Evidence for a Degradosome-Like Complex in the Mitochondria of Trypanosoma Brucei

FEBS Letters 583 (2009) 2333–2338

journal homepage: www.FEBSLetters.org

Evidence for a degradosome-like complex in the mitochondria of Trypanosoma brucei

Jonelle L. Mattiacio 1, Laurie K. Read *

Depatment of Microbiology and Immunology, Witebsky Center for Microbial Pathogenesis and Immunology, SUNY Buffalo School of Medicine, Buffalo, NY 14214, USA article info abstract

Article history: Mitochondrial RNA turnover in yeast involves the degradosome, composed of DSS-1 exoribonuc- Received 29 May 2009 lease and SUV3 RNA helicase. Here, we describe a degradosome-like complex, containing SUV3 Accepted 11 June 2009 and DSS-1 homologues, in the early branching protozoan, Trypanosoma brucei. TbSUV3 is mitoc- Available online 18 June 2009 hondrially localized and co-sediments with TbDSS-1 on glycerol gradients. Co-immunoprecipitation demonstrates that TbSUV3 and TbDSS-1 associate in a stable complex, which differs from the yeast Edited by Michael Ibba degradosome in that it is not stably associated with mitochondrial ribosomes. This is the ﬁrst report of a mitochondrial degradosome-like complex outside of yeast. Our data indicate an early evolution- Keywords: ary origin for the mitochondrial SUV3/DSS-1 containing complex. RNA turnover RNA processing Trypanosome Structured summary: RNA helicase MINT-7187980: SUV3 (genbank_protein_gi:XP_844349) and DSS1 (uniprotkb:Q38EM3) colocalize Exoribonuclease (MI:0403) by cosedimentation (MI:0027) MINT-7188074: SUV3 (genbank_protein_gi:XP_844349) physically interacts (MI:0914) with DSS1 (uniprotkb:Q38EM3) by anti tag co-immunoprecipitation (MI:0007)

1. Introduction only known exoribonuclease involved in yeast mitochondrial RNA (mtRNA) turnover [8]. Saccharomyces cerevisiae strains that The degradation of RNA is an essential element in the regulation are genetically inactivated for either DSS-1 or SUV3 have similar of gene expression. It both controls the abundance of mature RNAs phenotypes, strongly accumulating excised introns as well as and eliminates processing by-products and aberrant or defective mRNA and rRNA precursors with abnormal 50 and 30 termini [9– molecules that form during RNA synthesis and maturation [1]. 11]. These cells also display decreased steady-state levels of ma- RNA degradation is of particular importance in mitochondria ture transcripts along with disruption of translation [7,11,12]. where transcriptional control is minimal and polycistronic tran- Orthologues of the SUV3 helicase are present in the genomes of a scription produces precursor RNAs that require extensive process- wide spectrum of eukaryotes, and they have been shown to be at ing [2–5]. The machineries that catalyze RNA turnover in least partially mitochondrially localized in humans and plants mitochondria exhibit substantial divergence between species [6]. [13–15]. In contrast to yeast, however, human and plant mitochon- In yeast, the mitochondrial degradosome is comprised of an RNR dria lack the DSS-1 exoribonuclease. They do contain the phospho- (RNase II/RNase R-like) family hydrolytic exoribonuclease, encoded rolytic exoribonuclease polynucleotide phosphorylase (PNPase), by DSS-1 gene, and an NTP-dependent RNA helicase, encoded by although there is no evidence for its association with SUV3 the SUV3 gene. DSS-1 and SUV3 appear to be the sole components [16,17]. A recent study demonstrated that human cells depleted of the degradosome based on TAP-tagging studies in yeast, which of the SUV3 helicase accumulate shortened poly(A+) mtRNAs and also showed that the complex is exclusively associated with mito- are impaired in translation [18]. These studies indicate that SUV3 chondrial ribosomes [7]. The degradosome, which exhibits hydro- can profoundly affect mitochondrial RNA metabolism in the ab- lytic 30 to 50 exoribonuclease and RNA helicase activities, is the sence of a yeast-like degradosome complex. Trypanosoma brucei is a protozoan parasite that has consistently been identiﬁed as one of the earliest branching mitochondria-con- * Corresponding author. Fax: +1 716 829 2158. taining eukaryotes [19]. Mitochondrial RNA metabolism in T. brucei E-mail address: [email protected] (L.K. Read). is extraordinarily complicated, involving polycistronic transcrip- 1 Present address: University of Rochester, Department of Microbiology and Immunology, 601 Elmwood Ave, Box 672, KMRB, Room 3-9804, Rochester, NY tion, extensively overlapping genes, and massive remodeling of 14642, USA. mRNAs by guide RNA-directed uridine insertion/deletion editing

0014-5793/$36.00 Ó 2009 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2009.06.024 2334 J.L. Mattiacio, L.K. Read / FEBS Letters 583 (2009) 2333–2338

[20]. We previously identified a gene encoding a homologue of DSS- using the procedure of Zeiner et al. [27]. The degree of cytoplasmic 1 in the T. brucei genome (termed TbDSS-1) [21], and a peptide orig- contamination of the mitochondrial preparation was assessed by inating from TbDSS-1 was recently detected in the mitochondrial Western blotting using antibodies against cytoplasmic TbHsp70.4. proteome [22]. Targeted depletion of TbDSS-1 in insect stage T. brucei results in aberrant levels of several mitochondrial RNA species, 2.3. Glycerol gradient sedimentation including never edited, unedited and edited mRNAs as well as guide RNAs [21]. TbDSS-1 depleted cells also accumulate RNA maturation Glycerol gradient fractionation of mitochondrial lysates was by-products originating from the region upstream of the first genes performed as previously described [28]. Mitochondrial lysate was on the major and minor strands of the mitochondrial genome, and obtained from 1010 PF T. brucei cell equivalents by adding 500 ll 12S rRNA processing intermediates with mature 30 ends and unpro- of mitochondrial lysis buffer [20 mM Tris–HCl (pH 7.5), 50 mM 0 cessed 5 ends [23]. Overall, these studies suggest that TbDSS-1 rep- KCl, 10 mM MgCl2, 100 lM ATP, 0.2% NP-40, Complete EDTA-free resents at least one of the main exoribonucleases involved in RNA protease inhibitors (Roche)] to purified mitochondria and incubat- turnover and surveillance in T. brucei mitochondria. In the present ing on ice for 10 min prior to centrifugation at 13000g for 15 min. study, we report a T. brucei homologue of the SUV3 RNA helicase Five hundred ll of purified mitochondrial lysate was layered onto a (TbSUV3). To determine whether TbSUV3 interacts with TbDSS-1 12-ml 5–20% linear glycerol gradient and centrifuged for 20 h at in a mitochondrial degradosome-like complex, we created a T. bru- 4 °C in Beckman SW-41 rotor at 35000 rpm. Twenty-four 500 ll cei cell line expressing a PTP (ProtC-TEV-ProtA [24]) tagged TbSUV3 fractions were collected from the top of the tube, and 20 ll of each protein at an endogenous allele. We show that the TbSUV3-PTP fu- fraction was analyzed by Western blotting with PAP reagent for the sion protein is properly expressed and targeted to the mitochon- detection of TbSUV3 and polyclonal anti-TbDSS-1 antibodies [21] drion. Glycerol gradient fractionation suggests that TbSUV3 and to detect endogenous TbDSS-1. Standards (cytochrome c, 1.9S; bo- TbDSS-1 co-sediment in a high-molecular-weight complex, and vine serum albumin, 4S; yeast alcohol dehydrogenase, 7.4S; cata- subsequent IgG purification of TbSUV3-PTP containing complexes lase, 11S; and thyroglobulin, 19S) were fractionated in a parallel shows that the two proteins interact in T. brucei mitochondria. gradient and analyzed by SDS–PAGE and Coomassie blue staining. These studies represent the first report of a core enzymatic complex that is likely involved in RNA turnover and surveillance in the 2.4. Immunoprecipitation of the TbSUV3 containing complex mitochondria of T. brucei. Further, this is the first report of a mitochondrial degradosome-like complex in an organism other than For IgG purification of TbSUV3-PTP, peak glycerol gradient frac- yeast. Our data demonstrate an early evolutionary origin for the tions (7–13) were pooled and fresh protease inhibitor tablet was mitochondrial SUV3/DSS-1 containing complex. added. Five hundred microliters of pooled gradient fractions was incubated with 20 ll IgG Fastflow Sepharose beads (Amersham Biosciences) for 2 h at 4 °C. The bound material was pelleted by 2. Materials and methods centrifugation at 10000g for 5 min and the unbound supernatant transferred to a separate tube. The Sepharose beads were then 2.1. Oligonucleotides used for 50 RACE analysis washed three times with PA-150 buffer [20 mM Tris–HCl (pH 7.7), 150 mM KCl, 3 mM MgCl , 0.5 mM DTT, 0.1% Tween 20[ and The oligonucleotides used for 50 RACE are listed as follows with 2 resuspended in Buffer A [10 mM Tris–HCl (pH 8.0), 25 mM KCl, restriction sites underlined. CSL-22 (50-GCATCGATGCTATTATTAGA 10 mM MgCl ]. The IgG Sepharose beads were boiled at 95 °C for ACAGTTTCTGTACTATATTG -30), SUV3-8 (50-GCGGATCCAACGCCGC 2 5 min prior to loading on SDS–PAGE. Ten percent of each fraction GTGAGTCTTCC-30), SUV3 -9 (50-GCGGATCCGTGCCTTCGGGTACCA was analyzed by Western blot to detect TbDSS-1 and TbSUV3- GTC-30). PTP using anti-TbDSS1 antibodies [21] and PAP reagent, respectively. 2.2. Trypanosome cell culture, transfection, and cell fractionation Immunoprecipitations using anti-ProtC antibodies were performed as described above with the following modifications. Ten The procyclic form (PF) T. brucei clone IsTAR1 stock EATRO 164 micrograms of anti-ProtC antibody (Roche monoclonal HPC4) was grown as previously described [25]. Stable cell lines constitu- was incubated with 500 ll of pooled gradient fractions in 2 mM tively expressing a TbSUV3 C-terminal PTP tag fusion protein were CaCl2 with rocking at 4 °C for 2 h. Control reactions in the absence generated via electroporation. To generate the pC-PTP-TbSUV3 of antibody were processed in parallel. Twenty microliters of Pro- construct, a 500-nucleotide fragment of TbSUV3 C-terminal coding tein G Sepharose beads was then added to each tube and the slurry 0 0 region was PCR amplified using TbSUV3-PTP5 (5 -GCCGGGGCC was incubated with rocking for an additional 2 h at 4 °C. The bound 0 0 CAAGACCTCAGGTGTGGTGCC-3 ) forward and TbSUV3-PTP3 (ATA- material was pelleted by centrifugation at 10000g for 5 min and 0 AGAATGCGGCCGCGGCAACCTCCGCAACAGCTC-3 ) reverse prim- unbound supernatant transferred to a separate tube. The Sephar- ers and cloned into the Apal/Not l restriction sites of the pC- ose beads were then washed three times with PC-150 buffer PTP-Neo vector [24] (a generous gift from Arthur Günzl, Univ. of [20 mM Tris–HCl (pH 7.7), 150 mM KCl, 3 mM MgCl2, 1 mM CaCl2, Connecticut). For genomic integration, pTbSUV3-PTP-NEO was lin- 0.1% Tween 20], resuspended in buffer A and boiled at 95 °C for earized within the TbSUV3 sequence at a unique Bcl I restriction 5 min prior to loading on SDS–PAGE. Ten percent of each fraction site. For transfection, log-phase PF T. brucei clone IsTAR1 stock was analyzed by Western blot as described above. EATRO 164 cells were electroporated in the presence of 20 lgof Bcl I linearized TbSUV3-PTP. Transfections were carried out on ice in 2-mm cuvettes using a Bio-Rad electroporator with two 3. Results and discussion pulses at the following settings: 800 V, 25 lF, and 400 X. Following transfection, cells were selected with 40 lg of G418/ml and clonal 3.1. TbSUV3 encodes a putative ATP-dependent RNA helicase that cell lines were generated by limiting dilution. Expression of PTP- localizes to the mitochondria tagged protein was analyzed by Western blotting with PAP probe (Sigma), which detects the Protein A domain of the PTP tag. We previously described the role of the mitochondrial exoribo- Mitochondria were isolated by the procedure of Harris et al. nuclease, TbDSS-1, in RNA stability and as part of an RNA surveil- [26]. Whole cell and cytoplasmic fractionation was carried out lance system that eliminates stalled 12S rRNA processing J.L. Mattiacio, L.K. Read / FEBS Letters 583 (2009) 2333–2338 2335 intermediates and maturation by-products from the system thought to be involved in RNA binding in association with motifs [21,23]. To determine if T. brucei possesses an SUV3 homologue IV and V, although this has only been demonstrated for eIF4A that might act in concert with TbDSS-1, analogous to the yeast [30]. Interestingly, Motif III is characteristically absent in all mitochondrial degradosome, we searched T. brucei GeneDB SUV3 helicases, including TbSUV3. Together, these analyses indi- with the S. cerevisiae SUV3 sequence. We identified a predicted cate that T. brucei expresses an SUV3 homologue. protein highly homologous to SUV3, which we term TbSUV3 We next wanted to confirm the expected mitochondrial locali- (Tb927.4.1990). To confirm its expression and characterize the cor- zation of TbSUV3. TbSUV3 is predicted to contain a mitochondrial responding mRNA, we performed 50 RACE on oligo(dT)-primed PF import sequence at its N-terminus by the PSORTII program (http:// RNA using a gene-specific primer in combination with a primer psort.ims.u-tokyo.ac.jp/). In addition, the N-terminus of the homologous to the 39 nt spliced leader sequence present on all T. TbSUV3 ORF exhibits characteristic regions of homology to known brucei nuclear encoded mRNAs. This analysis indicated the pres- trypanosome mitochondrial import sequences [21,31,32], includ- ence of a mature trans spliced TbSUV3 mRNA with an 18 nt 50 ing tandem arginine residues followed by multiple hydrophobic untranslated region. To confirm the open reading frame (ORF) amino acids with interspersed and flanking serine and threonine identified in silico, the predicted ORF was PCR amplified from PF residues (Fig. 2A). To determine whether TbSUV3 is mitochondrial- T. brucei cDNA, cloned, and sequenced. The 1881-nt ORF is identical ly localized, we used epitope tagging to create a TbSUV3 fusion to the sequence in T. brucei Gene DB with the exception of an ala- protein in T. brucei. We utilized a construct designed for stable nine to valine substitution at amino acid 617, and predicts a pro- integration of a PTP tag into an endogenous allele [24], which tein with a molecular mass of 70.6 kDa and a pI of 9.01. The allows PTP-tagged proteins to be expressed at normal levels, predicted protein exhibits 32–38% identity and 50–54% similarity potentially alleviating problem of nonspecific protein–protein with SUV3 homologues from Homo sapiens, S. cerevisiae, Arabidop- interactions due to overexpression of the tagged protein. To this sis thaliana, and Caenorhabditis elegans [15] over the conserved cen- end, a 500-bp fragment of the TbSUV3 C-terminal coding region tral region (Fig. 1A). SUV3-like proteins form a distinct and was cloned into pC-PTP-Neo vector [24]. The resulting vector was conserved Ski2p family of DExH/D RNA helicases that possess se- linearized within the TbSUV3 sequence at a unique restriction site ven conserved motifs within their central region. Depicted in and transfected into T. brucei EATRO 164 strain. Cultures that had Fig. 1B is a sequence alignment of Motifs I–VI of SUV3 proteins integrated the plasmid construct into an endogenous TbSUV3 allele from T. brucei, H. sapiens, S. cerevisiae, A. thaliana, and C. elegans. were selected by G418 treatment, and clonal lines subsequently Motifs I and II, also known as the Walker A and B box, are crucial isolated by limiting dilution. Western blot analysis using the PAP for ATPase and helicases activities [29]. Motifs Ia and Ib are reagent, which recognizes the Protein A domain in the PTP tag,

A % identity/similarity over central region Tb Hs 37/53 Sc 32/50 At 35/53 Ce 38/54 I Ia Ib II IV VIV B

Fig. 1. TbSUV3 is a putative ATP-dependent RNA helicase with conserved motifs. (A) Schematic representation of the structure of SUV3 homologues from T. brucei (Tb; Accession No. XP844349), H. sapiens (Hs; Accession No. NP_003162), S. cerevisiae (Sc; Accession No. NP015296), A. thaliana (At; Accession No. BAF01552), and C. elegans (Ce; Accession No. NP001040911) illustrating the presence of conserved motifs (Motifs I, Ia, Ib, II, IV, V, and VI) and variable N- and C-termini. The percent amino acid identity/ similarity over the conserved central region (encompassing amino acids 115–602 of TbSUV3) is shown. (B) A multiple sequence alignment of Motifs I–VI of SUV3 homologues shown in panel A was generated using ClustalW. Identical amino acids are indicated by white letters on a black background; similar amino acids are indicated by white letters on a gray background. 2336 J.L. Mattiacio, L.K. Read / FEBS Letters 583 (2009) 2333–2338

A 3.2. TbSUV3 is present in higher order complexes

To address whether TbSUV3 is present in a macromolecular complex, we subjected mitochondrial extract from cells expressing TbSUV3-PTP to glycerol gradient fractionation. Fractions from a 5% to 20% glycerol gradient were first resolved by SDS–PAGE and analyzed by Western blot with the PAP reagent (Fig. 3, top panel). TbSUV3-PTP exhibited a broad distribution in fractions 5–19, sed- imenting predominantly between 8 and 11.3S. Monomeric TbSUV3-PTP was expected to exhibit sedimentation values of less B WT TbSUV3PTP than 7.4S, suggesting the presence of TbSUV3-containing macro- T T C M molecular complexes. Previous glycerol gradient analysis demonstrated that TbDSS-1 PAP is also present in higher order complexes, but unlike yeast DSS-1, is not stably associated with ribosomes [21]. To determine whether the sedimentation profile of TbDSS-1 overlaps or coincides TbHsp70.4 with that of TbSUV3-PTP, we analyzed the same gradient fractions 1 2 3 4 with antibodies against TbDSS-1. HRP conjugated goat anti-rabbit antibodies, which would not be expected to interact with the Fig. 2. TbSUV3 is mitochondrially localized. (A) Sequence alignment of the TbSUV3 Protein A portion of the TbSUV3-PTP protein [33], were utilized N terminal amino acid sequence with known and predicted targeting sequences from T. brucei mitochondrial proteins TBmtRNAP, KREL2, ISP, ATPase subunit 9, as secondary antibodies. As shown in Fig. 3 (bottom panel), RBP16, MRP1, and TbDSS-1. The characteristic one or two N-terminal arginine TbDSS-1 exhibits a broad sedimentation profile in fractions 7–17, residues are shown by white letters on black background. Serine and threonine corresponding to 8–10S, similar to TbSUV3-PTP. These results residues (white letters on gray background) flank hydrophobic residues that are suggest that TbSUV3 and TbDSS-1 may be associated with mito- shown by black letters on gray background. (B) Mitochondrial localization of TbSUV3-PTP fusion protein. Wild-type (WT) or TbSUV3-PTP expressing cells were chondrial complexes. analyzed by Western blot with the PAP reagent to detect TbSUV3-PTP (top) or with antibody against TbHSP70.4 as a cytoplasmic marker (bottom). Each lane contains 10 lg protein. Total cell extracts (T, lanes 1 and 2); cytoplasmic extract (C, lane 3); 3.3. TbSUV3 interacts with TbDSS-1 in a mitochondrial degradosome- mitochondrial extract (M, lane 4). like complex confirmed that a protein of the correct size (84 kDa) was To determine whether TbSUV3 and TbDSS-1 are stably associ- expressed in TbSUV3-PTP cells (Fig. 2B, top panel, compare lanes ated, we performed co-immunoprecipitation experiments. Peak 1 and 2). Total protein, cytosolic, and mitochondrial extracts were glycerol gradient fractions (fractions 7–13, Fig. 3) were pooled prepared from TbSUV3-PTP cells, and equal microgram amounts of and incubated with IgG Sepharose beads, which bind the Protein protein were analyzed using the PAP reagent. TbSUV3-PTP was de- A moiety of the PTP tag. After washing, 10% of the input, unbound, tected only in the total protein and mitochondrial fractions and bound proteins were analyzed by Western blot with the PAP (Fig. 2B, lanes 2 and 4), and not in the cytosolic fraction (Fig. 2B, reagent to confirm TbSUV3-PTP precipitation and with anti- lane 3). Moreover, TbSUV3-PTP was enriched in mitochondria TbDSS-1 antibodies to assess their interaction. As shown in compared to whole cells, demonstrating that it is targeted to the Fig. 4A, the majority of both TbSUV3 and TbDSS-1 were identified mitochondrion. Western blotting using anti-TbHsp70.4 (Fig. 2B, in the pellet, demonstrating an in vivo association of the two pro- bottom panel) confirmed the efficiency of the mitochondrial teins. To confirm this interaction, we performed co-immunopre- fractionation. The presence of a putative mitochondrial import cipitation experiments with the same pooled gradient fractions sequence and enrichment in mitochondrial extracts, lead us to and anti-ProtC antibodies directed against the ProtC moiety of conclude that TbSUV3 is a nuclear encoded, mitochondrially local- the PTP tag. TbSUV3-PTP was precipitated using the anti-ProtC ized protein. Consistent with this conclusion, a recent survey of the antibodies bound to Protein G Sepharose beads, and negative con- T. brucei mitochondrial proteome identified several TbSUV3 trol experiments were performed in the absence of anti-ProtC anti- peptides [22]. bodies to account for non-specific binding of TbDSS-1 to the beads.

1.9S 4.3S 7.4S 11.3S 19S 5% 20% 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

TbSUV3PTP

TbDSS-1

Fig. 3. TbSUV3 and TbDSS-1 co-sediment in glycerol gradients. Mitochondrial extracts from TbSUV3-PTP expressing cells were fractionated on a 5–20% glycerol gradient. Aliquots of each fraction were analyzed by Western blot using the PAP reagent to detect TbSUV3-PTP (top panel) and antibodies against TbDSS-1 (bottom panel). Sedimentation coefﬁcients were determined by sedimentation of markers in a parallel gradient. J.L. Mattiacio, L.K. Read / FEBS Letters 583 (2009) 2333–2338 2337

A IgG Note added in proof Input S P While this manuscript was in press, Wang et al. reported a complex comprised of SUV3 and PNPase in human mitochondria, http://www.jbc.org/cgi/doi/10.1074.jbc.M109.009605. WB: PAP Acknowledgements

We thank Jay Bangs for antibodies and Arthur Günzl for the PTP WB: anti-TbDSS-1 vector. This work was supported by NIH R56AI047329 and RO1 AI077520 to L.K.R. J.L.M. was supported in part by NIH T32AI07614. B References -ProtC control anti [1] Housely, J. and Tollervery, D. (2009) The many pathways of RNA degradation. Cell 136, 763–776. I S P S P [2] Koslowsky, D.J. and Yahampath, G. (1997) Mitochondrial mRNA 30 cleavage/ polyadenylation and RNA editing in Trypanosoma brucei are independent events. Mol. Biochem. Parasitol. 90, 81–94. [3] Montoya, J., Gaines, G.L. and Attardi, G. (1983) The pattern of transcription of WB: PAP the human mitochondrial rRNA genes reveals two overlapping transcription units. Cell 34, 151–159. [4] Schafer, B. (2005) RNA maturation in mitochondria of S. cerevisiae and S. pombe. Gene 354, 80–85. [5] Binder, S. and Brennicke, A. (2003) Gene expression in plant mitochondria: WB: anti-TbDSS-1 transcriptional and post-transcriptional control. Philos. Trans. R. Soc. Lond. B Biol. Sci. 358, 181–188. Fig. 4. In vivo interaction between TbSUV3 and TbDSS-1. (A) Peak glycerol gradient [6] Gagliardi, D., Stepien, P.P., Temperley, R.J., Lightowlers, R.N. and Chrzanowska- fractions from TbSUV3-PTP expressing cells were pooled and incubated with IgG Lightowlers, Z.M. (2004) Messenger RNA stability in mitochondria: different Sepharose beads. Beads were washed, and 10% of input (I), supernatant (S), and means to an end. Trends Genet. 20, 260–267. pellet (P) fractions were analyzed by SDS–PAGE and Western blot with the PAP [7] Dziembowski, A., Piwowarski, J., Hoser, R., Minczuk, M., Dmochowska, A., Siep, reagent (top) and anti-TbDSS-1 (bottom). (B) TbSUV3-PTP was isolated from pooled M., van der Spek, H., Grivell, L. and Stepien, P.P. (2003) The yeast mitochondrial degradosome. Its composition, interplay between RNA helicase and RNase glycerol gradient fractions by immunoprecipitation with anti-ProtC antibodies. activities and the role in mitochondrial RNA metabolism. J. Biol. Chem. 278, Reactions lacking primary antibodies (control) were performed as a negative 1603–1611. control. Ten percent of input (I), supernatant (S), and pellet (P) fractions were [8] Malecki, M., Jedrzejczak, R., Stepien, P.P., Golik, P. and P (2007) In vitro analyzed by Western blot as in panel A. reconstitution and characterization of the yeast mitochondrial degradosome complex unravels tight functional interdependence. J. Mol. Biol. 372, 23– 36. [9] Margossian, S.P., Li, H., Zassenhaus, H.P. and Butow, R.A. (1996) The DexH box protein Suv3p is a component of a yeast mitochondrial 30-to-50 In these experiments, we detected both TbSUV3-PTP and TbDSS-1 exoribonuclease that suppresses group I intron toxicity. Cell 84, in the pellet in the presence of anti-ProtC antibody, but not in 199–209. [10] Stepien, P.P., Kokot, L., Leski, T. and Bartnik, E. (1995) The suv3 nuclear gene controls performed in the absence of primary antibody (Fig. 4B). product is required for the in vivo processing of the yeast mitochondrial 21S Collectively, these results demonstrate that TbSUV3 associates rRNA transcripts containing the R1 intron. Curr. Genet. 27, 234–238. with TbDSS-1 in T. brucei mitochondria. [11] Golik, P., Szczepanek, T., Bartnik, E., Stepien, P.P. and Lazowska, J. (1995) The S. cerevisiae nuclear gene SUV3 encoding a putative RNA helicase is necessary for the stability of mitochondrial transcripts containing multiple introns. Curr. 3.4. Concluding remarks Genet. 28, 217–224. [12] Rogowska, A.T., Puchta, O., Czarnecka, A.M., Kaniak, A., Stepien, P.P. and Golik, P. (2006) Balance between transcription and RNA degradation is vital for This study reports the expression of an SUV3 RNA helicase Saccharomyces cerevisiae mitochondria: reduced transcription rescues the homologue, TbSUV3, in the early branching eukaryote, T. brucei. phenotype of deficient RNA degradation. Mol. Biol. Cell 17, 1184–1193. [13] Minczuk, M., Piwowarski, J., Papworth, M.A., Awiszus, K., Schalinski, S., We further demonstrate that TbSUV3 is localized to mitochondria Dziembowski, A., Dmochowska, A., Bartnik, E., Tokatlidis, K., Stepien, P.P. where it associates with the TbDSS-1 exoribonuclease in a complex and Borowski, P. (2002) Localisation of the human hSuv3p helicase in the analogous to the S. cerevisiae mitochondrial degradosome [7]. This mitochondrial matrix and its preferential unwinding of dsDNA. Nucl. Acids Res. 30, 5074–5086. constitutes the first report of a DSS-1/SUV3 containing complex in [14] Gagliardi, D., Kuhn, J., Spadinger, U., Brennicke, A., Leaver, C.J. and Binder, S. an organism other than yeast. While we were unable to isolate (1999) An RNA helicase (AtSUV3) is present in Arabidopsis thaliana enzymatically active TbSUV3 or TbDSS-1 from trypanosomes or mitochondria. FEBS Lett. 458, 337–342. [15] Dmochowska, A., Kalita, K., Krawczyk, M., Golik, P., Mroczek, K., Lazowska, J., bacteria, presumably due to the lability of these proteins, both pro- Stepien, P.P. and Bartnik, E. (1999) A human putative Suv3-like RNA helicase is teins possess all of the residues necessary for their predicted enzy- conserved between Rhodobacter and all eukaryotes. Acta Biochem. Pol. 46, matic functions, indicative of a role in mitochondrial RNA 155–162. [16] Holec, S., Lange, H., Kuhn, K., Alioua, M., Borner, T. and Gagliardi, D. (2006) metabolism. We were also unable to obtain TbSUV3 depleted cells Relaxed transcription in Arabidopsis mitochondria is counterbalanced by RNA for functional studies despite exhaustive attempts. Nevertheless, stability control mediated by polyadenylation and polynucleotide TbDSS-1 knockdown cells display pleiotropic effects on trypano- phosphorylase. Mol. Cell. Biol. 26, 2869–2876. some mitochondrial RNA metabolism similar to those described [17] Slomovic, S. and Schuster, G. (2008) Stable PNPase RNAi silencing: its effect on the processing and adenylation of human mitochondrial RNA. RNA 14, 310– in DSS-1 or SUV3 null yeast cells [7,21,23]. Thus, our data reveal 323. an early evolutionary origin for the mitochondrial degradosome. [18] Khidr, L., Wu, G., Davila, A., Procaccio, V., Wallace, D. and Lee, W.-H. (2008) This complex has apparently been lost during evolution, as human Role of SUV3 helicase in maintaining mitochondrial homeostatis in human cells. J. Biol. Chem. 283, 27064–27073. SUV3 functions in mitochondrial RNA metabolism in the absence [19] Dacks, J.B. and Doolittle, W.F. (2001) Reconstructing/deconstructing the of any DSS-1 homologue [18]. It will be of future interest to deter- earliest eukaryotes: how comparative genomics can help. Cell 107, 419– mine the spectrum of organisms that possess a mitochondrial DSS- 425. [20] Lukes, J., Hashimi, H. and Zikova, A. (2005) Unexplained complexity of the 1/SUV3 containing complex, and to better understand the myriad mitochondrial genome and transcriptome in kinetoplastid flagellates. Curr. functions of this important complex in vivo. Genet. 48, 277–299. 2338 J.L. Mattiacio, L.K. Read / FEBS Letters 583 (2009) 2333–2338

[21] Penschow, J.L., Sleve, D.A., Ryan, C.M. and Read, L.K. (2004) TbDSS-1, an [28] Goulah, C.C. and Read, L.K. (2007) Differential effects of arginine methylation essential Trypanosoma brucei exoribonuclease homolog that has pleiotropic on RBP16 mRNA binding, guide RNA (gRNA) binding, and gRNA-containing effects on mitochondrial RNA metabolism. Eukaryot. Cell 3, 1206–1216. ribonucleoprotein complex (gRNP) formation. J. Biol. Chem. 282, 7181–7190. [22] Panigrahi, A.K., Ogata, Y., Zikova, A., Anupama, A., Dalley, R.A., Acestor, N., [29] Shu, Z., Vijayakumar, S., Chen, C.F., Chen, P.L. and Lee, W.H. (2004) Purified Myler, P.J. and Stuart, K.D. (2009) A comprehensive analysis of Trypanosoma human SUV3pexhibits multiple-substrate unwinding activity upon brucei mitochondrial proteome. Proteomics 9, 434–450. conformational change. Biochemistry 43, 4781–4790. [23] Mattiacio, J.L. and Read, L.K. (2008) Roles for TbDSS-1 in RNA surveillance and [30] Rogers Jr., G.W., Komar, A.A. and Merrick, W.C. (2002) eIF4A: the godfather of decay of maturation by-products from the 12S rRNA locus. Nucl. Acids Res. 36, the DEAD box helicases. Prog. Nucl. Acid Res. Mol. Biol. 72, 307–331. 319–329. [31] Hausler, T., Stierhof, Y.D., Blattner, J. and Clayton, C. (1997) Conservation of [24] Schimanski, B., Nguyen, T.N. and Gunzl, A. (2005) Highly efficient tandem mitochondrial targeting sequence function in mitochondrial and affinity purification of trypanosome protein complexes based on a novel hydrogenosomal proteins from the early-branching eukaryotes Crithidia, epitope combination. Eukaryot. Cell 4, 1942–1950. Trypanosoma, and Trichomonas. Eur. J. Cell Biol. 73, 240–251. [25] Brun, R. and Schonenberger, R. (1979) Cultivation and in vitro cloning of [32] McManus, M.T., Shimamura, M., Grams, J. and Hajduk, S.L. (2001) procyclic culture forms of Trypanosoma brucei in a semi-defined medium. Acta Identification of candidate mitochondrial RNA editing ligases from Trop. 36, 289–292. Trypanosoma brucei. RNA 7, 167–175. [26] Harris, M.E., Moore, D.R. and Hajduk, S.L. (1990) Addition of uridines to edited [33] Bonifacino, J.S., Esteban, C.D. and Springer, T.A. (1999) Immunoprecipitation RNAs in trypanosome mitochondria occurs independently of transcription. J. (Ausubel, F.M. et al., Eds.), Current Protocols in Molecular Biology, vol. 2, John Biol. Chem. 265, 11368–11376. Wiley and Sons Inc. (Chapter 10.16.1). [27] Zeiner, G.M., Sturm, N.R. and Campbell, D.A. (2003) Exportin 1 mediates nuclear export of the kinetoplastid spliced leader RNA. Eukaryot. Cell 2, 222– 230.