DBUA 1019 Apertural view; 9 – Manzonia unifasciata DBUA 173. Apertural view; 10 – Setia alexandrae DBUA 469. Apertural view; 11 – Setia ermelindoi DBUA 497. Apertural view; 12 – Rissoa guernei DBUA 662. Apertural view; 13 – Central teeth of the radula; 14 – Central, lateral and marginal teeth of the radula; 15 – Radula. General view.

FCUP 7 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Rissoids present cephalic tentacles with eyes situated in swelling at their outer bases, but some deep-water species appeared to have lost the eyes (Figure I.3). Rissoidae species are gonochoric, therefore there is separation of the sexes in different individuals (Ávila, 2005; Ponder, 1984a). Lens-shaped, ovoid or spherical, ovigerous capsules Figure I.3 – Setia subvaricosa in are deposited on various underwater substrates and Caloura, São Miguel Island. (March 2010). Eyes are located in swelling at the Rissoidae larvae will arise from those eggs. As in other base of cephalic tentacles. marine gastropods, two modes of larval development can be distinguished among Rissoidae species – planktotrophic and non-planktotrophic (Ávila, 2005; Ponder, 1984a; Scheltema, 1989, 1986a, 1986b, 1977). Planktotrophic species usually display longer free-swimming feeding larval stage, whereas in non-planktotrophic species this stage is absent. The latter type of early development comprises lecithotrophic species and species with direct development, where both embryonic and larval development occur inside the egg from which a completely formed juvenile arises. In both cases, larvae do not feed on phytoplankton or zooplankton while in the water column (Ávila, 2005; Ávila et al., 2012a; Mileikovsky, 1971; Pouli et al., 2001; Thiriot-Quiévreux, 1980). The determination of the mode of larval development in Rissoidae is achieved through indirect methods, with analyses of the protoconch (Figure I.4) both in recent and fossil material, since the knowledge about the life cycle of rissoids is still limited. In this family, planktotrophic species typically display multispiral protoconchs, with nucleus usually smaller than 200 µm, and with more than 2 whorls. In addition, larval and embryonic protoconchs are easily distinguished in species with this mode of larval development (e.g., Alvania cancellata, Figure I.4a). In contrast, non-planktotrophic species of rissoids generally present paucispiral protoconchs, with nucleus usually larger than 200 µm and with 1-1.5 whorls (e.g., Alvania mediolittoralis, Figure I.4b) (Ávila and Malaquias, 2003; Ávila, 2005, 2000b; Ávila et al., 2012a; Jablonski and Lutz, 1983; Scheltema, 1978; Shuto, 1974).

FCUP 8 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Figure I.4 – Protoconchs of Rissoidae species. a) Protoconch of Alvania cancellata, a planktotrophic rissoid. Lateral view. b) Protoconch of Alvania angioyi, a non-planktotrophic rissoid. Lateral view.

The fossil record of rissoids is extensive and the first known Rissoidae-like organisms date at least from the Lower Jurassic (ca. 170.3-182.7 Ma) (Conti et al., 1993; Criscione and Ponder, 2013; Criscione et al., 2016). During the Miocene, the family Rissoidae was already well-diversified and modern genera are abundant in the fossil littoral gastropod assemblages of the Central Paratethys. Alvania spp. and Manzonia spp. are found at least since Eggenburgian (Early Miocene; ca. 20 Ma), whereas Rissoa spp. are present since the Karpatian (Early Miocene; ca. 17 Ma) but it was not until the Badenian (Middle Miocene; ca. 16.4-13.0 Ma) that rissoids bloomed and reached its maximum diversity in the Central Paratethys (Kowalke and Harzhauser, 2004) (Figure I.5).

Figure I.5 – Timeline showing the main events regarding the appearance of the first Rissoidae-like organisms (170.3-182.7 Ma) and diversification of the family Rissoidae. Based on the literature (Conti et al. 1993; Kowalke and Harzhauser 2004; Criscione and Ponder 2013; Criscione et al. 2016).

I.3.3. Systematic classification of Rissoidae

The family Rissoidae has been considered very difficult to classify, since several attempts to revise the genera and subfamilies contained within Rissoidae have been made through the years. The minute size of individuals, its diverse morphology and a high degree of convergence in shell characters are pointed out as the main aspects that hamper a comprehensive treatment of the family at the generic level (Ávila, 2005; Criscione et al., 2016; Ponder, 1984a). The earlier taxonomic reviews of the family Rissoidae, carried out by Thiele (1929), Wenz (1938) and Coan (1964), were based mainly on the general similarity of

FCUP 9 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) conchological characters. Afterwards, Nordsieck (1972) revised the European species of rissoids, leading to multiple splitting of species and several changes at the generic level, after a detailed analysis based on shell characters. The classification of rissoids was subsequently revised by Ponder (1967) based on anatomical observations of New Zealand species, which resulted in the modification of Coan’s (1964) listing of subfamilies and genera, with the proposal of four distinct subfamilies within Rissoidae: Lironobinae, Barleeinae, Anabathrinae and Rissoinae. The family Rissoidae (sensu Ponder, 1967) was later fragmented in ten families assigned to five superfamilies, according to the classification of caenogastropods of Golikov and Starobogatov (1975) and seven distinct families among rissoids were recognized by Slavoshevskaya (1975), based on differences in their genitalia. Two subfamilies previously recognized by Ponder (1967) – Barleeinae and Anabathrinae – were included in Barleeiidae Gray, 1857 (Ponder, 1983b) and several genera were assigned to families Cingulopsidae Fretter & Patil, 1958 (Ponder and Yoo, 1980) and Iravadiidae Thiele, 1928 (Ponder, 1984b). More recently, the taxonomic position of genera assigned to the family Rissoidae (sensu Ponder, 1967) was refined by Ponder (1984a), through an anatomical evaluation of rissoids at a global scale. Using a combination of 51 morphological characters from the shell, protoconch, radula, operculum, head-foot and internal anatomy of living specimens, this author was able to generate a dendrogram including 31 genera (28 modern and three fossil genera). Two subfamilies within Rissoidae – Rissoinae and Rissoininae – were recognized, and this systematic classification scheme became the most commonly accepted for several years. Finally, Criscione and Ponder (2013) investigated the phylogenetic status of the superfamily Rissooidea based on molecular data of its families, including representatives of five species of rissoids [Alvania cimex (Linnaeus, 1758), Lironoba australis (Tenison- Woods, 1877), Subestea australiae Frauenfeld, 1867, Rissoa ventricosa Desmarest, 1814, and Rissoina fasciata A. Adams 1853]. These authors proposed the elevation of the subfamily Rissoininae (sensu Ponder, 1984a) to the family level, with a single representative genus, Rissoina, forming a distinct clade with Barleeiidae. Subsequent work by Criscione et al. (2016), focusing in the family Rissoidae (sensu Ponder, 1984a), led to the most comprehensive molecular phylogeny of this family to date and evaluation of the suitability of morphological characters as taxonomic markers. Herein, the authors suggested the taxonomic revision of the family Rissoidae as one of six distinct family- lineages within the superfamily Rissooidea, each supported by molecular analyses and presenting unique combinations of morphological traits. Rissoininae, formerly recognized as a subfamily (sensu Ponder, 1984a), was split into two new families –

FCUP 10 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Rissoinidae Stimpson, 1865 and Zebinidae Coan, 1964. Merelina Iredale, 1915 and Lironoba Iredale, 1915 genera were comprised into a new family: Lironobidae Ponder, 1967. Therefore, family Rissoidae is restricted to the former subfamily Rissoinae, with the exclusion of Merelina and Lironoba genera. This work, supported by several synapomorphies, provided a new classification scheme of the family Rissoidae (sensu Criscione et al., 2016), thus enlightening the phylogenetic status of this peculiar family.

I.3.4. Rissoidae in the Northeast Atlantic Ocean

In the NE Atlantic Ocean, several species of rissoids belonging to various genera are found in European continental shores, archipelagos and seamounts, where there is a predominance of non-planktotrophic species (Ávila, 2005). In this region, the Canary Islands are considered the most diverse site, with 89 rissoid species inhabiting its waters. Portuguese shores and Cabo Verde Archipelago follow the Canary Islands in terms of diversity, with 74 and 67 species of Rissoidae, respectively (Ávila et al., 2012a). The species-diversity of each genera varies among the NE Atlantic regions. Along the Portuguese shores, the genera Alvania, Rissoa, Setia and Pusillina are the best represented, comprising 74, 26, 18 and 11 species, respectively. Crisilla and Manzonia genera present high species diversity in the Macaronesian Archipelagos and, particularly, 26 species of Schwartziella Nevill, 1881 are found at Cabo Verde. Furthermore, the genus Manzonia also presents considerable number of distinct species at the Lusitanian group of seamounts (Ávila et al., 2012a). High numbers of endemic species are reported for Atlantic archipelagos and seamounts (Ávila, 2005; Ávila et al., 2012a). Cabo Verde constitutes an example of such richness as 58 rissoids, predominantly assigned to Alvania and Schwartziella genera and corresponding to 86.6% of the Rissoidae fauna, are endemic to this archipelago. The Azores and the Canary Islands also stand out for their considerable numbers of endemic rissoids, counting 48.7% and 19.1% of the total Rissoidae fauna at each location, respectively (Ávila et al., 2012a; Cordeiro and Ávila, 2015). Moreover, an endemic genus – Porosalvania – to the Southern Azores Seamounts Chain (SASC), located south from the Azores, was recently described by Gofas (2007), thus contributing to the high percentage values of rissoid endemisms at this location (76.9%) (Ávila et al., 2012a).

FCUP 11 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

I.4. Rissoidae in the Azores Archipelago

The first annotated checklists of Rissoidae in the Azores were provided by Drouët (1858), Dautzenberg (1889) and Nobre (1930, 1924). More recently, scientific expeditions and workshops, organized by the University of the Azores, have contributed to update the checklists and to describe the distribution and zonation of the rissoids on these waters (Ávila, 2003, 2000a; Ávila et al., 2005; Martins et al., 2009). Ávila et al. (2012a) revised the checklists of marine rissoids in the entire Atlantic Ocean and Mediterranean Sea, including an update of the rissoid fauna in the Azores. Recently, four new species of rissoids were described by Cordeiro and Ávila (2015), thus increasing the rissoid fauna of the Azores to 39 species, assigned to 14 genera. Among these, 26 rissoid species (probably 27, if Alvania multiquadrata van der Linden & Wagner, 1989 proves to occur nowadays in the Azores) are found from the intertidal down to 50 m depth whereas the remaining inhabit deeper waters (Cordeiro and Ávila, 2015). Besides its species-richness, the family Rissoidae possesses the highest percentage of marine endemisms in the Azores Archipelago. A total of 19 endemic species – 15 shallow-water species and four deep-water species – all of them with a non- planktotrophic mode of larval development, are found in Azorean waters, corresponding to 48.7% of all rissoids in this region (Ávila et al., 2012a; Cordeiro and Ávila, 2015). Rissoids constitute a considerable percentage of all endemic shallow-water molluscs from the Azores (15 out of 37, approximately 40.5%; Ávila 2016, pers. comm.), undoubtedly contributing to the Azorean biodiversity. Rissoidae representatives are not only found in present-day molluscan assemblages in the Azores, but also in the fossil record of Santa Maria Island. Santa Maria is the southeastern-most and oldest island in the archipelago, with an estimated age of 6.01±0.14 Ma (Ramalho et al., 2017), and the only with exposed marine fossiliferous sediments where molluscs are the best represented group (Ávila et al., 2016, 2015c, 2015d, 2009a, 2009b, 2002). Usually, rissoids are rarely preserved in the fossil record due to fragile, minute shells and unsuitable habitats for fossilization (Criscione and Ponder, 2013). In spite of that, in Santa Maria Island, representatives of this family are found in Early Pliocene and Pleistocene (MIS 5e) outcrops (Ávila, 2005; Ávila et al., 2015c, 2009a, 2009b, 2002; Madeira et al., 2007) and their abundance in the fossil deposits can be explained by a combination of initial abundance, taphonomic biases and selective investigations, focused on molluscs, performed in the island (Ávila et al., 2002; Madeira et al., 2007).

FCUP 12 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

I.5. A link among modes of larval development, geographical distribution, bathymetry/ecological zonation and evolutionary time in oceanic islands

As stated by Darwin (1859), archipelagos constitute “live-laboratories” and the oceanic volcanic islands of the Azores Archipelago are no exception. Due to its privileged location in the middle of the Atlantic Ocean, the Azores Archipelago is seen by many as a perfect place to perform varied studies on its fauna and flora, allowing to test ecological, evolutionary and biogeographical theories.

I.5.1. Theoretical hypothesis

Many evolutionary and biogeographical studies have been realized in the past decades in the Azores, mainly resorting to shallow-water molluscs of oceanic islands and seamounts as a model to study how marine species have reached, colonised and, in some cases, speciated these islands (Ávila and Malaquias, 2003; Ávila, 2005, 2000b; Ávila et al., 2009a, 2008a, 2004). There are several known mechanisms by which benthic marine invertebrates disperse: 1) by means of pelagic larvae; 2) by foresy (i.e., by attachment to bird feathers, which constitutes a common mean of dispersal in some intertidal molluscs); 3) by rafts composed of egg-masses, juveniles or adults of small- sized species attached to suitable floating materials (e.g., logs, seaweeds, and carapaces of marine turtles) (Ávila, 2013, 2006). In temperate Atlantic waters, dispersal by rafting is a crucial mechanism for shallow-water marine molluscs. Since dispersal depends on chance events, highly abundant species and species associated with hard substrata or rocky shores covered by algae have greater chances of being rafted (Ávila, 2013; Scheltema, 1986a). The dispersal ability of invertebrate marine species is reflected by the duration of its larval phase, with biogeographic and evolutionary implications. A relationship between the geographical distribution of littoral benthic species and its mode of larval development was suggested by Scheltema in several studies (Scheltema and Williams, 1983; Scheltema, 1995, 1989, 1986a; Scheltema et al., 1996). According to its conclusions, species possessing pelagic larvae with a long free-swimming stage can easily disperse and reach remote islands, in a way that may even prevent speciation due to frequent gene flow between mainland and insular populations (Ávila, 2013, 2006; García-Talavera, 1983; Scheltema and Williams, 1983; Scheltema, 1986b; Scheltema et al., 1996). On the other hand, species with non-planktotrophic development usually have narrower ranges of distribution than planktotrophic species, since their dispersal abilities

FCUP 13 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) are lower due to the absence of a free-swimming stage (Scheltema, 1995, 1989, 1986a). Despite these constraints, some gastropod species with non-planktotrophic larvae can occupy a wide geographical range. Examples are Lasaea adansoni (Gmelin, 1791) (O’Foighil, 1989) or Littorina saxatilis (Olivi, 1792) (Johannesson, 1988). A posterior pedal gland that secretes mucus is found in Rissoidae species, either with planktotrophic or non-planktotrophic larval development, allowing rissoids to suspend themselves from the surface film and providing a new mean for dispersal through rafting (Ávila, 2013). Algae in which rissoids live can be easily pulled out from the substratum by wave action, causing intertidal and shallow-water Rissoidae species to be rafted along. Once the rafting process begins, it is not assured that it will succeed, especially in volcanic oceanic islands located far from other land masses. The distance and deep- waters separating land masses constitute effective barriers to the dispersal of adult gastropods, particularly for shallow benthic insular species as the majority of Rissoidae inhabiting Azorean waters (Ávila, 2013; Ávila et al., 2012a). Ávila (2013, 2006) was the first to suggest the addition of bathymetrical/ecological zonation to the relation between mode of larval development and the geographical range distribution proposed by Scheltema (1995, 1989, 1986a). Considering rafting as a key mechanism of dispersal for epibenthic intertidal and shallow-water non-planktotrophic species, three main assumptions can be established (Ávila, 2013, 2006): 1) Intertidal species living in islands are more prone to be rafted than species occupying deeper waters, as they are more likely to be affected by disturbing events that favour their passive dispersal; 2) A direct relationship between bathymetry/ecological zonation and geographical distribution of a species exists, so that intertidal species generally have wider ranges than sublittoral species and these, in turn, should have wider geographical ranges than deep-water species. Once more, this can be explained by the higher chance of intertidal species to be subjected to extreme events that increase the probability of being rafted and disperse; 3) The chances of a successful dispersal are higher for micromolluscs in which adults are the rafting stage, therefore small-sized species are more likely to be well succeeded in the process and will have wider geographical ranges than medium-sized and large-sized species.

Another variable – evolutionary time – was suggested by Ávila (2013) to be added to the relation between modes of larval development, geographical distribution and bathymetry/ecological zonation, thus providing an explanation for the simultaneous

FCUP 14 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) existence of congeneric non-planktotrophic species, which differ only in their bathymetrical range, in two nearby archipelagos (e.g., Azores and Madeira). A new theoretical hypothesis was formulated based on this premise, stating that if both species presently occur in two nearby archipelagos, then the one inhabiting deeper waters is expected to be longer-lived than the shallow-water/intertidal species, in a geological sense (Ávila, 2013).

I.5.2. Practical implications

The practical implications of the theoretical hypothesis have been tested with fossils collected in the outcrops of Santa Maria Island, the only Azorean island where diversified marine fossils are abundantly found and studied since the middle of the 20th century (Ferreira, 1955, 1952; Zbyszewski and Ferreira, 1961). The peculiar geological history of Santa Maria Island encloses two major periods during which sediments rich in fossiliferous contents were deposited (Ramalho et al., 2017; Serralheiro, 2003; Serralheiro et al., 1987). The Touril volcano-sedimentary complex was deposited during the Early Pliocene, ca. 5.3-4.1 Ma, during the guyot stage of the island (Ramalho et al., 2017). Diversified Pliocene fossils, bounded by lava flows dated 4.78±0.135 and 4.13±0.19 Ma (Ramalho et al., 2017), are presently found in these sediments, including teeth of bony fishes and sharks (Ávila et al., 2012b), bones of cetaceans (Ávila et al., 2015b; Estevens and Ávila, 2007), coralline algae (Ávila et al., 2015a, 2015d; Meireles et al., 2013; Rebelo et al., 2016a, 2016b, 2014), and a large variety of marine invertebrates, namely molluscs, equinoderms, ostracods, brachiopods and bryozoans, among others (Ávila et al., 2015a, 2015d; Janssen et al., 2008; Kroh et al., 2008; Madeira et al., 2011; Meireles et al., 2012; Rebelo et al., 2014; Winkelmann et al., 2010). Later, new events of deposition took place, originating fossiliferous outcrops scattered around the islands, dated from the Late Pleistocene with ages of 120-130 ky (MIS 5e) (Ávila, 2013; Ávila et al., 2015c, 2008a; Ramalho et al., 2017). Both in Pliocene and Late Pleistocene (MIS 5e) outcrops, marine molluscs – bivalves and gastropods – are the most diversified and abundant fossils found (Ávila et al., 2016, 2015c, 2015d, 2009b). Fossil Rissoidae from Santa Maria Island were used to test the theoretical idea that fossils of deep-water species are expected to be older than the ones from shallow- water/intertidal species, as a consequence of the former species to be longer-lived, in a geological sense, than the latter. Rissoidae fossils dated from the Pliocene are only well preserved at Ponta do Castelo outcrop, whereas Late Pleistocene (MIS 5e) rissoids are quite abundant and well preserved at several outcrops throughout the south shores of the island – Prainha/Praia do Calhau, Pedra-que-Pica and Vinha Velha – as well as on

FCUP 15 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Lagoinhas outcrop on the north (Ávila, 2013). A total of 19 rissoid species are assigned to these Pleistocene (MIS 5e) outcrops (Ávila et al., 2015c, 2009b; Cordeiro and Ávila, 2015), all of them still living on present-day Azorean waters (Ávila, 2005). In Pleistocene (MIS 5e) sediments of Prainha and Lagoinhas, Alvania mediolittoralis Gofas, 1989 is the most frequent rissoid species with abundances of 10.29% and 21.77%, respectively, and the second most abundant rissoid in Vinha Velha outcrops (7.99%), following Cingula trifasciata. (J Adams, 1800). Alvania sleursi (Amati, 1987) is also found at moderate abundances at Lagoinhas sediments (6.92%) but at a considerably lower frequency at Prainha (1.56%) and Vinha Velha (1.55%) (Ávila et al., 2015c, 2009a, 2002). A. sleursi is the only Rissoidae species that is also reported from Pliocene outcrops. In the present times, A. mediolittoralis is found in the intertidal turf of the Azores and Madeira archipelagos, whereas A. sleursi inhabits waters down to 15-25 m deep and is reported from recent records in the Azores, Madeira and Selvagens (Ávila, 2013). The finding of a rissoid species – A. sleursi – fossilized in Pliocene and Pleistocene (MIS 5e) sediments of Santa Maria Island and its presence in present-day habitats of three archipelagos located close by, suggests that this species first speciated in one of the archipelagos (probably the Azores, where it is a common species, occurring in all islands) and later reached Madeira and Selvagens Islands, since representatives are not found in the fossiliferous outcrops of the latter archipelagos. When comparing the two Alvania species – the intertidal A. mediolittoralis and the subtidal/circalittoral A. sleursi – at the fossil and recent scenarios, the link between non-planktotrophic mode of larval development, geographic range, bathymetrical/ecological zonation and evolutionary time is supported, as A. sleursi is expected to be longer-lived in a geological sense, contributing to its broader geographic range. The family Rissoidae is a powerful tool to test this idea, not only at the geological and ecological levels, but also from the molecular point of view to infer the evolutionary history of rissoids in the archipelago. This family is pointed out as adequate to test the aforementioned hypothesis due to its high number of species and genera, many with non-planktotrophic larvae (Ávila, 2013, 2006), and for being widely distributed across the Atlantic Ocean particularly in Atlantic Islands, as the Azores Archipelago (Ávila et al., 2012a). Moreover, most of these small-sized species are associated with algae, increasing the likelihood of being rafted to new locations. Regarding the study area, the Azorean Islands are ideal to address the theoretical hypothesis in study, due to its privileged location in the middle of the North Atlantic Ocean, its well-studied geological history and the considerably low-degree of environmental anthropogenic perturbations

FCUP 16 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

(Ávila, 2013, 2006). Such characteristics, allied to the fossiliferous content of Santa Maria Island, allow to test the theoretical idea using both fossil and recent Rissoidae.

I.6. Molecular tools in phylogenetic inferences

Today’s scientific research on evolution relies, essentially, on morphological based methods and molecular data analyses, particularly DNA sequences (Patwardhan et al., 2014). Molecular tools are based on the transmission of genetic information contained in DNA molecules throughout generations and on how evolutionary forces such as selection and gene flow shape diversity at various taxonomic levels, since diversity is the result of the gradual accumulation of modifications in an organism’s genome (Avise, 2004; Park and Moran, 1994). Taking into account information retrieved by molecular markers, it is possible to infer the phylogenetic history of a group of taxa (e.g., species) (Patwardhan et al., 2014). However, phylogenies inferred from a single marker only reflect the evolution of that gene and do not necessarily reflect the evolutionary history of species (Patwardhan et al., 2014). To avoid misinterpretation of phylogenies and reveal a more robust realistic evolutionary history, the combined use of several molecular markers – nuclear and mitochondrial sequences – is a common practice, as they are comprised in different regions of the genome with distinct rates of evolution, effective population sizes and modes of inheritance (Avise, 2004, 1998; Ballard and Whitlock, 2004; Tollefsrud et al., 2009; Zhang and Hewitt, 2003).

I.6.1. Mitochondrial markers

With a few exceptions, multiple copies of mitochondrial DNA (mtDNA) molecules are found in eukaryotic cells. In animals, mitochondrial genome is a small circular molecule with approximately 16,000 bp, typically comprising 37 genes with a few short non-coding region apart from the control region (Boore, 1999; Ladoukakis and Zouros, 2017; Yang et al., 2014). These molecules are uniparentally inherited, in most cases from the female parent, and recombinational genetic processes are thought to be rare. In animal populations, a mutation rate higher than the one of nuclear DNA (nDNA) and a lower effective population size – ¼ of that of nuclear autosomes (Lynch et al., 2006) – are reported as responsible for a faster fixation of new alleles, creating considerable amounts of sequence variation in closely related species and populations (Ladoukakis and Zouros, 2017; Yang et al., 2014). Nonetheless, these same properties that make mtDNA appealing to infer the phylogenetic history, are also the ones increasing the likelihood of genetic saturation of mitochondrial sequences, that negatively affect their utility as molecular markers (Ballard and Whitlock, 2004; Ladoukakis and Zouros, 2017).

FCUP 17 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Maternal inheritance and absence of recombination make mtDNA an ideal molecular tool for the reconstruction of phylogenies because each lineage can be traced as a single evolutionary history. Moreover, the high mutation rate of mtDNA and alternation of conserved and variable segments allow the comparison of individuals from the same population and closely related species (Avise, 2004; Ladoukakis and Zouros, 2017; Mandal et al., 2014). The mitochondrial Cytochrome C Oxidase subunit I gene (COI) is slowly evolving compared to other protein coding mtDNA regions and has been recurrently used for estimating molecular phylogenies, particularly at the lower taxonomic levels such as genera and species (Mandal et al., 2014; Patwardhan et al., 2014). Nonetheless, this marker also allows to draw inferences on the evolutionary history at higher taxonomic levels up to orders, being classified as a good phylogenetic performer in retrieving expected trees among distantly related taxa (Mandal et al., 2014; Patwardhan et al., 2014; Russo et al., 1996; Zardoya and Meyer, 1996). The conserved 16S ribosomal RNA (rRNA) gene has also been used in phylogenetic inferences of distantly related species. Due to its slowest mutation rate when compared to mitochondrial protein coding genes, 16S gene allows to estimate the phylogenetic history at the family and genera levels (Mandal et al., 2014; Patwardhan et al., 2014; Stackebrandt and Goebel, 1994; Woese, 1987).

I.6.2. Nuclear markers

The inclusion of nuclear molecular markers (nDNA) on phylogenetic studies has been proved essential to overcome the inaccuracies on evolutionary histories inferred solely from mitochondrial markers, as nDNA provides extra information due to the contrasting differences with mtDNA (Tollefsrud et al., 2009). Nuclear DNA is biparentally inherited and recombination events at different rates are common in these molecules, which can sometimes bring difficulties in conjecturing the evolutionary history of taxa. Moreover, the slower mutation rate of nDNA causes a lower accumulation of recurrent mutations, which makes these markers not ideal for intraspecific studies, but suitable to retrieve deeper relationships among taxa since homoplasy is less probable to happen (Zhang and Hewitt, 2003). Nuclear rRNA genes, such as 28S gene, are frequently considered as the most suitable markers for inferring phylogenetic history of taxa, as they are universal to every organism and composed by highly conserved and variable domains (Patwardhan et al., 2014). Besides that, rRNA genes typically display a slower mutation rate when compared

FCUP 18 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) to nuclear protein coding genes, allowing older evolutionary relationships to be recovered at higher resolution (Huelsenbeck et al., 1996; Patwardhan et al., 2014).

I.7. Objectives

The main objective of this dissertation is to test the theoretical hypothesis proposed by Ávila (2013, 2006) regarding the relationship among modes of larval development, geographical distribution, bathymetry/ecological zonation and evolutionary time in oceanic islands. A phylogenetic analysis of three molecular markers from 14 Rissoidae species (nine endemic to the Azores Archipelago), assigned to seven genera found in Azorean waters, will be performed. Moreover, this work also aims to enlighten the systematic position of these seven genera in the phylogeny of the family, particularly Crisilla and Botryphallus, which are absent from most phylogenetic studies of rissoids. Finally, the reconstruction of the evolutionary history of the family Rissoidae in the Azores Archipelago is intended, through the inference of a species tree based on the information provided by different molecular markers.

Specifically, this work aims to: (i) analyse molecular phylogenies of the family Rissoidae; (ii) establish the systematic position of Azorean rissoids; (iii) reconstruct a species tree, integrating geological data from the archipelago to calibrate split events; and (iv) test the theoretical biogeographical hypothesis proposed by Ávila (2013, 2006).

FCUP 19 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Chapter II – Methodologies

II.1. Taxon sampling and outgroup choice

Samples of the Rissoidae species used in this work were collected in coastal sites in the Azores Archipelago, namely in São Miguel, Pico, Faial, Flores and Santa Maria islands and deposited at the marine Molluscs Reference Collection of the Department of Biology of the University of the Azores (DBUA). The collection and taxonomic identification of samples were realized by researchers from the University of Azores. After being sorted in DBUA, all the individuals were stored on 96% ethanol. The invertebrate nomenclature used follows that adopted in the WoRMS (http://www.marinespecies.org) database. Individuals of 14 Rissoidae species from the Azores Archipelago [Alvania angioyi van Aartsen, 1982, A. cancellata (da Costa, 1778), A. formicarum Gofas, 1989, A. mediolittoralis Gofas, 1989, A. poucheti Dautzenberg, 1889, A. sleursi (Amati, 1987), Botryphallus ovummuscae (Gofas, 1990), Cingula trifasciata (J. Adams, 1800), Crisilla postrema (Gofas, 1990), Manzonia unifasciata Dautzenberg, 1889, Rissoa guernei Dautzenberg, 1889, Setia alexandrae Ávila & Cordeiro, 2015, S. ermelindoi Ávila & Cordeiro, 2015, and S. subvaricosa Gofas, 1990], assigned to seven genera, were included in posterior phylogenetic analyses. The outgroup choice is of great importance in phylogenetic analyses, since systematic errors like long-branch attraction and others regarding fast-evolving molecules as mitochondrial DNA (mtDNA) affect the reconstruction of phylogenies (Brinkmann and Philippe, 2008; Xavier et al., 2012). Although it is not considered as part of the ingroup, the selected outgroup should be preferably closely related to the ingroup to overcome such limitations on the phylogenetic analyses, contributing to resolve the polarity of the characters in study and providing directionality to the evolutionary history inferred (Brinkmann and Philippe, 2008; Caravas and Friedrich, 2010; Lemey et al., 2009; Xavier et al., 2012). For that reason, Pisinna glabrata (Megerle von Mühlfeld, 1824) and Anabathron contabulatum Frauenfeld, 1867 (Gastropoda: Anabathridae), species that belongs to another superfamily (Truncatelloidea Gray, 1840) closely related to Rissoidae (sensu Criscione & Ponder 2013; Criscione et al. 2016), were selected as outgroups. The island and date at which samples of the ingroups and outgroup were collected, as well as the geographical distribution of each species according to Cordeiro et al. (2015), are summarized in Table II.1.

FCUP 20 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Table II.1 – List of locations, island of the Azores Archipelago and date of collection of individuals of the 14 Rissoidae species and the outgroup Pisinna glabrata included in the phylogenetic analyses. DBUA code refers to the Marine Molluscs Reference Collection of the Department of Biology of the University of the Azores to which specimens are assigned. Geographical distribution of each species, according to Cordeiro et al. (2015), is also provided. AZO – Azores; SCA – Scandinavia; BRI – British Isles; POR – Portugal; MED – Mediterranean Sea; MAD – Madeira; CAN: Canary Islands; CAP – Cabo Verde; NWA – Northwest Africa.

Geographical Location Island Date DBUA code distribution Alvania angioyi Baixa da Pedrinha Santa Maria 25-06-2014 DBUA 1146 Endemic AZO Alvania cancellata Caloura São Miguel 21-05-1999 DBUA 1058 BRI, POR, MED, AZO, Porto da Horta Faial 03-12-2009 - MAD, CAN, CAP, NWA Alvania formicarum Baixa do Vigário Santa Maria 11-01-2016 - Endemic AZO Ilhéu de Vila do Porto Santa Maria 24-06-2014 DBUA 1145 Alvania mediolittoralis Cerco-Caloura São Miguel 08-12-1995 DBUA 755 AZO, MAD Caloura São Miguel 30-04-2002 - Alvania poucheti Not specified Faial 07-1989 Endemic AZO Baixa do Porto Flores 27-10-1990 DBUA 574 Alvania sleursi Baixa da Pedrinha Santa Maria 25-06-2014 DBUA 1146 AZO, MAD Botryphallus ovummuscae Caloura São Miguel 07-11-2009 - Endemic AZO Cingula trifasciata Lajes Pico 18-08-1995 - SCA, BRI, POR, MED, Poça da Barra Pico 09-06-2003 - AZO Caloura São Miguel 03-08-2009 - Crisilla postrema Ilhéu de Vila do Porto Santa Maria 24-06-2014 DBUA 1145 AZO, MAD Manzonia unifasciata Baixa do Porto Flores 27-10-1990 DBUA 574 Endemic AZO Ilhéu de Vila do Porto Santa Maria 24-06-2014 DBUA 1145 Rissoa guernei Ilhéu de Vila do Porto Santa Maria 24-06-2014 DBUA 1145 Endemic AZO Baixa do Vigário Santa Maria 11-01-2016 - Setia alexandrae Ilhéu de Vila do Porto Santa Maria 26-08-2004 DBUA 1018 Endemic AZO Setia ermelindoi Baixa de João Lopes Santa Maria 26-06-2014 DBUA 1144 Endemic AZO Baixa do Vigário Santa Maria 11-01-2016 - Setia subvaricosa Ilhéu de Vila do Porto Santa Maria 24-06-2014 DBUA 1145 Baixa de João Lopes Santa Maria 26-06-2014 DBUA 1144 Endemic AZO Baixa do Vigário Santa Maria 11-01-2016 - MED, AZO, MAD, Pisinna glabrata (outgroup) Baixa do Vigário Santa Maria 11-01-2016 - CAN, NWA

II.2 Molecular analysis

II.2.1. DNA extraction

Genomic DNA (gDNA) of the ingroups and outgroup species – 8 Alvania angioyi, 6 A. cancellata, 4 A. formicarum, 26 A. mediolittoralis, 8 A. poucheti, 3 A. sleursi, 6 Botryphallus ovummuscae, 24 Cingula trifasciata, 5 Crisilla postrema, 6 Manzonia unifasciata, 13 Rissoa guernei, 3 Setia alexandrae, 3 S. ermelindoi, 13 S. subvaricosa, and 5 Pisinna glabrata (outgroup) – was extracted from the entire animal, due to its reduced dimensions, using the commercial kit PureLink® Genomic DNA Mini Kit (InvitrogenTM) according to the manufacturer’s instructions. A total volume of 40 µl of

FCUP 21 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) elution buffer was used in the final step of the protocol and only one elution was performed for each individual.

II.2.2. DNA amplification

Two mitochondrial genes – COI and 16S rRNA – and a nuclear gene – 28S rRNA – were amplified by Polymerase Chain Reaction (PCR). These genes were selected as they are a combination of fast and slowly evolving genes from both the mitochondrial and nuclear genomes. Moreover, they are among the most commonly used markers on phylogenetic studies of the family Rissoidae and other gastropods (Borges et al., 2016; Criscione et al., 2016, 2009; Davis et al., 1998; Hausdorf et al., 2003; Quattro et al., 2001; Szarowska et al., 2005; Takano and Kano, 2014; Wilke et al., 2013). All PCR amplifications were performed for a total volume of 25 µl for each sample, entailing 3 μl of template DNA, -10x buffer MgCl2 free, 2.5 mM MgCl2, 0.2 mM dNTP, 10 μM of each primer, 0.1 μg μl-1 Bovine Serum Albumin (BSA, Promega), 0.3U Platinum

Taq DNA polymerase, and double distilled water (ddH2O) to volume. A concentration of

3 mM MgCl2 was used on PCR amplifications of samples presenting faint bands. The primers and PCR conditions used in DNA amplification of each fragment are described on Table II.2. The amplification of the 28S fragments of A. mediolittoralis required optimization of PCR conditions to the following protocols: 94ºC (4'); [x35] 94ºC (20'), 61ºC (50''), 72ºC (1'); 72ºC (10') for the 28SDKF/LSU1600R pair of primers and 94ºC (4'); [x5] 94ºC (50’'), TD 55-50ºC (45''), 72ºC (1'30’’); [x35] 94ºC (50’'), 50ºC (45''), 72ºC (1'30’’); 72ºC (10') for the Rd1a/28Sb pair of primers. The 2x QIAGEN Multiplex PCR Master Mix (QIAGEN®), consisting of HotStartTaq DNA Polymerase, QIAGEN Multiplex PCR Buffer with 6mM

MgCl2, dNTP Mix and 10μM of each 16Sar-L and 16Sbr-H primers, was used to obtain amplicons of 16S gene from A. sleursi, as these samples failed to amplify after submitted to the previous protocol. To amplify these samples, the following conditions were used: 95ºC (15’); [x35] 95ºC (30’’), 57ºC (1’30’’), 72ºC (1’30’’); 72ºC (10’). PCR reactions were performed in a Biometra TProfessional thermal cycler. A positive and a negative control were added to each run, respectively to confirm the effective amplification of the desired fragment using a sample that was previously amplified for the target in question and to check for contaminations using all reagents except DNA. The efficiency of the reactions and quality of the amplified DNA products were electrophoretically confirmed in 2% (w/v) agarose gel with GelRed (DNA fluorescent dye, BioTargetTM), using 3 µL of PCR products and 5 µL of molecular weight marker NYZDNA

FCUP 22 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Ladder V (NZYTech, Ltd.). After running the gels at 300V, the PCR products were visualized in a UV transilluminator device (Bio-Rad).

Table II.2 – Target gene, primer name and sequence (5’-3’), source and PCR conditions applied (temperature, time and number of cycles).

Gene Primer Sequence (5’–3’) Reference PCR conditions

LCO1490 F: GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) 94ºC (4'); [x35]* 94ºC (1'), HCO2198 R: TAAACTTCAGGGTGACCAAAAAATCA 55ºC (40''/1'), 72ºC (2'); 72ºC (4') Wilke and COI COR722b R: TAAACTTCAGGGTGACCAAAAAATYA Davis (2000)

jgLCO1490 F: TITCIACIAAYCAYAARGAYATTGG 94ºC (4'); [x35]* 94ºC (30''-1'), Geller et al. 45ºC/ 48ºC/ 55ºC (30''-50'') or (2013) 55ºC (50''-1'), 72ºC (45''-2'); jgHCO2198 R: TAIACYTCIGGRTGICCRAARAAYCA 72ºC (5')

16Sar-L F: CGCCTGTTTATCAAAAACAT 94ºC (5'); [x35]* 94ºC (30''), Palumbi et 50ºC (1') or 52-54ºC (30''), al. (2002) 72ºC (1'); 72ºC (10') 16Sbr-H R: CCGGTCTGAACTCAGATCACGT 16S 16SARis F: TGCCTGTTTAGCAAAAACAT-3' Criscione 94ºC (5'); [x35]* 94ºC (30''), and Ponder 52ºC (1'), 72ºC (1'); 72ºC (7') (2013) 16SBRis R: CCGGTCTGAACTCAGATCATGT

Strong et al. 28SDKF F: GATCGGACGAGATTACCCGCTGAA (2011) 94ºC (5'); [x35]* 94ºC (1'), 55ºC (1'), 72ºC (2'); 72ºC (10') Williams et LSU1600R R: AGCGCCATCCATTTTCAGG al. (2003) 28S Edgecombe Rd1a F: CCCSCGTAAYTTAGGCATAT and Giribet 94ºC (4'); [x41]* 94ºC (20''), (2006) 56ºC/ 58ºC/ 61ºC (30''), 72ºC Whiting (40''); 72ºC (10') 28Sb R: TCGGAAGGAACCAGCTAC (2002) * Some samples required 40 cycles to achieve an acceptable amplification level.

II.2.3. Sequencing and analysis of sequences

A commercial facility – Genewiz, London, UK – performed the PCR product purification and Sanger sequencing with the same primers used in the PCR amplifications. Taking into account the expected length of the amplicons and to ensure the quality and coverage of the target genes, the 28S fragments (1100-1300 bp) and COI fragments (700 bp) were sequenced in a bidirectional way, whereas 16S fragments (500 bp) were sequenced for only one strand. The reverse strand was also sequenced in cases where the forward read was ambiguous. Moreover, sequencing of the nuclear

FCUP 23 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) gene in both directions allowed to confirm the existence of heterozygotes. Previously published sequences of COI, 16S and 28S genes from other Rissoidae species found in the North Atlantic Ocean and outgroup Anabathron contabulatum, deposited in NCBI database are summarized in Table II.3 and were also added to the final dataset.

Table II.3 – Sequences of COI, 16S and 28S genes amplified for other Rissoidae species from the North Atlantic Ocean and outgroup Anabathron contabulatum, deposited in NCBI database. Accession numbers and reference of the published sequences are provided.

COI 16S 28S Reference Alvania A. aeoliae KR698192 KR698251 Criscione et al. (2016) A. beanii FN650144 - 46 FN820512 Tverberg (n.d.) A. cimex KC109935 KC109987 Criscione and Ponder (2013) A. discors KR698196 KR698255 Criscione et al. (2016) A. geryonia KR698197 Criscione et al. (2016) A. lanciae KR698198 KR698257 Criscione et al. (2016) A. lineata KR698199 KR698258 Criscione et al. (2016) A. mamillata KR698200 Criscione et al. (2016) A. punctura FN650147 - 49 FN820513 Tverberg (n.d.) A. scabra KR698201 KR698259 Criscione et al. (2016) A. subcrenulata KR698203 KR698261 Criscione et al. (2016) A. subsoluta FN650150 Tverberg (n.d.) A. tenera KR698204 KR698262 Criscione et al. (2016)

Cingula C. trifasciata KU496634 Borges et al. (2016) KR698208 KR698266 Criscione et al. (2016) Crisilla C. beniamina KR698211 Criscione et al. (2016) Manzonia M. crassa KR698217 Criscione et al. (2016)

Onoba O. semicostata FN650151 - 53 FN820518 Tverberg (n.d.) KR698223 KR698277 Criscione et al. (2016) Pseudosetia P. semipellucida FN650154, 56 Tverberg (n.d.) P. sp. FN650172 - 73 Tverberg (n.d.) Pusillina P. inconspicua FN650157 - 59 Tverberg (n.d.) KR698230 KR698283 Criscione et al. (2016) P. marginata KR698231 KR698284 Criscione et al. (2016) P. philippi KR698232 KR698285 Criscione et al. (2016) P. radiata KR698286 Criscione et al. (2016) P. sarsii FN650160 FN820520 Tverberg (n.d.)

Rissoa R. auriscalpium HQ623175 HQ623159 Wilke et al. (2013) KR698233 KR698287 Criscione et al. (2016) R. guerinii KR698234 KR698288 Criscione et al. (2016) R. lia KR698237 KR698291 Criscione et al. (2016) R. membranacea AY676128 AY676117 Szarowska et al. (2005) KR698236 KR698290 Criscione et al. (2016) R. monodonta KR698238 KR698292 Criscione et al. (2016) R. parva AF445343 Hausdorf et al. (2003) R. similis KR698239 Criscione et al. (2016) R. variabilis KR698240 Criscione et al. (2016)

FCUP 24 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Table II.4 (cont.)

COI 16S 28S Reference R. ventricosa KC109973 KC110026 Criscione and Ponder (2013) R. violacea KR698241 Criscione et al. (2016) Setia S. ambigua KR698296 Criscione et al. (2016) Anabathron A. contabulatum KC109937 KC109989 Criscione and Ponder (2013) (outgroup)

After manually checking the chromatograms for misreads, sequences were edited using Geneious Pro v4.8.5 (Kearse et al., 2012). A BLAST search in the NCBI online database (Madden, 2002), realized to all the sequences, allowed the evaluation of their authenticity and homology of the targeted mitochondrial and nuclear genes. Sequences of the mitochondrial protein coding COI gene were uploaded in Geneious Pro v4.8.5 (Kearse et al., 2012) and translated into aminoacids considering the “Invertebrate mitochondrial genetic code”. This process allowed to check for the existence of stop codons, which are indicative of the presence of pseudogenes. Only sequences presenting at least one reading frame without stop codons were compiled into the final datasets. Plus, estimates of the raw (p) distances among haplotypes of rissoids and outgroups were conducted in MEGA7 (Kumar et al., 2016).

II.2.4. Phylogenetic analyses

Sequences of the mitochondrial markers (COI and 16S genes) were aligned using Clustal Omega algorithm via Web Services by EMBL-EBI (McWilliam et al., 2013). Contrariwise, the alignment of 28S sequences was performed using the MAFFT algorithm (Katoh et al., 2005). Afterwards, sequences of the same marker were trimmed to match in length – 658 bp for the COI gene, 504 bp to 16S gene and 1128 bp to 28S gene – and collapsed into haplotypes resorting to ALTER software (Glez-Peña et al., 2010). Non-homologous positions and saturation by multiple substitutions often obscure the phylogenetic signal due to, respectively, poorly aligned positions and divergent regions on alignment of DNA sequences (Xia, 2009). This scenario was observed at the 16S and 28S alignments datasets, therefore such regions were removed using GBlocks Server v0.91b (Castresana, 2000), reducing the alignment to 415 bp and 975 bp, respectively, and making it more suitable for posterior phylogenetic analyses. Prior to the phylogenetic reconstructions, PartitionFinder v1.1.1 (Lanfear et al., 2012) was used to determine appropriate best-fit partitioning schemes and models of molecular evolution, according to the Akaike’s Information Criterion (AIC) (Akaike, 1973). Selection of models with the AIC method allows to simultaneous compare multiple nested and non-

FCUP 25 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) nested models, as well as to assess the uncertainty inherent to the model selection process (Posada and Buckley, 2004). Moreover, it resorts to the estimated marginal likelihood (EML) as a starting value, which is penalized by the number of parameters accounted by each model in a way that the smaller the AIC value, the better the model fits to the data (Strugnell et al., 2005). A total of three sequence datasets were analysed: a) sequences for mitochondrial encoded COI gene; b) sequences for mitochondrial 16S rRNA gene; and c) sequences for nuclear 28S rRNA gene. Data partitioning by codon (1+2+3) of the mitochondrial COI gene was applied in order to minimize saturation effects of codon positions on phylogenetic reconstructions (Salemi, 2009) and to take into account the different rates of evolution of each codon position (Pond et al., 2009). In the present study, two model-based methods of phylogenetic reconstruction were applied to the datasets – Bayesian Inference (BI) and Maximum Likelihood (ML). Phylogenetic reconstructions were not performed for concatenated datasets to avoid the loss of information, as it was not possible to achieve the amplification of all markers for all individuals. For the BI analyses, executed in MrBayes v3.2.6 software (Ronquist et al., 2012), two independent runs each with four chains for 2x107 generations were performed, considering the best-fit models of nucleotide substitution for each dataset. Trees and parameters were sampled every 1,000 generations, with the heating parameter set to 0.25. Stationarity was considered to be reached when the average standard deviation of split frequencies was lower than 0.01. Majority-rule consensus trees were estimated from both analyses, in order to determine Bayesian posterior probabilities (PP) of the phylogenetic reconstructions, after discarding the first 5,000 generations considered as burn-in and corresponding to 25% of the total samples. For the ML analyses, developed using Garli v2.0.1 (Zwickl, 2006), a total of 10 independent search replicates were performed, allowing an exhaustive search of the best ML tree for each dataset. ML bootstrap analyses were achieved using 1,000 bootstrap replicates. The evaluation of log likelihood values across searches allowed to check the convergence between the topologies of the trees generated. SumTrees program of the DendroPy package (Sukumaran and Holder, 2010) was used to summarize non-parametric bootstrap support (BS) values for the best tree inferred by Garli software, after generating a majority-rule consensus tree. Consensus trees inferred for each molecular marker were visualized and rooted – setting Pisinna glabrata as outgroup for the COI dataset, Anabathron contabulatum as outgroup for the 28S dataset and both previously mentioned species as outgroups for the 16S dataset – resorting to FigTree v1.4.3 software (Rambaut, 2006). Posterior

FCUP 26 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) modifications of the phylogenies, including the insertion of BS and PP values and addition of a colour code (cf. Appendix 1), were performed with Inkscape v0.92 (http://www.inkscape.org).

II.2.5. Species tree reconstruction and estimation of divergence times

A dataset containing COI and 28S genes was created and analysed within BEAST v2.4.5 software (Bouckaert et al., 2014) in order to estimate the true evolutionary history of rissoid species, based on the coestimation of multi-individual multi-locus sequence data. Only species with multiple representatives for both markers were included in this analysis: Alvania angioyi, A. formicarum, A. mediolittoralis, A. sleursi, Cingula trifasciata, Crisilla postrema, Rissoa guernei and Setia subvaricosa. Only representatives of the latter species that were not grouped with R. guernei in gene phylogenetic trees were considered to be S. subvaricosa (cf. III.2.2), thus being included in the species tree reconstruction analyses. The StarBEAST2 framework (Ogilvie et al., 2017), available through the BEAUti package manager, was used to infer the species tree topology and divergence times of taxa in study. This fully Bayesian multispecies coalescent method allows a more precise estimation of several parameters by embedding each gene tree within a single shared species tree and provides an alternative to concatenated datasets (Ogilvie et al., 2017), which have been associated to the overestimation of divergence times (Ogilvie et al., 2016) and over/underestimation of the length of specific branches due to incomplete lineage sorting (Mendes and Hahn, 2016). The software jModelTest v2.1.10 (Darriba et al., 2012) was used to determine the best-fit models for each marker analysed and estimate the parameters for each model defined. For the COI marker, HKY+I+G model was defined, with gamma shape=0.61, proportion of invariants=0.55 and kappa=18.7407. For the 28S marker, the model GTR+I+G was set, with gamma shape=0.471 and proportion of invariants=0.508, plus rate AC=0.3118, rate AG=2.1462, rate AT=0.797, rate CG=0.7967, rate CT=6.8066 and rate GT=1.0. A strict clock with estimation of the rate performed by the software was defined for both datasets, since the small matrix of nucleotide data does not contain enough information to infer most of the parameters required for more complex models as relaxed molecular clocks (Villarreal and Renner, 2014). Regarding the priors, Yule Model of speciation was defined; the remaining specifications were set to default values. To estimate the timing of the split events, four calibration points based on the fossil record of Santa Maria Island (Azores) were defined. These calibration points do not concern specific times for splits between taxa, but the minimum age attributed to certain clades according to their presence/absence in fossiliferous outcrops dated from the

FCUP 27 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Pliocene and Pleistocene (MIS 5e). A. sleursi is an extant species present in both Pliocene and Pleistocene (MIS 5e) sediments, therefore it has to be longer-lived in a geological sense than the older sediments in which is found. For that reason, a minimum age of 4.13 Ma (Ramalho et al., 2017) was set for the divergence among A. sleursi, A. mediolittoralis and A. formicarum. On the other hand, a minimum age of 0.12 Ma was set up for: (1) the split between A. formicarum and A. mediolittoralis, (2) the divergence among C. trifasciata and the endemic species A. angioyi and C. postrema; (3) the split between R. guernei and S. subvaricosa. This minimum bound was considered as the species aforementioned are only found in the more recent sediments of the Pleistocene (MIS 5e) (Ávila et al., 2015c, 2009b; Cordeiro and Ávila, 2015). The analysis was run for 108 generations, with parameters sampled every 10,000th generations and burn-in defined to 10% of the total samples. The adequate burn-in was defined after graphically checking the approximate number of generations needed to achieve the stationary state in Tracer v1.6 software (Rambaut et al., 2014). Moreover, Tracer v1.6 software was used to assess convergence of Markov Chain Monte Carlo (MCMC) chains and to evaluate the effective sample sizes (ESS) reached for every parameter. The final species tree with node ages, calculated as means of the posterior estimates, and their 95% Highest Posterior Densities (HPD) was computed resorting to TreeAnotator v2.4.5 (Rambaut and Drummond, 2002), after discarding the defined burn- in. The final species tree was visualized with FigTree v1.4.3 software (Rambaut, 2006) and posterior modifications of the phylogeny were performed resorting to Inkscape v0.92 (http://www.inkscape.org).

FCUP 29 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Chapter III – Results

III.1. DNA amplification and sequence data

The mitochondrial markers COI and 16S rRNA were successfully amplified and sequenced for a total of 58 individuals (619-658 bp) and 47 individuals (463-496 bp), respectively. Fragments of lengths between 1014 and 1373 bp of the nuclear marker 28S rRNA were also amplified for 45 rissoids. Unfortunately, for the species Alvania poucheti and Manzonia unifasciata, it was not possible to obtain sequences of any marker. Since no sequences of these taxa are available on NCBI database, they were not included in any further analyses. For the species Alvania cancellata, the 16S gene was only amplified for one individual and no sequences of the other markers were obtained. Therefore, sequences of A. cancellata were not included in posterior phylogenetic analyses and the taxonomic status of this species could not be checked. Moreover, the amplification of the 16S marker was not accomplished for Setia alexandrae and S. ermelindoi. Additionally, COI was successfully amplified for five individuals of the outgroup Pisinna glabrata with lengths of 627-658 bp, whereas markers 16S and 28S were amplified for four individuals with 497 bp and 1195-1333 bp, respectively. After compiling and aligning the sequences of COI, 16S and 28S, they were trimmed to match in a final length of 658 bp, 504 bp and 1128 bp, respectively. Interestingly, the alignment for COI sequences of rissoid species displayed a few indels in Botryphallus ovummuscae, S. alexandrae and S. ermelindoi species. A three bp deletion was observed in B. ovummuscae between positions 287 and 291 (Figure III.1a). In S. alexandrae and S. ermelindoi, two blocks were deleted consistently in both species – one of three bp between the positions 95 and 99 (Figure III.1b), and the other of nine bp between positions 355 and 365 (Figure III.1c) of the alignment.

FCUP 30 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Figure III.1 – Alignment of mtDNA COI gene, considering the consensus sequences of all the Rissoidae species in study, except Botryphallus ovummuscae, Setia alexandrae and S. ermelindoi, for which all sequences amplified are represented. (a) Gap only observed in B. ovummuscae; (b, c) Gaps detected in S. alexandrae and S. ermelindoi. Only noticeable gaps are represented, one bp gaps are omitted. Colours in the sequences highlight disagreements to consensus.

FCUP 31 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Regarding the 16S marker alignment (prior to removal of non-homologous blocks on GBlocks), several indels were also detected. A deletion of one bp at position 29 (Figure III.2a) and a deletion of a nine bp block comprised between positions 256 and 264 of the alignment (Figure III.2b), were observed in all rissoid species except B. ovummuscae. Plus, a nucleotide was deleted at position 266 (also in Figure III.2b) and another at position 321 in all Rissoidae sequences except B. ovummuscae (Figure III.2c). Other indels could be observed in some species or genera included in the analysis: a one bp deletion at the position 5 (Figure III.2d) spotted in all Alvania spp., Crisilla beniamina Monterosato, 1884, Cingula trifasciata, Manzonia crassa (Kanmacher, 1798) and Onoba semicostata (Montagu, 1803); a one bp deletion in all Pusillina spp. and Rissoa spp. at position 56 (Figure III.2e) and another at position 73 (Figure III.2f), the latter also absent in C. trifasciata, Crisilla spp. and most Alvania spp.; plus a two bp deletion at positions 254-255 in all Rissoa spp. except R. ventricosa (Figure III.2g). Other punctual indels in only one or few taxa of rissoids were distinguished scattered on the 16S alignment. In B. ovummuscae, four deletions were perceived: a small block of three bp between positions 45 and 49 (Figure III.2h), one bp deleted at position 70 (Figure III.2i), two bp at positions 309-310 (Figure III.2j) and another deleted nucleotide at position 316 (Figure III.2k). For the 28S marker alignment (prior to removal of non-homologous blocks on GBlocks), indels of nucleotide blocks or single nucleotides were also observed. Only in

B. ovummuscae, a nucleotide was deleted in position 872 (Figure III.3a). A considerable number of nucleotide blocks present in S. alexandrae and S. ermelindoi were deleted in all the remaining sequences: three bp deletion between positions 370 and 374 (Figure

III.3b), eight bp deleted between positions 466 and 475 (Figure III.3c), a block of 15 bp between positions 546 and 562 (Figure III.3d), four bp deleted between positions 684 and

689 (Figure III.3e), three bp deleted between positions 742 and 746 (Figure III.3f), and a gap of 11 bp comprised between positions 910 and 922 (Figure III.3g; some species present a bigger gap in this location, due to a higher number of nucleotides deleted). Moreover, when comparing to S. alexandrae and S. ermelindoi, four bp between positions 573 and 578 were missing in all Pusillina spp., Rissoa spp. and Setia sp. At this location, two bp at positions 573-574 were deleted in all Alvania spp. and C. postrema (Figure III.3h; bigger gaps in some of the species, as more nucleotides are deleted). More gaps with small length and private to a given species (not shared with other taxa in study), were also observed in the alignment.

FCUP 32 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Figure III.2 – Alignment of mtDNA 16S rRNA gene, considering the consensus sequences of all the Rissoidae species in study, except Botryphallus ovummuscae, for which all sequences amplified are represented. (a-c) Gap observed in all species, except in B. ovummuscae sequences; (d) One bp gap in Alvania spp., C. beniamina, C. trifasciata, M. crassa and O. semicostata; (e) One bp gap in Pusillina spp. and Rissoa spp.; (f) One bp gap in Pusillina spp., Rissoa spp., C. trifasciata, Crisilla spp. and most Alvania spp.; (g) Two bp gap in all Rissoa spp. except R. ventricosa; (h-k) Gaps detected only in B. ovummuscae. Colours in the sequences highlight disagreements to consensus.

FCUP 33 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Figure III.3 – Alignment of nDNA 28S rRNA gene, considering the consensus sequences of all the Rissoidae species in study, except Botryphallus ovummuscae, Setia alexandrae and S. ermelindoi for which all sequences amplified are represented. (a) Gap observed only in B. ovummuscae; (b-g) Gaps observed in all species, except in S. alexandrae and S. ermelindoi; (h) Four bp gap detected in Pusillina spp., Rissoa spp. and Setia spp.; two bp gap in all Alvania spp. and C. postrema (more nucleotides missing in some species). Only noticeable gaps are represented, most one or two bp gaps are omitted, including the ones private to a given species. Colours in the sequences highlight disagreements to consensus.

FCUP 34 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

A BLAST search was performed for the three markers. No sequences of the species under study are deposited in the NCBI database, except for Cingula trifasciata. Most sequences showed homology to the targeted genes of other gastropod mollusc species (with a few exceptions), thus confirming their authenticity. Alvania angioyi, A. cancellata, A. formicarum, A. mediolittoralis, A. sleursi and Crisilla postrema sequences matched against other Rissoidae sequences deposited in NCBI database. C. trifasciata presented 98-100% coverage and 98-99% identity with sequences of COI, 16S and 28S for specimens of the same nominal species deposited in the NCBI database, therefore its authenticity was accepted. Rissoa guernei and Setia subvaricosa blasted with rissoid species for 16S and 28S, but sequences of the COI marker blasted with sequences from other mollusc species with approximately 80% of identity (Alia carinata (Hinds, 1844) or Fluviopupa erromangoana Zielske & Haase, 2014). Curiously, R. guernei and some S. subvaricosa sequences matched against the same rissoid sequence for the 16S and 28S markers (R. similis Scacchi, 1836 and R. guerinii Récluz, 1843, respectively), whereas the remaining S. subvaricosa sequences blasted with a different Rissoidae species [R. violacea Desmaret, 1814 for 16S and R. lia (Monterosato, 1884) for 28S marker]. B. ovummuscae, S. alexandrae and S. ermelindoi constitute other exceptions to the general scenario of sequence matching to Rissoidae species. The four B. ovummuscae sequences of COI and 16S genes showed, respectively, 76% and 78% of identity to sequences of the Iravadiidae family and 98% identity with a sequence of Iravadia W. T. Blanford, 1867 sp. to the 28S marker. BLAST search of COI sequences of S. alexandrae and S. ermelindoi, through the Megablast algorithm, retrieved insect or spider genera, but with low coverage and identity. A more sensitive analysis, using the Blastn algorithm, was used and homology with molluscs (sea slug Tenellia A. Costa, 1866 sp. or gastropod Siphonaria G. B. Sowerby I, 1832 sp.) was obtained for all samples. The 28S sequences analysed for both species matched with Philine grandioculi Ohnheiser & Malaquias, 2013, however with low coverage of 73% and only 90% of identity.

III.2. Phylogenetic analyses

III.2.1. Analyses performed on total Rissoidae dataset

After collapsing sequences into haplotypes, Bayesian Inference (BI) and Maximum Likelihood (ML) methods were applied to each of the three datasets – COI, 16S and 28S – and phylogenetic gene trees were obtained. For every marker, sequences of Setia alexandrae and S. ermelindoi shared haplotypes; hereafter, these sequences were

FCUP 35 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) treated as a cluster termed ‘Setia’. According to the analyses performed on PartitionFinder, models of molecular evolution were applied to the datasets as follows: a) COI – HKY+I+G (1st partition), GTR+I+G (2nd and 3rd partition); b) 16S – GTR+I+G; c) 28S – GTR+I+G. Overall, BI and ML analyses produced phylogenetic trees with similar topologies, particularly at the level of major clades. For the phylogenetic trees inferred separately for each marker (Figure III.4), only a few split events are moderately (70-90%) or well supported (>90%) by bootstrap values (BS) (data not shown). For the mitochondrial COI gene (Figure III.4a), Botryphallus ovummuscae was included in the clade containing Alvania mediolittoralis, A. formicarum, A. sleursi and A. beanii (Hanley in Thorpe, 1844), as a sister species of the latter, whereas the cluster ‘Setia’ occupied a basal position. The split events concerning B. ovummuscae and cluster ‘Setia’ were not supported by ML analysis (BS 15.6% and 53.7%, respectively). The ML analysis performed for the mitochondrial 16S rRNA gene placed sequences of B. ovummuscae in the clade comprising sequences of C. trifasciata (Figure III.4b), but the support is low for this node (BS 16.05%). Finally, in the phylogenetic tree obtained for the nuclear 28S gene (Figure III.4c), both B. ovummuscae and cluster ‘Setia’ occupied a basal position but split events had low support (BS <70%). In all phylogenetic trees inferred, B. ovummuscae and ‘Setia’ either occupied basal positions or were positioned at the tip of a long branch. Both situations undeniably reflect considerable differences in the gene sequences of these taxa when compared to the other Rissoidae species.

FCUP 36 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Figure III.4 – Polar tree layout of the Maximum Likelihood tree obtained for the: a) mitochondrial COI marker; b) mitochondrial 16S rRNA marker; c) nuclear 28S rRNA marker. Bootstrap support values are not shown. The branches containing Botryphallus ovummuscae and cluster ‘Setia’ are highlighted in yellow and green, respectively.

FCUP 37 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

III.2.2. Analyses performed on Rissoidae dataset, excluding Botryphallus ovummuscae and cluster ‘Setia’

Both Botryphallus ovummuscae and cluster ‘Setia’ (S. alexandrae and S. ermelindoi) displayed considerable differences in the sequences of the mitochondrial and nuclear markers when compared to other Rissoidae used in this study. Therefore, and to avoid incorrect phylogenetic inferences due to phenomena such as Long Branch Attraction, the analyses were repeated for each marker excluding these species. New alignments were built for COI, 16S and 28S markers, with 658 bp, 424 bp and 978 bp (length of rRNA genes sequences after analysed with GBlocks), respectively. Sequences of COI (75 sequences), 16S (80 sequences) and 28S (60 sequences) genes were collapsed, respectively, into 55, 62 and 40 haplotypes. BI and ML approaches were applied to each of the three datasets. Phylogenetic gene trees were obtained for both methods, comprising the sequences of Rissoidae species obtained in this study and other rissoids for which sequences are deposited in NCBI database, as explained in Methodologies (cf. Table II.3). According to the analyses on PartitionFinder, the following models of molecular evolution were applied to each dataset: a) COI – HKY+G (1st partition), GTR+G (2nd partition), HKY+I (3rd partition); b) 16S – GTR+I+G; c) 28S – GTR+I+G. Generally, BI and ML analyses produced phylogenetic trees with similar topologies for the three datasets. The trees display both bootstrap support (BS) and posterior probabilities (PP) of the nodes, inferred from ML and BI analysis respectively, and PP values tended to be higher than BS values at most of the nodes. Two major groups were easily distinguished in the phylogenetic trees inferred for the three markers in study (Figure III.5-7). The topology of these major groups was concordant between BI and ML analyses for mitochondrial COI and nuclear 28S rRNA genes, but is only supported by PP in COI tree (82%). Group I incorporated haplotypes of Alvania, Cingula and Crisilla genera. In the phylogenetic tree for COI marker (Figure III.5), representatives of the genus Pseudosetia included in the analyses were also present in this group. The genus Alvania was polyphyletic in all the analyses, with several distinct lineages assembled within Group I. Group II comprised representatives of Pusillina, Rissoa and Setia genera, constituting a common clade to all three phylogenies inferred from the markers in study. Curiously, Rissoa guernei and some haplotypes of Setia subvaricosa were depicted as the same taxon in all the trees, whereas other haplotypes of the latter species were detected in different branches on the three molecular phylogenies inferred: basal position relative to all rissoids analysed in COI phylogeny (BS 100%, PP 100%); as sister species to Pusillina spp. in 28S phylogeny

FCUP 38 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

(BS 94%, PP 99%); and basal position relative to the clade comprising Rissoa and Pusillina spp. – Clade C – in 16S phylogenetic tree (unsupported). The best trees retrieved with the mtDNA markers (Figure III.5 for the COI gene and Figure III.7 for the 16S) and nDNA 28S marker (Figure III.6) are, in a general view, well supported by PP, but only some split events of haplotypes within the same species are supported by ML analyses. The topology of COI and 28S phylogenies was similar but 16S phylogenetic tree topology was not concordant with the previous ones. Nevertheless, some patterns were easily observed in all phylogenies. Clade A: comprised Alvania formicarum, A. mediolittoralis, A. sleursi and A. beanii in the COI phylogeny (Figure III.5). The split between A. mediolittoralis and A. formicarum was inferred with considerable support in both ML and BI analyses for the COI gene (BS 79%, PP 100%), whereas the older splits were only supported by PP (>90%). Clade A was also observed in the 28S phylogeny (Figure III.6) comprising A. formicarum, A. mediolittoralis, A. sleursi, A. cimex and A. subcrenulata (Bucquoy, Dautzenberg & Dollfus, 1884), but only supported by PP values (>85%). In the 16S phylogenetic tree (Figure III.7), Clade A was formed exclusively by A. formicarum and A. sleursi, since A. beanii occupies a basal position relative to Group I and A. mediolittoralis was not sequenced for this gene, therefore it was not possible to ascertain its position on the tree. The divergence between A. formicarum and A. sleursi branches was only supported by BI analysis (PP 71%). Clade B: comprised Alvania angioyi, A. punctura (Montagu, 1803), Crisilla postrema and Cingula trifasciata in the COI dataset (Figure III.5) with high PP support (>90%), whereas in the 28S phylogeny (Figure III.6) all the aforementioned taxa (except A. punctura), plus Alvania discors, A. lanciae, A. lineata, A. scabra, A. tenera (Philippi, 1844), were included in this clade. Clade B was only supported in the BI analyses (PP 96% in the COI phylogeny; PP 88% in the 28S phylogeny), but in the 28S phylogenetic tree the subclade encompassing A. discors (Allan, 1818), A. lanciae (Calcara, 1845), A. lineata Risso, 1826 and A. scabra (Philippi, 1844) showed high support by both methodologies (BS 98%, PP 100%). The major relationships established within this clade were concordant between the mtDNA COI and nDNA phylogenies: C. trifasciata occupies a basal position in Clade B and C. postrema is sister species to Alvania representatives included in this clade (unsupported in COI phylogeny; PP 95% in 28S phylogeny). Additionally, Crisilla beniamina was included in Clade B in the 16S phylogeny (Figure III.7), which comprised all the previously mentioned taxa but had low support in both BI and ML analyses. In this phylogenetic tree, the major split event leading to the

FCUP 39 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) divergence among A. discors, A. lanciae, A. lineata and A. scabra was highly supported by both ML and BI (BS 100%, PP 100%), as it was the one comprising Crisilla spp. as a monophyletic group (BS 100%, PP 100%). C. beniamina was only included in 16S dataset, hence no inferences could be done regarding the taxonomic position of this group with the other markers analysed. In contrast with COI and 28S phylogenies, A. punctura occupied a basal position in Clade B in the 16S phylogenetic tree, but this relationship was unsupported. Clade C: comprised Pusillina inconspicua (Alder, 1844), P. sarsii (Lovén, 1846), Rissoa auriscalpium (Linnaeus, 1758), R. guernei and most haplotypes of S. subvaricosa in COI phylogeny (Figure III.5), whereas in the 28S phylogenetic tree (Figure III.6) P. marginata (Michaud, 1830), P. philippi (Aradas & Maggiore, 1844), several Rissoa spp. and Setia ambigua (Brugnone, 1873) were also included in this clade. A major pattern common to COI and 28S phylogenetic trees is the well-supported group formed by haplotypes of R. guernei and some S. subvaricosa (BS 93%, PP 100% in the COI phylogeny; PP 99% in the 28S phylogeny), which denotes their resemblance and suggests that these species might belong to the same taxon. In the 28S phylogeny, within Clade C, a small clade formed by all Rissoa spp. (except Rissoa lia) included in this dataset plus S. ambigua was well supported by both ML and BI analysis (BS 87%, PP 99%). R. lia was comprised in another small clade within Clade C supported by ML and BI analyses (BS 91%, PP 99%), together with Pusillina spp. In the 16S phylogenetic tree (Figure III.7), Clade C comprised the taxa included in the homonymous clade in the 28S dataset, plus Pusillina sarsii, Rissoa parva (da Costa, 1778), R. similis, R. variabilis (Megerle von Mühlfeld, 1824) and R. violacea. A trichotomy encompassing subclades formed by Pusillina spp. and Rissoa spp., except R. guernei and R. similis, might contribute to the low support of the split event that originated these lineages. In this phylogeny, R. similis was sister species to the group formed by R. guernei and several S. subvaricosa haplotypes, a relationship well supported by both analyses (BS 97%, PP 100%). Moreover, in this dataset, R. auriscalpium and R. guerinii were depicted as different haplotypes of the same taxon (PP 79%). The association of P. inconspicua and P. sarsii as the same taxon was well supported in COI and 16S trees both for ML and BI analyses (BS, PP 100% for COI; BS 99%, PP 99% for 16S).

Clade D was only inferred in COI phylogeny (Figure III.5), although with low support (BS, PP <70%), and comprised exclusively deep-water rissoid species for which COI sequences are available at GenBank database. The genus Pseudosetia Monterosato, 1884 appeared as monophyletic and closely related to Alvania subsoluta (Aradas, 1847),

FCUP 40 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) whereas Onoba semicostata occupied a basal position. Since only COI sequences are available for A. subsoluta and this clade was not supported by ML or BI analyses, inferences on the taxonomic position of the four species included in this clade are not trustworthy.

Regarding 16S phylogenetic tree (Figure III.7), some relationships with low or no support were only detected with this dataset. O. semicostata and Manzonia crassa were placed in a basal position in relation to Clade C, but the split event was not supported. Alvania geryonia (Nardo, 1847) and A. cimex were grouped at the tip of the same branch and represented as haplotypes of the same taxon. Alvania mamillata Risso, 1826 was represented as sister species to the taxa previously mentioned (BS 74%, PP 90%).

Figure III.5 – Maximum Likelihood tree obtained for mtDNA COI gene. Values at the nodes correspond to Bootstrap Support values from Maximum Likelihood analysis and Posterior Probability from Bayesian Inference. Clades A-D are identified. The Accession Numbers of sequences retrieved from NCBI database are provided. Asterisks (*) represent support values inferior to 70%. Colour code intends to facilitate the visual identification of the species included in the phylogenetic analysis. Colour correspondence can be found in the Appendix 1.

FCUP 41 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Figure III.6 – Maximum Likelihood tree obtained for nDNA 28S rRNA gene. Values at the nodes correspond to Bootstrap Support values from Maximum Likelihood analysis and Posterior Probability from Bayesian Inference. Clades A-C are identified. The Accession Numbers of sequences retrieved from NCBI database are provided. Asterisks (*) represent support values inferior to 70%. Colour code intends to facilitate the visual identification of the species included in the phylogenetic analysis. Colour correspondence can be found in the Appendix 1.

FCUP 42 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Figure III.7 – Maximum Likelihood tree obtained for mtDNA 16S rRNA gene. Values at the nodes correspond to Bootstrap Support values from Maximum Likelihood analysis and Posterior Probability from Bayesian Inference. Clades A-C are identified. The Accession Numbers of sequences retrieved from NCBI database are provided. Asterisks (*) represent support values inferior to 70%. Colour code intends to facilitate the visual identification of the species included in the phylogenetic analysis. Colour correspondence can be found in the Appendix 1.

FCUP 43 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

III.2.3. Species tree reconstruction and estimation of divergence times

StarBEAST2 framework was used to infer the evolutionary history and estimate divergence times of eight Rissoidae species, based on COI and 28S markers (Figure III.8). The best-fit models and their respective parameters that can be fixed in StarBEAST were estimated with jModelTest, together with the addition of four calibration points, allowing to optimize tree search. The effective sample sizes (ESSs) of every parameter reached values higher than 1,000 and assessment of parameter statistics in Tracer v1.6 suggested the convergence of the analysis. According to this analysis, representatives of the family Rissoidae started to diversify at 17.52 Ma, during the Early Miocene, splitting into a lineage that originated Rissoa and Setia genera and other that lead to the speciation of Alvania, Cingula and Crisilla genera. Alvania angioyi is more closely related to Crisilla postrema and Cingula trifasciata than to other Alvania spp., thus this genus was not monophyletic, as observed in the gene trees. Three clades were easily identified in the species tree: Clade A: according to the estimated divergence times, a first split event (calibrated) occurred in the Late Miocene (ca. 7.67 Ma) between C. trifasciata and the ancestral of A. angioyi and C. postrema. Later, ca. 2.5 Ma, the differentiation between A. angioyi and C. postrema took place (ca. 5.32 Ma). A low degree of uncertainty was associated to these estimations, as the Highest Posterior Density (HPD) showed a maximum interval of ca. 5 Ma on the first split event and ca. 3.8 Ma on the second one. Clade B: comprised two split events, both calibrated according to the fossil record of Santa Maria Island. According to the estimated ages, the diversification of these three species started during the Middle Pliocene, ca. 4.34 Ma, splitting the lineage that originated Alvania sleursi from the ancestral of the other two species. A second split event, responsible for the appearance of A. formicarum and A. mediolittoralis, had an estimated age of 360 ky, during the Pleistocene. High confidence was attributed to the estimated ages of both split events in this clade, as they were calibrated and defined by narrow HPD intervals. Clade C: the splitting between Rissoa guernei and Setia subvaricosa took place 5.14 to 20.48 Ma and the estimated age of the split event was 13.44 Ma. Since an extensive credibility interval of 15.34 Ma was associated with this event, a high degree of uncertainty obscured the estimation of a trustworthy age for this node, thus no major inferences could be done regarding the taxonomic position and temporal range of existence of these two species.

FCUP 44 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Figure III.8 – Rissoidae species tree, estimated according to a fully Bayesian multispecies coalescent method implemented in StarBEAST2 software with datasets of mtDNA COI gene and nDNA 28S rRNA gene. Four calibrations were added to some nodes, as illustrated in the figure. Clades A-C are depicted by different colours. Coloured yellow bar represents the emergence of the first island of Santa Maria, the oldest of the Azores Archipelago. Values at the nodes correspond to the estimate age of the split event and blue node bars represent 95% of the Highest Posterior Density interval. Numbers within brackets represent the 95% credibility interval associated with the node bars and, thus, split events. Colour code intends to facilitate the visual identification of the species included in the phylogenetic analysis. Colour correspondence can be found in the Appendix 1.

FCUP 45 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

III.3. Estimates of pairwise distances

The raw (p) distances among the species and haplotypes in study ranged from 0 to 37% in COI and 16S datasets and from 0 to 27% in the 28S dataset. Overall, differences within haplotypes of the same species were inferior to 1.5% in COI marker, 4.7% in 16S dataset and 1% in 28S gene. In the three datasets in study, outstandingly high values of divergence were observed in the pairwise comparison of both Botryphallus ovummuscae and ‘Setia’ with the remaining genera in study (Table III.1). In COI and 28S datasets, the divergence among ‘Setia’ and the remaining ingroups was higher than the differentiation of B. ovummuscae. For the COI marker, the minimum differentiation level of B. ovummuscae was 26.7%, with Alvania spp., and it reached a maximum divergence of 29.8% with Onoba sp., whereas ‘Setia’ level of divergence ranged from 32.4% with Cingula sp. to 35.4% with Pusillina spp. In the 16S dataset, only B. ovummuscae was analysed, showing a minimum divergence of 30.9% with Alvania spp. and maximum differentiation with Rissoa spp. (33.5%). Lower p-distances for both B. ovummuscae and ‘Setia’ were observed in the 28S dataset – in B. ovummuscae the divergence ranged from 10.3% to 12%, respectively with Onoba sp. and Setia spp., whereas 27% was the divergence level between ‘Setia’ and every genera in study. Therefore, the divergence between B. ovummuscae and the remaining species in study, as well as between ‘Setia’ and other ingroups, were much higher than the p- distance values estimated for the comparisons between other rissoids and the outgroups, suggesting a high degree of differentiation of these taxa and supporting their removal from the phylogenetic analyses performed in the present work.

Table III.1 – Mean p-distances of the pairwise comparison of Botryphallus ovummuscae and cluster ‘Setia’ with representatives of the genera in study, for COI, 16S and 28S markers.

COI 16S 28S B.ovummuscae 'Setia' B.ovummuscae 'Setia' B.ovummuscae 'Setia' Alvania sp. 0.267 0.339 0.309 - 0.112 0.274 Cingula sp. 0.269 0.324 0.298 - 0.117 0.273 Crisilla sp. 0.27 0.352 0.313 - 0.117 0.273 Manzonia sp. - - 0.305 - - - Onoba sp. 0.298 0.334 0.313 - 0.103 0.271 Pseudosetia sp. 0.274 0.345 - - - - Pusillina sp. 0.283 0.354 0.313 - 0.117 0.271 Rissoa sp. 0.272 0.353 0.335 - 0.115 0.273 Setia sp. 0.275 0.348 0.332 - 0.12 0.27 * Cluster ‘Setia’ comprises sequences of S.alexandrae and S.ermelindoi.

FCUP 46 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

III.3.1. p-distances for the mtDNA COI marker

In the COI marker dataset (Appendix 2), differences within Alvania spp. ranged between 14% and 18.4%, except for the pairwise comparison of A. formicarum and A. mediolittoralis haplotypes that showed a small divergence of 3%. Pseudosetia spp. and P. semipellucida displayed 17% to 17.6% divergence. Differences between the two species assigned to Pusillina spp. were small, as P. sarsii and the three P. inconspicua haplotypes diverged 1.7% at maximum. Rissoa auriscalpium and R. guernei divergence ranged from 19.2% to 19.9%. Moreover, a considerable degree of differentiation was also detected when comparing haplotypes 1 to 5 with haplotypes 6 to 8 of Setia subvaricosa, with differences of 19.7% to 20.9%. Differences of this magnitude were also observed when comparing haplotypes 6 to 8 of S. subvaricosa with haplotypes of R. guernei. Pairwise comparisons of haplotypes 1 to 5 of S. subvaricosa and haplotypes of R. guernei revealed reduced differences among them (p-distance <1%), suggesting that these belong to the same taxon. The remaining genera included in the p-distance matrix were represented by a single species, therefore it was not possible to calculate intrageneric distances in these cases. Pairwise differences among species of different genera – excluding B. ovummuscae and ‘Setia’ – varied between 13% and 23.4% and the analysis revealed 16% to 23% divergence between the ingroups and the outgroup Pisinna glabrata.

III.3.2. p-distances for the mtDNA 16S marker

Regarding the 16S marker (Appendix 3), divergence ranged from 1.4% to 15.8% within Alvania spp. and only 0.5% divergence was detected between A. cimex and A. geryonia. Differences of approximately 7.5% were observed between Crisilla beniamina and C. postrema. Within Pusillina spp., divergence levels ranged between 7.2% and 10.2%, with the sole exception of the pairwise comparison between P. inconspicua and P. sarsii that showed only 0.2% of differentiation. Within Rissoa spp., divergence ranged from 0.9% to 10.2%. When comparing the haplotypes of Setia subvaricosa, considerable differentiation of 14.4% to 14.9% was detected among haplotypes 1 to 4 and haplotypes 5 and 6. Similar degree of divergence was observed in the pairwise comparison of haplotypes 5 and 6 of S. subvaricosa and haplotypes of Rissoa guernei, whereas the differences among haplotypes 1 to 4 of S. subvaricosa and haplotypes of R. guernei were inferior to 1%, thus probably belonging to the same taxon. The remaining genera included in the p-distance matrix were represented by a single species, therefore it was not possible to calculate intrageneric distances in these cases.

FCUP 47 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Pairwise comparisons among species of different genera – excluding Botryphallus ovummuscae – revealed differences ranging from 20.3% to 24.2% and 17.4% to 28%, between the ingroups and the outgroups Anabathron contabulatum and Pisinna glabrata, respectively.

III.3.3. p-distances for the nDNA 28S marker

Analysing the distance matrix of 28S dataset (Appendix 4), differences between 1% and 6.2% were detected within Alvania spp. Among A. formicarum, A. mediolittoralis and A. sleursi, pairwise distances were lower than 1%, a scenario also observed in the comparison between A. cimex and A. subcrenulata. Within Pusillina spp., differences among species were lower than 1%. Divergence levels among species of Rissoa spp. ranged from 0.3% to 3.8%, and the lower values (<1%) were observed for the comparison among R. auriscalpium, R. guerinii and R. guernei. When analysing Setia spp., 6.3% divergence was detected among haplotypes 1 to 2 and the remaining haplotypes of S. subvaricosa. A similar level of divergence occurred among haplotypes 3 and 4 of S. subvaricosa and haplotypes of R. guernei. In fact, no differentiation was observed between R. guernei and haplotypes 1 and 2 of S. subvaricosa, suggesting that they belong to the same taxon as inferred in mtDNA p-distances matrices. Low divergence of 1.2% was detected among haplotypes 1 and 2 of S. subvaricosa and S. ambigua, but higher differences existed when comparing the latter species with haplotypes 3 and 4 of S. subvaricosa (5.7%). The other genera included in the analyses were represented by a single species, hence it was not possible to infer intrageneric distances in these cases. Comparisons among species of different genera – excluding Botryphallus ovummuscae and ‘Setia’ – showed that the divergence level ranged from 1% to 9.9%. Differences between the ingroups and the outgroup Anabathron contabulatum ranged from 11.8% to 13.9%.

FCUP 49 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Chapter IV – Discussion

IV.1. Gene phylogenetic trees

Considerable discrepancies tend to exist between non-parametric bootstrap values (BS) from Maximum Likelihood (ML) analysis and Bayesian posterior probabilities (PP), regarding the support provided by each method to the relationships inferred (Douady et al., 2003; Erixon et al., 2003), a scenario observed in the phylogenies inferred throughout this work. This often leads to misinterpretations, and erroneous conclusions can be drawn if the support values are not analysed with caution. Bayesian Inference (BI) implies the calculus of PP through the combination of prior probability and the likelihood of each tree estimated; the tree with the highest PP is then considered the best estimate of the phylogeny. In most phylogenies, PP is higher than BS values, as it tends to overestimate the support of the relationships inferred (Douady et al., 2003). High PP values can lead to misinterpret phylogenetic signals, giving support to incorrect evolutionary relationships (Douady et al., 2003). Non-parametric BS is a more conservative estimator, thus being less likely to provide strong support to false phylogenetic hypotheses (Douady et al., 2003; Erixon et al., 2003). Therefore, it is more likely that the tree topology inferred from ML analyses is the one reflecting the real evolutionary history of each marker.

IV.2. Systematic position of Botryphallus ovummuscae, Setia alexandrae and Setia ermelindoi

Results obtained throughout this work suggested that a considerable degree of genetic differentiation occurs between Botryphallus ovummuscae, Setia alexandrae, S. ermelindoi and rissoids included in the phylogenetic analyses. For the first time, a representative of the genus Botryphallus – B. ovummuscae – was included in phylogenetic analyses of the family Rissoidae. Several indels along the sequences of the three markers analysed were detected exclusively in B. ovummuscae, but not in the other rissoids in study. High levels of genetic divergence between this species and the other genera of Rissoidae – 26-30% in the COI marker, 29.5-33.5% in the 16S marker and 10-12% in the 28S marker – were highlighted by the p-distances estimated. Moreover, in all the phylogenies inferred, B. ovummuscae either occupied a basal position or was positioned at the tip of a long branch, thus reflecting major differences in relation to the remaining Rissoidae species. When sequences of this species were analysed resorting to Megablast algorithm, a considerable degree of

FCUP 50 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) similarity with species assigned to family Iravadiidae was detected for the three markers. Even a more sensitive analysis, performed with Blastn algorithm, revealed similarity with sequences of family Iravadiidae but not with rissoids. Considering this, the phylogenetic relationships established between B. ovummuscae and rissoids were not in concordance with the current classification of the family Rissoidae. Therefore, a systematic reclassification of B. ovummuscae is proposed based on COI, 16S rRNA and 28S rRNA sequences and dissimilarity with representatives of the family Rissoidae, supported by the phylogenies inferred.

Because S. alexandrae and S. ermelindoi shared haplotypes, they were treated as a cluster in subsequent analyses. Several indels exclusive from this cluster, some with considerable length, were detected in COI and 28S rRNA alignments. These indels contribute to the high degree of genetic divergence between cluster ‘Setia’ and rissoids in study, reflected on the exceptionally high values of p-distances inferred for COI and 28S markers – 32-35% and 27-27.5%, respectively. In COI and 28S phylogenetic trees, this cluster was positioned at the tip of a long basal branch, undeniably denoting major differentiation of this taxa relatively to the family Rissoidae. BLAST searches for the mtDNA COI gene revealed unsupported similarities with insect or spider genera to all the sequences, but a more sensitive analysis with Blastn algorithm showed homology to mollusc species. COI gene has been used as the standard barcode for most animal groups and in most cases provides reliable identifications at the genus or species level (Hebert et al., 2004). Still, the correct assignment of the sequences being analysed to a particular group of organisms, based on the homology search performed by BLAST algorithms, depends on the sequences deposited on the database. Although Tenellia sp. and Siphonaria sp. sequences deposited in NCBI database are the most similar to S. alexandrae and S. ermelindoi for the COI marker, the BLAST search performed for nDNA 28S rRNA marker revealed affinities with Philine grandioculi. Nuclear markers are, usually, more conserved than mitochondrial genes, thus older relationships are easily retrieved (Patwardhan et al., 2014). Similarity between cluster ‘Setia’ and Rissoidae sequences were not inferred; plus, the homology with other molluscs’ taxa, although with low to moderate identity, support that major differences exist between cluster ‘Setia’ and other members of the family Rissoidae. All these observations suggest that cluster ‘Setia’ should not be considered within the family Rissoidae. Cordeiro and Ávila (2015) highlighted the resemblance of the shell shape of S. ermelindoi and that of some Rissoella Gray, 1847 species. Although the authors discarded the hypothesis of the new taxa described being a new species of the genus Rissoella, due to marked morphological differences, this idea was tested in the present work.

FCUP 51 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Raw (p) distances between sequences of 28S of S. alexandrae, S. ermelindoi and representatives of the genus Rissoella deposited at NCBI database – Rissoella elongatospira (Accession number: FJ917232) and Rissoella rissoaformis (Accession number: FJ917226) – were calculated. Divergence levels of approximately 16% were estimated between the two Rissoella spp. retrieved from NCBI database, whereas 19- 20% divergence was detected between them and cluster ‘Setia’. The latter p-distance levels reflect a considerable differentiation between cluster ‘Setia’ and Rissoella spp., higher than that inferred between the two species of Rissoella tested. No further inferences could be made regarding the systematic position of ‘Setia’ lineage, as molecular data of COI and 16S genes from Rissoella spp. is not available.

IV.3. Phylogenetic relationships within the family Rissoidae

Phylogenetic analyses performed for Rissoidae taxa, excluding Botryphallus ovummuscae and cluster ‘Setia’, revealed the existence of two major groups consistent in the three markers analysed and supported the monophyly of the family Rissoidae. Within Group I were comprised several representatives of the genus Alvania in polyphyly, as recognized by Criscione et al. (2016), and this genus was characterized by high values of p-distance among its elements, reflecting high intrageneric genetic variability. The type species of Alvania – A. cimex – included in the 28S dataset, formed a well- supported subclade within Clade A, comprising A. formicarum, A. mediolittoralis, A. sleursi and A. subcrenulata. The degree of genetic differentiation between A. formicarum and A. mediolittoralis in COI and 28S markers was low (3% and <1%, respectively). This scenario might be an indicator of a current divergence between these lineages occupying mostly shallow-waters (Cordeiro et al., 2015). The first species is endemic to the Azores and the second is believed to have initially speciated in the Azores and later dispersed to Madeira (Ávila, 2013), probably in recent times, providing a possible explanation for these low values of genetic distinctness. C. trifasciata, the type species of Cingula (Fleming, 1818), was positioned within Clade B in all phylogenies inferred and Alvania tenera was observed as sister species to C. trifasciata in the phylogenies of both rRNA genes. All the previous relationships were in concordance with the ones inferred by Criscione et al. (2016) in the most comprehensive phylogenetic study of the family Rissoidae to date. According to Criscione et al. (2016), the subclade comprising the type species is the one that truly represents the genus Alvania. Thus, species within Clade A in the phylogenetic trees inferred for rRNA genes, closely related to Alvania cimex, can be considered true representatives of this genus. Nevertheless, such deductions must be

FCUP 52 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) approached with caution, as the inclusion of sequences of a specimen assigned to a type-species of a genus does not guarantee it is indeed a true representative of that taxon (e.g., misidentification of the specimens). This approach can only be performed with total confidence if the holotype, or at least the paratypes, are the specimens from which DNA is extracted and sequences posteriorly used in phylogenetic analyses. Alvania angioyi was depicted as closely related to the subclade containing A. discors, A. lanciae, A. lineata and A. scabra in the phylogenies of rRNA genes. Some controversy is associated with the classification of the latter four species and some doubts whether they are members of the genus Alvania remain, as they form a distantly related lineage in relation to other Alvania spp.. Criscione et al. (2016) treated these species with caution, considering that this subclade could be reclassified as Alvaniella Sacco, 1895, for which A. scabra is considered the type species. Plus, A. lineata is the type species of Alvanolira Nordsieck, 1972 and was included in the subclade, therefore it might also be denominated accordingly. In spite of that, these were mere suggestions proposed by Criscione et al. (2016) and no formal attempt to reclassify these species has been performed yet. This subclade should, indeed, be reviewed carefully in a detailed phylogenetic study using more representatives of each nominal species included within it. On the other hand, representatives of the genus Crisilla – C. postrema and C. beniamina – were evaluated and positioned as sister species to A. angioyi. The degree of genetic divergence of Crisilla spp. was approximately the same in the pairwise comparisons with A. angioyi and Cingula trifasciata, for COI (14-15%) and 16S (12-15%) markers. Nonetheless, in the 28S marker a discrepancy in the degree of genetic differentiation between these species was detected, as 3-4% divergence was displayed between C. postrema and C. trifasciata, but only 1.5% divergence between C. postrema and A. angioyi. The relationships established among these taxa were concordant and well supported in all phylogenies. Until the taxonomic review of the family Rissoidae was published, the type species of Crisilla – C. semistriata (Montagu, 1808) – had been considered a subgenus of Alvania due to morphological similarities (Gofas, 1990; Ponder, 1984a). Group II comprised Pusillina spp., Rissoa spp. and Setia spp. within Clade C in all phylogenies inferred, which is concordant with clade E detected by Criscione et al. (2016). As in the work by Criscione et al. (2016), two subclades were perceived both in ML and BI phylogenetic trees. A first subclade comprised only Rissoa guernei, R. auriscalpium and some haplotypes of S. subvaricosa in the COI phylogenetic tree, but also R. ventricosa – the type species of the genus Rissoa – R. guerinii, R. membranacea (J. Adams, 1800), R. monodonta (Philippi, 1836) and Setia ambigua in the 28S

FCUP 53 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) phylogeny. While some haplotypes of S. subvaricosa were grouped together with R. guernei as belonging to the same taxon in all the three phylogenies, the remaining haplotypes of this taxa occupied different positions in the trees; whether in a basal position (COI phylogeny) or included within Clade C (rRNA phylogenies). The genetic divergence between these haplotypes and the ones associated with R. guernei are of the same magnitude as the differentiation of S. subvaricosa compared to the other rissoids studied. In the 28S phylogeny, S. ambigua was more closely related to Rissoa spp. than to haplotypes of S. subvaricosa, as reflected in the degree of genetic divergence (1-2% between S. ambigua and Rissoa spp., 5.7% divergence with S. subvaricosa). Morphologically, S. ambigua displays a smooth, elongate conical, transparent shell similar to the shell of other species assigned to the genus Setia, but with accentuated differences regarding the shell of the type species S. pulcherrima Jeffreys, 1848 (Criscione et al., 2016). Morphological and molecular distinction of S. ambigua relatively to other Setia spp. and close relationships with Rissoa spp. denoted in the phylogenies, might suggest the need of a taxonomic revision of this taxon, as stated by Criscione et al. (2016). The second subclade observable in COI and 28S phylogenies comprised Rissoa lia and Pusillina spp., none of which is the type species of its genera. The taxonomic position of R. lia among representatives of the genus Pusillina was well supported by ML and BI analyses, as well as by low genetic divergence estimated, which might call for the need to review the systematic position of this taxon or confirmation of the specimen’s classification, as it might constitute a case of misidentification. In the 16S phylogeny, Group II was not fully resolved, appearing as a trichotomy encompassing several Rissoa spp. and representatives of the genus Pusillina, probably contributing for the low support of the splitting event and most relationships established within this group. Therefore, low confidence was attributed to these inferences. On the light of the results obtained throughout the present work, it becomes clear that a meticulous revision of relationships established within the family Rissoidae and taxa comprised within Groups I and II is required. Particularly, the polyphyly of the genus Alvania emphasise the need to review it, as distinct lineages are currently classified under the same nominal classification and relationships are established between some of its representatives and other genera.

When contrasting these phylogenetic relationships with the phenogram inferred by Ponder (1984a) based on 51 morphological characters, the discrepancies in the relationships established among genera become clear. Ponder’s (1985) phenogram is based on the similarity of several morphological characters of rissoids, which does not

FCUP 54 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) necessarily reflect evolutionary relationships, as the similarities among different genera might be a result of morphological convergence of distinct evolutionary lineages through time (Speed and Arbuckle, 2017).

IV.3.1. Are they the same species?

In the present study, some pairs of taxa – Alvania cimex and A. geryonia, Pusillina inconspicua and P. sarsii, Rissoa auriscalpium and R. guerinii – were clustered together, showing low genetic diversity in pairwise comparisons. Erroneous identification of the specimens might be in the origin of these curious associations of two distinct species. Also, some mollusc species present accentuated phenotypic variability of the shell morphology [e.g., Littorina saxatilis (Panova et al., 2011)], in a way that different forms are classified as different species when first described. Usually, differences in phenotypic characters within the same species do not reflect differences with taxonomic importance to distinguish evolutionary lineages. Incongruences in species’ identification based in morphological and molecular data are common in molluscs and detailed integrative studies are advised in order to enlighten the systematic position of discordant cases (Borges et al., 2016). Both hypotheses aforementioned might explain these associations, but could not be tested throughout this work, as many of the sequences of the species involved were retrieved from NCBI database and no individuals were directly manipulated and identified in this work.

The association of Rissoa guernei and some haplotypes of Setia subvaricosa as the same taxon was the only that could be analysed in further detail, as the sequences used in phylogenetic analyses were obtained from individuals collected for this study. In pairwise comparisons inferred for all datasets, the divergence between the haplotypes of these species was lower than 0.5%, indicating high molecular similarity among them. Similarities in the shell morphology of representatives of S. subvaricosa that were grouped within R. guernei (Figure IV.1b) and the ones that form a distinct group (Figure IV.1c) are easily perceived, particularly in the smooth texture and coloured striations. The same colour pattern is observed in R. guernei (Figure IV.1a), although the colours are usually more faded and interposed with short, thickened and elevated axial ribs observed in major whorls. The most striking difference between the shell of S. subvaricosa that were placed within R. guernei and the remaining representatives of the species is the shape of the posterior apertural notch, which is very developed with a slight elongation in the first representatives of S. subvaricosa. Erroneous identification of the specimens, given the most current and widely used taxonomic concepts of Rissoa and Setia genera, is unlikely to have happened, as the

FCUP 55 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) taxonomic classification was performed and checked by researchers with wide expertise in molluscs’ morphology. If R. cf. guernei (identified as S. subvaricosa) does not belong to the genus Setia, as suggested by molecular similarities detected in this work, a possible explanation for the morphological differences is hereby proposed: R. guernei (Figure IV.1a) displays sexual dimorphism in which the shell shape of one of the sexes (Figure IV.1b) resembles morphological characteristics of S. subvaricosa (Figure IV.1c), thus challenging the correct identification of these species. Gofas (1990) already proposed the manifestation of sexual dimorphism in R. guernei based on the differences observed in the posterior apertural notch: the outer lip is normally inserted in males with well-developed penis, whereas the notch occurs on females and individuals with under- developed penis. Accordingly, individuals identified as S. subvaricosa that showed molecular affinities with R. guernei should be designated as Rissoa cf. guernei until this hypothesis is confirmed.

Figure IV.1 – Shell shape characteristics of Rissoa guernei and Setia subvaricosa. a) Rissoa guernei. Apertural view; b) Rissoa cf. guernei. Apertural view; c) Setia subvaricosa. Apertural view.

IV.4 Species tree reconstruction and estimation of divergence times

IV.4.1. Inference of the species tree

Species tree reconstruction is possible by several phylogenetic methodologies, some requiring concatenation of molecular data. BI analyses provide a distribution of trees which are likely to reflect the evolutionary history of the taxa analysed considering the combined alignment, a set of priors and likelihood function (Ogilvie et al., 2017). Contrariwise, when applying ML methods to the inference of a species tree based on

FCUP 56 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) concatenated sequences, a single species tree that best fits the combined alignment will be estimated according to the phylogenetic likelihood function (Felsenstein, 1981; Ogilvie et al., 2017). Inferences drawn from likelihood-based concatenation have been associated with inconsistent results, by assigning high confidence levels to unsupported nodes due to model misspecification or long-branch attraction (Liu et al., 2015; Ogilvie et al., 2017), and systematic errors on the estimation of branch lengths and divergence times due to by incomplete lineage sorting phenomenon (Ogilvie et al., 2017, 2016). Splits and branches that don’t occur in the species tree can be defined in gene trees, if their topology is discordant. Substitution produced by incomplete lineage sorting can occur in those branches, which frequently results in homoplasy in the species tree, causing the erroneous estimation of the branches’ lengths either by over/underestimation and reflecting a non-existent substitution rate (Mendes and Hahn, 2016; Ogilvie et al., 2017). Regarding the branch lengths or topology, trees inferred with concatenated datasets are unlikely to constitute reliable reconstructions of the species trees (Ogilvie et al., 2017). Therefore, StarBEAST2 framework (Ogilvie et al., 2017) was chosen to infer the Rissoidae species tree, as it is a fully Bayesian multispecies coalescent method that provides a reliable estimation of several parameters by embedding each gene tree within a single shared species tree. Four calibration points based on the fossil record of Santa Maria Island were defined as the minimum age of the clades to which they were assigned, as recommended for species tree reconstruction analyses (Forest, 2009; Parham et al., 2012). Moreover, fossil age estimates follow the most recent literature available for the fossil taxa in question (Ávila et al., 2015c, 2009b; Cordeiro et al., 2015; Ramalho et al., 2017), ensuring that the temporal placement of the lineage in the phylogenetic analyses was accurate according to the most recent and valid knowledge (Parham et al., 2012). The low number of fossil calibration points and their inference from fragmented fossil record of an island are not considered ideal to reconstruct a species tree (Parham et al., 2012). However, useful information to calibrate a phylogenetic tree with the taxa analysed is only available in Santa Maria Island, the only with fossiliferous outcrops in the archipelago. The age estimated for older split events is associated with lower confidence levels, even in nodes that were previously calibrated. This scenario might be a consequence of discrepancy between the placement of the calibration point and its true position in the phylogeny, as the further the calibration point is assigned relatively to the node of interest, the greater the uncertainty associated with the estimations (Forest, 2009). Nevertheless, the divergence dates and relationships proposed by the species tree obtained seem reasonable based on the geological history of the Azores

FCUP 57 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Archipelago, worldwide fossil record of the family Rissoidae and the evolutionary history revealed by mtDNA COI and 16S plus nDNA 28S phylogenies.

IV.4.2. Evolutionary history of the family Rissoidae in the Azores Archipelago

The lineage that later originated Alvania angioyi, A. formicarum, A. mediolittoralis, A. sleursi, Cingula trifasciata, Crisilla postrema, Rissoa guernei and Setia subvaricosa, first started to diversify during the Early Miocene, ca. 17.52 Ma. The timing estimated for this split event is in agreement with the fossil record of rissoids worldwide, as Rissoidae-like organisms appeared during the Lower Jurassic (Conti et al., 1993; Criscione and Ponder, 2013; Criscione et al., 2016) and some genera were already diversified in the Central Paratethys during the Miocene (Kowalke and Harzhauser, 2004). Several split events were estimated with different confidence degree in the species tree reconstructed, but as the present work constitutes a phylogenetic study, split events reflect the timing of divergence of the lineages that later originated modern assemblages, and not the time of arrival of rissoids or their ancestrals to the vicinities of Azores Archipelago.

IV.4.2.1. Occurrence of endemic and non-endemic rissoid species in the Azores Archipelago In general, a biogeographical paradox occurs in the Azores Archipelago (Ávila, 2013, 2000b) – the “Azorean Biogeographic Paradox” – where strong biogeographic affinities between the Azores and Mediterranean/Eastern Atlantic are detected in recent and Pleistocene (MIS 5e) shallow-water marine molluscs, including rissoids, notwithstanding the prevailing eastward flow of the current systems (Ávila, 2013, 2005, 2000b; Ávila et al., 2015c). Despite the similarity with Mediterranean/European shores, most of the shallow-water rissoid species found in the Azores Archipelago are endemisms. Alvania is the most diversified genus, comprising nine species of which only three are not endemic (Cordeiro et al., 2015). The Azorean endemic Rissoidae are probably autochthonous descents of organisms that reached the archipelago in the past, as no evidences of a former broader geographic distribution of these species are recorded in the fossil record of insular or continental outcrops (Ávila et al., 2012a; Mironov and Krylova, 2006). Considering these biogeographic affinities, it is plausible to assume that ancestrals of most rissoid species currently found in the Azores Archipelago might have been originated in the Mediterranean region. The Mediterranean basin is believed to have acted as a “centre

FCUP 58 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) of marine fauna redistribution”, where accumulation, speciation and dispersal of new taxa took place during the Cretaceous and Paleogene (Mironov and Krylova, 2006; Mironov, 2006). Such processes likely happened to the family Rissoidae, contributing to the diversity observed within the family in Central Paratethys during the Miocene, ca. 17 Ma (Kowalke and Harzhauser, 2004). The considerable number of Rissoidae endemisms (41.2%; new calculations1) can be explained by the arrival of an ancestral with Mediterranean/European origins to the Azores or vicinities and later speciation into several new congeneric species, as proposed by Ávila (2005) and observed in Meteor Seamounts by Gofas (2007) (cf. IV.4.2.2 for further details on the ancestrals and IV.4.2.3 for the routes of colonisation). This scenario was already described for Alvania, Crisilla, Onoba, Pusillina, Rissoa and Setia genera in the Mediterranean Sea; Manzonia and Crisilla genera at Madeira, Selvagens and Canary Islands and genus Cingula at Saint Helena Island, among other examples (Ávila et al., 2012a). The polyphyly of Alvania spp. in molecular phylogenies and species tree might be suggestive of a process similar to a radiation of an ancestral in the Azores. Another possible explanation for the high number of Azorean endemisms would be the occurrence of several colonisation events by ancestrals that originated a new species without radiating (Ávila, 2005). This might be the case of R. guernei, closely related to other European Rissoa spp., as determined by molecular phylogenies, and member of a genus only represented by two species in the archipelago (Cordeiro et al., 2015). Therefore, two distinct mechanisms leading to speciation of the family Rissoidae in the Azores Archipelago might have acted concomitantly in the past, originating modern-day endemic rissoids as Alvania angioyi, A. formicarum, R. guernei and Setia subvaricosa (included in the species tree reconstruction). The remaining Rissoidae species included in the species tree reconstruction are not endemic to the archipelago: Alvania mediolittoralis, A. sleursi and Crisilla postrema are found in relatively shallow-waters of the Azores and Madeira archipelagos, Cingula trifasciata is a widespread rissoid reported for Scandinavia, British Islands, Portuguese shores, Mediterranean Sea and Azores Archipelago. The following rissoids are also reported for several locations in the NE Atlantic Ocean and Mediterranean Sea: A. cancellata is the third and last non-endemic Alvania sp. found in the NE Atlantic Ocean and Mediterranean Sea, as Pusillina inconspicua; Crisilla iunoniae and Rissoa mirabilis in the Azores, Madeira and Canary Islands, Setia quisquiliarum in the Azores and Canary Islands and S. ambigua also in the Mediterranean Sea (Cordeiro et al., 2015). Possible

1 New calculations excluding Botryphallus ovummuscae, Setia alexandrae and S. ermelindoi (following the results obtained in this study), plus Zebina paivensis and Merelina tesselata [according to the new classification scheme proposed by Criscione et al. (2016)]. 14 Azorean endemisms out of 34 rissoid species reported for the Azores.

FCUP 59 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) explanations for the presence of widely distributed species in the Azores Archipelago are provided in IV.4.2.2.

IV.4.2.2. Influence of the mode of larval development in the colonisation of remote areas by Rissoidae In isolated oceanic islands located far from potential colonisation sources, as the Azores Archipelago, it would be expected to find a high proportion of planktotrophic species relative to species with non-planktotrophic larvae (Ávila et al., 2009a). This scenario is observed when considering the total modern-day molluscs’ assemblages in the Azores Archipelago (Ávila et al., 2009a). Nonetheless, this trend is not detected in the family Rissoidae: all the species reported for the Azores Archipelago display non- planktotrophic larvae, except Alvania cancellata which is widely distributed (Ávila, 2005). The unbalance between the modes of larval development of rissoids in the Azores Archipelago and other oceanic islands might be explained by the easy shift in larval life- strategy during the speciation process (Ávila, 2013, 2006, 2005). In view of that, after successfully reach and colonise a new isolated location, the shift from planktotrophic to non-planktotrophic larvae provides evolutionary advantages by hampering the dispersal of larvae to open-water, far from the suitable conditions of a submarine seamount or island. Later, the ancestral rissoids speciated into a new taxon or suffered in situ adaptive radiation to originate several new species, all with non-planktotrophic larvae (Ávila, 2005).

Planktotrophic rissoid species with broad distributions The capability of relatively long-distance dispersal by Alvania cancellata is supported by its wide distribution through the Mediterranean Sea and NE Atlantic Ocean and observation of transient populations in the Lusitanian Seamounts (Gofas, 2007). The broad distribution range of this planktotrophic species is expected, as a free-swimming larval stage facilitates dispersal and colonisation of new areas (Scheltema, 1995, 1989, 1986a). A. cancellata reported to the Azores Archipelago are believed to be conspecific with the taxon occurring in Mediterranean/European shores, though some minor morphological distinctions can be pointed out on Azorean specimens (Gofas, 1990). Specimens of A. cancellata are also found in Pleistocene (MIS 5e) sediments of Santa Maria Island (Ávila, 2005; Ávila et al., 2009b; Cordeiro and Ávila, 2015). Considering this scenario, one can assume that a stable population of the planktotrophic A. cancellata was established in Santa Maria Island before the last interglacial episode.

FCUP 60 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Non-planktotrophic rissoid species with broad distribution The wide distribution range of non-planktotrophic littoral species is not expected to be observed often, as the absence of a free-swimming larval stage lowers dispersal abilities (Scheltema, 1995, 1989, 1986a). Despite this expectation, some non-planktotrophic littoral rissoids also reported for the Azores Archipelago can be pointed out – Cingula trifasciata, Obtusella intersecta and Pusillina inconspicua (Cordeiro et al., 2015). Special attention will be given to C. trifasciata as it was included in species tree inferred, but the hypotheses formulated for this species are likely to be applied to other non-planktotrophic species with similar distribution ranges. The situation of C. trifasciata is curious, as this non-planktotrophic taxon is present in NE Atlantic Ocean and Mediterranean Sea (Cordeiro et al., 2015) and some subtle morphological differences between Azorean and European specimens were pointed out by Gofas (1990). Based on these minor variations, it was suggested that these morphological variants could represent distinct taxa (Ávila, 2005; Gofas, 1990), but genetic data does not support this idea. A low level of genetic divergence between these lineages was detected in 16S and 28S datasets, which included representatives of C. trifasciata from Northern Ireland (cf. Criscione et al., 2016). The intraspecific divergence between Azorean (hap 1-6, cf. Appendix 3; hap 1-2, cf. Appendix 4) and Irish (hap 7, cf. Appendix 3; hap 3, cf. Appendix 4) representatives was slightly higher (1.2-2.1% in the 16S dataset and 0.4% in the 28S dataset) than the genetic differentiation among Azorean haplotypes (<1.6% in the 16S dataset and 0% in the 28S dataset), but according to the current knowledge on molecular data from the family Rissoidae it is not sufficient to distinguish them as species or subspecies. In the fossil record of Santa Maria, C. trifasciata is only found in recent sediments dated from the MIS 5e but not in older outcrops (Ávila et al., 2015c). Therefore, it is acceptable to interpret the low genetic differentiation and fossil record as indicatives of a relatively recent colonisation of the Azores Archipelago between the Pliocene and Pleistocene (MIS 5e), through mechanisms that are still under debate (cf. IV.4.2.3.). The time period elapsed until present-days is unlikely to have been enough to cause the differentiation of Azorean and Mediterranean/European forms. Moreover, the low genetic divergence might be indicative of the beginning of a divergence process between lineages and probably reflects the few alterations that happened since the first stable populations of C. trifasciata established in the Azores region. The absence of detailed population genetics’ data makes it impossible to confirm if gene flow is maintained between Azorean and non- Azorean populations. It is unlikely that this taxon speciated in the Azores region and later dispersed to its current distribution range for a few reasons: (1) the split event of this

FCUP 61 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) lineage was estimated to have happened 7.67 Ma and by this time Santa Maria had not emerged yet; (2) fossils of this species are not found in older sediments, so even if populations were present in Santa Maria by that time, they would not be numerous, thus decreasing the possibility of a successful dispersal and colonisation of new areas; (3) the time period of 120-130 ky, to which fossils are assigned indicating stable populations of C. trifasciata in Santa Maria Island, is unlikely to have been sufficient for the current successfully widespread dispersal. P. inconspicua is another non-planktotrophic rissoid species with broad distribution out of the Azores Archipelago, but since sequences of Azorean specimens were not obtained in this study it was not possible to ascertain the degree of genetic differentiation between Azorean and Mediterranean/European lineages. Nevertheless, and taking palaeontological history in Santa Maria into account, it is likely that a process of colonisation of the Azores regions by P. inconspicua also happened between the Pliocene and Pleistocene (MIS 5e), identically to the scenario proposed for C. trifasciata.

Non-planktotrophic rissoid species distributed in Atlantic archipelagos Several examples of littoral rissoids present in nearby Atlantic archipelagos exist – Alvania mediolittoralis, A. sleursi, Crisilla iunoniae, C. postrema, Rissoa mirabilis and Setia quisquilarum (Cordeiro et al., 2015). The case of C. postrema will be looked in detail, as this taxon was included in the species tree reconstruction. The suppositions regarding this species can probably be generalised for non-planktotrophic species with similar distribution ranges. The geographical distribution of A. mediolittoralis and A. sleursi, also included in the species tree, will be further analysed in detail (cf. IV.4.3.). C. postrema is a non-planktotrophic rissoid currently present in the Azores and Madeira archipelagos and reported for Pleistocene (MIS 5e) outcrops of Santa Maria (Ávila et al., 2015c; Cordeiro and Ávila, 2015). Plus, the species tree reconstruction places this taxon together with the endemic non-planktotrophic Alvania angioyi (which is also observed in the 28S gene tree and, to some extent, in the COI gene tree). Considering this close relationship, supported by molecular data, one can propose that this species originated in the Azores region and successfully colonised Santa Maria Island between the Pliocene and Pleistocene, as it is not observed in older sediments. Throughout times, the Azores might have acted as a source for dispersal of C. postrema to Madeira, where it is found nowadays (Cordeiro et al., 2015) but not in its fossil record. The dispersal of individuals between archipelagos probably happened by rafting of egg- masses, juveniles or adults attached to floating materials (e.g., algae), the process most commonly accepted to explain long-distance dispersal of non-planktotrophic small-sized

FCUP 62 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) organisms. The dispersal of these materials by sea currents allowed rissoids to be rafted along, eventually reaching another archipelago (Ávila, 2013; Scheltema, 1986a) (cf. I.5.2). The idea of Madeira as a source area for the colonisation of the Azores by C. postrema was discarded for several reasons: (1) specimens of C. postrema are not found in the fossil record of Madeira or surrounding territories (Ávila 2016, pers. comm.); (2) it would be expected earlier dispersal of individuals to nearby regions as Canary Islands or the North of Africa, separated of Madeira by a relatively short distance, but there are no reports of the existence of this species in areas other than the Azores and Madeira (Cordeiro et al., 2015); (3) shallow-water habitats nearby Madeira are likely to be similar to those in this archipelago, due to geographical proximity and similarity of the climatic conditions, so unsuitability of habitat cannot be pointed out as a reason for the absence of C. postrema in nearby landmasses. This idea is supported by Crisilla iunoniae and R. mirabilis, which are reported for the Azores, Madeira and Canary Islands, probably with the first archipelago acting as a source region to the remaining two.

IV.4.2.3. Possible colonisation routes of the Azores Archipelago by rissoids The “Azorean Biogeographic Paradox” constitutes the main difficulty in explaining the mechanisms by which rissoids and other molluscs first reached the Azores (Ávila et al., 2012a, 2009a) and, also, the Southern Azores Seamounts Chain (SASC) (Mironov and Krylova, 2006). Hereafter, a hypothesis aiming to enlighten possible colonisation routes by the family Rissoidae will be provided, based on the current knowledge and results obtained in this work. From the Cretaceous (ca. 145-66 Ma) until the end of the Paleogene (ca. 24 Ma), circumglobal tropical current flowing westward was established in the globe, passing by the Tethys Seaway and Panama Straits and favouring transport of organisms in that direction (Barron and Peterson, 1989; Haq, 1981). The beginning of the closure of the Isthmus of Panama started ca. 24 Ma (O’Dea et al., 2016), causing a reversal in the direction of transport through the Panama Strait and inducing easterly flow (Omta and Dijkstra, 2003). In Middle Miocene, the closure of the Tethys Seaway took place causing the restriction of the Tethys Current and later forming the Mediterranean basin as we know it today (Ávila, 2005; Haq, 1981). After these geological and oceanographic events, the present-day patterns of oceanic circulation in the NE Atlantic Ocean were established and are believed to have been maintained almost unaltered since the complete closure of the Isthmus of Panama, ca. 3.2 to 2.76 Ma (Ávila, 2005; O’Dea et al., 2016).

FCUP 63 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Two possible explanations for the biogeographic affinities observed in the family Rissoidae between the Azores Archipelago and Mediterranean Sea (Ávila, 2005, 2000b; Ávila et al., 2015c, 2012a, 2009a) have already been proposed: (1) range expansion of Mediterranean/European/west African species during glacial terminations, during which short-lived currents flowing westward and northward were established; (2) instability of the current system associated to the Azores Archipelago with the formation of eddies and meanders favouring west and northward transport of Mediterranean/Atlantic fauna, plus two annual oscillations in the typical current regime during which prevailing currents flow northwestward from Africa and/or Madeira to the Azores Archipelago. Another justification for the biogeographical patterns in the Azores regards to the role of seamounts in processes of speciation and dispersal of shallow-water marine molluscs. The probable role of the Lusitanian group of seamounts, located between Portugal mainland and Madeira Archipelago in such processes during Pleistocene glacial periods, has already been stressed by some authors (Ávila and Malaquias, 2003; Ávila, 2005; Ávila et al., 2016, 2009a; Brenke, 2002; Gofas and Beu, 2002; Gofas, 2000, 1992; Mironov and Krylova, 2006). Despite these suggestions, the potential importance SASC in these biological processes in the middle of the NE Atlantic Ocean have been underestimated in previous studies. Thus, a fourth possible explanation will be hereafter described, considering past current regime in the NE Atlantic Ocean, the origin and geological features of the Azores Archipelago and vicinities and, finally, the role of nearby seamounts in the dispersal of rissoids (and littoral benthic fauna in general) to the middle of the Atlantic Ocean. Until Early Miocene, the predominant direction of the sea currents was westward, as the Tethys Seaway was still opened and the long-term process of the closure of the Isthmus of Panama was only beginning, thus facilitating the dispersal of Mediterranean/European species by rafting or pelagic larvae in that direction (Ávila et al., 2009a). By that time, neither the Azores plateau (ca. 20 Ma) nor islands existed in the NE Atlantic Ocean, though the Cruiser plateau (ca. 50-76 Ma) and several seamounts attributed to SASC were already formed or being formed in the middle of the ocean. Seamounts and islands, when formed, are empty habitats, and dispersal of benthic organisms is required for their colonisation (Gofas, 2007). Plus, considering variations in the sea level through times and the intrinsic geological features of these elevated structures, it is probable that some of these seamounts had been emerged in the past (e.g., Great Meteor, Hyéres, Irving, Atlantis guyots), forming true islands (Ávila et al., 2016, 2009a). Even though many extant rissoid species were not able to settle in the present-day Azores region, the once

FCUP 64 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) empty older seamounts and islands might have provided suitable habitats for benthic littoral populations to be established. Nowadays, the Great Meteor Seamount is positioned exactly in the centre of the outflow water from the Mediterranean Sea (Brenke, 2002). If the general trend in the area was the same until Early Miocene, the seamounts in this area would also be influenced by Mediterranean waters, probably transporting rissoids and other molluscs westwards from the continental shelf to the shallow-waters in this NE Atlantic region (Brenke, 2002; Mironov and Krylova, 2006). It is accepted that marine gastropod larvae can survive for long-time periods in open-sea (Scheltema, 1986a, 1978, 1977) and, under the present-day sea current regime, larvae can cover the distance between Madeira and the Azores Archipelago (840 km) in 40 to 60 days (Brenke, 2002). Due to the considerable distance between the Strait of Gibraltar and SASC (approximately 2,000 km), it is plausible to assume that the first rissoids reaching and successfully colonising the shallow-waters in these region to have had planktotrophic larvae (cf. IV.4.2.2), and the time necessary for the transport would probably be relatively short, as the associated sea current system would accelerate dispersal. Moreover, some non- planktotrophic species might have reached the shallow-waters in the middle of the Atlantic Ocean by chance events, with rafting being facilitated by the prevailing currents. The first split event between some rissoid species currently inhabiting Azorean waters was estimated to have happened 12.82 to 23.17 Ma. If one considers that this divergence already happened in the middle of the Atlantic Ocean, then the only landmasses present there by that time would be SASC seamounts and islands that no longer exist today. These elevations might have successfully received migrants of littoral benthic species from Mediterranean/European shores, where the family Rissoidae was already diversified (Kowalke and Harzhauser, 2004). These migrants likely took advantage of the prevailing currents regime in the Palaeo-Atlantic Ocean to reach the SASC and later speciated in the area. Nevertheless, it is important to stress that these estimations refer to the divergence of lineages, not to colonisation events, and only broad assumptions can be made regarding the timing of establishment of stable population of ancestrals. The formation of the Azores plateau started ca. 20 Ma, almost contemporaneously with the reversal of flow in the North Atlantic Ocean, and volcanism in the area created a possible structural continuity in the seafloor between this plateau and SASC, where relatively shallow and residual topography is detected (Gente et al., 2003). If rissoid species had already reached the SASC through the old westward flow, it would be easier for some individuals to reach the Azores plateau, even under prevailing eastward flow. Changes in the sea level and formation of shallow-water structures between the two

FCUP 65 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) areas probably contributed for the creation of additional shorelines and submarine shelves (Ávila et al., 2016) that might have acted as stepping-stones for intertidal and subtidal/circalittoral rissoids. Non-planktotrophic species are usually restricted to narrower areas, occupying only a few nearby seamounts, but by chance are able to reach other islands or seamounts (Ávila, 2005; Gofas, 2007), especially if the distance between the source and sink is reduced by the existence of stepping-stones in between. Looking at the geographical position of SASC and Azores plateau and short distances between some landmasses (Figure IV.2), it becomes evident the potential role of seamounts in creating additional nearby shorelines adequate for shallow-water rissoids to establish viable populations and disperse to the Azores Archipelago, using these elevations as stepping-stones.

Figure IV.2 – Geographical setting of the Azores plateau and Southern Azores Seamounts Chain in the Northeast Atlantic Ocean. The Great Meteor, Hyéres, Irving and Atlantis seamounts are identified as structures with smooth, flat- topped topography – guyots – with relatively shallow summits (approximately 200-400 m depths). The distance between nearby guyots, Santa Maria Island and the Strait of Gibraltar is depicted. Bathymetry of the region was retrieved from EMODnet Bathymetry Consortium (2016): EMODnet Digital Bathymetry (DTM) [http://doi.org/10.12770/c7b53704-999d- 4721-b1a3-04ec60c87238], on August 2017.

FCUP 66 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

IV.4.3. Testing the theoretical hypothesis

A link among mode of larval development, geographical distribution, bathymetry/ecological zonation and evolutionary times, considering rafting the main mechanism of dispersal of epibenthic intertidal and shallow-water non-planktotrophic marine species to oceanic islands, was first suggested by Ávila (2013, 2006). Accordingly, some assumptions were established: (1) the deeper a species inhabit, the lower the probability of those species being rafted; (2) species inhabiting shallower waters are expected to have wider geographic distribution ranges than those inhabiting deeper waters. All the aforementioned variables were combined into a theoretical hypothesis attempting to explain the simultaneous existence of congeneric non- planktotrophic species, only differing in their bathymetrical range, in two nearby archipelagos. In order for this scenario to occur, it is expected the species inhabiting deeper waters to be longer-lived, in a geological sense, than the one occupying shallower waters (Ávila, 2013). The practical implications of this theory were confirmed by ecological data and palaeontological observations in Santa Maria Island. Throughout this study, the theoretical hypothesis was tested using molecular data to reconstruct the evolutionary history of Rissoidae species in the Azores Archipelago. Within the species tree inferred, Clade B must be emphasized to test this hypothesis, as it comprises two non- planktotrophic species that are found in the fossil record of Santa Maria Island supporting the theory – Alvania mediolittoralis and A. sleursi. The divergence between the lineages that originated A. sleursi and the shallow-waters species was estimated to have happened 4.13 to 4.8 Ma. By this time, the volcanic edifice of Santa Maria Island is believed to have been under a period of waning volcanism, erosion and subsidence, which led to the formation of a guyot (Ramalho et al., 2017). Thus, in this time period, Santa Maria’s edifice became a shallow-water sandy shoal probably with some residual islets from former eruptive episodes and where volcanic activity was rare, mostly submarine (Ávila et al., 2012b; Ramalho et al., 2017). A wide variety of marine environments existed in the guyot (Ramalho et al., 2017), yielding diverse organisms typical from open-water marine environments and benthic species from shallower waters, as marine molluscs (Ávila et al., 2015a, 2015d) including A. sleursi. The finding of fossilized representatives of A. sleursi on Pliocene sediments of Santa Maria Island suggests that the divergence of the lineages encompassed within Clade B already occurred in the Azores Archipelago, where A. sleursi was able to establish stable populations long before A. mediolittoralis speciated. The posterior divergence of lineages that originated A. formicarum and A. mediolittoralis is estimated to have taken place ca.

FCUP 67 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

360 ky, during the Pleistocene. Considering that representatives of both these species are found in MIS 5e highstand deposits of Santa Maria Island (Ávila et al., 2015c), the age estimated for the split event leading to their speciation can be accepted and the divergence is believed to have happened in the Azores Archipelago. Nowadays, A. mediolittoralis is commonly found in the intertidal algal turf but can be observed up to depths of 24 m (Ávila, 2013, 2005; Cordeiro et al., 2015), and is detected in Pleistocene (MIS 5e) sediments of Santa Maria Island (Ávila et al., 2015c, 2009a, 2002). By its turn, A. sleursi presently occurs in deeper waters up to 40 m depth, although it is more common on depths of 15-25 m (Ávila, 2013, 2003, 2000a; Cordeiro et al., 2015); fossil specimens dated from the Pliocene [in sediments with ages bounded by lava flows dated 4.78±0.135 and 4.13±0.19 Ma (Ramalho et al., 2017)] and Pleistocene (MIS 5e) can be found in Santa Maria (Ávila, 2005; Ávila et al., 2015c, 2009b; Cordeiro and Ávila, 2015). Both rissoid species present non-planktotrophic larval development and are currently reported for two nearby archipelagos – Azores and Madeira – making them ideal to test the theoretical hypothesis (Ávila, 2013, 2006). According to the main assumptions of the theoretical hypothesis (Ávila, 2013), A. sleursi – the species inhabiting deeper waters – would be less prone to be rafted than A. mediolittoralis – the species occupying shallower waters – which by its turn is expected to have broader geographical distribution. Despite these predictions, both species are currently distributed in the same geographical areas and are thought to have first speciated in the Azores Archipelago and later reached Madeira Islands. The proposal of the Azores Archipelago as a source in the colonisation process of Madeira is based on the evolutionary history inferred and data provided by ecological and palaeontological observations, as both are common species in the Azores, occurring in all islands, and are found in the fossil record of Santa Maria Island but not in fossiliferous outcrops of Madeira Archipelago (Ávila, 2013). The theoretical hypothesis states that a subtidal/circalittoral species is expected to be longer-lived, in a geological sense, than the intertidal species, so that organisms would have enough time to speciate, disperse (probably by rafting, even though subtidal/circalittoral species are less prone to engage this process), settle and successfully colonise another archipelago to widen its geographic range (Ávila, 2013, 2006). The evolutionary history of the family Rissoidae in the Azores Archipelago, particularly Clade B, revealed that the oldest split event (4.34 Ma) is the one leading to the divergence of A. sleursi, which is also a taxon that is found both in older Pliocene and recent Pleistocene (MIS 5e) sediments in Santa Maria’s outcrops. More recently, during the Pleistocene (360 ky), the speciation of the intertidal species A. mediolittoralis

FCUP 68 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic) started in the archipelago. Therefore, the theoretical hypothesis proposed by Ávila (2013, 2006) to explain the simultaneous existence of two congeneric species, differing only in their bathymetrical range, in two nearby archipelagos is hereby confirmed by genetic data, in addition to the support provided by ecological and palaeontological data. Observations in distinct scientific fields – phylogenetics, palaeontology and ecology – increase the robustness of the theory.

FCUP 69 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Chapter V – Conclusions and future perspectives

This work constitutes the first molecular approach to rissoids in the Azores Archipelago, which so far have only been studied at the ecological (Ávila, 2003, 2000a; Ávila et al., 2008b; Cordeiro et al., 2015; Gofas, 2007, 1990), palaeontological (Ávila et al., 2015c, 2009b, 2002) and biogeographical levels (Ávila, 2013, 2006, 2005; Ávila et al., 2012a). Overall, the main objectives of this dissertation were accomplished and the main conclusions are summarized afterwards:

a) Phylogenetic analyses and analysis of genetic divergence revealed that Botryphallus ovummuscae and cluster ‘Setia’, endemic species currently assigned to Rissoidae, are in fact not true members of this family and a review of their taxonomic position is required; b) Molecular phylogenies inferred highlight the need to meticulously review the taxonomic status of most rissoid species and genera; c) The possibility of sexual dimorphism in Rissoa guernei, in which one of the sexes morphological resembles Setia subvaricosa, was proposed on the light of molecular affinities with R. guernei detected on some haplotypes of the latter species; d) The reconstruction of the evolutionary history of eight Rissoidae species found in Azorean waters revealed that divergence among lineages probably started during Early Miocene, ca. 17.52 Ma; e) It was hypothesised that endemic Azorean species originated either by a process similar to radiation of an ancestral in the middle of the Atlantic Ocean or by the arrival and later in situ speciation of an ancestral into a new species, without radiating; f) Theoretical hypotheses, aiming to explain the influence of the mode of larval development in the colonisation of the Azores Archipelago by rissoids and current geographical range, were formulated for three situations: planktotrophic species with broad distributions, non-planktotrophic species with broad distributions and non-planktotrophic species in nearby Atlantic archipelagos; g) The potential role of Southern Azores Seamounts Chain as stepping-stones in the colonisation of the Azores Archipelago by Mediterranean/European/ African ancestrals was hypothesised;

FCUP 70 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

h) The theoretical biogeographical hypothesis proposed by Ávila (2013, 2006), supported by ecological and palaeontological data of the family Rissoidae, was confirmed by genetic data, as the species tree revealed that the speciation of the subtidal/circalittoral Alvania sleursi started ca. 4.34 Ma, and only recently (360 ky) the divergence of the intertidal A. mediolittoralis took place.

Notwithstanding all conclusions withdrawn from this work, there are still some topics that await clarification. Therefore, as future work, molecular analyses should be extended to more species of the family Rissoidae, increasing the sampling coverage and number of marker loci analysed, to enlighten taxonomic status at specific and generic levels and phylogenetic relationships within the family. Furthermore, detailed phylogenetic studies are required to enlighten the systematic position of B. ovummuscae, S. alexandrae and S. ermelindoi. Analyses at the population level should be performed in species that are found far from the Azores Archipelago, to evaluate genetic exchanges between populations and the potential role of SASC as stepping-stones in the colonisation process. Plus, morphological observations of genitalia of R. guernei and R. cf. guernei are necessary to assess the possibility of sexual dimorphism in this taxon.

The evolutionary history of the family Rissoidae in the Azores Archipelago is complex, and the current knowledge needs to be improved with more data in order to clarify the processes and mechanisms underlying the colonisation of this NE Atlantic region by rissoids.

FCUP 71 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

References

Adam, C., Madureira, P., Miranda, J.M., Lourenço, N., Yoshida, M., Fitzenz, D., 2013. Mantle dynamics and characteristics of the Azores plateau. Earth and Planetary Science Letters 362: 258–271.

Akaike, H., 1973. Information Theory and an Extension of the Maximum Likelihood Principle, In: Petrov, B.N. and Csaki, F. (Eds.), Proceedings of the 2nd International Symposium on Information Theory. Budapest: Akademiai Kiado. 267–281.

Albano, P.G., Sabelli, B., Bouchet, P., 2011. The challenge of small and rare species in marine biodiversity surveys: microgastropod diversity in a complex tropical coastal environment. Biodiversity and Conservation 20(13): 3223–3237.

Ávila, S.P., Azevedo, J.M.N., 1997. Shallow-water molluscs from the Formigas islets, Azores, collected during the “Santa Maria e Formigas 1990” scientific expedition. Açoreana 8(3): 323–330.

Ávila, S.P., 2000a. The shallow-water Rissoidae (Mollusca, Gastropoda) of the Azores and some aspects of their ecology. Iberus 18(2): 51–76.

Ávila, S.P., 2000b. Shallow-water marine molluscs of the Azores: biogeographical relationships. Arquipélago Life and Marine Sciences. Supplement 2 (Part A): 99– 131.

Ávila, S.P., Amen, R.G., Azevedo, J., Cachão, M., García-Talavera, F., 2002. Checklist of the Pleistocene marine molluscs of Prainha and Lagoinhas (Santa Maria Island, Azores). Açoreana 9(4): 343–370.

Ávila, S.P., 2003. The littoral molluscs (Gastropoda, Bivalvia and Polyplacophora) of São Vicente, Capelas (São Miguel Island, Azores): ecology and biological associations to algae. Iberus 21(1): 11–33.

Ávila, S.P., Malaquias, M.A.E., 2003. Biogeographical relationships of the molluscan fauna of the Ormonde seamount (Gorringe Bank, Northeast Atlantic Ocean). Journal of Molluscan Studies 69: 145–150.

Ávila, S.P., Cardigos, F., Santos, R.S., 2004. D. João de Castro Bank, a shallow water hydrothermal-vent in the Azores: checklist of the marine molluscs. Arquipélago Life and Marine Sciences 21A: 75–80.

FCUP 72 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Ávila, S.P., 2005. Processos e padrões de dispersão e colonização nos Rissoidae (Mollusca: Gastropoda) dos Açores. x+329 pp. Unpublished Ph.D Thesis, University of the Azores, Ponta Delgada.

Ávila, S.P., Santos, A.C., Penteado, A.M., Rodrigues, A.M., Quintino, I., Machado, M.I., 2005. The molluscs of the intertidal algal turf in the Azores. Iberus 23(1): 67–76.

Ávila, S.P., 2006. Oceanic islands, rafting, geographical range and bathymetry: a neglected relationship, In: Hayden, T.J., Murray, D.A. and O’Connor, J.P. (Eds.), Proceedings of the 5th International Symposium on the Fauna and Flora of Atlantic Islands. Dublin, 24-27 August 2004. Occasional Publication of the Irish Biogeographical Society: 22–39.

Ávila, S.P., Madeira, P., Mendes, N., Rebelo, A.C., Medeiros, A., Gomes, C., García- Talavera, F., da Silva, C.M., Cachão, M., Hillaire-Marcel, C., Martins, A.M.F., 2008a. Mass extinctions in the Azores during the last glaciation: fact or myth? Journal of Biogeography 35: 1123–1129.

Ávila, S.P., Melo, P.J., Lima, A., Amaral, A., Martins, A.M.F., Rodrigues, A., 2008b. Reproductive cycle of the rissoid Alvania mediolittoralis Gofas, 1989 (Mollusca, Gastropoda) at São Miguel Island (Azores, Portugal). Journal of Invertebrate Reproduction and Development 52: 31–40.

Ávila, S.P., da Silva, C.M., Schiebel, R., Cecca, F., Backeljau, T., Martins, A.M.F., 2009a. How did they get here? The biogeography of the marine molluscs of the Azores. Bulletin de la Société Géologique de France 180(4): 295–307.

Ávila, S.P., Madeira, P., Zazo, C., Kroh, A., Kirby, M., da Silva, C.M., Cachão, M., Martins, A.M.F., 2009b. Palaeoecology of the Pleistocene (MIS 5.5) outcrops of Santa Maria Island (Azores) in a complex oceanic tectonic setting. Palaeogeography, Palaeoclimatology, Palaeoecology 274(1): 18–31.

Ávila, S.P., Goud, J., Martins, A.M.F., 2012a. Patterns of diversity of the Rissoidae (Mollusca: Gastropoda) in the Atlantic and the Mediterranean region. The Scientific World Journal Article-ID 164890: 1-30.

Ávila, S.P., Ramalho, R., Vullo, R., 2012b. Systematics, palaeoecology and palaeobiogeography of the Neogene fossil sharks from the Azores (Northeast Atlantic). Annales de Paléontologie 98(3): 167–189.

Ávila, S.P., Sigwart, J., 2013. New records for the shallow-water chiton fauna (Mollusca, Polyplacophora) of the Azores (NE Atlantic). ZooKeys 312: 23–38.

FCUP 73 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Ávila, S.P., 2013. Unravelling the patterns and processes of evolution of marine life in oceanic islands: a global framework, In: Fernández-Palacios, J.M., Nascimento, L., Hernández, J.C., Clemente, S., González, A. and Díaz-González, J.P. (Eds.), Climate Change Perspectives from the Atlantic: Past, Present and Future: 95– 125. Universidad de La Laguna.

Ávila, S.P., Cachão, M., Ramalho, R.S., Botelho, A.Z., Madeira, P., Rebelo, A.C., Cordeiro, R., Melo, C., Hipólito, A., Ventura, M.A., Lipps, J.H., 2015a. The Palaeontological Heritage of Santa Maria Island (Azores: NE Atlantic): a Re- evaluation of Geosites in GeoPark Azores and Their Use in Geotourism. Geoheritage 8(2): 155–171.

Ávila, S.P., Cordeiro, R., Rodrigues, A.R., Rebelo, A.C., Melo, C., Madeira, P., Pyenson, N.D., 2015b. Fossil Mysticeti from the Pleistocene of Santa Maria Island, Azores (Northeast Atlantic Ocean), and the prevalence of fossil cetaceans on oceanic islands. Palaeontologia Electronica 18.2.27A: 1–12.

Ávila, S.P., Melo, C., Silva, L. and R.R.S., Quartau, R., Hipólito, A., Cordeiro, R., Rebelo, A.C., Madeira, P., Rovere, A., Hearty, P.J., Henriques, D., da Silva, C.M., Martins, A.M.F., Zazo, C., 2015c. A review of the MIS 5e highstand deposits from Santa Maria Island (Azores, NE Atlantic): palaeobiodiversity, palaeoecology and palaeobiogeography. Quaternary Science Reviews 114: 126–148.

Ávila, S.P., Ramalho, R.S., Habermann, J.M., Quartau, R., Kroh, A., Berning, B., Johnson, M., Kirby, M.X., Zanon, V., Titschack, J., Goss, A., Rebelo, A.C., Melo, C., Madeira, P., Cordeiro, R., Meireles, R., Bagaço, L., Hipólito, A., Silva, C.M., Cachão, M., Madeira, J., 2015d. Palaeoecology, taphonomy, and preservation of a lower Pliocene shell bed (coquina) from a volcanic oceanic island (Santa Maria Island, Azores). Palaeogeography, Palaeoclimatology, Palaeoecology 430: 57– 73.

Ávila, S.P., Melo, C., Berning, B., Cordeiro, R., Landau, B., da Silva, C.M., 2016. Persististrombus coronatus (Mollusca: Strombidae) in the lower Pliocene of Santa Maria Island (Azores, NE Atlantic): Paleoecology, paleoclimatology and paleobiogeographic implications. Palaeogeography, Palaeoclimatology, Palaeoecology 441: 912–923.

Avise, J.C., 1998. The history and purview of phylogeography: a personal reflection. Molecular Ecology 7: 371–379.

Avise, J.C., 2004. Molecular markers, natural history and evolution. 2nd edition. Sinauer Associates Inc., Sunderland (Massachusetts). xv+684 pp.

FCUP 74 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Ballard, J.W.O., Whitlock, M.C., 2004. The incomplete natural history of mitochondria. Molecular Ecology 13: 729–744.

Barron, E.J., Peterson, W.H., 1989. Model simulation of the Cretaceous ocean circulation. Science 244(4905): 684–686.

Boore, J.L., 1999. Animal mitochondrial genomes. Nucleic Acids Research 27(8): 1767– 1780.

Borges, L.M.S., Hollatz, C., Lobo, J., Cunha, A.M., Vilela, A.P., Calado, G., Coelho, R., Costa, A.C., Ferreira, M.S.G., Costa, M.H., Costa, F.O., 2016. With a little help from DNA barcoding: investigating the diversity of Gastropoda from the Portuguese coast. Nature Scientific Reports 6: 20226.

Bouckaert, R., Heled, J., Kühnert, D., Vaughan, T., Wu, C., Xie, D., Suchard, M.A., Rambaut, A., Drummond, A.J., 2014. BEAST 2: a software platform for Bayesian evolutionary analysis. PLoS Computational Biology 10(4): e1003537.

Brenke, N., 2002. The benthic community of the Great Meteor Bank, In: ICES Annual Science Conference. 1-5 October 2002. Copenhagen, Denmark. Theme Session: Oceanography and Ecology of Seamounts – Indications of Unique Ecosystems (M30): 13.

Brinkmann, H., Philippe, H., 2008. Animal phylogeny and large-scale sequencing: progress and pitfalls. Journal of Systematics and Evolution 46(3): 274–286.

Caravas, J., Friedrich, M., 2010. Of mites and millipedes: recent progress in resolving the base of the arthropod tree. Bioessays 32(6): 488–495.

Castresana, J., 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular Biology and Evolution 17(4): 540–552.

Coan, E., 1964. A proposed revision of the Rissoacean families Rissoidae, Rissoinidae and Cingulopsidae. Veliger 6(3): 164–171.

Conti, M.A., Monari, S., Oliverio, M., 1993. Early rissoid gastropods from the Jurassic of Italy: the meaning of first appearances. Scripta Geologica Special Issue 2: 67– 74.

Cordeiro, R., Ávila, S.P., 2015. New species of Rissoidae (Mollusca, Gastropoda) from the Archipelago of the Azores (northeast Atlantic) with an updated regional checklist for the family. ZooKeys 480: 1–19.

FCUP 75 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Cordeiro, R., Borges, J.P., Martins, A.M.F., Ávila, S.P., 2015. Checklist of the littoral gastropods (Mollusca Gastropoda) from the Archipelago of the Azores (NE Atlantic). Biodiversity Journal 6(4): 855–900.

Costa, A.C., Ávila, S.P., 2001. Macrobenthic mollusc fauna inhabiting Halopteris spp. subtidal fronds in São Miguel island, Azores. Scientia Marina 65(2): 117–126.

Criscione, F., Ponder, W.F., 2013. A phylogenetic analysis of rissooidean and cingulopsoidean families (Gastropoda: Caenogastropoda). Molecular Phylogenetics and Evolution 66(3): 1075–1082.

Criscione, F., Scuderi, D., Patti, F.P., 2009. Revising α-taxonomy in shelled gastropods: the case of Rissoa panhormensis Verduin, 1985 (Caenogastropoda: Rissoidae). Nautilus 123(4): 303–312.

Criscione, F., Ponder, W.F., Kӧhler, F., Takano, T., Kano, Y., 2016. A molecular phylogeny of Rissoidae (Caenogastropoda: Rissooidea) allows testing the diagnostic utility of morphological traits. Zoological Journal of the Linnean Society 18 pp.

Darriba, D., Taboada, G.L., Doallo, R., Posada, D., 2012. jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9(8): 772.

Darwin, C., 1859. The Origin of Species. 551 pp.

Dautzenberg, P., 1889. Contribution à la faune Malacologique des Îles Açores. Résultats des dragaes effectués par le yatch l’Hirrondelle pendant sa campagne scientifique de 1887. Revision des mollusques marins des Açores. Résultats de Campagnes Scientifiques Prince de Monaco 1: 119.

Davis, G.M., Wilke, T., Spolsky, C., Qiu, C.P., Qiu, D.C., Xia, M.Y., Zhang, Y., Rosenberg, G., 1998. Cytochrome Oxidase I-based phylogenetic relationships among the Pomatiopsidae, Hydrobiidae, Rissoidae and Truncatellidae (Gastropoda: Caenogastropoda: Rissoacea). Malacologia 40(1-2): 251–266.

Douady, C.J., Delsuc, F., Boucher, Y., Doolittle, W.F., Douzery, E.J.P., 2003. Comparison of Bayesian and maximum likelihood bootstrap measures of phylogenetic reliability. Molecular Biology and Evolution 20(2): 248–254.

Drouët, H., 1858. Mollusques Marins des Îles Açores. Mémoires de la Societé d’Agriculture, des Sciences et Belles-lettres du département de l’Aube (II). 84 pp.

Edgecombe, G.D., Giribet, G., 2006. A century later - a total evidence re-evaluation of the phylogeny of scutigeromorph centipedes (Myriapoda: Chilopoda). Invertebrate Systematics 20(5): 503–525.

FCUP 76 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

EMODnet Bathymetry Consortium (2016): EMODnet Digital Bathymetry (DTM). http://doi.org/10.12770/c7b53704-999d-4721-b1a3-04ec60c87238. Batymetrical information retrieved in August 2017.

Erixon, P., Svennblad, B., Britton, T., Oxelman, B., 2003. Reliability of Bayesian posterior probabilities and bootstrap frequencies in phylogenetics. Systematic Biology 52(5): 665–673.

Estevens, M., Ávila, S.P., 2007. Fossil Whales from the Azores, In: Ávila, S.P. and Martins, A.M.F. (Eds.), Proceedings of the “1st Atlantic Islands Neogene” International Congress. Ponta Delgada, 12-14 June 2006. Açoreana, Supplement 5: 140–161.

Faber, M.J., Moolenbeek, R.G., 2004. Five new micromolluscs from the Tropical Western Atlantic (Gastropoda, Rissooidea, Barleeidae, Rissoidae). Beaufortia 54(3): 59– 65.

Felsenstein, J., 1981. Evolutionary trees from DNA sequences: a maximum likelihood approach. Journal of Molecular Evolution 17(6): 368–376.

Ferreira, O.V., 1952. Os pectinídeos do Miocénico da ilha de Santa Maria (Açores). Revista da Faculdade de Ciências de Lisboa 2a série 2: 243–258.

Ferreira, O.V., 1955. A fauna Miocénica da ilha de Santa Maria. Comunicações dos Serviços Geológicos de Portugal 36: 9–44.

Fock, H., Uiblein, F., Kӧster, F., Von Westernhagen, H., 2002. Biodiversity and species- environment relationships of the demersal fish assemblage at the Great Meteor Seamount (subtropical NE Atlantic), sampled by different trawls. Marine Biology 141(1): 185–199.

Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers for amplification of mitochondrial Cytochrome C Oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3(5): 294– 299.

Forest, F., 2009. Calibrating the Tree of Life: fossils, molecules and evolutionary timescales. Annals of Botany 104(5): 789–794.

García-Talavera, F., 1983. Los moluscos gasterópodos anfiatlánticos: estudio paleo y biogeográfico de las especies bentónicas litorales. Universidad de La Laguna, Colección Monografías 10. 352 pp.

Geller, J., Meyer, C., Parker, M., Hawk, H., 2013. Redesign of PCR primers for mitochondrial Cytochrome C Oxidase subunit I for marine invertebrates and

FCUP 77 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

application in all-taxa biotic surveys. Molecular Ecology Resources 13(5): 851– 861.

Gente, P., Dyment, J., Maia, M., Goslin, J., 2003. Interaction between the Mid-Atlantic Ridge and the Azores hotspot during the last 85 Myr: Emplacement and rifting of the hot spot-derived plateaus. Geochemistry, Geophysics, Geosystems 4(10): 8514 .

Glez-Peña, D., Gómez-Blanco, D., Reboiro-Jato, M., Fdez-Riverola, F., Posada, D., 2010. ALTER: program-oriented conversion of DNA and protein alignments. Nucleic Acids Research. Web Server Issue 38.

Gofas, S., 1990. The littoral Rissoidae and Anabathridae of São Miguel, Azores, In: Martins, A.M.F. (Ed.), The Marine Fauna and Flora of the Azores. (Proceedings of the First International Workshop of Malacology, Vila Franca Do Campo, São Miguel, Azores). Açoreana, Supplement 2: 97–134.

Gofas, S., 1992. Island-jumping Rissoids (Gastropoda, Prosobranchia): the case of the Lusitanian seamounts, In: Abstracts of the Eleventh International Malacological Congress, Siena: 302–303.

Gofas, S., 2000. Four species of the family Fasciolariidae (Gastropoda) from the North Atlantic seamounts. Journal of Conchology 37(1): 7-16.

Gofas, S., Beu, A., 2002. Tonnoidean gastropods of the North Atlantic Seamounts and the Azores. American Malacological Bulletin 17(1-2): 91–108.

Gofas, S., 2007. Rissoidae (Mollusca: Gastropoda) from northeast Atlantic seamounts. Journal of Natural History 41(13-16): 779–885.

Golikov, A.N., Starobogatov, Y.I., 1975. Systematics of prosobranch gastropods. Malacologia 15(1): 185–232.

Haq, B.U., 1981. Paleogene paleoceanography: Early Cenozoic oceans revisited. Oceanologica Acta 4: 71–82.

Hausdorf, B., Rӧpstorf, P., Riedel, F., 2003. Relationships and origin of endemic Lake Baikal gastropods (Caenogastropoda: Rissooidea) based on mitochondrial DNA sequences. Molecular Phylogenetics and Evolution 26(3): 435–443.

Hebert, P.D.N., Stoeckle, M.Y., Zemlak, T.S., Francis, C.M., 2004. Identification of Birds through DNA Barcodes. PLoS Biology 2(10): e312.

Huelsenbeck, J.P., Bull, J.J., Cunningham, C.W., 1996. Combining data in phylogenetic analysis. Trends in Ecology & Evolution 11(4): 152–158.

FCUP 78 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Jablonski, D., Lutz, R.A., 1983. Larval ecology of marine benthic invertebrates: paleobiological implications. Biological Reviews 58(1): 21–89.

Janssen, A.W., Kroh, A., Ávila, S.P., 2008. Early Pliocene heteropods and pteropods (Mollusca, Gastropoda) from Santa Maria Island (Azores, Portugal): systematics and biostratigraphic implications. Acta Geologica Polonica 58(3): 355–369.

Johannesson, K., 1988. The paradox of Rockall: why is a brooding gastropod (Littorina saxatilis) more widespread than one having a planktonic larval dispersal stage (L. littorea)? Marine Biology 99(4): 507–513.

Katoh, K., Kuma, K., Toh, H., Miyata, T., 2005. MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Research 33: 511-518.

Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., Drummond, A., 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28(12): 1647–1649.

Kowalke, T., Harzhauser, M., 2004. Early ontogeny and palaeoecology of the Mid- Miocene rissoid gastropods of the Central Paratethys. Acta Palaeontologica Polonica 49(1): 111–134.

Kroh, A., Bitner, M.A., Ávila, S.P., 2008. Novocrania turbinata (Brachiopoda) from the early Pliocene of the Azores (Portugal). Acta Geologica Polonica 58(4): 473–478.

Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33, 1870–1874.

Ladoukakis, E.D., Zouros, E., 2017. Evolution and inheritance of animal mitochondrial DNA: rules and exceptions. Journal of Biological Research-Thessaloniki 24(1): 1- 7.

Lanfear, R., Calcott, B., Ho, S.Y.W., Guindon, S., 2012. PartitionFinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses. Molecular Biology and Evolution 29(6): 1675–1701.

Lavelle, J.W., Mohn, C., 2010. Motion, commotion, and biophysical connections at deep ocean seamounts. Oceanography 23(1): 90–103.

Lemey, P., Salemi, M., Vandamme, A., 2009. The Phylogenetic Handbook: A Practical Approach to Phylogenetic Analysis and Hypothesis. 2nd edition. Cambridge University Press. xxvi+723 pp.

FCUP 79 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Liu, L., Xi, Z., Wu, S., Davis, C.C., Edwards, S.V., 2015. Estimating phylogenetic trees from genome-scale data. Annals of the New York Academy of Sciences 1360(1): 36–53.

Lynch, M., Koskella, B., Schaack, S., 2006. Mutation pressure and the evolution of organelle genomic architecture. Science 311(5768): 1727–1730.

MacAndrew, R., 1856. Report on the marine testaceous Mollusca of the North-east Atlantic and neighbouring seas, and the physical conditions affecting their development. Report of the British Association for the Advance of Science 26, 101–158.

Madden, T., 2002. The BLAST sequence analysis tool. 2002 Oct 9 [Updated 2003 Aug 13], In: McEntyre J. and Ostell J. (Eds.), The NCBI Handbook [Internet]. Bethesda (MD): National Center for Biotechnology Information (US).

Madeira, P., Kroh, A., Cordeiro, R., Meireles, R., Ávila, S.P., 2011. The fossil echinoids of Santa Maria Island, Azores (Northern Atlantic Ocean). Acta Geologica Polonica 61(3): 243–264.

Madeira, P., Kroh, A., Martins, A.M.F., Ávila, S.P., 2007. The marine fossils from Santa Maria Island: an historical overview. Açoreana Supplement 5: 59–73.

Malaquias, M.A.E., Calado, G.P., Padula, V., Villani, G., Cervera, J.L., 2009. Molluscan diversity in the North Atlantic Ocean: new records of opisthobranch gastropods from the Archipelago of the Azores. Marine Biodiversity Records 2: e38.

Mandal, S.D., Chhakchhuak, L., Gurusubramanian, G., Kumar, N.S., 2014. Mitochondrial markers for identification and phylogenetic studies in insects – A Review. DNA Barcodes 2: 1–9.

Martins, A.M.F., 1980. Notes on the habitat of five halophile Ellobiidae in the Azores. Museu Carlos Machado, Ponta Delgada. 24 pp.

Martins, A.M.F., 1995. Anatomy and systematics of Ovatella vulcani (Morelet, 1860) (Pulmonata: Ellobiidae) from the Azores, In: Martins, A.M.F. (Ed.), The Marine Fauna and Flora of the Azores. (Proceedings of the Second International Workshop of Malacology and Marine Biology, Vila Franca Do Campo, São Miguel, Azores). Açoreana, Supplement 4: 231–248.

Martins, A.M.F., Borges, J.P., Ávila, S.P., Costa, A.C., Madeira, P., Morton, B., 2009. Illustrated checklist of the infralittoral molluscs off Vila Franca do Campo. Açoreana Supplement 6: 15–103.

FCUP 80 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

McWilliam, H., Li, W., Uludag, M., Squizzato, S., Park, Y.M., Buso, N., Cowley, A.P., Lopez, R., 2013. Analysis tool web services from the EMBL-EBI. Nucleic Acids Research 41 (Web Server Issue): 597–600.

Meireles, R.P., Faranda, C., Gliozzi, E., Pimentel, A., Zanon, V., Ávila, S.P., 2012. Late Miocene marine ostracods from Santa Maria island, Azores (NE Atlantic): Systematics, palaeoecology and palaeobiogeography. Revue de Micropaléontologie 55(4): 133–148.

Meireles, R.P., Quartau, R., Ramalho, R.S., Rebelo, A.C., Madeira, J., Zanon, V., Ávila, S.P., 2013. Depositional processes on oceanic island shelves – Evidence from storm-generated Neogene deposits from the mid-North Atlantic. Sedimentology 60(7): 1769–1785.

Mendes, F.K., Hahn, M.W., 2016. Gene tree discordance causes apparent substitution rate variation. Systematic Biology 65(4): 711–721.

Métrich, N., Zanon, V., Créon, L., Hildenbrand, A., Moreira, M., Marques, F.O., 2014. Is the “Azores hotspot” a wetspot? Insights from the geochemistry of fluid and melt inclusions in olivine of Pico basalts. Journal of Petrology 55(2): 377–393.

Mileikovsky, S.A., 1971. Types of larval development in marine bottom invertebrates, their distribution and ecological significance: a re-evaluation. Marine Biology 10: 193–213.

Mironov, A.N., 2006. Centers of marine fauna redistribution. Entomological Review 86 Supplement 1: 532–544.

Mironov, A.N., Krylova, E.M., 2006. Origin of the fauna of the Meteor Seamounts, north- eastern Atlantic, In: Mironov, A.N., Gebruk, A.V. and Southward, A.J. (Eds.), Biogeography of the North Atlantic Seamounts: 22–57. KMK Scientific Press, 196 pp.

Morton, B., 1967. Malacological Report. Chelsea College Azores Expedition, July- October 1965. Final Report 30–38.

Morton, B., 1990. The biology and functional morphology of Ervilia castanea (Bivalvia: Tellinacea) from the Azores, In: Martins, A.M.F. (Ed.), The Marine Fauna and Flora of the Azores. (Proceedings of the First International Workshop of Malacology, Vila Franca Do Campo, São Miguel, Azores). Açoreana, Supplement 2: 75–96.

Morton, B., 1995. The biology and functional morphology of Trichomusculus semigranatus (Bivalvia: Mytiloidea) from the Azores, In: Martins, A.M.F. (Ed.),

FCUP 81 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

The Marine Fauna and Flora of the Azores. (Proceedings of the Second International Workshop of Malacology and Marine Biology, Vila Franca Do Campo, São Miguel, Azores). Açoreana, Supplement 4: 279–295.

Morton, B., Martins, A.M.F., Britton, J.C., 1998. Ecologia Costeira dos Açores. Sociedade Afonso Chaves, Ponta Delgada. x+249 pp.

Morton, B., Da Cunha, R.T., Martins, A.M.F., 2014. Species richness, relative abundance and dwarfism in Azorean bivalves: consequences of latitude, isolation or productivity? Or all three? Journal of the Marine Biological Association of the United Kingdom 94(3): 567–578.

Nobre, A., 1924. Contribuições para a fauna dos Açores. Anais do Instituto de Zoologia da Universidade do Porto 1: 41–90.

Nobre, A., 1930. Materiais para o estudo da fauna dos Açores. Instituto de Zoologia da Universidade do Porto, Porto. 108 pp.

Nordsieck, F., 1972. Die europäischen Meeresschnecken (Opisthobranchia mit Pyramidellidae: Rissoacea). Gustav Fischer Verlag, Stuttgart. 327 pp.

O’Dea, A., Lessios, H.A., Coates, A.G., Eytan, R.I., Restrepo-Moreno, S.A., Cione, A.L., Collins, L.S., de Queiroz, A., Farris, D.W., Norris, R.D.S.R.F., Woodburne, M.O., Aguilera, O., Aubry, M., Berggren, W.A., Budd, A.F., Cozzuol, M.A., Coppard, S.E., Duque-Caro, H., Finnegan, S., Gasparini, G.M., Grossman, E.L., Johnson, K.G., Keigwin, L.D., Knowlton, N., Leigh, E.G., Leonard-Pingel, J.S., Marko, P.B., Pyenson, N.D., Rachello-Dolmen, P.G., Soibelzon, E., Soibelzon, L., Todd, J.A., Vermeij, G.J., Jackson, J.B.C., 2016. Formation of the Isthmus of Panama. Science Advances 2(8): e1600883.

O’Foighil, D., 1989. Planktotrophic larval development is associated with a restricted geographic range in Lasaea, a genus of brooding, hermaphroditic bivalves. Marine Biology 103: 349–358.

Ogilvie, H.A., Heled, J., Xie, D., Drummond, A.J., 2016. Computational performance and statistical accuracy of *BEAST and comparisons with other methods. Systematic Biology 63(5): 381–396.

Ogilvie, H.A., Bouckaert, R.R., Drummond, A.J., 2017. StarBEAST2 brings faster species tree inference and accurate estimates of substitution rates. Molecular Biology and Evolution: msx126.

Omta, A.W., Dijkstra, H.A., 2003. A physical mechanism for the Atlantic-Pacific flow reversal in the early Miocene. Global and Planetary Change 36(4): 265–276.

FCUP 82 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Palumbi, S., Martin, A., Romano, S., McMillan, W.O., Stice, L., Grabowski, F., 2002. The simple fool’s guide to PCR, version 2. Department of Zoology and Kewalo Marine Laboratory, University of Hawaii.

Panova, M., Blakeslee, A.M., Miller, A.W., Mäkinen, T., Ruiz, G.M., Johannesson, K., André, C., 2011. Glacial history of the North Atlantic marine snail, Littorina saxatilis, inferred from distribution of mitochondrial DNA lineages. PLoS One 6(3): e17511.

Parham, J.F., Donoghue, P.C.J., Bell, C.J., Calway, T.D., Head, J.J., Holroyd, P.A., Inoue, J.G., Irmis, R.B., Joyce, W.G., Ksepka, D.T., Patané, J.S.L., Smith, N.D., Tarver, J.E., van Tuinen, M., Yang, Z., Angielczyk, K.D., Greenwood, J.M., Hipsley, C.A., Jacobs, L., Makovicky, P.J., Müller, J., Smith, K.T., Theodor, J.M., Warnock, R.C.M., Benton, M.J., 2012. Best practices for justifying fossil calibrations. Systematic Biology 61(2): 346–359.

Park, L.K., Moran, P., 1994. Developments in molecular genetic techniques in fisheries. Reviews in Fish Biology and Fisheries 4, 272–299.

Patwardhan, A., Ray, S., Roy, A., 2014. Molecular markers in phylogenetic studies – A Review. Journal of Phylogenetics & Evolutionary Biology 2: 1-9.

Pond, S.L.K., Poon, A.F.Y., Frost, S.D.W., 2009. Estimating selection pressures on alignments of coding sequences, In: Lemey, P., Salemi, M. and Vandamme, A. (Eds.), The Phylogenetic Handbook: A Practical Approach to Phylogenetic Analysis and Hypothesis. 2nd edition: 419-451. Cambridge University Press. xxvi+723 pp.

Ponder, W.F., 1967. Classification of Rissoidae and Orbitestellidae with descriptions of some new taxa. Transactions of the Royal Society of New Zealand, Zoology 9(17): 193–224.

Ponder, W.F., Yoo, E.K., 1980. A review of the genera of the Cingulopsidae with a revision of the Australian and tropical Indo-Pacific species (Mollusca: Gastropoda: Prosobranchia). Records of the Australian Museum 33(1): 1–88.

Ponder, W.F., 1983a. Rissoaform gastropods from the Antarctic and sub-Antarctic. The Eatoniellidae, Rissoidae, Barleeidae, Cingulopsidae, Orbitestellidae, and Rissoellidae (Mollusca, Gastropoda) of Signy Island, South Orkney Islands, with a review of the Antarctic and sub-Antarctic (excluding southern South America and the New Zealand sub-Antarctic Islands) species. British Antarctic Survey Scientific Report 108: 1-97.

FCUP 83 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Ponder, W.F., 1983b. Review of the genera of the Barleeidae (Mollusca: Gastropoda: Rissoacea). Records of the Australian Museum 35(6): 231–281.

Ponder, W.F., 1984a. A review of the genera of the Rissoidae (Mollusca: Mesogastropoda: Rissoacea). Records of the Australian Museum Supplement 4: 1-221.

Ponder, W.F., 1984b. A review of the genera of the Iravadiidae (Gastropoda: Rissoacea) with an assessment of the relationships of the family. Malacologia 25(1): 21–71.

Ponder, W.F., De Keyzer, R.G., 1998. Family Rissoidae, In: Beesley, P.L., Ross, G.J.B. and Wells, A. (Eds.), Mollusca: The Southern Synthesis. Fauna of Australia. Vol. 5: 749–751. CSIRO, Australian Biological Resources Study, Environment Australia. Department of the Environment, xv+563 pp.

Posada, D., Buckley, T.R., 2004. Model selection and model averaging in phylogenetics: advantages of Akaike Information Criterion and Bayesian approaches over likelihood ratio tests. Systematic Biology 53(5): 793–808.

Pouli, E., Boletzky, S., Féral, J.P., 2001. Combined ecological factors permit classification of developmental patterns in benthic marine invertebrates: a discussion note. Journal of Experimental Marine Biology and Ecology 257: 109– 115.

Pusch, C., Beckmann, A., Porteiro, F.M., von Westernhagen, H., 2004. The influence of seamounts on mesopelagic fish communities. Archive of Fishery and Marine Research 51(1-3): 165–186.

Quattro, J., Chase, M., Rex, M., Greig, T., Etter, R., 2001. Extreme mitochondrial DNA divergence within populations of the deep-sea gastropod Frigidoalvania brychia. Marine Biology 139(6): 1107–1113.

Ramalho, R.S., Helffrich, G., Madeira, J., Cosca, M., Thomas, C., Quartau, R., Hipólito, A., Rovere, A., Hearty, P.J., Ávila, S.P., 2017. Emergence and evolution of Santa Maria Island (Azores) – The conundrum of uplifted islands revisited. The Geological Society of America Bulletin 129(3-4): 372-390.

Rambaut, A., 2006. FigTree v1.4.2 Tree Figure Drawing Tool. Available from http://tree.bio.ed.ac.uk/software/figtree/.

Rambaut, A., Drummond, A.J., 2002. TreeAnotator v2.4.5 MCMC Output analysis. Available from http://tree.bio.ed.ac.uk/software/beast.

Rambaut, A., Suchar, M.A., Xie, W., Drummond, A.J., 2014. Tracer v1.6 MCMC Trace Analysis Tool. Available from http://beast.bio.ed.ac.uk/tracer.

FCUP 84 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Rebelo, A.C., Rasser, M., Riosmena-Rodríguez, R., Neto, A.I., Ávila, S.P., 2014. Rhodolith forming coralline algae in the Upper Miocene of Santa Maria Island (Azores, NE Atlantic): a critical evaluation. Phytotaxa 190(1): 370–382.

Rebelo, A.C., Meireles, R.P., Barbin, V., Neto, A.I., Melo, C., Ávila, S.P., 2016a. Diagenetic history of lower Pliocene rhodoliths of the Azores archipelago (NE Atlantic): application of cathodoluminescence techniques. Micron 80: 112–121.

Rebelo, A.C., Rasser, M.W., Kroh, A., Johnson, M.E., Ramalho, R.S., Melo, C., Uchman, A., Berning, B., Silva, I., Zonon, V., Neto, A.I., Cachão, M., Ávila, S.P., 2016b. Rocking around a volcanic island shelf: Pliocene rhodolith beds from Malbusca, Santa Maria Island (Azores, NE Atlantic). Facies 62(3): 1–31.

Ribeiro, L.P., Madureira, P., Hildenbrand, A., Martins, S., Mata, J., 2017. The Azores plume influence on the SASC-Great Meteor and MAR: the importance for the Portuguese Extension of the Continental Shelf Project (PECSP), In: EGU General Assembly Conference Abstracts 19.

Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Höhna, S., Larget, B., Liu, L., Suchard, M.A., Huelsenbeck, J.P., 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542.

Russo, C.A., Takezaki, N., Nei, M., 1996. Efficiencies of different genes and different tree-building methods in recovering a known vertebrate phylogeny. Molecular Biology and Evolution 13(3): 525–536.

Salemi, M., 2009. Genetic distances and nucleotide substituition models, In: Lemey, P., Salemi, M. and Vandamme, A. (Eds.), The Phylogenetic Handbook: A Practical Approach to Phylogenetic Analysis and Hypothesis. 2nd edition: 126-140. Cambridge University Press, xxvi+723 pp.

Scheltema, R.S., 1977. Dispersal of marine invertebrate organisms: paleobiogeographic and biostratigraphic implications, In: Kaufmann, R.G. and Hazel, J.E. (Eds.), Concepts and Methods of Biostratigraphy: 73–108. Dowden, Hutchinson & Ross, Stroudsberg, Pennsylvania, xiii+658 pp.

Scheltema, R.S., 1978. On the relationship between dispersal of pelagic veliger larvae and the evolution of marine prosobranch gastropods, In: Battaglia, B. and Beardmore, J.A. (Eds.), Marine Organisms: Genetics, Ecology and Evolution. NATO Conference Series. Series IV: Marine Sciences: 303–322. Plenum Press, New York.

FCUP 85 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Scheltema, R.S., Williams, I.P., 1983. Long-distance dispersal of planktonic larvae and the biogeography and evolution of some Polynesian and western Pacific mollusks. Bulletin of Marine Science 33(3): 545–565.

Scheltema, R.S., 1986a. On dispersal and planktonic larvae of benthic invertebrates: an eclectic overview and summary of problems. Bulletin of Marine Science 39(2): 290–322.

Scheltema, R.S., 1986b. Long-distance dispersal by planktonic larvae of shoal-water benthic invertebrates among central Pacific islands. Bulletin of Marine Science 39(2): 241–256.

Scheltema, R.S., 1989. Planktonic and non-planktonic development among prosobranch gastropods and its relationship to the geographic range of species, In: Ryland, J.S. and Tyler, P.A. (Eds.), Reproduction, Genetics and Distributions of Marine Organisms: 183–188. Olsen & Olsen, International Symposium Series, viii+469 pp.

Scheltema, R.S., 1995. The relevance of passive dispersal for the biogeography of Caribbean mollusks. American Malacological Bulletin 11(2): 99–115.

Scheltema, R.S., Williams, I.P., Lobel, P.S., 1996. Retention around and long-distance dispersal between oceanic islands by planktonic larvae of benthic gastropod Mollusca. American Malacological Bulletin 12(1/2): 67–75.

Serralheiro, A., Alves, C.A.M., Forjaz, V.H., Rodrigues, B., 1987. Carta Vulcanológica dos Açores, Ilha de Santa Maria. Centro de Vulcanologia INIC, Ponta Delgada.

Serralheiro, A., 2003. A geologia da Ilha de Santa Maria, Açores. Açoreana 10(1): 141– 192.

Shuto, T., 1974. Larval ecology of prosobranch gastropods and its bearing on biogeography and paleontology. Lethaia 7(3): 239–256.

Silveira, G., Stutzmann, E., Davaille, A., Montagner, J.-P., Mendes-Victor, L., Sebai, A., 2006. Azores hotspot signature in the upper mantle. Journal of Volcanology and Geothermal Research 156(1): 23–34.

Simroth, H., 1888. Zur Kenntniss der Azorenfauna. Archiv für Naturgeschichte I(3): 179– 234.

Skavoshevskaya, L.V., 1975. Peculiarities of the reproductive system of the Rissoacea and their importance for taxonomy in this superfamily (in Russian), In: Molluscs, their system, evolution and significance in nature: 117–120. Theses in

FCUP 86 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Communications. Academy of Sciences, U.S.S.R. Institute of Zoology. Izdatel’stvo “Nauka”, Leningrad.

Speed, M.P., Arbuckle, K., 2017. Quantification provides a conceptual basis for convergent evolution. Biological Reviews 92(2): 815–829.

Stackebrandt, E., Goebel, B.M., 1994. Taxonomic note: a place for DNA-DNA reassociation and 16S rRNA sequence analysis in the present species definition in bacteriology. International Journal of Systematic and Evolutionary Microbiology 44(4): 846–849.

Strong, E.E., Colgan, D.J., Healy, J.M., Lydeard, C., Ponder, W.F., Glaubrecht, M., 2011. Phylogeny of the gastropod superfamily Cerithioidea using morphology and molecules. Zoological Journal of the Linnean Society 162(1): 43–89.

Strugnell, J., Norman, M., Jackson, J., Drummond, A.J., Cooper, A., 2005. Molecular phylogeny of coleoid cephalopods (Mollusca: Cephalopoda) using a multigene approach; the effect of data partitioning on resolving phylogenies in a Bayesian framework. Molecular Phylogenetics and Evolution 37(2): 426–441.

Sukumaran, J., Holder, M.T., 2010. DendroPy: a Python library for phylogenetic computing. Bioinformatics 26: 1569–1571.

Szarowska, M., Falniowski, A., Riedel, F., Wilke, T., 2005. Phylogenetic relationships of the subfamily Pyrgulinae (Gastropoda: Caenogastropoda: Hydrobiidae) with emphasis on the genus Dianella Gude, 1913. Zootaxa 891, 1–32.

Takano, T., Kano, Y., 2014. Molecular phylogenetic investigations of the relationships of the echinoderm-parasite family Eulimidae within Hypsogastropoda (Mollusca). Molecular Phylogenetics and Evolution 79: 258–269.

Thiele, J., 1929-1935. Handbuch der Systematischen Weichtierkunde. Gustav Fischer, Jena. 376 pp.

Thiriot-Quiévreux, C., 1980. Protoconques et coquilles larvaires des mollusques rissoidés Mediterranéens. Annales de la Institue Océanographique 56: 65–76.

Tollefsrud, M.M., Sønstebø, J.H., Brochmann, C., Johnsen, O., Skrøppa, T., Vendramin, G.G., 2009. Combined analysis of nuclear and mitochondrial markers provide new insight into the genetic structure of North European Picea abies. Heredity 102: 549–562.

Triantis, K.A., Borges, P.A.V., Hortal, J., Whittaker, R.J., 2010. The Macaronesian province: patterns of species richness and endemism of arthropods, In: Serrano, A.R.M., Borges, P.A.V., Boieiro, M. and Oromí, P. (Eds.), Terrestrial Arthropods

FCUP 87 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

of Macaronesia – Biodiversity, Ecology and Evolution: 49-71. Sociedade Portuguesa de Entomologia, Lisboa, 327 pp.

Tucholke, B.E., Smoot, N.C., 1990. Evidence for age and evolution of Corner seamounts and Great Meteor Seamount Chain from multibeam bathymetry. Journal of Geophysical Research 95(B11): 17555–17569.

Tverberg, J., n.d. Molecular phylogenetics of North-East Atlantic hydrothermal vent and wood fall associated Rissoidae (Mollusca: Gastropoda). Unpublished.

Verhoef, J., 1984. A geophysical study of the Atlantis-Meteor Seamount Complex. Instituut voor Aardwetenschappen der Rijksuniversiteit te Utrecht 38, 156 pp.

Villarreal, J.C., Renner, S.S., 2014. A review of molecular-clock calibrations and substitution rates in liverworts, mosses, and hornworts, and a timeframe for a taxonomically cleaned-up genus Nothoceros. Molecular Phylogenetics and Evolution 78: 25–35.

Von Rad, U., 1974. Great Meteor and Josephine Seamounts (eastern North Atlantic): composition and origin of bioclastic sands, carbonate and pyroclastic rocks. “Meteor” Forschungsergeb. Reihe C 19: 1–62.

Warén, A., 1973. Revision of the Rissoidae from the Norwegian North Atlantic expedition 1876-78. Sarsia 53(1): 1–16.

Warén, A., 1974. Revision of the Arctic-Atlantic Rissoidae (Gastropoda, Prosobranchia). Zoologica Scripta 3: 121–135.

Wenz, W., 1938-144. Gastropoda. Teil 1, Allgemeiner Teil und Prosobranchia. In: Schindewolfe, O.H. (Ed.), Handbuch der Paläozoologie. Vol. 6. Gebrüer Bornträger, Berlin: 1–231.

Whiting, M.F., 2002. Mecoptera is paraphyletic: multiple genes and phylogeny of Mecoptera and Siphonaptera. Zoologica Scripta 31(1): 93–104.

Wilke, T., Davis, G.M., 2000. Infraspecific mitochondrial sequence diversity in Hydrobia ulvae and Hydrobia ventrosa (Hydrobiidae: Rissooidea: Gastropoda): Do their different life histories affect biogeographic patterns and gene flow? Biological Journal of the Linnean Society 70: 89–105.

Wilke, T., Haase, M., Hershler, R., Liu, H.-P., Misof, B., Ponder, W., 2013. Pushing short DNA fragments to the limit: Phylogenetic relationships of “hydrobioid”gastropods (Caenogastropoda: Rissooidea). Molecular Phylogenetics and Evolution 66(3): 715–736.

FCUP 88 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Williams, S.T., Reid, D.G., Littlewood, D.T.J., 2003. A molecular phylogeny of the Littorininae (Gastropoda: Littorinidae): unequal evolutionary rates, morphological parallelism, and biogeography of the Southern Ocean. Molecular Phylogenetics and Evolution 28(1): 60–86.

Winkelmann, K., Buckeridge, J.S., Costa, A.C., Dionísio, M.A.M., Medeiros, A., Cachão, M., Ávila, S.P., 2010. Zullobalanus santamariaensis sp. nov. a new late Miocene barnacle species of the family Archeobalanidae (Cirripedia: Thoracica), from the Azores. Zootaxa 2680: 33–44.

Woese, C.R., 1987. Bacterial evolution. Microbiological Reviews 51: 221–271.

Xavier, R., Santos, A.M., Harris, D.J., Sezgin, M., Machado, M., Branco, M., 2012. Phylogenetic analysis of the north-east Atlantic and Mediterranean species of the genus Stenosoma (Isopoda, Valvifera, Idoteidae). Zoologica Scripta 41(4): 386– 399.

Xia, X., 2009. Assessing substitution saturation with DAMBE, In: Lemey, P., Salemi, M. and Vandamme, A. (Eds.), The Phylogenetic Handbook: A Practical Approach to Phylogenetic Analysis and Hypothesis. 2nd edition: 615-621. Cambridge University Press, xxvi+723 pp.

Yang, L., Tan, Z., Wang, D., Xue, L., Guan, M., Huang, T., Li, R., 2014. Species identification through mitochondrial rRNA genetic analysis. Scientific Reports 4: 4089.

Yang, T., Shen, Y., van der Lee, S., Solomon, S.C., Hung, S.-H., 2006. Upper mantle structure beneath the Azores hotspot from finite-frequency seismic tomography. Earth and Planetary Science Letters 250(1): 11–26.

Zardoya, R., Meyer, A., 1996. Phylogenetic performance of mitochondrial protein-coding genes in resolving relationships among vertebrates. Molecular Biology and Evolution 13(7): 933–942.

Zbyszewski, G., Ferreira, O.V., 1961. La faune marine des basses plages quaternaires de Praia et Prainha dans l’ile de Santa Maria (Açores). Comunicações dos Serviços Geológicos de Portugal 45: 467–478.

Zhang, D.-X., Hewitt, G.M., 2003. Nuclear DNA analyses in genetic studies of populations: practice, problems and prospects. Molecular Ecology 12: 563–584.

Zwickl, D.J., 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. x+115 pp. Ph.D Thesis, University of Texas, Austin.

FCUP 89 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Appendix 1

Appendix 1 – Colour code intending to facilitate the visual identification of the species included in the phylogenetic analyses.

FCUP 90 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Appendix 2

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 1 A.beanii 2 A.angioyi_ hap1 0.140 3 A.angioyi_ hap2 0.138 0.002 4 A.angioyi_ hap3 0.138 0.002 0.000 5 A.formicarum_ hap1 0.138 0.144 0.142 0.142 6 A.formicarum_hap2 0.136 0.142 0.140 0.140 0.002 7 A.mediolittoralis_ hap1 0.136 0.149 0.148 0.148 0.031 0.031 8 A.mediolittoralis_hap2 0.134 0.148 0.146 0.146 0.029 0.029 0.002 9 A.mediolittoralis_hap3 0.136 0.149 0.148 0.148 0.031 0.031 0.004 0.002 10 A.punctura_ hap1 0.157 0.140 0.138 0.138 0.190 0.192 0.188 0.186 0.184 11 A.punctura_ hap2 0.159 0.146 0.144 0.144 0.188 0.190 0.186 0.184 0.182 0.006 12 A.punctura_ hap3 0.157 0.140 0.138 0.138 0.190 0.192 0.188 0.186 0.184 0.000 0.006 13 A.sleursi_ hap1 0.117 0.155 0.153 0.153 0.119 0.117 0.111 0.109 0.107 0.167 0.172 0.167 14 A.sleursi_ hap2 0.117 0.151 0.149 0.149 0.103 0.102 0.096 0.094 0.092 0.184 0.186 0.184 0.086 15 A.subsoluta 0.153 0.151 0.149 0.149 0.153 0.151 0.155 0.153 0.151 0.167 0.172 0.167 0.138 0.149 16 B.ovummuscae 0.262 0.259 0.259 0.259 0.272 0.272 0.270 0.268 0.266 0.261 0.262 0.261 0.266 0.287 0.280 17 C.trifasciata_ hap1 0.157 0.132 0.130 0.130 0.153 0.153 0.159 0.157 0.155 0.151 0.157 0.151 0.146 0.155 0.138 0.266 18 C.trifasciata_ hap2 0.157 0.132 0.130 0.130 0.157 0.157 0.159 0.157 0.155 0.153 0.159 0.153 0.148 0.153 0.138 0.272 0.010 19 C.trifasciata_ hap3 0.157 0.136 0.134 0.134 0.157 0.157 0.163 0.161 0.159 0.151 0.157 0.151 0.149 0.159 0.142 0.270 0.008 0.010 20 C.trifasciata_ hap4 0.157 0.132 0.130 0.130 0.153 0.153 0.159 0.157 0.155 0.151 0.157 0.151 0.148 0.153 0.140 0.268 0.006 0.008 0.006 21 C.trifasciata_ hap5 0.159 0.136 0.134 0.134 0.155 0.155 0.161 0.159 0.157 0.153 0.159 0.153 0.148 0.157 0.140 0.268 0.008 0.010 0.008 0.006 22 C.trifasciata_ hap1 0.155 0.134 0.132 0.132 0.155 0.155 0.161 0.159 0.157 0.153 0.159 0.153 0.148 0.157 0.140 0.270 0.010 0.011 0.010 0.008 0.010 23 C.postrema 0.209 0.142 0.140 0.140 0.205 0.203 0.199 0.201 0.199 0.155 0.157 0.155 0.188 0.209 0.193 0.270 0.153 0.153 0.153 0.153 0.153 0.155 24 O.semicostata_ hap1 0.188 0.178 0.176 0.176 0.174 0.172 0.176 0.174 0.172 0.205 0.207 0.205 0.170 0.167 0.163 0.297 0.174 0.176 0.174 0.176 0.176 0.176 0.190 25 O.semicostata_ hap2 0.188 0.182 0.180 0.180 0.176 0.174 0.178 0.176 0.174 0.207 0.209 0.207 0.172 0.169 0.163 0.297 0.176 0.178 0.176 0.178 0.178 0.178 0.193 0.006 26 O.semicostata_ hap3 0.186 0.180 0.178 0.178 0.176 0.174 0.178 0.176 0.174 0.203 0.205 0.203 0.172 0.169 0.165 0.299 0.176 0.178 0.176 0.178 0.178 0.178 0.190 0.002 0.008 27 P.semipellucida_ hap1 0.176 0.190 0.188 0.188 0.192 0.193 0.197 0.195 0.193 0.188 0.186 0.188 0.197 0.182 0.169 0.276 0.186 0.186 0.184 0.186 0.188 0.188 0.190 0.193 0.193 0.195 28 P.semipellucida_ hap2 0.172 0.190 0.188 0.188 0.192 0.193 0.197 0.195 0.193 0.186 0.184 0.186 0.195 0.178 0.165 0.278 0.182 0.182 0.180 0.182 0.184 0.184 0.190 0.190 0.190 0.192 0.006 29 Pseudosetia sp._hap1 0.169 0.178 0.176 0.176 0.178 0.176 0.180 0.178 0.176 0.201 0.203 0.201 0.169 0.172 0.146 0.272 0.172 0.172 0.172 0.172 0.170 0.170 0.188 0.182 0.184 0.180 0.176 0.172 30 Pseudosetia sp._hap2 0.167 0.176 0.174 0.174 0.176 0.174 0.178 0.176 0.174 0.199 0.201 0.199 0.167 0.170 0.144 0.270 0.170 0.170 0.170 0.170 0.169 0.169 0.186 0.180 0.182 0.178 0.174 0.170 0.002 31 P.inconspicua_ hap1 0.201 0.184 0.182 0.182 0.205 0.203 0.197 0.195 0.193 0.197 0.199 0.197 0.182 0.197 0.169 0.282 0.195 0.192 0.197 0.193 0.195 0.195 0.207 0.184 0.184 0.186 0.211 0.209 0.192 0.190 32 P.inconspicua_ hap2 0.201 0.186 0.184 0.184 0.207 0.205 0.199 0.197 0.195 0.197 0.199 0.197 0.182 0.197 0.170 0.285 0.195 0.192 0.197 0.193 0.195 0.195 0.211 0.184 0.184 0.186 0.213 0.211 0.195 0.193 0.006 33 P.inconspicua_ hap3 0.199 0.186 0.184 0.184 0.203 0.201 0.195 0.193 0.192 0.199 0.201 0.199 0.180 0.195 0.167 0.280 0.197 0.193 0.199 0.195 0.197 0.197 0.209 0.182 0.182 0.184 0.213 0.211 0.190 0.188 0.002 0.008 34 P.sarsii 0.205 0.184 0.182 0.182 0.213 0.211 0.205 0.203 0.201 0.201 0.203 0.201 0.186 0.201 0.172 0.285 0.195 0.192 0.197 0.193 0.195 0.195 0.211 0.184 0.184 0.186 0.215 0.213 0.190 0.188 0.011 0.017 0.013 35 R.auriscalpium 0.213 0.199 0.197 0.197 0.207 0.207 0.195 0.197 0.195 0.203 0.205 0.203 0.211 0.207 0.216 0.282 0.211 0.209 0.213 0.211 0.213 0.213 0.213 0.215 0.216 0.216 0.215 0.213 0.215 0.213 0.199 0.201 0.197 0.211 36 R.guernei_ hap1 0.216 0.195 0.193 0.193 0.207 0.205 0.215 0.213 0.215 0.218 0.218 0.218 0.216 0.192 0.218 0.270 0.215 0.215 0.218 0.215 0.211 0.216 0.218 0.215 0.218 0.215 0.224 0.230 0.215 0.213 0.207 0.207 0.205 0.211 0.199 37 R.guernei_ hap2 0.218 0.197 0.195 0.195 0.209 0.207 0.216 0.215 0.216 0.220 0.220 0.220 0.218 0.193 0.220 0.272 0.216 0.216 0.220 0.216 0.213 0.218 0.220 0.213 0.216 0.213 0.226 0.232 0.216 0.215 0.205 0.205 0.203 0.209 0.197 0.002 38 R.guernei_ hap3 0.218 0.195 0.193 0.193 0.207 0.205 0.215 0.213 0.215 0.216 0.216 0.216 0.215 0.192 0.216 0.270 0.213 0.213 0.216 0.213 0.209 0.215 0.222 0.209 0.213 0.209 0.228 0.234 0.213 0.211 0.203 0.203 0.201 0.207 0.199 0.006 0.004 39 R.guernei_ hap4 0.222 0.199 0.197 0.197 0.211 0.209 0.216 0.215 0.216 0.216 0.216 0.216 0.213 0.192 0.218 0.270 0.215 0.215 0.218 0.215 0.211 0.216 0.218 0.211 0.215 0.211 0.226 0.232 0.215 0.213 0.205 0.205 0.203 0.209 0.195 0.008 0.006 0.006 40 R.guernei_ hap5 0.220 0.195 0.193 0.193 0.209 0.207 0.216 0.215 0.216 0.218 0.218 0.218 0.216 0.193 0.218 0.268 0.213 0.213 0.216 0.213 0.213 0.215 0.218 0.211 0.215 0.211 0.226 0.232 0.215 0.213 0.205 0.205 0.203 0.209 0.197 0.006 0.004 0.004 0.006 41 R.guernei_ hap6 0.216 0.192 0.190 0.190 0.205 0.203 0.213 0.211 0.213 0.215 0.215 0.215 0.216 0.193 0.215 0.264 0.213 0.213 0.216 0.213 0.209 0.215 0.220 0.211 0.215 0.211 0.226 0.232 0.215 0.213 0.203 0.203 0.201 0.207 0.192 0.010 0.008 0.008 0.010 0.008 42 R.guernei_ hap7 0.224 0.201 0.199 0.199 0.213 0.211 0.216 0.215 0.216 0.216 0.216 0.216 0.220 0.193 0.222 0.272 0.218 0.218 0.222 0.218 0.215 0.220 0.220 0.211 0.215 0.211 0.226 0.232 0.218 0.216 0.205 0.205 0.203 0.209 0.197 0.008 0.006 0.006 0.008 0.006 0.010 43 R.guernei_ hap8 0.220 0.197 0.195 0.195 0.213 0.211 0.220 0.218 0.220 0.215 0.215 0.215 0.216 0.190 0.218 0.274 0.215 0.215 0.218 0.215 0.211 0.216 0.216 0.211 0.215 0.211 0.222 0.228 0.215 0.213 0.201 0.201 0.199 0.205 0.197 0.008 0.006 0.006 0.008 0.006 0.010 0.004 44 R.guernei_ hap9 0.220 0.197 0.195 0.195 0.209 0.207 0.216 0.215 0.216 0.215 0.215 0.215 0.216 0.190 0.218 0.274 0.215 0.215 0.218 0.215 0.215 0.216 0.220 0.207 0.211 0.207 0.222 0.228 0.218 0.216 0.201 0.201 0.199 0.205 0.197 0.008 0.006 0.006 0.008 0.006 0.010 0.004 0.004 45 'Setia'_ hap1 0.333 0.330 0.330 0.330 0.335 0.333 0.345 0.343 0.343 0.347 0.349 0.347 0.337 0.337 0.339 0.368 0.322 0.322 0.324 0.324 0.326 0.318 0.352 0.333 0.333 0.333 0.354 0.351 0.339 0.337 0.354 0.356 0.356 0.351 0.358 0.351 0.351 0.347 0.347 0.349 0.347 0.352 0.351 0.349 46 'Setia'_ hap2 0.333 0.331 0.331 0.331 0.331 0.330 0.341 0.339 0.339 0.347 0.349 0.347 0.330 0.333 0.335 0.366 0.320 0.320 0.322 0.322 0.324 0.316 0.347 0.328 0.328 0.328 0.354 0.351 0.335 0.333 0.352 0.354 0.354 0.349 0.356 0.352 0.352 0.349 0.349 0.351 0.352 0.354 0.352 0.351 0.011 47 'Setia'_ hap3 0.337 0.335 0.335 0.335 0.335 0.333 0.345 0.343 0.343 0.351 0.352 0.351 0.337 0.341 0.339 0.368 0.330 0.330 0.331 0.331 0.333 0.326 0.358 0.341 0.341 0.341 0.358 0.354 0.337 0.335 0.356 0.358 0.358 0.352 0.364 0.356 0.356 0.352 0.352 0.354 0.352 0.358 0.356 0.354 0.013 0.013 48 S.subvaricosa_ hap1 0.220 0.197 0.195 0.195 0.209 0.207 0.216 0.215 0.216 0.218 0.218 0.218 0.216 0.193 0.218 0.270 0.215 0.215 0.218 0.215 0.211 0.216 0.220 0.211 0.215 0.211 0.226 0.232 0.215 0.213 0.205 0.205 0.203 0.209 0.197 0.004 0.002 0.002 0.004 0.002 0.006 0.004 0.004 0.004 0.349 0.351 0.354 49 S.subvaricosa_ hap2 0.220 0.197 0.195 0.195 0.209 0.207 0.216 0.215 0.216 0.218 0.218 0.218 0.216 0.193 0.218 0.270 0.215 0.215 0.218 0.215 0.211 0.216 0.220 0.211 0.215 0.211 0.226 0.232 0.215 0.213 0.205 0.205 0.203 0.209 0.197 0.004 0.002 0.002 0.004 0.002 0.006 0.004 0.004 0.004 0.349 0.351 0.354 0.000 50 S.subvaricosa_ hap3 0.218 0.195 0.193 0.193 0.207 0.205 0.215 0.213 0.215 0.216 0.216 0.216 0.215 0.192 0.220 0.272 0.213 0.213 0.216 0.213 0.209 0.215 0.218 0.209 0.213 0.209 0.224 0.230 0.213 0.211 0.207 0.207 0.205 0.211 0.195 0.006 0.004 0.004 0.006 0.004 0.008 0.006 0.006 0.006 0.347 0.349 0.352 0.002 0.002 51 S.subvaricosa_ hap4 0.218 0.195 0.193 0.193 0.207 0.205 0.215 0.213 0.215 0.216 0.216 0.216 0.215 0.192 0.216 0.268 0.213 0.213 0.216 0.213 0.209 0.215 0.218 0.209 0.213 0.209 0.224 0.230 0.213 0.211 0.203 0.203 0.201 0.207 0.199 0.006 0.004 0.004 0.006 0.004 0.008 0.006 0.006 0.006 0.349 0.351 0.354 0.002 0.002 0.004 52 S.subvaricosa_ hap5 0.218 0.199 0.197 0.197 0.207 0.205 0.215 0.213 0.215 0.216 0.216 0.216 0.215 0.192 0.216 0.272 0.213 0.213 0.216 0.213 0.209 0.215 0.222 0.213 0.216 0.213 0.228 0.234 0.216 0.215 0.207 0.207 0.205 0.211 0.195 0.006 0.004 0.004 0.006 0.004 0.008 0.006 0.006 0.006 0.349 0.351 0.354 0.002 0.002 0.004 0.004 53 S.subvaricosa_ hap6 0.182 0.165 0.163 0.163 0.182 0.182 0.186 0.184 0.182 0.192 0.193 0.192 0.201 0.205 0.176 0.287 0.178 0.174 0.178 0.178 0.182 0.176 0.182 0.193 0.197 0.193 0.199 0.197 0.188 0.186 0.192 0.193 0.193 0.195 0.211 0.205 0.207 0.205 0.209 0.205 0.203 0.207 0.207 0.203 0.349 0.349 0.351 0.207 0.207 0.205 0.205 0.209 54 S.subvaricosa_ hap7 0.163 0.140 0.138 0.138 0.163 0.163 0.167 0.165 0.163 0.178 0.180 0.178 0.192 0.180 0.149 0.282 0.165 0.161 0.169 0.165 0.169 0.163 0.172 0.172 0.176 0.172 0.199 0.197 0.182 0.180 0.174 0.176 0.176 0.178 0.218 0.203 0.205 0.203 0.207 0.203 0.201 0.209 0.209 0.205 0.337 0.337 0.343 0.205 0.205 0.203 0.203 0.207 0.057 55 S.subvaricosa_ hap8 0.169 0.142 0.140 0.140 0.169 0.169 0.169 0.167 0.165 0.180 0.182 0.180 0.193 0.182 0.149 0.276 0.172 0.169 0.176 0.172 0.176 0.170 0.174 0.176 0.180 0.176 0.203 0.201 0.182 0.180 0.167 0.169 0.169 0.170 0.226 0.197 0.199 0.197 0.201 0.197 0.195 0.203 0.203 0.199 0.345 0.345 0.347 0.199 0.199 0.201 0.197 0.201 0.061 0.010 56 P.glabrata_ hap1 0.193 0.159 0.157 0.157 0.197 0.197 0.199 0.197 0.195 0.167 0.172 0.167 0.195 0.199 0.192 0.284 0.180 0.176 0.178 0.180 0.182 0.182 0.190 0.220 0.222 0.222 0.201 0.203 0.224 0.222 0.218 0.218 0.220 0.222 0.222 0.222 0.224 0.222 0.228 0.224 0.218 0.226 0.224 0.224 0.343 0.343 0.351 0.224 0.224 0.226 0.222 0.222 0.186 0.170 0.170 57 P.glabrata_ hap2 0.195 0.157 0.155 0.155 0.195 0.195 0.197 0.195 0.193 0.169 0.174 0.169 0.193 0.201 0.190 0.285 0.178 0.174 0.176 0.178 0.180 0.180 0.188 0.218 0.220 0.220 0.203 0.205 0.226 0.224 0.220 0.220 0.222 0.224 0.224 0.224 0.226 0.224 0.230 0.226 0.220 0.228 0.226 0.226 0.343 0.343 0.351 0.226 0.226 0.228 0.224 0.224 0.188 0.172 0.172 0.002 58 P.glabrata_ hap3 0.195 0.157 0.155 0.155 0.199 0.199 0.201 0.199 0.197 0.165 0.170 0.165 0.197 0.201 0.193 0.285 0.182 0.178 0.180 0.182 0.184 0.184 0.188 0.222 0.224 0.224 0.203 0.205 0.226 0.224 0.220 0.220 0.222 0.224 0.224 0.224 0.226 0.224 0.230 0.226 0.220 0.228 0.226 0.226 0.345 0.345 0.352 0.226 0.226 0.228 0.224 0.224 0.184 0.169 0.169 0.002 0.004

FCUP 91 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Appendix 3

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 1 A.angioyi_ hap1 2 A.angioyi_ hap2 0.002 3 A.beanii 0.093 0.093 4 A.cimex 0.088 0.088 0.026 5 A.discors 0.128 0.130 0.130 0.137 6 A.formicarum_ hap1 0.095 0.095 0.060 0.063 0.153 7 A.formicarum_ hap2 0.093 0.093 0.060 0.063 0.149 0.005 8 A.formicarum_ hap3 0.091 0.091 0.058 0.060 0.147 0.007 0.002 9 A.geryonia 0.088 0.088 0.030 0.005 0.137 0.063 0.063 0.060 10 A.lanciae 0.128 0.126 0.126 0.135 0.067 0.137 0.133 0.130 0.135 11 A.lineata 0.133 0.135 0.130 0.133 0.053 0.147 0.142 0.140 0.133 0.051 12 A.mamillata 0.086 0.086 0.030 0.014 0.140 0.063 0.063 0.060 0.014 0.133 0.130 13 A.punctura 0.100 0.100 0.093 0.091 0.133 0.098 0.093 0.091 0.091 0.130 0.126 0.091 14 A.scabra 0.144 0.144 0.135 0.137 0.086 0.158 0.153 0.151 0.135 0.072 0.074 0.142 0.144 15 A.sleursi_ hap1 0.100 0.100 0.063 0.070 0.137 0.053 0.053 0.051 0.070 0.142 0.144 0.065 0.088 0.151 16 A.sleursi_ hap2 0.081 0.081 0.058 0.060 0.130 0.063 0.058 0.056 0.060 0.137 0.137 0.056 0.088 0.144 0.047 17 A.subcrenulata 0.095 0.095 0.033 0.037 0.137 0.056 0.056 0.053 0.037 0.128 0.126 0.035 0.079 0.137 0.067 0.058 18 A.tenera 0.112 0.112 0.098 0.098 0.140 0.112 0.112 0.109 0.098 0.140 0.142 0.102 0.105 0.135 0.109 0.107 0.098 19 B.ovummuscae_ hap1 0.323 0.326 0.335 0.330 0.347 0.314 0.314 0.314 0.328 0.344 0.337 0.330 0.323 0.344 0.333 0.326 0.323 0.330 20 B.ovummuscae_ hap2 0.323 0.326 0.335 0.330 0.347 0.314 0.314 0.314 0.328 0.344 0.337 0.330 0.323 0.344 0.333 0.326 0.323 0.330 0.000 21 C.trifasciata_ hap1 0.102 0.102 0.081 0.100 0.126 0.095 0.095 0.093 0.100 0.126 0.123 0.098 0.095 0.133 0.102 0.102 0.093 0.102 0.330 0.330 22 C.trifasciata_ hap2 0.095 0.095 0.079 0.095 0.126 0.091 0.091 0.088 0.095 0.116 0.116 0.093 0.095 0.126 0.095 0.095 0.088 0.102 0.323 0.323 0.012 23 C.trifasciata_ hap3 0.098 0.098 0.084 0.100 0.128 0.095 0.095 0.093 0.100 0.119 0.119 0.098 0.100 0.130 0.100 0.095 0.093 0.107 0.326 0.326 0.016 0.005 24 C.trifasciata_ hap4 0.098 0.098 0.084 0.098 0.128 0.093 0.093 0.091 0.098 0.123 0.121 0.095 0.100 0.130 0.102 0.098 0.091 0.107 0.321 0.321 0.014 0.007 0.012 25 C.trifasciata_ hap5 0.098 0.098 0.081 0.095 0.123 0.091 0.091 0.088 0.095 0.119 0.116 0.093 0.095 0.126 0.098 0.098 0.088 0.102 0.323 0.323 0.009 0.002 0.007 0.005 26 C.trifasciata_ hap6 0.093 0.093 0.077 0.093 0.123 0.088 0.088 0.086 0.093 0.114 0.114 0.091 0.093 0.123 0.093 0.093 0.086 0.100 0.321 0.321 0.014 0.002 0.007 0.009 0.005 27 C.trifasciata_ hap7 0.093 0.093 0.079 0.091 0.116 0.088 0.088 0.086 0.091 0.116 0.114 0.091 0.091 0.123 0.095 0.095 0.084 0.102 0.326 0.326 0.021 0.014 0.019 0.016 0.012 0.016 28 C.beniamina 0.144 0.147 0.137 0.140 0.172 0.151 0.147 0.144 0.142 0.170 0.165 0.135 0.121 0.160 0.144 0.133 0.128 0.142 0.328 0.328 0.133 0.133 0.135 0.135 0.133 0.130 0.128 29 C.postrema_ hap1 0.123 0.126 0.140 0.140 0.144 0.160 0.160 0.158 0.142 0.174 0.160 0.135 0.130 0.158 0.149 0.133 0.137 0.133 0.333 0.333 0.140 0.142 0.144 0.140 0.140 0.140 0.135 0.074 30 C.postrema_ hap2 0.123 0.126 0.140 0.140 0.147 0.160 0.160 0.158 0.142 0.177 0.163 0.135 0.133 0.156 0.149 0.133 0.137 0.133 0.335 0.335 0.140 0.142 0.144 0.140 0.140 0.140 0.135 0.077 0.002 31 M.crassa 0.088 0.088 0.091 0.093 0.140 0.081 0.079 0.077 0.093 0.126 0.142 0.088 0.088 0.149 0.093 0.084 0.081 0.116 0.328 0.328 0.100 0.102 0.107 0.105 0.100 0.100 0.098 0.133 0.130 0.133 32 O.semicostata_ hap1 0.109 0.109 0.086 0.098 0.160 0.116 0.114 0.112 0.102 0.142 0.147 0.093 0.119 0.151 0.105 0.098 0.088 0.137 0.335 0.335 0.109 0.107 0.107 0.112 0.109 0.109 0.109 0.144 0.156 0.156 0.091 33 O.semicostata_hap2 0.114 0.114 0.093 0.102 0.163 0.126 0.123 0.121 0.107 0.140 0.147 0.102 0.126 0.153 0.119 0.112 0.095 0.142 0.347 0.347 0.116 0.114 0.114 0.119 0.116 0.116 0.114 0.151 0.165 0.165 0.093 0.026 34 P.inconspicua 0.165 0.165 0.144 0.153 0.193 0.153 0.149 0.147 0.153 0.193 0.195 0.149 0.174 0.198 0.165 0.140 0.151 0.151 0.330 0.330 0.170 0.170 0.170 0.170 0.167 0.167 0.165 0.193 0.198 0.198 0.142 0.151 0.156 35 P.marginata 0.177 0.177 0.165 0.174 0.200 0.170 0.165 0.163 0.172 0.198 0.202 0.172 0.181 0.202 0.170 0.153 0.177 0.172 0.344 0.344 0.191 0.181 0.186 0.184 0.184 0.179 0.179 0.200 0.198 0.198 0.160 0.174 0.174 0.072 36 P.philippi 0.181 0.181 0.151 0.163 0.200 0.167 0.163 0.165 0.158 0.191 0.195 0.165 0.170 0.200 0.174 0.172 0.158 0.177 0.353 0.353 0.181 0.181 0.181 0.186 0.184 0.179 0.179 0.184 0.198 0.200 0.158 0.160 0.156 0.098 0.102 37 P.sarsii 0.167 0.167 0.147 0.156 0.191 0.156 0.151 0.149 0.156 0.191 0.193 0.151 0.172 0.198 0.167 0.142 0.153 0.153 0.328 0.328 0.172 0.172 0.172 0.172 0.170 0.170 0.167 0.191 0.195 0.198 0.140 0.153 0.158 0.002 0.074 0.095 38 R.auriscalpium_ hap1 0.163 0.163 0.137 0.151 0.195 0.153 0.149 0.147 0.147 0.188 0.193 0.149 0.158 0.191 0.158 0.151 0.149 0.172 0.363 0.363 0.167 0.167 0.172 0.172 0.170 0.165 0.165 0.184 0.191 0.193 0.133 0.151 0.147 0.079 0.079 0.042 0.077 39 R.auriscalpium_ hap2 0.165 0.165 0.135 0.149 0.193 0.156 0.151 0.149 0.144 0.186 0.191 0.151 0.158 0.188 0.160 0.153 0.147 0.170 0.363 0.363 0.170 0.170 0.174 0.174 0.172 0.167 0.167 0.186 0.193 0.195 0.135 0.153 0.149 0.081 0.084 0.042 0.079 0.005 40 R.guerinii 0.172 0.172 0.137 0.151 0.198 0.158 0.153 0.151 0.147 0.191 0.198 0.153 0.160 0.193 0.163 0.156 0.153 0.174 0.367 0.367 0.177 0.177 0.181 0.181 0.179 0.174 0.174 0.191 0.198 0.200 0.137 0.156 0.156 0.088 0.084 0.047 0.086 0.009 0.009 41 R.guernei_ hap1 0.174 0.174 0.149 0.160 0.205 0.170 0.165 0.163 0.156 0.200 0.205 0.163 0.172 0.202 0.174 0.167 0.156 0.181 0.365 0.365 0.188 0.184 0.188 0.188 0.186 0.181 0.179 0.200 0.207 0.209 0.163 0.167 0.172 0.107 0.105 0.063 0.105 0.051 0.051 0.047 42 R.guernei _hap2 0.170 0.170 0.144 0.156 0.200 0.165 0.160 0.158 0.151 0.195 0.200 0.158 0.167 0.198 0.170 0.163 0.151 0.177 0.365 0.365 0.184 0.179 0.184 0.184 0.181 0.177 0.174 0.195 0.202 0.205 0.158 0.163 0.167 0.102 0.100 0.058 0.100 0.047 0.047 0.042 0.005 43 R.guernei_ hap3 0.170 0.170 0.144 0.156 0.200 0.165 0.160 0.158 0.151 0.195 0.200 0.158 0.167 0.198 0.170 0.163 0.151 0.177 0.365 0.365 0.184 0.179 0.184 0.184 0.181 0.177 0.174 0.195 0.202 0.205 0.158 0.163 0.167 0.102 0.100 0.058 0.100 0.047 0.047 0.042 0.005 0.000 44 R.guernei_ hap4 0.170 0.170 0.144 0.156 0.200 0.165 0.160 0.158 0.151 0.195 0.200 0.158 0.167 0.198 0.170 0.163 0.151 0.177 0.365 0.365 0.184 0.179 0.184 0.184 0.181 0.177 0.174 0.195 0.202 0.205 0.158 0.163 0.167 0.102 0.100 0.058 0.100 0.047 0.047 0.042 0.005 0.000 0.000 45 R.guernei_ hap5 0.172 0.172 0.147 0.158 0.198 0.167 0.163 0.160 0.153 0.198 0.195 0.160 0.170 0.200 0.172 0.165 0.153 0.179 0.365 0.365 0.186 0.181 0.186 0.186 0.184 0.179 0.177 0.198 0.200 0.202 0.160 0.165 0.170 0.102 0.100 0.058 0.100 0.047 0.047 0.042 0.009 0.005 0.005 0.005 46 R.guernei_ hap6 0.172 0.172 0.142 0.153 0.202 0.167 0.163 0.160 0.149 0.198 0.200 0.156 0.170 0.200 0.172 0.165 0.153 0.179 0.365 0.365 0.186 0.181 0.186 0.186 0.184 0.179 0.177 0.198 0.205 0.207 0.160 0.165 0.170 0.098 0.095 0.053 0.095 0.042 0.042 0.037 0.009 0.005 0.005 0.005 0.005 47 R.membranacea_ hap1 0.170 0.170 0.160 0.160 0.193 0.172 0.167 0.165 0.156 0.198 0.191 0.153 0.160 0.195 0.170 0.163 0.153 0.172 0.367 0.367 0.181 0.181 0.186 0.186 0.181 0.179 0.174 0.188 0.195 0.198 0.147 0.160 0.158 0.107 0.102 0.072 0.105 0.056 0.056 0.060 0.065 0.060 0.060 0.060 0.060 0.060 48 R.membranacea _hap2 0.170 0.170 0.156 0.158 0.191 0.163 0.163 0.160 0.153 0.191 0.188 0.153 0.163 0.198 0.170 0.170 0.149 0.174 0.358 0.358 0.174 0.174 0.179 0.179 0.174 0.172 0.167 0.198 0.200 0.202 0.151 0.163 0.158 0.112 0.100 0.065 0.109 0.056 0.056 0.060 0.072 0.067 0.067 0.067 0.067 0.067 0.035 49 R.lia 0.179 0.177 0.167 0.179 0.207 0.165 0.160 0.163 0.174 0.200 0.207 0.177 0.172 0.207 0.181 0.165 0.165 0.186 0.356 0.356 0.188 0.188 0.191 0.193 0.191 0.186 0.186 0.184 0.195 0.198 0.144 0.163 0.158 0.100 0.093 0.040 0.098 0.037 0.042 0.042 0.065 0.060 0.060 0.060 0.060 0.060 0.072 0.074 50 R.monodonta 0.184 0.181 0.170 0.181 0.205 0.174 0.170 0.172 0.177 0.193 0.207 0.184 0.170 0.205 0.181 0.174 0.167 0.188 0.356 0.356 0.191 0.188 0.191 0.193 0.191 0.186 0.188 0.200 0.207 0.209 0.170 0.170 0.165 0.119 0.119 0.079 0.116 0.067 0.067 0.072 0.088 0.084 0.084 0.084 0.086 0.086 0.074 0.077 0.067 51 R.parva 0.170 0.170 0.153 0.165 0.202 0.147 0.142 0.144 0.160 0.195 0.200 0.163 0.163 0.195 0.158 0.160 0.153 0.177 0.358 0.358 0.179 0.174 0.179 0.179 0.177 0.172 0.170 0.191 0.198 0.200 0.151 0.156 0.153 0.107 0.098 0.051 0.105 0.037 0.042 0.047 0.053 0.049 0.049 0.049 0.049 0.049 0.049 0.056 0.044 0.056 52 R.similis 0.172 0.172 0.149 0.160 0.207 0.170 0.165 0.163 0.156 0.198 0.205 0.163 0.172 0.207 0.179 0.163 0.160 0.181 0.363 0.363 0.188 0.188 0.188 0.193 0.191 0.186 0.184 0.193 0.205 0.207 0.158 0.170 0.170 0.098 0.095 0.047 0.095 0.040 0.040 0.035 0.028 0.023 0.023 0.023 0.023 0.019 0.060 0.067 0.056 0.084 0.051 53 R.variabilis 0.184 0.184 0.156 0.167 0.209 0.165 0.160 0.163 0.163 0.195 0.205 0.170 0.167 0.207 0.179 0.174 0.158 0.177 0.360 0.360 0.184 0.184 0.188 0.188 0.186 0.181 0.181 0.198 0.207 0.209 0.142 0.170 0.163 0.102 0.100 0.037 0.100 0.037 0.037 0.042 0.056 0.051 0.051 0.051 0.051 0.051 0.067 0.065 0.040 0.077 0.042 0.049 54 R.ventricosa 0.193 0.193 0.165 0.181 0.209 0.174 0.170 0.167 0.177 0.205 0.205 0.172 0.188 0.207 0.172 0.170 0.172 0.184 0.351 0.351 0.191 0.188 0.193 0.193 0.191 0.186 0.188 0.188 0.205 0.205 0.177 0.172 0.170 0.072 0.060 0.091 0.072 0.077 0.077 0.086 0.102 0.098 0.098 0.098 0.098 0.093 0.098 0.095 0.091 0.100 0.086 0.098 0.093 55 R.violacae 0.172 0.170 0.170 0.179 0.202 0.163 0.158 0.160 0.174 0.205 0.207 0.177 0.174 0.209 0.167 0.153 0.172 0.186 0.344 0.344 0.191 0.191 0.193 0.195 0.193 0.188 0.186 0.198 0.193 0.195 0.153 0.172 0.170 0.107 0.091 0.056 0.105 0.047 0.051 0.056 0.077 0.072 0.072 0.072 0.067 0.072 0.060 0.074 0.047 0.065 0.040 0.067 0.058 0.100 56 S.subvaricosa_ hap1 0.170 0.170 0.144 0.156 0.200 0.165 0.160 0.158 0.151 0.195 0.200 0.158 0.167 0.198 0.170 0.163 0.151 0.177 0.365 0.365 0.184 0.179 0.184 0.184 0.181 0.177 0.174 0.195 0.202 0.205 0.158 0.163 0.167 0.102 0.100 0.058 0.100 0.047 0.047 0.042 0.005 0.000 0.000 0.000 0.005 0.005 0.060 0.067 0.060 0.084 0.049 0.023 0.051 0.098 0.072 57 S.subvaricosa _hap2 0.170 0.170 0.144 0.156 0.200 0.165 0.160 0.158 0.151 0.195 0.200 0.158 0.167 0.198 0.170 0.163 0.151 0.177 0.365 0.365 0.184 0.179 0.184 0.184 0.181 0.177 0.174 0.195 0.202 0.205 0.158 0.163 0.167 0.102 0.100 0.058 0.100 0.047 0.047 0.042 0.005 0.000 0.000 0.000 0.005 0.005 0.060 0.067 0.060 0.084 0.049 0.023 0.051 0.098 0.072 0.000 58 S.subvaricosa_ hap3 0.167 0.167 0.147 0.158 0.202 0.163 0.158 0.156 0.153 0.198 0.202 0.156 0.170 0.200 0.167 0.160 0.153 0.179 0.365 0.365 0.181 0.177 0.181 0.181 0.179 0.174 0.172 0.193 0.200 0.202 0.156 0.160 0.165 0.100 0.098 0.060 0.098 0.044 0.049 0.044 0.007 0.002 0.002 0.002 0.007 0.007 0.063 0.070 0.058 0.086 0.047 0.026 0.053 0.095 0.070 0.002 0.002 59 S.subvaricosa_ hap4 0.167 0.167 0.142 0.153 0.198 0.163 0.158 0.156 0.149 0.193 0.198 0.156 0.170 0.195 0.167 0.160 0.149 0.179 0.363 0.363 0.181 0.177 0.181 0.181 0.179 0.174 0.172 0.198 0.205 0.207 0.156 0.160 0.165 0.100 0.098 0.060 0.098 0.044 0.044 0.040 0.007 0.002 0.002 0.002 0.007 0.007 0.058 0.065 0.063 0.086 0.051 0.026 0.053 0.100 0.070 0.002 0.002 0.005 60 S.subvaricosa_ hap5 0.179 0.177 0.174 0.172 0.216 0.165 0.160 0.160 0.167 0.212 0.209 0.165 0.181 0.214 0.177 0.160 0.167 0.188 0.330 0.330 0.193 0.193 0.195 0.198 0.193 0.191 0.188 0.212 0.214 0.216 0.170 0.188 0.191 0.126 0.147 0.137 0.123 0.130 0.135 0.140 0.153 0.149 0.149 0.149 0.144 0.147 0.128 0.119 0.133 0.142 0.133 0.151 0.137 0.133 0.123 0.149 0.149 0.147 0.147 61 S.subvaricosa_ hap6 0.181 0.179 0.177 0.177 0.214 0.170 0.165 0.165 0.172 0.214 0.205 0.170 0.186 0.214 0.179 0.163 0.172 0.188 0.330 0.330 0.195 0.195 0.198 0.200 0.195 0.193 0.191 0.216 0.216 0.219 0.172 0.191 0.193 0.128 0.144 0.135 0.126 0.133 0.137 0.142 0.151 0.147 0.147 0.147 0.142 0.144 0.128 0.119 0.130 0.140 0.130 0.149 0.135 0.130 0.121 0.147 0.147 0.144 0.144 0.005 62 A.contabulatum 0.207 0.205 0.202 0.205 0.226 0.195 0.195 0.193 0.205 0.233 0.221 0.205 0.198 0.240 0.216 0.207 0.200 0.228 0.312 0.312 0.221 0.216 0.219 0.221 0.219 0.214 0.216 0.226 0.237 0.240 0.214 0.219 0.223 0.226 0.242 0.228 0.223 0.230 0.230 0.237 0.242 0.242 0.242 0.242 0.240 0.240 0.233 0.221 0.233 0.228 0.223 0.240 0.233 0.233 0.237 0.242 0.242 0.242 0.242 0.223 0.221 63 P.glabrata _hap1 0.244 0.244 0.233 0.240 0.260 0.240 0.235 0.237 0.237 0.274 0.265 0.240 0.249 0.251 0.247 0.244 0.242 0.260 0.349 0.349 0.242 0.244 0.249 0.249 0.244 0.242 0.242 0.260 0.256 0.253 0.242 0.256 0.249 0.263 0.265 0.260 0.263 0.256 0.260 0.265 0.279 0.279 0.279 0.279 0.277 0.274 0.272 0.265 0.265 0.272 0.253 0.272 0.258 0.270 0.256 0.279 0.279 0.277 0.277 0.247 0.244 0.174 64 P. glabrata_ hap2 0.247 0.247 0.235 0.242 0.263 0.242 0.237 0.240 0.240 0.277 0.267 0.242 0.251 0.253 0.249 0.247 0.244 0.263 0.351 0.351 0.244 0.247 0.251 0.251 0.247 0.244 0.244 0.263 0.258 0.256 0.244 0.258 0.251 0.265 0.267 0.263 0.265 0.258 0.263 0.267 0.281 0.281 0.281 0.281 0.279 0.277 0.274 0.267 0.267 0.274 0.256 0.274 0.260 0.272 0.258 0.281 0.281 0.279 0.279 0.249 0.247 0.177 0.005

FCUP 92 Phylogenetic analysis of the family Rissoidae (Mollusca: Gastropoda) in the Azores Archipelago (NE Atlantic)

Appendix 4

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 1 A.angioyi_ hap1 2 A.angioyi_ hap2 0.001 3 A.cimex 0.032 0.033 4 A.discors 0.041 0.043 0.056 5 A.formicarum 0.033 0.034 0.020 0.057 6 A.lanciae 0.029 0.030 0.047 0.025 0.044 7 A.lineata 0.028 0.029 0.048 0.030 0.045 0.018 8 A.mediolittoralis 0.035 0.036 0.022 0.059 0.002 0.046 0.047 9 A.scabra 0.028 0.029 0.048 0.036 0.046 0.019 0.013 0.046 10 A.sleursi_ hap1 0.031 0.032 0.017 0.057 0.006 0.046 0.045 0.008 0.046 11 A.sleursi_hap2 0.037 0.038 0.027 0.062 0.012 0.052 0.049 0.015 0.048 0.010 12 A.subcrenulata 0.030 0.031 0.009 0.059 0.017 0.046 0.049 0.019 0.051 0.013 0.024 13 A.tenera 0.031 0.032 0.041 0.039 0.038 0.032 0.032 0.040 0.037 0.038 0.047 0.040 14 B.ovummuscae 0.115 0.116 0.112 0.124 0.102 0.114 0.114 0.102 0.121 0.103 0.110 0.108 0.109 15 C.trifasciata_ hap1 0.030 0.031 0.040 0.052 0.041 0.043 0.049 0.044 0.048 0.044 0.050 0.043 0.036 0.116 16 C.trifasciata_ hap2 0.030 0.031 0.040 0.052 0.041 0.043 0.049 0.044 0.048 0.044 0.050 0.043 0.036 0.116 0.000 17 C.trifasciata_ hap3 0.030 0.031 0.040 0.050 0.041 0.040 0.047 0.044 0.046 0.044 0.050 0.043 0.035 0.118 0.004 0.004 18 C.postrema 0.013 0.015 0.045 0.040 0.041 0.030 0.031 0.044 0.033 0.041 0.047 0.038 0.035 0.117 0.038 0.038 0.036 19 O.semicostata 0.050 0.051 0.055 0.061 0.046 0.055 0.052 0.048 0.055 0.050 0.052 0.053 0.044 0.103 0.052 0.052 0.050 0.045 20 P.inconspicua 0.070 0.071 0.072 0.079 0.074 0.074 0.078 0.076 0.079 0.076 0.083 0.075 0.064 0.115 0.066 0.066 0.064 0.068 0.064 21 P.marginata 0.071 0.072 0.073 0.080 0.075 0.075 0.079 0.077 0.080 0.077 0.084 0.076 0.065 0.116 0.067 0.067 0.065 0.070 0.065 0.001 22 P.philippi 0.074 0.075 0.076 0.084 0.079 0.079 0.083 0.081 0.083 0.081 0.088 0.079 0.072 0.121 0.073 0.073 0.071 0.074 0.074 0.011 0.010 23 P.radiata 0.072 0.073 0.076 0.079 0.078 0.076 0.080 0.080 0.081 0.080 0.087 0.079 0.066 0.116 0.071 0.071 0.071 0.071 0.067 0.007 0.006 0.010 24 R.auriscalpium 0.074 0.075 0.079 0.088 0.075 0.075 0.085 0.077 0.082 0.078 0.083 0.079 0.074 0.114 0.074 0.074 0.074 0.074 0.072 0.032 0.033 0.041 0.037 25 R.guerinii 0.075 0.076 0.080 0.088 0.076 0.074 0.084 0.078 0.081 0.079 0.084 0.080 0.076 0.114 0.076 0.076 0.076 0.074 0.072 0.033 0.034 0.043 0.038 0.003 26 R.guernei_ hap1 0.072 0.073 0.079 0.087 0.075 0.071 0.081 0.077 0.080 0.078 0.083 0.077 0.073 0.115 0.073 0.073 0.071 0.071 0.071 0.029 0.030 0.038 0.036 0.009 0.006 27 R.guernei_ hap2 0.072 0.073 0.079 0.087 0.075 0.071 0.081 0.077 0.080 0.078 0.083 0.077 0.073 0.115 0.073 0.073 0.071 0.071 0.071 0.029 0.030 0.038 0.036 0.009 0.006 0.000 28 R.guernei_ hap3 0.072 0.073 0.079 0.087 0.075 0.071 0.081 0.077 0.080 0.078 0.083 0.077 0.073 0.115 0.073 0.073 0.071 0.071 0.071 0.029 0.030 0.038 0.036 0.009 0.006 0.000 0.000 29 R.guernei_ hap4 0.073 0.074 0.080 0.088 0.076 0.072 0.082 0.078 0.081 0.079 0.084 0.078 0.074 0.116 0.074 0.074 0.072 0.072 0.072 0.030 0.031 0.039 0.037 0.010 0.007 0.001 0.001 0.001 30 R.guernei_ hap5 0.073 0.074 0.080 0.088 0.076 0.072 0.082 0.078 0.081 0.079 0.084 0.078 0.074 0.116 0.074 0.074 0.072 0.072 0.072 0.030 0.031 0.039 0.037 0.010 0.007 0.001 0.001 0.001 0.000 31 R.guernei_ hap6 0.072 0.073 0.079 0.087 0.075 0.071 0.081 0.077 0.080 0.078 0.083 0.077 0.073 0.115 0.073 0.073 0.071 0.071 0.071 0.029 0.030 0.038 0.036 0.009 0.006 0.000 0.000 0.000 0.001 0.001 32 R.membranacea 0.071 0.072 0.076 0.083 0.070 0.075 0.077 0.072 0.078 0.073 0.078 0.076 0.077 0.115 0.075 0.075 0.075 0.070 0.070 0.034 0.035 0.043 0.038 0.015 0.013 0.016 0.016 0.016 0.017 0.017 0.016 33 R.lia 0.074 0.075 0.077 0.082 0.079 0.077 0.081 0.081 0.082 0.081 0.088 0.080 0.071 0.119 0.073 0.073 0.071 0.072 0.068 0.007 0.006 0.013 0.008 0.037 0.038 0.034 0.034 0.034 0.035 0.035 0.034 0.037 34 R.monodonta 0.072 0.073 0.075 0.087 0.070 0.072 0.079 0.072 0.077 0.072 0.080 0.073 0.070 0.113 0.074 0.074 0.072 0.073 0.072 0.036 0.037 0.044 0.043 0.027 0.027 0.023 0.023 0.023 0.024 0.024 0.023 0.022 0.037 35 R.ventricosa 0.073 0.074 0.078 0.084 0.074 0.072 0.082 0.076 0.079 0.075 0.080 0.078 0.074 0.116 0.074 0.074 0.074 0.072 0.070 0.033 0.034 0.043 0.038 0.007 0.006 0.006 0.006 0.006 0.007 0.007 0.006 0.013 0.036 0.025 36 S.ambigua 0.071 0.072 0.077 0.085 0.072 0.068 0.079 0.074 0.076 0.074 0.079 0.075 0.071 0.113 0.068 0.068 0.066 0.070 0.067 0.031 0.032 0.038 0.037 0.018 0.017 0.012 0.012 0.012 0.013 0.013 0.012 0.018 0.034 0.021 0.015 37 'Setia' 0.273 0.274 0.268 0.272 0.278 0.269 0.275 0.278 0.273 0.275 0.279 0.270 0.275 0.269 0.273 0.273 0.274 0.273 0.271 0.271 0.272 0.274 0.269 0.273 0.273 0.273 0.273 0.273 0.274 0.274 0.273 0.273 0.272 0.277 0.268 0.273 38 S.subvaricosa_ hap1 0.072 0.073 0.079 0.087 0.075 0.071 0.081 0.077 0.080 0.078 0.083 0.077 0.073 0.115 0.073 0.073 0.071 0.071 0.071 0.029 0.030 0.038 0.036 0.009 0.006 0.000 0.000 0.000 0.001 0.001 0.000 0.016 0.034 0.023 0.006 0.012 0.273 39 S.subvaricosa_ hap2 0.072 0.073 0.079 0.087 0.075 0.071 0.081 0.077 0.080 0.078 0.083 0.077 0.073 0.115 0.073 0.073 0.071 0.071 0.071 0.029 0.030 0.038 0.036 0.009 0.006 0.000 0.000 0.000 0.001 0.001 0.000 0.016 0.034 0.023 0.006 0.012 0.273 0.000 40 S.subvaricosa_ hap3 0.085 0.086 0.090 0.099 0.092 0.091 0.094 0.094 0.091 0.091 0.095 0.091 0.088 0.129 0.090 0.090 0.090 0.088 0.088 0.057 0.058 0.059 0.056 0.062 0.065 0.063 0.063 0.063 0.064 0.064 0.063 0.061 0.058 0.064 0.065 0.057 0.267 0.063 0.063 41 S.subvaricosa_ hap4 0.085 0.086 0.090 0.099 0.092 0.091 0.094 0.094 0.091 0.091 0.095 0.091 0.088 0.129 0.090 0.090 0.090 0.088 0.088 0.057 0.058 0.059 0.056 0.062 0.065 0.063 0.063 0.063 0.064 0.064 0.063 0.061 0.058 0.064 0.065 0.057 0.267 0.063 0.063 0.000 42 A.contabulatum 0.122 0.123 0.132 0.138 0.121 0.130 0.130 0.121 0.131 0.121 0.122 0.129 0.119 0.062 0.124 0.124 0.124 0.127 0.118 0.127 0.128 0.129 0.130 0.128 0.127 0.124 0.124 0.124 0.126 0.126 0.124 0.130 0.132 0.127 0.127 0.123 0.272 0.124 0.124 0.139 0.139