The Oncoprotein Tax of the Human T-Cell Leukemia Virus Type 1 Activates Transcription Via Interaction with Cellular ATF-1/CREB Factors in Saccharomyces Cerevisiae

JOURNAL OF VIROLOGY, Nov. 1996, p. 7478–7484 Vol. 70, No. 11 0022-538X/96/$04.00ϩ0 Copyright ᭧ 1996, American Society for Microbiology

The Oncoprotein Tax of the Human T-Cell Leukemia Virus Type 1 Activates Transcription via Interaction with Cellular ATF-1/CREB Factors in Saccharomyces cerevisiae

MARIA SHNYREVA AND THOMAS MUNDER* Department of Cell and Molecular Biology, Hans-Kno¨ll-Institut fu¨r Naturstoff-Forschung e.V., D-07745 Jena, Germany

Received 18 April 1996/Accepted 23 July 1996

The transcription factor Tax of the oncogenic human T-cell leukemia virus type 1 is likely to be responsible for viral replication in the host organism and for the induction of proliferation in infected cells. To investigate Tax-mediated transcription in vivo, we expressed Tax as well as CREB in Saccharomyces cerevisiae. The activity of these proteins was monitored by expression of a ␤-galactosidase reporter gene, which was fused to two viral 21-bp repeats located upstream of the yeast cytochrome c1 oxidase minimal promoter. Coexpression of Tax and CREB in S. cerevisiae led to a 20-fold increase in ␤-galactosidase activity in comparison with that in strains expressing either Tax or CREB alone. By screening a human cDNA library, we were able to demonstrate that the Tax transactivation assay using S. cerevisiae can be successfully applied to identify other cellular proteins forming ternary complexes with Tax and 21-bp repeats in vivo. Upon transformation in S. cerevisiae, 1 of 13,500 clones tested positive. Sequencing of the cDNA insert of the rescued plasmid revealed that this DNA encoded the ATF-1 protein. ␤-Galactosidase induction was comparable to that of the Tax/CREB coexpression system. This indicates that Tax-mediated transcription is critically dependent on the presence of cellular CREB or

ATF-1 in vivo. Stimulation of transcription initiation required an unmasked NH2 terminus of Tax. Fusion of Tax to the yeast Gal4 protein abolished the transactivation potential of Tax. Reconstitution of the transcriptional properties of viral Tax together with the cellular proteins of the ATF-1/CREB family in S. cerevisiae allows the functional characterization of these proteins in vivo.

The oncogenic retrovirus human T-cell leukemia virus type HTLV-1 promoter in an in vitro reaction (40). This effect is 1 (HTLV-1) is the etiologic agent of proliferative as well as enhanced in the presence of endogenous CREB (13). These degenerative phenomena in infected humans. It causes a T-cell data suggest that Tax forms a complex with CREB in vitro that malignancy, the adult T-lymphocytic leukemia (26, 48, 61), and assembles on the 21-bp repeats, forming a ternary nucleopro- the neurodegenerative disease tropical spastic paraparesis– tein complex (47). HTLV-1-associated myelopathy (19, 46). The replication of The function of Tax and CREB in transcriptional activation HTLV-1 is regulated by its own products Tax and Rex (23, 32). in vivo is still elusive, and available data are difficult to recon- Tax augments transcription via 21-bp repeats found in the long cile. This may be due to the presence of endogenous proteins terminal repeat (LTR) of the viral genome (17, 31, 40, 52). In involved in Tax-mediated transcription in mammalian cells. To addition, Tax is responsible for the expression of several cel- elucidate the role of Tax and CREB in transcriptional regula- lular genes involved in growth control, like interleukin-2, the tion, we performed in vivo studies with Saccharomyces cerevi- interleukin-2 receptor ␣ chain, c-fos, and granulocyte-macro- siae. S. cerevisiae is an excellent model organism for heterolo- phage colony-stimulating factor (14–16, 24, 30, 36). This might gous gene expression (for a recent review, see reference 25). be responsible for HTLV-1-induced neoplastic transformation Because of its simplicity, S. cerevisiae should allow analysis of (54). Therefore, Tax is important for both viral replication and the cooperation of coexpressed Tax and CREB without inter- viral pathogenesis. ference from other mammalian cellular factors. In this report, The molecular mechanism by which Tax activates HTLV-1 we demonstrate that heterologous expression of Tax and gene expression has been the subject of intense investigation. It CREB or ATF-1 in S. cerevisiae augmented transcription of a was found that Tax does not bind directly to DNA elements lacZ reporter via the viral 21-bp repeats in vivo. An unmasked within the LTR (20, 44). By using in vitro binding assays, it has NH2 terminus of Tax is absolutely required for this activity. We been demonstrated that Tax interacts with a variety of cellular show that the Tax transactivation assay can be successfully proteins, including members of the ATF-1/CREB family (47, applied to identify proteins which induce transcription via the 57, 60, 65, 66). These transcription factors recognize the se- viral LTR of HTLV-1. This is a powerful way to investigate quence TGACGT in the 21-bp repeats, designated cyclic AMP proteins which may be important for the manifestation of vi- response elements (CRE) (3, 5, 58, 60, 64–66). Biochemical rus-induced diseases in humans. studies have shown that purified Tax protein enhances the binding of CREB to the CRE taken from the viral LTR (13, 60, MATERIALS AND METHODS 62, 66). Additionally, Tax augments transcription of the Recombinant-DNA techniques. Manipulation of DNA was carried out by standard procedures (49). Construction of plasmids is described in Table 1. The Tax protein we used in our studies is tagged at its COOH terminus with six * Corresponding author. Mailing address: Hans-Kno¨ll-Institut fu¨r histidine residues which do not influence the activity of Tax (64). For the two- hybrid analyses, cDNAs coding for Tax and rat CREB were inserted into the Naturstoff-Forschung e.V., Department of Cell and Molecular Biol- multiple cloning sites of plasmids pGBT9 and pGAD424, which express the Gal4 ogy, Beutenbergstr. 11, D-07745 Jena, Germany. Phone: (49) 3641- DNA binding domain (Gal4BD) and the Gal4 activation domain (Gal4AD), 656692. Fax: (49) 3641-656694. Electronic mail address: tmunder respectively (Clontech). In-frame fusions of GAL4-tagged genes were verified by @leutra.imb-jena.de. sequencing by the dideoxynucleotide termination method (50), by using the

7478 VOL. 70, 1996 Tax-MEDIATED TRANSCRIPTION IN S. CEREVISIAE 7479

TABLE 1. Description of plasmids used in this study

Plasmid Relevant protein Origina pMS1 Gal4BD-CREB Cloning of 1.0-kb NdeI (filled)-BamHI fragment of pET-11a-CREB (66) into EcoRI (filled)- and BamHI-digested pGBT9; Gal4BD and initiator ATG of rat CREB are spaced by Pro-Glu-Phe residues pMS2 Gal4AD-CREB Same fragment as described above, but cloned in pGAD424 pMS3 Cloning of 1.3-kb HindIII-BamHI (filled) fragment of pTaxH6 (65) between HindIII and SalI (filled) sites of pBluescript SK(ϩ) to facilitate in-frame fusion of Tax to Gal4BD and Gal4AD pMS4 Gal4BD-Tax Ligation of 1.3-kb EcoRI-XhoI fragment of pMS3 with EcoRI-SalI-digested pGBT9; Gal4BD and initiator ATG of Tax are spaced by Pro-Glu-Phe-Asp-Ile-Lys-Leu residues pMS5 Gal4AD-Tax Same fragment as described above, but cloned in pGAD424 pMS7b CRE-CYC1-lacZ Derivative of pSS (51). Insertion of two 21-bp repeats of viral LTR between HindIII and XhoI sites of CYC1 minimal promoter at bp Ϫ178 by linker tailing with oligonucleotides 5Ј-AGCTTTCGAGAAG GCCCTGACGTCTCCCCCAGATCTGGGCGTTGACGACAACCCCTCACCTCAAAAAACTTTCC ATGC-3Ј and 5Ј-TCGAGCATGGAAAGTTTTTTGAGGTGAGGGGTTGTCGTCAACGCCCAGA TCTGGGGGAGACGTCAGGGCCTTCTCGAA-3Ј pTM175b Obtained after sequential cloning of following fragments into pUC19: 2␮m sequences (2,166 bp of YEp24), HIS3 gene (1,760 bp of YEp6 [56]), GAPCL promoter (400 bp [41]), and CYC1 terminator sequences (255 bp) amplified by PCR using yeast genomic DNA as the template. Primers were as follows: GAPCL promoter, 5Ј-GCGGATCCAGTTCATAGGTCCATTCTC-3Ј and 5Ј-GCGAATTCT TTATTTATGTGGGTTTATTCGAA-3Ј; CYC1 terminator, 5Ј-GCGTCGACATCATGTAATTAGT TATGTCACGC-3Ј and 5Ј-GAGCATGCAAATTAAAGCCTTCGAGCGTCCCA-3Ј. A multiple- cloning-site-containing linker was inserted in the EcoRV site (oligonucleotides 5Ј-TCGAGATATCC TCGAGCTGCAGCCATGGG-3Ј and 5Ј-TCGACCCATGGCTGCAGCTCGAGGATATC-3Ј). PCR products were verified by sequencing pMS8 Tax Cloning of 1.3-kb EcoRI-XhoI fragment of pMS3 into pTM175 pMS9 Tax Exchange of HIS3 selection marker of pMS8 with ADE2-containing BglII fragment (filled) taken from pASZ11 (55) pMS10 CREB Cloning of 1.0-kb NdeI (filled)-BamHI (filled) fragment of pET-11a-CREB into EcoRV site of pBluescript SK(ϩ) pMS11 CREB Ligation of 0.6-kb EcoRI-KpnI fragment of pMS10 with 0.7-kb KpnI-SphI fragment of pMS1 containing alcohol dehydrogenase terminator sequences and cloning into EcoRI-SphI-digested pMS9 pMS13 CYC1-lacZ Deletion of CRE-containing 78-bp HindIII-XhoI fragment of pMS7

a Boldface type in the oligonucleotide sequences indicates the CRE (65). Underlining indicates cloning sites. b For a detailed map, see Fig. 1.

Pharmacia T7 sequencing system. The human ATF-1 cDNA was sequenced by value of 1. Each experiment included at least three independent yeast transfor- using the LI-COR system. mants, and the experiments were repeated three to ﬁve times. The expression of Tax/CREB/ATF-1 in S. cerevisiae was driven by a truncated version of the glyceraldehyde-3-phosphate dehydrogenase promoter (41) present on high-copy-number expression vectors. RESULTS Yeast strains, transformation, and growth conditions. Transformation of yeast Tax as well as CREB forms homodimeric complexes in vivo. cells was carried out by the method of Klebe et al. (33). Yeast transformants were selected and cultivated on SD synthetic medium (2% glucose and 0.67% yeast Many transcription factors interact with their cognate DNA nitrogen base without amino acids) supplemented with essential amino acids and binding site upon dimerization. The CREB protein belongs to nucleotides. the family of basic-region leucine zipper transcription factors Yeast strain SFY526 (MATa ura3-52 his3-200 leu2-3,-112 trp1-901 ade2-101 (bZip) (27). These bZip domains comprise a leucine-rich lys2-801 ⌬gal4 ⌬gal80 URA3::GAL1-lacZ; Clontech) was used for the two-hybrid analyses. As a host for Tax/CREB/ATF-1 expression, strain TFY176 (MAT␣ ura3 dimerization motif and a basic region that mediates DNA his3 leu2 trp1 ade2-101) was generated by crossing S188-8B (MAT␣ ura3-52 his3 contact (34). Gel mobility shift assays have shown that CREB leu2) with CB023 (MATa pep4::HIS3 prb1::hisG prc1::hisG ura3-1 his3-11,-15 is able to form homodimers (22). To analyze the ability of Tax leu2-3,-112 trp1-1 ade2-101 [9]). Reporter plasmids pMS7 and pMS13 (Table 1) and CREB to form dimers in vivo, we used the yeast two- were linearized with StuI and integrated into the ura3 locus of TFY176, which gave rise to strains MSY9 and MSY10, respectively. hybrid system (references 11 and 42 and references therein). ␤-Galactosidase assay. ␤-Galactosidase expression was detected either by The results of our two-hybrid studies are shown in Table 2. qualitative determination by a ﬁlter lift assay (7) with 5-bromo-4-chloro-3-in- Because of the activation properties of Tax, expression of the dolyl-␤-D-galactopyranoside as a substrate or quantitatively by o-nitrophenyl-␤- Gal4BD-Tax hybrid in the presence of Gal4AD, which is not D-galactopyranoside hydrolysis measured photometrically at 420 nm upon per- meabilization of cells (8). The enzymatic activity was normalized to cell culture attached to Tax or CREB, resulted in weak transcription of the density, expressed as arbitrary units. The activity in control strains was set to the reporter gene. This was consistent with previous reports deal- 7480 SHNYREVA AND MUNDER J. VIROL.

TABLE 2. Two-hybrid analysis of Tax/Tax, CREB/CREB, and Tax/CREB interactionsa ␤-Galactosidase Proteins expressionb Gal4BD-Tax ϩ Gal4AD ...... ϩ Gal4BD ϩ Gal4AD-Tax ...... Ϫ Gal4BD-Tax ϩ Gal4AD-Tax...... ϩϩϩ

Gal4BD-CREB ϩ Gal4AD ...... Ϫ Gal4BD ϩ Gal4AD-CREB ...... Ϫ Gal4BD-CREB ϩ Gal4AD-CREB...... ϩϩ Gal4BD-CREB ϩ Gal4AD-CREB ϩ pTM175...... ϩϩ Gal4BD-CREB ϩ Gal4AD-CREB ϩ Tax ...... ϩϩ

Gal4BD-Tax ϩ Gal4AD-CREB...... ϩ Gal4BD-CREB ϩ Gal4AD-Tax...... Ϫ

a Plasmids expressing the described proteins were transformed into yeast strain SFY526. The ␤-galactosidase activity of the resulting strains was monitored by a ﬁlter lift assay (7). Plasmid pTM175 is a yeast expression vector lacking Tax DNA (see Fig. 1). b ␤-Galactosidase activity as detected by ﬁlter lift assay: ϩ, weak; ϩϩ, inter- mediate; ϩϩϩ, strong; Ϫ, not detectable. ing with Gal4BD-Tax fusions in mammalian cells (10, 14, 18, 53, 62). The presence of both Gal4BD-Tax and Gal4AD-Tax hybrid proteins in the reporter strain led to a strong increase in lacZ expression, indicating that Tax forms homodimeric complexes in vivo. The expression of a Gal4BD-CREB hybrid together with Gal4AD did not induce ␤-galactosidase activity. Likewise, a Gal4BD construct lacking CREB was not activated by Gal4AD-CREB. In the presence of both Gal4BD-CREB and Gal4AD-CREB, lacZ gene expression was stimulated, indicating that CREB formed homodimers in vivo (Table 2). Coex- pression of Tax (plasmid pMS8) in this strain did not further enhance ␤-galactosidase activity. No complex formation between Tax and CREB was observed in the yeast two-hybrid system. Fusions of Tax and CREB to either Gal4BD or Gal4AD were used (Table 2). The level of transactivation induced by Gal4BD-Tax and Gal4AD- CREB was not higher than the ␤-galactosidase level induced by Gal4BD-Tax and Gal4AD lacking CREB. In contrast, use of the Gal4BD-Tax bait led to the detection of several proteins interacting with Tax in the two-hybrid assay (unpublished data). In a recently published work, Yin and coworkers demonstrated a physical interaction between Tax and CREB in mammalian cells using the chloramphenicol acetyltransferase reporter (62). In this study, the cDNAs of Tax and CREB were fused at the COOH terminus to the DNA binding domain of Gal4 and the activation domain of the herpes simplex virus

Vp16 protein. In our yeast two-hybrid assay, the NH2-terminal portions of Tax and CREB were masked by the fusion to the FIG. 1. Detailed maps of expression plasmids. (a) Yeast 2␮m-derived vector Gal4 domains. pTM175 for high-level expression of Tax and ATF-1/CREB. GAPCLP, promoter Transactivation of a reporter via 21-bp repeats in the viral of the glyceraldehyde-3-phosphate dehydrogenase gene; CYC1T, terminator sequences of the cytochrome c1 oxidase gene. (b) Yeast integrative vector pMS7 LTR in vivo is dependent on the presence of both Tax and for expression of lacZ under control of the cytochrome c1 oxidase minimal CREB proteins. To analyze the role of CREB in HTLV-1 promoter (CYC1mp) and two 21-bp repeats of the HTLV-1-derived LTR. replication and Tax-mediated transactivation, we constructed an in vivo detection system in S. cerevisiae. Two copies of the viral 21-bp repeats were inserted upstream of the yeast mini- lactosidase (Fig. 2). The presence of both Tax and CREB mal cytochrome c1 oxidase (CYC1) promoter at bp Ϫ178 to expression plasmids led to a 20-fold increase in lacZ expression control the expression of bacterial lacZ. This construct was in comparison with the activity of ␤-galactosidase in strain integrated into the yeast genome, resulting in strain MSY9, MSY9 lacking Tax and CREB. These data demonstrate that which was subsequently transformed with Tax and/or CREB CREB-mediated activation of gene expression in S. cerevisiae expression vectors (Fig. 1). We found that the expression of via CREB binding sites located within the viral LTR was com- either Tax or CREB together with plasmids lacking Tax and pletely dependent on Tax. CREB coding sequences did not stimulate the activity of ␤-ga- Replacement of native CREB by a Gal4AD-CREB fusion VOL. 70, 1996 Tax-MEDIATED TRANSCRIPTION IN S. CEREVISIAE 7481

FIG. 2. Heterologously expressed Tax and rat CREB activate transcription in S. cerevisiae. Reporter plasmid pMS7 was transformed alone, with the Tax expression vector pMS8, and/or with the CREB expression vector pMS11 into yeast strain TFY176. Expressed proteins are indicated. Quantitative ␤-galactosidase FIG. 4. Tax and human ATF-1 stimulate transcription via HTLV-1 21-bp activity was monitored as described in Materials and Methods. Data are ex- repeats in vivo. The cDNAs of Tax, ATF-1, and CREB, as indicated, were pressed as means Ϯ standard deviations (error bars) as obtained from three to inserted in expression vector pTM175 or its derivatives and transformed into five independent yeast transformants. Each experiment was performed at least yeast strain MSY9 containing the 21-bp repeat–CYC1 minimal promoter–lacZ three times. reporter (bars a and c to g) or strain MSY10 lacking 21-bp sequences (bar b). The ␤-galactosidase activities of three independent yeast transformants were determined quantitatively at least three times (means Ϯ standard deviations [error bars] are shown). construct in the presence of Tax led to a similar increase in lacZ expression in comparison with the level for the native CREB (Fig. 3). This indicated that the Gal4AD extension had no influence on the CREB transactivation potential via 21-bp transcriptional activation in vivo, a Gal4 activation domain- repeats. In contrast, no ␤-galactosidase induction was observed tagged cDNA library from HeLa cells (Clontech) was cotrans- when Gal4-Tax was coexpressed with native CREB. This formed with the Tax expression vector pMS8 into the yeast showed that Tax as a Gal4 fusion protein was incapable of strain MSY9, containing the 21-bp repeats–CYC1 minimal activating transcription from 21-bp repeats even in the pres- promoter–lacZ reporter construct. Transformants were plated on SD medium and analyzed for ␤-galactosidase activity by a ence of CREB. We propose that the NH2 terminus of Tax is required for the interaction with CREB in vivo. filter lift assay (7). Of 13,500 clones, one colony tested positive. Use of the Tax/CREB reconstitution system in S. cerevisiae Sequencing of the cDNA insert within the rescued plasmid to identify proteins involved in Tax/CREB/CRE binding in revealed that the DNA encodes the ATF-1 protein (64). It is vivo. To test whether the Tax/CREB reconstitution system known that HeLa cells express a large amount of ATF-1 (29). allows the identification of auxiliary proteins which interact Retransformation of the entire-ATF-1-sequence-containing either with Tax or CREB on the viral 21-bp repeats to facilitate plasmid into the yeast reporter strain led to lacZ gene expres-

FIG. 3. An unmasked NH2 terminus of Tax is necessary for Tax/CREB- FIG. 5. A free NH2 terminus of Tax is required for ATF-1-mediated tran- mediated transactivation in S. cerevisiae via the viral 21-bp repeats. Tax was fused scription in S. cerevisiae. The NH2 terminus of Tax was masked through the with its NH2 terminus to Gal4BD and Gal4AD, respectively. Activity of ␤-ga- attachment of Gal4BD and Gal4AD moieties. ␤-Galactosidase activity in yeast lactosidase in strain MSY9 expressing the indicated proteins was monitored. reporter strain MSY9 expressing the indicated Tax versions together with ATF-1 Data were obtained from three independent yeast colonies, measured at least was determined. These data were obtained from at least three independent three times, and are given as means Ϯ standard deviations (error bars). experiments (means Ϯ standard deviations [error bars] are shown). 7482 SHNYREVA AND MUNDER J. VIROL. sion only in the presence of Tax. These results demonstrated On the basis of these data, we propose that the formation of that Tax coexpressed with ATF-1 specifically increased tran- heterodimers between ATF-1 and CREB has an effect on scription via the 21-bp repeats in vivo. Tax-mediated transcription similar to that of homodimeric Since the identified ATF-1 cDNA was not tagged in frame to ATF-1 or CREB complexes. Gal4AD, we placed the entire coding sequence of ATF-1 un- Our two-hybrid studies have shown that CREB can form der control of the yeast glyceraldehyde-3-phosphate dehydro- homodimers in vivo. Tax has no influence on CREB dimeriza- genase promoter, the same promoter used for Tax and CREB tion in the absence of 21-bp repeats. This is in accordance with expression. This measure should guarantee equal levels of co- recently published in vitro data, indicating that Tax is present expressed proteins. Expression of Tax and ATF-1 led to a in a complex with CREB and the 21-bp repeat but was not 22-fold activation of lacZ gene expression in comparison with found in a complex with CREB and other CRE sequences (63). the level obtained by overexpression of Tax alone (Fig. 4). The This indicates that the effect of Tax on CREB is likely due to induction level was similar to that of the Tax/CREB coexpres- stabilization of binding of CREB dimers to 21-bp repeats (4). sion system. This reaction was highly specific, as we did not Moreover, we found that Tax is also able to generate ho- observe Tax- and ATF-1-dependent lacZ gene expression in modimers in vivo. This is consistent with the work of Legrain the reporter strain MSY10 lacking the 21-bp enhancer se- and coworkers, who used different two-hybrid vectors to show quences. Similar to CREB, ATF-1 did not stimulate transcrip- Tax dimerization (35). In vitro studies using chemical cross- tion of lacZ when Tax was replaced by Gal4-Tax (Fig. 5). Thus, linking of Tax with glutaraldehyde support these findings (21). the integrity of the NH2 terminus of Tax was critical for Tax/ Taken together, these indications lead to a model for Tax- ATF-1-mediated transcription. Coexpression of both ATF-1 mediated transcription. We propose that transcription via the and CREB together with Tax did not enhance the ␤-galacto- viral LTR is induced by a large complex composed of CREB sidase activity relative to activity with ATF-1/Tax- or CREB/ binding sites and CREB as well as Tax homodimers assembled Tax-expressing strains (Fig. 4). on the viral 21-bp repeats. The formation of a multiprotein Herewith, we show that the Tax/CREB/21-bp repeat recon- complex between Tax and CREB has also been postulated by stitution system allows fast screening to identify proteins which interact with Tax on the viral LTR sequence in vivo. Adya et al. (2). Obtaining results in contrast to ours, Yin and coworkers have shown recently that in an assay using a mammalian two- DISCUSSION hybrid system performed with T-lymphocytic Jurkat cells, Tax In this report, we show that Tax-mediated transcription in binds to CREB in vivo (62). In this assay, the COOH terminus vivo via 21-bp repeats located in the LTR of HTLV-1 was fully of Tax was linked to the Gal4BD. The inability to detect dependent on the presence of cellular CREB or ATF-1. We Tax/CREB interaction in yeast cells may be due to the masking used S. cerevisiae as a model system for the reconstitution of of the Tax amino terminus by Gal4 and the fact that yeast cells Tax/CREB/ATF-1 activity. Because of the presence of numer- may lack endogenous proteins required for the interaction ous other cellular proteins, which may influence the activity of between Tax and CREB in the absence of 21-bp repeats. Tax, the role of Tax in viral gene expression in higher eu- It has been demonstrated recently that the attachment of a karyotes is difficult to investigate. glutathione S-transferase moiety to the NH2 terminus of Tax We monitored the transcriptional activity of Tax/ATF-1/ prevents the binding of Tax to CREB in vitro (1). To address CREB in yeast cells through expression of ␤-galactosidase whether blockage of the NH2 terminus of Tax influences its driven by a yeast minimal promoter containing ATF-1/CREB transactivating potential, we expressed Gal4BD-Tax or binding sites within two HTLV-1 21-bp repeats. We showed Gal4AD-Tax together with native CREB and ATF-1 in yeast that the coexpression of Tax together with CREB or ATF-1 led strain MSY9. We found that the integrity of the NH2 terminus to high-level activity of ␤-galactosidase in comparison with the of Tax is critical for Tax/CREB- and Tax/ATF-1-mediated activity in yeast cells expressing Tax or ATF-1/CREB alone. transcription via 21-bp repeats. Transactivation is not impaired This indicates that Tax-mediated transcription via the viral if native Tax together with CREB attached to Gal4 sequences 21-bp repeats is completely dependent on the presence of is present in MSY9. From these data, we conclude that an cellular CREB or ATF-1. ATF-1 is highly related to CREB, unmasked NH2 terminus of Tax is critically required for the and both proteins form heterodimeric complexes when assayed interaction with CREB and for the induction of transcription in vitro (29, 66) and in vivo (38). Despite the extensive struc- via the viral 21-bp repeats. tural homologies, ATF-1 and CREB exhibit several functional In summary, our data have shown that the transcriptional differences in higher eukaryotes (12, 28, 29, 39, 45). It has been activities of viral Tax and cellular CREB and ATF-1 can be proposed that Tax stabilizes the binding of CREB homodimers reconstituted in S. cerevisiae. This avoids the problem of en- and ATF-1/CREB heterodimers to the viral LTR by direct dogenous proteins influencing the function of Tax/ATF-1/ interaction with CREB, whereas Tax binds only marginally to CREB, present in mammalian cells. S. cerevisiae contains pro- ATF-1 homodimers (2, 6, 66). Armstrong and coworkers dem- teins with ATF-1/CREB-like activity, recognizing CREB onstrated recently that Tax is able to increase the 21-bp repeat binding sites (37, 43, 59). The lacZ gene is not expressed in our binding activity of ATF-1 (3). This was confirmed by gel shift LTR reporter strain lacking Tax and/or ATF-1/CREB. This experiments with a glutathione S-transferase–ATF-1 fusion indicates that CREB-like proteins in S. cerevisiae have no in- and purified Tax proteins (60). Our results support the latter fluence on Tax-mediated transcription in our system. However, observations, clearly showing that ATF-1 induces transcription we do not exclude the possibility that yeast endogenous bZip via the viral 21-bp repeats in the presence of Tax in vivo. In our proteins like GCN4 may have a similar activation potential at experiments, ATF-1 and CREB augment transcription to the high expression levels. same extent. This may be due to the high expression levels of We stress the possibility of using the LTR reporter system in these proteins. Slight differences in activation potential may S. cerevisiae for the identification of proteins of viral or cellular depend on protein binding activity and cannot be analyzed in origin that interact with CREB or ATF-1 on the viral 21-bp our system. Coexpression of ATF-1 and CREB in the presence enhancer in the absence of Tax. Furthermore, it should be of Tax did not further enhance the transcriptional stimulation. possible to analyze the functions of other viral targets in S. VOL. 70, 1996 Tax-MEDIATED TRANSCRIPTION IN S. CEREVISIAE 7483 cerevisiae to find proteins involved in the regulation of viral association of human T-cell leukemia virus Tax proteins with DNA results in gene expression. transcriptional activation. J. Virol. 65:4525–4528. 19. Gessain, A., F. Barin, J. C. Vernant, O. Gout, L. Maurs, A. Calender, and G. de The. 1985. Antibodies to human T-lymphotropic virus type I in patients ACKNOWLEDGMENTS with tropical spastic paraparesis. Lancet ii:407–410. 20. Giam, C.-Z., and Y. L. Xu. 1989. HTLV-I tax gene product activates tran- We are indebted to Heike Launhardt for construction of pTM175, scription via preexisting factors and cyclic AMP responsive element. J. Biol. Karin Adelhelm for oligonucleotide synthesis, and Vera Hahnemann Chem. 264:15236–15241. for sequencing of the ATF-1 cDNA. We thank Neeraj Adya, Chou- 21. Gitlin, S. D., P. F. Lindholm, S. J. Marriott, and J. N. Brady. 1991. Trans- Zen Giam, and Didier Picard for providing plasmids and Robert S. dominant human T-cell lymphotropic virus type I TAX1 mutant that fails to Fuller for the gift of yeast strain CB023. Additionally, we are grateful localize to the nucleus. J. Virol. 65:2612–2621. to Albert Hinnen, Hans-Peter Saluz, and Stefan Wo¨lfl for critically 22. Gonzalez, G. A., K. K. Yamamoto, W. H. Fischer, D. Karr, P. Menzel, W. Biggs, W. W. Vale, and M. R. Montminy. reading the manuscript. 1989. A cluster of phosphorylation sites on the cyclic AMP-regulated nuclear factor CREB predicted by its M.S. was supported in part by a grant from the Deutschen Akade- sequence. Nature (London) 337:749–751. mischen Austauschdienst. 23. Hidaka, M., J. Inoue, M. Yoshida, and M. Seiki. 1988. Post-transcriptional regulator (rex) of HTLV-1 initiates expression of viral structual proteins but suppresses expression of regulatory proteins. EMBO J. 7:519–523. ADDENDUM 24. Himes, S. R., L. S. Coles, R. Katsikeros, R. K. Lang, and M. F. Shannon. 1993. HTLV-1 tax activation of the GM-CSF and G-CSF promoters requires While the manuscript of this article was under review, a the interaction of NF-␬B with other transcription factor families. Oncogene similar study was published by Bantignies and coworkers (3a). 8:3189–3197. 25. Hinnen, A., F. Buxton, B. Chaudhuri, J. Heim, T. Hottiger, B. Meyhack, and REFERENCES G. Pohlig. 1995. Gene expression in recombinant yeast, p. 121–193. In A. 1. Adya, N., and C.-Z. Giam. 1995. Distinct regions in human T-cell lympho- Smith (ed.), Gene expression in recombinant microorganisms. Marcel Dek- trophic virus type I Tax mediate interactions with activator protein CREB ker, Inc., New York. and basal transcription factors. J. Virol. 69:1834–1841. 26. Hinuma, Y., H. Komoda, T. Chosa, T. Kondo, M. Kohakura, T. Takenaka, 2. Adya, N., L.-J. Zhao, W. Huang, I. Boros, and C.-Z. Giam. 1994. Expansion M. Kikuchi, M. Ichimaru, K. Yunoki, I. Sato, R. Matsuo, Y. Takiuchi, H. of CREB’s DNA recognition specificity by Tax results from interaction with Uchino, and M. Hanaoka. 1982. Antibodies to adult T-cell leukemia virus- Ala-Ala-Arg at positions 282-284 near the conserved DNA binding domain associated antigen (ATLA) in sera from patients with ATL and controls in of CREB. Proc. Natl. Acad. Sci. USA 91:5642–5646. Japan: a nationwide sero epidemiologic study. Int. J. Cancer 29:631–635. 3. Armstrong, A. P., A. A. Franklin, M. N. Uittenbogaard, H. A. Giebler, and 27. Hoeffler, J. P., T. E. Meyer, Y. Yun, J. L. Jameson, and J. F. Habener. 1988. J. K. Nyborg. 1993. Pleiotropic effect of the human T-cell leukemia virus Tax Cyclic AMP-responsive DNA binding protein: structure based on a cloned protein on the DNA binding activity of eukaryotic transcription factors. Proc. placental cDNA. Science 242:1430–1433. Natl. Acad. Sci. USA 90:7303–7307. 28. Hurst, H. C., N. Masson, N. C. Jones, and K. A. W. Lee. 1990. The cellular 3a.Bantignies, F., R. Rousset, C. Desbois, and P. Jalinot. 1996. Genetic char- transcription factor CREB corresponds to activating transcription factor 47 acterization of transactivation of the human T-cell leukemia virus type 1 (ATF-47) and forms complexes with a group of polypeptides related to promoter: binding of Tax to Tax-responsive element 1 is mediated by the ATF-43. Mol. Cell. Biol. 10:6192–6203. cyclic AMP-responsive members of the CREB/ATF family of transcription 29. Hurst, H. C., N. F. Totty, and N. C. Jones. 1991. Identification and functional factors. Mol. Cell. Biol. 16:2174–2182. characterization of the cellular activating transcription factor 43 (ATF-43) 4. Baranger, A. M., C. R. Palmer, M. K. Hamm, H. A. Giebler, A. Brauweiler, protein. Nucleic Acids Res. 19:4601–4609. J. K. Nyborg, and A. Schepartz. 1995. Mechanism of DNA-binding enhance- 30. Inoue, J., M. Seiki, T. Taniguchi, S. Tsuru, and M. Yoshida. 1986. Induction ment by the human T-cell leukaemia virus transactivator Tax. Nature (Lon- of interleukin 2 receptor gene expression by p40x encoded by human T-cell don) 376:606–608. leukemia virus type 1. EMBO J. 5:2883–2888. 5. Beimling, P., and K. Moelling. 1992. Direct interaction of CREB protein 31. Kadison, P., H. T. Poteat, K. M. Klein, and D. V. Faller. 1990. Role of with 21 bp Tax-response elements of HTLV-I LTR. Oncogene 7:257–262. protein kinase A in Tax transactivation of the human T-cell leukemia virus 6. Brauweiler, A., P. Garl, A. A. Franklin, H. A. Giebler, and J. K. Nyborg. type I long terminal repeat. J. Virol. 64:2141–2148. 32. Kiyokawa, T., M. Seiki, S. Iwashita, K. Imagawa, F. Shimizu, and M. Yo- 1995. A molecular mechanism for human T-cell leukemia virus latency and x-III Tax transactivation. J. Biol. Chem. 270:12814–12822. shida. 1985. p27 proteins encoded by the pX sequence of human T-cell 7. Breeden, L., and K. Nasmyth. 1985. Regulation of the yeast HO gene. Cold leukemia virus type I. Proc. Natl. Acad. Sci. USA 82:8359–8363. Spring Harbor Symp. Quant. Biol. 50:643–650. 33. Klebe, R. J., J. V. Harriss, Z. D. Sharp, and M. G. Douglas. 1983. A general 8. Breeden, L., and K. Nasmyth. 1987. Cell cycle control of the yeast HO gene: method for polyethylene-glycol-induced genetic transformation of bacteria Cis- and Trans-acting regulators. Cell 48:389–397. and yeast. Gene 25:333–341. 9. Brenner, C., and R. S. Fuller. 1992. Structural and enzymatic characteriza- 34. Landschulz, W. H., P. F. Johnson, and S. L. McKnight. 1988. The leucine tion of a purified prohormone-processing enzyme: secreted, soluble Kex2 zipper: a hypothetical structure common to a new class of DNA binding protease. Proc. Natl. Acad. Sci. USA 89:922–926. proteins. Science 240:1759–1764. 10. Connor, L. M., M. N. Oxman, J. N. Brady, and S. J. Marriott. 1993. Twenty-one 35. Legrain, P., M.-C. Dokhelar, and C. Transy. 1994. Detection of protein- base pair repeat elements influence the ability of a Gal4-Tax fusion protein to protein interactions using different vectors in the two-hybrid system. Nucleic transactivate the HTLV-I long terminal repeat. Virology 195:569–577. Acids Res. 22:3241–3242. 11. Fields, S., and O.-K. Song. 1989. A novel genetic system to detect protein- 36. Leung, K., and G. J. Nabel. 1988. HTLV-1 transactivator induces interleu- protein interactions. Nature (London) 340:245–246. kin-2 receptor expression through an NF-kappa B-like factor. Nature (Lon- 12. Flint, K. J., and N. C. Jones. 1991. Differential regulation of three members don) 333:776–778. of the ATF/CREB family of DNA-binding proteins. Oncogene 6:2019–2026. 37. Lin, Y.-S., and M. R. Green. 1989. Identification and purification of a Sac- 13. Franklin, A. A., M. F. Kubik, M. N. Uittenbogaard, A. Brauweiler, P. Utais- charomyces cerevisiae protein with the DNA binding specificity of mamma- incharoen, M.-A. H. Matthews, W. S. Dynan, J. P. Hoeffler, and J. K. Nyborg. lian activating transcription factor. Proc. Natl. Acad. Sci. USA 86:109–113. 1993. Transactivation by the human T-cell leukemia virus Tax protein is 38. Liu, F., M. A. Thompson, S. Wagner, M. E. Greenberg, and M. R. Green. mediated through enhanced binding of activating transcription factor-2 1993. Activating transcription factor-1 can mediate Ca2ϩ- and cyclic AMP- (ATF-2) ATF-2 response and cyclic AMP element-binding protein (CREB). inducible transcriptional activation. J. Biol. Chem. 268:6714–6720. J. Biol. Chem. 268:21225–21231. 39. Maekawa, T., S. Matsuda, J.-I. Fujisawa, M. Yoshida, and S. Ishi. 1991. 14. Fujii, M., T. Niki, T. Mori, T. Matsuda, M. Matsui, N. Nomura, and M. Cyclic AMP response element-binding protein, CRE-BP1, mediates the Seiki. 1991. HTLV-1 Tax induces expression of various immediate early E1A-induced but not the Tax-induced trans-activation. Oncogene 6:627–632. serum responsive genes. Oncogene 6:1023–1029. 40. Matthews, M. A., R. B. Markowitz, and W. S. Dynan. 1992. In vitro activation 15. Fujii, M., P. Sassone-Corsi, and I. M. Verma. 1988. c-fos promoter transac- of transcription by the human T-cell leukemia virus type I Tax protein. Mol. tivation by the tax1 protein of human T-cell leukemia virus type I. Proc. Natl. Cell. Biol. 12:1986–1996. Acad. Sci. USA 85:8526–8530. 41. Meyhack, B., A. Hinnen, and J. Heim. 1989. Heterologous gene expression 16. Fujii, M., H. Tsuchiya, T. Chujoh, T. Akizawa, and M. Seiki. 1992. Interac- in Saccharomyces cerevisiae, p. 311–321. In C. L. Hershberger, S. W. tion of HTLV-I Tax1 with p67SRF causes the aberrant induction of cellular Queener, and G. Hegeman (ed.), Genetics and molecular biology of indus- immediate early genes through CArG boxes. Genes Dev. 6:2066–2076. trial microorganisms. American Society for Microbiology, Washington, D.C. 17. Fujii, M., H. Tsuchiya, and M. Seiki. 1991. HTLV-I Tax has distinct but 42. Munder, T. 1995. Strategy to analyze protein/protein and protein/protein/ overlapping domains for transcriptional activation and for enhancer speci- DNA interactions in vivo, p. 11–35. In H.-P. Saluz and K. Wiebauer (ed.), ficity. Oncogene 6:2349–2352. DNA- and nucleoprotein structure in vivo. R. G. Landes Company, Austin, 18. Fujisawa, J., M. Toita, T. Yoshimura, and M. Yoshida. 1991. The indirect Tex. 7484 SHNYREVA AND MUNDER J. VIROL.

43. Nojima, H., S. H. Leem, H. Araki, A. Sakai, N. Nakashima, Y. Kanaoka, and 55. Stotz, A., and P. Linder. 1990. The ADE2 gene from Saccharomyces cerevi- Y. Ono. 1994. Hac1: a novel yeast bZip protein binding to the CRE motif is siae: sequence and new vectors. Gene 95:91–98. a multicopy suppressor for cdc10 mutant of Schizosaccharomyces pombe. 56. Struhl, K., D. T. Stinchcombe, S. Scherer, and R. W. Davis. 1979. High- Nucleic Acids Res. 22:5279–5288. frequency transformation of yeast: autonomous replication of hybrid DNA. 44. Nyborg, J. K., W. S. Dynan, I. S. Chen, and W. Wachsman. 1988. Binding of Proc. Natl. Acad. Sci. USA 76:1035–1039. host-cell factors to DNA sequences in the long terminal repeat of human 57. Suzuki, T., J. I. Fujisawa, M. Toita, and M. Yoshida. 1993. The transactiva- T-cell leukemia virus type I: implications for viral gene expression. Proc. tor tax of human T-cell leukemia virus type 1 (HTLV-I) interacts with cyclic Natl. Acad. Sci. USA 85:1457–1461. AMP-responsive element (CRE) binding and CRE modulator proteins that 45. Orten, D. J., J. M. Strawhecker, S. D. Sanderson, D. Huang, M. B. Prys- bind to the 21-base-pair enhancer of HTLV-1. Proc. Natl. Acad. Sci. USA towsky, and S. H. Hinrichs. 1994. Differential effects of monoclonal anti- 90:610–614. bodies on activating transcription factor-1 and cyclic AMP response element 58. Suzuki, T., H. Hirai, J. Fujisawa, T. Fujita, and M. Yoshida. 1993. A trans- binding protein interactions with DNA. J. Biol. Chem. 269:32254–32263. activator Tax of human T-cell leukemia virus type 1 binds to NF-kappa B p50 46. Osame, M., K. Usuku, S. Izumo, N. Ijichi, H. Amitani, A. Igata, M. Matsu- and serum response factor (SRF) and associates with enhancer DNAs of the moto, and M. Tara. 1986. HTLV-I associated myelopathy, a new clinical 93: entity. Lancet i:1031–1032. NF-kappa B site and CArG box. Oncogene 2391–2397. Vincent, A. C., and K. Struhl. 47. Paca-Uccaralertkun, S., L. J. Zhao, N. Adya, J. V. Cross, B. R. Cullen, I. M. 59. 1992. ACR1, a yeast ATF/CREB repressor. Boros, and C.-Z. Giam. 1994. In vitro selection of DNA elements highly Mol. Cell. Biol. 12:5394–5405. responsive to the human T-cell lymphotropic virus type I transcriptional 60. Wagner, S., and M. R. Green. 1993. HTLV-I tax protein stimulation of DNA activator, Tax. Mol. Cell. Biol. 14:456–462. binding of bZip proteins by enhancing dimerization. Science 262:395–399. 48. Poiesz, B., R. W. Ruscetti, A. F. Gazdar, P. A. Bunn, J. D. Minna, and R. C. 61. Yamamoto, K. K., G. A. Gonzalez, W. H. Biggs, and M. R. Montminy. 1988. Gallo. 1980. Detection and isolation of type C retrovirus particles from fresh Phosphorylation-induced binding and transcriptional efficacy of nuclear fac- and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. tor CREB. Nature (London) 334:494–498. Proc. Natl. Acad. Sci. USA 77:7415–7419. 62. Yin, M.-J., E. J. Paulssen, J.-S. Seeler, and R. B. Gaynor. 1995. Protein 49. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a domains involved in both in vivo and in vitro interactions between human laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, T-cell leukemia virus type I Tax and CREB. J. Virol. 69:3420–3432. N.Y. 63. Yin, M. J., and R. Gaynor. 1996. Complex formation between CREB and 50. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with Tax enhances the binding affinity of CREB for the human T-cell leukemia chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467. virus type 1 21-base-pair repeats. Mol. Cell. Biol. 16:3156–3168. 51. Schena, M., and K. R. Yamamoto. 1988. Mammalian glucocorticoid receptor 64. Yoshimura, T., J. Fujisawa, and M. Yoshida. 1990. Multiple cDNA clones derivatives enhance transcription in yeast. Science 241:965–967. encoding nuclear proteins that bind to the tax-dependent enhancer of 52. Seeler, J. S., C. Muchardt, M. Podar, and R. B. Gaynor. 1993. Regulatory HTLV-1: all contain a leucine zipper structure and basic amino acid domain. elements involved in tax-mediated transactivation of the HTLV-I LTR. EMBO J. 9:2537–2542. Virology 196:442–450. 65. Zhao, L. J., and C.-Z. Giam. 1991. Interaction of the human T-cell lympho- 53. Semmes, O. J., and K.-T. Jeang. 1992. Mutational analysis of human T-cell trophic virus type I (HTLV-I) transcriptional activator Tax with cellular leukemia virus type I Tax: regions necessary for the function determined with factors that bind specifically to the 21-base-pair repeats in the HTLV-I 47 mutant proteins. J. Virol. 66:7183–7192. enhancer. Proc. Natl. Acad. Sci. USA 88:11445–11449. 54. Smith, M. R., and W. C. Greene. 1991. Type I human T cell leukemia virus 66. Zhao, L. J., and C.-Z. Giam. 1992. Human T-cell lymphotrophic virus type I Tax protein transforms rat fibroblasts through the cyclic adenosine mono- (HTLV-I) transcriptional activator, Tax, enhances CREB binding to phosphate response element binding protein/activating transcription factor HTLV-I 21-base-pair repeats by protein-protein interaction. Proc. Natl. pathway. J. Clin. Invest. 88:1038–1042. Acad. Sci. USA 89:7070–7074.