The Heavy Metal Tolerant Soil Bacterium Achromobacter Sp. AO22 Contains a Unique Copper Homeostasis Locus and Two Mer Operons

J. Microbiol. Biotechnol. (2012), 22(6), 742–753 http://dx.doi.org/10.4014/jmb.1111.11042 First published online March 24, 2012 pISSN 1017-7825 eISSN 1738-8872

The Heavy Metal Tolerant Soil Bacterium Achromobacter sp. AO22 Contains a Unique Copper Homeostasis Locus and Two mer Operons

Ng, Shee Ping†, Enzo A. Palombo, and Mrinal Bhave*

Environment and Biotechnology Centre, Faculty of Life and Social Sciences, Swinburne University of Technology, PO Box 218, Melbourne, Victoria 3122, Australia Received: November 16, 2011 / Revised: January 26, 2012 / Accepted: January 27, 2012

Copper-containing compounds are introduced into the sp. strain AO22 is thus an ideal candidate for understanding environment through agricultural chemicals, mining, and copper homeostasis mechanisms and exploiting them for metal industries and cause severe detrimental effects on copper biosensor or biosorption systems. ecosystems. Certain microorganisms exposed to these Keywords: Heavy metals, copper, mer, cop, two-component stressors exhibit molecular mechanisms to maintain signal transduction, genomic island intracellular copper homeostasis and avoid toxicity. We have previously reported that the soil bacterial isolate Achromobacter sp. AO22 is multi-heavy metal tolerant and exhibits a mer operon associated with a Tn21 type Copper-containing compounds are introduced into the transposon. The present study reports that AO22 also environment through mining activities, use in agriculture hosts a unique cop locus encoding copper homeostasis as bactericides, fungicides, and growth promoters, as well determinants. The putative cop genes were amplified from as metal works. Copper is an essential trace element for the strain AO22 using degenerate primers based on reported cellular functions, mainly in electron transfer and dioxygen cop and pco sequences, and a constructed 10,552 base pair transport and activation. However, it is also highly toxic contig (GenBank Accession No. GU929214). BLAST when in excess, owing to its high redox potential and ability analyses of the sequence revealed a unique cop locus of 10 to produce reactive oxygen species harmful to cellular complete open reading frames, designated copSRABGOFCDK, components [15]. Thus intracellular copper concentrations with unusual separation of copCD from copAB. The need to be sensed and balanced carefully in all cell types. promoter areas exhibit two putative cop boxes, and copRS Microorganisms occurring in environments contaminated appear to be transcribed divergently from other genes. with heavy metals often exhibit adaptation to such The putative protein CopA may be a copper oxidase environments through having developed, and/or acquired involved in export to the periplasm, CopB is likely extra- by horizontal transfer, genetic systems that encode a variety cytoplasmic, CopC may be periplasmic, CopD is cytoplasmic/ of mechanisms of resistance to metal toxicity. For example, inner membrane, CopF is a P-type ATPase, and CopG, a number of genera and species of bacteria from natural CopO, and CopK are likely copper chaperones. CopA, B, environments (such as mercury deposits), as well as diverse C, and D exhibit several potential copper ligands and aquatic and terrestrial sites contaminated by human activities, CopS and CopR exhibit features of two-component regulatory exhibit the mercury resistance-encoding mer operons systems. Sequences flanking indicate the AO22 cop locus (reviewed in Barkay et al., [3]). These operons are being may be present within a genomic island. Achromobacter researched intensely for development of mercury biosensors [6], and bioremediation/phytoremediation systems [9, 11]. In comparison, only a handful of bacteria have been *Corresponding author reported as yet to encode copper tolerance. These include Phone: +61-3-9214-5759; Fax: +61-3-9819-0834; E-mail: [email protected] sequestration of copper by the copABCDcopRS operon of † Pseudomonas syringae pv. tomato [8], the pcoABCDcopRS School of Engineering, Science and Technology, Nilai University College, Persiaran Universiti, 71800 Putra Nilai, Negeri Sembilan, operon of E. coli strains isolated from piggeries [7], and Malaysia cueO in E. coli [18], or P1-type ATPase-mediated efflux # Supplementary data for this paper are available on-line only at systems (e.g., by copA of E. coli) [42]. The multi-heavy http://jmb.or.kr. metal resistant bacterium Cupriavidus metallidurans CH34, 743 Ng et al. originally isolated from a zinc-contaminated source, has Cloning and Sequencing of PCR Products been studied extensively and encodes a plasmid-borne The PCR products were cloned into pGEM-T Easy vectors (Promega, cluster of 19 genes that include homologs of the cop system Australia) and colonies containing recombinant plasmids selected on - mentioned above, in addition to the chromosomallyencoded Luria Bertani (LB) agar plates containing ampicillin, IPTG, and X- Plus copRScopABCD [36]. Regulation of copper homeostasis gal. Plasmids from these were isolated with the Wizard SV Minipreps DNA Purification System (Promega, Australia) and sequenced systems commonly involves either a two-component signal using vector-based primers T7 (5'TAATACGACTCACTATAG3') transduction system, such as the copRS of P. syringae pv. and SP6 (5'ATTTAGGTGACACTATAGAAT3'), the gene-specific tomato [8] and pcoRS and cusRS of E. coli [7, 38], or primers (Table 1), and additional internal primers designed progressively. regulators similar to the merR of mer operons, such as cueR, which regulates copA transcription in E. coli [40]. In Analysis of Sequence Data light of the environmental catastrophes in copper mining DNA sequence assemblies, restriction maps, translations into putative areas [21] or copper contamination in agricultural environments proteins, and other analyses were conducted using BioEdit (http:// [21], as well as toxicity effects on human cells [15], it is www.mbio.ncsu.edu/BioEdit/bioedit.html). The DNA sequences were highly desirable to identify biodiversity in copper homeostasis used for BLASTN searches and aligned with corresponding reported mechanisms, with a view to develop biosensors for detecting copper homeostasis-related genes using ClustalW (http://www.ebi.ac.uk/ bioavailable and toxic amounts of copper in a given Tools/msa/clustalw2/). Each putative AO22 protein was analyzed for potential signal peptides using SignalP v.3.0 (http://www.cbs.dtu.dk/ environment, as well as to develop detoxification systems. services/SignalP-3.0/) and subcellular locations by PSORTb v.2.0.4 We have previously reported a lead, copper, and mercury (http://www.psort.org/psortb/index.html); a PSORTb score of at least tolerant soil bacterial strain, Achromobacter sp. AO22, 7.5 was considered significant. The characteristic features of putative from a disused battery-manufacturing site in Melbourne, proteins were identified by alignment with homologs from reported Australia, which harbors a transposon of the Tn21 subgroup systems using ClustalW. DNA regions of interest were submitted in of the Tn3 family, with the mer operon associated with it both directions to the BPROM server (http://linux1.softberry.com/ [39, 51]. This work reports the identification of an elaborate berry.phtml?topic=bprom&group=programs&subgroup=gfindb) for copper homeostasis locus and a second mer operon, predicting potential promoter regions including the -10 and -35 suggesting the strong potential of AO22 for development hexamers and likely transcription initiation sites. The potential of biosensor and metal detoxification systems. regulatory protein-binding sites, which are typically palindromic, were identified in the putative promoter regions using the Palindrome Search server (http://bioinfo.cs.technion.ac.il/projects/Engel-Freund/ new.html). MATERIALS AND METHODS Homology Modeling of the Putative AO22 CopA Protein Amplification of cop Operon Genes, the Second mer Operon, The three-dimensional structure of the putative AO22 CopA protein and a Possible Genomic Island in Strain AO22 was predicted by homology modeling using SWISS-MODEL (http:// In the absence of any molecular information on copper homeostasis swissmodel.expasy.org/workspace/). The automatic modeling tool Achromobacter Alcaligenes genes of sp. AO22 (initially identified as was used, where a suitable template was automatically selected based sp. AO22; [51]), it was hypothesised that the reported sequence of on a BLAST result generated using the putative protein sequence of copA copR, Cupriavidus metallidurans two key genes, and in CH34 AO22 CopA as input data. Protein structures were visualized and A. eutrophus (also first identified as CH34; [33]) could be used images generated using DeepView/SWISS-PDB Viewer v.4.0.1 (http:/ initially to design primers to amplify any related genes in AO22. /spdbv.vital-it.ch/). Degenerate primers COPA-F, COPA-R, COPR-F, and COPR-R were designed based on relatively conserved regions of the copA and Determination of Minimum Inhibitory Concentrations of Metals copR C. metallidurans genes of CH34 pMOL30 (GenBank Accession The minimum inhibitory concentrations (MICs) of metals were No. NC_007971) and megaplasmid (MPL, NC_007974) (Table 1). determined based on Teitzel and Parsek [49]. Test strains were As sequence data for AO22 genes were acquired progressively (see grown in 2 ml of LB containing the appropriate supplements for results), additional primers COPAB-F, COPBurf-R, COPS-R, 448-F, 18-24 h. One hundred µl of LB containing metals at concentrations and 442-R were then designed based on the cop locus of Delftia ranging from 0.5 to 8.0 mM for CuSO4 and from 0.001 to 0.04 mM acidovorans SPH-1 (NC_010002) [46], and additional primers were for HgCl2, followed by 10 µl of the overnight culture of each test designed to test for the presence of related adjoining sequences of a strain, were added to each well in sterile 96-well microtiter plates. A mer genomic island (Table 1). The possibility of a second operon blank well containing LB without heavy metals was included for mer o (designated 2) within it was investigated using primers MER483- each strain. MIC was determined after 48 h of growth at 37 C. The mer D. acidovorans F and MER486-R based on a locus in SPH-1. optical density of the wells was read at wavelength 595 nm using an PCR amplifications were performed on genomic DNA (gDNA) of iMark Microplate Absorbance Reader (BioRad) at time zero and a AO22 using the primer pairs and annealing temperatures indicated final optical density reading was taken after 48 h. Each experiment in Table 1. All reactions typically contained 1× BioMix (Bioline, was performed in triplicate. The MIC was recorded as the lowest Taq - Australia; contains dNTPs, polymerase, MgCl2), 100 400 ng of metal concentration that completely inhibited the growth of the test template, and 0.1 µg of each primer in a final volume of 50 µl. organism. A SOIL BACTERIUM WITH COPPER AND MERCURY RESISTANCE OPERONS 744

Table 1. Primers designed for amplification and sequencing of copper homeostasis determinants and the possible genomic island in strain AO22. Target gene/region Primer Primer sequence Annealing temperature Expected amplicon in strain AO22 name (5'→3') used for pair (oC) length (bp)a

copA COPA-F RATYCACTGGCACGGCAT 57 1,427-1,463 COPA-R GCAACATMARGTGGCAGTG COPR-F AARCTGCTGGTRGTSGARGA copR 57 654 COPR-R RTATCCCATGCCRCGCAC COPAB-F CTTCCTGGTGACAGCCGA copAB 57 1,281 COPBurf-R GCTCGGGTCCTTCCACAC COPR-F AARCTGCTGGTRGTSGARGA copRS 57 2,095 COPS-R TTAAGCGATGCGAGGCAG 448-F GATGGTGCGAGATAACGGAG copG-K 60 5,452 442-R GGCTTGTTGGTGATGGCA 427-F CTGCCTGTGAAGAGGTGCC GI-PCR 1 58 648 429-R CTCGTGTTGCGTCCTTACC 428-F TTGCCCCTGCTTCCCTTT GI-PCR 2 57 273 429-R CTCGTGTTGCGTCCTTACC 442-F GATGGTGCGAGATAACGGAG GI-PCR 3 57 910 444-R GCTCTTCTCAACGCTCTATGG 443-F TTACCCGCCGTGCTCCTG GI-PCR 4 57 657 444-R GCTCTTCTCAACGCTCTATGG 452-F ATCCTGCCCGCCAACGA GI-PCR 5 57 718 453-R GAAATCGCACCTGCCCAT 468-F TTTGCGATTCGGTGACAG GI-PCR 6 57 613 468-R ATGCTTGCAACCCGTTTC 468-F TTTGCGATTCGGTGACAG GI-PCR 7 57 3,937 473-R GTGGGGCACGGGAACAG 492-F CCATCCCCAACCAGTCCT GI-PCR 8 57 2,561 497-R CACCCACCTCATCAGCGA 496-F GCAACGGCATTCCTCATC GI-PCR 9 57 914 497-R CACCCACCTCATCAGCGA 497-F TAGTTCTCCAGCCCTTCGG GI-PCR 10 57 1358 498-R GGTGTTCGTGATCATCGG 468-F TTTGCGATTCGGTGACAG GI-PCR 11 57 28,000 497-R CACCCACCTCATCAGCGA MER483-F CTATCCGGCACAGCAGGA mer2 57 2,821 MER486-R TCAACAGCAGTGCAATGC R= A + G; Y = C + T; M = A + C; K = T + G; S = C + G aEstimates for the first two primer pairs are as for the C. metallidurans CH34 pMOL30 cop locus (GenBank NC_007971) and megaplasmid (NC_007974) sequences, and estimates for the other cop operon sections, genomic island (GI) sections, and mer2 operon are as per the D. acidovorans SPH-1 sequence (NC_010002).

RESULTS ends of this 3 kb insert were used in a BLASTN search, and revealed >97% identity to the copRcopA region of D. Molecular Characterization of the Achromobacter sp. acidovorans strain SPH-1 (Accession No. NC_010002). Strain AO22 cop Locus Further cop genes occur in SPH-1 flanking this region, Amplification of gDNA of Achromobacter sp. strain prompting the design and use of primer pair COPR-F/ AO22 with COPA-F/COPA-R and COPR-F/COPR-R led COPS-R for amplifying sequences upstream of copRcopA, to products of about 1.5 kilobase pairs (kb) and 600 base and pairs COPAB-F/COPBurf-R and DA448-F/DA442-R pairs (bp), respectively (Fig. S1). Amplification was then for downstream sections. Products of 2, 1.2, and 5 kb were performed with the reverse primer pair COPR-R/COPA-R, noted, respectively (Fig. S1). The complete sequences of to investigate whether the putative copR and copA genes clones of these four fragments were determined and a might be transcribed divergently, and yielded a band of 10,552 bp contig was constructed (reported as GU929214 about 3 kb. Partial sequences (987 bp and 587 bp) from the in GenBank). 745 Ng et al.

Fig 1. Copper homeostasis genetic determinants in the Achromobacter sp. AO22 cop locus. Blocks represent individual genes, with pointed ends indicating direction of transcription. Numbers between blocks indicate length of intergenic regions in base pairs. The negative value represents the 29 bp overlap of the 3'end of copR and the 5'end of copS. Numbers below the blocks and in parenthesis indicate the length of genes in bp and their putative protein products in amino acids, respectively.

A six-frame translation of the 10,552 bp sequence led to His607, and Met612 in AO22 CopA. In order to visualize identification of 10 complete open reading frames (ORFs). the potential role of these ligands, a 3D model of AO22 The locus was designated as cop owing to homology to CopA was built using SWISS-MODEL (Fig. 2A), with reported loci (discussed below), and the genes were named zucchini ascorbate oxidase (PDB Accession No. 1ASQ) [34] copSRABGOFCDK (Fig. 1). The copR and copS appear selected by the server as template. This showed several transcribed divergently from other genes, with copR regions in CopA (Phe220-Arg238, Met386-Met407, Asn419- overlapping the putative start codon of copS. The spacer Leu442, Pro494-Gly-496, Met515-Gly524) where equivalent between copR and copA was 255 bp, and copB was 25 bp residues were absent in 1ASQ (Fig. 2B). However, downstream of the putative copA stop codon. Unlike all superimposition of the two and closer inspection at the known cop operons, wherein the ABCD genes are adjacent, region within 4Å of the four copper atoms revealed the 12 AO22 copCD were separated from copAB by three ORFs ligands of the putative CopA to be very close to those in (copG, copO, and copF). The last gene copK was 128 bp 1ASQ (Fig. 2C). In contrast to the relatively conserved N- downstream of the stop codon of copD. and C-termini, there is a highly variable His- and Met-rich The genes were subjected to BLAST searches, and region in all CopA homologs; this region (Met379-His466 sequences of the genes and their putative proteins aligned of AO22 CopA) also accounted for most of the residues to the reported systems; that is, copRScopABCD of C. that were absent in 1ASQ. AO22 CopA has six copies of metallidurans CH34 pMOL30 and MPL [36], P. syringae the motif MXXM (3XMTGM, 1× each of MGSM, MGGM, pv. tomato [8], P. putida [1], Xanthomonas campestris pv. MAGM) (Fig. S2A), shared with the related proteins (five juglandis [27], X. perforans pv. vesicatoria (X. axonopodis in pMOL30 CopA, four in P. syringae CopA, five in E. pv. vesicatoria) [53], cus from E. coli K-12 sub-strain coli PcoA). The main difference between CopA of AO22 MG1655 [38], pco from E. coli pRJ1004 [7], and E. coli and SPH-1 was also in this section; two more MTGM and cueO [18] (DNA alignments not shown). For copG, copO, an MSGM occur in SPH-1. copF, and copK, relevant genes from these systems (if The putative 326 aa CopB has a signal peptide and may applicable) as well as the top six BLAST hits were be extra-cytoplasmic, similar to CopB of P. syringae [8], included. The analyses led to the following results. Orf2 of X. campestris [27], and PcoB of E. coli [7], which are all associated with the outer membrane. AO22 CopB Features of the Putative Structural Proteins of Strain and its homologs are more conserved at the C-terminal AO22 cop Locus (Fig. S2B). The motif MDHXXMXM occurs once at the The putative 619 amino acid (aa) long AO22 CopA was N-terminus of AO22 CopB; it occurs 5 times in P. syringae predicted to be periplasmic, and included an N-terminal 42 aa CopB [8] and 10 times in pMOL30 CopB [36]. signal peptide with two conserved Arg residues, making it The putative CopC (128 aa) also had a signal peptide, a potential target of the twin-arginine-translocation (tat) may be periplasmic, and shares the Cu(I)- and Cu(II)- pathway for export to the periplasm (Fig. S2A). The three binding sites of E. coli PcoC [13, 23] and P. syringae conserved domains (types 1, 2, 3) associated with the CopC [2] (Fig. S2C). The predicted Cu(I) ligands are copper oxidase superfamily [34] and four His-rich clusters Met40, Met43, Met46, His49, and Met52 in the motif including a conserved C-terminal HCHXXXHM motif MXXMX(X)HXXM, also noted in CopB, whereas the were also identified. The His-rich regions with 12 conserved equivalent Cu(II)-binding site in AO22 CopC is likely ligands known to interact with type 1, 2, and 3 copper constituted by His1, Glu27, Asp90, and His 92. atoms, as revealed in the structures of plant ascorbate The CopD (308 aa) was predicted to be a cytoplasmic oxidases [34], correspond to His113, His115, His155, (inner) membrane protein, with eight transmembrane helices His157, His553, His556, His558, His601, Cys602, His603, (TMHs) (Fig. S2D), as noted in E. coli PcoD [7], P. A SOIL BACTERIUM WITH COPPER AND MERCURY RESISTANCE OPERONS 746

Fig. 2. Model of 3D protein structure of AO22 CopA. (A) Ribbon diagram of the predicted AO22 CopA structure. Elements of secondary structure (helices and beta sheets) are colored from N- to C-terminal in the order violet, blue, green, yellow, orange, red. (B) Superimposed image of the Cα atoms of AO22 CopA (blue) and zucchini ascorbate oxidase (PDB accession 1ASQ) (pink). Light blue regions represent residues in AO22 CopA where the corresponding residues are missing in 1ASQ. Copper atoms bound to 1ASQ are shown as green spheres. (C) Superimposition of AO22 CopA residues onto those in zucchini ascorbate oxidase located within 4Å of the 4 copper atoms (blue spheres). AO22 CopA residues (labeled) are shown in CPK colors: white for carbon, red for oxygen, blue for nitrogen, yellow for sulfur. Zucchini ascorbate oxidase residues are shown in pink. syringae CopD [8], and pMOL30 and MPL CopD [36]. The CopO (90 aa) had two predicted TMHs, and Three His (His141, His153, His160 of AO22 CopD) were highest identity to SPH-1 CopO (98%) followed by conserved and could be the metal ligands, although the ligands HMPREF0004_1699 of Achromobacter piechaudii ATCC of reported CopD proteins have not been confirmed as yet. 43553 and SSKA14_1240 of Stenotrophomonas sp. SKA14, The CopF (826 aa) was also predicted to be a cytoplasmic but very low identities (18% in protein, 30% in DNA) to (inner) membrane protein with eight TMHs (Fig. S2E) and pMOL30 CopO. The possible metal-binding sites of AO22 appears to be a homolog of copper-translocating P-type CopO include 10 His, three Met and 2 Cys (Fig. S2G). The (P1B-type) ATPases such as E. coli CopA [42]. It contained Cys55, Met58, and His59 constitute a highly conserved the motif DKTGT, characteristics of Cu P-type ATPases. CPLMH motif, as also His63. Interestingly, Met1, His5, The CPx/xPC motif, characteristic of heavy metal P-type His39, His42, Met62, His66, His68, and His71 were also ATPases, also occurred in the sixth TMH. The N-terminal conserved in all except for pMOL30 CopO. 150 aa contains 17 His and 4 Cys, which may be the metal- The AO22 CopK (94 aa) also had a predicted signal binding sites common in heavy metal P-type ATPases. peptide. BLASTX search using AO22 copK DNA as The CopG is 161 aa long and also has a 33 aa signal query returned 12 unique hits (Fig. S2H). The highest hits peptide (Fig. S2F), hence it is possibly periplasmic, and (90% identity) contained two identical sequences, from likely a homolog of pMOL30 CopG [31]. It exhibited a Achromobacter piechaudii ATCC43553 and Stenotrophomonas number of potential metal-binding sites including 4 Cys, 4 sp. SKA14. Interestingly, three other top hits belonged to His, and 2 Met, all of which except His160 were conserved the plasmid pAph01 of Candidatus Accumulibacter phosphatis in all sequences. The motif CGCC of pMOL30 [36] is clade IIA str. UW-1. Cu(I)-binding ligands (Met28, Met38, constituted by Cys47, Cys49, and Cys50 in AO22 CopG. Met44, Met54) of pMOL30 CopK are absent in the mature 747 Ng et al.

AO22 CopK. Interestingly, of the potential metal-binding (Fig. 4A). The PcopA -35 (TTCATC) and -10 (TAGCAT) sites (Met31, Met48, His92) of AO22 CopK, Met48 was and PcopR -35 (ATGAAT) and -10 (CAAAAT) elements conserved in all 12 sequences and His92 in 9, including in the respective directions differ in 3 or 2 positions from CopK of pMOL30, wherein it is proposed to be involved the consensus (TTGACA; TATAAT); however, such variations in Cu(II) binding [45]. are not unusual [20]. The spacing between the -10 and -35 boxes of PcopA (17 bp) and PcopR (16 bp) agrees well Features of the Putative Two-Component Regulatory with the 16-18 bp consensus for sigma-70 promoters [20]. System of Strain AO22 cop Locus A 7 bp perfect palindrome ATTACATGAATGTAAT was The AO22 CopS (477 aa) may have a 41 aa signal peptide noted upstream of the -35 box of PcopA. Such palindromic (predicted with a low probability of 0.23) and may be an cop boxes had been reported in other copper and silver inner-membrane protein, with two TMHs corresponding to responsive promoters [44]). A comparison with to these E. coli PcoS [7]. Multiple alignment with the sensor showed that in PcopR, the distance between the 3' end of the histidine kinases (HK) of related two-component signal palindrome and 5' end of the -35 box was much longer transduction (TCST) systems (Fig. S2I) showed it contained (55 bp) than in others (-2 to 25 bp); hence PcopR was the three conserved regions; that is, a specific His [17] excluded in the final alignment (Fig. 4B). Interestingly, the (His266), the dimerization domain [41] (256-309), and C- putative PcopA cop box shared the 2 bp gap between the terminal ATP-binding domain [41] (367-469). It is noteworthy half-repeats and high identity with other cop boxes. The that although the reported CopS homologs are all predicted AO22 PcopA transcription start site and -10 implicated in responding to copper stimulation, their N- hexamer are also at the same distance from the palindrome terminal regions shared little identity. The AO22 CopR as in PpcoE and PcusC. Based on these similarities, PcopA (230 aa) was predicted to be cytoplasmic, and alignment may also be copper (and silver?) inducible. with the response regulatory (RR) proteins of other copper TCST systems (Fig. S2J) showed conservation of the The AO22 cop Locus is Possibly Located on a Genomic signal receiver domain [48], C-terminal effector domain Island [48], as well as the aspartate phosphorylation site (residues While this work was under way, a new report indicated that 4-116, 128-228, and Asp51 of AO22 CopR). the cop locus of D. acidovorans SPH-1 was part of a 66 kb In order to evaluate the relatedness to RRs and HKs genomic island (GI), DAGI-2 [52]. Hence, to assess this from other heavy metal TCST systems, alignments were possibility for the AO22 cop locus, primers based on selected performed with the Salmonella silver resistance determinants sections of DAGI-2 were used in various combinations [19], the cadmium-zinc-cobalt (czc), and other heavy metal (Table 1) to amplify the AO22 gDNA. The results indicated TCST systems from C. metallidurans CH34 [12, 32], P. that these sections, including flanking regions of the cop syringae pv. tomato, Ralstonia solanacearum GMI1000, locus, were present in AO22 (Fig. 5), suggesting a DAGI- Fusobacterium sp., and Bacillus cereus ATCC 14579, as 2-like element. However, confirmation of this possibility well as non-heavy metal TCST systems, composed of E. will need amplification of overlapping sections and complete coli OmpR/EnvZ and those of unknown functions from C. sequencing. metallidurans CH34 MPL, Corynebacterium diphtheriae NCTC 13129, and Streptococcus agalactiae. Proteins from Presence of a Second mer Operon in Strain AO22 two eukaryotic systems were also included: SKN7 (RR) The data obtained on copper homeostasis determinants and SLN1 (HK) from Saccharomyces cerevisiae and the (see above) prompted investigations into a possible second Arabidopsis thaliana proteins ARR18 (RR) and ETR1 mer operon in AO22. PCR amplification using primer pair (HK) (alignments not shown). The phylogenetic tree showed MER483-F/MER486-R yielded a product of approximately three main clusters including one of copper/silver HKs 3 kb (Fig. 6A). Its clone yielded a 2,821 bp sequence, wherein AO22 CopS clustered with CusS and SilS, whereas which contained four complete ORFs, designated merR2, CopS from C. metallidurans CH34 and P. syringae and merT2, merP2, merA2 (Fig. 6B), and the operon was named PcoS from E. coli form a separate branch (Fig. 3). Similarly, mer2 owing to homology to our previously reported TnAO22 AO22 CopR grouped with the copper/silver RRs whereas other mer from the same strain [39]. The mer2 exhibits the core heavy metal and non-heavy metal RRs form two other clusters. genes merRTPA, with merR2 transcribed divergently from the other genes, as noted in most other reported Gram-negative Putative AO22 copA and copR Promoters Have Signature mer operons including that on TnAO22 (merRTPADEorf2). “Copper Boxes” However, it appears to lack merD and two downstream Analysis of the 255 bp region between the proposed start orfs noted in TnAO22 mer, and the predicted mer2 proteins codons of AO22copR and copA using BPROM identified were only 64%, 75%, 60%, and 77% identical to the two potential promoters; one upstream of copA and the counterparts in TnAO22 mer, confirming that a second and other in the complementary strand upstream of copR different mer operon is indeed present in AO22. A SOIL BACTERIUM WITH COPPER AND MERCURY RESISTANCE OPERONS 748

Fig. 3. Neighbor-joining distance dendogram of copper-homeostasis-related two-component signal transduction systems. (A) Histidine kinases; (B) response regulators. Bootstrap percentages (500 replicates) are shown to the left of the respective node. The three main clusters of copper/silver, other heavy metal, and non-heavy metal, two-component signal transduction systems are shaded in grey, dark grey, and light grey, respectively, with GenBank accession numbers given in parentheses. HMRR: heavy metal response regulator; RR: response regulator; HMHK: heavy metal histidine kinase; HK: histidine kinase.

AO22 mer Determinants Confer Additional Tolerance E. coli without the transposon. The Hg MICs were 0.04, to E. coli Whereas AO22 cop Determinants Do Not 0.02, and 0.01 mM, respectively. It was interesting to In order to test if the AO22 mer and cop genes confer note that in E. coli, pVS520::TnAO22 seemed to have additional mercury and copper tolerance, respectively, in conferred increase in resistance to Hg(II). However, E. coli E. coli, the MICs of Hg(II) and Cu(II) for the respective (pVS520::TnAO22), though estimated to have multiple strains were determined. The Hg(II) MIC of E. coli CB454 copies of the mer operon on TnAO22 (which corresponds strains containing TnAO22, E. coli (pVS520::TnAO22) [39], to the copy number of plasmid RP1 and its derivatives was determined and compared with wild-type AO22 and [16]), did not show higher resistance to Hg(II) compared 749 Ng et al.

Fig. 4. Putative copper promoters in Achromobacter sp. AO22. (A) Structure of the putative promoters of AO22 copA and copR. The sequence represents the intergenic region between the putative transcription start sites of AO22 copR and copA, indicated by arrows. The deduced -10 and -35 hexamers are shown by bold and single underlines, respectively. An AT-rich inverted repeat sequence is shaded. (B) Alignment of AO22 copA promoter region with known copper and silver inducible promoters, E. coli PpcoA, PpcoE [44], and PcusC [38]; Salmonella enterica serovar Typhimurium PsilC and PsilE [19] and P. syringae PcopA [35] and PcopH [29]. The palindromic copper box is indicated by bold arrows and boxed. The putative -35 and -10 hexamers are indicated by single and bold underlines, respectively. The predicted or determined transcript start sites are shaded. Accession numbers: E. coli plasmid pRJ1004 (X83541) for PpcoA and PpcoE; E. coli PcusC (AF245661); PsilC and PsilE (AF067954); P. syringae PcopA (M19930).

with wild-type AO22. This could indicate that the TnAO22 To test the effect of the AO22 cop determinants in E. mer requires host factors found in AO22 but not E. coli; for coli, E. coli JM109 strains carrying the cloned copSRAB example, the presence of mer2, to confer full resistance. [amplified using primer pair COPS-R/COPABurf-R (Table 1)]

Fig. 5. Amplification of regions of the genomic island in Achromobacter sp. AO22. (A) Structure of an assumed genomic island in AO22 and neighboring sections, based on Delftia acidovorans SPH-1 DAGI-2 [52]. The approximate regions of PCR 1 to 11 (listed in Table 1) are circled. Daci_0428 to Daci_0497 refer to locus tags for the genes on DAGI-2. Forward and reverse primers for each PCR were designed to anneal on the right and left ends of each circled region, respectively. (B) Lane M: GeneRuler DNA Ladder Mix; lanes 1-11: PCR 1 to 11 (Table 1). A SOIL BACTERIUM WITH COPPER AND MERCURY RESISTANCE OPERONS 750

Fig. 6. The second mer operon of strain AO22. (A) Amplification of the second mer operon from gDNA of AO22 with primers MER483-F/MER486-R. Lane M1: GeneRuler DNA Ladder Mix; lane AO22: Achromobacter sp. AO22. (B) Structure of the AO22 mer2 operon compared with the equivalent regions of the earlier reported mer operon on TnAO22 [39]. Genes are represented by block arrows with the pointed ends indicating the directions of transcription. Numbers indicate length of ORFs and spacer regions in bp. Numbers in parenthesis represent the number of amino acids for each putative protein. Numbers in italics between the blocks indicate the % nucleotide and protein (in parenthesis) sequence identities. or the copG to copK (copG-K) regions of the AO22 cop to its less toxic form Cu2+ in a cytoplasmic reaction [18]. locus were tested for copper MIC. Strain AO22 and E. coli The P. syringae CopA binds 11 Cu atoms per molecule [8] JM109 without plasmid were tested in parallel for comparison. whereas CueO binds 4 [18], and the Met-rich region is The copper MICs for the three E. coli strains were 3 mM thought to determine the copper-binding capacities of compared with 6 mM for strain AO22, suggesting that the multi-copper oxidases. However, the crystal structure of cloned cop genes of AO22 did not confer additional copper CueO showed that this region includes a helix that blocks tolerance to E. coli. However, it was not clear whether the access of bulky organic substrate to the Cu-binding site, genes from AO22 were not expressed or whether the thus providing CueO the specificity as cuprous oxidase [24]. AO22 mechanism of copper tolerance was not functional Furthermore, PcoA catalyses the Cu(I) in Cu(I)Cu(II)- in a different bacterial genus. bound PcoC [14], likely through direct interaction of the Met-rich region of PcoA with the Met-rich Cu(I) site in PcoC [23]. Based on the conservation of the twin-Arg, DISCUSSION HCHXXXHM, and the Met-rich region in AO22 CopA, AO22 CopA appears to be a copper oxidase and may In this work, a cop locus composed of 10 genes, function in protecting the periplasmic space from Cu copSRABGOFCDK (not necessarily representing a single toxicity by oxidizing Cu(I) to Cu (II). operon), was isolated from the gDNA of Achromobacter Comparatively limited information is available on CopB sp. strain AO22. It is reasonable to assume that this locus is proteins. P. syringae CopB and PcoB are predicted to be on the main chromosome of AO22, as no plasmid could be outer membrane proteins, and together with P. syringae isolated after numerous attempts (data not shown). The CopA and PcoA, respectively, confer low-level resistance putative proteins are not identical to known copper resistance [8, 26]. Similarly, X. axonopodis pv. citri CopA and CopB proteins but show conservation of functionally important are sufficient for low-level resistance, and inactivation of features. In addition, a putative copper-responsive promoter copAB leads to copper sensitivity [50]. The consensus was also identified. HXXMXXM, likely involved in Cu(I) fixation [26, 36], Compared with other copABCD systems, the AO22 cop occurs only once in the putative AO22 CopB. The pMOL30 locus has an unusual organisation in that copAB and copCD CopB has more metal-binding motifs compared with its are separated. The conserved twin-Arg motif in the CopA chromosomal counterpart. Adaikkalam and Swarup [1] signal peptide suggests its translocation to the periplasm propose that the number of metal-binding domains, such as via the TAT pathway. The E. coli PcoA and P. syringae the Met-rich regions of CopB-like proteins, is positively CopA have a role in periplasmic handling of copper correlated to levels of copper tolerance. The outer membrane [26, 30], and CueO, a multicopper oxidase with a role in E. location of CopB-like proteins has led to proposals that, in coli copper tolerance [40], is distantly related (17-21% combination with CopA and possibly CopC, they facilitate identity) to CopA homologs and shares these features. The the export of copper from the periplasm [8, 14, 26, 43]; AO22 CopA also shares the conserved HCHXXXHM thus, AO22 CopB may play a role in detoxification of motif with its homologs, the first two residues being periplasmic copper. responsible for copper binding and cuprous oxide activity The conservation of Cu(I)- and Cu(II)-binding sites in the of CueO proposed to protect the cells by converting Cu1+ putative AO22 CopC suggests it may have similar functions 751 Ng et al. in copper handling as its homologs. Both P. syringae CopC may sense the copper in the external environment and and E. coli PcoC effect intermolecular transfer of Cu ions relay the signal to CopR, which may in turn regulate the regardless of their oxidation states [13, 55]. As mentioned expression of the adjacent structural genes copA and copB. above, the Met-rich Cu(I) site of E. coli PcoC seems to The promoter elements in the spacer between copR and interact with PcoA. CopC is also proposed to interact with copA represent possible binding sites for CopR. Cop boxes CopD. In P. syringae, expression of CopC and CopD have been reported so far in phytopathogens or enteric together (but not alone) increases sensitivity to copper isolates (e.g., promoters of P. syringae copABCDRS [35], [8, 10]. Because of the likely inner membrane location of X. campestris pv. vesicatoria [4], E. coli pcoABCDRS [44], P. syringae CopD, together with CopC, they are suggested and E. coli cusSRCFBA [38, 54]). In P. syringae and E. to be required for copper uptake into the cytoplasm [10]. coli, purified CopR and CusR bind at the copper box of the This suggests that CopAB and CopCD may have evolved copper-inducible promoters PcopA and PcusC, respectively separately, possibly explaining their non-adjacent positions [35, 54]. Our results indicate that TCST systems for copper at the AO22 cop locus. homeostasis is a common theme in diverse bacteria. The AO22 CopF exhibits features of efflux pumps of the P-type ATPase family and is phylogenetically related Functionality and Possible Location of the Second mer to the subgroup that transports Cu(I). In E. coli, disruption Operon of copA, which encodes a P-type ATPase CopA, results in The fact that the mer2 of AO22 may be functional can be sensitivity of cells to Cu salts [42]. Located in the cytoplasmic inferred from the Hg(II) MIC experiments, wherein the (inner) membrane, these may confer tolerance by facilitating wild-type AO22 had higher Hg resistance compared with ATP-dependent transport of Cu ions out of the cytoplasm, TnAO22-harboring E. coli. Genes encoding the Zn/Cd/Pb as seen through accumulation of copper ions catalyzed by transporters of Pseudomonas putida KT2440 [28] localize CopB in an inside-out membrane vesicle of E. hirae [47]. on different parts of the genome, but their products are Based on relatedness to Cu ATPases, AO22 CopF may shown to interact synergistically and compensate each have a role in detoxifying cytoplasmic copper. other. Studies are required to assess a similar interplay The copG, copO, and copK genes were first described within between the two mer operons in strain AO22. the 21-gene cop cluster of pMOL30 of C. metallidurans With exceptions such as Tn5053 from Xanthomonas sp. CH34 [36]. The genes are highly up-regulated under and TnMERI1 from Bacillus megaterium [22, 25], most copper, but the physiological functions of their proteins are mercury resistance determinants of environmental isolates unconfirmed as yet. AO22 CopG and its homologs harbor are located on plasmids. Despite numerous attempts to a number of potential copper ligands (i.e., certain His, Met, isolate plasmids, none was found in AO22. However, the and Cys residues). The CGCC motif suggests they may possibility of a megaplasmid in AO22 that harbors TnAO22 function as chaperones that deliver copper ions to/from and mer2 cannot be ruled out, as it is often difficult to partner P-type ATPases, such as CopZ of E. hirae [37]. On isolate such plasmids owing to being very similar in size and the other hand, although a conserved CPLMHxxxH is noted physical properties to the main chromosome. For example, in CopO, its role is unknown. Based on pMOL30 CopO pMOL28 and pMOL30 of C. metallidurans CH34 are [31], these proteins may be located in the inner membrane conjugative, but their transfers were limited to close taxonomic and also serve as copper chaperones. The structure and groups [33]. Thus, further efforts to identify conjugative metal-binding properties of pMOL30 CopK have shed plasmids in AO22 should include strains of beta-proteobacteria some light on their roles. This CopK is periplasmic and (to which Achromobacter sp. AO22 belongs) as recipients. binds up to 2 Cu(I) per molecule [5], and binding of Cu(I) through four Met causes a conformational change, A Possible Genomic Island in AO22 probably leading to formation of the Cu(II)-binding site Amplifications of key regions and sequencing showed that involving a His [45]. However, equivalent properties of the the cop locus of strain AO22 is on a possible genomic AO22 CopK could not be predicted from alignments island, similar to the D. acidovorans SPH-1 DAGI-2 [52]. alone, as the Cu(I)-binding ligands were not conserved; This is highly interesting, considering the different geographic further work is required in this regard. origins of the two strains. However, genes in GIs are generally of foreign origin, indicating acquisition through Gene Regulation by CopRS horizontal transfer, and identical GIs are often identified in The AO22 CopS and CopR exhibit features of the histidine unrelated bacteria (e.g., CMGI-1 of C. metallidurans CH34 kinases and response regulators, respectively, of TCST is almost identical to the PAGI2-C island of a P. aeruginosa systems. In E. coli, pcoRS were shown to be essential for strain isolated from cystic fibrosis patients [32, 52]). The maximal copper-inducible expression from PpcoA [7], and presence of a Tn21-related transposon in AO22 reported cusRS essential for expression from PpcoE and PcusC. By by us earlier [39] supports such a possibility. The present analogy with other copper TCST systems, AO22 CopS results indicate the DAGI-2-like GIs may be ancient, more A SOIL BACTERIUM WITH COPPER AND MERCURY RESISTANCE OPERONS 752 widespread than expected, and may play a role in survival 10. Cooksey, D. A. 1993. Copper uptake and resistance in bacteria. of the host in contaminated environments. Besides the cop Mol. Microbiol. 7: 1-5. and mer loci, the DAGI-2 of SPH-1 encodes ars (arsenic 11. Deng, X. and D. B. Wilson. 2001. Bioaccumulation of mercury resistance), cd/pbr (cadmium/lead resistance) and sil (silver from wastewater by genetically engineered Escherichia coli. 56: - resistance) [52]; thus, it needs to be investigated whether Appl. Microbiol. Biotechnol. 276 279. 12. Diels, L., Q. Dong, D. van der Lelie, W. Baeyens, and M. such loci also occur in strain AO22. Exploring these will Mergeay. 1995. The czc operon of Alcaligenes eutrophus CH34: provide better understanding as to how Achromobacter From resistance mechanism to the removal of heavy metals. J. sp. strain AO22 has adapted to its heavy metal rich Ind. Microbiol. 14: 142-153. microenvironment. 13. Djoko, K. Y., Z. Xiao, D. L. Huffman, and A. G. Wedd. 2007. In conclusion, the present data provide insights into how Conserved mechanism of copper binding and transfer. A environmental bacteria may balance intracellular copper comparison of the copper-resistance proteins PcoC from Escherichia levels. The AO22 cop locus appears to encode systems for coli and CopC from Pseudomonas syringae. Inorg. Chem. 46: periplasmic handling as well as cytoplasmic detoxification, 4560-4568. under the regulation of a classical two-component signal 14. Djoko, K. Y., Z. Xiao, and A. G. Wedd. 2008. Copper resistance transduction system, and exhibits a potential copper- in E. coli: The multicopper oxidase PcoA catalyzes oxidation of I II 9: - responsive promoter. Achromobacter sp. AO22 thus has high copper(I) in Cu Cu -PcoC. ChemBioChem 1579 1582. 15. Dorsey, A. and L. Ingerman. 2004. Toxicology Profile for potential as a copper biosensor as well as for a biosoprtion Copper. Agency for Toxic Substances and Disease Registry. system for environmental samples. The presence of two 16. Figurski, D. H. and D. R. Helinski. 1979. Replication of an mer operons provides similar opportunities for mercury origin-containing derivative of plasmid RK2 dependent on a biosensor and detoxification systems. plasmid function provided in trans. Proc. Natl. Acad. Sci. USA 76: 1648-1652. 17. Forst, S., J. Delgado, and M. Inouye. 1989. Phosphorylation of REFERENCES OmpR by the osmosensor EnvZ modulates expression of the ompF and ompC genes in Escherichia coli. Proc. Natl. Acad. 1. Adaikkalam, V. and S. Swarup. 2005. Characterization of Sci. USA 86: 6052-6056. copABCD operon from a copper-sensitive Pseudomonas putida 18. Grass, G. and C. Rensing. 2001. CueO is a multi-copper oxidase strain. Can. J. Microbiol. 51: 209-216. that confers copper tolerance in Escherichia coli. Biochem. 2. Arnesano, F., L. Banci, I. Bertini, S. Mangani, and A. R. Biophys. Res. Commun. 286: 902-908. Thompsett. 2003. A redox switch in CopC: An intriguing 19. Gupta, A., K. Matsui, J. F. Lo, and S. Silver. 1999. Molecular copper trafficking protein that binds copper(I) and copper(II) at basis for resistance to silver cations in Salmonella. Nat. Med. 5: different sites. Proc. Natl. Acad. Sci. USA 100: 3814-3819. 183-188. 3. Barkay, T., S. M. Miller, and A. O. Summers. 2003. Bacterial 20. Harley, C. B. and R. P. Reynolds. 1987. Analysis of E. coli Mercury resistance from atoms to ecosystems. FEMS Microbiol. promoter sequences. Nucl. Acids Res. 15: 2343-2361. Rev. 27: 355-384. 21. Hettler, J., G. Irion, and B. Lehmann. 1997. Environmental 4. Basim, H., G. V. Minsavage, R. E. Stall, J.-F. Wang, S. Shanker, impact of mining waste disposal on a tropical lowland river and J. B. Jones. 2005. Characterisation of a unique chromosomal system: A case study on the Ok Tedi Mine, Papua New Guinea. copper resistance gene cluster from Xanthomonas campestris Mineral. Depos. 32: 280-291. pv. vesicatoria. Appl. Environ. Microbiol. 71: 8284-8291. 22. Huang, C.-C., M. Narita, T. Yamagata, Y. Itoh, and G. Endo. 5. Bersch, B., A. Favier, P. Schanda, S. van Aelst, T. Vallaeys, J. 1999. Structure analysis of a class II transposon encoding the Covès, et al. 2008. Molecular structure and metal-binding mercury resistance of the Gram-positive bacterium Bacillus properties of the periplasmic CopK protein expressed in megaterium MB1, a strain isolated from Minamata Bay, Japan. Cupriavidus metallidurans CH34 during copper challenge. J. Gene 234: 361-369. Mol. Biol. 380: 386-403. 23. Huffman, D. L., J. Huyett, F. W. Outten, P. E. Doan, L. A. 6. Bontidean, I., A. Mortari, S. Leth, N. L. Brown, U. Karlson, M. Finney, B. M. Hoffman, and T. V. O’Halloran. 2002. Spectroscopy M. Larsen, et al. 2004. Biosensors for detection of mercury in of Cu(II)-PcoC and the multicopper oxidase function of PcoA, contaminated soils. Environ. Pollut. 131: 255-262. two essential components of Escherichia coli pco copper resistance 7. Brown, N. L., S. R. Barrett, J. Camakaris, B. T. Lee, and D. A. operon. Biochemistry 41: 10046-10055. Rouch. 1995. Molecular genetics and transport analysis of the 24. Kataoka, K., H. Komori, Y. Ueki, Y. Konno, Y. Kamitaka, S. copper-resistance determinant (pco) from Escherichia coli Kurose, et al. 2007. Structure and function of the engineered plasmid pRJ1004. Mol. Microbiol. 17: 1153-1166. multicopper oxidase CueO from Escherichia coli - deletion of 8. Cha, J. S. and D. A. Cooksey. 1991. Copper resistance in the methionine-rich helical region covering the substrate-binding Pseudomonas syringae mediated by periplasmic and outer site. J. Mol. Biol. 373: 141-152. membrane proteins. Proc. Natl. Acad. Sci. USA 88: 8915-8919. 25. Kholodii, G., O. V. Yurieva, O. L. Lomovskaya, Z. Gorlenko, S. 9. Chen, S., E. Kim, M. L. Shuler, and D. B. Wilson. 1998. Hg2+ Z. Mindlin, and V. G. Nikiforov. 1993. Tn5053, a mercury removal by genetically engineered Escherichia coli in a hollow resistance transposon with integron’s ends. J. Mol. Biol. 230: fiber bioreactor. Biotechnol. Prog. 14: 667-671. 1103-1107. 753 Ng et al.

26. Lee, S. M., G. Grass, C. Rensing, S. R. Barrett, C. J. Yates, J. V. 40. Outten, F. W., D. L. Huffman, J. A. Hale, and T. V. O’Halloran. Stoyanov, and N. L. Brown. 2002. The Pco proteins are 2001. The independent cue and cus systems confer copper involved in periplasmic copper handling in Escherichia coli. tolerance during aerobic and anaerobic growth in Escherichia Biochem. Biophys. Res. Commun. 295: 616-620. coli. J. Biol. Chem. 276: 30670-30677. 27. Lee, Y. A., M. Hendson, N. J. Panopoulos, and M. N. Schroth. 41. Park, H., S. K. Saha, and M. Inouye. 1998. Two-domain 1994. Molecular cloning, chromosomal mapping, and sequence reconstitution of a functional protein histidine kinase. Proc. analysis of copper resistance genes from Xanthomonas campestris Natl. Acad. Sci. USA 95: 6728-6732. pv. juglandis: Homology with small blue copper proteins and 42. Rensing, C., B. Fan, R. Sharma, B. Mitra, and B. P. Rosen. multicopper oxidase. J. Bacteriol. 176: 173-188. 2000. CopA: An Escherichia coli Cu(I)-translocating P-type 28. Leedjarv, A., A. Ivask, and M. Virta. 2008. Interplay of ATPase. Proc. Natl. Acad. Sci. USA 97: 652-656. different transporters in the mediation of divalent heavy metal 43. Rensing, C. and G. Grass. 2003. Escherichia coli mechanisms resistance in Pseudomonas putida KT2440. J. Bacteriol. 190: of copper homeostasis in a changing environment FEMS 2680-2689. Microbiol. Rev. 27: 197-213. 29. Lim, C. K. and D. A. Cooksey. 1993. Characterization of 44. Rouch, D. A. and N. L. Brown. 1997. Copper-inducible chromosomal homologs of the plasmid-borne copper resistance transcriptional regulation at two promoters in the Escherichia operon of Pseudomonas syringae. J. Bacteriol. 175: 4492-4498. coli copper resistance determinant pco. Microbiology 143: 30. Mellano, M. A. and D. A. Cooksey. 1988. Nucleotide sequence 1191-1202. and organization of copper resistance genes from Pseudomonas 45. Sarret, G., A. Favier, J. Coves, J.-L. Hazemann, M. Mergeay, syringae pv. tomato. J. Bacteriol. 170: 2879-2883. and B. Bersch. 2010. CopK from Cupriavidus metallidurans 31. Mergeay, M., S. Monchy, P. Janssen, R. Houdt, and N. Leys. CH34 binds Cu(I) in a tetrathioether site: Characterization by 2009. Megaplasmids in Cupriavidus genus and metal resistance, X-ray absorption and NMR spectroscopy. J. Am. Chem. Soc. pp. 209-238. In E. Schwartz (ed.). Microbial Megaplasmids. 132: 3770-3777. Springer, Berlin. 46. Schleheck, D., T. P. Knepper, K. Fischer, and A. M. Cook. 32. Mergeay, M., S. Monchy, T. Vallaeys, V. Auquier, A. 2004. Mineralisation of individual congeners of linear Benotmane, P. Bertin, et al. 2003. Ralstonia metallidurans, a alkylbenzenesulfonate by defined pairs of heterotrophic bacteria. bacterium specifically adapted to toxic metals: Towards a catalogue Appl. Environ. Microbiol. 70: 4053-4063. of metal-responsive genes. FEMS Microbiol. Rev. 27: 385-410. 47. Solioz, M. and A. Odermatt. 1995. Copper and silver transport 33. Mergeay, M., D. Nies, H. G. Schlegel, J. Gerits, P. Charles, and by CopB-ATPase in membrane vesicles of Enterococcus hirae. F. Van Gijsegem. 1985. Alcaligenes eutrophus CH34 is a J. Biol. Chem. 270: 9217-9221. facultative chemolithotroph with plasmid-bound resistance to 48. Stock, A. M., J. M. Mottonen, J. B. Stock, and C. E. Schutt. heavy metals. J. Bacteriol. 162: 328-334. 1989. Three-dimensional structure of CheY, the response regulator 34. Messerschmidt, A., R. Ladenstein, R. Huber, M. Bolognesi, L. of bacterial chemotaxis. Nature 337: 745-749. Avigliano, R. Petruzzelli, et al. 1992. Refined crystal structure 49. Teitzel, G. M. and M. R. Parsek. 2003. Heavy metal resistance of ascorbate oxidase at 1.9 Å resolution. J. Mol. Biol. 224: of biofilm and planktonic Pseudomonas aeruginosa. Appl. 179-205. Environ. Microbiol. 69: 2313-2320. 35. Mills, S. D., C. K. Lim, and D. A. Cooksey. 1994. Purification 50. Teixeira, E. C., J. C. Franco de Oliveira, M. T. Marques Novo, and characterization of CopR, a transcriptional activator protein and M. C. Bertolini. 2008. The copper resistance operon copAB that binds to a conserved domain (cop box) in copper-inducible from Xanthomonas axonopodis pathovar citri: Gene inactivation promoters of Pseudomonas syringae. Mol. Gen. Genet. 244: results in copper sensitivity. Microbiology 154: 402-412. 341-351. 51. Trajanovska, S., M. L. Britz, and M. Bhave. 1997. Detection of 36. Monchy, S., M. A. Benotmane, R. Wattiez, S. van Aelst, V. heavy metal ion resistance genes in Gram-positive and Gram- Auquier, B. Borremans, et al. 2006. Transcriptomic and negative bacteria isolated from a lead-contaminated site. proteomic analyses of the pMOL30-encoded copper resistance Biodegradation 8: 113-124. in Cupriavidus metallidurans strain CH34. Microbiology 152: 52. Van Houdt, R., S. Monchy, N. Leys, and M. Mergeay. 2009. 1765-1776. New mobile genetic elements in Cupriavidus metallidurans 37. Multhaup, G., D. Strausak, K.-D. Bissig, and M. Solioz. 2001. CH34, their possible roles and occurrence in other bacteria. Interaction of the CopZ copper chaperone with the CopA copper Antonie Van Leeuwenhoek 96: 205-226. ATPase of Enterococcus hirae assessed by surface plasmon 53. Voloudakis, A. E., T. M. Reignier, and D. A. Cooksey. 2005. resonance. Biochem. Biophys. Res. Commun. 288: 172-177. Regulation of resistance to copper in Xanthomonas axonopodis 38. Munson, G. P., D. L. Lam, F. W. Outten, and T. V. O’Halloran. pv. vesicatoria. Appl. Environ. Microbiol. 71: 782-789. 2000. Identification of a copper-responsive two-component system 54. Yamamoto, K. and A. Ishihama. 2005. Transcriptional response on the chromosome of Escherichia coli K-12. J. Bacteriol. 182: of Escherichia coli to external copper. Mol. Microbiol. 56: 5864-5871. 215-227. 39. Ng, S. P., B. Davis, E. A. Palombo, and M. Bhave. 2009. A 55. Zhang, L., M. Koay, M. J. Maher, Z. Xiao, and A. G. Wedd. Tn5051-like mer-containing transposon identified in a heavy 2006. Intermolecular transfer of copper ions from the CopC metal tolerant strain Achromobacter sp. AO22. BMC Res. Notes protein of Pseudomonas syringae. Crystal structures of fully 2: 38. loaded CuICuII forms. J. Am. Chem. Soc. 128: 5834-5850.