DOCSLIB.ORG

HERC3-Mediated SMAD7 Ubiquitination Degradation Promotes Autophagy-Induced EMT and Chemoresistance in Glioblastoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
HERC3-Mediated SMAD7 Ubiquitination Degradation Promotes Autophagy-Induced EMT and Chemoresistance in Glioblastoma Published OnlineFirst March 12, 2019; DOI: 10.1158/1078-0432.CCR-18-3791 Translational Cancer Mechanisms and Therapy Clinical Cancer Research HERC3-Mediated SMAD7 Ubiquitination Degradation Promotes Autophagy-Induced EMT and Chemoresistance in Glioblastoma Hong Li1, Junjie Li1, Lei Chen1, Songtao Qi1,2,3, Shishi Yu4, Zhijian Weng1, Ziyou Hu5, Qiang Zhou1, Zong Xin1, Linyong Shi1, Liyi Ma1, Annie Huang6, and Yuntao Lu1,2,3 Abstract Purpose: Glioblastoma, a common malignant intracranial Results: Autophagy inducers significantly upregulated tumor, has the most dismal prognosis. Autophagy was the expression of HERC3, which promotes ubiquitina- reported to act as a survival-promoting mechanism in gliomas tion-mediated degradation of SMAD7 in an autolyso- by inducing epithelial-to-mesenchymal transition (EMT). some-dependent manner. The corresponding increase in Here, we determined the critical molecules involved in autop- p-SMAD2/3 level and TGFb pathway activation finally hagy-induced EMT and elucidated the possible mechanism of induced EMT in cell lines and primary glioblastoma cells. chemoradiotherapy resistance and tumor recurrence. Moreover, HERC3 overexpression was observed in pseudo- Experimental Design: We used isobaric tags for relative and palisade cells surrounding tumor necrosis and in tumor- absolute quantitation to identify the critical proteins and adjacent tissue; high HERC3 and low SMAD7 levels pre- pathway mediating EMT via autophagy inducer treatment, dicted poor clinical outcome in glioblastoma; xenograft of and tested the expression of these proteins using tissue micro- nude mice and in vitro experiments confirmed these array of gliomas and clinical glioblastoma samples as well as findings. tissues and cells separated from the core lesion and tumor- Conclusions: Together, our findings reveal the indis- peripheral region. Analysis of the Cancer Genome Atlas data- pensable role of HERC3 in regulating canonical SMAD2/ base and 110 glioblastoma cases revealed the prognostic value 3-dependent TGFb pathway involvement in autophagy- of these molecules. The functional role of these critical mole- induced EMT, providing insights toward a better understand- cules was further confirmed by in vitro experiments and intra- ing of the mechanism of resistance to temozolomide and cranial xenograft in nude mice. peripheral recurrence of glioblastoma. Introduction widely used after surgical resection. Temozolomide has been evidenced to trigger autophagy-associated cell death to inhibit Autophagy is thought to play a double-edged sword role in tumor growth in GBM (3). However, the prognosis of patients cancer by either suppressing tumorigenesis via its quality con- with GBM remains poor despite such treatment, with a median trol function or promoting tumor survival under microenvi- survival of 14.6 months. Moreover, inhibition of autophagy by ronmental stress and increasing growth and aggressiveness (1). knockdown of autophagy related 12 (ATG12) in glioma cells As the standard Stupp therapy for glioblastoma (GBM; ref. 2), does not affect cell viability, proliferation, or migration, but the most common intracranial aggressive tumor, ionizing radi- rather significantly reduces cellular invasion in a three- ation plus concomitant and adjuvant temozolomide has been dimensional (3D) organotypic model. Thus, autophagy may play a critical role in the benign-to-malignant transition, which 1Department of Neurosurgery, Southern Medical University, Guangzhou, China. is central to the initiation of metastasis (4). In addition, 2Nanfang Neurology Research Institution, Nanfang Hospital, Southern Medical 3 autophagy has also recently been considered to be an impor- University, Guangzhou, China. Nanfang Glioma Center, Guangzhou, China. tant mediator of the epithelial-to-mesenchymal transition 4Editorial Department of the Journal of Southern Medical University, Guangz- hou, China. 5Research Center of Clinical Medicine, Nanfang Hospital, Southern (EMT) status in several epithelial carcinomas. In particular, in Medical University, Guangzhou, China. 6Brain Tumor Research Center, SickKids hepatocellular carcinoma cells, starvation-induced autophagy Hospital, Toronto, Canada. is critical for cellular invasion via the induction of EMT (5). Note: Supplementary data for this article are available at Clinical Cancer Furthermore, autophagy is thought to comprise a potential Research Online (http://clincancerres.aacrjournals.org/). molecular mechanism of chemoresistance in cancers (6, 7), H. Li, J. Li, L. Chen, and S. Qi contributed equally to this article. and has accordingly been assessed as a potential therapeutic target during EMT in renal cell carcinoma (8). Corresponding Author: Yuntao Lu, Nanfang Hospital, #1838 North Guangzhou EMT, a critical biological behavior involved in proper embry- Avenue, Guangzhou 510515, China. Phone: 8620-61641806; Fax: 8620-6164- 1806; E-mail: [email protected] onic development, has also been shown to mediate tumor invasion and metastasis in several tumors (9, 10), including Clin Cancer Res 2019;25:3602–16 gliomas. In GBM, the EMT stimulated by activators, including doi: 10.1158/1078-0432.CCR-18-3791 members of the SNAI family (e.g., ZEB1 and ZEB2), can cause Ó2019 American Association for Cancer Research. cells to obtain certain features of mesenchymal cells, such as 3602 Clin Cancer Res; 25(12) June 15, 2019 Downloaded from clincancerres.aacrjournals.org on September 30, 2021. © 2019 American Association for Cancer Research. Published OnlineFirst March 12, 2019; DOI: 10.1158/1078-0432.CCR-18-3791 HERC3 Promotes Autophagy-Induced EMT and Chemoresistance repair activity under cisplatin treatment (20). HERC2 also plays Translational Relevance an important role in breast carcinogenesis through ubiquitin- Autophagy-induced epithelial-to-mesenchymal transition mediated degradation of the breast cancer suppressor BRCA1 (21). (EMT) reportedly contributes indispensably to tumor invasion In comparison, rare studies regarding "small" HERCs have indi- and chemoresistance in gliomas. We previously proved cated that HERC3 mRNA exhibits high expression in brain tis- that temozolomide, a classic glioblastoma chemotherapeutic sue (22) and that "small" HERC proteins can interact with each agent that also functions as an autophagic inducer, can induce other and localize to the same cellular structures, which are EMT, which mediates drug resistance. Here, we uncovered that identified as late endosomes and lysosomes (23). HERC3 is also the E3 ubiquitin ligase, HERC3, promotes the ubiquitination- considered as a novel candidate for regulating the inflammatory mediated degradation of SMAD7 (I-Smad) in an autolyso- response initiated by NF-kB (24), which negatively regulates some-dependent manner, and consequently activates the autophagy (25). Although the functional role of "small" HERCs TGFb pathway, which plays indispensable roles in autop- in cancer remains unknown, frame shift mutations in HERC3 hagy-induced EMT; the differential expression of HERC3 and have been correlated with microsatellite instability in gastric and SMAD7 in the core lesions and peripheral tissues indicated the colorectal carcinomas (26). mechanism of the peripheral recurrence of chemoradiother- In this study, we found that HERC3 is the critical molecule apy-treated glioblastoma. Moreover, analysis of the clinical involved in autophagy-induced EMT and that it activates the database revealed a prognostic value of HERC3 in glioblasto- SMAD2/3-dependent TGFb signaling pathway by ubiquitin- ma. Targeting HERC3 via tumor xenografts significantly inhib- mediated degradation of SMAD7, which is indicative of the ited cellular invasion, reversed EMT, and increased overall endosomal-lysosomal–dependent degradation pathway (27). survival. Our data would be of remarkable value for designing Besides, HERC3 and SMAD7 level were differentially expressed new combination therapies that can overcome chemoresis- in tissues and cells separated from the core lesion and tumor- tance and that can be further tested in clinical trials. peripheral region. The levels of these two molecules were closely correlated with poor prognosis of patients with GBM, especially those with the classical subtypes, who were treated with the Stupp regimen after surgery (2) by The Cancer Genome Atlas longer cellular projections (pseudopodia) and higher invasive (TCGA) bioinformatics analysis and follow up data for 110 ability (11). In addition, EMT may also induce the cellular clinical cases. Our findings elucidate the possible mechanism of dedifferentiation of noncancer stem cells, allowing the cells to temozolomide chemoradiotherapy resistance and tumor recur- acquire self-renewal and tumor-initiating ability, as well as a rence of GBM. tolerance to chemoradiotherapy (12, 13). Recently, Parkinson protein 2 E3 ubiquitin protein (PARK2) was shown to partic- ipate in regulating the invasion–metastasis cascade in GBM Materials and Methods cells by downregulating ZEB1 expression to mitigate EMT and Clinical tumor sample collection acting as a metastasis suppressor in GBM progression (14). In In total, 110 patients with newly diagnosed GBM who had contrast, E3 ubiquitin ligase HectH9 was found to mediate undergone surgery plus standard chemoradiotherapy (Stupp K63-linked polyubiquitination of HAUSP and cause CBP-medi- regimen) were included in this study. All samples were collected ated H3K56 acetylation on HIF-1a target gene promoters to from the Nanfang Hospital of Southern Medical University promote EMT/metastasis
Load more

Recommended publications
  • Application of Microrna Database Mining in Biomarker Discovery and Identification of Therapeutic Targets for Complex Disease
    Article Application of microRNA Database Mining in Biomarker Discovery and Identification of Therapeutic Targets for Complex Disease Jennifer L. Major, Rushita A. Bagchi * and Julie Pires da Silva * Department of Medicine, Division of Cardiology, University of Colorado Anschutz Medical Campus, Aurora, CO 80045, USA; [email protected] * Correspondence: [email protected] (R.A.B.); [email protected] (J.P.d.S.) Supplementary Tables Methods Protoc. 2021, 4, 5. https://doi.org/10.3390/mps4010005 www.mdpi.com/journal/mps Methods Protoc. 2021, 4, 5. https://doi.org/10.3390/mps4010005 2 of 25 Table 1. List of all hsa-miRs identified by Human microRNA Disease Database (HMDD; v3.2) analysis. hsa-miRs were identified using the term “genetics” and “circulating” as input in HMDD. Targets CAD hsa-miR-1 Targets IR injury hsa-miR-423 Targets Obesity hsa-miR-499 hsa-miR-146a Circulating Obesity Genetics CAD hsa-miR-423 hsa-miR-146a Circulating CAD hsa-miR-149 hsa-miR-499 Circulating IR Injury hsa-miR-146a Circulating Obesity hsa-miR-122 Genetics Stroke Circulating CAD hsa-miR-122 Circulating Stroke hsa-miR-122 Genetics Obesity Circulating Stroke hsa-miR-26b hsa-miR-17 hsa-miR-223 Targets CAD hsa-miR-340 hsa-miR-34a hsa-miR-92a hsa-miR-126 Circulating Obesity Targets IR injury hsa-miR-21 hsa-miR-423 hsa-miR-126 hsa-miR-143 Targets Obesity hsa-miR-21 hsa-miR-223 hsa-miR-34a hsa-miR-17 Targets CAD hsa-miR-223 hsa-miR-92a hsa-miR-126 Targets IR injury hsa-miR-155 hsa-miR-21 Circulating CAD hsa-miR-126 hsa-miR-145 hsa-miR-21 Targets Obesity hsa-mir-223 hsa-mir-499 hsa-mir-574 Targets IR injury hsa-mir-21 Circulating IR injury Targets Obesity hsa-mir-21 Targets CAD hsa-mir-22 hsa-mir-133a Targets IR injury hsa-mir-155 hsa-mir-21 Circulating Stroke hsa-mir-145 hsa-mir-146b Targets Obesity hsa-mir-21 hsa-mir-29b Methods Protoc.
    [Show full text]
  • 35Th International Society for Animal Genetics Conference 7
    35th INTERNATIONAL SOCIETY FOR ANIMAL GENETICS CONFERENCE 7. 23.16 – 7.27. 2016 Salt Lake City, Utah ABSTRACT BOOK https://www.asas.org/meetings/isag2016 INVITED SPEAKERS S0100 – S0124 https://www.asas.org/meetings/isag2016 epigenetic modifications, such as DNA methylation, and measuring different proteins and cellular metab- INVITED SPEAKERS: FUNCTIONAL olites. These advancements provide unprecedented ANNOTATION OF ANIMAL opportunities to uncover the genetic architecture GENOMES (FAANG) ASAS-ISAG underlying phenotypic variation. In this context, the JOINT SYMPOSIUM main challenge is to decipher the flow of biological information that lies between the genotypes and phe- notypes under study. In other words, the new challenge S0100 Important lessons from complex genomes. is to integrate multiple sources of molecular infor- T. R. Gingeras* (Cold Spring Harbor Laboratory, mation (i.e., multiple layers of omics data to reveal Functional Genomics, Cold Spring Harbor, NY) the causal biological networks that underlie complex traits). It is important to note that knowledge regarding The ~3 billion base pairs of the human DNA rep- causal relationships among genes and phenotypes can resent a storage devise encoding information for be used to predict the behavior of complex systems, as hundreds of thousands of processes that can go on well as optimize management practices and selection within and outside a human cell. This information is strategies. Here, we describe a multi-step procedure revealed in the RNAs that are composed of 12 billion for inferring causal gene-phenotype networks underly- nucleotides, considering the strandedness and allelic ing complex phenotypes integrating multi-omics data. content of each of the diploid copies of the genome.
    [Show full text]
  • HERC3 (NM 014606) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG214034 HERC3 (NM_014606) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: HERC3 (NM_014606) Human Tagged ORF Clone Tag: TurboGFP Symbol: HERC3 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG214034 representing NM_014606 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTATGTTGGGGATATTGGTCTCTGGGCCAACCTGGTATCAGCACCAACCTGCAGGGAATTGTGGCTG AGCCCCAGGTGTGTGGGTTCATATCTGACAGAAGTGTCAAGGAAGTGGCCTGTGGGGGAAACCACTCTGT GTTCCTGCTGGAAGATGGGGAAGTTTACACATGTGGTTTGAACACCAAGGGGCAACTGGGCCATGAGAGG GAAGGAAACAAGCCAGAACAAATTGGAGCTCTGGCAGATCAGCATATCATTCATGTGGCATGTGGCGAGT CCCACAGTCTGGCCCTCAGTGACCGAGGCCAGCTGTTTTCTTGGGGTGCAGGGAGTGATGGTCAGCTAGG ACTCATGACTACTGAGGATTCTGTGGCAGTGCCCAGGTTAATACAAAAGCTGAACCAGCAAACAATATTA CAAGTTTCCTGTGGCAACTGGCATTGCTTGGCTCTTGCGGCTGATGGCCAGTTCTTCACCTGGGGAAAGA ACAGCCATGGGCAGCTTGGCTTAGGGAAGGAGTTCCCCTCCCAAGCCAGCCCACAGAGGGTGAGGTCCCT GGAGGGGATCCCACTGGCTCAGGTGGCTGCCGGAGGGGCTCACAGCTTTGCCCTGTCTCTCTCAGGAGCT GTTTTTGGCTGGGGGATGAATAATGCCGGGCAGCTAGGGCTCAGTGATGAAAAAGATCGAGAATCTCCAT GCCATGTAAAACTCTTACGCACGCAAAAAGTTGTCTATATTAGTTGTGGAGAAGAACACACAGCAGTTCT CACAAAGAGTGGAGGTGTGTTTACCTTTGGCGCTGGTTCCTGTGGGCAACTTGGACACGACTCCATGAAT GATGAGGTTAACCCTAGAAGAGTTCTAGAGCTGATGGGTAGTGAAGTAACTCAAATTGCTTGTGGCAGAC
    [Show full text]
  • HERC5, a HECT E3 Ubiquitin Ligase Tightly Regulated in LPS Activated Endothelial Cells
    Research Article 4749 HERC5, a HECT E3 ubiquitin ligase tightly regulated in LPS activated endothelial cells Renate Kroismayr, Ulrike Baranyi*, Christian Stehlik‡, Andrea Dorfleutner‡, Bernd R. Binder§ and Joachim Lipp Department of Vascular Biology and Thrombosis Research, Medical University of Vienna and BMT, Bio-Molecular Therapeutics, Schwarzspanierstrasse 17, 1090 Vienna, Austria *Present address: Department of Surgery, Vienna General Hospital, Medical University of Vienna, Währinger Güttel 18-20, 1090 Vienna, Austria ‡Present address: Mary Babb Randolph Cancer Center and Department of Microbiology, Immunology, and Cell Biology, West Virginia University School of Medicine, PO Box 9300, Morgantown, WV 26506, USA §Author for correspondence (e-mail: [email protected]) Accepted 27 May 2004 Journal of Cell Science 117, 4749-4756 Published by The Company of Biologists 2004 doi:10.1242/jcs.01338 Summary By differential screening we isolated genes upregulated mRNA levels suggests that the initial drop in HERC5 in inflammatory cytokine-stimulated human skin protein is balanced by increased protein synthesis due to microvascular endothelial cells. One of these cDNAs upregulation of HERC5 mRNA. This leads to recovery of encoded RCC1 (regulator of chromosome condensation 1)- HERC5 protein levels within 12 hours of LPS stimulation like repeats and a HECT (homologous to E6-AP C- and points at a tight control of HERC5 protein. To analyze terminus) domain, representing a member of the HERC functional activity of this putative member of the ubiquitin- (HECT and RCC1 domain protein) family of ubiquitin conjugating pathway we performed in vitro assays with ligases. The mRNA level of this member, HERC5, is different ubiquitin-conjugating enzymes.
    [Show full text]
  • Scheffner Et Al., 2014 Biochimica Et Biophysica Acta
    Biochimica et Biophysica Acta 1843 (2014) 61–74 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbamcr Mammalian HECT ubiquitin-protein ligases: Biological and pathophysiological aspects☆ Martin Scheffner a,⁎, Sharad Kumar b,c,d,⁎⁎ a Department of Biology, Konstanz Research School Chemical Biology, University of Konstanz, Konstanz, Germany b Centre for Cancer Biology, SA Pathology, Frome Road, Adelaide, SA 5000, Australia c Department of Medicine, University of Adelaide, Adelaide, SA 5005, Australia d Division of Health Sciences, University of South Australia, Adelaide, SA 5001, Australia article info abstract Article history: Members of the HECT family of E3 ubiquitin-protein ligases are characterized by a C-terminal HECT domain that Received 7 December 2012 catalyzes the covalent attachment of ubiquitin to substrate proteins and by N-terminal extensions of variable Received in revised form 18 February 2013 length and domain architecture that determine the substrate spectrum of a respective HECT E3. Since their discov- Accepted 22 March 2013 ery in 1995, it has become clear that deregulation of distinct HECT E3s plays an eminent role in human disease or Available online 29 March 2013 disease-related processes including cancer, cardiovascular and neurological disorders, viral infections, and im- mune response. Thus, a detailed understanding of the structure–function aspects of HECT E3s as well as the iden- Keywords: fi HECT domain ti cation and characterization of the substrates and regulators of HECT E3s is critical in developing new Ubiquitin ligase approaches in the treatment of respective diseases. In this review, we summarize what is currently known Ubiquitination about mammalian HECT E3s, with a focus on their biological functions and roles in pathophysiology.This article Disease is part of a Special Issue entitled: Ubiquitin–Proteasome System.
    [Show full text]
  • Molecular Characterization of HERC5: a Novel Multifunctional Antiviral Protein
    Western University Scholarship@Western Electronic Thesis and Dissertation Repository 8-14-2015 12:00 AM Molecular Characterization of HERC5: A Novel Multifunctional Antiviral Protein Matthew W. Woods The University of Western Ontario Supervisor Dr. Stephen Barr The University of Western Ontario Graduate Program in Microbiology and Immunology A thesis submitted in partial fulfillment of the equirr ements for the degree in Doctor of Philosophy © Matthew W. Woods 2015 Follow this and additional works at: https://ir.lib.uwo.ca/etd Part of the Medical Microbiology Commons Recommended Citation Woods, Matthew W., "Molecular Characterization of HERC5: A Novel Multifunctional Antiviral Protein" (2015). Electronic Thesis and Dissertation Repository. 3057. https://ir.lib.uwo.ca/etd/3057 This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected]. MOLECULAR CHARACTERIZATION OF HERC5: A NOVEL MULTIFUNCTIONAL ANTIVIRAL PROTEIN (Thesis format: Integrated Article) by Matthew W. Woods Graduate Program in Microbiology and Immunology A thesis submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy The School of Graduate and Postdoctoral Studies The University of Western Ontario London, Ontario, Canada © Matthew W. Woods 2015 Abstract Interferon (IFN)-induced proteins serve as one of the first lines of defense against viral pathogens such as Human Immunodeficiency Virus (HIV)-1. IFN treatment has been shown to restrict multiple stages of HIV-1 replication. The identities and functions of IFN-induced proteins involved in the inhibition of HIV-1 and other viruses are not fully understood.
    [Show full text]
  • Specific Association Between Alcohol Intake, High Grade of Di€Erentiation
    Oncogene (2002) 21, 1225 ± 1232 ã 2002 Nature Publishing Group All rights reserved 0950 ± 9232/02 $25.00 www.nature.com/onc Speci®c association between alcohol intake, high grade of dierentiation and 4q34-q35 deletions in hepatocellular carcinomas identi®ed by high resolution allelotyping Olivier Bluteau1, Jean-Christophe Beaudoin1, Patricia Pasturaud1, Jacques Belghiti2, Dominique Franco3, Paulette Bioulac-Sage4, Pierre Laurent-Puig1 and Jessica Zucman-Rossi*,1 1INSERM U434, CEPH 27 Rue Juliette Dodu, 75010 Paris, France; 2HoÃpital Beaujon, 92110 Clichy, France; 3HoÃpital Antoine BeÂcleÁre, 92140 Clamart, France; 4HoÃpital Pellegrin, 33000 Bordeaux, France One of the most frequent deletions in hepatocellular Introduction carcinoma (HCC) is that involving the long arm of chromosome 4 (30 to 70% of the cases). These Hepatocellular carcinoma (HCC) is one of the most chromosomal deletions are closely related to hepatitis common cancers worldwide, particularly in Asia and B virus (HBV) infection. A tumor suppressor gene (TSG) Africa. Recently, its incidence has substantially located on 4q has been proposed in liver carcinogenesis, increased in United Kingdom, France and United but has not been identi®ed as yet. Despite previous LOH States (Deuc et al., 1998; El-Serag and Mason, 1999; studies focused on 4q in HCC, a clear minimal common Taylor-Robinson et al., 1997). Etiological factors that region of deletion (MCRD) could not be delimited. To have been associated with the development of the further investigate the role of chromosome 4q LOH in disease are well known and include infection with the the pathogenesis of HCC, 85 microsatellite markers hepatitis B virus or hepatitis C virus, heavy alcohol spanning chromosome 4q were systematically analysed in intake, prolonged dietary exposure to A¯atoxin B1 and a series of 154 well-characterized primary liver tumors.
    [Show full text]
  • E3 Ubiquitin Ligase TRIP12: Regulation, Structure, and Physiopathological Functions
    International Journal of Molecular Sciences Review E3 Ubiquitin Ligase TRIP12: Regulation, Structure, and Physiopathological Functions 1,2, 1,2, 1,2, 1,2, , Manon Brunet y, Claire Vargas y, Dorian Larrieu y,Jérôme Torrisani * y and Marlène Dufresne 1,2,* 1 Institut National de la Santé et de la Recherche Médicale, INSERM Unit 1037, Centre de Recherches en Cancérologie de Toulouse, CEDEX 1, 31 037 Toulouse, France; [email protected] (M.B.); [email protected] (C.V.); [email protected] (D.L.) 2 Université Toulouse III-Paul Sabatier, CEDEX 9, 31 062 Toulouse, France * Correspondence: [email protected] (J.T.); [email protected] (M.D.); Tel.: +33-582-741-644 (J.T.); +33-582-741-643 (M.D.) These authors have contributed equally to this work. y Received: 25 September 2020; Accepted: 5 November 2020; Published: 12 November 2020 Abstract: The Thyroid hormone Receptor Interacting Protein 12 (TRIP12) protein belongs to the 28-member Homologous to the E6-AP C-Terminus (HECT) E3 ubiquitin ligase family. First described as an interactor of the thyroid hormone receptor, TRIP12’s biological importance was revealed by the embryonic lethality of a murine model bearing an inactivating mutation in the TRIP12 gene. Further studies showed the participation of TRIP12 in the regulation of major biological processes such as cell cycle progression, DNA damage repair, chromatin remodeling, and cell differentiation by an ubiquitination-mediated degradation of key protein substrates. Moreover, alterations of TRIP12 expression have been reported in cancers that can serve as predictive markers of therapeutic response. The TRIP12 gene is also referenced as a causative gene associated to intellectual disorders such as Clark–Baraitser syndrome and is clearly implicated in Autism Spectrum Disorder.
    [Show full text]
  • Biochimica Et Biophysica Acta 1783 (2008) 1467–1479
    Biochimica et Biophysica Acta 1783 (2008) 1467–1479 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbamcr Review The RCC1 superfamily: From genes, to function, to disease Ouadah Hadjebi, Eduard Casas-Terradellas, Francesc R. Garcia-Gonzalo 1, Jose Luis Rosa ⁎ Departament de Ciències Fisiològiques II, IDIBELL, Campus de Bellvitge, Universitat de Barcelona, E-08907, L'Hospitalet de Llobregat, Barcelona, Spain ARTICLE INFO ABSTRACT Article history: The Regulator of Chromosome Condensation 1 (RCC1) was identified over 20 years ago as a critical cell cycle Received 3 December 2007 regulator. By analyzing its amino acid sequence, RCC1 was found to consist of seven homologous repeats of Received in revised form 19 March 2008 51–68 amino acid residues, which were later shown to adopt a seven-bladed β-propeller fold. Since the Accepted 20 March 2008 initial identification of RCC1, a number of proteins have been discovered that contain one or more RCC1-like Available online 10 April 2008 domains (RLDs). As we show here, these RCC1 superfamily proteins can be subdivided in five subgroups Keywords: based on structural criteria. In recent years, a number of studies have been published regarding the functions RCC1 of RCC1 superfamily proteins. From these studies, the emerging picture is that the RLD is a versatile domain RLD which may perform many different functions, including guanine nucleotide exchange on small GTP-binding GRF proteins, enzyme inhibition or interaction with proteins and lipids. Here, we review the available structural GEF and functional data on RCC1 superfamily members, paying special attention to the human proteins and their HERC involvement in disease.
    [Show full text]
  • A Short Evolutionary Journey Across the HERC Ubiquitin Ligases Enrico Bracco2*, Cristina Panuzzo1, Barbara Pergolizzi1* 1Dept
    Bracco E, Panuzzo C, Pergolizzi B. J Immunol Sci. (2018); 2(1): 46-49 Journal of Immunological Sciences Mini Review Open Access A short evolutionary journey across the HERC Ubiquitin Ligases Enrico Bracco2*, Cristina Panuzzo1, Barbara Pergolizzi1* 1Dept. of Clinical & Biological Sciences, University of Turin, Italy 2Dept. of Oncology, University of Turin, Italy Article Info ABSTRACT Article Notes HECT ubiquitin ligases are key components of the eukaryotic ubiquitin- Received: December 22, 2017 proteasome system controlling different cellular physiological aspects as well Accepted: February 05, 2018 as the genesis of several human diseases. Among the HECT family, the HERC *Correspondence: subfamily members are characterized by having one or more RCC1-like domains, Dr. Enrico Bracco, Department of Oncology, University of a C-terminal HECT domain and the molecular mass ranging approximately Turin, AOU S. Luigi, 10043 Orbassano TO, Italy; from 120 kDa to 500 kDa. Due to their large size , some of them are refractory E-mail: [email protected]. to functional characterization. We have recently identified and functionally Dr. Barbara Pergolizzi, Dept. of Clinical & Biological characterized a novel large HECT member in Dictyostelium discoideum that, in Sciences, University of Turin, Italy; many aspects, exhibits structural similarities with the mammalian large HERC1. E-mail: [email protected] In the present minireview , we shortly summarize and revise the current phylogenetic history of HERC proteins among the different living organisms. © 2018 Bracco E. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License. Introduction Ubiquitination, which is the covalent ligation of ubiquitin to a substrate protein, is associated with almost every cellular process including signal transduction, DNA damage repair, cell cycle regulation and autophagic clearance.
    [Show full text]
  • HERC3 (NM 014606) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC214034L3 HERC3 (NM_014606) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: HERC3 (NM_014606) Human Tagged ORF Clone Tag: Myc-DDK Symbol: HERC3 Vector: pLenti-C-Myc-DDK-P2A-Puro (PS100092) E. coli Selection: Chloramphenicol (34 ug/mL) Cell Selection: Puromycin ORF Nucleotide The ORF insert of this clone is exactly the same as(RC214034). Sequence: Restriction Sites: SgfI-MluI Cloning Scheme: ACCN: NM_014606 ORF Size: 3150 bp This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 HERC3 (NM_014606) Human Tagged ORF Clone – RC214034L3 OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_014606.1 RefSeq Size: 4894 bp RefSeq ORF: 3153 bp Locus ID: 8916 UniProt ID: Q15034 Domains: RCC1, HECT Protein Families: Druggable Genome Protein Pathways: Ubiquitin mediated proteolysis MW: 117 kDa Gene Summary: This gene encodes a member the HERC ubiquitin ligase family.
    [Show full text]
  • HECT E3 Ubiquitin Ligases – Emerging Insights Into Their Biological Roles and Disease Relevance Yaya Wang1,2, Diana Argiles-Castillo2, Emma I
    © 2020. Published by The Company of Biologists Ltd | Journal of Cell Science (2020) 133, jcs228072. doi:10.1242/jcs.228072 REVIEW SUBJECT COLLECTION: UBIQUITIN HECT E3 ubiquitin ligases – emerging insights into their biological roles and disease relevance Yaya Wang1,2, Diana Argiles-Castillo2, Emma I. Kane2, Anning Zhou1 and Donald E. Spratt2,* ABSTRACT Ubiquitylation (also known as ubiquitination) is an essential Homologous to E6AP C-terminus (HECT) E3 ubiquitin ligases play a signaling pathway that involves the covalent attachment of critical role in various cellular pathways, including but not limited to ubiquitin, a highly conserved 8.5 kDa protein, onto a target protein trafficking, subcellular localization, innate immune response, substrate (Akutsu et al., 2016; Hershko and Ciechanover, 1998; viral infections, DNA damage responses and apoptosis. To date, 28 Komander and Rape, 2012; Swatek and Komander, 2016). This HECT E3 ubiquitin ligases have been identified in humans, and highly regulated process is achieved through the sequential action – recent studies have begun to reveal how these enzymes control of three enzymes an ubiquitin-activating enzyme (E1), an various cellular pathways by catalyzing the post-translational ubiquitin-conjugating enzyme (E2), and an ubiquitin ligase (E3). attachment of ubiquitin to their respective substrates. New studies The E3 ubiquitin ligases selectively facilitate the formation of an ε have identified substrates and/or interactors with different members of isopeptide bond between the C-terminus of ubiquitin and the - the HECT E3 ubiquitin ligase family, particularly for E6AP and amino group of a lysine residue on a substrate protein (Deol et al., members of the neuronal precursor cell-expressed developmentally 2019; Komander and Rape, 2012; Pickart and Eddins, 2004).
    [Show full text]