DOCSLIB.ORG

Mammalian Transcription Factor a Is a Core Component of the Mitochondrial Transcription Machinery

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mammalian Transcription Factor a Is a Core Component of the Mitochondrial Transcription Machinery Mammalian transcription factor A is a core component of the mitochondrial transcription machinery Yonghong Shia,b, Anke Dierckxc, Paulina H. Wanrooija,b, Sjoerd Wanrooija, Nils-Göran Larssonb,d, L. Marcus Wilhelmssonc, Maria Falkenberga,1, and Claes M. Gustafssona,1 aDepartment of Medical Biochemistry and Cell Biology, University of Gothenburg, SE-405 30 Gothenburg, Sweden; bDivision of Metabolic Diseases, Karolinska Institutet, 171 77 Stockholm, Sweden; cDepartment of Chemical and Biological Engineering/Physical Chemistry, Chalmers University of Technology, S-41296 Gothenburg, Sweden; and dMax Planck Institute for Biology of Ageing, D-50931 Cologne, Germany Edited by Alan R. Fersht, Medical Research Council Laboratory of Molecular Biology, Cambridge, United Kingdom, and approved August 30, 2012 (received for review December 1, 2011) Transcription factor A (TFAM) functions as a DNA packaging factor in TFAM is required to recruit POLRMT/TFB2M to LSP, and mammalian mitochondria. TFAM also binds sequence-specifically to mutations in the TFAM high-affinity binding site abolish pro- sites immediately upstream of mitochondrial promoters, but there moter-specific transcription (14, 17). The exact distance between are conflicting data regarding its role as a core component of the the specific TFAM binding site and the LSP transcription start site mitochondrial transcription machinery. We here demonstrate that is important for promoter function (17), and there may be direct TFAM is required for transcription in mitochondrial extracts as well as physical interactions between the C-terminal domain of TFAM in a reconstituted in vitro transcription system. The absolute re- and the other components of the mitochondrial transcription quirement of TFAM can be relaxed by conditions that allow DNA machinery (18). X-ray structural studies have revealed that TFAM breathing, i.e., low salt concentrations or negatively supercoiled bound to LSP induces a dramatic U-turn in DNA and places the DNA templates. The situation is thus very similar to that described in C-terminal tail of TFAM next to the transcription start site, where nuclear RNA polymerase II-dependent transcription, in which the POLRMT and TFB2M are expected to bind (19, 20). Collectively, free energy of supercoiling can circumvent the need for a subset of these observations support a model in which TFAM interacts with basal transcription factors at specific promoters. In agreement with the other components of the mitochondrial transcription ma- these observations, we demonstrate that TFAM has the capacity to chinery and recruits them to a precise position at the promoter. BIOCHEMISTRY induce negative supercoils in DNA, and, using the recently developed A recent study questioned the importance of TFAM for tran- O– fi nucleobase analog FRET-pair tC tCnitro,we nd that TFAM distorts scription initiation using a reconstituted in vitro transcription fi fi signi cantly the DNA structure. Our ndings differ from recent system and suggested that POLRMT and TFB2M could initiate observations reporting that TFAM is not a core component of the promoter-specific transcription in the absence of TFAM (21). fi mitochondrial transcription machinery. Instead, our ndings support This finding led to the conclusion that mitochondrial transcrip- a model in which TFAM is absolutely required to recruit the transcrip- tion is a two-component system also in higher cells, much similar tion machinery during initiation of transcription. to the situation in yeast. However, this model is not easy to rec- oncile with findings from other laboratories that have demon- he mtDNA is a double-stranded circular molecule that enc- strated that TFAM is an essential mammalian transcription factor Todes 22 tRNAs, 2 rRNAs, and 13 subunits of the respiratory both in vivo and in vitro (6, 15, 22). We here investigate the role of chain. Transcription is initiated from two sites, the light- and TFAM for transcription initiation in a defined in vitro system. We heavy-strand promoters (LSP and HSP1, respectively), and pro- find that the requirement for TFAM can be relaxed if conditions ceeds to produce near genome-length polycistronic transcripts, are chosen that allow for promoter breathing, i.e., low salt con- which are subsequently processed to generate the individual RNA centrations or negatively supercoiled DNA templates. The situ- molecules (1). Transcription from LSP also produces the RNA ation is thus similar to what has been described in nuclear primers required for initiation of mtDNA replication at the origin transcription where the need for the basal transcription factors of the heavy strand (2–4). In vivo experiments have identified TFIIE, TFIIF, and TFIIH can be circumvented by the free energy a second transcription initiation site (HSP2) downstream of of supercoiling (23). Our findings reconcile findings in the field HSP1, but the sequence requirements of this promoter remain to and firmly establish TFAM as a basal transcription factor. be defined (5, 6). In budding yeast, the basic machinery for mtDNA transcrip- Results tion consists only of two factors: the mitochondrial RNA poly- TFAM-Depleted Mitochondrial Extracts Cannot Initiate Transcription. merase (Rpo41) and its accessory factor Mtf1, also denoted We first investigated if TFAM is required for transcription from sc-mtTFB (1). In mammalian cells, it has been reported that the HSP1 and LSP promoters in mitochondrial extracts (Fig. 1A). mitochondrial transcription also requires the transcription factor To this end, we used antibodies to immunodeplete TFAM from A (TFAM), a high-mobility group-box (HMG) protein (7, 8). transcriptionally active mitochondrial extracts. Immunoblotting TFAM plays a role as an mtDNA packaging factor that can bind, analysis demonstrated that TFAM could be efficiently depleted, wrap, and bend DNA in a non–sequence-specific manner (9–12). whereas the levels of POLRMT and TFB2M remained unchanged TFAM also binds sequence-specifically to sites upstream (−15 to −35) of the HSP1 and LSP transcription start sites (13, 14). The human mitochondrial RNA polymerase (POLRMT) is distantly Author contributions: Y.S., A.D., N.-G.L., L.M.W., M.F., and C.M.G. designed research; Y.S., related to the bacteriophage T7 RNA polymerase and has the A.D., L.M.W., and M.F. performed research; Y.S., P.H.W., and S.W. contributed new re- agents/analytic tools; Y.S., A.D., L.M.W., M.F., and C.M.G. analyzed data; and Y.S., A.D., capacity to recognize promoter elements (14). In combination, P.H.W., S.W., N.-G.L., L.M.W., M.F., and C.M.G. wrote the paper. POLRMT, TFAM, and the mammalian Mtf1 homolog TFB2M The authors declare no conflict of interest. can initiate transcription from a promoter-containing DNA This article is a PNAS Direct Submission. fragment in vitro (15). TFB2M forms a heterodimeric complex 1To whom correspondence may be addressed. E-mail: [email protected] or with POLRMT and interacts directly with the priming substrate, [email protected]. indicating that TFB2M acts as a transient component of the This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. catalytic site of the transcription initiation complex (16). 1073/pnas.1119738109/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1119738109 PNAS Early Edition | 1of6 Downloaded by guest on October 1, 2021 A run-off transcription on linearized DNA templates containing HSP1, LSP, or both HSP1 and LSP (Fig. 2A). Indeed, in the HSP1 CCCAGCACACACACACCGCTGCTAACCCCATACCCCGAACCAACCAAACCCCAAAGACACCCGCCACAGTTTA* presence of 5 mM MgCl2 and low levels of NaCl (4 mM), our transcription system generated run-off transcription products in * LSP GGGGAAAATAATGTGTTAGTTGGGGGGTGACTGTTAAAAGTGCATACCGCCAAAAGATAAAATTTGAAATCTG the absence of TFAM (Fig. 2A, lane 1). In agreement with results published by others (21), the highest levels of TFAM-independent B mt extract + + + C mt extract - ++++ transcription were observed at HSP1, whereas relatively low levels Prot A beads - + + Prot A beads - - +++ of LSP transcription were seen in the absence of TFAM. In- TFAM Ab + - - TFAM Ab - - - ++ terestingly, a gradual increase of NaCl concentrations led to the POLRMT TFAM + - --+ inhibition of promoter-specific transcription (Fig. 2A, lanes 1–5). POLRMT/B2 + - --- TFB2M The levels of both LSP and HSP1 transcription dropped signifi- LSP RO cantly at 12 mM NaCl, and the reactions were almost completely TFAM inhibited in the presence of 24 mM NaCl. When TFAM was added to the reactions, we obtained markedly different results (Fig. 2A, D HSP RO HSP1 LSP lanes 6–10). Importantly, the transcription reactions gave sub- WT MUT WT MUT 1 2 3 4 5 stantially higher levels of run-off products in the presence of TFAM --+ +++ TFAM, even at very low salt concentrations (Fig. 2A, compare lanes 1 and 6). Note that the depicted gel images in Fig. 2A, right LSP RO hand column, are overexposed on purpose, because we wanted to use the same exposure time for all of the experiments to allow for HSP1 RO a direct comparison of the efficiency of promoter-dependent LSP PT transcription in the presence and absence of TFAM. Furthermore, the TFAM-containing transcription reactions remained un- Fig. 1. TFAM is required for HSP1 and LSP transcription in mitochondrial affected by increasing amounts of NaCl added. The transcription extracts. (A) Sequences of the HSP1 and LSP promoters. The TFAM binding yield was similar at 4 and 48 mM NaCl (Fig. 2A, compare lanes 6 sites (13, 14) are underlined. The boxed sequences were mutated to in- and 10), and we could not observe a clear effect on transcription activate TFAM-dependent transcription. (B) Immunodepletion of TFAM from B mitochondrial extracts. Immunoblotting against the indicated proteins levels until NaCl concentrations were above 100 mM (Fig. 2 ). demonstrates that POLRMT and TFB2M levels remained unaffected. (C) Run- DNA is not a static structure. Because the negatively charged off transcription in mitochondrial extracts was monitored using run-off phosphates of the DNA backbone repel each other, the double transcription on linearized templates containing HSP1 or LSP.
Load more

Recommended publications
  • Mitochondrial Transcription Factor a Promotes DNA Strand Cleavage at Abasic Sites
    Mitochondrial transcription factor A promotes DNA strand cleavage at abasic sites Wenyan Xu (许文彦)a,1, Riley M. Boyda,1, Maya O. Treea, Faris Samkaria, and Linlin Zhaoa,b,2,3 aDepartment of Chemistry and Biochemistry, Central Michigan University, Mount Pleasant, MI 48859; and bBiochemistry, Cellular, and Molecular Biology Graduate Program, Central Michigan University, Mount Pleasant, MI 48859 Edited by Rafael Radi, Universidad de la Republica, Montevideo, Uruguay, and approved July 18, 2019 (received for review July 2, 2019) In higher eukaryotic cells, mitochondria are essential subcellular damage in cells (13, 14). Within mitochondria, AP lesions are organelles for energy production, cell signaling, and the biosynthesis also abundant and can number in the hundreds per cell, con- of biomolecules. The mitochondrial DNA (mtDNA) genome is in- sidering their steady-state level (0.2 to 3 AP sites per 105 bp) (15, dispensable for mitochondrial function because it encodes protein 16) and the number of mtDNA copies per cell (∼1,000) (17). subunits of the electron transport chain and a full set of transfer and Importantly, AP sites are chemically labile and reactive and can ribosomal RNAs. MtDNA degradation has emerged as an essential lead to secondary DNA damage such as DNA single-strand quality control measure to maintain mtDNA and to cope with mtDNA breaks (SSBs), DNA–DNA interstrand cross-links, and DNA– damage resulting from endogenous and environmental factors. protein cross-links (DPCs) (18–23). If not repaired, AP sites Among all types of DNA damage known, abasic (AP) sites, sourced and their derivatives are mutagenic in the nuclear genome (24– from base excision repair and spontaneous base loss, are the most 26); however, the understanding of the biological consequence of abundant endogenous DNA lesions in cells.
    [Show full text]
  • Transcription from the Second Heavy-Strand Promoter of Human Mtdna Is Repressed by Transcription Factor a in Vitro
    Transcription from the second heavy-strand promoter of human mtDNA is repressed by transcription factor A in vitro Maria F. Lodeiroa, Akira Uchidaa, Megan Bestwickb, Ibrahim M. Moustafaa, Jamie J. Arnolda, Gerald S. Shadelb,c, and Craig E. Camerona,1 aDepartment of Biochemistry and Molecular Biology, Pennsylvania State University, University Park, PA 16802; bDepartment of Pathology, Yale University School of Medicine, New Haven, CT 06520; and cDepartment of Genetics, Yale University School of Medicine, New Haven, CT 06520 Edited* by Douglas C. Wallace, Center for Mitochondrial and Epigenomic Medicine (CMEM), Children’s Hospital of Philadelphia, Philadelphia, PA, and approved March 8, 2012 (received for review November 15, 2011) Cell-based studies support the existence of two promoters on the factor B2 (TFB2M). The long-standing paradigm was that TFAM heavy strand of mtDNA: heavy-strand promoter 1 (HSP1) and HSP2. binds to a site in the promoter upstream of the transcription start However, transcription from HSP2 has been reported only once in site and recruits a complex POLRMT/TFB2M by an interaction of a cell-free system, and never when recombinant proteins have been the carboxyl-terminal tail of TFAM with TFB2M (3). However, we used. Here, we document transcription from HSP2 using an in vitro recently showed that basal mitochondrial transcription is not ab- system of defined composition. An oligonucleotide template repre- solutely dependent on TFAM (4). This observation suggested that senting positions 596–685 of mtDNA was sufficient to observe tran- the two-component transcription system found in lower eukaryotes scription by the human mtRNA polymerase (POLRMT) that was had acquired an additional layer of regulation in mammals that is absolutely dependent on mitochondrial transcription factor B2 mediated by TFAM (4).
    [Show full text]
  • Analysis of Trans Esnps Infers Regulatory Network Architecture
    Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Anat Kreimer All rights reserved ABSTRACT Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer eSNPs are genetic variants associated with transcript expression levels. The characteristics of such variants highlight their importance and present a unique opportunity for studying gene regulation. eSNPs affect most genes and their cell type specificity can shed light on different processes that are activated in each cell. They can identify functional variants by connecting SNPs that are implicated in disease to a molecular mechanism. Examining eSNPs that are associated with distal genes can provide insights regarding the inference of regulatory networks but also presents challenges due to the high statistical burden of multiple testing. Such association studies allow: simultaneous investigation of many gene expression phenotypes without assuming any prior knowledge and identification of unknown regulators of gene expression while uncovering directionality. This thesis will focus on such distal eSNPs to map regulatory interactions between different loci and expose the architecture of the regulatory network defined by such interactions. We develop novel computational approaches and apply them to genetics-genomics data in human. We go beyond pairwise interactions to define network motifs, including regulatory modules and bi-fan structures, showing them to be prevalent in real data and exposing distinct attributes of such arrangements. We project eSNP associations onto a protein-protein interaction network to expose topological properties of eSNPs and their targets and highlight different modes of distal regulation.
    [Show full text]
  • Mitochondrial Dysfunction in Sepsis Is Associated with Diminished
    www.nature.com/scientificreports OPEN Mitochondrial dysfunction in sepsis is associated with diminished intramitochondrial TFAM despite its increased cellular expression Tim Rahmel 1*, Britta Marko1, Hartmuth Nowak1, Lars Bergmann1, Patrick Thon1, Katharina Rump1, Sebastian Kreimendahl2, Joachim Rassow2, Jürgen Peters3, Mervyn Singer4, Michael Adamzik1,5 & Björn Koos1,5 Sepsis is characterized by a dysregulated immune response, metabolic derangements and bioenergetic failure. These alterations are closely associated with a profound and persisting mitochondrial dysfunction. This however occurs despite increased expression of the nuclear-encoded transcription factor A (TFAM) that normally supports mitochondrial biogenesis and functional recovery. Since this paradox may relate to an altered intracellular distribution of TFAM in sepsis, we tested the hypothesis that enhanced extramitochondrial TFAM expression does not translate into increased intramitochondrial TFAM abundance. Accordingly, we prospectively analyzed PBMCs both from septic patients (n = 10) and lipopolysaccharide stimulated PBMCs from healthy volunteers (n = 20). Extramitochondrial TFAM protein expression in sepsis patients was 1.8-fold greater compared to controls (p = 0.001), whereas intramitochondrial TFAM abundance was approximate 80% less (p < 0.001). This was accompanied by lower mitochondrial DNA copy numbers (p < 0.001), mtND1 expression (p < 0.001) and cellular ATP content (p < 0.001) in sepsis patients. These fndings were mirrored in lipopolysaccharide stimulated PBMCs taken from healthy volunteers. Furthermore, TFAM- TFB2M protein interaction within the human mitochondrial core transcription initiation complex, was 74% lower in septic patients (p < 0.001). In conclusion, our fndings, which demonstrate a diminished mitochondrial TFAM abundance in sepsis and endotoxemia, may help to explain the paradox of lacking bioenergetic recovery despite enhanced TFAM expression.
    [Show full text]
  • Cytotoxic Effects and Changes in Gene Expression Profile
    Toxicology in Vitro 34 (2016) 309–320 Contents lists available at ScienceDirect Toxicology in Vitro journal homepage: www.elsevier.com/locate/toxinvit Fusarium mycotoxin enniatin B: Cytotoxic effects and changes in gene expression profile Martina Jonsson a,⁎,MarikaJestoib, Minna Anthoni a, Annikki Welling a, Iida Loivamaa a, Ville Hallikainen c, Matti Kankainen d, Erik Lysøe e, Pertti Koivisto a, Kimmo Peltonen a,f a Chemistry and Toxicology Research Unit, Finnish Food Safety Authority (Evira), Mustialankatu 3, FI-00790 Helsinki, Finland b Product Safety Unit, Finnish Food Safety Authority (Evira), Mustialankatu 3, FI-00790 Helsinki, c The Finnish Forest Research Institute, Rovaniemi Unit, P.O. Box 16, FI-96301 Rovaniemi, Finland d Institute for Molecular Medicine Finland (FIMM), University of Helsinki, P.O. Box 20, FI-00014, Finland e Plant Health and Biotechnology, Norwegian Institute of Bioeconomy, Høyskoleveien 7, NO -1430 Ås, Norway f Finnish Safety and Chemicals Agency (Tukes), Opastinsilta 12 B, FI-00521 Helsinki, Finland article info abstract Article history: The mycotoxin enniatin B, a cyclic hexadepsipeptide produced by the plant pathogen Fusarium,isprevalentin Received 3 December 2015 grains and grain-based products in different geographical areas. Although enniatins have not been associated Received in revised form 5 April 2016 with toxic outbreaks, they have caused toxicity in vitro in several cell lines. In this study, the cytotoxic effects Accepted 28 April 2016 of enniatin B were assessed in relation to cellular energy metabolism, cell proliferation, and the induction of ap- Available online 6 May 2016 optosis in Balb 3T3 and HepG2 cells. The mechanism of toxicity was examined by means of whole genome ex- fi Keywords: pression pro ling of exposed rat primary hepatocytes.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Mitochondria Turnover and Lysosomal Function in Hematopoietic Stem Cell Metabolism
    International Journal of Molecular Sciences Review Mitochondria Turnover and Lysosomal Function in Hematopoietic Stem Cell Metabolism Makiko Mochizuki-Kashio 1, Hiroko Shiozaki 2, Toshio Suda 3,4 and Ayako Nakamura-Ishizu 1,* 1 Microanatomy and Developmental Biology, Tokyo Women’s Medical University, 8-1 Kawadacho, Shinjuku-ku, Tokyo 162-8666, Japan; [email protected] 2 Department of Hematology, Tokyo Women’s Medical University, 8-1 Kawadacho, Shinjuku-ku, Tokyo 162-8666, Japan; [email protected] 3 Cancer Science Institute, National University of Singapore, 14 Medical Drive, MD6, Singapore 117599, Singapore; [email protected] 4 International Research Center for Medical Sciences, Kumamoto University, 2-2-1 Honjo, Chuo-ku, Kumamoto City 860-0811, Japan * Correspondence: [email protected] Abstract: Hematopoietic stem cells (HSCs) reside in a hypoxic microenvironment that enables glycolysis-fueled metabolism and reduces oxidative stress. Nonetheless, metabolic regulation in organelles such as the mitochondria and lysosomes as well as autophagic processes have been implicated as essential for the determination of HSC cell fate. This review encompasses the current understanding of anaerobic metabolism in HSCs as well as the emerging roles of mitochondrial metabolism and lysosomal regulation for hematopoietic homeostasis. Keywords: hematopoietic stem cells; ROS; mitochondria; lysosome; autophagy; folliculin Citation: Mochizuki-Kashio, M.; Shiozaki, H.; Suda, T.; Nakamura-Ishizu, A. Mitochondria 1. Introduction Turnover and Lysosomal Function in Hematopoietic cells consist of a heterogenous group of cells originating from hematopoi- Hematopoietic Stem Cell Metabolism. etic stem cells (HSCs) [1]. HSCs differentiate into multi-potent progenitor cells (MPPs) Int. J. Mol. Sci. 2021, 22, 4627.
    [Show full text]
  • Cross-Strand Binding of TFAM to a Single Mtdna Molecule Forms the Mitochondrial Nucleoid
    Cross-strand binding of TFAM to a single mtDNA molecule forms the mitochondrial nucleoid Christian Kukata,b,1, Karen M. Daviesc,1, Christian A. Wurmd,1, Henrik Spåhra, Nina A. Bonekampa, Inge Kühla, Friederike Joosc, Paola Loguercio Polosae, Chan Bae Parka,f, Viktor Posseg, Maria Falkenbergg, Stefan Jakobsd,h, Werner Kühlbrandtc, and Nils-Göran Larssona,i,2 aDepartment of Mitochondrial Biology, Max Planck Institute for Biology of Ageing, 50931 Cologne, Germany; bFACS & Imaging Core Facility, Max Planck Institute for Biology of Ageing, 50931 Cologne, Germany; cDepartment of Structural Biology, Max Planck Institute of Biophysics, 60438 Frankfurt am Main, Germany; dDepartment of NanoBiophotonics, Max Planck Institute for Biophysical Chemistry, 37077 Göttingen, Germany; eDepartment of Biosciences, Biotechnologies and Biopharmaceutics, University of Bari Aldo Moro, 70125 Bari, Italy; fInstitute for Medical Sciences, Ajou University School of Medicine, Suwon 443-721, Korea; gDepartment of Medical Biochemistry and Cell Biology, University of Gothenburg, 405 30 Gothenburg, Sweden; hDepartment of Neurology, University of Göttingen Medical School, 37073 Göttingen, Germany; and iDepartment of Laboratory Medicine, Karolinska Institutet, 171 77 Stockholm, Sweden Edited by F. Ulrich Hartl, Max Planck Institute of Biochemistry, Martinsried, Germany, and approved August 4, 2015 (received for review June 23, 2015) Mammalian mitochondrial DNA (mtDNA) is packaged by mito- To date, mitochondrial transcription factor A (TFAM) is the chondrial transcription factor A (TFAM) into mitochondrial nucle- only protein that fulfills a stringent definition of a structural oids that are of key importance in controlling the transmission and component that packages mtDNA in the mammalian nucleoid expression of mtDNA. Nucleoid ultrastructure is poorly defined, (8).
    [Show full text]
  • The Tumor Suppressor Folliculin Regulates AMPK-Dependent Metabolic Transformation Ming Yan,1,2 Marie-Claude Gingras,1,2 Elaine A
    Downloaded on April 29, 2014. The Journal of Clinical Investigation. More information at www.jci.org/articles/view/71749 Research article The tumor suppressor folliculin regulates AMPK-dependent metabolic transformation Ming Yan,1,2 Marie-Claude Gingras,1,2 Elaine A. Dunlop,3 Yann Nouët,1,2 Fanny Dupuy,1,4 Zahra Jalali,1,2 Elite Possik,1,2 Barry J. Coull,5 Dmitri Kharitidi,1,2 Anders Bondo Dydensborg,1,2 Brandon Faubert,1,4 Miriam Kamps,5 Sylvie Sabourin,1,2 Rachael S. Preston,3 David Mark Davies,3 Taren Roughead,1,2 Laëtitia Chotard,1,2 Maurice A.M. van Steensel,5 Russell Jones,1,4 Andrew R. Tee,3 and Arnim Pause1,2 1Goodman Cancer Research Center and 2Department of Biochemistry, McGill University, Montréal, Québec, Canada. 3Institute of Cancer and Genetics, Cardiff University, Cardiff, Wales, United Kingdom. 4Department of Physiology, McGill University, Montréal, Québec, Canada. 5Department of Dermatology, Maastricht University, Maastricht, The Netherlands. The Warburg effect is a tumorigenic metabolic adaptation process characterized by augmented aerobic gly- colysis, which enhances cellular bioenergetics. In normal cells, energy homeostasis is controlled by AMPK; however, its role in cancer is not understood, as both AMPK-dependent tumor-promoting and -inhibiting functions were reported. Upon stress, energy levels are maintained by increased mitochondrial biogenesis and glycolysis, controlled by transcriptional coactivator PGC-1α and HIF, respectively. In normoxia, AMPK induces PGC-1α, but how HIF is activated is unclear. Germline mutations in the gene encoding the tumor suppressor folliculin (FLCN) lead to Birt-Hogg-Dubé (BHD) syndrome, which is associated with an increased cancer risk.
    [Show full text]
  • Blood-Derived Mitochondrial DNA Copy Number Is Associated with Gene Expression Across Multiple
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.17.209023; this version posted July 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Blood-derived mitochondrial DNA copy number is associated with gene expression across multiple 2 tissues and is predictive for incident neurodegenerative disease 3 4 Stephanie Y. Yang1, Christina A. Castellani1, Ryan J. Longchamps1, Vamsee K. Pillalamarri1, Brian 5 O’Rourke2, Eliseo Guallar3, Dan E. Arking1,2 6 7 8 1McKusick-Nathans Department of Genetic Medicine, Johns Hopkins University School of Medicine, 9 Baltimore, MD 10 2Division of Cardiology, Department of Medicine, Johns Hopkins University School of Medicine, 11 Baltimore, MD 12 3Departments of Epidemiology and Medicine, and Welch Center for Prevention, Epidemiology, and 13 Clinical Research, Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD 14 15 Email addresses: 16 [email protected] 17 [email protected] 18 [email protected] 19 [email protected] 20 [email protected] 21 [email protected] 22 [email protected] 23 24 25 26 27 28 29 30 31 32 33 34 35 *Correspondence and address for reprints to: 36 Dan E. Arking, Ph.D. 37 Johns Hopkins University School of Medicine 38 733 N Broadway Ave 39 Miller Research Building Room 459 40 Baltimore, MD 21205 41 (410) 502-4867 (ph) 42 [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.17.209023; this version posted July 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Investigation of the Folliculin (Flcn) Tumor Suppressor Gene in Energy Metabolism Ming Yan Department of Biochemistry Mcgill
    Investigation of the Folliculin (Flcn) tumor suppressor gene in energy metabolism Ming Yan Department of Biochemistry McGill University Montréal, Canada Dec., 2015 A thesis submitted to McGill University in partial fulfillment of the requirements for the degree of Doctor of Philosophy. © Ming Yan, 2015 ABSTRACT Birt–Hogg–Dubé (BHD) syndrome is an autosomal dominant hereditary disorder characterized by skin fibrofolliculomas, lung cyst, spontaneous pneumothorax and renal cell carcinoma (RCC). This condition is caused by germline mutations of folliculin (Flcn) gene, which encodes a 64-kDa protein named folliculin (FLCN). The AMP-actived protein kinase (AMPK) is a master regulator of cellular energy homeostasis. FLCN interacts with AMPK through FLCN-interacting proteins (FNIP1/2). Molecular function of FLCN and how FLCN interacts with AMPK in energy metabolism are largely unknown. We used mouse embryonic fibroblasts (MEFs) and adipose specific Flcn knockout mouse model to investigate the role of Flcn and its function associated with AMPK in energy metabolism. We found that loss of FLCN constitutively activates AMPK, which in turn leads to elevation in peroxisome proliferator-activated receptor gama coactivator 1 α (PGC-1α), which mediates mitochondrial biogenesis and increase reactive oxygen species (ROS) production. Elevated ROS induces hypoxia-inducible factor (HIF) transcriptional activity and drives Warburg metabolic reprogramming. These findings indicate that Flcn exert tumor suppressor activity by acting as a negative regulator of AMPK-dependent HIF activation and Warburg effect. To investigate the potential role of FLCN/AMPK/ PGC-1α in fat metabolism, we generated an adipose-specific Flcn knockout mouse model. Flcn KO mice exhibit elevated energy expenditure associated with increased O2 consumption, and are protected from diet-induced obesity.
    [Show full text]
  • LONP1 Is Required for Maturation of a Subset of Mitochondrial Proteins and Its Loss Elicits
    bioRxiv preprint doi: https://doi.org/10.1101/306316; this version posted April 23, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. LONP1 is required for maturation of a subset of mitochondrial proteins and its loss elicits an integrated stress response Olga Zurita Rendón and Eric A. Shoubridge. Montreal Neurological Institute and Department of Human Genetics, McGill University, Montreal, QC, Canada. Eric A. Shoubridge, Montreal Neurological Institute, 3801 University Street, Montreal, Quebec, Canada H3A 2B4 Email: [email protected] Tel: 514-398-1997 FAX: 514-398-1509 bioRxiv preprint doi: https://doi.org/10.1101/306316; this version posted April 23, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract LONP1, a AAA+ mitochondrial protease, is implicated in protein quality control, but its substrates and precise role in this process remain poorly understood. Here we have investigated the role of human LONP1 in mitochondrial gene expression and proteostasis. Depletion of LONP1 resulted in partial loss of mtDNA, complete suppression of mitochondrial translation, a marked increase in the levels of a distinct subset of mitochondrial matrix proteins (SSBP1, MTERFD3, FASTKD2 and CLPX), and the accumulation of their unprocessed forms, with intact mitochondrial targeting sequences, in an insoluble protein fraction.
    [Show full text]