Endoplasmic Reticulum Stress Protein GRP78 Modulates Lipid Metabolism to Control Drug Sensitivity and Antitumor Immunity in Breast Cancer Katherine L

Cancer Microenvironment and Immunology Research

Endoplasmic Reticulum Stress Protein GRP78 Modulates Lipid Metabolism to Control Drug Sensitivity and Antitumor Immunity in Breast Cancer Katherine L. Cook1,2, David R. Soto-Pantoja1, Pamela A.G. Clarke2, M. Idalia Cruz2, Alan Zwart2, Anni Warri€ 2, Leena Hilakivi-Clarke2, David D. Roberts3, and Robert Clarke2

Abstract

The unfolded protein response is an endoplasmic reticulum of GRP78-regulated metabolite changes by treating tumor-bear- stress pathway mediated by the protein chaperone glucose regu- ing mice with tamoxifen and/or linoleic acid. Tumors treated with lated-protein 78 (GRP78). Metabolic analysis of breast cancer linoleic acid plus tamoxifen exhibited reduced tumor area and cells shows that GRP78 silencing increases the intracellular con- tumor weight. Inhibition of either GRP78 or linoleic acid treat- centrations of essential polyunsaturated fats, including linoleic ment increased MCP-1 serum levels, decreased CD47 expression, acid. Accumulation of fatty acids is due to an inhibition of and increased macrophage inﬁltration, suggesting a novel role for mitochondrial fatty acid transport, resulting in a reduction GRP78 in regulating innate immunity. GRP78 control of fatty acid of fatty acid oxidation. These data suggest a novel role of oxidation may represent a new homeostatic function for GRP78. GRP78-mediating cellular metabolism. We validated the effect Cancer Res; 76(19); 5657–70. 2016 AACR.

Introduction translocate to the Golgi complex where it is cleaved by site 1 and 2 proteases (S1P and S2P) to form the activated ATF6 Glucose-regulated protein 78 (GRP78) is a protein chaper- transcription factor. Activation of the UPR controls various cell onethatactsasamasterregulatoroftheunfoldedprotein signaling pathways, including cap-dependent protein transla- response (UPR; refs. 1, 2). In the absence of stress, GRP78 is tion,cellcycle,apoptosis,autophagy,transcriptionofprotein primarily bound to the three protein effectors of each UPR arm, chaperones, antioxidant response, among other responses. inositol requiring enzyme 1 (ERN1; IRE1), PKR-like endoplas- Although activation of the UPR is initially prosurvival, pro- mic reticulum kinase (EIF2AK3; PERK), and activating tran- longed UPR activation can lead to cell death (1, 2). scription factor 6 (ATF6). These heterodimers remain inactive Breast cancers exhibit increased activation of several UPR in the endoplasmic reticulum membrane until released from signaling components (4–6). Furthermore, some breast cancer GRP78. Release occurs following the accumulation of unfold- therapies, such as tamoxifen (TAM) and faslodex (fulvestrant, ICI) ed/misfolded proteins within the endoplasmic reticulum, þ used in the management of estrogen receptor–positive (ER ) allowing induction of the UPR. Stimulation of IRE1 results in breast cancers, stimulate UPR signaling to promote cell survival the unconventional splicing of X-box–binding protein 1 and drug resistance (7). Antiestrogen-resistant breast cancer cell (XBP1), leading to production of the active transcription factor lines express elevated levels of both GRP78 and XBP1, suggesting XBP1-S and its related signaling (3). Activated PERK can phos- UPR activation as a driver of endocrine therapy resistance (8, 9). phorylate eIF2a, inhibiting cap-dependent protein translation þ Treatment of ER breast cancer cells with antiestrogens can cause and promoting the translation of activating transcription factor the accumulation of inactive ERa within the cell (10, 11). Abla- 4(ATF4) and DNA damage-inducible transcript 3 (DDIT3; tion of ERa through RNAi inhibited antiestrogen therapy-medi- CHOP). The release of GRP78 from ATF6 enables ATF6 to ated UPR activation (7). Thus, accumulation of ERa can stimulate UPR signaling. Inhibiting GRP78 using RNAi can potentiate antiestrogen responses in sensitive cells and at least partly restore 1 Department of Surgery and Hypertension and Vascular Research sensitivity in resistant cells. We also showed that inhibition of Center, Wake Forest University School of Medicine, Winston-Salem, North Carolina. 2Department of Oncology and Lombardi Comprehen- GRP78 prevented antiestrogen-mediated autophagy induction sive Cancer Center, Georgetown University Medical Center, Washing- through regulation of AMPK (8, 12), suggesting that targeting 3 ton, DC. Laboratory of Pathology, National Cancer Institute, NIH, GRP78 may affect other AMPK-regulated functions such as cel- Bethesda, Maryland. lular metabolism (13). Note: Supplementary data for this article are available at Cancer Research Using a GRP78-targeting morpholino, for the ﬁrst time we Online (http://cancerres.aacrjournals.org/). show that in vivo inhibition of GRP78 potentiates tamoxifen þ Corresponding Author: Katherine L. Cook, Wake Forest University, Medical sensitivity in ER breast tumors and can restore sensitivity in Center Boulevard, Winston-Salem, NC 27157. Phone: 336-716-2234; Fax: 336- resistant tumors. Diverging from GRP780s canonical role in UPR 716-1456; E-mail: [email protected] signaling, metabolomics analysis shows a novel role of GRP78 in doi: 10.1158/0008-5472.CAN-15-2616 regulating lipid metabolism. For example, we now show that 2016 American Association for Cancer Research. supplementation of the GRP78-regulated metabolite linoleic acid

www.aacrjournals.org 5657

(LA), a polyunsaturated omega-6 fatty acid, restores endocrine and/or 1 mmol/L NAC (antioxidant). On day 3 or 6, media therapy sensitivity in vivo. We further show that GRP78 inhibition were aspirated and cells were stained with crystal violet, permea- prevents mitochondrial lipid transportation through a reduction bilized in citrate buffer, and absorbance was read at 480 nm of CPT1A that limits fatty acid oxidation and increases lipid using a plate reader. accumulation, peroxidation, and reactive oxygen species (ROS) generation. Moreover, in vivo supplementation with LA in com- Metabolomics bination with tamoxifen produced a greater inhibition of tumor Metabolite analysis was performed by Metabolon; see Supple- growth than does treatment with tamoxifen alone. These data mentary Experimental Procedures. suggest that LA regulation by GRP78 mediates, at least partly, the antitumor activity of the GRP78 morpholino. We also show, for Inhibition of GRP78 in vivo xenograft mouse models the first time, that GRP78 inhibition in BALB/c mice and in Five-week-old ovariectomized athymic nude mice (Harlan Lab- athymic tumor-bearing mice treated with human-targeting oratories) were injected orthotopically into the mammary fat pads GRP78 morpholino or the GRP78-regulated metabolite (LA) with a suspension of 1 106 LCC1 or LCC9 cells in Matrigel. Mice supplementation, regulates CD47 expression and stimulates an were supplemented with subcutaneous implantation of a 17b- innate immune response, which includes increase macrophage estradiol pellet (0.36 mg, 60-day release; Innovative Research of þ infiltration, to reduce ER tumor growth. America). Once tumors obtained an area of 30 to 40 mm2, mice were treated every 3 days with an intraperitoneal injection of Materials and Methods 250 mLof30mmol/L human-specific GRP78 targeting morpholino (antisense code: GAGAGCTTCATCTTGCCAGCCAGTT) or Materials mouse-specific GRP78 targeting morpholino (antisense code: The following materials were obtained as indicated: Mouse and GCTCAGCAGTCAGGCAGGAGTCTTA) or a combination of both human specific targeting GRP78 morpholinos (GeneTools); human- and mouse-targeting GRP78 morpholinos in saline. Tamoxifen citrate diet (LabDiet) and 4-OH Tamoxifen (Tocris Where appropriate, some mice were also placed on a 5053 PicoLab Bioscience). Improved Minimal Essential Medium (IMEM; Gibco Rodent Diet 20 containing 400 ppm tamoxifen citrate. Tumors Invitrogen BRL); bovine calf charcoal stripped serum (CCS; Equi- were measured weekly for 4 to 6 weeks. Mice were sacrificed and tech-Bio Inc.); oil-red-O stain and N-acetyl-cysteine (NAC; Sigma- tumors were removed at necropsy, fixed in neutral buffered Aldrich); and crystal violet (Thermo Fisher Scientific). GRP78 formalin, and processed using routine histologic methods. siRNA was obtained from Dharmacon. GRP78 pcDNA was obtained from Origene. ACC inhibitor, TOFA was obtained from Systemic GRP78 inhibition by morpholino Santa Cruz Biotechnology. Antibodies were obtained from the Female, 4-week-old, BALB/c mice were purchased from Harlan. following sources: GRP78, CPT1A, calreticulin, HMBG1, phos- Every 3 days, mice were injected intraperitoneally with 250 mLof pho-ACC, ACC, SCD1, FASN, phospho-AMPK, p110 alpha, phos- 30 mmol/L mouse-specific GRP78-targeting morpholino for 3 pho-Akt, Akt, IRE1, PERK, CHOP, XBP1-S, and MCP-1 (Cell weeks before being euthanized. At necropsy, serum was collected Signaling Technology); CD47 (clone 301, eBioscience); adipo- for cytokine analysis and mammary glands were harvested for phillin (Abbiotec); b-tubulin (Sigma-Aldrich), GRP78 (for IHC), protein and immunohistochemical analysis. b-actin, and polyclonal and horseradish peroxidase–conjugated secondary antibodies (Santa Cruz Biotechnology). Linoleic acid In vivo metabolite replacement model (Tocris) was used for the in vitro studies. Linoleic acid (Sigma Five-week-old ovariectomized athymic nude mice were injected Aldrich) and time release linoleic acid and estrogen pellets were orthotopically into the mammary fat pads with a suspension obtained from Innovative Research of America for the in vivo of 1 106 LCC9 cells in Matrigel. Mice were supplemented studies. The Fatty Acid Oxidation Kit was from Abcam, the Lipid with subcutaneous implantation of a 17b-estradiol pellet. Once Peroxidation Kit was obtained from Invitrogen, and the ROS tumors obtained an area of 30 to 40 mm2, mice were treated with Determination Flow Cytometry Kit was from Enzo. The kit for 0.25 mg/day linoleic acid, 2.5 mg/day linoleic acid and/or 400 the immunohistochemical determination of ROS was obtained ppm tamoxifen citrate diet. Tumors were measured weekly for from (Millipore). 6 weeks. At the end of the study, mice were euthanized and serum, Cell culture mammary glands, and tumors were obtained for analysis. LCC1 and LCC9 human breast carcinoma cells, previously derived in this laboratory (14, 15), were grown in phenol- RT-PCR red–free IMEM media containing 5% charcoal-treated calf RNA was extracted using TRIzol by following the manufac- serum (CCS) and defined as basal growth conditions. ZR- turer's protocol. cDNA was synthesized from 1 to 5 mg of total RNA 75-1 obtained from the ATCC, were grown in RPMI contain- using Superscript first strand RT-PCR reagents as described by the ing 10% FBS. Cells were grown at 37Cinahumidified, 5% manufacturer. qRT-PCR was then performed using the SYBR CO2:95% air atmosphere. Green Kit. The gene/primer sequence data is shown in the Sup- plementary Experimental Procedures. Cell proliferation Human breast cancer cells (5 104 cells/mL) in IMEM contain- Western blot hybridization ing 5% CCS were plated in 24-well tissue culture plates. For some As previously described, cells, tumors, and mammary glands experiments cells were transfected with control (scrambled non- were harvested in RIPA lysis buffer, protein was measured using a targeting) or GRP78 siRNA on day of plating. On day 1 after standard BSA assay, and proteins were size fractionated by poly- plating, cells were treated with varying doses of tamoxifen acrylamide gel electrophoresis and transferred to nitrocellulose (10–1,000 nmol/L) and/or 100 nmol/L–100 mmol/L linoleic acid membranes. Membranes were incubated overnight with primary

5658 Cancer Res; 76(19) October 1, 2016 Cancer Research

antibodies. Immunoreactive products were visualized by chemi- therapy responsiveness, whereas overexpression of GRP78 luminescence and quantified by densitometry using the ImageJ conferred resistance. digital densitometry software (http://imagej.nih.gov/ij/). Protein loading was visualized by incubation of stripped membranes with In vivo inhibition of GRP78 a monoclonal antibody to b-actin (1:1,000). We determined whether inhibiting GRP78 in vivo would be a þ successful therapeutic strategy for the treatment of ER breast Flow cytometry cancer. In the LCC9 (tamoxifen-resistant) xenografts, a combina- þ LCC9 cells were transfected with control (sequence-specific tion of human targeting GRP78 morpholino tamoxifen or þ þ scrambled oligonucleotide) or GRP78 siRNA and treated with human mouse targeting GRP78 morpholino tamoxifen signif- tamoxifen (100 nmol/L) for 3 days. To measure fatty acid oxi- icantly reduced tumor area (Fig. 1B) and tumor wet weight dation, cells were stained as described in the Fatty Acid Oxidation (Fig. 1C) when compared with either control, tamoxifen-only, – Detection Kit (Abcam), and counted by flow cytometry (GUMC or GRP78 morpholino-only treated animals, or mouse targeting þ – Flow Cytometry Shared Resource). To measure ROS generation or GRP78 morpholino tamoxifen treated animals. These data sug- lipid peroxidation, cells were stained as described in the Total ROS gest that inhibition of GRP78 in the tumor epithelial cells, not in Detection Kit (Enzo Life Sciences) or the lipid peroxidation Kit the microenvironment, results in the re-sensitization of tumors (Invitrogen) and counted by flow cytometry (GUMC Flow to endocrine targeted therapies. Successful targeting of GRP78 by – Cytometry Shared Resource). the morpholino was evident in the LCC9 tumor bearing mice treated with human-targeting GRP78 morpholino-only and tamoxifenþhuman–targeting GRP78 (Fig. 1D) and resulted in Oil-red-O staining the increase of other UPR signaling component protein levels LCC9 cells were transfected with control siRNA, GRP78 siRNA, (PERK, CHOP, IRE1, and XBP1-S). Furthermore, specificity of the or treated with 10 mmol/L linoleic acid for 72 hours. Cells were mouse-targeting GRP78 morpholino was confirmed in mammary fixed using 4% PFA, then stained with oil-red-O to visualize lipid glands from mice treated with human-targeting GRP78 morpho- droplets. lino or mouse targeting GRP78 morpholino (Fig. 1E) confirming the specificity of GRP78 targeting morpholinos. Tumor sections Immunohistochemistry from treated LCC9 xenografts were immunostained with a GRP78 Tumors were fixed in 10% formalin for at least 24 hours before antibody. Successful targeting of GRP78 by the morpholino was embedding in paraffin. Embedded tumors were cut into 5-mm evident in the GRP78 morpholino-only and TAMþGRP78 mor- thick sections and immunostaining was performed with an anti- pholino–treated animals (Supplementary Fig. S1C) body to CD68 (1:100), GRP78 (1:100), adipophillin (1:100), Tumor area was decreased in the LCC1 (tamoxifen-sensitive) CD47 (1:100) or a nonspecific antibody (negative control) using xenografts treated either with tamoxifen-only or human-targeting the DAB method. Stained sections were visualized and photo- GRP78 morpholinoþtamoxifen when compared with the graphed. ROS IHC was performed using the OxyIHC Oxidative untreated and GRP78 morpholino only treated control mice (Fig. Stress Detection Kit. 1F). However, tumor area was significantly smaller in mice treated with tamoxifenþhuman–targetingGRP78 morpholino when Cytokine analysis compared with tamoxifen-only–treated mice. Mice treated with Serum from mice was collected and snap frozen at the time of tamoxifen-only and tamoxifenþhuman–targeting GRP78 mor- necropsy. Quansys Biosciences Q-Plex Array kits were used to pholino also showed decreased tumor weight when compared measure MCP-1 mouse cytokine levels as described previously with their respective control tumors (Fig. 1G). Moreover, a com- (16). bination of tamoxifenþhuman–targeting GRP78 morpholino significantly reduced tumor weight when compared with tumors from the tamoxifen-only–treated mice. Thus, inhibiting GRP78 in Statistical analysis combination with antiestrogen treatment potentiated endocrine Data are presented as the mean SEM. Statistical differences therapy sensitivity. were evaluated by Student t test or ANOVA followed by Bonfer- Cell surface GRP78 localization was previously shown to roni post hoc tests. Criterion for statistical significance was set at activate PI3K/Akt signaling (17, 18). We determined the protein P < 0.05. levels of p110a, phosphorylated Akt (Ser473 and Thr308), and total Akt (Supplementary Fig. S1D) in LCC9 xenograft tumors. Results Targeting of GRP78 by human GRP78 morpholino had no overall In vitro inhibition of GRP78 effect on PI3K/Akt signaling. We first confirmed that inhibition of GRP78 by RNAi restores endocrine therapy sensitivity in LCC9 breast cancer cells (estrogen Metabolomic profile of GRP78 inhibition independent and antiestrogen cross-resistant) and also potenti- To identify the molecular mechanism of GRP78-mediated ates antiestrogen therapy responsiveness in antiestrogen sensitive potentiation of the tamoxifen responsiveness, given our previ- þ ER ZR-75-1 breast cancer cells in vitro. Breast cancer cells were ous work suggesting GRP78 regulation of AMPK (8), metabo- transfected with control (untargeted) siRNA, GRP78 siRNA, or lomics analysis of over 330 validated metabolites was per- GRP78 cDNA for 24 hours then plated (1 104) in an ACEA formed on LCC1 and LCC9 breast cancer cells treated with xCELLigence RTCA system electronic microtiter plate (E-Plate) to tamoxifen and/or transfected with GRP78 siRNA. Inhibition measure cell index by electrical impedence for 72 hours in the of GRP78 in the LCC1 cells significantly upregulated over 14 presence of 100 nmol/L tamoxifen (Fig. 1A and Supplementary metabolites and downregulated 39 metabolites. GRP78 knock- Fig. S1A and S1B). Inhibition of GRP78 potentiated endocrine down in the antiestrogen-resistant LCC9 cells significantly

www.aacrjournals.org Cancer Res; 76(19) October 1, 2016 5659

A BC Tumor weight (g) Tumor

D Time (weeks)

E Tumor weight (g) Tumor

Time (weeks)

Figure 1. Effects of targeting GRP78. A, LCC9 or ZR-75-1 ERþ breast cancer cells were transfected with control siRNA, GRP78 siRNA, or GRP78 cDNA for 24 hours, plated in an ACEA E-plate and treated with vehicle or 4-OHT for 72 hours and cell index was then measured by electrical impedance; n ¼ 3; , P < 0.002. B, LCC9 orthotopic tumors were untreated (control) or treated with tamoxifen, human and/or mouse GRP78-targeting morpholino (GRP78M), or human and/or mouse GRP78MþTAM for 4 weeks. Tumors were measured weekly with calipers and tumor area calculated. C, average wet weight of LCC9 upon sacrifice; n ¼ 8–10; , P < 0.03. D, protein lysates from LCC9-treated tumors were isolated and Western blot hybridization was used to confirm levels of GRP78 and other UPR signaling components. E, protein lysates from untreated (control) or mammary glands treated with human or mouse targeting GRP78M were isolated and Western blot hybridization was used to confirm expression levels of GRP78 and other UPR signaling components. F, LCC1 orthotopic tumors were grown to 25 to 30 mm2 before treatment with TAM, GRP78M, or GRP78MþTAM for 6 weeks. Tumors were measured weekly with calipers and tumor area calculated. G, LCC1 tumor weight upon completion of study; n ¼ 6–10; , P < 0.001.

upregulated over 30 metabolites and downregulated 13 meta- tamoxifen in both LCC1 and LCC9 cell lines. GRP78 silencing bolites. Principal component analysis (PCA) revealed a distinct alone and in combination with tamoxifen treatment was accom- separation between LCC1 and LCC9 samples implying signif- panied by the accumulation of cellular linoleate (18:2 n6), icant differences in basal metabolism between cell types (Fig. linolenate (18:3 n3 or n6), dihomo-linoleate (20:2 n6), 2A). The effects of GRP78 knockdown were more subtle when dihomo-linolenate (20:3 n3 or n6), and arachidonate (20:4 compared within, rather than between, cell lines. Desmosterol n6; Fig. 2C–H). was elevated in tamoxifen-treated samples in agreement with earlier studies (19, 20), thereby serving as an internal control of Targeting GRP78 reduces fatty acid oxidation drug efficacy (Fig. 2B). The increase in cellular fatty acids could reflect perturbations in Metabolomic profiling when GRP78 was inhibited identified a fatty acid uptake, lipid biosynthesis, or fatty acid b-oxidation. We change in lipid metabolism common to both LCC1 and LCC9 investigated the impact of GRP78 silencing on expression of the breast cancer cells. The heat map for lipid metabolite levels is lipid/cholesterol metabolism modulator genes sterol-regulatory shown in Supplementary Fig. S2A. Six significant lipid metabo- element–binding factor-1 and -2 (SREBP1 and SREBP2). Inhibi- lites were regulated by GRP78 silencing and GRP78 knockdown þ tion of GRP78 significantly reduced SREBP1 (Fig. 3A) and SREBP2

5660 Cancer Res; 76(19) October 1, 2016 Cancer Research

Figure 2. Metabolomic proﬁle of GRP78 inhibition. A, PCA analysis shows a distinct separation between LCC1 and LCC9 samples. B, desmosterol levels in LCC1 and LCC9 cells treated with vehicle, TAM, GRP78 siRNA, or GRP78 siRNA þ TAM that serves as an internal control for tamoxifen efﬁcacy. Relative levels of linoleate (C), linolenate (D), dihomo-linoleate (E), dihomo- linolenate (F), arachidate (G), and arachidonate (H) in LCC1 and LCC9 cells treated with vehicle, TAM, GRP78 siRNA, or GRP78 siRNA þ TAM. n ¼ 6 independent experiments; , P < 0.05.

(Fig. 3B) when compared with control transfected cells. Tamox- We measured the effect of GRP78 inhibition in liver tissue of ifen treatment resulted in a significant increase in SREBP1 in LCC1 female wild-type, B6.129(Cg)-Hspa5tm1.1Alee/J (GRP78 hetero- cells and SREBP2 in LCC9 cells, suggesting a differential regula- zygous), BALB/c mice treated with GRP78-targeting morpholino, tion of these genes by tamoxifen in antiestrogen–sensitive and and in BALB/c-untreated controls. Inhibition of GRP78 in normal, –resistant cells. non-cancerous tissue had no effect on SCD1 or FASN protein Several genes are controlled by SREBP1 including stearoyl-CoA levels. However, we observed an increase in ACC protein and desaturase (SCD; SCD1), fatty acid synthase (FASN), and acetyl- reduced CPT1A protein expression (Fig. 3D). These data suggest a CoA carboxylase (ACACA; ACC; ref. 21). Western blot hybridiza- differential effect of GRP78 inhibition in tumors versus non- tion of protein lysates from control siRNA or GRP78 siRNA cancerous tissue, where de novo lipogenesis proteins are only transfected LCC1, LCC9, and ZR-75-1 cells shows that GRP78- inhibited in breast cancer cells and CPT1A/fatty acid mitochon- silencing inhibits SCD1 and FASN protein expression, while drial transport may be reduced systemically by GRP78 targeting. modestly increasing ACC protein levels (Fig. 3C). ACC is phos- To determine whether GRP78 specifically regulated the ACC/ phorylated by AMP-activated protein kinase (PRKAA1; AMPK) at CPT1A signaling axis, LCC9 (Fig. 3E) and ZR-75-1 cells (Fig. 3F) Ser79, inhibiting ACC activity. GRP78 knockdown reduces pACC were transfected with control or GRP78 siRNA GRP78 cDNA to Ser79 protein levels (Fig. 3C). ACC can inhibit CPT1A through "rescue" the GRP78 protein levels. Overexpression of GRP78 in malonyl-CoA synthesis. Inhibition of GRP78 results in decreased GRP78-silenced breast cancer cells prevented the ability of CPT1A expression (Fig. 3C), suggesting that GRP78 silencing may GRP78-silencing to induce ACC and inhibit CPT1A. To confirm inhibit fatty-acid transport into the mitochondria. the specificity of GRP78 for mediating the observed differences in

www.aacrjournals.org Cancer Res; 76(19) October 1, 2016 5661

AC D gene expression SREBP1 Fold change

B b-Actin b-Actin gene expression SREBP2 Fold change

G 5 mmol/L 50 mmol/L

E I J

b-Actin

b-Actin H F

b-Actin b-Actin

Figure 3. Targeting GRP78 reduces fatty acid oxidation. Relative gene expression of SREBP1 (A) or SREBP2 (B) in LCC1 and LCC9 cells treated with vehicle, TAM, GRP78 siRNA, or GRP78 siRNA þ tamoxifen normalized with HRPT housekeeping gene expression. n ¼ 4 independent experiments in triplicate; , P < 0.05. C, analysis of downstream SREBP1 regulated proteins SCD1, FASN, ACC (total), p-ACC (inactive) in LCC1, LCC9, and ZR-75-1 cells transfected with control or GRP78 siRNA. D, relative protein levels of GRP78, FASN, SCD1, ACC, CPT1A in BALB/c mice livers either control (untreated) or treated with GRP78-targeting morpholino or in 129S wild-type or GRP78 heterozygous mice. Equivalence of protein loading on gels was conﬁrmed by measuring b-actin expression; n ¼ 4; , P < 0.02. LCC9 (E) or ZR-75-1 (F) cells were transfected with control siRNA, GRP78 siRNA, GRP78 cDNA, or GRP78 siRNAþ GRP78 cDNA. Relative protein levels of GRP78, ACC, CPT1A, and p-AMPK were measured by Western blot hybridization. G, LCC9 cells transfected with control or GRP78 siRNA were treated with TOFA [5-(tetradecyloxy)-2-furoic acid], an ACC inhibitor, for 72 hours. Protein levels of GRP78, ACC, CPT1A, and b-actin were measured by Western blot hybridization. H, LCC9 cells were transfected with control siRNA, GRP78 siRNA, PERK siRNA, or XBP1 siRNA for 72 hours. Relative protein levels of GRP78, PERK, XBP1-S, ACC, CPT1A, and b-actin were measured by Western blot hybridization. I, levels of fatty acid oxidation enzymes ACADVL, ACADM, and HADHA were measured by ﬂow cytometry in LCC1 and LCC9 cells transfected with control or GRP78 siRNA; n ¼ 3; , P < 0.04. J, butyrylcarnitine and propionylcarnitine metabolite levels in LCC1 and LCC9 cells transfected with control or GRP78 siRNA TAM; n ¼ 6; , P < 0.05.

lipid metabolism, LCC9 cells were transfected with GRP78 siRNA, try. LCC9 cells expressed higher levels of ACADVL, ACADM, and PERK siRNA, or XBP1 siRNA to inhibit each of the three UPR HADHA when compared with their antiestrogen-sensitive paren- signaling arms. Expression of ACC and CPT1A was then measured tal cells (LCC1). Knockdown of GRP78 inhibited ACADVL, by Western hybridization (Fig. 3H). Knockdown of GRP78, but ACADM, and HADHA in both LCC1 and LCC9 cells (Fig. 3I). neither PERK nor XBP1, increased ACC protein levels and reduced Reduced levels of the carnitine conjugates butyrylcarnitine and CPT1A. LCC9 cells were transfected with control or GRP78 siRNA propionylcarnitine, generated by the oxidation of even and odd and treated with various doses of 5-(tetradecyloxy)-2-furoic acid chain fatty acids respectively, were observed predominantly in (TOFA), an ACC inhibitor (Fig. 3G). Inhibition of ACC activity by GRP78 silenced/tamoxifen-treated LCC1 and LCC9 cells, suggest- TOFA prevented the GRP78-mediated reduction of CPT1A ing that loss of GRP78 may sensitize resistant cells by disrupting expression. lipid metabolism (Fig. 3J). Fatty acid b-oxidation enzymes acyl-Coenzyme A dehydrogenase very-long chain (ACADVL), acyl-CoA dehydrogenase, C-4 to Inhibition of GRP78 increases cellular lipid content C-12 straight chain (ACADM), and hydroxyacyl-CoA dehydroge- To conﬁrm GRP78-mediated regulation of cellular lipid con- nase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase trifunctional tent, LCC9 cells were transfected with control siRNA or GRP78 protein alpha subunit (HADHA) were measured by ﬂow cytome- siRNA or treated with 10 mmol/L linoleic acid and stained with

5662 Cancer Res; 76(19) October 1, 2016 Cancer Research

oil-red-O (Fig. 4A). Inhibition of GRP78 or treatment of cells tion of GRP78 knockdown and endocrine-targeted therapy with linoleic acid resulted in an overall increase in cellular lipid increased ROS in both LCC9 cells (Fig. 5B) and xenografts (Fig. content. LCC9 xenograft sections were immunostained with 5C). LCC9 xenografts were stained with TUNEL to measure apo- Adipose differentiation related-protein (adipophilin), a marker ptosis. As we previously observed in vitro in LCC9 cultured cells (8), of intracellular lipid droplets in metabolically active cells (Fig. only simultaneous knockdown of GRP78 with tamoxifen treat- 4B). Adipophilin expression was increased in human-targeting ment resulted in a stimulation of cell death in vivo in LCC9 GRP78 morpholino-only and tamoxifenþhuman–targeting xenograft tumors (Fig. 5D). Thus, the increased cellular lipid GRP78 morpholino–treated mice. The elevated levels of lipid content resulting from GRP78 inhibition in the presence of endo- droplets and cellular lipid content are consistent with GRP78 crine-targeted therapy induces lipid oxidation and ROS produc- knockdown increasing cellular fatty acid concentrations. When tion. Increased ROS generated by GRP78-mediated lipid oxidation LCC9 (Fig. 4C) or ZR-75-1 (Fig. 4D) were transfected with promotes tamoxifen-mediated cell death. We have previously control or GRP78 siRNA in vitro, knockdown of GRP78 in both shown increased cellular concentrations of ROS promotes cell þ ER breast cancer cell lines increased adipophilin protein levels. death in these cell lines (7). We then treated LCC9 and ZR- 75-1 cells that were transfected with control or GRP78 siRNA Combination of GRP78 silencing and endocrine therapy with 1 mmol/L NAC and/or tamoxifen for 72 hours and mea- increases ROS and cell death sured relative cell density by crystal violet assay (Fig. 5E). Knockdown of GRP78þTAM in LCC9 cells signiﬁcantly Inhibition of ROS by NAC partially rescued GRP78 knockdown increased lipid oxidation (Fig. 5A). Interestingly, only a combina- re-sensitization (LCC9) or potentiation (ZR-75-1) of endocrine

Figure 4. Inhibition of GRP78 increases cellular lipid content. A, oil-red-O staining of LCC9 cells transfected with control or GRP78 siRNA or treated with 10 mmol/L LA. Cells were permeabilized and stained; absorbance was read at 490 nm to measure cellular lipid content; n ¼ 3; , P < 0.02. B, LCC9 tumor sections were stained using an adipophilin antibody and visualized at 40. LCC9 (C) or ZR-75-1 (D) human breast cancer cells were transfected with control or GRP78 siRNA for 96 hours and adipophilin was measured by Western blot hybridization.

www.aacrjournals.org Cancer Res; 76(19) October 1, 2016 5663

AB 8 5 6 4 4 3 2.5 2 2.0 2.0

1.5 1.5

1.0 change fold 1.0 Lipid peroxidation 0.5 0.5 Reactive oxygen species Reactive oxygen

0.0

(BODIPY oxidized/BODIPY reduced) (BODIPY oxidized/BODIPY 0.0 TAM Control Control GRP78 siRNA GRP78 siRNA Positive control Positive control 100 nmol/L TAM GRP78 siRNA+TAM GRP78 siRNA +TAM C Control TAM D Control TAM

GRP78M GRP78M+TAM GRP78M GRP78M+TAM Tunel staining Tunel ROS staining

Control GRP78 Control Control GRP78 GRP78 siRNA+ siRNA+ siRNA m m Control GRP78 siRNA+ siRNA+ siRNA 1 mol/L NAC 1 mol/L NAC E siRNA 1 mmol/L NAC m 1.5 siRNA 1 mol/L NAC 1.5

1.0 1.0

0.5 LCC9 0.5 ZR-75-1

Relative cell density 0.0 Relative cell density 0.0

Control Control Control Control Control Control Control Control m m mmol/L TAM mmol/L TAM mmol/L TAM mmol/L TAM mol/L TAM mol/L TAM 1 1 1 mmol/L TAM 1 mmol/L TAM 1 1 1 10 nmol/L TAM 10 nmol/L TAM 1 10 nmol/L TAM 10 nmol/L TAM 10 nmol/L TAM 10 nmol/L TAM 10 nmol/L TAM 10 nmol/L TAM 100 nmol/L TAM 100 nmol/L TAM 100 nmol/L TAM 100 nmol/L TAM 100 nmol/L TAM 100 nmol/L TAM 100 nmol/L TAM 100 nmol/L TAM Control GRP78 Control GRP78 Control GRP78 siRNA siRNA F Control GRP78 siRNA siRNA siRNA siRNA +NAC +NAC siRNA siRNA +NAC +NAC GRP78 GRP78

MCP1 MCP1 LCC9 b-Actin ZR-75-1 b-Actin

Figure 5. Combination of GRP78 silencing and endocrine therapy increases ROS and cell death. A, lipid peroxidation was measured by flow cytometry in LCC9 cells treated with cumene hydroperoxide (positive control), vehicle, TAM, GRP78 siRNA, or GRP78 siRNA þ TAM. n ¼ 4; , P < 0.001. B, ROS was measured by flow cytometry in LCC9 cells treated with 100 mmol/L pyocyanin (positive control), vehicle, TAM, GRP78 siRNA, or GRP78 siRNA þ TAM. n ¼ 3; , P < 0.001. C, LCC9 tumor sections were stained using OxyIHC kit to measure ROS and visualized at 10 magnification. D, LCC9 tumor sections were stained with TUNEL to measure apoptosis and visualized at 20. E, LCC9 and ZR-75-1 human breast cancer cells were transfected with control or GRP78 siRNA and treated with 1 mmol/L NAC and various doses of 4-OHT (tamoxifen) for 72 hours; relative cell density was measured by crystal violet; n ¼ 3; , P < 0.05. F, LCC9 and ZR-75-1 breast cancer cells were transfected with control or GRP78 siRNA and treated with 1 mmol/L NAC for 48 hours and MCP-1 protein levels were measured by Western blot hybridization.

5664 Cancer Res; 76(19) October 1, 2016 Cancer Research

therapy responsiveness, suggesting a key role of ROS in medi- data suggest an important role for the tumor microenviron- ating this phenotype. Furthermore, inhibition of ROS by NAC ment in mediating GRP78-regulated metabolite breast tumor treatment prevented GRP78-mediated MCP-1 induction in growth inhibition. GRP78-silenced breast cancer cells (Fig. 5F), suggesting that targeting GRP78 may affect the tumor microenvironment GRP78 inhibition and GRP78-mediated metabolites affect through ROS regulation. innate immunity Serum was extracted from LCC9 xenograft bearing mice treated GRP78-regulated metabolite supplementation inhibits tumor with vehicle (control), TAM, LA, or LAþTAM and was used to growth determine circulating levels of MCP-1 by ELISA (Fig. 7A). Sup- Antiestrogen-resistant LCC9 breast cancer cells were treated plementation with the GRP78-regulated metabolite LA signiﬁ- with escalating doses of linoleic acid and tamoxifen in vitro. cantly increased serum levels of monocyte chemotactic protein Co-treatment with the GRP78-regulated metabolite (linoleic acid; 1(CCL2; MCP-1) when compared with vehicle (control) or LA) and tamoxifen resulted in a modest resensitization of the tamoxifen-treated mice. Female BALB/c mice (no mammary resistant LCC9 breast cancer cells to tamoxifen (Fig. 6A). LA tumors) were injected with control or a mouse targeting GRP78 concentrations that successfully potentiated antiestrogen sensi- morpholino for 3 weeks to systemically reduce overall GRP78 tivity signiﬁcantly reduced GRP78 protein expression (Fig. 6B), protein levels. Serum from BALB/c mice treated with morpholino suggesting a reciprocal relationship between GRP78 and GRP78- expressed higher levels of circulating MCP-1 when compared with regulated metabolites. serum isolated from control injected BALB/c mice (Fig. 7A). Thus, LCC9 xenografts were grown in the mammary fat pad regions systemic inhibition of GRP78 or supplementation with LA, a of female athymic mice and mice treated with various doses of GRP78-regulated metabolite, produce similar effects on circulat- LA and/or tamoxifen for 6 weeks. Combination treatment with ing MCP-1 levels. LAþTAM reduced both tumor area (Fig. 6C) and tumor weight Western blot hybridization of protein lysates isolated from LCC9 (Fig. 6D). Importantly, this combination was as effective as the xenograft control or treated tumors with TAM, LA, or LAþTAM (Fig. combination of GRP78 targeting and tamoxifen treatment, 7B) or human-targeting GRP78 morpholino tamoxifen (Fig. 7C) suggesting that the GRP78-regulated metabolite (LA) could were used to measure relative protein levels of "eat me/don't eat mediate GRP78 morpholino antitumor activity. Furthermore, me" protein signals including calreticulin (CALR), high mobility independent of tamoxifen exposure, LA treatment inhibited group box 1 (HMGB1), and CD47. Only GRP78MTAM or GRP78 protein expression in LCC9 breast tumors (Fig. 6E), LAþTAM–treated tumors have increased multiple "eat me" signal- supporting the feedback interaction observed in vitro. In vivo ing proteins, including HMGB1 and calreticulin. LCC9 tumors supplementation with LA (Fig. 6C) resulted in a more effective treated with either GRP78M TAM or LATAM have decreased inhibition of growth than was observed in vitro (Fig.6A).These CD47 expression, a potent "don't eat me" signal. These data suggest

10 100 1 10 100 B C nmol/L nmol/L mmol/L mmol/L mmol/L GRP78

A 1.25 m m m b-Actin Figure 6. Control 1 mol/L LA 10 mol/L LA 100 mol/L LA Supplementation with LA, a GRP78- 1.00 1.25 regulated cellular metabolite, inhibits tumor growth. A, LCC9 cells were 0.75 1.00 treated with 1 to 100 mmol/L LA, and/or 0.75 0.50 various concentrations of tamoxifen 0.50 (vehicle, 10, 100, and 1,000 nmol/L) for 0.25

(GRP78/ b -actin) 0.25 6 days. Relative cell density was LCC9 Cell density GRP78 Fold change 0.00 0.00 determined by crystal violet assay; Control 10 nmol/L 100 nmol/L 1 mmol/L 10 mmol/L 100 mmol/L n ¼ 4; , P < 0.02. B, LCC9 cells were LA LA LA LA LA treated with 1 to 100 mmol/L LA for Control Control Control Control E GRP78 Staining 72 hours. Western blot hybridization 10 nmol/L TAM 10 nmol/L TAM 10 nmol/L TAM 10 nmol/L TAM 100 nmol/L TAM 100 nmol/L TAM 100 nmol/L TAM 100 nmol/L TAM Control TAM was used to conﬁrm levels of GRP78; 1,000 nmol/L TAM 1,000 nmol/L TAM 1,000 nmol/L TAM 1,000 nmol/L TAM n ¼ 4; , P < 0.003. C, LCC9 orthotopic C D tumors were untreated (control) or 100 0.5

treated with tamoxifen, 0.25 mg/day 90 0.4 LA, 2.5 mg/day LA, 0.25 mg/day LA 80 þ þ 0.3 TAM, or 2.5 mg/day LA TAM for ) 0.25 mg LA+TAM

2 0.25 mg LA 6 weeks. Tumors were measured weekly 70 0.2 with calipers and tumor areas were 60

calculated from the lengths on the two weight (g) Tumor 0.1 50 longest perpendicular measurements. D, average wet weight of LCC9 tumors 40 0.0 upon sacriﬁce; n ¼ 6–9; , P < 0.001. 30 TAM Control Tumor area (mm Tumor 2.5 mg LA 2.5 mg LA+TAM E, LCC9 tumor sections were stained 20 Control TAM using GRP78 antibodies and Linoleic acid (.25 mg/day) visualized at 40. 10 Linoleic acid (.25 mg/day)+TAM Linoleic acid (2.5 mg/day) Linoleic acid (2.5 mg/day) Linoleic acid (2.5 mg/day)+TAM Linoleic acid (0.25 mg/day) 0 01234567Linoleic acid (0.25Linoleic mg/day)+TAM acid (2.5 mg/day)+TAM Time (Weeks)

www.aacrjournals.org Cancer Res; 76(19) October 1, 2016 5665

A B

acid

Mammary gland EF Mammary glands

Figure 7. Inhibition of GRP78- and GRP78-regulated cellular metabolites affect innate immunity. A, serum from LCC9 xenograft-bearing female aythmic mice untreated (control) and treated TAM, LA, LAþTAM, and serum from untreated or GRP78 morpholino–treated female BALB/c mice were analyzed by ELISA for circulating systemic levels of MCP-1; n ¼ 4; , P < 0.001. B, protein lysates from LCC9 tumors (control, TAM, LA, or LAþTAM) were analyzed using Western blot hybridization for calreticulin, HMGB1, and self-recognition identifier CD47. C, protein lysates from LCC9 tumors (control, tamoxifen, human targeting GRP78M, or human targeting GRP78MþTAM) were analyzed using Western blot hybridization for calreticulin, HMGB1, and self-recognition identifier CD47. E, protein lysates from mammary glands extracted from untreated or GRP78M-treated female BALB/c mice were analyzed for calreticulin and CD47. Gel loading was confirmed by measuring b-actin expression. Treated LCC9 tumor sections (D) or mammary glands (F) from untreated or GRP78 morpholino (GRP78M)–treated BALB/c mice were stained using CD68 antibody to determine macrophage infiltration and visualized at 40 magnification.

5666 Cancer Res; 76(19) October 1, 2016 Cancer Research

that either supplementation with LA or targeting GRP78 stimulates activation of SREBP to the activation of the ATF6 UPR arm. a switch in immunosurveillance signaling. Integration of UPR and SREBP regulation is intuitively rational. Expression of the calreticulin and CD47 proteins was mea- Accumulation of unusable unfolded proteins within the sured in protein lysates from mammary glands from BALB/c endoplasmic reticulum should trigger a mechanism to inhibit mice treated with control or mouse-targeting GRP78 morpho- concurrently protein production to help relieve endoplasmic lino by Western blot hybridization (Fig. 7E). Reduction of reticulum stress. Integration of UPR signaling and lipid metab- GRP78 in the mammary glands of BALB/c mice increased olism is likely needed to address the problems with the calreticulin levels, similar to the effects of human-targeting unfolded protein components of lipoproteins being managed GRP78M treatment in xenografts. Unlike breast tumor tissue, bytheUPRinthepresenceofendoplasmicreticulumstress. inhibiting GRP78 in normal mammary tissue increased expres- Previous studies have suggested a possible role of UPR sion of the CD47 "don't eat me" signal. These data suggest a signaling in lipid metabolism. GRP78 heterozygous mice are differential role of GRP78 in regulating CD47 signaling in resistant to obesity when placed on a high fat diet, suggesting a neoplastic versus normal tissues. LCC9 xenografts (Fig. 7D) role of GRP78 in modulating lipid metabolism (27). Other and BALB/c mammary glands (Fig. 7F) were stained for CD68 studies in a hepatic steatosis model showed increased UPR todeterminemacrophageinfiltration. Both knockdown of signaling components and endoplasmic reticulum stress in the GRP78 by morpholino and supplementation with its regulated liver of obese mice (28, 29). Overexpression of GRP78 reduced metabolite LA, increased macrophage infiltration in target UPR signaling and prevented insulin-mediated SREBP1c cleav- tissues. Thus, either inhibition of GRP78 or treatment with LA age (30). The authors proposed that GRP78 binds to the SREBP can potentiate an antitumoral immune response. complex preventing SCAP translocation to the Golgi complex and activation. Although these data seemingly contradict some of our findings, we observed that GRP78 knockdown reduced Discussion cellular SCAP protein levels, thereby preventing SREBP trans- Breast cancer is the most frequently diagnosed cancer among location and activation by S1P/S2P (Supplementary Fig. S3E). women. Over 230,000 new cases of invasive breast cancer are Therefore, both GRP78 overexpression and GRP78 depletion diagnosed annually, with 70% of all breast cancers expressing may inhibit SREBP through two distinct mechanisms: SREBP1 the ERa (22). These cancers are often treated with ERa-targeted binding and SCAP inhibition. therapies such as receptor antagonists (antiestrogens), includ- Other UPR signaling arms are implicated in promoting ing tamoxifen. However, many initially responsive tumors lipogenesis (28). In an ATF6 knock-out mouse model, endo- developresistancetotheseendocrine therapies and, overall, plasmic reticulum stress led to liver steatosis resulting from þ more women die from ER breast cancer than from any other impaired b-oxidation mediated by reduced C/EBP transcrip- subtype of breast cancer (23). Our previous work reported tional activity (29). IRE1 knockout mice also developed liver elevated GRP78 protein levels in all molecular subtypes of steatosis and lipid accumulation (31). The mechanism medi- breast cancer when compared with the normal surrounding ating hepatic lipid accumulation in IRE1 deficient mice is breast tissue (8). Furthermore, endocrine therapy resistant unclear but may be mediated in part by loss of XBP1 activity breast cancer cell lines overexpress GRP78, suggesting GRP78 (31, 32). PERK inhibition can reduce SCD1 and FASN expres- as a mediator of breast cancer resistance (8, 24). Although sion, also implicating this UPR signaling arm in lipogenesis others have proposed GRP78 as a general target for therapy (33). In support of these data, we show that inhibition of either (25), our current study highlights the importance of targeting XBP1 or PERK in LCC9 breast cancer cells has no overall effect þ GRP78 as a specific therapeutic strategy for ER breast cancer on ACC and CPT1A signaling (Fig. 3H). Since we previously (26). We show, for the first time, that antisense morpholino can showed that GRP78 silencing results in a significant increase in successful target GRP78 protein expression in vivo to potentiate all three arms of UPR, our observed results may represent novel þ endocrine sensitivity in ER breast tumors. Combining tamox- actions of GRP78 that occur independent of some UPR signal- ifen with the GRP78-targeting morpholino restored sensitivity ing components. þ in resistant ER tumors (Fig. 1B and C) and increased tamox- GRP78 inhibition led to a modest increase in ACC, suggest- þ ifen responsiveness in antiestrogen sensitive ER breast tumors ing differential regulation of SREBP1 controlled genes. We also (Fig. 1F and G). observed a significant decrease in the inactivated phosphory- These studies expand the role of GRP78 from a protein lated-ACC Ser79; hence, GRP78 knockdown results in ACC chaperone controlling the unfolded protein response to activation. ACC is inactivated when phosphorylated on Ser79 include an important function in regulating lipid metabolism. by AMPK. We have previously shown that GRP78 overexpres- Knockdown of GRP78 resulted in the accumulation of cellular sion increases autophagic signaling by stimulating AMPK (8, essential fatty acids (Fig. 2), suggesting that GRP78 regulates 12). Knockdown of GRP78 prevents TSC2/AMPK signaling theiruptakeand/orcatabolism. We show that inhibiting activation (8). Activation of ACC leads to increased malonyl- GRP78 reduces SREBP-1 transcript levels and decreases the CoA synthesis, resulting in the inhibition of CPT1A (34). expression of some SREBP-1 target genes (Fig. 3A and C). CPT1A is localized in the outer mitochondrial membrane and SREBP1 is a basic helix-loop-helix-leucine zipper transcription catalyzes the primary regulated step in overall mitochondrial factor that is maintained as an inactive precursor when located fatty acid oxidation (35). We observed decreased levels of within the endoplasmic reticulum lumen (21). Activation of both the mitochondrial fatty acid transporter protein, CPT1A, SREBP1 involves its translocation to the Golgi complex by (Fig. 3C and D) and b-oxidation enzyme activities and bypro- SREBP cleavage-activating protein (SCAP) and proteolytic ducts (Fig. 3I and J). Furthermore, treatment of LCC9 cells cleavage by site 1 (S1) and site 2 (S2) proteases. It is not transfected with GRP78 siRNA with TOFA (an ACC inhibitor), surprising that GRP78 regulates SREBP, given the similarity in prevented GRP78-targeting reduction of CPT1A (Fig. 3G).

www.aacrjournals.org Cancer Res; 76(19) October 1, 2016 5667

Taken together, these data suggest that the increased cellular cancer and is associated with poor survival (43). We show, for concentration of lipids observed with GRP78 silencing is due to the first time, that GRP78 is a modulator of "self-recognition" an overall inhibition of fatty acid oxidation. through differential regulation of CD47 (Fig. 7B, C and E). Metabolomic analysis also identified elevated levels of oleic Supplementing mice bearing LCC9 xenografts with LA signifi- and palmitoyl ethanolamide in GRP78-inhibited cells (Supple- cantly reduced CD47 expression in tumor cells, an effect expected mentary Fig. S2B). Co-treatment with oleic ethanolamide and to increase their immune recognition and susceptibility to T-cell tamoxifen restores tamoxifen sensitivity in antiestrogen resistant and/or macrophage-mediated cytotoxicity. Treatment of mice LCC9 breast cancer cells (Supplementary Fig. S2C). Thus, the lipid bearing LCC9 xenografts with a human GRP78-targeting mor- accumulation that accompanies GRP78 inhibition increases the pholino tamoxifen decreased CD47 expression (Fig. 7C production of other antigrowth lipid metabolite bioproducts. and Supplementary Fig. S4). Interestingly, tamoxifen treatment Oleic and palmitoyl ethanolamide can also inhibit the expression significantly increased CD47 protein levels in both breast cancer of fatty acid hydrolase, reflecting their key roles in lipid metab- cell lines and xenograft tumors; CD47 may be a critical compo- olism (36). Furthermore, mice treated with oleic ethanolamide nent mediating endocrine resistance. Moreover, tamoxifen was had reduced body weight gain when fed a high-fat diet (37), shown to significantly upregulate CD47 expression in the human perhaps explaining the obesity-resistant phenotype observed in endometrium, suggesting a role of CD47 in promoting tamoxfien- GRP78 heterozygous mice (27). induced endometrial cancer (44). In normal mammary tissue, Inhibition of GRP78 led to increased cellular lipid content (Fig. systemic GRP78 protein reduction increased macrophage infil- 2; Fig. 4). Increases in fatty acid accumulation within non-adipose tration (Fig. 7F). Although GRP78 inhibition may negatively tissue can lead to cellular dysfunction and death, a phenomenon impact normal tissue, the GRP78-targeting morpholino signifi- called lipid toxicity (38). Lipid toxicity may promote the cell death cantly increased mammary gland expression of CD47 (Fig. 7E), mediated by GRP78 targeting; others have reported a role for thereby protecting normal tissue from the cytolytic activities of PUFAs in cancer cell death in vitro (39). For example, PUFA- macrophages. induced cytotoxicity can be mediated by lipid peroxidation (40). Many normal tissues increase cellular fatty acid levels through Inhibition of GRP78 in LCC9 breast cancer cells increased lipid uptake of circulating fatty acids (28). Unlike normal tissue, to peroxidation (Fig. 5A). Furthermore, morpholino-mediated meet their increased metabolic needs malignant cancer cells GRP78 silencing in combination with tamoxifen in vivo resulted often upregulate de novo fatty acid synthesis enzymes, perhaps to in a significant increase in ROS generation and cell death (Fig. 5C supplement reduced access to exogenous fatty acids from poor and D). Blockade of ROS generation by treatment with NAC perfusion within the tumor microenvironment. This phenom- partially rescued GRP78-silencing re-sensitization of LCC9 cells to enon is characteristic of the metabolic-switch often observed in endocrine therapy (Fig. 5E), further supporting the critical role of cancer cells (45). We show, for the first time, that targeting UPR-mediated ROS generation. Treatment of LCC9 breast cancer GRP78 specifically inhibits de novo fatty acid synthesis proteins cells with increasing concentrations of the GRP78-regulated in breast cancer cells and reduces mitochondrial b-oxidation metabolite LA showed a modest increase in tamoxifen sensitivity through CPT1A inhibition. Thus, GRP78 inhibition increased in vitro (Fig. 6A). However, in vivo supplementation of LA resulted cellular lipid content, and promoted both lipid peroxidation þ in a clear resensitization of ER -resistant breast tumors to tamox- and ROS generation. GRP78 knockdown increased lipid toxicity ifen (Fig. 6C). These data suggest that, while the effect of LA may and breast cancer cell death. Increased ROS generation, by partly reflect stimulation of lipid peroxidation in the tumor GRP78 knockdown, increases circulating chemokine MCP-1 epithelial cells, the tumor microenvironment plays a vital role and recruits macrophages into the tumor microenvironment. in mediating GRP78-regulated metabolite tumor cytotoxicity. GRP78 differentially regulates CD47-dependent immune sur- Because the UPR can be prosurvival or prodeath, UPR-driven veillance signaling in mammary tumor and normal cells to signaling must be able to regulate the recognition and elimi- protect normal tissue and sensitize breast tumors to macro- nation of cells by the immune system. Systemic reduction of phage cytolytic activities. Taken together, these data establish a GRP78, or supplementation with LA, increased both circulating novel role for GRP78 in mediating lipid metabolism and levels of MCP-1 (Fig. 7A) and macrophage recruitment in the explain why targeting GRP78 could be an effective therapeutic mammary tumors and glands (Fig. 7D and F). Treatment of optionforthetreatmentofbreastcancer,andparticularly mice bearing LCC9 xenografts with human GRP78-targeting endocrine-resistant disease. morpholino increased macrophage infiltration as indicated by CD68 immunoreactivity (Fig. 7D). Previous reports showed Disclosure of Potential Conflicts of Interest that endoplasmic reticulum stress induced MCP-1 expression in No potential conflicts of interest were disclosed. the kidneys of db/db mice through induction of XBP1, linking UPR signaling to MCP-1 chemokine regulation (6). Moreover, Authors' Contributions LA treatment of endothelial cells also stimulated MCP-1 pro- Conception and design: K.L. Cook, R. Clarke duction through an oxidative mechanism (41). Treatment with Development of methodology: K.L. Cook, D.R. Soto-Pantoja, L. Hilakivi- NAC (a ROS inhibitor) prevented GRP78-silencing mediated Clarke MCP-1 induction (Fig. 5F). Thus, the primary effect of lipid Acquisition of data (provided animals, acquired and managed patients, peroxidation and ROS generation mediated by either GRP78 provided facilities, etc.): K.L. Cook, D.R. Soto-Pantoja, P.A.G. Clarke, € inhibition or dosing with LA appears to be the stimulation of M.I. Cruz, A. Zwart, A. Warri MCP-1 expression and macrophage recruitment. Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): K.L. Cook, P.A.G. Clarke, L. Hilakivi-Clarke, CD47 is a widely expressed cell surface receptor that serves R. Clarke to regulate innate and adaptive immune system responses (42). Writing, review, and/or revision of the manuscript: K.L. Cook, D.R. Soto- Clinical data indicate that CD47 is often upregulated in breast Pantoja, L. Hilakivi-Clarke, D.D. Roberts, R. Clarke

5668 Cancer Res; 76(19) October 1, 2016 Cancer Research

Administrative, technical, or material support (i.e., reporting or organizing the NCI Career Transition Award (1K22CA181274-01A1). The work was data, constructing databases): M.I. Cruz supported by awards from the US Department of Health and Human Study supervision: K.L. Cook, R. Clarke Services (R01-CA131465, U01-CA184902 and U54-CA149147 to R. Clarke). D.D. Roberts was supported by the Intramural Research Program of the NIH, National Cancer Institute, Center for Cancer Research. Grant Support K.L. Cook is supported by a DOD Breast Cancer Research Program Received October 5, 2015; revised May 31, 2016; accepted June 3, 2016; Postdoctoral Fellowship (BC112023). D.R. Soto-Pantoja is supported by published online October 1, 2016.

References þ 1. Clarke R, Shajahan AN, Wang Y, Tyson J, Riggins RB, Weiner LM, et al. gen responsiveness in ER breast cancer. Clin Cancer Res 2014;20: Endoplasmic Reticulum stress, the unfolded protein response, and gene 3222–32. network modeling in antiestrogen resistant breast cancer. Horm Mol Biol 17. Zhang Y, Tseng CC, Tsai YL, Fu X, Schiff R, Lee AS. Cancer cells resistant to Clin Investig 2011;5:35–44. therapy promote cell surface relocalization of GRP78 which complexes 2. Clarke R, Cook KL, Hu R, Facey CO, Tavassoly I, Schwartz JL, et al. with PI3K and enhances PI(3,4,5)P3 production. PLoS ONE 2013;8: Endoplasmic reticulum stress, the unfolded protein response, autophagy, e80071. and the integrated regulation of breast cancer cell fate. Cancer Res 18. Liu R, Li X, Gao W, Zhou Y, Wey S, Mitra SK, et al. Monoclonal antibody 2012;72:1321–31. against cell surface GRP78 as a novel agent in suppressing PI3K/AKT 3. Hu R, Warri A, Jin L, Zwart A, Riggins RB, Fang HB, et al. NF-kappaB signaling, tumor growth, and metastasis. Clin Cancer Res 2013;19: signaling is required for XBP1 (unspliced and spliced)-mediated effects on 6802–11. antiestrogen responsiveness and cell fate decisions in breast cancer. Mol 19. Gylling H, Pyrhonen S, Mantyla E, Maenpaa H, Kangas L, Miettinen TA. Cell Biol 2015;35:379–90. Tamoxifen and toremifene lower serum cholesterol by inhibition of delta 4. Fernandez PM, Tabbara SO, Jacobs LK, Manning FC, Tsangaris TN, 8-cholesterol conversion to lathosterol in women with breast cancer. J Clin Schwartz AM, et al. Overexpression of the glucose-regulated stress gene Oncol 1995;13:2900–5. GRP78 in malignant but not benign human breast lesions. Breast Cancer 20. Poirot M, Silvente-Poirot S, Weichselbaum RR. Cholesterol metabolism Res Treat 2000;59:15–26. and resistance to tamoxifen. Curr Opin Pharmacol 2012;12:683–9. 5. Davies MP, Barraclough DL, Stewart C, Joyce KA, Eccles RM, Barraclough R, 21. Horton JD, Goldstein JL, Brown MS. SREBPs: activators of the complete et al. Expression and splicing of the unfolded protein response gene XBP-1 program of cholesterol and fatty acid synthesis in the liver. J Clin Invest are significantly associated with clinical outcome of endocrine-treated 2002;109:1125–31. breast cancer. Int J Cancer 2008;123:85–8. 22. Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics, 2014. CA Cancer J Clin 6. Chen J, Guo Y, Zeng W, Huang L, Pang Q, Nie L, et al. ER stress triggers MCP- 2014;64:9–29. 1 expression through SET7/9-induced histone methylation in the kidneys 23. Riggins RB, Bouton AH, Liu MC, Clarke R. Antiestrogens, aromatase of db/db mice. Am J Physiol Renal Physiol 2014;306:F916–25. inhibitors, and apoptosis in breast cancer. Vitam Horm 2005;71: 7. Cook KL, Clarke PA, Parmar J, Hu R, Schwartz-Roberts JL, Abu-Asab M, 201–37. et al. Knockdown of estrogen receptor-alpha induces autophagy and 24. Fu Y, Li J, Lee AS. GRP78/BiP inhibits endoplasmic reticulum BIK and inhibits antiestrogen-mediated unfolded protein response activation, protects human breast cancer cells against estrogen starvation-induced promotingROS-induced breast cancer cell death. FASEB J 2014;28: apoptosis. Cancer Res 2007;67:3734–40. 3891–905. 25. Booth L, Roberts JL, Cash DR, Tavallai S, Jean S, Fidanza A, et al. GRP78/ 8. Cook KL, Shajahan AN, Warri A, Jin L, Hilakivi-Clarke LA, Clarke R. BiP/HSPA5/Dna K is a universal therapeutic target for human disease. J Cell Glucose-regulated protein 78 controls cross-talk between apoptosis and Physiol 2015;230:1661–76. autophagy to determine antiestrogen responsiveness. Cancer Res 2012;72: 26. Cook KL, Clarke PA, Clarke R. Targeting GRP78 and antiestrogen resistance 3337–49. in breast cancer. Future Med Chem 2013;5:1047–57. 9. Gomez BP, Riggins RB, Shajahan AN, Klimach U, Wang A, Crawford AC, 27. Ye R, Jung DY, Jun JY, Li J, Luo S, Ko HJ, et al. Grp78 heterozygosity et al. Human X-box binding protein-1 confers both estrogen independence promotes adaptive unfolded protein response and attenuates diet-induced and antiestrogen resistance in breast cancer cell lines. FASEB J 2007;21: obesity and insulin resistance. Diabetes 2010;59:6–16. 4013–27. 28. Baumann J, Sevinsky C, Conklin DS. Lipid biology of breast cancer. 10. Cook KL, Clarke R. Estrogen receptor-a signaling and localization regulates Biochim Biophys Acta 2013;1831:1509–17. þ autophagy and unfolded protein response activation in ER breast cancer. 29. Rutkowski DT, Wu J, Back SH, Callaghan MU, Ferris SP, Iqbal J, et al. UPR Receptors Clin Investig 2014;1:e316. pathways combine to prevent hepatic steatosis caused by ER stress-medi- 11.IshiiY,PapaL,BahadurU,YueZ,Aguirre-GhisoJ,ShiodaT, ated suppression of transcriptional master regulators. Dev Cell 2008;15: et al. Bortezomib enhances the efficacy of fulvestrant by ampli- 829–40. fying the aggregation of the estrogen receptor, which leads to a 30. Kammoun HL, Chabanon H, Hainault I, Luquet S, Magnan C, Koike T, et al. proapoptotic unfolded protein response. Clin Cancer Res 2011;17: GRP78 expression inhibits insulin and ER stress-induced SREBP-1c acti- 2292–300. vation and reduces hepatic steatosis in mice. J Clin Invest 2009;119: 12. Cook KL, Clarke R. Heat shock 70 kDa protein 5/glucose-regulated protein 1201–15. 78 "AMP"ing up autophagy. Autophagy 2012;8:1827–9. 31. Sha H, He Y, Chen H, Wang C, Zenno A, Shi H, et al. The IRE1alpha-XBP1 13. Hardie DG, Ross FA, Hawley SA. AMPK: a nutrient and energy sensor that pathway of the unfolded protein response is required for adipogenesis. Cell maintains energy homeostasis. Nat Rev Mol Cell Biol 2012;13:251–62. Metab 2009;9:556–64. 14. Brunner N, Boulay V, Fojo A, Freter CE, Lippman ME, Clarke R. Acquisition 32. Lee AH, Scapa EF, Cohen DE, Glimcher LH. Regulation of hepatic lipo- of hormone-independent growth in MCF-7 cells is accompanied by genesis by the transcription factor XBP1. Science 2008;320:1492–6. increased expression of estrogen-regulated genes but without detectable 33. Bobrovnikova-Marjon E, Hatzivassiliou G, Grigoriadou C, Romero M, DNA amplifications. Cancer Res 1993;53:283–90. Cavener DR, Thompson CB, et al. PERK-dependent regulation of lipogen- 15. Brunner N, Boysen B, Jirus S, Skaar TC, Holst-Hansen C, Lippman J, et al. esis during mouse mammary gland development and adipocyte differen- MCF7/LCC9: an antiestrogen-resistant MCF-7 variant in which acquired tiation. Proc Natl Acad Sci U S A 2008;105:16314–9. resistance to the steroidal antiestrogen ICI 182,780 confers an early cross- 34. Carracedo A, Cantley LC, Pandolfi PP. Cancer metabolism: fatty acid resistance to the nonsteroidal antiestrogen tamoxifen. Cancer Res oxidation in the limelight. Nat Rev Cancer 2013;13:227–32. 1997;57:3486–93. 35. Lee K, Kerner J, Hoppel CL. Mitochondrial carnitine palmitoyltransferase 16. Cook KL, Warri A, Soto-Pantoja DR, Clarke PA, Cruz MI, Zwart A, 1a (CPT1a) is part of an outer membrane fatty acid transfer complex. J Biol et al. Hydroxychloroquine inhibits autophagy to potentiate antiestro- Chem 2011;286:25655–62.

www.aacrjournals.org Cancer Res; 76(19) October 1, 2016 5669

36. Liu J, Cinar R, Xiong K, Godlewski G, Jourdan T, Lin Y, et al. Monounsat- 41. Woo Lee Y, Joo Park H, Hennig B, Toborek M. Linoleic acid induces MCP-1 urated fatty acids generated via stearoyl CoA desaturase-1 are endogenous gene expression in human microvascular endothelial cells through an inhibitors of fatty acid amide hydrolase. Proc Natl Acad Sci U S A oxidative mechanism. J Nutr Biochem 2001;12:648–54. 2013;110:18832–7. 42. Soto-Pantoja DR, Terabe M, Ghosh A, Ridnour LA, DeGraff WG, Wink 37. Lo Verme J, Gaetani S, Fu J, Oveisi F, Burton K, Piomelli D. Regulation DA, et al. CD47 in the tumor microenvironment limits cooperation of food intake by oleoylethanolamide. Cell Mol Life Sci 2005;62: between antitumor T-cell immunity and radiotherapy. Cancer Res 708–16. 2014;74:6771–83. 38. Lelliott C, Vidal-Puig AJ. Lipotoxicity, an imbalance between lipogenesis de 43. Willingham SB, Volkmer JP, Gentles AJ, Sahoo D, Dalerba P, Mitra SS, et al. novo and fatty acid oxidation. Int J Obes Relat Metab Disord 2004;28Suppl The CD47-signal regulatory protein alpha (SIRPa) interaction is a thera- 4:S22–8. peutic target for human solid tumors. Proc Natl Acad Sci U S A 39. Begin ME, Ells G, Das UN, Horrobin DF. Differential killing of human 2012;109:6662–7. carcinoma cells supplemented with n-3 and n-6 polyunsaturated fatty 44. GielenSC, Kuhne LC, Ewing PC, BlokLJ, Burger CW. Tamoxifentreatmentfor acids. J Natl Cancer Inst 1986;77:1053–62. breast cancer enforces a distinct gene-expression proﬁle on the human 40. Begin ME, Ells G, Horrobin DF. Polyunsaturated fatty acid-induced cyto- endometrium: an exploratory study. Endocr Relat Cancer 2005;12:1037–49. toxicity against tumor cells and its relationship to lipid peroxidation. J Natl 45. Kroemer G, Pouyssegur J. Tumor cell metabolism: cancer's Achilles' heel. Cancer Inst 1988;80:188–94. Cancer Cell 2008;13:472–82.

5670 Cancer Res; 76(19) October 1, 2016 Cancer Research

Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2016 American Association for Cancer Research. Endoplasmic Reticulum Stress Protein GRP78 Modulates Lipid Metabolism to Control Drug Sensitivity and Antitumor Immunity in Breast Cancer

Katherine L. Cook, David R. Soto-Pantoja, Pamela A.G. Clarke, et al.

Cancer Res 2016;76:5657-5670.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/76/19/5657

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2016/10/13/76.19.5657.DC1

Cited articles This article cites 45 articles, 17 of which you can access for free at: http://cancerres.aacrjournals.org/content/76/19/5657.full#ref-list-1

Citing articles This article has been cited by 3 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/76/19/5657.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/76/19/5657. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.