Monitoring Gene Expression Changes in Bovine Oviduct Epithelial Cells During the Oestrous Cycle

449 Monitoring gene expression changes in bovine oviduct epithelial cells during the oestrous cycle

S Bauersachs, S Rehfeld, SE Ulbrich1, S Mallok2, K Prelle, H Wenigerkind3, R Einspanier1, H Blum2 and E Wolf Institute of Molecular Animal Breeding, Ludwig Maximilians University, Feodor-Lynen-Str. 25, 81377 Munich, Germany 1Institute of Physiology, Technical University of Munich, Weihenstephaner Berg 3, 85354 Freising, Germany 2Gene Centre of the Ludwig Maximilians University, Feodor-Lynen-Str. 25, 81377 Munich, Germany 3Bavarian Research Centre for Biology of Reproduction, Hackerstr. 27, 85764 Oberschleissheim, Germany (Requests for offprints should be addressed to E Wolf; Email: [email protected]) (K Prelle is now at CRBA Gynecology & Andrology, Schering AG, Muellerstr. 178, 13442 Berlin, Germany) (R Einspanier is now at Institute of Veterinary Biochemistry, Free University of Berlin, Oertzenweg 19b, 14163 Berlin, Germany)

Abstract

The oviduct epithelium undergoes marked morphological and functional changes during the oestrous cycle. To study these changes at the level of the transcriptome we did a systematic gene expression analysis of bovine oviduct epithelial cells at oestrus and dioestrus using a combination of subtracted cDNA libraries and cDNA array hybridisation. A total of 3072 cDNA clones of two subtracted libraries were analysed by array hybridisation with cDNA probes derived from six cyclic heifers, three of them slaughtered at oestrus and three at dioestrus. Sequencing of cDNAs showing significant differences in their expression levels revealed 77 different cDNAs. Thirty-seven were expressed at a higher level at oestrus, for the other 40 genes expression levels were higher at dioestrus. The identified genes represented a variety of functional classes. During oestrus especially genes involved in the regulation of protein secretion and protein modification, and mRNAs of secreted proteins, were up-regulated, whereas during dioestrus particularly transcripts of genes involved in transcription regulation showed a slight up-regulation. The concentrations of seven selected transcripts were quantified by real-time RT-PCR to validate the cDNA array hybridisation data. For all seven transcripts, RT-PCR results were in excellent correlation (r>0·92) with the results obtained by array hybridisation. Our study is the first to analyse changes in gene expression profiles of bovine oviduct epithelial cells during different stages of the oestrous cycle, providing a starting point for the clarification of the key transcriptome changes in these cells. Journal of Molecular Endocrinology (2004) 32, 449–466

Introduction The oviduct is responsible for the transport of ova, sperm and embryos, and the oviduct epithelial The oviduct epithelium is important for different cells are the ﬁrst to have contact with the ova and reproductive processes and undergoes marked the cleavage-stage embryos. The isthmus part is morphological and functional changes during the described as functioning as a sperm reservoir – oestrous cycle. It has been shown that a dramatic sperm adhere to the epithelium and at the time of change in the frequencies of ciliated and non- ovulation they are released (Hunter & Wilmut ciliated cells occurs during the oestrous cycle (Yaniz 1984) to ensure the perfect timing of fertilisation. In et al. 2000). At pre-oestrus the epithelium consists this way, the oviduct provides the microenviron- mainly of secretory cells and at dioestrus of ciliated ment for sperm capacitation, fertilisation, and early cells. A recent study implies that the individual embryonic development (Buhi 2002). epithelial cells change their functional status, rather At the molecular level only few genes or proteins than the whole cell population being renewed, are known that change in activity or abundance during the oestrous cycle (Suuroia et al. 2002). during the oestrous cycle and may be important for

Downloaded from Bioscientifica.com at 09/29/2021 05:28:10AM via free access 450 S BAUERSACHS and others · Transcriptomics of oviduct epithelial cells

fertility, such as the bovine oviduct-specific after standing heat occurred and three animals glycoprotein, the major secretory protein in the (group B) 12 days after oestrus. Blood samples were oviduct (Boice et al. 1990). This protein has been taken just before slaughtering to determine P4 described as having a positive influence on sperm serum levels. Group A animals displayed low serum capacitation and motility, the interaction of the P4 levels (,3·0 ng/ml) and group B animals had gametes and fertilisation (for a review, see Buhi high serum P4 levels (.12·0 ng/ml). Oviducts were 2002). The expression of this glycoprotein is trimmed free of surrounding tissue and ligated at oestrogen-dependent with the highest level at the infundibulum and at the isthmus–uterus oestrus and the lowest in the luteal phase. junction. The complete organs were rinsed with However, the production of a null mutation of the PBS. After opening the oviduct longitudinally, oviduct-specific glycoprotein (OVGP1) gene in a epithelial cells were isolated by scraping the recent study in the mouse showed that fertility of mucosal epithelial layer with a sterile glass slide ovgp1/ females was in normal limits, indicating (Reischl et al. 1999). Within 10 min after death cells that OVGP1 is not essential for fertilisation (Araki were transferred into cryotubes and immediately et al. 2003). dropped into liquid nitrogen for transport, and Recently, we did a first systematic analysis of were stored at 80 C until further processing. All gene expression in bovine oviduct epithelial cells at experiments with animals were carried out with day 3·5 of the oestrous cycle comparing the permission from the local veterinary authorities. ipsilateral and the contralateral oviduct (Bauersachs et al. 2003). For that study we successfully used a Oligonucleotides for suppression subtractive combination of subtracted cDNA libraries and hybridisation (SSH) cDNA array hybridisation to identify cDNAs differentially regulated in the ipsi- vs the contralat- The following oligonucleotides were used for eral oviduct. In the present study we investigated SSH: cDNA primer 1: AACTGCGGCCGCGTA the mRNA expression profile in epithelial cells of CAGCT20VN (V=A, C or G), cDNA primer 2: the ipsilateral oviduct at oestrus and dioestrus to GAGAT20VN, adapter 1: 5 -GTAATACGACTC provide a starting point for the identification of key ACTATAGGGCTCGAGCGCGCCGCAGGGC transcriptome changes during the oestrous cycle. AGTG-3, adapter 1 reverse: 5-CACTGCCCTG The results obtained by cDNA array hybridisation CGGG-3, adapter 2: 5-GTAATACGACTCAC were verified for seven selected transcripts by TATAGGGCAGGGCGTGGTGCGCGCTGC absolute quantification using a real-time RT-PCR TGG-3, adapter 2 reverse: 5-CCAGCAGCGC approach. GCAG-3, PCR primer 1: 5-GTAATACGACT CACTATAGGGC-3, nested primer 1: 5-TCG AGCGCGCCGCAGGGCAGTG-3, and nested Materials and methods primer 2: 5-AGGGCGTGGTGCGCGCTGC TGG-3. Synchronisation of oestrous cycle and isolation of oviduct epithelial cells Six cyclic heifers (Deutsches Fleckvieh) between 22 Generation of subtracted cDNA libraries and 36 months old were treated with a progester- The production of subtracted libraries was done one (P4)-releasing intravaginal device (1·94 g P4) according to the SSH method (Diatchenko et al. (EAZI-Breed CIDR; Animal Reproductive Tech- 1996, 1999, Gurskaya et al. 1996). Total RNA from nologies Ltd, Leominster, Hereford and Worcs, bovine oviduct epithelial cells was isolated using UK) for 11 days beginning at dioestrus. After Trizol (Invitrogen) according to the manufacturer’s removal a single dose of 500 µg cloprostenol instructions. For each stage of the cycle, oestrus and (Estrumate; Essex Tierarznei, Munich, Germany) dioestrus, RNA of two animals was pooled. was administered i.m. Animals were observed for Double-stranded (ds) cDNA was synthesised start- sexual behaviour (i.e. toleration, sweating, vaginal ing with 80 µg total RNA (corresponding to mucus) to determine standing heat, which occurred approximately 1·5–2 µg mRNA) using Superscript around 60 h after Estrumate injection. Three II (400 U) (Invitrogen) and cDNA primer 1 animals (group A) were slaughtered the morning (50 pmol) for first-strand synthesis. The second

Journal of Molecular Endocrinology (2004) 32, 449–466 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/29/2021 05:28:10AM via free access Transcriptomics of oviduct epithelial cells · S BAUERSACHS and others 451 strand was synthesised with Escherichia coli DNA Tris/HCl-EDTA(TE) buffer (pH 8·0), incubated at polymerase I (40 U), E. coli RNase H (2 U), and 96 C for 10 min, and stored at 20 C. PCR E. coli DNA ligase (10 U) (Invitrogen) according to amplification of the cDNA insertions was per- the manufacturer’s instructions. Ribosomal and formed in 20 µl in 96-well cycle plates and other residual RNAs were digested with 3 µl RNase contained 1 µl diluted bacterial cells, PCR buffer (0·5 mg/µl, DNase-free, from bovine pancreas; (peQLab, Erlangen, Germany), 200 pmol/µl Roche Diagnostics) for 90 min at 37 C. cDNA was dNTPs, 0·3 pmol/µl of the respective primers then incubated with 10 U T4 DNA polymerase (modified T3 and T7 primers), and 1 U Taq DNA (Roche) (5 min at 16 C) to yield blunt ends. After polymerase (peQLab). All PCR products were phenol/chloroform extraction and DNA precipita- analysed by 0·8% agarose gel electrophoresis tion cDNA was digested with RsaI (Roche). Tester showing that more than 95% of the PCR reactions cDNA was ligated with adapter 1/1 rev or adapter yielded defined PCR products. Fifteen microlitres 2/2 rev overnight at 16 C using T4 DNA ligase of PCR reactions were transferred to 384-well (400 U; New England Biolabs). The first step of microtitre plates (Nunc) containing 15 µl 2-fold SSH was performed in 4 µl for 8 h and the second spotting buffer (40 mM Tris–HCl pH 8, 2 M NaCl, hybridisation in 9 µl for 20 h at 68 C. Excess of 2 mM EDTA, bromophenol blue). A total of 1536 driver was 30-fold in the first step of SSH. PCR products were spotted onto nylon membranes Suppression PCR was performed with the follow- (Nytran Supercharge; Schleicher & Schuell, Dassel, ing parameters for primary PCR reactions: 75 C Germany) on an area of 2050 mm using an for 5 min; 96 C for 60 s; 29 cycles (dioestrus) or 31 Omnigrid Accent microarrayer (GeneMachines, cycles (oestrus) at (94 C for 30 s, 66 C for 30 s, San Carlos, CA, USA) and solid pins (SSP015, 72 C for 1·5 min); 72 C for 3 min. PCR products diameter 0·015 inches; Telechem International, were diluted 10-fold and 1 µl of the dilution was Sunnyvale, CA, USA). Spotting was done six times used as a template for secondary PCR. This for each PCR product on the same position for reaction was performed using nested primers with sufficient and equal application; 25 arrays were the following parameters: 96 C for 1 min; 12 produced simultaneously. The overall 3072 PCR cycles (dioestrus) or 14 cycles (oestrus) at (94 C for products had to be distributed on two arrays that 30 s, 68 C for 30 s, 72 C for 1·5 min); 72 C for contained 1536 cDNAs (768 cDNAs of each 3 min. All PCR reactions were done in a Perkin subtracted library per array). The spotted cDNAs Elmer Cetus thermal cycler using the Advantage were denatured on the arrays by incubation on 2 Polymerase Mix (BD Clontech, Heidelberg, filter paper (Schleicher & Schuell) soaked with Germany). After phenol/chloroform extraction and 0·5 M NaOH for 20 min at room temperature. DNA precipitation PCR products were digested DNA was fixed by baking at 80 C for 30 min and with BssHII (New England Biolabs) (inside the UV cross-linking (120 mJ/cm2) (XL-1500 UV adapter sequences), purified by agarose gel Crosslinker; Spectronics Corp., New York, USA). electrophoresis, and ligated overnight with the AscI-digested (New England Biolabs) and dephos- cDNA array hybridisation phorylated vector DNA (derivative of pBSIISK ; Stratagene). The ligation reaction was introduced RNA of all six animals (oestrus n=3, dioestrus n=3) directly into E. coli SURE (Stratagene) by was converted to ds cDNA essentially as described electroporation. The subtracted libraries were above but using cDNA primer 2. 33P-labelled cDNA stored as glycerol stocks at 80 C. probes were generated from ds cDNA corresponding to 7·5–15 µg total RNA. cDNA was heat- denatured for 10 min at 96 C and then chilled on Preparation of cDNA arrays ice. High Prime reaction mixture (Roche), dNTP cDNA array hybridisation was done essentially as mixture (dCTP final concentration 10 pmol/µl, previously described (Bauersachs et al. 2003). In dATP, dGTP, and dTTP final concentration each brief, 1536 cDNA clones were randomly picked for 100 pmol/µl) and 90 µCi [-33P]dCTP were added each library and grown overnight at 37 Cin to a final volume of 20 µl. Reactions were incubated 100 µl LB medium in 96-well microtitre plates. for 4 h at 37 C and subsequently purified with Bacterial suspensions were diluted 20-fold in MicroSpin G-25 Columns (Amersham Biosciences) www.endocrinology.org Journal of Molecular Endocrinology (2004) 32, 449–466

Downloaded from Bioscientifica.com at 09/29/2021 05:28:10AM via free access 452 S BAUERSACHS and others · Transcriptomics of oviduct epithelial cells

to remove unincorporated nucleotides and to each array. These normalised values of the six estimate labelling efficiency. Hybridisation was done hybridisation experiments were then used for as follows: pre-hybridisation was done for up to six statistical analysis (Student’s t-test). Differences arrays together in one 15 cm glass hybridis- were considered significant at P,0·05 and a ratio ation bottle: 310 min 10 ml 1PBS/10% SDS d1·5. Reproducibility of the used array system was at 65 C; 210 min 10 ml 0·1PBS/1% SDS at shown previously (Bauersachs et al. 2003). 85 C; 310 min 10 ml 1PBS/10% SDS at 65 C. Hybridisation probes were denatured for Sequencing of cDNAs with differential 15 min at 96 C immediately before adding to the hybridisation signals and data analysis hybridisation solution. Hybridisation was done in plastic vials (Poly-Q vials, 18 ml; Beckman Coulter, cDNA fragments showing differential hybridisation Munich, Germany) in 2 ml 1PBS, pH 7·5/10% signals were sequenced directly from spotting SDS for 45 h at 65 C. After hybridisation, arrays solutions by automated DNA sequencing (3100- were put together in one 15 cm glass hybridis- Avant Genetic Analyzer; Applied Biosystems, ation bottle and washed as follows: 35 min 10 ml Langen, Germany). Resulting sequences were 1PBS/10% SDS at 65 C; 310 min 10 ml 1 compared with public sequence databases using the PBS/10% SDS at 65 C; 310 min 10 ml basic local alignment search tool at the National 0·1PBS/1% SDS at 65 C and finally 25 min Centre for Biotechnology Information (http:// 10 ml 1PBS/1% SDS/2 mM EDTA at room www.ncbi.nlm.nih.gov/blast/blast.cgi). cDNAs temperature. Filters were dried by baking at 80 C without similar entries in the ‘nr’ database (all for 20 min and exposed to an imaging plate BAS-SR GenBank+RefSeq Nucleotides+EMBL+DDBJ+ (Fuji Photo Film Co.) Imaging plates were scanned PDB sequences, but no EST, STS, GSS, or phase with a phosphor imager (Storm 860; Amersham 0, 1 or 2 HTGS sequences) were in addition Biosciences). compared with themselves to find redundant To facilitate optimal evaluation of the hybridis- cDNA fragments. Based on the human or mouse ation signals, 212 of the 3072 cDNA fragments homologues simplified Gene Ontologies were were removed from the arrays due to their very built using GeneSpring software version 6·1 high signal intensity that interfered with the (Silicon Genetics, Redwood City, CA, USA). analysis of approximately 20% of all signals; 103 Data from other sources, for example UniGene cDNA fragments were from the oestrous library (www.ncbi.nlm.nih.gov/uniGene/), LocusLink (www. and 109 from the dioestrous library. Hybridis- ncbi.nlm.nih.gov/locusLink/), and PubMed (www. ation of the arrays with the cDNA for bovine ncbi.nlm.nih.gov/entrez/query.fcgi), were also inte- mRNA for 95 kDa OVGP1 showed that approxi- grated. The obtained sequences were submitted to mately 70 cDNA fragments corresponded to the dbEST (a division of GenBank). OVGP1 cDNA. The OVGP1-positive cDNA fragments came from the oestrous library and Primer pairs for real-time RT-PCR showed higher expression at oestrus. The cDNAs that were removed in addition to the OVGP1 The following primers were used to amplify specific cDNAs showed no differential signals between fragments referring to selected regulated genes (for oestrus and dioestrus. abbreviations see Table 1, length of PCR products These optimised arrays were used for the final in square brackets): TRA1 (for 5-TGGCAGAG hybridisation analysis as described above. ACCATCGAAAG-3; rev 5-GGTAACTTCCC CTTCAGCAG-3 [120 bp]), ERP70 (for 5-TCGA CTACATGATGGAGCAG-3; rev 5-CCGACT Analysis of array data TAAAGACTCCGATG-3 [117 bp]), GRP78/ Array evaluation was done using AIDA Image HSPA5 (for 5-AACGACCCCTGACGAAAG Analyzer (Version 3·27; Raytest, Straubenhardt, AC-3; rev 5-TCACTCGAAGAATGCCATTC Germany). Background was subtracted with the AC-3 [129 bp]), AGR2 (for 5-AACTCAAAC ‘Weighted background dot’ function. Raw data TGCCCCAGACC-3; rev 5-ACAAACTGCTC obtained by AIDA Array software were exported to TGCCAATCTC-3 [205 bp]), OVGP1 (for 5-TG Microsoft Excel and normalised to the median of TCCACGTTTTCCAACCG-3; rev 5-GGAGG

Journal of Molecular Endocrinology (2004) 32, 449–466 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/29/2021 05:28:10AM via free access www.endocrinology.org

Table 1 Genes up-regulated at oestrus

GenBank Common accession Homology Protein Gene Ontologies Gene Ontologies Gene Ontologies name number UniGene (%) function Biological Process Molecular Function Cellular Component Oe:Di* P value

Bovine cDNA/gene or homologue Homo sapiens FLJ37927; NM_152623 Hs.170708 78 Cell cycle control ———7·50·023 CDC20-like protein G6VTS76519 (FLJ37927) Homo sapiens CDC28 CKS2; NM_001827 Hs.83758 93 Cell cycle control Regulation of CDK Cyclin-dependent — 7·1 0·006 protein kinase CKSHS2 activity; cell cycle; protein kinase activity regulatory subunit 2 cytokinesis Homo sapiens mRNA KIAA1154; AB032980 Hs.61345 78 Cellular defence Cellular defence Tumour antigen — 1·9 <0·001 for KIAA1154 protein DCDC2; RU2 response response Homo sapiens LCP1; CP64; NM_002298 Hs.381099 91 Cytoskeleton; — Actin binding; calcium Cytosol 2·6 0·048 lymphocyte cytosolic PLS2; LC64P; actin-bundling ion binding protein 1 (L-plastin) L-PLASTIN protein Homo sapiens retinoic RARRES1; NM_002888 Hs.82547 84 Membrane Negative regulation of — Integral to membrane 3·2 0·002 acid receptor TIG1 receptor; cell cell proliferation responder (tazarotene adhesion

induced) 1 molecule? cells epithelial oviduct of Transcriptomics Homo sapiens HCN4 NM_005477 Hs.225671 93 Muscle Microtubule-based Voltage-gated Microtubule; integral to 2·9 <0·001 hyperpolarization- contraction; movement; sodium ion potassium channel plasma membrane; activated cyclic pacemaker transport; potassium activity; structural membrane fraction nucleotide-gated channel ion transport; molecule activity; potassium channel 4 circulation; muscle 3′,5′-cAMP binding contraction Bos taurus mRNA for SLC35B1; AJ489254 Hs.154073 100 Nucleotide sugar Transport UDP-galactose Microsome 2·3 0·017 putative endoplasmic UGTREL1 transporter transporter activity reticulum nucleotide sugar transporter Homo sapiens ARMET; ARP NM_006010 Hs.436446 86 Oncogenesis ———4·00·006 ora fMlclrEndocrinology Molecular of Journal arginine-rich, mutated in early stage tumours Homo sapiens stromal SDF2L1 NM_022044 Hs.303116 81 Protein — — Membrane; 9·3 <0·001 cell-derived factor modiﬁcation?; endoplasmic reticulum 2-like 1 stress protein; O-mannosyltrans- ferase?

Downloaded fromBioscientifica.com at09/29/202105:28:10AM Homo sapiens protein ERP70; NM_004911 Hs.93659 90 Protein secretion; Protein secretion Protein disulphide Endoplasmic reticulum 12·3 0·005 disulphide isomerase ERP72 chaperone isomerase activity lumen related protein (calcium-binding

protein, · intestinal-related) Bos taurus tumour TRA1; GP96; NM_174700 Hs.192374 99 Protein secretion; Protein folding Chaperone activity Endoplasmic reticulum 11·4 <0·001 BAUERSACHS S rejection antigen GRP94 chaperone; (gp96) 1 immune-related Homo sapiens heat HSPA5; BIP; NM_005347 Hs.310769 93 Protein secretion; — Hsp70/Hsp90 Endoplasmic reticulum 6·1 <0·001 (2004) shock 70 kDa protein MIF2; GRP78 chaperone organising protein lumen 5 (glucose-regulated activity, ATP binding protein, 78 kDa)

32, Homo sapiens hypoxia HYOU1; NM_006389 Hs.277704 83 Protein secretion; Response to stress Chaperone activity Endoplasmic reticulum 5·4 0·002 up-regulated 1 ORP150 chaperone others and 449–466 via freeaccess 453 454 ora fMlclrEndocrinology Molecular of Journal Table 1 Continued BAUERSACHS S

GenBank Common accession Homology Protein Gene Ontologies Gene Ontologies Gene Ontologies name number UniGene (%) function Biological Process Molecular Function Cellular Component Oe:Di* P value

Bovine cDNA/gene

or homologue · others and Homo sapiens DNAJ DNAJB11; NM_016306 Hs.317192 94 Protein secretion; Protein folding Chaperone activity Endoplasmic reticulum 4·4 0·002 (Hsp40) homologue EDJ; HEDJ; chaperone subfamily B, member ABBP2; 11 ABBP-2 Homo sapiens protein P5 NM_005742 Hs.212102 91 Protein secretion; Electron transport; Protein disulphide Endoplasmic reticulum 3·6 0·001 disulphide chaperone protein folding isomerase activity isomerase-related protein rncitmc foiuteihla cells epithelial oviduct of Transcriptomics

(2004) Homo sapiens EDEM; NM_014674 Hs.154332 91 Protein secretion; N-linked glycosylation; Mannosyl- Integral to membrane 3·3 <0·001 endoplasmic reticulum KIAA0212 degradation of carbohydrate oligosaccharide degradation enhancing misfolded metabolism 1,2-alpha-mannosidase alpha glycoproteins activity; calcium ion

32, mannosidase-like binding Bos taurus glucose GRP58; NM_174333 Hs.308709 99 Protein secretion; Protein-nucleus Phospholipase C Endoplasmic reticulum 3·1 0·005 449–466 regulated protein ERp57; chaperone import; protein- activity; protein 58 kDa ERp60; endoplasmic reticulum disulphide isomerase ERp61; retention; signal activity; cysteine-type GRP57; transduction endopeptidase activity Pl-PLC Homo sapiens signal SSR4; TRAPD NM_006280 Hs.409223 87 Protein secretion Intracellular protein Calcium ion binding Endoplasmic 2·3 0·004 sequence receptor, transport reticulum; integral to delta (translocon- membrane; translocon associated protein delta) Homo sapiens anterior AGR2; AG2; NM_006408 Hs.226391 80 Secreted protein; — — Extracellular space 6·9 0·029 gradient 2 homologue GOB-4; ECM protein; (Xenopus laevis) HAG-2; XAG-2 differentiation Gastrin-releasing GRP S75723 Hs.153444 97 Secreted protein; Neuropeptide Growth factor activity Soluble fraction 4·0 <0·001 peptide (GRP) (sheep) hormone signalling pathway; regulation; signal transduction multifunctional Oryctolagus cuniculus DMBT1;GP340 AF043112 Hs.279611 86 Secreted protein; — Tumour suppressor — 3·1 <0·001 hensin ECM protein Homo sapiens deleted NM_007329 79 in malignant brain Downloaded fromBioscientifica.com at09/29/202105:28:10AM tumours 1 (DMBT1) Bovine mRNA for 95 OVGP1; D16639 Hs.1154 99 Secreted protein; Pregnancy; fertilization Hydrolase activity Extracellular space 2·7 0·003 kDa oviduct-speciﬁc MUC9 fertility control glycoprotein Homo sapiens sel-1 SEL1L; IBD2; NM_005065 Hs.181300 91 Signal — — Integral to membrane, 3·7 0·003 suppressor of SEL1-LIKE transduction? extracellular space lin-12-like Human gene for U3 U3 snRNA X14945 — 87 Small nuclear RNA ———3·60·005 small nuclear RNA www.endocrinology.org Homo sapiens — AC079465 — 78 Unknown — — — 18·4 0·005 chromosome 5 clone CTD-2124P24 1JEJ21G7 Bos taurus — CB223287 — 100 Unknown ———5·80·006 Jejunum #1 library Bos taurus cDNA Mus musculus adult C030027L06Rik AK021108 Mm.71000 83 Unknown ———5·00·022 male corpus striatum via freeaccess cDNA www.endocrinology.org

Table 1 Continued

GenBank Common accession Homology Protein Gene Ontologies Gene Ontologies Gene Ontologies name number UniGene (%) function Biological Process Molecular Function Cellular Component Oe:Di* P value

Bovine cDNA/gene

or homologue cells epithelial oviduct of Transcriptomics Human DNA sequence — AL162385 80 Unknown ———4·80·021 from clone RP11-244N9 on chromosome 9 Homo sapiens FLJ10707; NM_018187 Hs.405917 96 Unknown ———4·7<0·001 hypothetical protein KIAA1757 FLJ10707 Homo sapiens similar — BC011587 Hs.75668 90 Unknown ———2·30·007 to RIKEN cDNA 1700018018 gene 528733 MARC 3BOV — BM287908 — 97 Unknown ———2·20·004 ora fMlclrEndocrinology Molecular of Journal Bos taurus cDNA 153052 MARC 4BOV — BE665083 — 100 Unknown ———1·90·004 Bos taurus cDNA 5 cDNA fragments — — — — Unknown ————— without homology to database sequences Downloaded fromBioscientifica.com at09/29/202105:28:10AM *Mean oestrus:mean dioestrus. ECM, extracellular matrix. · BAUERSACHS S (2004) 32, n others and 449–466 via freeaccess 455 456 S BAUERSACHS and others · Transcriptomics of oviduct epithelial cells

GCGATCACTGAACTG-3 [856 bp]) referring to Data analysis of real-time RT-PCR Rief et al. (2002), C3 (for 5-AAGTTCATCAGCC The normal distribution of the data was tested by ACATCAAG-3 ; rev 5 -CACTGTTTCTGGTTC the Kolmogorow–Smirnov method. The signifi- TCCTC-3 [191 bp]), MS4A8B (for 5-CTGAC cance of differences was evaluated by a t-test CTGCTACCAAACCAAC-3 ; rev 5 -GCCCA (Sigma Stat, version 2·03). For all quantitative AACAAGGGAGGTATTC-3 [191 bp]) and assays a calibration curve based on a purified 18S rRNA (for 5 -AAGTCTTTGGGTTCCG PCR product was used. The efficiencies of the GG-3; rev 5-GGACA TCTAAGGGCATC specific PCRs were determined as described by ACA-3 [365 bp]) referring to Schoenfelder & Schoenfelder & Einspanier (2003). Correlation of Einspanier (2003). real-time RT-PCR and cDNA array hybridisation results was calculated using GraphPad Prism version 3·00 for Windows (GraphPad Software, Reverse transcription and real-time RT-PCR San Diego, CA, USA; www.graphpad.com). One microgram of each sample of total RNA (oestrus n=3, dioestrus n=3) was reverse transcribed Results in a total volume of 60 µl: 5buffer (Promega), 10 mM dNTPs (Roche), 50 µM hexamer primers To analyse the reflections of the morphological (Gibco BRL), 200 U Superscript RT enzyme changes in the bovine oviduct epithelium on the (Promega). The conventional PCRs were per- transcriptional activity we used a combination of formed in a thermal cycler (Biometra, Göttingen, subtracted cDNA libraries and cDNA array Germany) as previously described (Schams et al. hybridisation. Two subtracted cDNA libraries were 2002). All amplified PCR fragments were produced for oestrus and dioestrus respectively; commercially sequenced to verify the resulting 1536 randomly picked cDNA clones of each library PCR product (MWG-Biotech, Ebersberg, were analysed by cDNA array hybridisation. The Germany). Thereafter the specific melting point first array hybridisations showed that many cDNAs (MP) of the amplified product carried out within were on the array, which produced very strong the LightCycler standard PCR protocol served as signals (Fig. 1a) and interfered with the analysis of verification of the product identity (Pfaffl et al. up to 20% of all signals. A hybridisation of the 2003). The obtained sequences were subsequently arrays with a cDNA probe for the bovine mRNA submitted to the EMBL database. For each of the for 95 kDa OVGP1, which was known to be following real-time PCR reactions, 1 µl cDNA was expressed at very high levels especially at oestrus, used to amplify specific target genes. Quantitative showed that approximately 70 of the 3072 cDNAs real-time PCR reactions using the LightCycler corresponded to this gene (Fig. 1b). After removal DNA Master SYBR Green I protocol (Roche) of the OVGP1 cDNA fragments except for one and were performed as described previously an additional 142 cDNA fragments that also (Einspanier et al. 2002). In each PCR reaction revealed very strong signals (and no differential 17 ng/µl cDNA were introduced and amplified in expression) the hybridisation signals were much a 10 µl reaction mixture (3 mM MgCl2, 0·4 µM easier to analyse (Fig. 1c). These optimised cDNA primer forward and reverse each, 1Light arrays were then hybridised with probes of six Cycler DNA Master SYBR Green I (Roche)). The cyclic heifers (oestrus n=3, dioestrus n=3). annealing temperature was 60 C for all PCRs. The data analysis revealed 235 cDNA fragments The MP and the appropriate fluorescence showing significant signal differences between acquisition (FA) points for quantification within oestrus and dioestrus. In Figure 2a a scatter plot of the fourth step of the amplification segment were the array data for these cDNA fragments is shown. as follows: TRA1 (MP 81 C, FA 77 C), ERP70 This illustration shows that more cDNA fragments (MP 88 C, FA 84 C), GRP78/HSPA5 (MP were found in the subtracted libraries, which were 85 C, FA 81 C), AGR2 (MP 83 C, FA 77 C), up-regulated at oestrus. However, the sequence OVGP1 (MP 89 C, FA 85 C), C3 (MP 89 C, FA analyses of these 235 cDNA fragments revealed 37 85 C), MS4A8B (MP 85 C, FA 81 C), and 18S different genes with higher expression levels at rRNA (MP 88 C, FA 82 C). oestrus and 40 with increased expression at

Journal of Molecular Endocrinology (2004) 32, 449–466 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/29/2021 05:28:10AM via free access Transcriptomics of oviduct epithelial cells · S BAUERSACHS and others 457

Figure 1 Removal of cDNA fragments of highly abundant mRNAs. cDNA array hybridisation yielded for a number of cDNA clones very strong signals, which interfered with the analysis of up to 20% of all signals (a). To show that many of these cDNAs correspond to the bovine mRNA for 95 kDa OVGP1, arrays were hybridised with a cDNA probe for OVGP1 (b). All but one cDNA for this gene and 142 additional cDNAs, which yielded very strong signals (and no differential expression), were removed from the arrays and cDNA array hybridisation was repeated using this optimised array (c). dioestrus (Fig. 2b). The average signal ratio was 4·8 alphabetically by their probable protein function for the genes up-regulated at oestrus and 2·2 for and their signal ratio (descending). The common those up-regulated at dioestrus. Twenty-one genes name, the GenBank accession number, the were found more than once, most frequently the corresponding UniGene entry, the percent homol- Bos taurus tumour rejection antigen (gp96) 1 (TRA1) ogy to the database sequence, the Gene Ontologies, (n=56), the bovine homologue to the Homo sapiens and the P values are also shown. The signal ratios anterior gradient 2 homologue (Xenopus laevis) oestrus:dioestrus were up to 18-fold. Twenty-four (AGR2) (n=24) and the Homo sapiens heat shock of the cDNAs were assigned to genes whose 70 kDa protein 5 (glucose-regulated protein, function is known or inferred, mostly to the 78 kDa) (HSPA5) (n=16). For genes that were probable human homologue. For five cDNAs no represented with multiple copies on the array the hit in the GenBank database (‘nr’ and ‘est’) was ratios for the optimal quantifiable signals are shown found. In Table 2 the results are shown for the in the tables rather than the mean of all signal mRNAs, which were more abundant in the oviduct ratios. Nevertheless, the fold differences of the epithelial cells at dioestrus. The greatest difference intra-array replicates compared very well. Also, the in gene expression between dioestrus:oestrus was expression changes revealed by different fragments 4·4-fold. Twenty-two of the 40 cDNAs corre- of one cDNA were quite similar, as observed sponded to genes whose function is known or previously (Bauersachs et al. 2003). inferred. Two cDNAs could not be assigned to any Table 1 lists the cDNAs whose corresponding sequence in the GenBank database. mRNAs were more abundant in the oviduct The results of the cDNA array hybridisation epithelial cells at oestrus. The cDNAs are sorted were verified and absolutely quantified by the use www.endocrinology.org Journal of Molecular Endocrinology (2004) 32, 449–466

Downloaded from Bioscientifica.com at 09/29/2021 05:28:10AM via free access 458 S BAUERSACHS and others · Transcriptomics of oviduct epithelial cells

Figure 2 (a) Scatter plot of all differentially expressed cDNA fragments. The mean signals at oestrus (vertical axis) were plotted against the mean signals at dioestrus (horizontal axis) for all 235 differentially expressed cDNA fragments. The lines mark 1·5-fold difference in gene expression. (b) Overview of the identiﬁed differentially expressed genes and their assignment to different functional categories.

of real-time RT-PCR. The same six RNA dioestrus could be detected representing the least samples (oestrus n=3, dioestrus n=3) as for array but still significant change of expression. For all hybridisation were used. As standardisation for transcripts investigated there was a strong the gene-specific data generated from the correlation between cDNA array hybridisation real-time specific approach, the abundance of the and real-time RT-PCR data, as illustrated in 18S ribosomal RNA was used that was not Fig. 3. different between samples of oestrus and dioestrus To get a more detailed view of the differentially (see Table 3). Since we referred the absolute expressed genes regarding their assignment to mRNA amounts to the amount of total RNA, functional classes a simplified Gene Ontology for similar values for the 18S rRNA indicate that the biological processes and molecular functions similar amounts of total RNA were used for the was built (Fig. 4). Some of the biological processes cDNA synthesis. All seven selected genes that had and molecular functions were clearly dominated by been found up- or down-regulated at oestrus genes up-regulated either at oestrus or at dioestrus. revealed significant differences in the mRNA For example, the biological process ‘Protein quantification approach compared with dioestrus. secretion’ was clearly up-regulated at oestrus The mean concentrations of pg mRNA/µg total indicated by seven chaperones and two other RNAS.E.M., the mean oestrus:dioestrus gene proteins located in the endoplasmic reticulum (ER). expression differences, and the significance values In contrast, at dioestrus genes involved in are provided in Table 3. The mRNA concen- transcriptional regulation and genes with immune- trations ranged from 2 pg (AGR2) to 371 pg related functions were up-regulated. For other (OVGP1) per µg total RNA at oestrus. The biological processes and molecular functions shown corresponding concentrations at dioestrus were in Fig. 4 the mRNA abundance of identified genes 0·2 and 70 pg/µg total RNA respectively. Out of was higher at oestrus or at dioestrus. Further the group of selected genes up-regulated at analysis of these groups of genes showed that they oestrus, the 19-fold increase of TRA1 was highest, belong to different functional subclasses (see Tables whereas a 1·7-fold up-regulation of MS4A8B at 1 and 2).

Journal of Molecular Endocrinology (2004) 32, 449–466 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/29/2021 05:28:10AM via free access www.endocrinology.org Table 2 Genes up-regulated at dioestrus

GenBank Common accession Homology Protein Gene Ontologies Gene Ontologies Gene Ontologies name number UniGene (%) function Biological Process Molecular Function Cellular Component Di:Oe* P value

Bovine cDNA/gene or homologue Homo sapiens cyclin CCND1; BCL1; NM_053056 Hs.371468 81 Cell cycle G1/S transition of — Nucleus 2·9 <0·001 D1 (PRAD1: PRAD1; regulation mitotic cell cycle; cell parathyroid U21B31; growth and/or adenomatosis 1) D11S287E maintenance; cytokinesis Homo sapiens NP; PNP NM_000270 Hs.75514 84 Enzyme, purine DNA modification; Purine-nucleoside — 2·6 0·018 nucleoside synthesis nucleobase, phosphorylase activity; phosphorylase nucleoside, nucleotide transferase activity, and nucleic acid transferring glycosyl metabolism groups Bos taurus mRNA for MTND1 AB098969 — 98 Enzyme, energy Mitochondrial electron NADH dehydrogenase Respiratory chain 1·8 0·009 similar to NADH metabolism transport, NADH to (ubiquinone) activity; complex 1; dehydrogenase ubiquinone oxidoreductase activity mitochondrion; integral subunit 1 to membrane Homo sapiens C3; ASP NM_000064 Hs.284394 82 Immune response, Complement Complement activity; Extracellular 4·0 <0·001 complement complement activation, classic endopeptidase component 3 activity pathway, alternative inhibitor activity; pathway; G-PCR receptor binding cells epithelial oviduct of Transcriptomics protein signalling pathway; immune response Mus musculus FK506 FKBP1A; NM_008019 Hs.374638 92 Immune-related Protein folding Receptor activity; — 2·6 <0·001 binding protein 1a PKC12; protein folding, FK506 binding; PKC12; signalling FK506-sensitive FKBP12; peptidyl-prolyl cis-trans PPIASE; isomerase; FKBP-12; cyclophillin-type FKBP12C peptidyl-prolyl cis-trans isomerase activity ora fMlclrEndocrinology Molecular of Journal Homo sapiens NT5E; eN; NM_002526 Hs.153952 79 Immune-related, DNA metabolism; Hydrolase activity, Membrane fraction 1·7 0·017 5′-nucleotidase, ecto NTE; eNT; anti-inflammatory, nucleotide catabolism acting on ester bonds; CD73; E5NT signalling IMP-GMP specific 5′-nucleotidase Homo sapiens PDK4 AF334710 Hs.8364 85 Kinase Glucose metabolism; Pyruvate Mitochondrion 1·8 <0·001 pyruvate signal transduction dehydrogenase dehydrogenase kinase (lipoamide) kinase

Downloaded fromBioscientifica.com at09/29/202105:28:10AM 4 mRNA activity; ATP binding; protein kinase activity; transferase activity 598768 MARC 6BOV SMT3H1; CB24507 Hs.85119 100 Kinetochore — — Kinetochore 1·9 0·019 ′ Bos taurus cDNA 3 SMT3A; regulation · Homo sapiens SMT3 SUMO-3

suppressor of mif two BAUERSACHS S 3 homologue 1 (yeast), mRNA Homo sapiens MS4A8B; NM_031457 Hs.150184 82 Membrane Transport Transporter activity; Integral to membrane 2·1 0·001

(2004) membrane-spanning MS4A4; receptor, signalling receptor activity 4-domains, subfamily 4SPAN4 A, member 8B Homo sapiens O-linked OGT; HRNT1; NM_003605 — 90 Protein modiﬁca- Response to nutrients; Acetylglucosaminyl- Cytosol; nucleus 1·8 <0·001 32, N-acetylglucosamine FLJ23071; tion, signalling O-linked glycosylation; transferase activity; others and (GlcNAc) transferase MGC22921; signal transduction protein binding; trans- 449–466 (UDP-N- O-GLCNAC ferring glycosyl groups acetylglucosamine:

via freeaccess polypeptide-N- acetylglucosaminyl transferase) 459 460 ora fMlclrEndocrinology Molecular of Journal Table 2 Continued BAUERSACHS S

GenBank Common accession Homology Protein Gene Ontologies Gene Ontologies Gene Ontologies name number UniGene (%) function Biological Process Molecular Function Cellular Component Di:Oe* P value

Bovine cDNA/gene

or homologue · others and Homo sapiens RPL5; NM_000969 Hs.180946 90 Protein synthesis, Protein biosynthesis Structural constituent Cytosolic large 1·9 0·003 ribosomal protein L5 MSTP030 ribosomal protein of ribosome; rRNA ribosomal subunit; (RPL5) binding; 5S rRNA ribosome; intracellular binding Bos taurus mRNA for RPL26 AB098829 Hs.406682 99 Protein synthesis, Protein biosynthesis Structural constituent Cytosolic large 1·7 0·003 similar to ribosomal ribosomal protein of ribosome; RNA ribosomal subunit; protein L26 binding intracellular

Homo sapiens RALBP1 REPS1; NM_031922 Hs.333141 94 Signal — Calcium ion binding — 2·1 0·001 cells epithelial oviduct of Transcriptomics

(2004) associated Eps domain RALBP1 transduction, containing 1 endocytosis Homo sapiens zinc ZNF36; XM_168302 Hs.24758 80 Transcription Regulation of Transcription factor Nucleus 2·4 0·004 ﬁnger protein 36 KOX18; regulation transcription, activity 32, (KOX18) (ZNF36), PHZ-37; DNA-dependent mRNA ZNF139; 449–466 pHZ-37 Homo sapiens TFE3 NM_006521 Hs.274184 82 Transcription Cell growth and/or Transcription factor Nucleus 2·1 0·019 transcription factor regulation maintenance; activity binding to IGHM regulation of enhancer 3 transcription, DNA-dependent; transcription from Pol II promoter RC0-BN0284-260700- RNPC2; BE818469 Hs.282901 84 Transcription mRNA splicing; RNA binding Nucleus 2·1 0·006 023-f09 BN0284 HCC1; regulation, RNA regulation of Homo sapiens cDNA CAPER; processing transcription, Homo sapiens CC1.3; CC1.4 DNA-dependent RNPC2 RNA-binding region (RNP1, RRM) containing 2 Homo sapiens WD WDR13; NM_017883 Hs.12142 88 Transcription — — Nucleus 1·9 0·004 repeat domain 13 FLJ20563 regulation? Homo sapiens GTF21 GTF2IRD1; NM_016328 Hs.430854 93 Transcription Regulation of RNA polymerase II Nucleus 1·8 0·009 repeat domain GTF3; RBAP2; regulation transcription, transcription factor containing 1 CREAM1; DNA-dependent; activity, enhancer MUSTRD1; development binding Downloaded fromBioscientifica.com at09/29/202105:28:10AM WBSCR11; WBSCR12 Mus musculus TAF3 Taf3; TAF140; XM_129997 75 Transcription Transcription from Pol Protein binding; RNA Transcription factor 1·7 0·001 RNA polymerase II, TAFII140; regulation II promoter polymerase II TFIID complex TATA box binding mTAFII140; transcription factor protein 4933439M23Rik activity (TBP)-associated factor, 140 kDa Homo sapiens, similar RAB28 BC018067 Hs.306899 84 Transport, small — RAB small monomeric — 1·7 0·007

www.endocrinology.org to RAB28, member GTPase, vesicle GTPase activity RAS oncogene family transport Homo sapiens sorting SNX9; SDP1; NM_016224 Hs.7905 81 Transport, Protein localization SH3/SH2 adaptor — 1·6 <0·001 nexin 9 WISP; intracellular, protein activity SH3PX1 endocytosis Bos taurus NPC1 NM_174758 Hs.404930 97 Transport, Intracellular protein Sterol transporter Lysosome; integral to 1·6 0·002 Niemann–Pick membrane protein, transport; cholesterol activity; intracellular membrane; membrane disease, type C1 intracellular transport transporter activity; fraction

via freeaccess cholesterol transmembrane transport, receptor activity; molecular pump? hedgehog receptor activity www.endocrinology.org Table 2 Continued

GenBank Common accession Homology Protein Gene Ontologies Gene Ontologies Gene Ontologies name number UniGene (%) function Biological Process Molecular Function Cellular Component Di:Oe* P value

Bovine cDNA/gene or homologue 713065 MARC 6BOV — CB455882 — 100 Unknown ———4·40·022 Bos taurus cDNA 3′ Bos taurus ORF1 ORF1 Z24674 — 99 Unknown ———3·2<0·001 mRNA IMU602702614.R1 — CB168971 Bt.13764 99 Unknown ———2·90·006 CSEQFXL22 stomach-omasum Bos taurus cDNA 534395 MARC 4BOV — BM481842 — 94 Unknown ———2·30·013 Bos taurus cDNA 5′ TPA: Homo sapiens — BL00002 — 80 Unknown ———2·30·008 chromosome 7, Length=158409401 BX093047 Soares — BX093047 Hs.153661 91 Unknown ———2·2<0·001 adult brain

N2b5HB55Y Homo cells epithelial oviduct of Transcriptomics sapiens cDNA clone 592942 MARC 6BOV — CB420030 Bt.13766 100 Unknown ———2·10·005 Bos taurus cDNA 3′ Homo sapiens PAC — AC004455 — 87 Unknown ———2·00·004 clone RP5-1032B10 from 7 Homo sapiens NMDA FLJ11896; NM_024611 HS.145608 84 Unkown ———1·9<0·001 receptor-regulated NARG2 gene 2 IBE603019914.R1 — CB166522 Bt.6973 99 Unknown ———1·90·020

ora fMlclrEndocrinology Molecular of Journal CSEQFXN35 kidney Bos taurus cDNA BP250010A10E9 — BF046719 — 99 Unknown ———1·90·002 Soares normalized bovine placenta Bos taurus cDNA Human chromosome — AC002394 — 77 Unknown ———1·8<0·001 16 BAC clone

Downloaded fromBioscientifica.com at09/29/202105:28:10AM CIT987SK-A-211C6 Homo sapiens — AC106760 — 80 Unknown ———1·80·017 chromosome 5 clone RP11-215G15 Homo sapiens LOC283152 BC043548 Hs.114777 83 Unknown ———1·70·004· hypothetical protein LOC283152, mRNA BAUERSACHS S BP250016A20A10 — BF039581 Bt.5872 98 Unknown ———1·70·002 Soares normalized bovine placenta Bos (2004) taurus cDNA 211208 MARC 2BOV — BE756907 — 99 Unknown ———1·50·027 Bos taurus cDNA 32, Two cDNA fragments — — — — Unknown ————— others and without homology to 449–466 database sequences via freeaccess *Mean dioestrus:mean oestrus. 461 462 S BAUERSACHS and others · Transcriptomics of oviduct epithelial cells

Table 3 Results of real-time RT-PCR

GenBank Mean (±S.E.M.) Mean (±S.E.M.) accession pg mRNA/µg total pg mRNA/µg total Efficiency of number RNA at oestrus RNA at dioestrus Oe:Di* P value the PCR

Gene TRA1 NM_174700 22·21±4·24 1·17±0·31 19·0 0·002 1·99 ERP70 NM_004911 8·37±1·10 0·51±0·11 16·5 <0·001 1·86 GRP78/HSPA5 NM_005347 11·64±1·34 1·32±0·24 8·8 <0·001 1·93 AGR2 NM_006408 2·09±0·82 0·23±0·08 9·1 0·03 1·93 OVGP1 D16639 371·3±21·3 71·9±20·1 5·2 <0·001 1·83 C3 NM_000064 0·63±0·02 2·26±0·10 0·28 <0·001 1·86 MS4A8B NM_031457 0·69±0·07 1·20±0·06 0·59 0·001 1·95 18S rRNA — 2250±140 1950±140 1·15 n.s. 1·93

*Mean oestrus:mean dioestrus.

Discussion mRNAs, of which 37 were up-regulated at oestrus and 40 were more abundant at dioestrus. The objective of this study was to investigate To verify the results obtained by cDNA array differences in gene expression at the mRNA level in hybridisation seven genes were selected for absolute the oviduct epithelium between oestrus and quantification using real-time RT-PCR. The dioestrus to get a first view into the complex analysis of the same RNA samples as used for array regulation of gene expression during the oestrous hybridisation allowed a direct comparison of both cycle. For the first time differential gene expression methods. The results of the real-time RT-PCR in bovine oviduct epithelial cells was systematically confirmed clearly the data obtained by array investigated to identify genes that might be hybridisation as shown by the strong correlation of involved in the morphological and functional the data. The observation that ratios found by changes of these cells. So far, only few studies have real-time RT-PCR for genes up-regulated at been done to investigate systematically the oviduct oestrus were higher and the ratios for the selected epithelium through the oestrous cycle. Yaniz et al. two genes up-regulated at dioestrus were slightly (2000) showed that there are changes in the lower compared with array hybridisation can be proportions of secretory and ciliated cells during easily explained: for the array hybridisation, a ds the cycle, especially in the ampulla. As shown hybridisation probe was used. Although hybridis- previously both mRNA and protein levels of the ation to the cDNA fragment on the array should be steroid hormone receptors showed region-specific preferred, re-association to ds cDNA in the and cycle-dependent expression differences in the hybridisation solution can occur. The rate of bovine oviduct (Ulbrich et al. 2003). re-association depends on the concentration of To identify changes in gene expression, sub- each cDNA, which is higher in the probe where the tracted cDNA libraries were prepared for epithelial particular cDNA is more abundant. This effect is cells at oestrus and at dioestrus (enrichment of enhanced if the concentration of the cDNA spotted cDNAs of differentially expressed genes). Subse- on the array is not in very high excess to the quently, a set of randomly picked clones (1536 of corresponding cDNA in the hybridisation solution each library) was analysed by cDNA array as in the case of highly expressed genes like hybridisation with probes prepared from oviduct OVGP1 or TRA1. Furthermore, the mode of epithelial cells of six cyclic heifers, three at oestrus background subtraction and normalisation of the and three at dioestrus, to evaluate reproducibility raw data could result in normalised values that are and biological variation between individual ani- slightly too low or too high. This holds as well for mals. The analysis of the array data showed in the real-time PCR data. In our study the general that the average degree of up-regulation of calculation of the ratios was based on absolute mRNAs at oestrus was more than 2-fold higher mRNA concentrations. Another possibility is to than at dioestrus. Sequencing of the cDNAs that refer the data to a standard like the 18S rRNA. In showed differential signals revealed 77 different this case all oestrous values would slightly decrease

Journal of Molecular Endocrinology (2004) 32, 449–466 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/29/2021 05:28:10AM via free access Transcriptomics of oviduct epithelial cells · S BAUERSACHS and others 463

and all dioestrous values would increase resulting in slightly lower oestrus:dioestrus ratios. In the present study though this would not have changed the conclusion. In most studies where array hybridisation and real-time RT-PCR results were compared expression ratios were for some of the investigated genes completely different or ratios obtained by array hybridisation were lower (Rajeevan et al. 2001, Bangur et al. 2002, Jiang et al. 2002 (for review see Chuaqui et al. 2002)). In contrast, in our study the results for all selected genes correlated very well and the array data were clearly confirmed for the selected genes, demonstrating the capability of array hybridisation on nylon membranes using radioactively labelled probes for the identification of differentially expressed genes. Only a few of the identified genes have already been described in context with the oviduct or other reproductive organs. The cDNA of the major oviductal glycoprotein (OVGP1) showed by far the highest expression in the oviduct epithelium at oestrus compared with the other identified cDNAs. The measured up-regulation of 2·7-fold is certainly low, even the real-time PCR approach revealed only a 5·2-fold up-regulation. This may be due to the sampling procedure not discriminating between the ampulla and the isthmus region of the oviduct. Recently, we found that the abundance of the OVGP1 mRNA was slightly higher in the contralateral oviduct epithelium compared with the ipsilateral oviduct at day 3·5 (Bauersachs et al. 2003). The mRNA of L-plastin, a beta-actin- bundling protein (Namba et al. 1992), was also found to be regulated by estrogens and progestins in endometrial stromal cells (Leavitt et al. 1994). For the 78 kDa glucose-regulated protein (GRP78/ HSPA5), a chaperone located in the ER, differential expression in the glandular epithelium of the mouse uterus was described (Simmons & Kennedy 2000). In our study the expression of the GRP78 mRNA was increased 6-fold at oestrus.

Figure 3 Correlation of array hybridisation and real-time RT-PCR data. Seven selected genes identiﬁed as up-regulated at oestrus or dioestrus by cDNA array hybridisation were further analysed by real-time RT-PCR using identical RNA samples as for array hybridisation (oestrus n=3, dioestrus n=3). The mRNA concentrations obtained by real-time RT-PCR (pg mRNA/µg total RNA) and the normalised signals (Hyb signal) were used for the calculation of the correlation coefficient (r). OGP=OVGP1. www.endocrinology.org Journal of Molecular Endocrinology (2004) 32, 449–466

Downloaded from Bioscientifica.com at 09/29/2021 05:28:10AM via free access 464 S BAUERSACHS and others · Transcriptomics of oviduct epithelial cells

Figure 4 Simplified Gene Ontology. Differentially expressed genes at oestrus and dioestrus were classified using the Simplified Gene Ontology function of GeneSpring and functional data obtained by the database analysis. Gene Ontologies for Biological Processes and for Molecular Functions are shown. Bold: up-regulated at oestrus; Italics: up-regulated at dioestrus.

The anterior gradient homologue (AGR2), that was cycle in the uterus showed that expression was also up-regulated 6-fold, was first identified in markedly increased at day 16 compared with days Xenopus laevis as XAG-2 to play a putative role in 4, 10, 12 and 14 (Whitley et al. 1998); day 0 was not ectodermal patterning (Aberger et al. 1998). The investigated. The expression in the uterus was XAG-2 signalling depends on an intact fibroblast located mainly to the uterine gland epithelial cells growth factor signal transduction pathway (Aberger (Budipitoj et al. 2001). et al. 1998). Furthermore, this gene was found to be Also some of the genes up-regulated in the co-expressed with the oestrogen receptor in an oviduct epithelial cells at dioestrus have been oestrogen receptor-positive breast carcinoma cell described in the context of reproduction. The line (Thompson & Weigel 1998), suggesting that it expression of the purine nucleoside phosphorylase could be an oestrogen-regulated gene. The mRNA that was up-regulated 2·6-fold was also abundance of the gastrin-releasing peptide (GRP) described in human and mouse endometrium mRNA was 4-fold higher at oestrus than at (Kao et al. 2003). Our previous study of bovine dioestrus. GRP belongs to a group of regulatory oviduct epithelial cells at day 3·5 of the oestrous peptides and was found to be expressed in the cycle revealed a 2-fold higher mRNA level of reproductive tract of different species (Happola & this gene in the ipsilateral compared with the Lakomy 1989, Fraser et al. 1994, Whitley et al. contralateral oviduct (Bauersachs et al. 2003). For 1996, 1998, Budipitoj et al. 2001). In sheep a study the complement component C3 a role in the of GRP mRNA expression during the oestrous interaction of human gametes was postulated

Journal of Molecular Endocrinology (2004) 32, 449–466 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/29/2021 05:28:10AM via free access Transcriptomics of oviduct epithelial cells · S BAUERSACHS and others 465

(Anderson et al. 1993). Furthermore, oestrogen- cycle or to assign expression of interesting genes to dependent expression and negative regulation by distinct cells of the oviduct epithelium. P4 of the C3 mRNA was shown in the uterus of rats (Brown et al. 1990). However, we found a 4-fold increase in gene expression at dioestrus in the Acknowledgements oviduct epithelial cells. The FK506 binding protein 1a, also known as immunophilin FKBP12, We thank Peter Rieblinger for excellent animal has a role in T-cell immunosuppression and it was management. Supported by the Deutsche also shown to increase or initiate the sperm motility Forschungsgemeinschaft (FOR 478/1). in the male reproductive tract (Walensky et al. 1998). References For further interpretation and classification of the results, i.e. of the identified differentially expressed Aberger F, Weidinger G, GrunzH&Richter K 1998 Anterior genes, a simplified Gene Ontology was drawn. specification of embryonic ectoderm: the role of the Xenopus cement gland-specific gene XAG-2. Mechanisms of Development 72 In general, different functional classes were 115–130. up-regulated at the two analysed times of the Anderson DJ, Abbott AF & Jack RM 1993 The role of complement oestrous cycle. The up-regulation of genes involved component C3b and its receptors in sperm–oocyte interaction. PNAS 90 10051–10055. in protein secretion and of four secreted proteins at Araki Y, Nohara M, Yoshida-Komiya H, Kuramochi T, Ito M, oestrus correlates with morphological observations, Hoshi H, ShinkaiY&SendaiY2003 Effect of a null mutation of since more secretory cells are present in the the oviduct-specific glycoprotein gene on mouse fertilization. Biochemical Journal. 374 551–557. ampulla during oestrus compared with dioestrus Bangur CS, Switzer A, Fan L, Marton MJ, Meyer MR & Wang T (Yaniz et al. 2000). Moreover, a group of genes 2002 Identification of genes over-expressed in small cell lung mediating differentiation and/or suppression of carcinoma using suppression subtractive hybridization and cDNA microarray expression analysis. Oncogene 21 3814–3825. proliferation (e.g. RARRES1, GRP, AGR2, Bauersachs S, Blum H, Mallok S, Wenigerkind H, Rief S, Prelle K DMTB1) was found to be up-regulated at oestrus. & Wolf E 2003 Regulation of ipsilateral and contralateral bovine In contrast, at dioestrus genes promoting prolifer- oviduct epithelial cell function in the postovulation period: a ation and genes involved in transcriptional transcriptomics approach. Biology of Reproduction 68 1170–1177. Boice ML, Geisert RD, Blair RM & Verhage HG 1990 regulation were slightly up-regulated. Furthermore, Identification and characterization of bovine oviductal the expression of three immune-related genes was glycoproteins synthesized at estrus. Biology of Reproduction 43 increased at dioestrus, indicating changes in the 457–465. Brown EO, Sundstrom SA, Komm BS, Yi Z, TeuscherC&Lyttle immune regulation during the oestrous cycle. In CR 1990 Progesterone regulation of estradiol-induced rat uterine conclusion, the Gene Ontology classification secretory protein, complement C3. Biology of Reproduction 42 revealed different phenotypes of the oviduct 713–719. Budipitoj T, Matsuzaki S, Cruzana MB, Baltazar ET, Hondo E, epithelium, a more differentiated, secretory pheno- Sunaryo S, KitamuraN&YamadaJ2001Immunolocalization of type at oestrus and a less differentiated at dioestrus. gastrin-releasing peptide in the bovine uterus and placenta. Journal Since these phenotypes are mainly regulated by the of Veterinary Medical Science 63 11–15. Buhi WC 2002 Characterization and biological roles of ovarian hormones, the results of this study could oviduct-specific, oestrogen-dependent glycoprotein. Reproduction also be applied to other epithelia whose develop- 123 355–362. ment is under the control of these ovarian Chuaqui RF, Bonner RF, Best CJ, Gillespie JW, Flaig MJ, Hewitt SM, Phillips JL, Krizman DB, Tangrea MA, Ahram M et al. 2002 hormones. Post-analysis follow-up and validation of microarray experiments. In summary, our study is the first that Nature Genetics 32 (Suppl) 509–514. systematically investigated changes in gene expres- Diatchenko L, Lau YF, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov S, Lukyanov K, Gurskaya N, Sverdlov ED sion patterns at the mRNA level in bovine oviduct et al. 1996 Suppression subtractive hybridization: a method for epithelial cells during the oestrous cycle and generating differentially regulated or tissue-specific cDNA probes provides a starting point for more detailed analyses. and libraries. PNAS 93 6025–6030. The results of the cDNA array hybridisation have Diatchenko L, Lukyanov S, Lau YF & Siebert PD 1999 Suppression subtractive hybridization: a versatile method for identifying been verified and exactly quantified using real-time differentially expressed genes. Methods in Enzymology 303 349–380. RT-PCR. Since the oviduct is organised into Einspanier R, Schonfelder M, Muller K, Stojkovic M, Kosmann M, different functional compartments a next step WolfE&SchamsD2002 Expression of the vascular endothelial growth factor and its receptors and effects of VEGF during in vitro would be to compare gene expression in these maturation of bovine cumulus–oocyte complexes (COC). Molecular functional units at different times of the oestrous Reproduction and Development 62 29–36. www.endocrinology.org Journal of Molecular Endocrinology (2004) 32, 449–466

Downloaded from Bioscientifica.com at 09/29/2021 05:28:10AM via free access 466 S BAUERSACHS and others · Transcriptomics of oviduct epithelial cells

Fraser M, McDonald TJ, Spindel ER, Fahy M, Hill D & Challis JR metabolism and gene expression of bovine embryos produced 1994 Gastrin-releasing peptide is produced in the pregnant ovine in vitro. Reproduction 124 543–556. uterus. Endocrinology 135 2440–2445. Schams D, Berisha B, Kosmann M & Amselgruber WM 2002 Gurskaya NG, Diatchenko L, Chenchik A, Siebert PD, Khaspekov Expression and localization of IGF family members in bovine GL, Lukyanov KA, Vagner LL, Ermolaeva OD, Lukyanov SA & antral follicles during final growth and in luteal tissue during Sverdlov ED 1996 Equalizing cDNA subtraction based on different stages of estrous cycle and pregnancy. Domestic Animal selective suppression of polymerase chain reaction: cloning of Endocrinology 22 51–72. Jurkat cell transcripts induced by phytohemagglutinin and phorbol SchoenfelderM&Einspanier R 2003 Expression of hyaluronan 12-myristate 13-acetate. Analytical Biochemistry 240 90–97. synthases and corresponding hyaluronan receptors is differentially HappolaO&LakomyM1989 Immunohistochemical localization of regulated during oocyte maturation in cattle. Biology of Reproduction calcitonin gene-related peptide and bombesin/gastrin-releasing 69 269–277. peptide in nerve fibers of the rat, guinea pig and pig female Simmons DG & Kennedy TG 2000 Induction of glucose-regulated genital organs. Histochemistry 92 211–218. protein 78 in rat uterine glandular epithelium during uterine Hunter RH & Wilmut I 1984 Sperm transport in the cow: sensitization for the decidual cell reaction. Biology of Reproduction 62 peri-ovulatory redistribution of viable cells within the oviduct. 1168–1176. Reproduction, Nutrition, Development 597–608. 24 Suuroia T, Aunapuu M, ArendA&SeppE2002[‘Light’ epithelial Jiang Y, Harlocker SL, Molesh DA, Dillon DC, Stolk JA, Houghton cells of swine and bovine oviducts]. Tsitologiia 44 656–660. RL, Repasky EA, Badaro R, Reed SG & Xu J 2002 Discovery of differentially expressed genes in human breast cancer using Thompson DA & Weigel RJ 1998 hAG-2, the human homologue of the Xenopus laevis cement gland gene XAG-2, is coexpressed with subtracted cDNA libraries and cDNA microarrays. Oncogene 21 Biochemical and 2270–2282. estrogen receptor in breast cancer cell lines. Biophysical Research Communications Kao LC, Germeyer A, Tulac S, Lobo S, Yang JP, Taylor RN, 251 111–116. Osteen K, Lessey BA & Giudice LC 2003 Expression profiling of Ulbrich SE, KettlerA&Einspanier R 2003 Expression and endometrium from women with endometriosis reveals candidate localization of estrogen receptor alpha, estrogen receptor beta and genes for disease-based implantation failure and infertility. progesterone receptor in the bovine oviduct in vivo and in vitro. Endocrinology 144 2870–2881. Journal of Steroid Biochemistry and Molecular Biology 84 279–289. Leavitt J, Chen ZP, Lockwood CJ & Schatz F 1994 Regulation of Walensky LD, Dawson TM, Steiner JP, Sabatini DM, Suarez JD, synthesis of the transformation-induced protein, leukocyte plastin, Klinefelter GR & Snyder SH 1998 The 12 kD FK 506 binding by ovarian steroid hormones. Cancer Research 54 3447–3454. protein FKBP12 is released in the male reproductive tract and Namba Y, Ito M, Zu Y, ShigesadaK&MaruyamaK1992Human stimulates sperm motility. Molecular Medicine 4 502–514. T cell L-plastin bundles actin filaments in a calcium-dependent Whitley JC, Giraud AS & Shulkes A 1996 Expression of manner. Journal of Biochemistry 112 503–507. gastrin-releasing peptide (GRP) and GRP receptors in the Pfaffl MW, Lange IG & Meyer HH 2003 The gastrointestinal tract pregnant human uterus at term. Journal of Clinical Endocrinology and as target of steroid hormone action: quantification of steroid Metabolism 81 3944–3950. receptor mRNA expression (AR, ERalpha, ERbeta and PR) Whitley JC, Shulkes A, Salamonsen LA, Vogiagis D, Familari M & in 10 bovine gastrointestinal tract compartments by kinetic Giraud AS 1998 Temporal expression and cellular localization of RT-PCR. Journal of Steroid Biochemistry and Molecular Biology 84 a gastrin-releasing peptide-related gene in ovine uterus during the 159–166. oestrous cycle and pregnancy. Journal of Endocrinology 157 139–148. Rajeevan MS, Vernon SD, Taysavang N & Unger ER 2001 Yaniz JL, Lopez-Gatius F, SantolariaP&Mullins KJ 2000 Study of Validation of array-based gene expression profiles by real-time the functional anatomy of bovine oviductal mucosa. Anatomical (kinetic) RT-PCR. Journal of Molecular Diagnostics 3 26–31. Record 260 268–278. Reischl J, Prelle K, Schol H, Neumuller C, Einspanier R, Sinowatz F & Wolf E 1999 Factors affecting proliferation and dedifferentiation of primary bovine oviduct epithelial cells in vitro. Received in final form 9 December 2003 Cell and Tissue Research 296 371–383. Accepted 31 December 2003 Rief S, Sinowatz F, Stojkovic M, Einspanier R, WolfE&Prelle K Made available online as an 2002 Effects of a novel co-culture system on development, Accepted Preprint 16 January 2004

Journal of Molecular Endocrinology (2004) 32, 449–466 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/29/2021 05:28:10AM via free access