DOCSLIB.ORG

Evidence for a Degradosome-Like Complex in the Mitochondria of Trypanosoma Brucei

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Evidence for a Degradosome-Like Complex in the Mitochondria of Trypanosoma Brucei FEBS Letters 583 (2009) 2333–2338 journal homepage: www.FEBSLetters.org Evidence for a degradosome-like complex in the mitochondria of Trypanosoma brucei Jonelle L. Mattiacio 1, Laurie K. Read * Depatment of Microbiology and Immunology, Witebsky Center for Microbial Pathogenesis and Immunology, SUNY Buffalo School of Medicine, Buffalo, NY 14214, USA article info abstract Article history: Mitochondrial RNA turnover in yeast involves the degradosome, composed of DSS-1 exoribonuc- Received 29 May 2009 lease and SUV3 RNA helicase. Here, we describe a degradosome-like complex, containing SUV3 Accepted 11 June 2009 and DSS-1 homologues, in the early branching protozoan, Trypanosoma brucei. TbSUV3 is mitoc- Available online 18 June 2009 hondrially localized and co-sediments with TbDSS-1 on glycerol gradients. Co-immunoprecipitation demonstrates that TbSUV3 and TbDSS-1 associate in a stable complex, which differs from the yeast Edited by Michael Ibba degradosome in that it is not stably associated with mitochondrial ribosomes. This is the first report of a mitochondrial degradosome-like complex outside of yeast. Our data indicate an early evolution- Keywords: ary origin for the mitochondrial SUV3/DSS-1 containing complex. RNA turnover RNA processing Trypanosome Structured summary: RNA helicase MINT-7187980: SUV3 (genbank_protein_gi:XP_844349) and DSS1 (uniprotkb:Q38EM3) colocalize Exoribonuclease (MI:0403) by cosedimentation (MI:0027) MINT-7188074: SUV3 (genbank_protein_gi:XP_844349) physically interacts (MI:0914) with DSS1 (uni- protkb:Q38EM3) by anti tag co-immunoprecipitation (MI:0007) Ó 2009 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. 1. Introduction only known exoribonuclease involved in yeast mitochondrial RNA (mtRNA) turnover [8]. Saccharomyces cerevisiae strains that The degradation of RNA is an essential element in the regulation are genetically inactivated for either DSS-1 or SUV3 have similar of gene expression. It both controls the abundance of mature RNAs phenotypes, strongly accumulating excised introns as well as and eliminates processing by-products and aberrant or defective mRNA and rRNA precursors with abnormal 50 and 30 termini [9– molecules that form during RNA synthesis and maturation [1]. 11]. These cells also display decreased steady-state levels of ma- RNA degradation is of particular importance in mitochondria ture transcripts along with disruption of translation [7,11,12]. where transcriptional control is minimal and polycistronic tran- Orthologues of the SUV3 helicase are present in the genomes of a scription produces precursor RNAs that require extensive process- wide spectrum of eukaryotes, and they have been shown to be at ing [2–5]. The machineries that catalyze RNA turnover in least partially mitochondrially localized in humans and plants mitochondria exhibit substantial divergence between species [6]. [13–15]. In contrast to yeast, however, human and plant mitochon- In yeast, the mitochondrial degradosome is comprised of an RNR dria lack the DSS-1 exoribonuclease. They do contain the phospho- (RNase II/RNase R-like) family hydrolytic exoribonuclease, encoded rolytic exoribonuclease polynucleotide phosphorylase (PNPase), by DSS-1 gene, and an NTP-dependent RNA helicase, encoded by although there is no evidence for its association with SUV3 the SUV3 gene. DSS-1 and SUV3 appear to be the sole components [16,17]. A recent study demonstrated that human cells depleted of the degradosome based on TAP-tagging studies in yeast, which of the SUV3 helicase accumulate shortened poly(A+) mtRNAs and also showed that the complex is exclusively associated with mito- are impaired in translation [18]. These studies indicate that SUV3 chondrial ribosomes [7]. The degradosome, which exhibits hydro- can profoundly affect mitochondrial RNA metabolism in the ab- lytic 30 to 50 exoribonuclease and RNA helicase activities, is the sence of a yeast-like degradosome complex. Trypanosoma brucei is a protozoan parasite that has consistently been identified as one of the earliest branching mitochondria-con- * Corresponding author. Fax: +1 716 829 2158. taining eukaryotes [19]. Mitochondrial RNA metabolism in T. brucei E-mail address: [email protected] (L.K. Read). is extraordinarily complicated, involving polycistronic transcrip- 1 Present address: University of Rochester, Department of Microbiology and Immunology, 601 Elmwood Ave, Box 672, KMRB, Room 3-9804, Rochester, NY tion, extensively overlapping genes, and massive remodeling of 14642, USA. mRNAs by guide RNA-directed uridine insertion/deletion editing 0014-5793/$36.00 Ó 2009 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2009.06.024 2334 J.L. Mattiacio, L.K. Read / FEBS Letters 583 (2009) 2333–2338 [20]. We previously identified a gene encoding a homologue of DSS- using the procedure of Zeiner et al. [27]. The degree of cytoplasmic 1 in the T. brucei genome (termed TbDSS-1) [21], and a peptide orig- contamination of the mitochondrial preparation was assessed by inating from TbDSS-1 was recently detected in the mitochondrial Western blotting using antibodies against cytoplasmic TbHsp70.4. proteome [22]. Targeted depletion of TbDSS-1 in insect stage T. bru- cei results in aberrant levels of several mitochondrial RNA species, 2.3. Glycerol gradient sedimentation including never edited, unedited and edited mRNAs as well as guide RNAs [21]. TbDSS-1 depleted cells also accumulate RNA maturation Glycerol gradient fractionation of mitochondrial lysates was by-products originating from the region upstream of the first genes performed as previously described [28]. Mitochondrial lysate was on the major and minor strands of the mitochondrial genome, and obtained from 1010 PF T. brucei cell equivalents by adding 500 ll 12S rRNA processing intermediates with mature 30 ends and unpro- of mitochondrial lysis buffer [20 mM Tris–HCl (pH 7.5), 50 mM 0 cessed 5 ends [23]. Overall, these studies suggest that TbDSS-1 rep- KCl, 10 mM MgCl2, 100 lM ATP, 0.2% NP-40, Complete EDTA-free resents at least one of the main exoribonucleases involved in RNA protease inhibitors (Roche)] to purified mitochondria and incubat- turnover and surveillance in T. brucei mitochondria. In the present ing on ice for 10 min prior to centrifugation at 13000Âg for 15 min. study, we report a T. brucei homologue of the SUV3 RNA helicase Five hundred ll of purified mitochondrial lysate was layered onto a (TbSUV3). To determine whether TbSUV3 interacts with TbDSS-1 12-ml 5–20% linear glycerol gradient and centrifuged for 20 h at in a mitochondrial degradosome-like complex, we created a T. bru- 4 °C in Beckman SW-41 rotor at 35000 rpm. Twenty-four 500 ll cei cell line expressing a PTP (ProtC-TEV-ProtA [24]) tagged TbSUV3 fractions were collected from the top of the tube, and 20 ll of each protein at an endogenous allele. We show that the TbSUV3-PTP fu- fraction was analyzed by Western blotting with PAP reagent for the sion protein is properly expressed and targeted to the mitochon- detection of TbSUV3 and polyclonal anti-TbDSS-1 antibodies [21] drion. Glycerol gradient fractionation suggests that TbSUV3 and to detect endogenous TbDSS-1. Standards (cytochrome c, 1.9S; bo- TbDSS-1 co-sediment in a high-molecular-weight complex, and vine serum albumin, 4S; yeast alcohol dehydrogenase, 7.4S; cata- subsequent IgG purification of TbSUV3-PTP containing complexes lase, 11S; and thyroglobulin, 19S) were fractionated in a parallel shows that the two proteins interact in T. brucei mitochondria. gradient and analyzed by SDS–PAGE and Coomassie blue staining. These studies represent the first report of a core enzymatic complex that is likely involved in RNA turnover and surveillance in the 2.4. Immunoprecipitation of the TbSUV3 containing complex mitochondria of T. brucei. Further, this is the first report of a mito- chondrial degradosome-like complex in an organism other than For IgG purification of TbSUV3-PTP, peak glycerol gradient frac- yeast. Our data demonstrate an early evolutionary origin for the tions (7–13) were pooled and fresh protease inhibitor tablet was mitochondrial SUV3/DSS-1 containing complex. added. Five hundred microliters of pooled gradient fractions was incubated with 20 ll IgG Fastflow Sepharose beads (Amersham Biosciences) for 2 h at 4 °C. The bound material was pelleted by 2. Materials and methods centrifugation at 10000Âg for 5 min and the unbound supernatant transferred to a separate tube. The Sepharose beads were then 2.1. Oligonucleotides used for 50 RACE analysis washed three times with PA-150 buffer [20 mM Tris–HCl (pH 7.7), 150 mM KCl, 3 mM MgCl , 0.5 mM DTT, 0.1% Tween 20[ and The oligonucleotides used for 50 RACE are listed as follows with 2 resuspended in Buffer A [10 mM Tris–HCl (pH 8.0), 25 mM KCl, restriction sites underlined. CSL-22 (50-GCATCGATGCTATTATTAGA 10 mM MgCl ]. The IgG Sepharose beads were boiled at 95 °C for ACAGTTTCTGTACTATATTG -30), SUV3-8 (50-GCGGATCCAACGCCGC 2 5 min prior to loading on SDS–PAGE. Ten percent of each fraction GTGAGTCTTCC-30), SUV3 -9 (50-GCGGATCCGTGCCTTCGGGTACCA was analyzed by Western blot to detect TbDSS-1 and TbSUV3- GTC-30). PTP using anti-TbDSS1 antibodies [21] and PAP reagent, respectively. 2.2. Trypanosome cell culture, transfection, and cell fractionation Immunoprecipitations using anti-ProtC antibodies were per- formed as described above with the following modifications. Ten The procyclic form (PF) T. brucei clone IsTAR1 stock EATRO 164 micrograms of anti-ProtC antibody (Roche monoclonal HPC4) was grown as previously described [25]. Stable cell lines constitu- was incubated with 500 ll of pooled gradient fractions in 2 mM tively expressing a TbSUV3 C-terminal PTP tag fusion protein were CaCl2 with rocking at 4 °C for 2 h. Control reactions in the absence generated via electroporation. To generate the pC-PTP-TbSUV3 of antibody were processed in parallel. Twenty microliters of Pro- construct, a 500-nucleotide fragment of TbSUV3 C-terminal coding tein G Sepharose beads was then added to each tube and the slurry 0 0 region was PCR amplified using TbSUV3-PTP5 (5 -GCCGGGGCC was incubated with rocking for an additional 2 h at 4 °C.
Load more

Recommended publications
  • Ribonuclease E Organizes the Protein Interactions in the Escherichia Coli RNA Degradosome
    Downloaded from genesdev.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press Ribonuclease E organizes the protein interactions in the Escherichia coli RNA degradosome Nathalie F. Vanzo,1 Yeun Shan Li,2 Be´atrice Py,2,3 Erwin Blum,2 Christopher F. Higgins,2,4 Lelia C. Raynal,1 Henry M. Krisch,1 and Agamemnon J. Carpousis1,5 1Laboratoire de Microbiologie et Ge´ne´tique Mole´culaire, UPR 9007, Centre National de la Recherche Scientifique (CNRS), 31062 Toulouse Cedex, France; 2Nuffield Department of Clinical Biochemistry and Imperial Cancer Research Fund Laboratories, Institute of Molecular Medicine, John Radcliffe Hospital, University of Oxford, Oxford OX3 9DS, UK The Escherichia coli RNA degradosome is the prototype of a recently discovered family of multiprotein machines involved in the processing and degradation of RNA. The interactions between the various protein components of the RNA degradosome were investigated by Far Western blotting, the yeast two-hybrid assay, and coimmunopurification experiments. Our results demonstrate that the carboxy-terminal half (CTH) of ribonuclease E (RNase E) contains the binding sites for the three other major degradosomal components, the DEAD-box RNA helicase RhlB, enolase, and polynucleotide phosphorylase (PNPase). The CTH of RNase E acts as the scaffold of the complex upon which the other degradosomal components are assembled. Regions for oligomerization were detected in the amino-terminal and central regions of RNase E. Furthermore, polypeptides derived from the highly charged region of RNase E, containing the RhlB binding site, stimulate RhlB activity at least 15-fold, saturating at one polypeptide per RhlB molecule. A model for the regulation of the RhlB RNA helicase activity is presented.
    [Show full text]
  • The Structure and Function of the Gram-Positive Bacterial RNA Degradosome
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Frontiers - Publisher Connector REVIEW published: 03 February 2017 doi: 10.3389/fmicb.2017.00154 The Structure and Function of the Gram-Positive Bacterial RNA Degradosome Kyu Hong Cho* Department of Biology, Indiana State University, Terre Haute, IN, USA The RNA degradosome is a highly structured protein complex responsible for bulk RNA decay in bacteria. The main components of the complex, ribonucleases, an RNA helicase, and glycolytic enzymes are well-conserved in bacteria. Some components of the degradosome are essential for growth and the disruption of degradosome formation causes slower growth, indicating that this complex is required for proper cellular function. The study of the Escherichia coli degradosome has been performed extensively for the last several decades and has revealed detailed information on its structure and function. On the contrary, the Gram-positive bacterial degradosome, which contains ribonucleases different from the E. coli one, has been studied only recently. Studies on the Gram-positive degradosome revealed that its major component RNase Y was necessary for the full virulence of medically important Gram-positive bacterial pathogens, Edited by: suggesting that it could be a target of antimicrobial therapy. This review describes the Marc Bramkamp, Ludwig Maximilian University of structures and function of Gram-positive bacterial RNA degradosomes, especially those Munich, Germany of a Gram-positive model organism Bacillus subtilis, and two important Gram-positive Reviewed by: pathogens, Staphylococcus aureus and Streptococcus pyogenes. Jörg Stülke, University of Göttingen, Germany Keywords: Gram-positive RNA degradosome, B. subtilis, S.
    [Show full text]
  • Lecture 1 Enzymes in Genetic Engineering: Restriction Nucleases
    NPTEL – Bio Technology – Genetic Engineering & Applications MODULE 2: LECTURE 1 ENZYMES IN GENETIC ENGINEERING: RESTRICTION NUCLEASES: EXO & ENDO NUCLEASES 2-1.1 Introduction: A restriction enzyme is a nuclease enzyme that cleaves DNA sequence at a random or specific recognition sites known as restriction sites. In bacteria, restriction enzymes form a combined system (restriction + modification system) with modification enzymes that methylate the bacterial DNA. Methylation of bacterial DNA at the recognition sequence typically protects the own DNA of the bacteria from being cleaved by restriction enzyme. There are two different kinds of restriction enzymes: (1) Exonucleases catalyses hydrolysis of terminal nucleotides from the end of DNA or RNA molecule either 5’to 3’ direction or 3’ to 5’ direction. Example: exonuclease I, exonuclease II etc. (2) Endonucleases can recognize specific base sequence (restriction site) within DNA or RNA molecule and cleave internal phosphodiester bonds within a DNA molecule. Example: EcoRI, Hind III, BamHI etc. 2-1.2History: In 1970 the first restriction endonuclease enzyme HindII was isolated. For the subsequent discovery and characterization of numerous restriction endonucleases, in 1978 Daniel Nathans, Werner Arber, and Hamilton O. Smith awarded for Nobel Prize for Physiology or Medicine. Since then, restriction enzymes have been used as an essential tool in recombinant DNA technology. Joint initiative of IITs and IISc – Funded by MHRD Page 1 of 30 NPTEL – Bio Technology – Genetic Engineering & Applications 2-1.3 Restriction Endonuclease Nomenclature: Restriction endonucleases are named according to the organism in which they were discovered, using a system of letters and numbers. For example, HindIII (pronounced “hindee-three”) was discovered in Haemophilus influenza (strain d).
    [Show full text]
  • RNA Degradosomes Exist in Vivo in Escherichia Coli As Multicomponent Complexes Associated with the Cytoplasmic Membrane Via the N-Terminal Region of Ribonuclease E
    Corrections BIOCHEMISTRY. For the article ‘‘RNA degradosomes exist in vivo in Escherichia coli as multicomponent complexes associated with the cytoplasmic membrane via the N-terminal region of ribo- nuclease E’’ by Gunn-Guang Liou, Wann-Neng Jane, Stanley N. Cohen, Na-Sheng Lin, and Sue Lin-Chao, which appeared in number 1, January 2, 2001, of Proc. Natl. Acad. Sci. USA (98, 63–68; First Published December 26, 2000; 10.1073͞ pnas.011535498), the authors note that the y axis label of Fig. 1B ͞ should read ‘‘picomoles OD600.’’ The corresponding text in the Fig. 1 legend on page 64 and the results described on page 66, line 2 from the bottom of the left-hand column, should also be in units of picomole per OD600. www.pnas.org͞cgi͞doi͞10.1073͞pnas.161275298 NEUROBIOLOGY. For the article ‘‘In vivo induction of massive proliferation, directed migration, and differentiation of neural cells in the adult mammalian brain’’ by James Fallon, Steve Reid, Richard Kinyamu, Isaac Opole, Rebecca Opole, Janie Baratta, Murray Korc, Tiffany L. Endo, Alexander Duong, Gemi Nguyen, Masoud Karkehabadhi, Daniel Twardzik, and Sandra Loughlin, which appeared in number 26, December 19, 2000, of Proc. Natl. Acad. Sci. USA (97, 14686–14691), the authors note the follow- ing correction. Dr. Sanjiv Patel’s name and affiliation were omitted from the list of authors. Dr. Patel’s affiliation is St. Joseph’s Hospital and Medical Center, Paterson, NJ 07503. The corrected list of authors is: James Fallon, Steve Reid, Richard Kinyamu, Isaac Opole, Rebecca Opole, Janie Baratta, Murray Korc, Tiffany L. Endo, Alexander Duong, Gemi Nguyen, Ma- soud Karkehabadhi, Daniel Twardzik, Sanjiv Patel, and Sandra Loughlin.
    [Show full text]
  • GHODGE-DISSERTATION-2015.Pdf (5.049Mb)
    MECHANISTIC CHARACTERIZATION AND FUNCTION DISCOVERY OF PHOSPHOHYDROLASE ENZYMES FROM THE AMIDOHYDROLASE SUPERFAMILY A Dissertation by SWAPNIL VIJAY GHODGE Submitted to the Office of Graduate and Professional Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Chair of Committee, Frank M. Raushel Committee Members, Tadhg P. Begley David P. Barondeau Margaret E. Glasner Head of Department, François Gabbaϊ May 2015 Major Subject: Chemistry Copyright 2015 Swapnil Vijay Ghodge ABSTRACT Rapid advances in genome sequencing technology have created a wide gap between the number of available protein sequences, and reliable knowledge of their respective physiological functions. This work attempted to bridge this gap within the confines cog1387 and cog0613, from the polymerase and histidinol phosphatase (PHP) family of proteins, which is related to the amidohydrolase superfamily (AHS). The adopted approach involved using the mechanistic knowledge of a known enzymatic reaction, and discovering functions of closely related homologs using various tools including bioinformatics and rational library screening. L-histidinol phosphate phosphatase (HPP) catalyzes the penultimate step in the biosynthesis of the amino acid: L-histidine. Recombinant HPP from L.lactis was purified and its metal content and activity were optimized. Mechanistic and structural studies were conducted using pH-Rate profiles, solvent isotope, viscosity effects, site-directed mutagenesis, and X-ray crystallography. These studies, along with extensive bioinformatic analysis, helped determine the boundaries of HPP activity among closely related enzyme sequences within cog1387. Elen0235 from cog0613 was shown to hydrolyze 5-phosphoribose-1,2- cyclicphosphate (PRcP) to ribose-5-phosphate (R5P) and inorganic phosphate (Pi), with ribose-2,5-bisphosphate as a catalytic intermediate.
    [Show full text]
  • A Grad-Seq View of RNA and Protein Complexes in Pseudomonas
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.06.403469; this version posted December 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 2 A Grad-seq view of RNA and protein complexes in Pseudomonas 3 aeruginosa under standard and bacteriophage predation conditions 4 5 Milan Gerovaca, Laura Wickea,b, Kotaro Chiharac, Cornelius Schneidera,d, 6 Rob Lavigneb,#, Jörg Vogela,c,# 7 8 a Institute for Molecular Infection Biology (IMIB), University of Würzburg, 9 97080 Würzburg, Germany 10 b Laboratory of Gene Technology, KU Leuven, 3001 Leuven, Belgium 11 c Helmholtz Institute for RNA-based Infection Research (HIRI), Helmholtz Centre for 12 Infection Research (HZI), 97080 Würzburg, Germany 13 d Department of Biochemistry and Cancer Therapy Research Center (CTRC), 14 Theodor Boveri-Institute, University of Würzburg, 97074 Würzburg, Germany 15 16 # Corresponding authors: [email protected], [email protected] 17 18 Keywords: Grad-seq, Pseudomonas, ΦKZ, bacteriophage, infection 19 20 Running title: Grad-seq in Pseudomonas and phage 21 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.06.403469; this version posted December 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 22 ABSTRACT 23 The Gram-negative rod-shaped bacterium Pseudomonas aeruginosa is not only a major cause 24 of nosocomial infections but also serves as a model species of bacterial RNA biology. While 25 its transcriptome architecture and post-transcriptional regulation through the RNA-binding 26 proteins Hfq, RsmA and RsmN have been studied in detail, global information about stable 27 RNA–protein complexes is currently lacking in this human pathogen.
    [Show full text]
  • Ribosomal RNA Degradation Induced by the Bacterial RNA Polymerase Inhibitor Rifampicin
    Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Ribosomal RNA degradation induced by the bacterial RNA polymerase inhibitor rifampicin. Lina Hamouche1, Leonora Poljak1, and Agamemnon J. Carpousis1,2† 1LMGM, Université de Toulouse, CNRS, UPS, CBI, Toulouse, France 2TBI, Université de Toulouse, CNRS, INRAE, INSA, Toulouse, France Running title: Rifampicin-induced rRNA degradation †Corresponding author: [email protected] 1 Downloaded from rnajournal.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract Rifampicin, a broad-spectrum antibiotic, inhibits bacterial RNA polymerase. Here we show that rifampicin treatment of Escherichia coli results in a 50% decrease in cell size due to a terminal cell division. This decrease is a consequence of inhibition of transcription as evidenced by an isogenic rifampicin-resistant strain. There is also a 50% decrease in total RNA due mostly to a 90% decrease in 23S and 16S rRNA levels. Control experiments showed this decrease is not an artifact of our RNA purification protocol and therefore due to degradation in vivo. Since chromosome replication continues after rifampicin treatment, ribonucleotides from rRNA degradation could be recycled for DNA synthesis. Rifampicin- induced rRNA degradation occurs under different growth conditions and in different strain backgrounds. However, rRNA degradation is never complete thus permitting the re-initiation of growth after removal of rifampicin. The orderly shutdown of growth under conditions where the induction of stress genes is blocked by rifampicin is noteworthy. Inhibition of protein synthesis by chloramphenicol resulted in a partial decrease in 23S and 16S rRNA levels whereas kasugamycin treatment had no effect.
    [Show full text]
  • Genome-Wide Investigation of Cellular Functions for Trna Nucleus
    Genome-wide Investigation of Cellular Functions for tRNA Nucleus- Cytoplasm Trafficking in the Yeast Saccharomyces cerevisiae DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Hui-Yi Chu Graduate Program in Molecular, Cellular and Developmental Biology The Ohio State University 2012 Dissertation Committee: Anita K. Hopper, Advisor Stephen Osmani Kurt Fredrick Jane Jackman Copyright by Hui-Yi Chu 2012 Abstract In eukaryotic cells tRNAs are transcribed in the nucleus and exported to the cytoplasm for their essential role in protein synthesis. This export event was thought to be unidirectional. Surprisingly, several lines of evidence showed that mature cytoplasmic tRNAs shuttle between nucleus and cytoplasm and their distribution is nutrient-dependent. This newly discovered tRNA retrograde process is conserved from yeast to vertebrates. Although how exactly the tRNA nuclear-cytoplasmic trafficking is regulated is still under investigation, previous studies identified several transporters involved in tRNA subcellular dynamics. At least three members of the β-importin family function in tRNA nuclear-cytoplasmic intracellular movement: (1) Los1 functions in both the tRNA primary export and re-export processes; (2) Mtr10, directly or indirectly, is responsible for the constitutive retrograde import of cytoplasmic tRNA to the nucleus; (3) Msn5 functions solely in the re-export process. In this thesis I focus on the physiological role(s) of the tRNA nuclear retrograde pathway. One possibility is that nuclear accumulation of cytoplasmic tRNA serves to modulate translation of particular transcripts. To test this hypothesis, I compared expression profiles from non-translating mRNAs and polyribosome-bound translating mRNAs collected from msn5Δ and mtr10Δ mutants and wild-type cells, in fed or acute amino acid starvation conditions.
    [Show full text]
  • RNA Helicases in RNA Decay
    Biochemical Society Transactions (2018) 46 163–172 https://doi.org/10.1042/BST20170052 Review Article RNA helicases in RNA decay Vanessa Khemici and Patrick Linder Department of Microbiology and Molecular Medicine, Faculty of Medicine, University of Geneva, Geneva, Switzerland Correspondence: Patrick Linder ([email protected]) RNA molecules have the tendency to fold into complex structures or to associate with complementary RNAs that exoribonucleases have difficulties processing or degrading. Therefore, degradosomes in bacteria and organelles as well as exosomes in eukaryotes have teamed-up with RNA helicases. Whereas bacterial degradosomes are associated with RNA helicases from the DEAD-box family, the exosomes and mitochondrial degra- dosome use the help of Ski2-like and Suv3 RNA helicases. Introduction All living cells encounter situations where they need to adapt gene expression to changing environ- mental conditions. The synthesis of new mRNAs to be used for translation and the release of seques- tered or translational inactive mRNAs allow the cells to express new proteins. On the other hand, processing and degradation of RNAs not only helps to recycle essential components, but also to shut down expression of genes that are no longer required or would even be detrimental for living under a new condition. Moreover, remnants of processed or aberrant transcripts must rapidly be degraded to avoid the production of useless or even toxic peptides and proteins. Eubacteria, Archaea, and eukar- yotes have developed dedicated pathways and complexes to process RNA, check the accuracy of RNAs (surveillance), and feed undesired RNA into exoribonucleases that degrade RNA in a 30–50 or 50–30 direction.
    [Show full text]
  • The RNA Degradosome Promotes Trna Quality Control Through Clearance of Hypomodified Trna
    The RNA degradosome promotes tRNA quality control through clearance of hypomodified tRNA Satoshi Kimuraa,b,c,1 and Matthew K. Waldora,b,c,1 aDivision of Infectious Diseases, Brigham and Women’s Hospital, Boston, MA 02115; bDepartment of Microbiology, Harvard Medical School, Boston, MA 02115; and cHoward Hughes Medical Institute, Harvard Medical School, Boston, MA 02115 Edited by Susan Gottesman, NIH, Bethesda, MD, and approved December 11, 2018 (received for review August 15, 2018) The factors and mechanisms that govern tRNA stability in bacteria cations are often critical for efficient translation (9); consequently, are not well understood. Here, we investigated the influence of mutations that prevent such modification can result in loss of via- posttranscriptional modification of bacterial tRNAs (tRNA modifica- bility. In contrast, nucleotide modifications within the tRNA core tion) on tRNA stability. We focused on ThiI-generated 4-thiouridine [composed of the T- and D-stem loops and variable loop compo- (s4U), a modification found in bacterial and archaeal tRNAs. Compre- nents that interact within the tertiary structure (4)] and elbow hensive quantification of Vibrio cholerae tRNAs revealed that the [formed via the interaction of D and T loops (1)] are not generally abundance of some tRNAs is decreased in a ΔthiI strain in a station- required for viability, and the absence of a single modification ary phase-specific manner. Multiple mechanisms, including rapid usually does not have an effect on growth (15). Modifications out- degradation of a subset of hypomodified tRNAs, account for the side of the anticodon region are thought to promote the thermo- reduced abundance of tRNAs in the absence of thiI.
    [Show full text]
  • Spatial Organization and Dynamics of Rnase E and Ribosomes in Caulobacter Crescentus
    Spatial organization and dynamics of RNase E and ribosomes in Caulobacter crescentus Camille A. Bayasa, Jiarui Wanga,b, Marissa K. Leea, Jared M. Schraderb,1, Lucy Shapirob,c, and W. E. Moernera,2 aDepartment of Chemistry, Stanford University, Stanford, CA 94305; bDepartment of Developmental Biology, Stanford University School of Medicine, Stanford, CA 94305; and cChan Zuckerberg Biohub, San Francisco, CA 94158 Contributed by W. E. Moerner, March 5, 2018 (sent for review December 15, 2017; reviewed by Zemer Gitai and James C. Weisshaar) We report the dynamic spatial organization of Caulobacter cres- components of the degradosome or the ribosome that are on centus RNase E (RNA degradosome) and ribosomal protein L1 (ri- length scales of less than ∼200 nm. bosome) using 3D single-particle tracking and superresolution We used a combination of live-cell single-particle tracking microscopy. RNase E formed clusters along the central axis of the (SPT) and fixed-cell superresolution (SR) microscopy to study the cell, while weak clusters of ribosomal protein L1 were deployed dynamics and spatial distribution of eYFP-labeled (13) RNase E throughout the cytoplasm. These results contrast with RNase E and ribosomal protein L1 in Caulobacter on subdiffraction limit and ribosome distribution in Escherichia coli, where RNase E coloc- length scales. SPT and SR provide improved resolution down to alizes with the cytoplasmic membrane and ribosomes accumulate in ∼20–50 nm using fluorescent proteins (FPs) (14, 15). Moreover, Cau- polar nucleoid-free zones. For both RNase E and ribosomes in both SPT and SR are single-molecule (SM) methods, allowing us lobacter , we observed a decrease in confinement and clustering to investigate the heterogeneity in protein behavior and distribu- upon transcription inhibition and subsequent depletion of nascent tion across many different cells.
    [Show full text]
  • An Exosome Component Participating in Apoptotic DNA Degradation
    Downloaded from rnajournal.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press Structural and biochemical characterization of CRN-5 and Rrp46: An exosome component participating in apoptotic DNA degradation CHE-CHUAN YANG,1,2 YI-TING WANG,2,3,4 YU-YUAN HSIAO,2,4 LYUDMILA G. DOUDEVA,2 PAN-HSIEN KUO,2,4 SIH YAO CHOW,2 and HANNA S. YUAN1,2,3 1Graduate Institute of Biochemistry and Molecular Biology, National Taiwan University, Taipei, 10617 Taiwan, Republic of China 2Institute of Molecular Biology, Academia Sinica, Taipei 11529, Taiwan, Republic of China 3Taiwan International Graduate Program, Institute of Chemical Biology and Molecular Biophysics, Academia Sinica, Taipei 11529, Taiwan, Republic of China 4Institute of Bioinformatics and Structural Biology, National Tsing Hua University, Hsinchu, Taiwan 30013, Republic of China ABSTRACT Rrp46 was first identified as a protein component of the eukaryotic exosome, a protein complex involved in 39 processing of RNA during RNA turnover and surveillance. The Rrp46 homolog, CRN-5, was subsequently characterized as a cell death-related nuclease, participating in DNA fragmentation during apoptosis in Caenorhabditis elegans. Here we report the crystal structures of CRN-5 and rice Rrp46 (oRrp46) at a resolution of 3.9 A˚ and 2.0 A˚ , respectively. We found that recombinant human Rrp46 (hRrp46), oRrp46, and CRN-5 are homodimers, and that endogenous hRrp46 and oRrp46 also form homodimers in a cellular environment, in addition to their association with a protein complex. Dimeric oRrp46 had both phosphorolytic RNase and hydrolytic DNase activities, whereas hRrp46 and CRN-5 bound to DNA without detectable nuclease activity.
    [Show full text]