Mississippi State University Scholars Junction
Theses and Dissertations Theses and Dissertations
1-1-2012
A Procedure Using Rotylenchulus Reniformis Nucleotide Sequences to Quantitatively Measure Plant-Parasitic Nematode Infestation Levels using Metagenomic Dna Isolated Directly from Soil
Kurtis C. Showmaker
Follow this and additional works at: https://scholarsjunction.msstate.edu/td
Recommended Citation Showmaker, Kurtis C., "A Procedure Using Rotylenchulus Reniformis Nucleotide Sequences to Quantitatively Measure Plant-Parasitic Nematode Infestation Levels using Metagenomic Dna Isolated Directly from Soil" (2012). Theses and Dissertations. 233. https://scholarsjunction.msstate.edu/td/233
This Graduate Thesis - Open Access is brought to you for free and open access by the Theses and Dissertations at Scholars Junction. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of Scholars Junction. For more information, please contact [email protected]. Automated Template A: Created by James Nail 2011 V2.01
A procedure using Rotylenchulus reniformis nucleotide sequences to quantitatively
measure plant-parasitic nematode infestation levels using metagenomic DNA
isolated directly from soil
By
Kurtis C. Showmaker
A Thesis Submitted to the Faculty of Mississippi State University in Partial Fulfillment of the Requirements for the Degree of Masters of Science in Agricultural Life Sciences in the Department of Biochemistry, Molecular Biology, Entomology and Plant Pathology
Mississippi State, Mississippi
December 2012
Copyright by
Kurtis C. Showmaker
2012
A procedure using Rotylenchulus reniformis nucleotide sequences to quantitatively
measure plant-parasitic nematode infestation levels using metagenomic DNA
isolated directly from soil
By
Kurtis C. Showmaker
Approved:
______Gary W. Lawrence Shien Lu Associate Professor of Biochemistry, Associate Professor of Biochemistry, Molecular Biology, Entomology and Molecular Biology, Entomology and Plant Pathology Plant Pathology (Co-Director of Thesis) (Co-Director of Thesis)
______Vincent Klink Clarissa J. Balbalian Assistant Professor of Biological Sciences Committee Participant of Biochemistry, (Committee member) Molecular Biology, Entomology and Plant Pathology (Committee member)
______Michael A. Caprio George Hopper Professor of Biochemistry, Molecular Dean of the College of Agriculture Biology, Entomology and Plant Pathology Life Sciences (Graduate Coordinator)
Name: Kurtis C. Showmaker
Date of Degree: December 15, 2012
Institution: Mississippi State University
Major Field: Agricultural Life Sciences
Major Professor: Major Professor(s)
Title of Study: A procedure using Rotylenchulus reniformis nucleotide sequences to quantitatively measure plant-parasitic nematode infestation levels using metagenomic DNA isolated directly from soil
Pages in Study: 99
Candidate for Degree of Masters of Science
Molecular diagnostic tests have been developed and utilized to diagnose and to confirm diagnoses of many plant-parasitic nematodes. We evaluate the potential of a qPCR assay to detect and quantify Rotylenchulus reniformis in Mississippi directly from soil. A novel pipeline utilizing multiple databases containing nematode DNA and EST sequences was developed to aid in the selection of R. reniformis primers used in a PCR and qPCR assays. In vitro testing showed that the primers and probes developed from the novel pipeline for the qPCR assays could accurately detect the presence of R. reniformis.
Subsequent testing resulted in a trend of increasing observed number of R. reniformis resulting in increasing estimates by qPCR
DEDICATION
I dedicate this research to my son Chase.
ii
ACKNOWLEDGEMENTS
The author expresses his gratitude to his committee members; Clarissa Balbalian,
Shi-en Lu, Vincent Klink, and Gary Lawrence. A special thanks is given to my major professor whom taught me the how to identify plant-parasitic nematodes.
iii
TABLE OF CONTENTS
DEDICATION ...... ii
ACKNOWLEDGEMENTS ...... iii
LIST OF TABLES ...... vii
LIST OF FIGURES ...... ix
CHAPTER
I. DEVELOPMENT OF MOLECULAR MARKERS FOR ROTYLENCHULUS RENIFORMIS ...... 1
INTRODUCTION ...... 1 Statement of Problem ...... 1 Life Stage Development of Rotylenchulus reniformis ...... 2 Distribution and Host Ranges of Rotylenchulus spp...... 3 The Pathogen Rotylenchulus reniformis ...... 7 Management Practices for Rotylenchulus reniformis ...... 7 The Development of Molecular Diagnostic Tools for Nematodes ...... 8 Quantitative PCR ...... 12 Nematode Genomics Usefulness to Molecular Diagnostics ...... 13 Thesis Objective...... 15 MATERIALS AND METHODS ...... 17 Procurement of Nematodes ...... 17 Metagenomic Nematode DNA Isolation ...... 19 Rotylenchulus reniformis ITS1 Primer Design ...... 19 Rotylenchulus reniformis ITS1 Primer Pair Evaluation ...... 20 Rotylenchulus reniformis qPCR Primer and Probe Design ...... 21 Evaluation of potential qPCR Primer Pair Specificity ...... 23 Field Nematode Sampling and Extractions for qPCR ...... 24 Metagenomic Nematode DNA Extractions for qPCR ...... 24 PCR Assays on Soil Extracted Nematodes for select qPCR Primer Pairs...... 25 PCR Assays on Metagenomic DNA Isolated Directly from Soil Using the qPCR Primer Pairs ...... 25 Quantitative PCR Probe and Instrumentation ...... 26
iv
Hit 2 alt qPCR Assay Conducted on Cultured Extracted Rotylenchulus reniformis ...... 27 Hit 2 alt qPCR Assay Conducted on Extracted Nematodes from Field Samples ...... 27 Hit 7 qPCR Assay Conducted on Extracted Cultured Rotylenchulus reniformis ...... 28 Hit 7 qPCR Assay Conducted on Extracted Nematodes from Field Samples ...... 29 Hit 7 qPCR Assay on Direct Soil Metagenomic DNA ...... 29 Confirmation of PCR amplification in PCR and the qPCR reactions ...... 29 RESULTS ...... 30 Procurement of Nematodes ...... 30 Rotylenchulus reniformis ITS1 Primer Pair Evaluation ...... 31 Rotylenchulus reniformis Specific PCR Primer Pair and Probe Design ...... 31 Evaluation of Potential qPCR Primer Pair Specificity ...... 32 Field Nematode Sampling and Extractions for qPCR ...... 33 PCR Assays on Soil Extracted Nematodes for select qPCR Primer Pairs...... 33 PCR Assays on Metagenomic DNA Isolated Directly from Soil using the qPCR Primer Pairs...... 34 Hit 2 alt qPCR Assay Conducted on Cultured Extracted Rotylenchulus reniformis ...... 35 Hit 2 alt qPCR Assay Conducted on Extracted Nematodes from Field Samples ...... 35 Hit 7 qPCR Assay Conducted on Extracted Cultured Rotylenchulus reniformis ...... 35 Hit 7 qPCR Assay Conducted on Extracted Nematodes from Field Samples ...... 36 Hit 7 qPCR Assay on Direct Soil Metagenomic DNA ...... 36 Confirmation of PCR Amplification in PCR and the qPCR Reactions ...... 37 DISCUSSION ...... 37 Molecular Markers designed for the ITS1 Sequence did not Discriminate ...... 38 Development of Customized Computer Programs to Identify Molecular Probes ...... 39 Determination of Primer Specificity to Rotylenchulus reniformis ...... 42 Detection of Rotylenchulus reniformis DNA Isolated Directly from Field Extracted Nematodes with PCR ...... 43 PCR-based Demonstration of DNA Isolated from Field Soil Samples ...... 44 Detecting Rotylenchulus reniformis DNA with qPCR ...... 44 The Hit 2 alt qPCR Assay ...... 45
v
The Hit 7 qPCR Assay ...... 46 Final Conclusions...... 47
REFERENCES ...... 87
APPENDIX
A. PERL SCRIPT # 1 ...... 95
B. PERL SCRIPT # 2 ...... 97
vi
LIST OF TABLES
1 Value of Mississippi crops parasitized by R. reniformis from 2007 to 2011 ...... 48
2 2011 Cotton loss due to R. reniformis ...... 49
3 PCR assays to detect specific nematode species using a species specific primer pairs that produces one amplicon ...... 50
4 Quantitative PCR assays to detect or identify plant-parasitic nematode species ...... 52
5 Rotylenchulus reniformis ITS1 (RrITS1) field sample assay ...... 53
6 Primer pair (RrITS1) designed for the ITS1 sequence of R. reniformis ...... 53
7 GPS coordinates of the three South Farm (SF), corn and cotton sites ...... 53
8 Number of nematodes per 500 mm3 of soil used in Hit 2 alt field assay ...... 54
9 Number of nematodes per 500 mm3 of soil used in Hit 7 field assay ...... 55
10 Summary of Perl script outputs ...... 56
11 The Rotylenchulus reniformis Hit genes and their homologs ...... 57
12 List of Rotylenchulus reniformis Hit primers and probes for the qPCR assays ...... 58
13 The Hit 2 alt qPCR assay estimates of R Rotylenchulus reniformis from a serial dilution of the nematode suspension ...... 58
14 Comparison of morphological nematode estimates and qPCR estimates using Hit 2 alt primer pair ...... 59
15 Hit 7 qPCR estimates of known numbers of Rotylenchulus reniformis (Rr) ...... 60
16 Hit 7 Field sample Rotylenchulus reniformis (Rr) estimation ...... 61
vii
17 Hit 7 Field sample Rotylenchulus reniformis (Rr) qPCR estimation summary ...... 62
18 Hit 7 Direct soil Rotylenchulus reniformis (Rr) estimation ...... 63
19 Estimation of Rotylenchulus reniformis populations using Hit 7 qPCR directly from soil ...... 64
viii
LIST OF FIGURES
1 Value of Mississippi crops parasitized by Rotylenchulus reniformis from 2007 to 2011 ...... 64
2 U.S. distribution of Rotylenchulus reniformis in 2010 ...... 65
3 Collection site distribution maps ...... 66
4 Bioinformatics pipeline for the isolation of highly conserved DNA sequences from R. reniformis ...... 67
5 Field Locations for the field nematode population sampling in Oktibbeha county ...... 68
6 Close up aerial images of the soil collection sites ...... 69
7 Rotylenchulus reniformis primer pair RrITS1 evaluation on field samples ...... 70
8 The Hit 2 alt gene sequence ...... 71
9 The Hit 7 gene sequence ...... 71
10 The D2/D3 gene sequence ...... 72
11 Hit 2 alt ClustalW alignment ...... 73
12 Hit 7 ClustalW alignment ...... 74
13 Hit 2 alt qPCR primer and Taqman® probe sequence sites ...... 76
14 Hit 7 primer and Taqman® probe sequence sites ...... 77
15 Specificity of the Hit 2 alt and Hit 7 qPCR primers against R. reniformis and Meloidogyne incognita ...... 78
16 Hit 2 alt PCR amplification characteristics of qPCR primers on field extracted nematodes ...... 79
17 Hit 7 PCR amplification characteristics of qPCR primers on field extracted nematodes ...... 80 ix
18 Amplification characteristics of the Hit 2 alt and Hit 7 qPCR primer on DNA extracted directly from soil ...... 81
19 Hit 2 alt qPCR standard curve ...... 82
20 Confirmative Hit 2 alt sequence ...... 83
21 Confirmative 7 sequence ...... 84
22 Rotylenchulus reniformis D2/D3 ...... 85
23 Hit 7 qPCR standard curve ...... 86
x
CHAPTER I
DEVELOPMENT OF MOLECULAR MARKERS FOR ROTYLENCHULUS
RENIFORMIS
INTRODUCTION
Statement of Problem
Rotylenchulus reniformis Linford & Oliveira (1940), commonly known as the
reniform nematode, is a major crop pathogen of Gossypium hirsutum L. (cotton), Glycine
max L. Merr. (soybean), and Ipomoea batatas L. (sweet potatoes) in Mississippi (Abel et
al., 2007, Robinson, 2007, Lawrence and McLean, 1999). Over a five year period (2004-
2009), Mississippi agriculture producers grew an average of 1.07 billion production value dollars of these crops that are susceptible to R. reniformis on an average of 2,387,100
acres (Figure 1 and Table 1) (http://quickstats.nass.usda.gov/). In 2011 it was estimated
82,286 bales of cotton were lost due to R. reniformis by reducing yields 6 % (National
Cotton Council Disease Database: 1952-2011 [http://www.cotton.org/tech/pest/]). The
plant-parasitic nematode, R. reniformis, causes higher percent cotton yield reduction in
Mississippi than any other state (Table 2) (National Cotton Council Disease Database:
1952-2009). In sweet potato plots infested with R. reniformis, the nematode was shown to
have a 996-kg/ha yield reduction in non-treated plots. (Abel et al., 2007) Rotylenchulus
reniformis is a pathogen of cotton, soybean, and sweet potatoes the southeastern United
States (Figure 2). 1
With the yield losses caused by R. reniformis, the first step towards management
and reducing losses due to the nematode is identification of the nematode. Growers must
first identify the nematode’s presence before they can take proper steps to manage the
nematode. It is the purpose of this thesis to evaluate techniques that may aid in the
identification of R. reniformis. Although, current techniques involving morphology to
identify the nematode are sufficient, they require a trained technician or nematologist to properly identify the nematode. A molecular method as reported here could, relax this constraint and allow people in areas where such trained expertise are not available to have a means of examining their soil for R. reniformis.
Life Stage Development of Rotylenchulus reniformis
Rotylenchulus reniformis has a similar life cycle to other nematodes present in the genus Rotylenchulus (Robinson et al., 1997). Other Rotylenchulus spp. include, R.
anamictus, R. borealis, R. brevitubulus, R. clavicaudatus, R. leptus, R. macrodoratus, R.
macrosmoa, R. parvus, and R. sacchari (Robinson et al., 1997). Rotylenchulus reniformis
first stage juveniles (J1) develop within the egg shell after oviposition by a mature female
(Robinson et al., 1997). The nematode undergoes a molt, during the process shedding its
cuticle, and becoming a second stage juvenile (J2) (Robinson et al., 1997). The nematode
subsequently hatches from the egg. Rotylenchulus reniformis, like other plant-parasitic nematodes, are dependent on factors such as temperature and plant excretions to stimulate hatching. The J2 has not been observed to feed and subsequently undergoes two
additional molts before it begins to feed as a vermiform adult female (Robinson et al.,
1997). Males do not feed and have a reduced stylet (Robinson et al., 1997). Although,
males do not feed, they are required for procreation, because R. reniformis is an obligate 2
sexual reproducing organism. Except in the case of Japan, which harbors a parthenogenic
strain of R. reniformis, which was initially described as a separate species Rotylenchulus
nicotiana. This was later synonymized with R. reniformis (Agudelo et al., 2005,
Dasgupta et al., 1968, Nakasono and Ichinohe, 1967).
The vermiform R. reniformis female’s cephalic and cervical regions penetrate the
roots and establish its feeding site, the syncytium, in the pericycle (Robinson et al.,
1997). The development of a syncytium is common among the Rotylenchulus spp.
including R. borealis, R. macrosomoa, and R. parvus (Robinson et al., 1997).
Rotylenchulus macrodoratus differs from other members of the genus by not forming a syncytium and alternatively forming a uninulceate giant cell (Inserra and Vovlas, 1980).
Following establishment of the syncytium, the part of the R. reniformis female’s body remaining outside the root begins to enlarge to a kidney shape (Robinson et al., 1997).
Males copulate with the female and the female begins to lay single celled eggs in a gelatinous egg mass (Robinson et al., 1997). An exception to mating can be found in R. parvus and R. leptus, which reproduce by parthenogenic (i. e. asexual) means (Robinson et al., 1997).
Distribution and Host Ranges of Rotylenchulus spp.
Species from the genus Rotylenchulus have been reported from every continent in the world, with the exception of Antarctica. The ten species of Rotylenchulus differ in their demographic distribution (Robinson et al., 1997). Internationally R. reniformis has been identified on every continent expect Antarctica. Rotylenchulus reniformis has been isolated from South America, Central America, North America, the Caribbean Basin,
Africa, southern Europe, the Middle East, India, Southeast Asia, Australasia, the Indian 3
Ocean, China, Japan, the Philippines, and the Pacific (Robinson et al., 1997).
Rotylenchulus reniformis’ wide distribution is due to its polyphagous nature, but limited
by its requirement of warm temperatures which leads to it inhabiting subtropical, tropical,
and warm temperate niches (Robinson et al., 1997). Rotylenchulus reniformis also has
quarantine constraints such as intra-boarder quarantines in the United States enforced by
the states Arizona, California, and New Mexico; and is subject internationally to
quarantine in Chile and Switzerland (Robinson et al., 1997).
Rotylenchulus borealis has been reported only in Europe and Africa, parasitizing
Cucumis melo (cantaloupe), Sorghum bicolor L. (sorghum), Helianthus annuus
(sunflower), Ipomoea batatas L. (sweet potato), Solanum tuberosum L. (potato), Glycine max (soybean), and Zea maize L. (corn) (Robinson et al., 1997, Vovlas and Inserra,
1982). Although R. borealis has been found in cotton fields, a host study found that the strains used in the study did not parasitize cotton, hence the nematode’s ability to parasitize cotton is unclear (Vovlas and Inserra, 1982). Rotylenchulus borealis also failed to infect cultivars of Arachis hypogaea (peanut) cv. Florunner, Capsicum annuum
(pepper) cv. Yolo Wonder, Lycopersicon esculentum (tomato) cv. Roma, and Triticum durum Desf. cv. Creso (durum wheat) (Vovlas and Inserra, 1982).
Rotylenchulus macrodoratus is only found in the Mediterranean region and parasitizes fruit and ornamental trees as well as herbaceous plants such as soybean
(Inserra and Vovlas, 1980). Rotylenchulus macrodoratus differs from other
Rotylenchulus spp. by the formation of a uninucleate giant cell, as reported from soybean, instead of a syncytium (Inserra and Vovlas, 1980). This formation of uninuclceate giant cell feeding site compared to a syncytium as with the other species of Rotylenchulus
4
highlights the diversity of the genus. A few plants found to be hosts of R. macrodoratus include Citrus sinensis (orange), Ficus carica L. (fig), Neriurn oleander L. (oleander),
Olea europaea (olive), Pistacia vera L. (pistachio), Prunus amygdalus L. (almond),
Prunus armeniaca L. (apricot), Prunus domestica L. (plum), Quercus farnetto Ten.
(Italian oak), Glycine max (soybean), Vitis vinifena L. (grape) (Inserra and Vovlas, 1980,
Robinson et al., 1997).
Rotylenchulus macrosoma is found in Israel and Syria (Robinson et al., 1997). R. macrosoma parasitizes herbaceous hosts and olive trees but has not been found to parasitize Capsicum annuum (pepper) cv. Maor, Citrus aurantium L. (sour orange),
Gossypium barbadense (Egyptian cotton) cv. Acola, sorghum cv. D2052, Glycine max
(soybean) cv. Lee, Triticum aestivum (winter wheat) cv. Lakhish, and Lycopersicon esculentum (tomato) cv. Hosen (Robinson 1997).
Rotylenchulus parvus is the most well known parthenogenic species of the
Rotylenchulus genus. Rotylenchulus parvus is widely distributed and can be found on continents such as, Africa, Australia, Asia, and North America (Robinson et al., 1997).
While R. parvus does inhabit parts of the Caribbean Basin, it is not known to occur in
South America (Robinson et al., 1997). In the United States R. parvus has been located in
Arizona, California, and Florida (Robinson et al., 1997). Important crops that serve as hosts for R. parvus include Carica papaya L. (papaya), corn, Crotalaria juncea L. (Sunn
Hemp), Cynodon dactylon (L) Pers. (bermudagrass), Gossypium hirsutum L. (upland cotton), Hordeum vulgare L. (barley), Lycopersicon esculentum Mill. (tomato),
Macadamis sp. (macadamia), Nicotiana tabacum L. (tobacco), Pennisetum americanum
5
(= glaucum) (L.) K. Schum. (pearl millet), potato, Saccharum officinarum L. (sugarcane),
and Vigna unguiculata (L.) Walp (cowpea) (Robinson et al., 1997).
Rotylenchulus spp. such as R. anamictus, R. brevitubulus, R. clavicaudatus, R.
leptus, and R. sacchari are considered species of minor economic importance (Robinson et al., 1997). The extent of their distributions is unknown, but reviewed here are locations were they have been described from or have been known to inhabit. Rotylenchulus anamictus was described from specimens from the rhizosphere of Acacia sp., in Africa
(Robinson et al., 1997). R. brevitubulus was isolated from a savanna in Africa and morphologically differs from other Rotylenchulus spp. by having a bifurcate tail tip as a juvenile nematode (Robinson et al., 1997). R. clavicaudatus was described from South
Africa, and unlike other Rotylenchulus spp. such as R. reniformis which have a rounded tail tip, R. clavicaudatus has a distinct clavate tail tip (Robinson et al., 1997). R. leptus was described from specimens collected from Bambusa sp. in Africa (Robinson et al.,
1997). R. leptus is parthenogenetic and hosts are not known. (Robinson et al., 1997). R. sacchari was described from a male and immature female specimens isolated from a sugarcane field in South Africa (Robinson et al., 1997). A main characteristic that contrasts R. sacchari from other Rotylenchulus spp. is the length of its stylet (29.0-32.5
µm compared to less than 27 µm for other Rotylenchulus spp.) (Robinson et al., 1997).
In summary of the distributions and host ranges of Rotylenchulus spp. it is important to note that as a whole they are widely distributed and parasitize many important foods and feed crops. In relation to cotton production in the southeastern
United States only two species are potential pathogens of upland cotton: R. reniformis and R. parvus. Of these only R. reniformis has been reported in Mississippi.
6
The Pathogen Rotylenchulus reniformis
Rotylenchulus reniformis is of particular importance to cotton growers because of losses in gross income resulting from the nematode’s parasitism of cotton cultivars grown in the Southeastern United States. All commercial cotton cultivars of upland cotton (G. hirsutum) grown in the southeastern United States are susceptible to R. reniformis (Usery et al., 2005, Weaver et al., 2007, Robbins et al., 2008). Resistance to R. reniformis has been identified in commercially grown soybean cultivars and soybean breeding lines used in the southeastern United States (Robbins et al., 2008). Resistance to R. reniformis has been characterized in the cotton species G. barbadense L. accession GB713 (Gutierrez et al., 2011). Two quantitative trait loci (QTL) conferring the resistance have been found to be linked on chromosome 21 and a third QTL on chromosome 18 of G. hirstutum L. in an intraspecific cross (Gutierrez et al., 2011).
Management Practices for Rotylenchulus reniformis
Currently cotton growers can manage the pathogen by using crop rotations with a non-host, such as corn, or with nematicide applications using 1, 3-dichloropropene
(Telone®), aldicarb (Temik®), and oxamyl (Vydate®) (Lawrence et al., 2005). The production of aldicarb has been discontinued limiting its use as a management option
(Mueller, 2011). Robinson (2007) reported that soil populations of 1 to 10 R. reniformis nematodes per cc can cause damage to cotton. Robinson (2007) also reported that growers commonly used treatment thresholds of 16 R. reniformis nematodes per gram
(5000 nematodes per 500 cc of soil) at the end of the growing season.
In states where R. reniformis is present, soybean growers can utilize results from variety evaluations for R. reniformis to aid with the variety selection. Growers can select 7
a resistant soybean variety to help lower R. reniformis population numbers for the following crop season. Resistant soybean varieties limit the reproduction of the nematode to lower values than susceptible soybean cultivars (Robbins et al., 2008). Soybean cultivars that are resistant and those that support lower numbers of R. reniformis are commonly used in management strategies for the nematode.
Sweet potatoes, like other susceptible crops, also benefit from crop rotation with a non-host crop. It has been demonstrated that the use of the nematicide aldicarb can help in the production of #1 sweet potato roots per plant (Henn et al., 2006). Like other susceptible crops, the use of aldicarb has been shown to increase sweet potato yields
(Abel et al., 2007). This is important because not only does nematode infestation reduce sweet potato yields, it reduces the quality of the crop due to cracking of the epidermis by the nematode (Yik and Birchfield, 1982).
All agricultural producers of susceptible crops should have their soil tested for the presence of plant-parasitic nematodes. Most states provide a nematode diagnostic service though their extension service. The state run nematode diagnostic labs are an extremely valuable asset to all row crop producers. Nematode diagnostic lab reports provide the species or genera of plant-parasitic nematode population levels found in a soil sample.
Nematode diagnostics have the potential to increase profits, through more optimal variety and cultural practices selection.
The Development of Molecular Diagnostic Tools for Nematodes
Several molecular diagnostic tests have been developed and utilized to diagnose and to confirm diagnoses of many plant-parasitic nematodes (Block et al., 2005, Gasser,
2006). To date, no molecular diagnostic test has been reported for Rotylenchulus 8
reniformis. One of the first molecular techniques for nematode species identification,
developed in the 1970’s, was isozyme analysis of the Meloidogyne genus (Dickson et al.,
1971) (reviewed in Esbenshade and Triantaphyllou, 1990). After the development of the
DNA amplification technology, polymerase chain reaction (PCR), the potential for molecular diagnostics increased dramatically. Nucleic acid based analysis of plant- parasitic nematodes began with the study of the genomic and mitochondrial DNA of
Meloidogyne juveniles (Harris et al., 1990). Researchers were quick to apply PCR– agarose-gel-based techniques for analysis of plant-parasitic nematodes, such as simple-
sequence length polymorphisms (SSLPs), restriction fragment length polymorphisms
(RFLPs), randomly amplified polymorphic DNA (RAPD), and amplified fragment length
polymorphism (AFLPs) (Gasser and Monti, 1997, Powers and Harris, 1993, Cenis, 1993,
Semblat et al., 1998). General descriptions, of the above mentioned methods and the
basic principles behind them, can be found in current genetic texts such as Griffiths et al.,
(2000). Subbotin and Moens (2006) provided a review of how these genetic analysis techniques are currently being applied in nematology. Appling these techniques, researchers collected specific taxons, extracted DNA, conducted PCR, used restriction enzymes where applicable, and analyzed the products on an agarose gel which resulted in a DNA fingerprint that was unique to the nematode taxon studied.
Molecular diagnostics involving PCR assays can obtain several types of data that
are useful for diagnostic studies. A type of PCR reaction that produces a single unique
amplicon specific to a taxon (e.g. genus Meloidogyne or species M. incognita) is easily utilized in diagnostic screening. Analysis of PCR assays that produce a specific amplicon can be quickly conducted by viewing the presence or absence of a specific band on an
9
agarose gel. Another type of information obtained by PCR assays is banding patterns of
DNA (also referred to as fingerprints) produced by electrophoresis on an agarose gel.
These fingerprinting methods, in which every band in a taxon must be compared with
other bands in different taxa, are more cumbersome to work with than single amplicon
and may involve complex interpretation. This would be disadvantageous if the goal of the
molecular analysis was not having highly skilled and expensive workers perform the
work. Diagnostic PCR assays that produce a single confirmative amplicon have many
characteristics that make them advantageous over fingerprinting diagnostic PCR assays
that use specific banding patterns to identify species or different taxa, including quicker
analysis and less training of personnel who conduct them.
Single amplicon diagnostic PCR assays have been designed for nematode
identification utilizing different methodologies which produce a species specific primer
pair. These methods include sequence characterized amplified region (SCAR) and RAPD
analyses. Zijlstra (2000) and Zijlstra et al. (2000) demonstrated this technique by
selectively amplifying species specific DNAs from M. chitwoodi, M. fallax, M. hapla, M.
incoginta, M. javanica, and M. arenaria. Other methods include those involving primer
design from sequenced genes such as heat shock protein 70 (HSP70), glucuronidase, and
the ribosomal DNA (rDNA) genes 28S, 18S, 5.8S, D2/D3, intergenic spacer (IGS),
intertranscribed spacer 1 (ITS1), intertranscribed spacer 2 (ITS2) (summarized in Table
3). In these cases, taxon specific primer pairs are designed from known gene sequences
(e.g. HSP70, glucuronidase and ribosomal DNA genes and spacers) by obtaining the homologous sequences of the genes for the target organism and off target organisms and
then aligning their primary sequence. Subsequently, primer pairs are selected in DNA
10
regions where they differ in sequence. The SCAR and RAPD species specific primer pair
generation is conducted by running a RAPD PCR reaction in which shorter primer pairs
are used, than those usually used in PCR. This RAPD technique leads to the production
of randomly amplified DNA from the target and off target organisms. After the PCR, the
randomly amplified DNA is subject to electrophoresis on an agarose gel. The banding
pattern on the gel that represents the amplified DNA fragments is analyzed. The bands
are identified that are only present in the target taxon which is the focus of the particular
analysis. The bands unique to the target taxon are excised from and their DNA is
sequenced. The sequence produced is used to generate new primers, either by extending
the original rapid primers used in the original PCR reaction, or by generating new
primers from the sequence within the RAPD amplicon. This procedure is performed just
as in the species specific primer pair generating process from the gene sequences. Review
articles and recent publications on the development of PCR assays have shown how PCR
assays are applied to the analysis of nematodes (Blok, 2005, Berry et al., 2008).
Importantly, PCR based genetic analysis has been adopted by many researchers to aid in
the study of plant-parasitic nematodes (Table 3, a list of research using such techniques).
Sequence alignments and comparisons are another type of genetic analysis. By aligning DNA sequences of specific loci, such as the ITS1, of an unknown nematode with alignment programs such as Basic Local Alignment Search Tool (Blast) or ClustalW, to
sequences reported from specific species, similarity among the species can be identified
(Altschul et al., 1990). The major drawback to this method is the lack of sequence
information for the order Tylenchida, the order containing most of the plant-parasitic
nematodes. If more sequence data were available, this technique would be more useful,
11
but currently few plant-parasitic nematodes are represented in genetic sequence data collections such as NCBI.
DNA analysis, as seen above, is a very useful tool. An extension of DNA analysis is metagenomic DNA analysis. Metagenomic DNA is a pool of DNA that has been extracted directly from the environment. Thus, metagenomic DNA is a collection of
DNA that represents the sum total of DNA from all organisms in an environment. An example of metagenomic DNA being used in nematology can be found in Yan et al.,
(2008). Yan et al., (2008) showed that metagenomic DNA can be extracted directly from soil and used as a template in species specific PCR assays for Pratylenchus neglectus and
P. thornei.
Quantitative PCR
The PCR-based strategy is useful because it can provide information on the presence of a particular organism in an environmental sample. An extension of the PCR method ushers in quantitative capability, allowing the researcher to estimate the number of individuals in a population. This method, known as real-time PCR or quantitative PCR
(qPCR), differs from the PCR reaction by incorporating a molecular tag that is used to measure amplification products during the PCR reaction. The ability to measure amplification during the PCR reaction provides a way to analytically determine the amount of DNA starting material by comparison of known standards to the unknown samples. Quantitative PCR is quantitative because it uses the amount of DNA present in a sample to obtain a cycle threshold (Ct) value which corresponds to the amount of DNA isolated from the pathogen (Livak and Schmittgen, 2001). Quantitative PCR is advantageous over regular PCR because it provides a quick, gel free way to screen PCR 12
reactions, which can increase work output relative to the time invested by the investigator
to conduct the reaction. The procedure is gel free because the analyses are done during
the PCR reaction by the real-time thermocycling machine used to conduct the qPCR. By
accurately and effectively detecting the different levels of template DNA present from a
desired genome(s), estimates of the amount of the individuals (e.g. number of individuals
or number of colony forming units) can be generated from a designed model.
Currently, the potential of qPCR for diagnostic nematology and its suitability has yet to be determined and its utilization is in its infancy. Population estimates (i.e. the
number of nematodes in a sample) for species such as: Meloidogyne javanica,
Pratylenchus zeae, and Xiphinema elongatum have been determined with qPCR on native
soil samples from trial plots (Berry et al., 2008). As with single amplicon diagnostic
PCR assays, qPCR diagnostic assays have been designed from relatively few loci in
plant-parasitic nematodes, but include loci such as rDNA, major sperm protein 1 (Mspl),
and satellite DNA, specifically (Table 4).
In contrast to the dearth of studies in using qPCR for analyses involving plant- parasitic nematodes, qPCR’s ability to quantify the PCR amplification process is a highly utilized tool in pathogen detection. It has been used to identify and quantify various bacteria, fungi, and viruses (Atallah and Stevenson, 2006, Gao et al., 2004; Okubara, et
al., 2008, Finetti-Sialer and Ciancio et al., 2005). In those studies the samples were taken
from soil, plant tissues, or nematode samples.
Nematode Genomics Usefulness to Molecular Diagnostics
DNA sequencing is used in the design of PCR assays that can distinguish
different plant-parasitic nematodes. Since the year 2000, a substantial increase of DNA 13
sequencing has taken place due to the abundance and accessibility of DNA technology.
The nematode Caenorhabditis elegans was the first multicellular organism in which its
genome was sequenced (The Caenorhabditis elegans Sequencing Consortium, 1998).
Similar work was completed for C. elegans relative C. briggsae (Stein et al., 2003).
Having 2 nematode species’ genomic sequences allowed for comparative genomics to take place within the Nematoda phylum. To date, only two plant-parasitic genomes have
been sequenced and published. Those genomes include Meloidogyne incognita (Abad et
al., 2008) and Meloidogyne hapla (Opperman et al., 2008). The sequencing of M.
incognita and M. hapla has readily provided enormous amounts of data that can be used
for many applications. The sequencing project allows researchers to compare genes of the
plant-parasitic nematodes to genes in other plant-parasitic nematodes and many other
organisms. Specifically, C. elegans has been a useful tool for cellular and developmental
biologists and it possesses the highest quality annotated genome of any nematode because
of the extensive genetic and molecular work done on it. The C. elegans research
community has established a data warehouse at the website http://www.wormbase.org/
which houses the genomic sequence, as well as bioinformatics-based information.
Reverse genetic information of C. elegans development received a substantial boost by
the identification of RNA interference (RNAi) (Fire et al., 1998). Subsequent studies
determined that RNAi also works in plant-parasitic nematodes (Urwin et al., 2001;
Alkharouf et al., 2007; Klink et al., 2009).
Alkharouf et al. (2007) made a comparative analysis between approximately
24,000 ESTs from Heterodera glycines and both the genome and EST sequences of C. elegans. The purpose of the analysis was to identify genes with a very high probability of
14
being essential for the viability of H. glycines. The analysis of the 24,000 H. glycines
ESTs resulted in them filtering down into 8,334 unigenes. Those unigenes were then compared to the C. elegans sequences and parsed into six groups based on the conservation level of their primary DNA sequences. The group, Group 1, with the highest conserved gene sequences had 1508 genes. Group 1 genes were the most highly conserved between H. glycines and C. elegans, 266 were also shown to have lethal RNAi phenocopies when silenced or mutated in C. elegans (Alkharouf et al., 2007). These
genes, while clearly being homologs, were also shown to function in a similar manner
between H. glycines and C. elegans in yielding lethal phenocopies in H. glycines
(Alkharouf et al., 2007; Klink et al., 2009).
A massive amount of data is generated in DNA-oriented, computer-managed
analyses, especially when accompanied by functional data from numerous labs from
around the world. Computer programs aid in the evaluation of genetic sequences through
manipulation of FASTA formatted files that contain the sequences. BioPerl is a toolbox
of Perl scripts that aid in the handling of biological sequences in the computer language
Perl. Programs including Blast, ClustalW, Megalign®, Primerselect®, and Primer3 are
commonly used to search, align, and develop primers from FASTA files. (Rozen and
Skaletsky, 1999) The use of novel script writing aids in handling large datasets that
otherwise would be overwhelming to analyze by hand.
Thesis Objective
The objective of this study was to evaluate qPCR’s potential to identify and
quantify the presence of R. reniformis from a soil sample. The first step to achieve the
objective was to design R. reniformis primers specific for the ITS1 sequence reported by 15
Agudelo (2005) and evaluate the primers’ ability to selectively amplify R. reniformis
DNA from metagenomic DNA. Metagenomic DNA tested consists of DNA extracted
from multiple samples from different locations that did and did not contain R. reniformis.
The Agudelo (2005) ITS1 sequence was selected because it contained the most studied genetic sequence from any R. reniformis. This first step would also provide a premise for the conduction of the subsequent steps by showing that indeed R. reniformis DNA can be selectively amplified from metagenomic DNA, leading to our utilization of qPCR an extension of PCR. Our second step was to develop more R. reniformis primers from the remaining sequence data available, specifically the EST sequences deposited in GenBank by Wubben et al. (2010). Subsequent analyses resulted in the development of a novel bioinformatics pipeline used to compare R. reniformis EST sequences to other plant– parasitic nematode EST sequences and C. elegans RNAi lethal genes. The sequences from plant-parasitic nematodes H. glycines and Meloidogyne sp. provided a framework on which discrimination against other nematodes could be built. The analyses permitted the generation of genus-specific primers for those DNA sequences identified that could provide enough information to form a basis for discrimination. Our third step towards our objective was to use the R. reniformis specific primer pairs developed in the second step
(above) in a TaqMan® qPCR assay for the identification and quantification of R. reniformis. The R. reniformis specific primers generated in this study were screened through traditional PCR to determine their specificity. Once a primer pair was shown to be specific to R. reniformis, TaqMan® qPCR probes were created. The fourth and final step of this study was to evaluate the R. reniformis qPCR assay, developed in this study, for its potential to diagnose and quantify R. reniformis from field samples. Thus, by
16
completing these steps the objective of this study, to evaluate qPCR’s potential to identify
and quantify the presence of R. reniformis from a soil sample, will be met.
MATERIALS AND METHODS
Procurement of Nematodes
Cultures of R. reniformis (Linford and Oliveira, 1940) originally collected from a cotton field located near Tallahatchie, Mississippi (Figure 3), were maintained on the host
Gossypium hirsutum L. (cotton). Cultures of M. incognita (Chitwood, 1949) were
collected from an infested cotton field near Leflore, Mississippi (Figure 3), and were
maintained on Lycopersicon esculentum (L.) (tomato). Both of the cultures were
maintained in the Nematology Research glasshouse at Mississippi Agriculture and
Forestry Experiment Station (MAFES)’s R.R. Foil Plant Science Research Facility. M.
incognita was used in the study to screen for unwanted off-target amplification in the
assays. Since the potential for genes to be conserved among nematodes exist, M.
incognita was included in assays to show that the genes were not conserved among plant-
parasitic nematodes. Supplemental fluorescent light was provided to bring the day length
to a 16 hour day/8 hour night cycle. Temperatures were kept at a constant temperature
range between 28.9-34.4oC (84.0-94.0oF). Nematodes were cultured in 500 cm3 diameter
polystyrene cups (WinCup®, cat.# 208844; Phoenix, AZ) for a period of 2-6 months in a
50-50 (v/v) mixture of a Freestone fine sandy loam (46.25 % sand, 46.50 % silt, and 7.25
% clay) and builders sand.
Nematode extractions from plant samples cultured and maintained in the
glasshouse were performed according to the procedures reported by Lawrence et al.
(2005). Vermiform life stages were harvested for each nematode, including R. reniformis 17
and M. incognita. Soil and roots were submerged in tap water and agitated by hand to
loosen the soil from the roots. The nematodes were brought into suspension by hand
agitation followed by gravity sieving and sucrose floatation (specific gravity = 1.13)
(Lawrence et al. (2005)). All isolated vermiform life stages of each nematode were
identified utilizing a Nikon® Eclipse TS100® inverted microscope set to 40X.
Alternatively, visualization was performed under magnifications up to 400X, if needed.
Nematode samples were kept at 4°C until DNA isolations were conducted.
Nematode samples from alternative locations were obtained from cotton fields in
Calhoun, Chickasaw, and Carroll counties in Mississippi (Figure 3, Table 5). The R.
reniformis identification in the soil samples was performed by the Mississippi State
University (MSU) Extension Service Nematology Lab, Mississippi State, MS. The
nematode samples consisted of vermiform life stages of R. reniformis and other soil inhabiting nematodes including plant-parasites extracted by the MSU-ES Nematology
Lab.
Additional crop production field soil samples containing many different species of nematodes were collected in Mississippi, Missouri, and Illinois (Figure 3, Table 5).
Isolates were collected from each infested soil site. Nematode populations were identified and quantified through soil extractions and microscopic examinations as described previously. In addition to the 3 samples obtained from the MSU-ES determined to contain R. reniformis, another site in Oktibbeha county, MS was sampled and determined to contain R. reniformis through extraction and visual inspection (Figure 3, Table 5). A
500 cm3 soil sample was collected from the top 15.2 cm (6 inches) of the soil with a soil
probe at each site. The soil was homogenized by hand and a 150 cm3 sub sample was
18
extracted by gravity sieving and sucrose flotation as described previously. Isolated
vermiform nematodes were kept at 4°C, until DNA isolations were conducted.
Metagenomic Nematode DNA Isolation
Metagenomic DNA isolations were conducted by using the Powersoil® DNA extraction kit® (MO BIO Laboratories, Inc; cat # 12888-50; Carlsbad, CA). The manufacturer’s protocol was followed with modifications. The modifications were determined empirically during the development of the nematode DNA isolation procedure. The modifications included the omission of the addition of the 0.25 grams of soil in step 1. In its place, 0.3 ml of the nematode suspension, extracted from either glasshouse pots or field soil, was pipetted into the bead beating tube. Secondly, in steps that instructed to remove supernatant, a standard volume of 400 µl of supernatant was removed from each tube. The DNA was eluted from the spin column into the supplied microcenterfuge tube with 100 µl of nuclease free water (Promega cat # P119C;
Madison, WI) and stored at –40° C.
Rotylenchulus reniformis ITS1 Primer Design
A FASTA file was created for the intertranscribed spacer 1 (ITS1) sequence reported in Agudelo et al. (2005). Megalign® from the Lasergene® software package
(DNASTAR®; Madison, WI) was used to open the FASTA outfile. The program performed a Blastn (National Center for Biotechnology Information [NCBI] http://www.ncbi.nlm.nih.gov/) alignment of the R. reniformis ITS1 sequence to the
GenBank nucleotide (nt) database to identify similar sequences, download the sequences
producing hits, and subsequently performed a ClustalW alignment of these sequences.
19
Areas of R. reniformis sequences from the ClustalW alignment that had very few matching bases with other plant-parasitic nematodes were selected for further analysis for generation of the primer pairs. These regions were considered divergent. The divergent regions would maximize the probability of obtaining specific DNA amplification by PCR for R. reniformis, because the primers were made from DNA sequences only found in R. reniformis and different in other nematode species. Sequences were trimmed to retain the divergent areas. This trimming procedure removed DNA regions that were common in
DNA primary sequences between the different nematode species. PrimerSelect® of the
Lasergene® software package was used to generate the primer pair Rotylenchulus
reniformis ITS1 (RrITS1) (Table 6).
Rotylenchulus reniformis ITS1 Primer Pair Evaluation
Metagenomic nematode DNA was isolated from 8 soil samples taken from 4
locations in which R. reniformis was present, and 4 locations where R. reniformis was not
present (Figure 3, Table 5). One ml aliquot of the nematode suspension was added to a
bead beating tube in which the bead solution had been removed. The nematodes were
centrifuged at 2,000 rpm for 6 minutes. This was followed by removing 800 μl of
supernatant then adding bead solutions back into the tube. The manufacturer’s protocol
was then followed to completion. An additional 4 locations were sampled in which R.
reniformis was not present, as determined by visual inspection and described earlier
(Figure 3, Table 5). A 50 µl PCR reaction consisting of 2 µl template, 1.5 µl of 100 nM
forward and reverse primers each (Table 1.1), 20 µl nuclease free water (Ambion; cat
#AM9937; Grand Island, NY) and 25 µl Gotaq Green Master Mix (Promega; cat
#M7122; Madison, WI) was used to amplify DNA. The reaction conditions, as reported 20
by Agudelo et al. (2005), were modified to include a 2 minute pre-denaturation step at
94oC. The procedure then followed the Agudelo et al. (2005) protocol that included a denaturation at 94oC for 45 sec, annealing at 54 oC for 45 sec and primer extension at
72oC for 60 sec for 40 cycles. The PCR products were run out by gel electrophoresis on a
1% agarose (Sigma cat # A9539-25g; St. Louis, MO) gel with 0.01% ethidium bromide
incorporated into the gel. The PCR products were visualized and recorded with digital
imagery using a FOTO/Analyst Apprentice System® (FOTODYNE® Inc.; Hartland,
WI).
Rotylenchulus reniformis qPCR Primer and Probe Design
Genes that are conserved in primary DNA sequences between different nematode
species facilitated DNA primer design for R. reniformis. The free-living, genetic model
nematode, C. elegans, was used to base bioinformatics comparisons because its genome
is sequenced (The C. elegans Sequencing Consortium, 1998) and genes that are essential
for its viability (i.e. lethal, when nonfunctional) have been identified and are well studied
at the molecular level (Kamath et al., 2003; Sonnichsen et al., 2005). To identify genes
that are conserved and essential in function between the different nematode species, a
database of C. elegans homologs was identified in the plant-parasitic nematode, H.
glycines (Alkharouf et al., 2007). The DNA sequences for H. glycines were downloaded
in FASTA format from GenBank as reported in Alkharouf et al. (2007) (Figure 4). By performing this analysis, the H. glycines sequences acted as a surrogate for the identification of conserved and essential R. reniformis genes. The H. glycines genes were
originally parsed into six groups that represented different levels of DNA sequence
conservation between C. elegans and H. glycines (Alkharouf et al., 2007). For the 21
identification of candidate R. reniformis genes, Group1 H. glycines unigenes (Alkharouf et al., 2007) that represent the most highly conserved genes between C. elegans and H. glycines were selected. The genes were selected because they also represent ones that would have the highest probability of being truly orthologous, rather than being genes exhibiting DNA sequence conservation without having the same function or evolutionary lineage. A local comparative analysis nucleotide Blast database was generated by running formatdb, with the nucleotide option, from the Blastall suite (Camacho et al. 2009). The cDNA’s, from a transcriptome study of a R. reniformis adult female, were downloaded from GenBank (Wubben et al., 2010). A Perl script (Appendix section, Perl script #1) was written to perform and parse a standalone Blastn alignment of the 2004 reported cDNA’s to the essential (i.e. lethal when inactive) C. elegans genes, from which H. glycines homologs were originally identified (Alkharouf et al., 2007). The Perl script created a FASTA outfile that contained all the query R. reniformis sequences that found a successful DNA sequence match in the alignment. The R. reniformis cDNA sequences in the outfile were used in the second Perl program (Appendix Perl script #2) which conducted a standalone Blast against a database of all Meloidogyne sp. Expressed
Sequence Tag (EST) sequences reported in www.nematode.net (Wylie et al. 2004). A
FASTA outfile was created from Perl script #2 for each query R. reniformis sequence that had a successful match. The FASTA outfile that was created contained the sequence of the R. reniformis query and all matches found in the Meloidogyne sp. Database.
Megalign® from the Lasergene® software package (DNASTAR® Madison, WI) was used to open the FASTA outfile. This program performed a net NCBI Blastn alignment to identify functionality and download other similar sequences (Tables 10 and 11). The
22
program also performed a ClustalW alignment of all the sequences. Areas of R.
reniformis sequences from the ClustalW alignment that had very few matching bases were selected for the R. reniformis specific primer generation. These regions are
divergent areas of DNA sequence as previously described in the R. reniformis Specific
Primer Design Materials and Methods section of this thesis. The sequences were trimmed
to the divergent areas and imported into PrimerSelect® of the Lasergene® software
package. Rotylenchulus reniformis specific primer pairs were generated using
PrimerSelect® to produce quality primers with a product between the 100 - 400 bp
(Table 12). The primers were first tested for their specificity in PCR reactions. The best
primer pairs, that included the Hit 2 alt and the Hit 7, were subsequently used in qPCR
analyses. Probe sequences were selected from within the predicted PCR product for each
of the R. reniformis sequences. The primer generating program Primer3 was also used as
an alternative method to generate the R. reniformis specific primer pair and probe by
entering the trimmed divergent R. reniformis sequence into the Primer3 web server
(Rozen and Skaletsky, 1999) (Table 12).
Evaluation of potential qPCR Primer Pair Specificity
The potential R. reniformis specific qPCR primer pair evaluation was done by
performing a PCR reaction containing metagenomic DNA isolated from the glasshouse
cultures of R. reniformis and M. incognita. All potential R. reniformis specific primer
pairs (Table 12) were evaluated. Reaction conditions were 12.5 µl Gotaq Master mix
polymerase (Promega), 2 µl template DNA, 8.5 nuclease free water (Ambion), 1 µl 100
nM forward primer and 1 µl 100 nM reverse primer were used in the PCR reactions. PCR
23
cycle conditions were as described in the Rotylenchulus reniformis ITS1 Primer Pair
Evaluation section of this thesis.
Field Nematode Sampling and Extractions for qPCR
Three sampling sites were selected in Oktibbeha County, MS for sampling
nematodes for the qPCR analysis (Figure 5). The sampling sites included (1) a mixed
Fescue-warm season grass pasture (South Farm [SF]) where R. reniformis has not been
found in previous soil sampling (Figure 6A), (2) a cotton field (site referred to as Cotton)
known to be infested with R. reniformis as determined by previous soil sampling for
nematodes from the site (Figure 6B), (3) a corn field, (site referred to as Corn) known to
contain low levels of R. reniformis in isolated locations as determined by previous soil
sampling for nematodes (Figure 6C). The GPS coordinates for each site are presented
(Table 7). Three 500 cm3 soil samples were collected from the top 15.24 cm (6 inches) of soil with a soil probe at 3 sites (Corn, Cotton, South Farm) as described in the
Procurement of Nematodes section. Sampling was conducted independently for both Hit
2 alt and Hit 7 qPCR assays (Table 8 and 9, respectfully). All soil samples were processed as previously described in the Procurement of Nematodes section of the
Materials and Methods. The extracted plant-parasitic nematodes were identified morphologically utilizing the Inverted TS100 Nikon microscope (Table 8 and 9). Isolated vermiform nematodes were kept at 4°C until the DNA isolations were finished.
Metagenomic Nematode DNA Extractions for qPCR
Metagenomic DNA isolations from soil extracted nematodes were conducted by using the Powersoil® DNA extraction kit® (MO BIO Laboratories) as described
24
previously in the Metagenomic Nematode DNA Isolation section. Metagenomic DNA
was isolated from each soil samples collected during the Hit 2 alt and Hit 7 qPCR assay collections (Tables 8 and 9).
PCR Assays on Soil Extracted Nematodes for select qPCR Primer Pairs
The metagenomic DNA, extracted in triplicate from soil extracted nematodes from the three sample sites for each of the three sample locations from the Hit 7 collection site (Table 9), was used in a PCR reaction with primer pairs Hit 2 alt and Hit 7.
The nematode sampling and metagenomic DNA extraction method were described
previously in the Field Nematode Sampling and Extractions for qPCR and Metagenomic
Nematode DNA Extractions for qPCR sections, respectfully. The 20 µl PCR reaction
conditions included a 10 µl Taqman® Gene Expression Master Mix (Applied
Biosystems; cat #4369016; Foster City, CA), 1 µl 100 µM forward primer, 1 µl 100 uM
reverse primer, 4 µl nuclease free water (Ambion) and 4 µl metagenomic template DNA.
Analysis of the PCR reactions on agarose gels was conducted as previously described in
R. reniformis ITS1 Primer Pair Evaluation section.
PCR Assays on Metagenomic DNA Isolated Directly from Soil Using the qPCR Primer Pairs
To test the potential for the qPCR primer pairs to detect R. reniformis and
discriminate against off target soil inhabiting nematodes, PCR using template
metagenomic DNA, isolated directly from soil containing the naturally occurring
nematode fauna, in which R. reniformis was found to be present or not present, was
conducted. Metagenomic DNA was extracted from 0.5 grams of soil from each of the 9
soil samples taken for Hit 7 evaluation (See Field Nematode Sampling and Extractions 25
for qPCR) (Table 9). Metagenomic DNA was extracted as specified by the manufacturer’s protocol, with the one exception being using 0.5 grams of soil instead of
0.25 grams of soil. Two sets of PCR reactions were conducted with either Hit 2 alt or Hit
7 primer pairs in the PCR reaction. The PCR reaction conditions were described
previously in PCR Assays on Soil Extracted Nematodes for Select qPCR Primer Pairs.
Quantitative PCR Probe and Instrumentation
TaqMan® 6-carboxyfluorescein (6-FAM) (MWG Operon; Birmingham, AL) was
used to label probes in the qPCR. The 6-FAM probes have a maximum excitation at 495
nm and maximum emission at 520 nm. The quencher used in the qPCR reactions was the
Black Hole Quencher (BHQ1) (MWG Operon), with maximum excitation at 534 nm.
Assays were conducted for qPCR primer pairs that produced a single amplicon and had
no off target amplification. Quantitative PCR cycle conditions were as described in the
TaqMan® Gene Expression Master Mix (Applied Biosystems; cat #4369016; Foster
City, CA) manufacturer’s protocol. The amplification conditions described were two
initial single cycle steps UDG Incubation 2 min at 50 °C, AmpliTaq Gold, UP Enzyme
Activation 10 min at 95°C followed by a two step PCR reaction holding 15 sec at 95°C
and 1 min at 60°C for 40 cycles. The qPCR reactions were performed on an ABI 7300
(Applied Biosystems®). An average Ct value for each sample was obtained from qPCR
reactions conducted in triplicate. Access to the ABI 7300 was kindly provided by Dr.
John Brooks, Genetics and Precision Agriculture Research Unit, United States
Department of Agriculture/Agricultural Research Service, Mississippi State, MS 39762-
5267.
26
Hit 2 alt qPCR Assay Conducted on Cultured Extracted Rotylenchulus reniformis
To generate a standard curve for the amount of R. reniformis in a soil sample, approximately 1,000 vermiform R. reniformis nematodes in 0.3 ml of water were placed into the Powersoil® DNA isolation kit® (MO BIO Laboratories, Inc.) bead beating tubes and extracted as described previously in the Metagenomic Nematode DNA Extractions for qPCR section. Vermiform nematodes were isolated from cultures maintained on site, as described previously in Procurement of Nematodes. Three replicates of 1:10 serial dilutions of DNA extracted from approximately 1,000 nematodes were created and used for generation of the standard curve by qPCR.
For the Hit 2 alt qPCR assay to evaluate the accuracy of the standard curve a serial dilution of nematodes was made for the sample to contain an estimated 100, 10, and 1 nematodes with a water control (without nematodes) placed in the bead beating tube. DNA was isolated by the Powersoil® DNA isolation kit® as described previously in the Metagenomic Nematode DNA Isolation for qPCR section.
Hit 2 alt qPCR Assay Conducted on Extracted Nematodes from Field Samples
Three field soil sites were used in the analysis (Table 8). At each site, samples were collected in triplicate as described in the Field Nematode Sampling and Extractions for qPCR section. Each field soil sample was homogenized by hand. One hundred fifty mm3 of field soil was extracted as described previously in the Field Nematode Sampling and Extractions for qPCR Materials and Methods section. Nematodes were brought to a total volume of 7.5 ml and enumerated. 300 µl aliquots of the nematode suspensions were placed into the bead beating tube (MO BIO Laboratories, Inc.). The DNA isolation procedure was done with the Powersoil® DNA isolation kit® (MO BIO Laboratories, 27
Inc.) bead beating tubes and extracted as described previously in the Metagenomic
Nematode DNA Isolation for qPCR procedure found in the Materials and Methods
section. The qPCR reaction conditions included a 10 ul Taqman Gene Expression Master
Mix (Applied Biosystems; cat #4369016; Foster City, CA), 0.9 µl 100 µM forward primer, 0.9 µl 100 µM reverse primer, 2 µl 2.5 µM 6-FAM (MWG Operon®) probe and
4.4 µl metagenomic template DNA. The Hit 2 alt qPCR reaction was performed as described previously in the Quantitative PCR Probe and Instrumentation Materials and
Methods section.
Hit 7 qPCR Assay Conducted on Extracted Cultured Rotylenchulus reniformis
To generate a standard curve for the amount of R. reniformis in a soil sample,
1,000 vermiform life stage R. reniformis nematodes in 0.3 ml of water were placed into the Powersoil® DNA isolation kit® (MO BIO Laboratories, Inc.) bead beating tubes and extracted as described previously in the Metagenomic Nematode DNA Isolation for qPCR section. The vermiform R. reniformis used were isolated from the glasshouse cultures maintained on site as described previously in Procurement of Nematodes. A 1:10 serial dilution of DNA extracted from approximately 1,000 nematodes was created and used for generation of the standard curve by qPCR. The standard curve was generated from the above run in triplicate.
For the Hit 7 qPCR assay to evaluate the accuracy of the standard curve, samples containing exactly 100, 10, 1, and 0 vermiform R. reniformis nematodes were hand collected in triplicate under a stereomicroscope and DNA was isolated using the
Powersoil® DNA isolation kit® as described previously in the Metagenomic Nematode
DNA Isolation for qPCR. The 1,000 and 100 individual nematodes were isolated and 28
placed in a microcenterfuge tube. After the collection of the 1,000 and 100 individual nematodes, the samples were centrifuged (for 6 min at 2,000 rpm x g) and the supernatant removed to a volume of 0.3 ml. Concerning the collection of 10 and 1 individual nematode(s), the volume was brought to 0.3 ml. The samples then were subjected to
DNA isolation with the Powersoil® DNA isolation kit® (MO BIO Laboratories, Inc.) bead beating tubes and extracted as described previously in the Metagenomic Nematode
DNA Isolation for qPCR.
Hit 7 qPCR Assay Conducted on Extracted Nematodes from Field Samples
The nematodes used to conduct the Hit 7 qPCR from field samples were isolated as described in the section Field Nematode Sampling and Extractions for qPCR. The replicates of samples were used and three qPCR reactions for each sample were conducted. The qPCR reaction conditions are described in the Quantitative PCR Probe and Instrumentation section above.
Hit 7 qPCR Assay on Direct Soil Metagenomic DNA
To test the potential for detection and quantification of nematodes from metagenomic DNA extracted directly from soil with qPCR assays the Hit 7 qPCR assay was conducted on the metagenomic DNA isolated previously in the section PCR assays on Metagenomic DNA Isolated Directly from Soil using the qPCR Primer Pairs, with the
Hit 7 qPCR Primer Pair and probe.
Confirmation of PCR amplification in PCR and the qPCR reactions
To confirm that the DNA amplification in both PCR and qPCR reactions were products of R. reniformis DNA and not spurious amplification of off-target DNA, PCR 29
DNA amplification products were subjected to electrophoresis on a 1% agarose gel, then
excised. The excised DNA was purified using the Qiaquick Gel Extaction Kit (Qiagen cat
#28704; Valencia, CA) according to the manufacturer’s specifications. The purified DNA was ligated into the pGEM®-T Vector System II (Promega; cat# A3610). The ligation reaction product was transformed into competent JM109 cells and plated on 50 ug/ml ampicillin on LB-agar plates. White colonies growing on the selective media, presumed to contain the amplicon insert in the pGEM®-T Vector, were selected and grown (@
37oC overnight) in liquid culture in LB media containing 50 ug/ml ampicillin. Plasmid
DNA was isolated from the bacteria using the Qiaprep kit (Qiagen cat # 27106). The
DNA from the plasmid preps was sequenced to determine if the DNA amplification product was correctly amplifying the proper target. The DNA sequence was trimmed using the Crimson Editing freeware (http://www.crimsoneditor.com/). In this procedure,
the pGEM®-T Vector DNA sequence was trimmed leaving the qPCR-generated
sequence. The trimmed sequence was aligned in GenBank using the Blastn query option.
RESULTS
Procurement of Nematodes
Nematode populations used in the analysis were obtained from three main
sources. The first source included glasshouse cultured R. reniformis and M. incognita. A
second source of nematode populations was 3 nematode samples obtained through the
Mississippi Extension Service through the cooperation of growers at various sites in the
state of Mississippi (Figure 3A). These samples originated from Calhoun, Chickasaw,
and Carroll counties MS, and all contained R. reniformis. The third source was soil
samples from specific sites in Mississippi, Illinois and Missouri (Figure 3B, C; Table 5) 30
that were known to either harbor or lack R. reniformis. A soil sample from Oktibbeha
county Mississippi was determined to contain R. reniformis. Soil samples from
Mississippi and Scott counties Missouri and Pope and Massac counties Illinois were
determined not to contain R. reniformis. Although, the soil samples did not contain R.
reniformis they did contain other soil dwelling plant-parasitic nematodes
Rotylenchulus reniformis ITS1 Primer Pair Evaluation
The RrITS1 Primer Pair evaluation was conducted to determine if the designed primers would specifically amplify Rotylenchulus reniformis DNA. The RrITS1 primer
pair PCR reaction produced robust amplification at the expected size of 126 bp, as
determined by the in silico amplification product, in samples that had R. reniformis
(Figure 7). The PCR reaction produced less amplification in samples that lacked R. reniformis (Figure 7). However, there appeared to be a faint band at 100 bp (Figure 7).
Due to the undesired amplification in samples lacking R. reniformis, additional experiments were conducted to design PCR primers that would have more specificity to
R. reniformis.
Rotylenchulus reniformis Specific PCR Primer Pair and Probe Design
PCR primer pairs and probes were designed to develop a qPCR-based method to determine the presence of nematode species in soil samples. To accomplish this, a bioinformatic-based pipeline was developed (Figure 4). The pipeline consisted of Perl scripts developed (Appendix 1 and 2) that allowed for the identification of 14 R. reniformis genes (Figure 4; Table 10) that were found similar to genes from other plant- parasitic nematodes with Blastx (Table 11). Four potential R. reniformis specific primer
31
pairs were subsequently designed (Table 12). The Hit 2 (Figure 8) and Hit 7 (Figure 9) gene sequences became the focus of further investigations because they had a low number of unique sequences present in the database (Table 10). The primary DNA sequences of R. reniformis Hit 2, Hit 7, and the 28S ribosomal rDNA genes were independently verified through molecular cloning and subsequent capillary sequencing
(Figure 8, 9, 10) (see section Confirmation of PCR Amplification in PCR and the qPCR
Reactions). The Hit 2 (Figure 11) and Hit 7 (Figure 12) genes contained regions that were different in primary DNA sequence from the plant-parasitic nematodes H. glycine, and
Meloidogyne sp. From both Hit 2 (Figure 13) and Hit 7 (Figure 14) gene sequences, qPCR primers and their Taqman® probes were designed (Table 12). The primers were used in PCR reactions on R. reniformis and M. incognita DNA (Figure 15).
Evaluation of Potential qPCR Primer Pair Specificity
Three out of four of the potential qPCR primer pairs showed specificity to R. reniformis (Figure 15). The Hit 2 primer pair failed to amplify R. reniformis DNA, hence showing no specify to R. reniformis. Primer pairs Hit 2 alt and Hit 7 were selected for use in qPCR. The Hit 8 primer pair was not selected because it produced multiple amplicons in the reaction with the R. reniformis template DNA. The off-target organism M. incognita produced only faint miss-priming PCR products on the Hit 8 and Hit 2 alt primer pairs. The gel image (Figure 15) of PCR products for qPCR primer pairs demonstrated that the Hit 2 alt and Hit 7 primer pairs yielded robust amplification specifically to R. reniformis and not M. incognita.
32
Field Nematode Sampling and Extractions for qPCR
The soil samples that were collected from three local sites in Oktibbeha County
(Figure 6) to determine the possibility of developing a field-oriented, PCR-based
methodology to identify the presence of R.reniformis were found to contain plant- parasitic nematodes. The numbers of vermiform R. reniformis found to be present in the soil samples ranged from 5676 to 0 per 500 cc of soil (Tables 8 and 9). Off-target plant- parasitic nematodes belonging to taxons such as Meloidogyne sp., Helicotylenchus sp.,
Mesocriconema sp., Pratylenchus sp., and Tylenchorhynchous sp. were identified. These off-target organisms were found in the samples that contained and did not contain R. reniformis. The presence of off-target plant-parasitic nematodes, especially in the samples not containing R. reniformis, allowed us to test the specificity of the probes for
R. reniformis.
PCR Assays on Soil Extracted Nematodes for select qPCR Primer Pairs
The numbers of nematodes per 500 mm3 of soil from the SF, Cotton and Corn
sites ranged as follows: R. reniformis [0-3470], Meloidogyne spp.[0-27], Helicotylenchus
spp. [0-1110], Mesocriconema spp.[0-177], Pratylenchus spp. [0-277],
Tylenchorhynchous spp. [0-193] and free-living (not plant-parasitic) nematodes [220-
5887] (Table 9). The Hit 2 alt qPCR reaction showed a faint band indicating
amplification from all sites (Figure 16), including sites that did not have R. reniformis
present based on visual inspection under a microscope. Both negative controls (Figure
16; lanes 28 and 29) lacked amplification.
In contrast to the Hit 2 alt, the Hit 7 primers amplified DNA only in sites where
visual identification of R. reniformis was confirmed (Figure 17). Lanes 1-15 that lacked 33
R. reniformis had no Hit 7 amplification (Figure 17). However, it appears as though the
threshold for positive identification lies between 2 and 12 nematodes because none of the sites with approximately 2 R. reniformis nematodes yielded positive amplification
(Figure 17, lanes 16-18). Two of the three sites (lanes 22 and 23) that had 8 individuals of
R. reniformis had amplification (Figure 17). All sites with at least 12 individual R. reniformis nematodes (lanes 19-21 and 25-27) had amplification (Figure 17).
PCR Assays on Metagenomic DNA Isolated Directly from Soil using the qPCR Primer Pairs
The qPCR primer pairs PCR reaction products for the Hit 2 alt primed reactions were subject to electrophoresis on a 2 % agarose gel (Figure 18). In all cases, including the 3 SF sites and the 2 Corn sites that lack R. reniformis, the Hit 2 alt primer pair amplified DNA (Figure 18A). The Hit 2 alt primer pair did not amplify the negative controls (Figure 18A).
The Hit 7 primed reactions exhibited spurious amplification in 2 of the 5 SF
samples which should not have had any amplification (Figure 18B). In lane 1, the
amplification product is approximately 100 bp while in lane 3, the amplification product
is approximately 500 bp (Figure 18B). The expected size is 300 bp for R. reniformis. The
two Corn sites which lacked nematodes lacked amplification as expected (Figure 18B).
The SF3 site that had 2 R. reniformis present in the 0.5 g of soil used in the metagenomic
DNA extraction (extrapolated from the 500 cc count), yielded positive amplification of
the expected 300 bp size (Figure 18B). The three Cotton sites that had 41, 8 and 12
nematodes, extrapolated from the 500 cc count, yielded strong amplification of 300 bp
(Figure 18B).
34
Hit 2 alt qPCR Assay Conducted on Cultured Extracted Rotylenchulus reniformis
The standard curve for the Hit 2 alt qPCR assay was determined to have a slope of
-3.226840 and a y-intercept of 36.571972. The R² value of the standard curve was
0.993385. The generation of the standard curve (Figure 19) demonstrated that the DNA could readily be amplified in a quantitatively meaningful manner over a 4 log scale. This established the baseline for analyses that would compare, by qPCR, the quantity of DNA isolated from extracted nematodes from nematode infested soil samples. The correlation between the actual number of nematodes placed in the tube and the number of nematodes estimated by qPCR was R² = 0.2864 with a slope of 0.3288 and a y-intercept of 4.8574.
Hit 2 alt qPCR Assay Conducted on Extracted Nematodes from Field Samples
The qPCR procedure demonstrated that it was possible to determine the presence of R. reniformis as compared to reactions that lacked R. reniformis. The qPCR analyses identified the presence of R. reniformis, in every case tested, where R. reniformis had been identified by visual inspection (Table 14). The DNA sequencing analyses determined that the qPCR reaction products were R. reniformis DNA (Figures 20 and
22). The correlation between the estimated number of Rotylenchulus sp. by physical counts and qPCR amplification was R² = 0.7246, with a slope of 87.795 and a y – intercept of -879.09.
Hit 7 qPCR Assay Conducted on Extracted Cultured Rotylenchulus reniformis
The standard curve for the Hit 7 qPCR assay had a slope of -3.346787 and a y intercept of 36.109322 (Figure 23). The R² value for the standard curve was 0.985975.
The generation of the standard curve demonstrated that the DNA could readily be
35
amplified in a quantitatively meaningful manner over a 4 log scale. Sequencing of amplicons determined that the Hit 7 amplicon was R. reniformis DNA (Figures 21 and
22).
Hit 7 qPCR Assay Conducted on Extracted Nematodes from Field Samples
The Hit 7 qPCR assay detected Rotylenchulus sp. in 3 out of 4 infested sites
(Table 16). The Hit 7 qPCR assay had 0 false positives in the 5 sites that did not contain
R. reniformis. The correlation between the morphological estimate and qPCR estimate was low R² = 0.429, y = 0.132x - 0.4215. The samples from sample location Cotton 1 which had the most vermiform R. reniformis, 3470 vermiform R. reniformis nematodes per 500 cc soil, had the lowest Ct values, averaging Ct=33.44. The cotton 2 and cotton 3 sites containing 693 and 1000 R. reniformis nematodes per 500 cc soil had Ct values that averaged 35.47 and 36.07 respectfully (Table 17).
Hit 7 qPCR Assay on Direct Soil Metagenomic DNA
The Hit 7 qPCR assay was conducted at each of the 3 samples sites from the 3 sample locations SF, corn, and cotton. The Hit 7 qPCR assay conducted with metagenomic DNA isolated directly from the soil detected the presence of the R. reniformis in 3 out of 4 sample locations (Table 18). The one sample location containing
R. reniformis that did not produce an estimated amount of R. reniformis was sample location corn 3. The Hit 7 direct soil qPCR estimation of the number of R. reniformis present and morphological estimation produced a correlation of R² = 0.6745, y = 0.1561x
+ 9.3095. The cotton 1 samples produced the lowest Ct values averaging Ct= 33.63. The
36
cotton 2 and cotton 3 sites containing 693 and 1000 R. reniformis nematodes per 500 cc
soil averaged 34.84 and 101.76 respectively (Table 19).
Confirmation of PCR Amplification in PCR and the qPCR Reactions
The original sequence of the Hit 2 alt (Figure 20), Hit 7 (Figure 21) and the 28S
ribosomal gene (Figure 22) was used in comparative studies of the DNA sequence
obtained from cloning and subsequent sequencing of the PCR amplification products. By
comparative analysis, through Blastn alignments it was demonstrated that the
amplification products found in the qPCR and PCR reactions was the Hit 2 alt, Hit 7 or
28S ribosomal gene, respectively (Figures 20, 21, and 22).
DISCUSSION
Rotylenchulus reniformis is a major crop pathogen of Gossypium hirsutum
(cotton) (Figure 1, Table 2), Glycine max (soybean), and Ipomoea batatas (sweet potato)
in Mississippi (Figure 1) (Abel et al., 2007, Robinson, 2007, Lawrence and McLean,
1999). Rotylenchulus reniformis causes higher percent yield reductions in Mississippi
than any other state. Molecular diagnostic tests have been developed and utilized to
diagnose and to confirm diagnoses of many plant-parasitic nematodes, however, no
molecular diagnostic test had been reported for R. reniformis. This study was undertaken to develop a method to determine the presence of R. reniformis in Mississippi fields under agricultural practice. The procedure progressed through three stages, culminating in the identification of a molecular marker that would identify the presence of R. reniformis from DNA samples extracted directly from agricultural field samples.
37
The first stage was to evaluate the potential of designed primers specific to the
Agudelo et al. (2005) ITS1 sequence for use as a molecular marker to detect R. reniformis. This ITS1 sequence was targeted because it was found to be conserved in all
R. reniformis populations tested, except the parthenogenetic R. reniformis population in
Japan. The second stage was a bioinformatics-based query that resulted in the identification of sequences that had the potential to identify R. reniformis to the exclusion of other genera of plant-parasitic nematodes. The third stage was the development of qPCR methods to determine levels of R. reniformis in agricultural soil samples.
Molecular Markers designed for the ITS1 Sequence did not Discriminate
ClustalW alignments of the Agudelo et al. R. reniformis ITS1 sequence with other
plant-parasitic nematode rDNA sequences identified by NCBI server Blast alignments
showed areas that could potentially be used for design of a R. reniformis specific primer
pair. The four metagenomic DNA samples isolated from the 4 R. reniformis infested soils produced a PCR amplified product in the RrITS1 PCR assay (Figure 7). The four metagenomic DNA samples isolated from field samples that did not contain R. reniformis did not produce a robust RrITS1 amplified PCR product, even though they contained
other plant-parasitic nematodes. Plant-parasitic nematodes that were present in samples
not containing R. reniformis and not producing a PCR amplicon included M. incognita,
H. glycines, Pratylenchus spp. and Quinisulcius acutus. This outcome showed the
specificity of the RrITS1 primer pair to Rotylenchulus reniformis. However, a less
intensely amplified PCR product was noticed in the assay which made the RrITS1 primer
pair’s specificity questionable. In subsequent experiments the RrITS1 primer pair was
shown to produce a PCR amplified product even when metagenomic DNA was isolated 38
from extracted vermiform M. incognita nematodes; although this was not observed in the
field samples when M. incognita was present (samples isolated from Mississippi and
Scott Counties, Missouri). This is referred to as off-target amplification because it
appeared as though PCR amplification was occurring in the absence of R. reniformis. A
likely explanation is that DNA from other species of nematodes is similar enough in
primary sequence that PCR amplification can occur at a low level.
Development of Customized Computer Programs to Identify Molecular Probes
In order to identify R. reniformis sequences that could potentially be used as
primer sequences in an assay, R. reniformis EST sequences previously deposited on
GenBank were analyzed. Conserved genes among nematodes in the Class Secernentea
were identified through comparative analysis of available sequences of C. elegans, H.
glycines, Meloidogyne spp., and R. reniformis to identify genes that would be conserved
among R. reniformis populations. The analysis was initiated by utilizing previously
conducted sequence analyses of C. elegans and H. gylcines (Alkharouf et al., 2007)
(Figure 4). Alkharouf et al. (2007) provided a resource of the highest conserved genes of
C. elegans and H. glycines with conservation among genes implied through DNA
substitution patterns among orthologs. Custom Perl scripts, with the parameters (see
Appendex 1 and 2) used in the Blastn alignments and parsing of the alignment reports, produced 14 potential sequences that fit the criteria of being highly conserved. These fourteen sequences were analyzed by visual inspection of spreadsheets of the output files produced by the Perl scripts, and provided the details about the quality of the identified gene matches, referred to as hits. However, if the parameters were relaxed and less stringent the program could easily produce many more potential hits. The problem with 39
relaxing the parameters, such as the e-value cut-off, would result in the identification of more sequences that would have less conservation among them. This would be less advantageous because there would be less confidence in knowing that the identified genes were truly homologous (orthologous) between the different nematodes used in the analysis. The relaxed parameters then would interfere with the ability to design primers from less conserved regions of the gene as compared to the other plant-parasitic nematodes. When analyzing the output file (Table 10) from Perl script 2 (Appendix 2), which contains the 14 R. reniformis genes produced by the Blastn alignments of the R. reniformis EST’s against the Meloidogyne EST database, we identified sequences that would be useful in designing PCR primers (Table 10). The Meloidogyne database from nematode.net was used to as the basis to discriminate similar conserved regions of the sequences. Since an additional goal of the analysis was to develop a qPCR-based method to determine population levels in field samples, a few additional augmentations were made to identify sequences that would be used to design the qPCR assay. To narrow down the identified R. reniformis genes from 14 to more workable numbers, additional parameters were considered. The first additional parameter was the number of unique sequences with a hit, showing the number of unique Meloidogyne sequences in which a
Blast hit occurred. This step was necessary because the Blastn algorithm can produce multiple hits against different parts of the same sequence as can be seen with all the sequences (Table 10) that produced hits. Hit 2 and Hit 7 were selected for further work because they had a low number of unique sequences with a Hit (1 and 5 unique sequences, respectively) as compared to total Blast hits (21 and 71), respectfully. This
40
was desirable because the more number of similar sequences the greater the chance of mispriming events.
The function of the selected genes was determined by Blastx analysis, with Hit 2
and Hit 7 having high similarity between Arp2/3 complex and tubulin beta-1 chain,
respectively. The C. elegans homolog of Hit 2 Arp2/3 complex is essential to cell
migration in C. elegans by polymerizing new actin filaments (Sawa et al., 2003). A
homolog of Hit 7 showed 95% sequence identity over 53% of the Hit 7 sequence
(GenBank accession number GT736478). Due to only 53 % of the sequence aligning in
the Blastx alignments the Hit 7 sequence was queried into Vecscreen. Vecscreen is a
specialized Blast program used to check for vector contamination, on the NCBI web
server (http://www.ncbi.nlm.nih.gov/VecScreen/VecScreen.html). No vector
contamination was found with the cloning vector used by Wubben et al. (2010) pDNR-
LIB in the screening library. This observation supported the fact that the Hit 7 sequence
is from R. reniformis. Both of the sequences, Hit 2 and Hit 7, participate in highly
conserved and specific functions, likely responsible for the high level of sequence
conservation observed for each gene.
The ClustalW alignments of the sequences producing hits in the Blast program
highlighted areas in which potential R, reniformis specific primer pairs and probes could
be selected. Unfavorable areas that showed high homology, low binding temperature, and
repetitive stretches of single nucleotides were avoided in designing primers. Primers and
probes were tested only for Hit 2 alt and Hit 7. The Hit 2 alt is an alternative PCR primer
pair developed with Primer3 software that worked better than the Hit 2 primer pair in the
initial primer pair screening PCR reactions (see Evaluation of potential qPCR Primer Pair
41
Specificity and Figure 15). The two primer pairs were also selected for development into
a qPCR assay that will be discussed in a later section. These primer pairs were selected
because they were produced from sequences that passed the bioinformatic screening
procedure above and did not contain the unfavorable characteristics of high homology,
low binding temperature, and repetitive stretches of single nucleotides.
Determination of Primer Specificity to Rotylenchulus reniformis
The specificity of the primers for Hit 2, Hit 2 alt, Hit 7 and Hit 8 were determined for R. reniformis and M. incognita DNA. Using nematodes that are cultured in the glasshouse provided ample template DNA to conduct this analysis. A single nematode has very little DNA. This analysis (Figure 15) determined that Hit 7 would be the best primer for downstream analyses due to its specificity in R. reniformis as compared to M. incognita. It was noted that some DNA amplification occurred in M. incognita DNA samples when primed with the Hit 2 alt primer pairs. This artifact was observed in pure
DNA samples isolated from M. incognita and was not observed in soil samples. The analyses also demonstrated that it was possible to demonstrate the presence of nematodes in PCR-based studies using the Hit 2 alt and Hit 7 primer pairs in samples where DNA was extracted from as few as 1 R. reniformis individual. It appeared as though both the
Hit 2 alt and the Hit 7 Primer pairs could robustly detect the presence of R. reniformis in samples where low concentrations of their DNA were present. However, the primer pairs could not repeatedly detect the presence of DNA extracted from a single nematode in all cases. The efficient DNA extraction is difficult to obtain for known R. reniformis samples. The PCR reaction would not always identify the presence of the template DNA,
42
it was possible that the problem was from the ability to efficiently isolate the DNA and
not caused by the PCR reaction itself.
Detection of Rotylenchulus reniformis DNA Isolated Directly from Field Extracted Nematodes with PCR
The soil sample sites (Figures 3, 5, 6) that were used to obtain samples either had
or were devoid of R. reniformis. From field samples R. reniformis were extracted and
counted. Therefore, a known number of nematodes were obtained. DNA from R.
reniformis was isolated from those extracted samples. PCR using the Hit 2 alt (Figure 16)
and Hit 7 (Figure 17) was run on the samples. The Hit 2 alt primer pair consistently
yielded DNA amplification product even in samples which R. reniformis was absent
(Figure 16). This mispriming was an undesirable characteristic of the Hit 2 alt primer
pair. If our objective was a PCR primer pair the Hit 2 alt primer pair would have been
eliminated immediately for further development, but since we used TaqMan probe in
subsequent analyses the primer specificity did not constitute immediate dismissal.
In contrast, the Hit 7 primer pair demonstrated the ability to amplify a product
from soil extracted R. reniformis from samples containing as few as 8 nematodes. The Hit
7 primer pair never amplified a product in the absence of a visual observation of R. reniformis. However the Hit 7 primer pair failed to amplify samples containing 2 R. reniformis nematodes. This demonstrated that soil infested with R. reniformis may not yield amplifiable amounts of DNA. This was an important observation because when taken in consideration with the lack of any amplification in soil samples not containing R. reniformis, it demonstrates that the occurrence of false positives (detection of R. reniformis when R. reniformis is not present) would be low for the Hit 7 molecular
43
diagnostic. The experiments also showed that nematodes isolated from soil samples
yielded amplifiable amounts of DNA in a reliable manner even from as few as 8 nematodes.
PCR-based Demonstration of DNA Isolated from Field Soil Samples
When DNA was isolated directly from the soil, instead of from the extracted nematodes the Hit 2 alt primer pair demonstrated amplification in all lanes except the negative controls. In contrast, the Hit 7 primer pair amplified DNA from all samples having R. reniformis containing 2, 41, 8 and 12, vermiform R. reniformis nematodes,
respectively. DNA amplification products were observed in 2 samples that contained no
nematodes (Figure 18); however, these 2 spurious amplification events did not yield the
expected size for the Hit 7 primer pair. Thus, the bands not being the same length as the
R. reniformis band were off-target amplification products that can easily be discriminated
against because they were different in size than the R. reniformis amplicons.
Detecting Rotylenchulus reniformis DNA with qPCR
A qPCR analysis was developed to quantitatively measure R. reniformis.
Amplicons from qPCR conditions were gel-isolated, cloned and sequenced. This precautionary step was done to demonstrate that the amplicons observed from the qPCR conditions were the actual target for the Hit 2 alt, Hit 7 and the original RrITS D2/D3 primer pairs (Figures 20, 21, 22, respectively). The correct target was confirmed by sequencing. Subsequent qPCR analyses of field samples were performed using the Hit 2 alt and Hit 7 primer pairs. Three analyses were done for each primer pair. The first was a qPCR analysis on DNA isolated from known numbers of nematodes. The second set of
44
analyses was done on DNA isolated from nematodes isolated from field samples. The third analysis was done on DNA isolated directly from soil samples where the number of nematodes had already been counted by visual inspection.
The Hit 2 alt qPCR Assay
The Hit 2 alt assay was sensitive enough to detect a single vermiform R. reniformis nematode whose DNA was isolated in the bead beating tube. The assay produced a standard curve with a R² value of 0.99. The Hit 2 alt qPCR assay in which a known number of nematodes were aliquoted into the bead beating tube prior to metagenomic DNA extraction showed promising results. A few samples showed a trend of decreasing Ct values with increasing numbers of vermiform R. reniformis nematodes, which would be expected, while most samples did not show the trend. This lack of trending resulted in a low correlation (R² = 0.2864) between the actual number of nematodes placed in the tube and the number of nematodes estimated by qPCR. The Hit 2 alt qPCR assay did detect the presence of R. reniformis in all the samples that R. reniformis was present. However, further examination of this primer needs to be done before full confidence can be gained. The assay needs to be evaluated on different sites and different populations of R. reniformis in order to establish confidence levels of the assay’s ability to detect R. reniformis in samples from multiple locations.
The Hit 2 alt qPCR field assay detected R. reniformis in all samples where the nematode was present. This assay also showed specificity by not detecting R. reniformis in samples where they were not observed in the visual examination. The assay showed this specificity in the presence of other plant-parasitic nematodes such as Helicotylenchus dihystra, Mesocriconema spp., and Pratylenchus spp. A strong correlation between the 45
estimated number of Rotylenchulus sp. by physical counts and qPCR amplification was
not observed (R² = 0.7246), The sample with the highest number of R. reniformis
individuals, as expected, did produce the lowest Ct value and highest qPCR estimate of
the number of R. reniformis. However, in all cases where no visual observations were
made for R. reniformis, no Hit 2 alt qPCR product was obtained and no R. reniformis
were estimated. The qPCR typically overestimated the number of R. reniformis by a
multiple of 10. However, the sensitivity was still good and could detect very low
concentrations of nematodes which could be of use in diagnostic studies. Because of the
many problems that the Hit 2 alt primer pair presented during the analysis, the Hit 7
primer pair was used in parallel studies.
The Hit 7 qPCR Assay
Throughout the Hit 7 qPCR evaluation increasing numbers of vermiform R.
reniformis produced a trend of decreasing Ct values, as expected. When the Hit 7 qPCR
assay was conducted with handpicked vermiform R. reniformis there was a general trend
of increasing numbers of vermiform R. reniformis and decreasing Ct values. Only one of the three samples containing a single vermiform R. reniformis did not produce amplification. Samples in which no nematodes were present did not produce any amplification. The trend of increasing actual counts of R. reniformis and increasing
estimates obtained by qPCR was observed. These observations demonstrate the potential
for qPCR to estimate the number of nematodes from DNA extracted directly from known
numbers of nematodes by qPCR using the Hit 7 primer pair.
The Hit 7 qPCR assay on field samples showed promising results also. The assay
detected the presence of the nematode in 3 out of 4 sites where the nematode was known 46
to be present. The only site that contained R. reniformis nematodes that did not produce a
positive estimate for R. reniformis from the assay was corn 3 which had 193 R.
reniformis nematodes present per 500 cc of soil. Given the low nematode concentration
in the soil it was not improbable for template DNA not to make it in the qPCR assay,
since the assay only uses a fraction of the original soil sample. The samples had a trend
showing more R. reniformis leading to lower the Ct values (Table 17). This trend shows
promise in that the development of a direct soil qPCR assay may be probable.
Final Conclusions
Hit 2 alt and Hit 7 qPCR assays readily detected the presence of the nematode below the damage and action thresholds reported by Robinson (2007). Further testing and optimization of the qPCR assays may lead to the development of the assays to identify problematic areas of R. reniformis infestations. An area of work that needs to be
addressed is the DNA extraction procedure. Currently, the bead beating method found in
the Powersoil® kit provided useful amounts of DNA. It is possible that further
optimization of nematode and soil DNA extractions will improve the qPCR analysis.
Once this limitation is overcome, the procedure could eliminate the need for costly
nematode extractions, greenhouse culture and the time required to get the nematodes to a
high enough concentration to perform diagnostic tests based on morphology. Another
area of work is assessing the assays specificity against other populations of R. reniformis
and other species of Rotylenchulus.
47
Table 2 2011 Cotton loss due to R. reniformis
State Percent Loss Bales Lost (x 1,000) Alabama 4 32.096 Arkansas 1 15.48 Florida 2 3.855 Georgia 2.5 76.59 Louisiana 4 23.297 Mississippi 6 82.286 North Carolina 0.25 2.958 South Carolina 1 5.314 Tennessee 3 28.318 Texas 0.2 8.49 United States 1.5 278.68 Adapted from National Cotton Council Disease Database (National Cotton Council Disease Database: 1952-2011
49
Table 3 PCR assays to detect specific nematode species using a species specific primer pairs that produces one amplicon
Size of Reference Species Detected Amplicon Primer Sequence derived from Al-Banna et al 2004 Pratylenchus neglectus 290 D2/D3 rDNA Pratylenchus penetrans 278 D2/D3 rDNA Pratylenchus scribneri 286 D2/D3 rDNA Pratylenchus thornei 288 D2/D3 rDNA Pratylenchus vulnus 287 D2/D3 rDNA Bae et al 2009 Hoplolaimus columbus 580 ITS1 rDNA Hoplolaimus galeatus 120 ITS1 rDNA Hoplolaimus magnistylus 340 ITS1 rDNA Carrasco-Ballesteros 2007 Pratylenchus thornei 1078 SCAR Flemming et al 1998 Globodera rostochiensis 708 glucuronidase gene sequence Fullaoondo et al 1999 Globodera pallida 798 RAPD-PCR Globodera rostochiensis 315 RAPD-PCR Kang et al 2004 Bursaphelenchus xylophilus 263 IGS rDNA Bursaphelenchus mucronatus 287 IGS rDNA Leal et al 2005 Bursaphelenchus xylophilus 171 HSP70 Machado et al 2007 Pratylenchus brachyurus 267 ITS1 rDNA Matsunaga and Togashi 2004 Bursaphelenchus mucronatus 210 ITS2-28S rDNA Bursaphelenchus xylophilus 557 ITS1-ITS2 rDNA Meng et al 2004 Meloidogyne incognita 779 RAPD-SCAR-PCR Meloidogyne javanica 517 RAPD-SCAR-PCR Meloidogyne arenaria 955 RAPD-SCAR-PCR
50
Table 3 continued Size of Reference Species Detected Amplicon Primer Sequence derived from
Oliveira et al 2005 Xiphinema brevicolle 462 18S rDNA-ITS1 Xiphinema diffusum 718 18S rDNA-ITS1 Xiphinema elongatum 1057 18S rDNA-ITS1 Xiphinema ifacolum 816 18S rDNA-ITS1 Xiphinema longicaudatum 395 18S rDNA-ITS1 Quader et al 2008 Globodera pallid 256 ITS1 rDNA Globodera rostochiensis 434 ITS1 rDNA Randig et al 2002 Meloigogyne exigua 562 SCAR Meloigogyne incognita 399 SCAR Meloidogyne paranaensis 208 SCAR Riga et al 2007 Paratrichodorus allius 432 18S-5.8S rDNA Paratrichodorus teres 677 18S-5.8S rDNA Skantar 2007 Globodera tabacum 434 ITS rDNA Subbotin et al 2005 Ditylenchus dipsaci 263 rDNA Williamsom et al 1997 Meloidogyne hapla 960 SCAR Meloidogyne chitwoodi 850 SCAR Yan 2008 Pratylenchus neglectus 144 28S rDNA Zijlstra 2000 Meloidogyne chitwoodi 800 SCAR Meloidogyne fallax 530 SCAR Meloidogyne hapla 610 SCAR Zijlstra et al 2000 Meloidogyne incognita 1200 SCAR Meloidogyne javanica 670 SCAR Meloidogyne arenaria 420 SCAR Zijlstra et al 2004 Meloidogyne naasi 433 ITS1
51
Table 4 Quantitative PCR assays to detect or identify plant-parasitic nematode species
Type of qPCR Primers/Probe Sequence Reference Species Detected Assay derived from Berry et al 2008 Meloidogyne javanica SYBR Green rDNA Pratylenchus zeae SYBR Green rDNA Xiphinema elongatum SYBR Green rDNA Cao et al 2005 Bursaphelenchus xylophilus TaqMan probe rDNA Ciancio et al 2005 Meloidogyne incognita Scorpion rDNA Francois et al 2007 Bursaphelenchus xylophilus TaqMan probe Mspl satellite DNA De Weerdt et al 2010 Meloidogyne minor TaqMan probe rDNA Leal et al 2007 Bursaphelenchus xylophilus TaqMan probe Hsp70 Madani et al 2005 Heterodera schachtii SYBR Green rDNA Globodera pallida SYBR Green rDNA Nowaczk et al 2008 Globodera rostochiensis TaqMan probe rDNA Globodera artemisiae TaqMan probe rDNA Quader et al 2008 Globodera pallida SYBR Green rDNA Globodera rostochiensis SYBR Green rDNA Sato et al 2007 Pratylenchus penetrans SYBR Green rDNA Subbotin et al 2005 Ditylenchus dipsaci SYBR Green rDNA Toyota et al 2008 Globodera rostochiensis SYBR Green rDNA Meloidogyne incognita SYBR Green rDNA Zijlstra and Van Hoof 2006 Meloidogyne chitwoodi TaqMan probe rDNA Meloidogyne fallax TaqMan probe rDNA
52
Table 5 Rotylenchulus reniformis ITS1 (RrITS1) field sample assay
Crop Origin R. reniformis R reniformis Sample Source Sampled Present1 Detected2 Oktibbeha, MS Cotton Yes Yes Kurt Showmaker Calhoun, MS Cotton Yes Yes MSU extension Chickasaw, MS Cotton Yes Yes MSU extension Carroll, MS Cotton Yes Yes MSU extension Mississippi, MO Soybeans No No Kurt Showmaker Scott, MO Soybeans No No Kurt Showmaker Pope, IL Soybeans No No Kurt Showmaker Massac, IL Corn No No Kurt Showmaker Origin= County and State which the Field Samples was Obtained. The sites are provided in that accompanying Figure 3. 1 = R. reniformis determined present by visual confirmation. 2 = R. reniformis determined if PCR amplicon bands detected on agarose gel
Table 6 Primer pair (RrITS1) designed for the ITS1 sequence of R. reniformis
Name Sequence Description RenFks 5‘-TGTTCCCCGAACCTTGAAACATCCA-3 Forward Primer RenR144 5’-GCAGCCGTTTTTGATCAGTGTCC-3’5 Reverse Primer
Table 7 GPS coordinates of the three South Farm (SF), corn and cotton sites
Sample Latitude Longitude SF 1 33°25'0.13"N 88°47'17.05"W SF 2 33°24'57.53"N 88°47'20.27"W SF 3 33°24'52.73"N 88°47'18.05"W corn 1 33°28'43.96"N 88°46'51.46"W corn 2 33°28'44.08"N 88°46'53.28"W corn 3 33°28'42.94"N 88°46'52.27"W cotton 1 33°28'19.83"N 88°46'17.89"W cotton 2 33°28'22.03"N 88°46'14.22"W cotton 3 33°28'20.54"N 88°46'8.10"W
53
Table 10 Summary of Perl script outputs
Number of Average Average Hit Rotylenchulus reniformis C. elegans Unique Number Hit Lethal Homolog Query Accession % # Sequences of Hits Length Number Identity with a Hit (bp) 1 GT738372.1 10 11 82.69 104 2 GT738331.1 1 21 80.37 107 3 GT738328.1 24 31 79.64 167 4 GT738288.1 9 41 80.80 375 5 GT737960.1 31 51 79.52 166 6 GT737930.1 28 61 80.43 138 7 GT736478.1 5 71 80.00 140 8 GT737564.1 1 81 80.00 215 9 GT737483.1 0 0 0.00 0 10 GT737393.1 31 101 80.12 166 11 GT737166.1 27 111 79.62 157 12 GT736809.1 4 121 83.61 122 13 GT736791.1 9 131 79.47 375 14 GT736740.1 32 141 80.49 164 Step 5a from Figure 4 produced by importing the comma delimited summary outfile of Perl script #2 into excel. Accession numbers found to have a C. elegans lethal homolog from Perl script #1. Reported with the Blast results against the Meloidogyne incogita database from Perl script #2 (Appendix 2).
56
Table 12 List of Rotylenchulus reniformis Hit primers and probes for the qPCR assays
Name Sequence Software Designed From Hit 2 alt.F 5'-TTAATTGCCTTGGCCACTTC-3' Primer3 Hit.2 alt.R 5'-TGCTTCTTGGCAGTATCGTG-3' Primer3 Hit 2.alt.P 5’-ACACCATCTCCGCTATCCAC-3’ Primer3 Hit 8 F 5'-GAAGGTCAGGATACTCGCTACAT-3' Primerselect Hit 8 R 5'-GACATCCGGCTTCTCCTCCACTTG-3' Primerselect Hit 7 F 5'-CAAAATGTCCGCCACCTTCGTT-3' Primerselect Hit 7 R 5'-GTGCCGTCTCCTCAGCCTCGTA-3' Primerselect Hit 7 P 5’-ACGAGATGGAATTCACTGAGGCCGAA-3’ IDT Primerquest® Hit 2 F 5'-CGCCGTCCAAGCAAGCATC-3' Primerselect Hit 2 R 5'-GTGGCCAAGGCAATTAAGGAACAA-3' Primerselect
Table 13 The Hit 2 alt qPCR assay estimates of R Rotylenchulus reniformis from a serial dilution of the nematode suspension
R. reniformis Mean Std Dev Sample Milled Qty Qty Mean Ct 4 100 2.25 3.00 24.78 5 100 92.70 63.73 30.55 6 100 19.40 2.71 32.54 7 10 1.12 0.86 37.20 8 10 7.82 5.83 34.20 9 10 3.11 1.56 35.29 10 1 1.82 1.47 24.12 11 1 16.63 4.57 32.79 12 1 8.37 6.02 34.17
R. reniformis milled = number of R. reniformis estimated in the 0.3 ml of suspension added to the bead beating tube, Estimated Mean Qty, Std Dev Qty = The mean estimated number of nematodes present for the sample from triplicate wells of the sample in the qPCR plate and its standard deviation, respectfully. Ct. Average = the average of the triplicate wells in the qPCR reaction.
58
Table 15 Hit 7 qPCR estimates of known numbers of Rotylenchulus reniformis (Rr)
Sample Number of Ct Value qPCR mean qPCR Ct STD ID Rr Mean estimate STD 1 0 - - - - 2 0 - - - - 3 0 - - - - 4 1 33.25 3.60 21.24 28.29 5 1 - - - - 6 1 37.00 1.03 0.65 0.49 7 10 34.67 0.98 3.00 1.89 8 10 33.19 0.16 7.47 0.83 9 100 31.82 0.49 19.94 6.82 10 100 32.51 1.80 20.40 25.18 11 1000 25.28 0.07 1727.00 82.18 12 1000 25.26 0.20 1754.89 253.59 Ct values calculated for samples with more than one Ct value reported
60
Table 16 Hit 7 Field sample Rotylenchulus reniformis (Rr) estimation
STD of Ct Estimated qPCR mean qPCR Sample ID Number Value Ct STD Number of Rr estimate STD of Rr Mean SF 1.1 ------SF 1.2 ------SF 1.3 ------SF 2.1 ------SF 2.2 ------SF 2.3 ------SF 3.1 ------SF 3.2 ------SF 3.3 ------Corn 1.1 ------Corn 1.2 ------Corn 1.3 ------Corn 2.1 ------Corn 2.2 ------Corn 2.3 ------Corn 3.1 2.33 0.58 - - - - Corn 3.2 2.33 0.58 - - - - Corn 3.3 2.33 0.58 - - - - Cotton 1.1 41.67 9.07 33.90 0.19 2.48 0.46 Cotton 1.2 41.67 9.07 33.96 0.50 2.47 0.99 Cotton 1.3 41.67 9.07 32.46 0.54 10.45 4.73 Cotton 2.1 8.33 0.58 34.93 1.99 2.25 2.84 Cotton 2.2 8.33 0.58 35.23 0.46 0.73 0.28 Cotton 2.3 8.33 0.58 36.26 1.08 0.35 0.27 Cotton 3.1 12.00 5.57 35.87 0.65 0.42 0.20 Cotton 3.2 12.00 5.57 36.61 0.73 0.21 0.14 Cotton 3.3 12.00 5.57 35.73 2.24 1.41 2.06 Calculations done for samples with more than one Ct value
61
Table 17 Hit 7 Field sample Rotylenchulus reniformis (Rr) qPCR estimation summary
Estimated STD of Ct qPCR Number Number Value Ct mean qPCR Sample ID of Rr of Rr Mean STD estimate STD SF 1 ------SF 2 ------SF 3 ------Corn 1 ------Corn 2 ------Corn 3 2.33 0.58 - - - - Cotton 1 41.67 9.07 33.9 0.19 2.48 0.46 Cotton 2 8.33 0.58 36.26 1.08 0.35 0.27 Cotton 3 12 5.57 35.87 0.65 0.42 0.2 Calculations for samples with more than one Ct value
62
Table 18 Hit 7 Direct soil Rotylenchulus reniformis (Rr) estimation
Estimated STD of Ct qPCR Sample qPCR Number of Number of Value Ct STD mean ID STD Rr Rr Mean estimate soil.sf1 0 - - - - - soil.sf1 0 - - - - - soil.sf1 0 - ---- soil.sf.2 0 - ---- soil.sf.2 0 - ---- soil.sf.2 0 - ---- soil.sf.3 0 - ---- soil.sf.3 0 - ---- soil.sf.3 0 - ---- soil.corn.1 0 - ---- soil.corn.1 0 - ---- soil.corn.1 0 - ---- soil.corn.2 0 - ---- soil.corn.2 0 - ---- soil.corn.2 0 - ---- soil.corn.3 2.72 0.67 - - - - soil.corn.3 2.72 0.67 - - - - soil.corn.3 2.72 0.67 - - - - soil.cot.1 48.63 10.59 33.91 0.35 16.63 3.47 soil.cot.1 48.63 10.59 33.76 0.35 16.63 3.47 soil.cot.1 48.63 10.59 33.24 0.35 16.63 3.47 soil.cot.2 9.73 0.67 36.03 0.98 8.66 4.00 soil.cot.2 9.73 0.67 34.47 0.98 8.66 4.00 soil.cot.2 9.73 0.67 34.22 0.98 8.66 4.00 soil.cot.3 14.00 6.50 34.01 0.09 13.93 0.69 soil.cot.3 14.00 6.50 33.84 0.09 13.93 0.69 soil.cot.3 14.00 6.50 33.91 0.09 13.93 0.69 Estimated numbers transformed from volumetric measurements to weight (0.5g) using a standard bulk density of soil 1.4 g/ml. Estimate= 1/(n*(1.4 g/ 0.3 ml / 0.5 g soil)
63
Table 19 Estimation of Rotylenchulus reniformis populations using Hit 7 qPCR directly from soil
Estimated STD of Number qPCR Number of of mean Sample ID R. reniformis R. reniformis estimate qPCR STD soil.sf.1 0 - - - soil.sf.2 0 - - - soil.sf.3 0 - - - soil.corn.1 0 - - - soil.corn.2 0 - - - soil.corn.3 2.72 0.67 - - soil.cot.1 48.63 10.59 16.63 3.47 soil.cot.2 9.73 0.67 8.66 4 soil.cot.3 14 6.5 13.93 0.69 Calculations for samples with more than one Ct value
Figure 1 Value of Mississippi crops parasitized by Rotylenchulus reniformis from 2007 to 2011
Source: http://quickstats.nass.usda.gov/ data last accessed: 10/04/2012
64
Figure 2 U.S. distribution of Rotylenchulus reniformis in 2010
The areas in green represent counties where R. reniformis has been positively identified. The areas in yellow represent counties where R. reniformis has not been positively identified. The areas in white represent counties where R. reniformis has not been reported. Credit: Beltwide cotton nematode committee. Image obtained from: http://www.cotton.org/tech/pest/nematode/distributions.cfm?bw=1&type=Reniform
65
Figure 3 Collection site distribution maps
(A) Mississippi collection sites; the counties are (1) Tallahatchi, (2) Leflore, (3) Caroll, (4) Calhoun, (5) Chickasaw (6) Oktibbeha. (B) Illinois collection sites; the counties are Blue, Pope; Red, Massac. (C) Missouri collection sites; the counties are Red, Scott; Blue, Mississippi. Map obtained and modified nationalatlas.gov by the Mississippi State University High Performance Computing Collaboratory.
66
2,004 EST 14 Sequences that found Hits R. reniformis R. reniformis‐C. elegans Sequences Perl Lethal Script #1 SCN Homologs Blastn C. elegans Lethal SCN Perl Meloidogyne sp. Homologs Script #2 EST Database Blastn Sequences Database
Blastn Results Summary Outfile Individual fastA files containing the Query R. reniformis sequence Megalign® and Meloidogyne Sequences Blastn Hit 2 Primer Pair Hits Primerselect® Hit 7 Primer Pair Hit 1 Hit 2 Hit 3 Hit 4 Hit 8 Primer Pair Hit 5 Hit 6 Hit 7 Hit 8 Hit 9 Hit 10 Hit 11 Hit 12 Primer3 Hit 2 alt Primer Hit 13 Hit 14 Pair
Figure 4 Bioinformatics pipeline for the isolation of highly conserved DNA sequences from R. reniformis
The pipeline depicts how the (1a) 2004 R. reniformis EST DNA sequences and the (1b) 1507 H. glycines lethal Group 1 genes from Alkharouf et al. 2007 were downloaded from GenBank. The work was followed by the generation of a (2) Perl script (Appendix 1) that compared the 2004 R. reniformis sequences to the 1507 H. glycines lethal Group 1 genes from Alkharouf et al. 2007. That comparison resulted in the identification of (3a) 14 positive matches. Those 14 hits were compared to (3b) M. incognita gene sequences using a (4) second Perl script (Appendix 2). By performing that comparison, homologs to the major agricultural nematode pathogens (R. reniformis-H. glycines-M. incognita) could be identified. The comparisons resulted in a (5a) FASTA output file (Table 6) and (5b) Blast Results Summary Outfile (Table 7). The 14 Hit genes then were compared in (6) Megalign®, part of the DNAStar® computer software package in order to obtain alignments of homologous sequences for the Hit genes. Those comparative analyses allowed for the generation of PCR primer pairs using two different PCR primer generating programs, (7a) Primerselect® and (7b) Primer3. The Primerselect® program resulted in the generation of primers for the (8) Hit 2, Hit 7 and Hit 8 genes. The Primer3 package resulted in the generation of an alternate primer pair for the (8) Hit 2 gene called Hit 2 alt because it is an alternative primer pair to that made in the Primerselect® package.
67
Figure 5 Field Locations for the field nematode population sampling in Oktibbeha county
The three sites are referred to here as SF, Cotton and Corn. Accompanying GPS coordinates of the sites are found in Table 7. Enlarged areas that represent each collection site are found in Figure 6.
68
Figure 6 Close up aerial images of the soil collection sites
The sample sites are designated as A, SF; B, Cotton and C, Corn. GPS coordinates are found for the three replicates of each sample type sampling sites in Table 4.
69
Figure 7 Rotylenchulus reniformis primer pair RrITS1 evaluation on field samples
Metagenomic DNA template form samples containing R. reniformis (2-5) and samples not containing Rotylenchulus sp. (6-10) (Table 5). Lanes 2-5 = Oktibbeha, MS, Calhoun; MS Chickasaw, MS; and Carroll, MS. Lanes 7-10 = Mississippi, MO ; Scott, MO; Pope, IL; and Massac, IL. Lanes 1 and 6 100 bp ladder (New England Biolabs cat # N3231). Arrow pointing to 100 bp maker in figure.
70
Figure 8 The Hit 2 alt gene sequence
GenBank accession GT738331.1, obtained from R. reniformis nematode sedentary parasitic female library query of GenBank by Blastx was a query coverage of 92% (2e- 132) with a maximum identity of 81% in sequence to the actin-related protein 3, ARP3 (NP_491066.1) from C. elegans.
Figure 9 The Hit 7 gene sequence
GenBank accession GT736478, obtained from R. reniformis nematode sedentary parasitic female library query of GenBank by Blastx was a query coverage of 53% (6e-45) and 95% identical in sequence to the tubulin beta-1 chain (EFO19784.1) from Loa loa (African eyeworm)
71
Figure 10 The D2/D3 gene sequence
GenBank accession HM131883.1 obtained from R. reniformis nematode sedentary parasitic female library query of GenBank by Blastx was a query coverage of 100% (e- value = 0) and 99% identical in sequence to the 28S ribosomal gene originally obtained from R. reniformis
72
-60 -50 -40 -30 -20 -10 0 GT738331.1 CAATTCACGATACTGCCAAGAAGCAGCAAGAGCAAGGACGGCTTGCACCGCAATGTACAGACCCGGACCC 0 MH02263 TTTCATCCAGAAT T TGTCAGTTCTGATTAT AAAACATCAATTT CTGATTCTGTTGATCAAGTAATCCAAC 0
10 20 30 40 50 60 GT738331.1 ATTTATACAAAATCTAAATTAAAAGAAA- ACAAATTATGATTAGGAGGGTTCATCAAGTTAGCGCTCCAA 69 MH02263 -----T TTGAGCT T TAAAAT GCATTTACCACCTGT AGTGATT--GATAAT GGAACAGGT T A-----CACA 58
70 80 90 100 110 120 130 GT738331.1 AGACAGCATTGTACCGTACACAACTCGCCCCCCTTTCCATGTATTCCGCCTTTGTGTGTGCCACTTGATA 139 MH02263 AAACTTGGAT AT GCT GGAAAT AGT GAACCT CAATTTAT- - - TATTCC--CTCAACTATTGCT ATCAGGGA 123
140 150 160 170 180 190 200 GT738331.1 AAATTCCGCCGTCCAAGCAAGCATCGATCCACCAAACCAAACTGCATAGCGTTGCATTTTGTGCGAAATA 209 MH02263 TGCCGTGACAGCAAAAAGTAGTGGTGGAGGATTAGGGAAAAT TG- ATGAT CTTGATTTTTT T ATTGGAGA 192
210 220 230 240 250 260 270 GT738331.1 ACATTGACATCGATTTTCTTTGGCTTTAATT- - TCCCTCCAGAAAGCTGTTCACTTTGTGTCAAGCGTTG 277 MH02263 CGA--GGCT T TATCT CCAGCTGCTGCTAATTATT TTGT TAAGCACCCTAT AAGACATGGAATGGTTGAT G 260
280 290 300 310 320 330 340 GT738331.1 GTCTGAAATGCGTTTTATGTCCCGCTGGAGC- - CGTCTTCCGAAATCTTTGAACATTGTTGAACCACCAG 345 MH02263 AT TGGGACT TAAT GGAACGT TTT- TGGGAGCAATGT AT ATTTAAATATTTGAG- - - AGCAGAACC--TGA 324
350 360 370 380 390 400 410 GT738331.1 AAAGCACAATGTTTTCATAAAGGCCCCTCCGC- ACATCGATTGGGCACTGTTGAATGACCTGATCAATTG 414 MH02263 GGAT CACT ACTTTCT T ATGACAGAACCACCATTAAATACCCCAGAAAAT AGAGAAT ATACAGCAGAAGT G 394
420 430 440 450 460 470 GT738331.1 - CGTCCGAAA- - - TGGATGTTTTGTGTTCGGGGTTGACAAACTCTGGATGGAAGAATATTTCGGGTCC- - 478 MH02263 ATGT TTGAATCTTT CAATGTTCCTGGT CTACTTAT AGCAGT CCAAGCAGT T T T GGCT CTTTCT GCT T CTT 464
480 490 500 510 520 530 GT738331.1 - - - AAGAAAA------CGCTCATAGCCAACATCAGCAACAAATGGCTTCTTTGTGATGTTGTT 532 MH02263 GGCAAGAT AAACCGATAGATGCACGT TCT T T GACCGGATTGGT AATTGATAG--T GGT GATGGTGTTACT 532
540 550 560 570 580 590 600 GT738331.1 CACACCGTTGTAAACCTTGAACCATTTGTCTGGATCTGTATCATACTTGACAAATTCCTTGTGTATGTCC 602 MH02263 CATTGCATTCCAATTGCTGAAGGT TTTGTTATTGGCTCT TGCATA--AAACACGTTCCAATTGCTGGGAG 600
610 620 630 640 650 660 670 GT738331.1 GGACACACATAACAGTATTGTTCCTTAATTGCCTTGGCCACTTCATATGATTGCTCACTCGGAATAGTCG 672 MH02263 GGAT AT- - - TACTTAT T TTATTCAACAGCT ACAT CGTGAACGAGAAGT AGGCATTCCAAGTGAACAATCT 667
680 690 700 710 720 730 GT738331.1 GCTCTCGTTCTCTTAACATTTGTTGGATGAAATAAGTGA---TGTCACGACCGGCAATCGGAATGTGTTT 739 MH02263 TAT GAAGT T GCCAAAGCTAT AAAGGAGAGGCATTGTT ATGTTTGCCCAGATATACAAAAAGAAT T TGTTA 737
740 750 760 770 780 790 800 GT738331.1 AATGCAAGAGCCAGT- - GACATATCCATCTGCCACTGGAATACAATGTGTGACACCATCTCC- - GCTATC 805 MH02263 AATTTGAT AATGAACCAGAAAAATATATTCATTGTT ATAATGGCATTAAT AATGTTACGAAAAAGCCTT T 807
810 820 830 840 850 860 870 GT738331.1 CACTACGAGTCCTGTCAAAGAACGCTCATTCAATTCACGATACTGCCAAGAAGCAGCAAGAGCAAGGACG 875 MH02263 T ACCGTTGAT GT TGGCCAT GAACGAT TTCT TGGACCTGAAGT T T T CTTTCATCCAGAATTTGTCAGTTCT 877
880 890 900 GT738331.1 GCTTGCA---CCGCAATGTACAGACCCG--GACCC 905 MH02263 GATTATAAAACATCAATT T CTGATTCT GTTGAT CAAGTAATCCAAC 923
Figure 11 Hit 2 alt ClustalW alignment
The Hit.2.alt (GT738331.1) Clustalw alignment produced by Perl script #2 with sequence, MH02263, from Meloidogyne hapla. Blue highlighted areas differ from the R. reniformis sequence
73
GT736478.1 ------0 MI03045 ------T GGCCGGGCAAATGATGTCGGTTCAAAACAAGAATTCGTCATACT 45 MI04862 ------TACGGAACGGTCACAGACCATGTGGGCGTGCAACA 35 MP00532 ------0 MP01167 TGGTGAGATGACCATTACAAAAAAAAACTTGCCTCCGTTTTCCGGGACAAT T AAATGCGGATCTAAGAAA 70 MP01195 ------TGGTTTTGTTGTTTTTTTCGCCAAANCCCAGAGTTTTAAGACGGA 45
10 20 30 40 50 GT736478.1 ------G-TGGATCCCGAACAATG- TGAAGACCGCAGTCT-----GTGACATTCCACCTCGTGGCCTCA 56 MI03045 TTGTTGAA- T GGAT T CCAAACAACG- T T AAGACT GCGGT T T-----GTGACATTCCT CCGCGTGGT CTCA 108 MI04862 ATGAAAAACT TTTT AACTTAAAATGGCT AAGAATAATAGAACTGGTGT CTCATTAT- TTTCAT CGACTT A 104 MP00532 ------NN- NNGCT TTGCTGCGGC- - CGCGGGG---GTT T------GTTTNNTCCT CCACGTGGT CTCA 51 MP01167 ATTAGCAA- CAAACATGGT ACCATTCCCTAGACTTCAT T T T TTTATGCCTGGTTTTGCTCCACTCACGT C 139 MP01195 AGAAAGAA- CAGCT ATGCTGCTGT - - CCGGGAT CACGT T TCACAAGGGT GT GAAT T CCTCCT TGCAAAAA 112
60 70 80 90 100 110 GT736478.1 AAATGTCCGCCACCTTCGTTGG----CAATTCAACTGCAATT----CAGGAACTATTCAA----GCGTAT 114 MI03045 AGATGTCT GCGACCTTCATTGG----CAACTCCACGGCCATT----CAAGAACTGTTCAA----ACGCAT 166 MI04862 AAA- ACAAACAAAAACAACAAGG---CAGCT TTTCTTTAAAA---ATAGT AGT AAAATAA- ATAAAAGGC 166 MP00532 AAATGTCT GCCACCTTCATTGG----CAACTCCACGGCCATC----CAAGAACTGTTT AA----ACGCAT 109 MP01167 AAGAGGAAGT CAGAAT TAT AGGGCTTTAACT GT GCCAGAATTGACACAACAAAT GTTTGATGCTAAGAAT 209 MP01195 AAGGGGCT GCGACCTTCATTGG----CAACTCCACCGCCATC----CAGGAACTGTTCAA----ACGCAT 170
120 130 140 150 160 170 180 GT736478.1 TTCAGAACAATTTACCGCCATGTTCCGCCGCAAAGCTTTCCTCCACTGGTATACGGGCGAAGGAAT GGAC 184 MI03045 CTCT GAGCAATTCACGGCCATGTTCCGT CGCAAGGCCTTCCTT CACTGGTACACT GGCGAAGGT AT GGAC 236 MI04862 ACAAAAACCAAAAATTGTATT T TTATTTGTTAAT GT TTGT AT TTAT TGCT CATTTACCAACGGTTCAGTT 236 MP00532 CTCT GAGCAATTCACGGC-----TCCGT CGCAAAGCCTTCCTT CACTGGTACACT GGCGAAGGT AT GGAT 174 MP01167 AT GATGGCAGCTTGT GAT C----CACGT CACGGAAGAT ATCTA- ACAGTCGCAGCAATATTTTTATG--T 272 MP01195 CTCT GAGCAATTCACGGC-----TCCGT CGCAAGGCCTTCCTT CACTGGTACACT GGCGAAGGT AT GGAT 235
190 200 210 220 230 240 250 GT736478.1 GAGATGGAATT- CACTGAGGCCGA- - ATCCAACATGAACGACTTGATCTCGGAATACCAGCAATACCAGG 251 MI03045 GAGAT GGAAT T - CACT GAAGCCGA- - GTCCAACATGGACGACTTGATT TCT GAATACCAGCAATAT CAAG 303 MI04862 ATTTCAGCATCATAT T CAACTTCATCATCAGCTGT CGCATCTT GAT AT T GTTGATACTC- TGACACCAAA 305 MP00532 GAGAT GGAAT T - CACT GAAGCCGA- - GTCCAACATGAACGACTTGATT TCT GAATACCAGCAATAT CAAG 241 MP01167 CGAATGAGTAT- GAAAGAAGTTGATGAACAAATGT T AAATGTT CAAAACAAGAATT CT--TCATATTTTG 339 MP01195 GAGAT GGAAT T - CACAGAAGCCGA- - GTCCAACATGAACGACTTGATT TCT GAATACCAGCAATAT CAAG 302
260 270 280 290 300 310 320 GT736478.1 ACGCAACCGT GGACGAT GAGGGT GA- GT ACGAGGCT GAGGAGACGGCACAAGCAACCGCGGAAGT T GAGT 320 MI03045 AT GCGACT GT T GAAGACGAAGGGGA- AT TTGAAGGTGAAGAT ACCAATCAAGCAACT GTTGAACAAGAAT 372 MI04862 T CATTCATAT TAGATTCAGCTTCAGTAAACTCCATT TCATCCATTCCTTCACCAGTATACCAATGCAAAA 375 MP00532 AT GCGACT GT T GAAGACGAAGGGGA- AT TTGAAGGTGAAGAT ACCAATCAAGCAACT GTTGAACAAGAAT 310 MP01167 TTGAAT GGAT TCCAAATAAT GTAAA- AACTGCTGT T TGTGAT ATTCCT CCAAGAGGT GTTAAGAT GGCTG 408 MP01195 AT GCGACT GT AGAAGACGAAGGGGA- AT TTGAAGGGGAAGAT ACTAATCAAGCAACT GTTGAACAAGAAT 371
Figure 12 Hit 7 ClustalW alignment
74
330 340 350 360 370 GT736478.1 GAGCA---ATGGCATAATTCTGTGTC------GAGCATAAA------TAAT-TGTACCAAGATGAAAGAT 374 MI03045 AAAAA- - AGAGAGAAGTTTTCGT T T T --GAATTACCACGTATTTTTTTAAT- TT TATTTTGCT TTTAACC 437 MI04862 ATGCCTTGCGACGGAACAT TGCTGTA--AATTGCTCAGAAACTCGTTTAAACAAT T CCTGAATTGCAGTA 443 MP00532 AAAAAAAAGAGAGAAGTTTT TGTT T TTTAACTTACCACGTATTTTTTTAAT- ATTATTTTGCT TTTAACC 379 MP01167 CTACTTTTATT GGAAACT CTACTGCT------ATTCAGGAATTGTCTAAACGAATAT CTGAACAATTTAC 472 MP01195 AAAAA---GAGAGAAGTTTT TGTT T TTTAACTTACCACGTATTTTTTTAAT- ATTATTTTGCT TTTAAAC 437
380 390 400 410 420 430 GT736478.1 G-ATATTTCC----T--AATTCCTATAGGCACTTTGTT---GCCACATTTGACAAGCTAATTTA- - TTAT 432 MI03045 GCATATTTCCGAAAT- - AATTCCTCGCTTAACTTTATTTATGCCAGAA--AAAAAAACAATAT GC- TTAT 502 MI04862 G- --AATTT C- AAAT--AAAAGTAGCAGACAT TTTAAG---ACCACGCGGAGGAATAT CACAAACCGCTG 504 MP00532 GCATATTTCCGACAT ATAATTCCTCGCTTAACTTTATTTATGCCAGAA----AAAAACAATAT GC- TTAT 444 MP01167 CTCTATGT T C- AGACGCAAAGCT T TCCTTCAT T GGTACACAGGCGAAGGAATGGATGAAATGGAA-TTTA 540 MP01195 GCATATTTCCGAAAT- - AATTCCTCGCTTAACTTTATTTATGCCAAAAGAAAAAAAACAATAT GC- TTAT 504
440 450 460 470 480 490 GT736478.1 TACTATTTTTATTT------AA----TTTTTTGTTGCTTGCTTGCTTGTATGCCGATGGCGCTGTTCGCT 492 MI03045 ATACAGCTTCGTTTTAAAGAAACAAAAATTTTT TTGGT GACTTGAT GGT T T TTT- ATAAATTATTTAGAC 571 MI04862 T TTTAACATTATTTGGT AT CCACTCAACAAAATATGAAGAATT-TTTGCTT T GGACTGACATCATTT GAT 573 MP00532 ATACAGCTTCGTTTTAAAGAAA- AAAATTTTTT TTTGT GACTTGATTGTT T TTT- ATAAATTATTTAGAC 512 MP01167 CTGAAGCT GAATCT AATATGAA- TGATTTAGT AT CGGAATAT CAGCAATACCAGGAT GCCACTGCT - GAT 608 MP01195 ATACAGCTTCGTTTTAAAGAAA- AAAATTTTTT--TGT GACTTGATTGTT T TTTTATAAATTATTTAGAC 571
500 GT736478.1 CCCAAACA 500 MI03045 GAT AAA-TT GAT GGGGAATTTAAAAAAAAAAAACAATTTCACAA 614 MI04862 CAGCAT 579 MP00532 GAT AAATTTGATTGGGAAAAA 533 MP01167 GAT GAAGGAGAATTTGAAGAACATGAAGAACCGGAGCATGATAT 652 MP01195 GAT AAACT TGATTGGGAAAAAAGAGAAAGAGAGAAAAAAGAAAAGCCTCAGAGGTCAACAAAATTACAAG 641
GT736478.1 500 MI03045 614 MI04862 579 MP00532 533 MP01167 652 MP01195 CTCGGGCCAAACTTGGGCCAATTTCCGCCCATAATAGAGAGGTCGAAATTAAAAAATTCAACTGGGCCGG 711
Figure 12 (Continued)
The R. reniformis Hit 7 (GT736478.1) ClustalW alignment hits produced by Perl script #2 from the first base pair (bp) to bp 320 for GT736478. The other sequences, MI03045 and MI04862 were derived from Meloidogyne incognita. The sequences MP00532, MP01167 and MP01195 were derived from Meloidogyne paranaensis. Blue highlighted areas differ from the R. reniformis sequence.
75
Figure 13 Hit 2 alt qPCR primer and Taqman® probe sequence sites
The sequence represents the Hit 2 alt gene that was identified by comparative Blast analyses between H. glycines Group 1 and R. reniformis EST DNA sequences. The gene sequence is 905 base pairs. In red are the relative locations of the Hit 2 alt forward and Hit 2 alt reverse primers. The figure also presents the location of the Hit 2 alt Taqman® probe, relative to the forward and reverse primers. The image was generated in Seqbuilder® that is part of the Lasergene® software. The Hit 2 alt forward and Hit 2 alt reverse primers are found in Table 8.
76
Figure 14 Hit 7 primer and Taqman® probe sequence sites
The sequence represents the Hit7 gene that was identified by comparative Blast analyses between H. glycines Group 1 and R. reniformis EST DNA sequences. The gene sequence is 500 base pairs. In red are the relative locations of the Hit 7 forward and Hit 7 reverse primers. The figure also presents the location of the Hit 7 tagman probe, relative to the forward and reverse primers. The image was generated in Seqbuilder® that is part of the Lasergene® software. The Hit 7 forward and Hit 7 reverse primers are found in Table 8.
77
Figure 15 Specificity of the Hit 2 alt and Hit 7 qPCR primers against R. reniformis and Meloidogyne incognita
Rr, R. reniformis (morphologically confirmed); Mi, Meloidogyne incognita. Lane 1 Hit 8 primed reaction; Lane 2 Hit 7 primed reaction; Lane 3 Hit 2 primed reaction; Lane 4 Hit 2 alt primed reaction; Lane 5 Hit 8 primed reaction; Lane 6 Hit 7 primed reaction; Lane 7 Hit 2 primed reaction; Lane 8 Hit 2 alt primed reaction. Molecular Marker is 100 bp ladder (Promega cat # G210A; Madison, WI).
78
Figure 16 Hit 2 alt PCR amplification characteristics of qPCR primers on field extracted nematodes
PCR amplification characteristics of the Hit 2 alt qPCR primers on DNA isolated from nematodes extracted from the SF, Corn and Cotton sites. The field sites are SF, Corn and Cotton. Each site was replicated in triplicate. The number of R. reniformis whose DNA was isolated is provided below the amplicon in each reaction. Lane 1, SF1; Lane 2, SF1; Lane 3, SF1; Lane 4, SF2; Lane 5, SF2; Lane 6, SF2; Lane 7, SF3; Lane 8, SF3; Lane 9, SF3; Lane 10, Corn 1; Lane 11, Corn 1; Lane 12, Corn 1; Lane 13, Corn 2; Lane 14, Corn 2; Lane 15, Corn 2; Lane 16, Corn 3; Lane 17, Corn 3; Lane 18, Corn 3; Lane 19, Cotton 1; Lane 20, Cotton 1; Lane 21, Cotton 1; Lane 22, Cotton 2; Lane 23, Cotton 2; Lane 24, Cotton 2; Lane 25, Cotton 3; Lane 26, Cotton 3; Lane 27, Cotton 3; Lane 28, No DNA; Lane 29, No Primers. Molecular Marker is 100 bp ladder (Promega cat # G210A; Madison, WI). 79
Figure 17 Hit 7 PCR amplification characteristics of qPCR primers on field extracted nematodes
PCR amplification characteristics of the Hit 7 qPCR primers on DNA isolated from nematodes extracted from the SF, Corn and Cotton sites. The field sites are SF, Corn and Cotton. Each site was replicated in triplicate. The number of R. reniformis whose DNA was isolated is provided below the amplicon in each reaction. Lane 1, SF1; Lane 2, SF1; Lane 3, SF1; Lane 4, SF2; Lane 5, SF2; Lane 6, SF2; Lane 7, SF3; Lane 8, SF3; Lane 9, SF3; Lane 10, Corn 1; Lane 11, Corn 1; Lane 12, Corn 1; Lane 13, Corn 2; Lane 14, Corn 2; Lane 15, Corn 2; Lane 16, Corn 3; Lane 17, Corn 3; Lane 18, Corn 3; Lane 19, Cotton 1; Lane 20, Cotton 1; Lane 21, Cotton 1; Lane 22, Cotton 2; Lane 23, Cotton 2; Lane 24, Cotton 2; Lane 25, Cotton 3; Lane 26, Cotton 3; Lane 27, Cotton 3; Lane 28, No DNA; Lane 29, No Primers. Molecular Marker is 100 bp ladder (Promega cat # G210A; Madison, WI). 80
Figure 18 Amplification characteristics of the Hit 2 alt and Hit 7 qPCR primer on DNA extracted directly from soil
Collected at the SF, Corn and Cotton sites. The field sites are SF, Corn and Cotton. Each site was replicated in triplicate. The number of R. reniformis whose DNA was isolated is provided below the amplicon in each reaction. (A) Hit 2 alt primed reactions. (B) Hit 7 primed reactions. Lane 1, SF1; Lane 2, SF1; Lane 3, SF1; Lane 4, SF2; Lane 5, SF2; Lane 6, SF2; Lane 7, SF3; Lane 8, SF3; Lane 9, SF3; Lane 10, No DNA; Lane 11, No Primers. Molecular Marker is 100 bp ladder (Promega cat # G210A; Madison, WI).
81
Figure 19 Hit 2 alt qPCR standard curve
The standard curve was generated from DNA isolated from morphologically confirmed R. reniformis. The qPCR was run using an ABI 7300. The R. reniformis DNA was serial diluted 10-fold. The slope = -3.226840, the y-intercept = 36.571972 and the R² = 0.993385.
82
A TTTTGCTAGGTAGTGGATAGCGGAGATGGTGTCACACATTGTATTCCAGTGGCAGATGG ATATGTCATTGGCTCTTGCATTAAACACATTCCGATTGCCGGTCGTGACATCACTTATT TCATCCAACAAGTTCTCACCCTTAAATGTTATTTTTAATTTTATTTTAGATGTTAAGAG AACGAGAGCCGACTATT B
Figure 20 Confirmative Hit 2 alt sequence
A representative Hit 2 alt DNA sequence obtained from qPCR-generated DNA isolated from an agarose gel. (A) The Hit 2 alt gene sequence was obtained from DNA generated from a qPCR reaction. The DNA was isolated from a 1% agarose gel and ligated into the pGEM®-T Vector System II (Promega). The ligation product was cloned into competent JM109 cells and selected on 50 ug/ml ampicillin on LB-agar plates. Colonies were selected and grown in liquid culture in LB media containing 50 ug/ml ampicillin. Plasmid DNA was isolated from the colonies using the Qiaprep kit (Qiagen) and sequenced. The sequenced DNA was trimmed using the Crimson Editing freeware (http://www.crimsoneditor.com/). The pGEM®-T Vector DNA sequence was trimmed leaving the Hit 2 alt. sequence. The underlined sequence represents the Hit 2 alt. queried into GenBank. (B) The Hit 2 alt. DNA sequence was aligned to the EST database in GenBank using the Blastn query option. The outcome was a match to the original Hit 2. Rotylenchulus sp. sequence as obtained directly from the Blastx query in GenBank http://www.ncbi.nlm.nih.gov/ (GenBank accession GT738331.1).
83
A GAACAATTTACCGGTAGGCTCAACTACTTGTTTTTCCCTATTCAATCAAAACAAAGGAT TCTATTATCTTCATTTAAAATTATTTTTCTAATTTCAGCCATGTTCCGCCGCAAAGCTT TCCTCCACTGGTATACGGGCGAAGGAATGGACGAGATGGAATTCACTGAGGCCGAATCC AACATGAACGACTTGATCTCGGAATACCAGCAATACCAGGACGCAACCGTGGACGATGA GGGTGAGTACGAGGCTGAGGAGACGGCACAATCACTAGTGCGGCCGCCTGCAGGTCGAC CATATGGGAGAGCTC B
Figure 21 Confirmative 7 sequence
A representative Hit 7 sequence. The Hit 7 gene sequence was obtained from DNA generated from a qPCR reaction. The DNA was isolated from a 1% agarose gel and ligated into the pGEM®-T Vector Ststem II (Promega). The ligation product was cloned into competent JM109 cells and selected on 50 ug/ml ampicillin on LB-agar plates. Colonies were selected and grown in liquid culture in LB media containing 50 ug/ml ampicillin. Plasmid DNA was isolated from the colonies using the Qiaprep kit (Qiagen) and sequenced. The sequenced DNA was trimmed using the Crimson Editing freeware (http://www.crimsoneditor.com/). The pGEM®-T Vector DNA sequence was trimmed leaving the Hit 7 sequence (Figure A). The underlined sequence represents the Hit 7 queried into GenBank. The Hit 7 DNA sequence was aligned to the EST database in GenBank using the Blastn query option. The outcome was a match to the original Hit 7. Rotylenchulus sp. sequence as obtained directly from the Blastx query in GenBank http://www.ncbi.nlm.nih.gov/ (GenBank accession GT738331.1) (Figure B).
84
A GAGGGAAAGTTGCAAAGCACTTTGAAGAGAGAGTTAAACAGGACGTGAAACCGATGAGGTGGAAACGGACA GAGTCGGCGTATCTAGCCTGTATTCAACTGGAGACCCAAGCACATTGGGTAGGCCTTTTCCAGATTGGACA GGCAATCCAACTGTTTGGGAGTCTACAGTGCATTTGCAAGTGGAGTGCGCTGAGGTGGTCGGGTTAGCTGC TTGATCTCGGGTTTGAGGCCAGCCCCTCGGGGTATGGTACCCGGCTCGGGGGAGTGCTGTTTAGCCTGTTC AACTTGTATGGAAATGGTATCGGGTCCGGCTGGTATCCAGCTAACAACTGGTAGCGGTCGCATGCGACACG TACTAGTGGTTGGTTGGGTCCTGGTCTGGCTCCCATGTTTTCCAATCCTCGGTGTAAAAACCGGTCATCTG TCCGACCCGTCTTGAAACACGGACCAAGGAGTTTAGCGTGTGCGCGAGTCATTGGGTGTTGGAAACCCAAA GGCGCAATGAAAGTGAAGGTCTCTCTTGTGGAGCTGATGTGTGACCCGGGTCACCG B
Figure 22 Rotylenchulus reniformis D2/D3
A representative D2/D3 sequence obtained from qPCR-generated DNA isolated from an agarose gel. (A) The D2/D3 gene sequence was obtained from DNA generated from a PCR reaction. The DNA was isolated from a 1% agarose gel and ligated into the pGEM®-T Vector Ststem II (Promega). The ligation product was cloned into competent JM109 cells and selected on 50 ug/ml ampicillin on LB-agar plates. Colonies were selected and grown in liquid culture in LB media containing 50 ug/ml ampicillin. Plasmid DNA was isolated from the colonies using the Qiaprep kit (Qiagen) and sequenced. The sequenced DNA was trimmed using the Crimson Editing freeware (http://www.crimsoneditor.com/). The pGEM®-T Vector DNA sequence was trimmed leaving the D2/D3. sequence. The underlined sequence represents the D2/D3queried into GenBank. The D2/D3. (B) The DNA sequence was aligned to the nucleotide database in GenBank using the Blastn query option. The outcome was a match to the original D2/D3 Rotylenchulus sp. sequence as obtained directly from the Blastx query in GenBank http://www.ncbi.nlm.nih.gov/ (GenBank accession HM13188.1).
85
Figure 23 Hit 7 qPCR standard curve
A standard curve from DNA isolated from morphologically confirmed R. reniformis. The Hit 7 alt generated qPCR was run ABI 7300. The R. reniformis DNA was serial diluted 10-fold. The slope = -3.346787, the y-intercept = 36.109322 and the R² = 0.985975.
86
REFERENCES
Abad, P., Gouzy, J., Aury, J.M., Castagnone-Sereno, P., Danchin, E.G., Deleury, E., Perfus-Barbeoch, L., Anthouard, V., Artiguenave, F., Blok, V.C., Caillaud, M.C., Coutinho, P.M., Dasilva, C., De Luca, F., Deau, F., Esquibet, M., Flutre, T., Goldstone, J.V., Hamamouch, N., Hewezi, T., Jaillon, O., Jubin, C., Leonetti, P., Magliano, M., Maier, T.R., Markov, G.V., McVeigh, P., Pesole, G., Poulain, J., Robinson-Rechavi, M., Sallet, E., Segurens, B., Steinbach, D., Tytgat, T., Ugarte, E., van Ghelder, C., Veronico, P., Baum, T.J., Blaxter, M., Bleve-Zacheo, T., Davis, E.L., Ewbank, J.J., Favery, B., Grenier, E., Henrissat, B., Jones, J.T., Laudet, V., Maule, A.G., Quesneville, H., Rosso, M.N., Schiex, T., Smant, G., Weissenbach, J., Wincker, P. 2008. Genome sequence of the metazoan plant- parasitic nematode Meloidogyne incognita. Nature Biotechnology 26:909-915.
Abel, C., Stetina, S., Adams, L. 2007. Sweet Potato Yield Reduction Caused by Reniform Nematode in the Mississippi Delta [electronic resource]. Plant health progress. http://naldc.nal.usda.gov/download/12079/PDF
Agudelo, P., Robbins, R.T., Kim, K.S., Stewart, J.M. 2005. Histological changes in Gossypium hirsutum associated with reduced reproduction of Rotylenchulus reniformis. Journal of Nematology 37:185-189.
Al-Banna, L., Ploeg, A.T., Williamson, V.M., Kaloshian, I. 2004. Discrimination of six Pratylenchus species using PCR and species-specific primers. Journal of Nematology 36:142-146.
Alkharouf, N. W., Klink, V. P. and Matthews, B. F. 2007. Identification of Heterodera glycines (soybean cyst nematode [SCN]) cDNA sequences with high identity to those of Caenorhabditis elegans having lethal mutant or RNAi phenotypes. Experimental parasitology 115:247-258.
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. 1990. Basic local alignment search tool. Journal of Molecular Biology 215:403-410
Atallah, Z.K., Stevenson, W.R. 2006. A Methodology to Detect and Quantify Five Pathogens Causing Potato Tuber Decay Using Real-Time Quantitative Polymerase Chain Reaction [electronic resource]. Phytopathology 96:1037-1045.
87
Bae, C.H., Robbins, R.T., Szalanski, A.L. 2009. Molecular identification of some Hoplolaimus species from the USA based on duplex PCR, multiplex PCR and PCR-RFLP analysis. Nematology 11:471-480.
Berry, S.D., Fargette, M., Spaull, V.W., Morand, S., Cadet, P. 2008. Detection and quantification of root-knot nematode (Meloidogyne javanica), lesion nematode (Pratylenchus zeae) and dagger nematode (Xiphinema elongatum) parasites of sugarcane using real-time PCR. Molecular and Cellular Probes 22:168-176.
Blok, V.C. 2005. Achievements in and future prospects for molecular diagnostics of plant-parasitic nematodes. Canadian Journal of Plant Pathology 27:176-185.
Cao, A.X., Liu, X.Z., Zhu, S.F., Lu, B.S. 2005. Detection of the pinewood nematode, Bursaphelenchus xylophilus, using a real-time polymerase chain reaction assay. Phytopathology 95:566-571.
Camacho C., Coulouris G., Avagyan V., Ma N. Papadopoulos J., Bealer K., Madden T.L. 2009. BLAST+: architecture and applications. BMC Bioinformatics. 10:421
Carrasco-Ballesteros, S., Castillo, P., Adams, B., Pérez-Artés, E. 2007. Identification of Pratylenchus thornei, the cereal and legume root-lesion nematode, based on SCAR-PCR and satellite DNA. European Journal of Plant Pathology 118:115- 125.
Cenis, J.L. 1993. Identification of four major Meloidogyne spp. by random amplified polymorphic DNA (RAPD-PCR). Phytopathology 83:76-80.
Chitwood, B. G. 1949. Root-knot nematodes. 1. A revision of the genus Meloidogyne Goeldi, 1887. Proceedings of the Helminthological Society of Washington 16:90– 104.
Ciancio, A., Loffredo, A.P., F., Turturo, C., M., F.S. 2005. Detection of Meloidogyne incognita and Pochonia chlamydosporia by fluorogenic molecular probes. OEPP/EPPo Bulletin 35:157-164.
Dasgupta, D. R., D. J. Raski, and S. A. Sher. 1968. A revision of the genus Rotylenchulus Linford and Oliveira, 1940 (Nematoda: Tylenchidae).Proceedings of the Helminthological Society of Washington 35:169–172.
De Weerdt, M., Kox, L., Waeyenberge, L., Viaene, N., Zijlstra, C. 2010. A Real-time PCR Assay to Identify Meloidogyne minor. Journal of Phytopathology. 159: 80– 84
Dickson, D. W., D. Huisingh, and J. N. Sasser. 1971. Dehydrogenases, acid and alkaline phospharases, and esterases for chemotaxonomy of selected Meloidogyne, Ditylenchus, Heterodera and Aphelenchus spp. Journal of Nematology 3: 1-16.
88
Esbenshade, P.R., Triantaphyllou, A.C. 1990. Isozyme phenotypes for the identification of Meloidogyne species. Journal of Nematology 22:10-15.
Finetti-Sialer, M.M., Ciancio, A. 2005. Isolate-Specific Detection of Grapevine fanleaf virus from Xiphinema index Through DNA-Based Molecular Probes. Phytopathology 95:262-268.
Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., Mello, C.C. 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391:806-811.
Fleming, C.C., Turner, S.J., Powers, T.O., Szalanski, A.L. 1998. Diagnostics of cyst nematodes: use of the polymerase chain reaction to determine species and estimate population levels. Aspects of Applied Biology 52:375-382.
Francois, C., Castagnone, C., Boonham, N., Tomlinson, J., Lawson, R., Hockland, S., Quill, J., Vieira, P., Mota, M., Castagnone-Sereno, P. 2007. Satellite DNA as a target for TaqMan real-time PCR detection of the pinewood nematode, Bursaphelenchus xylophilus. Molecular Plant Pathology 8:803-809.
Fullaondo, A., Barrena, E., Viribay, M., Barrena, I., Salazar, A., Ritter, E. 1999. Identification of potato cyst nematode species Globodera rostochiensis and G. pallida by PCR using specific primer combinations. Nematology 1:157-163.
Gao, X., Hartman, G.L., Niblack, T.L., Li, S., Jackson, T.A., Lambert, K.N. 2004. Detection and quantification of Fusarium solani f. sp. glycines in soybean roots with real-time quantitative polymerase chain reaction. Plant Disease 88:1372- 1380.
Gasser, R.B. 2006. Molecular tools advances, opportunities and prospects. Veterinary Parasitology 136:69-89.
Gasser, R.B., Monti, J.R. 1997. Identification of parasitic nematodes by PCR-SSCP of ITS-2 rDNA. Molecular and Celluar Probes 11:201-209.
Griffiths A.J., Miller J.H., Suzuki D.T., Lewontin R. C., and Gelnart W. M. 2000. An Introduction to Genetic Analysis 7th ed. New York: W.H. Freeman and Company
Gutiérrez, O., Robinson, A., Jenkins, J., McCarty, J., Wubben, M., Callahan, F., and Nichols, R. 2011. Identification of QTL regions and SSR markers associated with resistance to reniform nematode in Gossypium barbadense L. accession GB713. TAG Theoretical and Applied Genetics 122: 271-280.
Harris, T.S., Sandall, L.J., Powers, T.O. 1990. Identification of single Meloidogyne juveniles by polymerase chain reaction amplification of mitochondrial DNA. Journal of Nematology 22:518-524.
89
Henn, R. A. Burdine, B., Main J.L., Balbalian C.J., 2006. Evaluation of nematicides for management of reniform nematodes and sweet potato yield, 2004. Fungicide and Nematicide Tests. Report 61:NO10. DOI:10.1094/FN61. The American Phytophathological Society, St. Paul, MN.
Inserra, R. N. and Vovlas N., 1980 The biology if Rotlenchulus macrodoratus. Journal of Nematology 12: 97-102
Kamath, R. S., Fraser, A. G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., Le Bot, N., Moreno, S., Sohrmann, M., Welchman, D. P., Zipperlen, P., and Ahringer, J. 2003. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421:231-237.
Kang, J.S., Choi, K.S.C., Shin, Moon, I.S., Lee, S.G., Lee, S.H. 2004. Development of an efficient PCR-based diagnosis protocol for the identification of the pinewood nematode, Bursaphelenchus xylophilus (Nematoda: Aphelenchoididae). Nematology 6:279-285.
Klink, V., Kim, K.-H., Martins, V., MacDonald, M., Beard, H., Alkharouf, N., Lee, S.- K., Park, S.-C., and Matthews, B. 2009. A correlation between host-mediated expression of parasite genes as tandem inverted repeats and abrogation of development of female Heterodera glycines cyst formation during infection of Glycine max. Planta 230:53-71.
Lawrence, G.W., McLean, K.S. 1999. Plant-parasitic nematode pests of soybeans. In: Heatherly, L.G., Hodges, H.F. (Eds.), Soybean Production in the Midsouth. CRC Press, pp. 291-310.
Lawrence, K.S., Lawrence, G.W., Van Santan, E. 2005. Effect of controlled cold storage on recovery of Rotylenchulus reniformis from naturally infested soil. Journal of Nematology 37:272-275.
Lawrence, K.S., Usery S.R., Burmester C.H., Lawrence G.W. 2005 Evaluation of Telone ll, Vapam HL, and Temick 15G for reniformn nematode management in cotton in North Alabama, 2004. In 2004 Cotton Research Report, 40. Auburn, AL: Alabama Agriculture Experiment Station Res. Report Number 26
Leal, I., Green, M., Allen, E., Humble, L., Rott, M. 2005. An effective PCR-based diagnostic method for the detection of Bursaphelenchus xylophilus (Nematoda: Aphelenchoididae) in wood samples from lodgepole pine. Nematology 7:833-842.
Leal, I., Green, M., Allen, E., Humble, L., Rott, M. 2007. Application of a real-time PCR method for the detection of pine wood nematode, Bursaphelenchus xylophilus, in wood samples from lodgepole pine. Nematology 9:351-362.
90
Linford M.B, Oliveira J.M. 1940. Rotylenchulus reniformis, nov. gen. n. sp., a nematode parasite of roots. Proceeding of the Helminthological Society of Washington 7: 35-42.
Livak, K. J., and Schmittgen, T. D. 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-[Delta][Delta]CT Method. Methods 25:402-408.
Machado, A.C., Ferraz, L.C., de Oliveira, C.M. 2007. Development of a a species- specific revers primer for the molecular diagnostic of Pratylenchus brachyurus. Nematropica 37:249-257.
Madani, M., Subbotin, S.A., Moens, M. 2005. Quantitative detection of the potato cyst nematode, Globodera pallida, and the beet cyst nematode, Heterodera schachtii, using Real-Time PCR with SYBR green I dye. Molecular and Cellular Probes 19:81-86.
Matsunaga, K., Togashi, K. 2004. A simple method for discriminating Bursaphelenchus xylophilus and B. mucronatus by species-specific polymerase chain reaction primer pairs. Nematology 6:273-277.
Mello, C. C. and Conte, D. J. 2004. Revealing the world of RNA interference. Natrure 431: 338-342.
Meng, Q.P., Long, H., Xu, J.H. 2004. PCR assays for rapid and sensitive identification of three major root-knot nematodes, Meloidogine incognita, M. javanica, and M. arenaria ACTA Phytopathologica Sinica 34:204-210.
Mueller J.D. 2011 The use of Temik 15G on cotton and soybean in the southeast. Proceedings of the Beltwide Cotton Conferences 1:208-214
Nakasono, K., and Ichinohe, M. 1967. A Japanese reniform nematode,
Rotylenchulus nicotiana (Yokoo and Tanaka, 1954) n. comb.(Tylenchida: Hoplolaimidae). Japanese Journal of Applied Entomologyand Zoology 4:169– 176.
Nowaczyk, K., Dobosz, R., Kornobis, S., Obrepalska-Steplowska, A. 2008. TaqMan REAL-Time PCR-based approach for differentiation between Globodera rostochiensis (golden nematode) and Globodera artemisiae species. Parasitology Research 103:577-581.
Okubara, P.A., Paulitz, T.C., Schroeder, K.L. 2008. Identification and Quantification of Rhizoctonia solani and R. oryzae Using Real-Time Polymerase Chain Reaction. Phytopathology 98:837-847.
91
Oliveira, C.M., Fenton, B., Malloch, G., Brown, D.J., Neilson, R. 2005. Development of species-specific primers for the ectoparasitic nematode species Xiphinema brevicolle, X. diffusum, X. elongatum, X. ifacolum and X. longicaudatum (Nematoda: Longidoridae) based on ribosomal DNA sequences. Annals of Applied Biology 146:281-288.
Opperman, C.H., Mitros, T., Schaff, J., Houfek, T.D., Liu, Q., Schaffer, R., Thomas, V.P., Windham, E., Scholl, E., Sosinski, B.R., Rokhsar, D.S., Burke, M., Bird, D.M., Williamson, V.M., Cohn, J., Gajan, J., Graham, S., Cromer, J., Diener, S. 2008. Sequence and genetic map of Meloidogyne hapla: A compact nematode genome for plant parasitism. Proceedings of the National Academy of Sciences of the United States of America 105:14802-14807.
Powers, T.O., Harris, T.S. 1993. A polymerase chain reaction method for identification of five major Meloidogyne species. Journal of Nematology 25:1-6.
Quader, M., Nambiar, L., Cunnington, J. 2008. Conventional and real-time PCR-based species identification and diversity of potato cyst nematodes (Globodera spp.) from Victoria, Australia. Nematology 10:471-478.
Randig, O., Bongiovanni, M., Carneiro, R.M., Castagnone-Sereno, P. 2002. Genetic diversity of root-knot nematodes from Brazil and development of SCAR markers specific for the coffee-damaging species. Genome 45:862-870.
Riga, E., Karanastasi, E., Marcelo, C., Oliveira, G., Neilson, R. 2007. Molecular Identification of Two Stubby Root Nematode Species. American Journal of Potato Research 84:161-167.
Robbins, R. T., Shipe, E., Arelli, P., Chen, P., Rakes, L., Jackson, L. E., Gbur, E. E., and Dombek, D. G. 2008. Reniform Nematode Reproduction on Soybean Cultivars and Public Breeding Lines in 2007. Pages 330-336 in: 2008 Beltwide Cotton Conferences, Nashville, Tennessee.
Robinson, A.F. 2007. Reniform in U.S. Cotton: When, Where, Why, and Some Remedies1. Annual Review of Phytopathology 45:263-288.
Robinson, A. F., Inserra, R. N., Caswell-Chen, E. P., Vovlas, N., and Troccoli, A. 1997. Rotylenchulus Species: Identification, Disterbution, Host Ranges, and Crop Plant Resistance. Nematologica 27:127-180.
Rozen, S., and Skaletsky, H. 1999. Primer3 on the WWW for General Users and for Biologist Programmers. Pages 365-386 in: Bioinformatics Methods and Protocols, S. Misener and S. A. Krawetz, eds. Humana Press.
Sato, E., Min, Y., shirakashi, T., Wada, S., Toyota, K. 2007. Detection of the root-lesion nematode, Pratylenchus penetrans (Cobb), in a nematode community using real- time PCR. Japanese Journal of Nematology 37:87-92. 92
Sawa, M., Suetsugu, S., Sugimoto, A., Miki, H., Yamamoto, M., Takenawa, T. 2003. Essential role of the C. elegans Arp2/3 complex in cell migration during ventral enclosure. Journal of Cell Science 116:1505-1518.
Semblat, J. P., Wajnberg, E., Dalmasso, A., Abad, P., and Castagnone-Sereno, P. 1998. High-resolution DNA fingerprinting of parthenogenetic root-knot nematodes using AFLP analysis. Molecular Ecology 7:119-125.
Skantar, A.M., Chitwood, D.J., Carta, L.K., Handoo, Z.A. 2007. Morphological and Molecular Identification of Globodera pallida Associated with Potato in Idaho [electronic resource]. Journal of Nematology 39:133-144.
Sonnichsen, B., Koski, L. B., Walsh, A., Marschall, P., Neumann, B., Brehm, M., Alleaume, A. M., Artelt, J., Bettencourt, P., Cassin, E., Hewitson, M., Holz, C., Khan, M., Lazik, S., Martin, C., Nitzsche, B., Ruer, M., Stamford, J., Winzi, M., Heinkel, R., Roder, M., Finell, J., Hantsch, H., Jones, S. J. M., Jones, M., Piano, F., Gunsalus, K. C., Oegema, K., Gonczy, P., Coulson, A., Hyman, A. A., and Echeverri, C. J. 2005. Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans. Nature 434:462-469.
Stein, L. D., Bao, Z., Blasiar, D., Blumenthal, T., Brent, M. R., Chen, N., Chinwalla, A., Clarke, L., Clee, C., Coghlan, A., Coulson, A., D'Eustachio, P., Fitch, D. H. A., Fulton, L. A., Fulton, R. E., Griffiths-Jones, S., Harris, T. W., Hillier, L. W., Kamath, R., Kuwabara, P. E., Mardis, E. R., Marra, M. A., Miner, T. L., Minx, P., Mullikin, J. C., Plumb, R. W., Rogers, J., Schein, J. E., Sohrmann, M., Spieth, J., Stajich, J. E., Wei, C., Willey, D., Wilson, R. K., Durbin, R., and Waterston, R. H. 2003. The Genome Sequence of Caenorhabditis briggsae: A Platform for Comparative Genomics. PLoS Biol 1:e45.
Subbotin, S.A., Madani, M., Krall, E., Sturhan, D., Moens, M. 2005. Molecular Diagnostics, Taxonomy, and Phylogeny of the Stem Nematode Ditylenchus dipsaci Species Complex Based on the Sequences of the Internal Transcribed Spacer-rDNA. Phytopathology 95:1308-1315.
Subbotin S.A. and Moens, M. 2006. Molecular Taxonomy and Phylogeny. in R. Perry and M. Moens, ed. Plant Nematology, UK: CABI
The C. elegans Sequencing Consortium. 1998. Genome sequence of the nematode C. elegans: a platform for investigating biology. Science 282:5396
Toyota, K., Shirakashi, T., Sato, E., Wada, S. 2008. Development of a real time PCR method for the potato-cyst nematode Globodera rostochiensis and the root-knot nematode Meloidogyne incognita. Soil Science and Plant Nutrition 54:72-76.
Urwin, P. E., Lilley, C. J., and Atkinson, H. J. 2002. Ingestion of Double-Stranded RNA by Preparasitic Juvenile Cyst Nematodes Leads to RNA Interference. Molecular Plant-Microbe Interactions 15:747-752. 93
Usery, S. R., Jr., Lawrence, K. S., Lawrence, G. W., and Burmester, C. H. 2005. Evaluation of cotton cultivars for resistance and tolerance to Rotylenchulus reniformis. Nematropica 35: 121-133.
Vovlas, N., and Inserra R. N. 1982 Biological relationship of Rotylenchulus borealis on several plant cultivars. Journal of Nematology 14: 373-377.
Weaver, D. B., Lawrence, K. S., and van Santen, E. 2007. Reniform Nematode Resistance in Upland Cotton Germplasm. Crop Science 47:19-24.
Williamson, V.M., Caswell-Chen, E.P., Westerdahl, B.B., Wu, F.F., Caryl, G. 1997. A PCR assay to identify and distinguish single juveniles of Meloidogyne hapla and M. chitwoodi. Journal of Nematology 29:9-15.
Wubben, M. J., Callahan, F. E., and Scheffler, B. S. 2010. Transcript analysis of parasitic females of the sedentary semi-endoparasitic nematode Rotylenchulus reniformis. Molecular and biochemical parasitology 172:31-40.
Wylie, T., Martin, J. C., Dante, M., Mitreva, M. D., Clifton, S. W., Chinwalla, A., Waterston, R. H., Wilson, R. K., and McCarter, J. P. 2004. Nematode.net: a tool for navigating sequences from parasitic and free‐living nematodes. Nucleic Acids Research 32: D423-D426.
Yan, G., Easley, S.A., Sheedy, J.G., Thompson, A.L., Smiley, R.W., Okubara, P.A., Skantar, A. 2008. Detection and Discrimination of Pratylenchus neglectus and P. thornei in DNA Extracts from Soil [electronic resource]. Plant Disease 92:1480- 1487.
Yik C. P. and Birchfield W. 1982 Reactions of sweet potato root tissue to the reniform nematode. Plant disease 66: 707-709
Zijlstra, C. 2000. Identification of Meloidogyne chitwoodi, M. fallax and M. hapla based on SCAR-PCR: a powerful way of enabling reliable identification of populations or individuals that share common traits. European Journal of Plant Pathology 106:283-290.
Zijlstra, C., Donkers-Venne, D.T.H.M., Fargette, M. 2000. Identification of Meloidogyne incognita, M. javanica and M. arenaria using sequence characterised amplified region (SCAR) based PCR assays. Nematology 2:847-853.
Zijlstra, C., Hoof, R.A.v. 2006. Multiplex Real-Time Polymerase Chain Reaction (TaqMan) Assay for the Simultaneous Detection of Meloidogyne chitwoodi and M. fallax [electronic resource]. Phytopathology 96:1255-1262.
Zijlstra, C., Hoof, R.v. Donkers-Venne, D., 2004. A PCR test to detect the cereal root- knot nematode Meloidogyne naasi. European Journal of Plant Pathology 110:855- 860. 94
APPENDIX A
PERL SCRIPT # 1
95
#!/usr/bin/perl -w use strict; use Bio::Seq; use Bio::SeqIO; use Bio::Tools::Run::StandAloneBlast; my @params = (program => 'blastn', database => "leathal.seqs.fasta", -a => 2); my $blast_obj = Bio::Tools::Run::StandAloneBlast->new(@params); my $seqio_obj = Bio::SeqIO->new(-file => "rest.fasta.edit.fasta", -format => "fasta" );
#Each query that has a suffecient hit get is writen to this file below. my $outqueryseqs = Bio::SeqIO->new(-file => ">rest.leathal.hits.fasta",-format => "fasta"); my $blastcount=0; while (my $seq_obj = $seqio_obj->next_seq){ my $great=0; if (length($seq_obj->seq)>100){ my $report_obj = $blast_obj->blastall($seq_obj); $blastcount++; while( my $result = $report_obj->next_result ) { while (my $hit = $result->next_hit){ while (my $hsp = $hit->next_hsp){ if($hsp->percent_identity>50){ if($hsp->length('query')>100){ if($hsp->evalue<2){ if($hsp->percent_identity<100){ $great=1; } } } } } } } }
#Each query that has a suffecient hit get is writen to this file below. if ($great==1){ $outqueryseqs->write_seq($seq_obj); } }
96
APPENDIX B
PERL SCRIPT # 2
97
#!/usr/bin/perl -w use strict; use Bio::Seq; use Bio::SeqIO; use Bio::Tools::Run::StandAloneBlast;
#Setting parameters for blastn my @params = (program => 'blastn', database => "M.compiled.fasta", -a => 2);
#Calling Blastn my $blast_obj = Bio::Tools::Run::StandAloneBlast->new(@params);
#Defining the Query set of sequences for Blastn my $seqio_obj = Bio::SeqIO->new(-file => "rest.leathal.hits.fasta", -format => "fasta" );
(open OUTFILE, ">run.2.leathal.feb.8.outfile.txt")||die("output did not open"); print OUTFILE "Query,Blast ID,# seq w/hit,total # Hits, avg % ID, avg lenght,\n";
my $blastcount=0; while (my $seq_obj = $seqio_obj->next_seq){ if (length($seq_obj->seq)>100){
#Printing query sequence to outfile my $seqout = $seq_obj->id; print OUTFILE "$seqout,";
#Calling and Clearing variables to be printed to outfile. my @outhits; my @outID; my @outlenght; my %outseq; my $report_obj = $blast_obj->blastall($seq_obj); $blastcount++; while( my $result = $report_obj->next_result ) { while (my $hit = $result->next_hit){ while (my $hsp = $hit->next_hsp){ if($hsp->percent_identity>50){ if($hsp->length('query')>100){ if($hsp->evalue<2){ if($hsp->percent_identity<100){ my $estcheck = ((($hsp->length('hit'))/($hit->length))*100); print "\nPecent of hit sequence: $estcheck";
98
if ($estcheck>1){ push(@outhits, 1); push(@outID, $hsp->percent_identity); push(@outlenght, $hsp->length('query'));
#Putting Hit names in hash my $outname= $seq_obj->id; my $hitquery= $hit->name; print "Blast count: $blastcount\n";
$outseq{$hitquery}=$outname;
} } } } } } } } #Gettin hit info ready and printing it to the Summary Outfile my $hashcount=0; for my $key ( keys %outseq ) { $hashcount++; } if ($hashcount>0){ print OUTFILE "$hashcount,"; my $add=0; foreach my $ok(@outhits){ $add=+$ok; } print OUTFILE $blastcount; print OUTFILE "$add,"
99