IL-25 Induces M2 Macrophages and Reduces Renal Injury in Proteinuric Kidney Disease

BASIC RESEARCH www.jasn.org

Qi Cao,* Changqi Wang,* Dong Zheng,* Ya Wang,* Vincent W. S. Lee,* Yuan Min Wang,† Guoping Zheng,* Thian Kui Tan,* Di Yu,‡ Stephen I. Alexander,† David C. H. Harris,* and Yiping Wang*

*Centre for Transplant and Renal Research, Westmead Millennium Institute, The University of Sydney, Sydney, NSW, Australia; †Centre for Kidney Research, Children’s Hospital at Westmead, Sydney, NSW, Australia; and ‡Department of Immunology and inflammation, Garvan Institute of Medical Research, Sydney, NSW, Australia

ABSTRACT The kidney contains receptors for the cytokine IL-25, but the effects of IL-25 in CKD are unknown. Here, we induced adriamycin nephropathy in both BALB/c mice and severe combined immunodeficient (SCID) mice, and we injected IL-25 for 7 consecutive days starting at day 5 after adriamycin administration. BALB/c mice treated with IL-25 had less glomerulosclerosis, tubular atrophy, interstitial expansion, and proteinuria than control mice at day 28. IL-25 increased the levels of IL-4 and IL-13 in serum, kidney, renal draining lymph nodes, and CD4ϩ lymphocytes. IL-25 also directly suppressed effector macrophages in BASIC RESEARCH vitro and in vivo and induced alternatively activated (M2) macrophages in vivo. However, in SCID mice and in BALB/c mice treated with IL-4/13–neutralizing antibody, IL-25 failed to protect against renal injury and did not induce M2. In conclusion, IL-25 protects against renal injury in adriamycin nephropathy in mice by, at least in part, inducing Th2 immune responses.

J Am Soc Nephrol 22: 1229–1239, 2011. doi: 10.1681/ASN.2010070693

IL-25 is a member of the IL-17 family of cytokines pressing IL-17 function but also suppresses epi- capable of inducing Th2-associated cytokine pro- sodes of relapsing-remitting EAE.4,7 Recently an- duction, but is distinctly different in function from other study showed that IL-25 is able to reduce other members of this family that act to promote proinflammatory cytokine production of CD14ϩ rather than ameliorate proinflammatory responses monocytes/macrophages in vitro and to protect in various tissues.1 IL-25 is produced by activated against LPS-induced lethal endotoxemia in mice.8 Ad- Th2 cells, mast cells, eosinophils, basophils, and ditionally, IL-25 increases serum levels of IgE, IgG1, cells in lung and intestine.2–4 Administration of IgA, blood eosinophilia, and eosinophilic infiltrates in IL-25 to mice has been shown to induce immune lungs and plays an important role in the development responses characterized by the overproduction of and exacerbation of asthma and allergic inflamma- Th2 cytokines such as IL-4, IL-5, and IL-13.5 IL-25 tion.9 IL-25 has also been shown to activate NF-␬B is an important regulator of Th2 responses and host defense. IL-25 dampens counterproductive Th1 responses in helminth infection and limits chronic Received July 1, 2010. Accepted February 13, 2011. inflammation in the gastrointestinal tract,6 inde- Published online ahead of print. Publication date available at pendent of its effects on Th2 cell differentiation. It www.jasn.org. has been reported that endogenous IL-25 is re- Correspondence: Dr. Yiping Wang, Centre for Transplant and Renal Research, University of Sydney, Westmead Millennium In- quired to limit IL-23 expression and number of stitute, Level 2 Block D, Darcy Road, Westmead, New South Th17 cells in large intestine.4 Furthermore, IL-25 Wales, Australia. Phone: 61–2-9845–6877; Fax: 61–2-9845–9620; not only inhibits the development of experimental E-mail: [email protected] autoimmune encephalomyelitis (EAE) by sup- Copyright © 2011 by the American Society of Nephrology

J Am Soc Nephrol 22: 1229–1239, 2011 ISSN : 1046-6673/2207-1229 1229 BASIC RESEARCH www.jasn.org

and to induce the production of IL-8 in a renal cell line.10 The role IL-25 Induced Th2 Responses in the Periphery of IL-25 in kidney disease is unknown. In AN mice treated with IL-25, serum levels of the Th2 cyto- IL-25’s biologic effects are mediated by the IL-25 receptor kines IL-4, IL-5, and IL-13 were significantly increased com- (IL-25R), which is constitutively expressed in kidney, liver, and pared with those of normal and control AN mice (Figure 2A). intestine.10 IL-25R is not only highly expressed by T cells (par- Splenic CD4ϩ T cells separated from AN mice treated with ticularly Th2 memory cells) but is also expressed by human IL-25 produced high levels of IL-4, IL-5, and IL-13 in culture blood monocytes (CD14 cells).8 In kidney disease, macro- supernatant with CD3/CD28 stimulation (Figure 2B). Simi- phages are essential mediators of chronic inflammatory reac- larly, by flow cytometry assessment, the numbers of IL-4ϩ and tions.11 Macrophage and T cell accumulation is a common IL-13ϩ cells were increased significantly among splenic CD4ϩ feature of human and animal renal disease and correlates with T cells from AN mice treated with IL-25 (Figure 2, C and D). the degree of histologic and functional injury.12,13 Adriamycin Furthermore, the mRNA expression of IL-4 and IL-13 in kid- nephropathy (AN) is a model of chronic proteinuric renal dis- ney and renal draining lymph nodes (RDLN) were signifi- ease induced by adriamycin that resembles human focal seg- cantly increased in AN mice treated with IL-25 compared with mental glomerular sclerosis.14,15 In AN, inflammatory infil- normal and control AN groups (Figure 2, E and F). The in- trates are also composed largely of macrophages and T cells. It crease of Th2 cytokines in AN mice treated with IL-25 was has been reported that administration of IL-4 ameliorates ex- transient. Th2 cytokine levels were high at week 2 and fell by perimental GN.16 An adenovirus expressing IL-13 injected into week 4 but were still significantly higher than those of normal kidney also increases renal IL-13 levels and attenuates acute and control AN mice at the same time point. kidney allograft injury.17 These studies have suggested that enhancing Th2 responses in kidney may reduce renal inflamma- IL-25 Suppressed Macrophage Activation In Vivo and tion and renal damage. Therefore, given its ability to induce In Vitro Th2 immune responses and to inhibit macrophage-derived in- To define the mechanisms underlying the protective effect of flammatory cytokines, IL-25 is a potential candidate for treat- IL-25 against renal injury, we examined the activation status of ing kidney disease. We thus examined the role of IL-25 in AN endogenous macrophages in the kidney. A significantly lower and tested its dependence on Th2 immune responses. percentage of macrophages expressed TNF-␣ and IL-12 in AN In this study, IL-25 was administered to mice with AN. We mice treated with IL-25 compared with that from control AN evaluated its ability to protect against renal functional and mice (Figure 3, A and B). In addition, mRNA expression of structural injury in vivo and examined possible mechanisms inducible nitric oxide synthase (iNOS), chemokine ligand 2 underlying its effect on macrophages and T cells. Here, we (CCL2), IL-1␤, and IL-6 was significantly lower in the macro- provide evidence that IL-25 is a critical cytokine in both pro- phages from AN mice treated with IL-25 compared with that moting Th2 immune responses and inhibiting renal injury in from control AN mice (Figure 3C). Similarly, in vitro studies murine AN. Notably, in addition to its role in promotion of showed that preincubation of activated macrophages with Th2 immune responses and deactivation of macrophages, a IL-25 significantly reduced their mRNA expression of iNOS novel mechanism underlying IL-25’s protective effects against and proinflammatory cytokines TNF-␣, CCL2, IL-1␤, IL-6, renal injury has been uncovered: that of its ability to induce and IL-12 (Figure 3D). Furthermore, IL-25 significantly sup- alternatively activated macrophages in vivo. pressed phagocytosis and NO production of LPS-activated macrophages (Figure 3, E and F).

IL-25 Induced Alternatively Activated Macrophages RESULTS In Vivo To further study the mechanisms of IL-25’s protective effects, IL-25 Protected against Renal Injury in AN BALB/c Mice we examined the phenotype and cytokine profile of endoge- Body weight was significantly reduced in AN mice compared with nous macrophages in kidney. Interestingly, the macrophages that of normal mice and was significantly improved in AN mice in kidneys from AN mice treated with IL-25 had elevated levels treated with IL-25 (Figure 1, A and B). Similarly, urine protein was of mannose receptor (MR)—10 times higher expression at significantly increased in AN mice compared with that of normal week 2 and 2 times higher expression at week 4 compared with mice and was significantly improved in AN mice treated with those from normal and control AN mice (Figure 4A). MR is IL-25 (Figure 1C). In AN, renal injury was characterized by glo- expressed on and has been used as a marker for alternatively merular sclerosis, tubular atrophy, and interstitial fibrosis. Glo- activated macrophages (M2). Correspondingly, other genes merular sclerosis was significantly reduced in AN mice treated also recognized as M2 markers, arginase, FIZZ1, YM1, and with IL-25 compared with that of control AN mice. Damaged IL-10, showed increased expression at week 2 in renal macro- tubules was significantly improved in AN mice with IL-25 com- phages from AN mice treated with IL-25 (Figure 4B). In vitro, pared with that of control AN mice. Similarly interstitial volume macrophages isolated from bone marrow and cultured with was significantly reduced in mice given IL-25 compared with that IL-25 alone did not express increased mRNA levels of MR, of control AN mice (Figure 1, D and E). arginase, FIZZ1, YM1, IL-10, or CCL-17. This showed that

1230 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 1229–1239, 2011 www.jasn.org BASIC RESEARCH

Figure 1. IL-25 protected against renal injury in AN BALB/c mice. (A) BALB/c mice were injected daily with IL-25 from day 5 to day 12 after ADR injection. Mice were killed on day 14 and day 28. (B) Body weight in normal, AN ϩ vehicle, and AN ϩ IL-25 groups on days 0 to 28. (C) Proteinuria at weeks 2 and 4. (D) PAS-stained sections of renal cortices at week 4 (ϫ200). (E) Quantitative assessment of glomerular sclerosis, tubular damage, and interstitial volume. The values represent the mean Ϯ SEM of evaluations from each group (n ϭ 8 per group). *P Ͻ 0.05, and **P Ͻ 0.01 versus AN ϩ vehicle.

IL-25 did not induce M2 macrophages directly. However, after mice treated with IL-25. The protective effects of IL-25 on re- stimulation with IL-25 and IL-4 or IL-13, macrophages in- nal function and histology were blocked by IL-4/13 neutraliz- creased their expression of MR and FIZZ1, but not arginase, ing antibodies (Figure 5, A–C). IL-4/13 neutralizing antibodies YM1, IL-10, and CCL-17, compared with macrophages ex- also blocked IL-25–mediated induction of M2 macrophages in posed to IL-4 or IL-13 alone (Figure 4C and Supplementary AN mice. The number of MR-positive macrophages in AN Figure S1). In addition, IL-25 induced expression of IL-4/13 in mice treated with IL-25 was decreased at week 2 and week 4 by CD4ϩ T cells in vitro after 3-day stimulation (Figure S2). IL-4/13 neutralizing antibodies compared with AN mice These IL-4/13 expressing CD4 T cells after IL-25 stimulation treated with IL-25 alone (Figure 6A). Correspondingly, other induced M2 phenotype in co-cultured macrophages. The ef- markers of M2 macrophages including arginase, FIZZ1, fect on macrophages of IL-25–induced T cells was blocked by YM1, and IL-10 were decreased at week 2 and week 4 (Figure IL-4/13 neutralizing antibodies (Figure 4D). 6B). Cellular protein levels of TNF-␣ and IL-12 and mRNA expression of iNOS, CCL2, IL-1, and IL-6 in renal macro- IL-4/13 Was Required for IL-25–Mediated Protection phages from AN mice treated with IL-25 were increased by To test whether IL-25 renoprotection was Th2 cytokine depen- IL-4/13 neutralizing antibodies at week 2 and week 4 (Figure dent, IL-4/13 neutralizing antibodies were administered to AN 6, C and D).

J Am Soc Nephrol 22: 1229–1239, 2011 IL-25 Ameliorates Adriamycin Nephropathy 1231 BASIC RESEARCH www.jasn.org

Figure 2. IL-25 induced peripheral Th2 responses. (A) IL-4, IL-5, and IL-13 levels in serum were assessed in normal, AN ϩ vehicle, and AN ϩ IL-25 groups at weeks 2 and 4. (B) The levels of cytokine expression were measured by ELISA in splenic CD4ϩ T cells stimulated for 3 days with anti-CD3/CD28 (1 ␮g/ml) and then restimulated for 24 hours with 1 ␮g/ml of anti-CD3. (C and D) Intracellular IL-4 and IL-13 expression was analyzed by flow cytometry in CD4ϩ T cells stimulated with ionomycin and PMA in the presence of GolgiStop for 5 hours. Numbers above the gates indicate the percentage of cells stained positive for each respective cytokine. (E and F) The mRNA expression of IL-4 and IL-13 in kidney (E) and RDLN (F) was examined by real-time PCR and expressed relative to the control of each experiment. The values represent the mean Ϯ SEM of evaluations from each group (n ϭ 8 per group). *P Ͻ 0.05, **P Ͻ 0.01, and ***P Ͻ 0.001 versus AN ϩ vehicle.

Effects of IL-25 on Inflammatory Infiltrates crease the expression of MR, arginase, FIZZ1, YM1, and IL-10 in Interstitial infiltration with macrophages, CD4ϩ, and renal macrophages from AN SCID mice (Supplementary Figure CD8ϩ T cells was significantly reduced in renal cortex of S4, A and B). In addition, IL-25 did not suppress endogenous AN mice treated with IL-25 compared with that of control renal macrophages in AN SCID mice. Cellular protein levels of AN mice at week 4 but not at week 2. Reduction of inflam- TNF-␣ and IL-12 and mRNA expression of iNOS, CCL2, IL-1, matory infiltrates by IL-25 was blocked by IL-4/13 neutral- and IL-6 were not reduced in renal macrophages from AN SCID izing antibodies (Figure 7). mice treated with IL-25 compared with those from normal and AN SCID mice (Supplementary Figure S4, C–E). IL-25 Did Not Protect against Renal Injury in Severe IL-25 did not protect against renal injury in AN SCID mice. Combined Immunodeficient Mice There were no differences in urine protein levels of AN SCID To test whether IL-25–induced renoprotection was lymphocyte mice treated with or without IL-25 (Figure 8A). There were dependent, the effect of IL-25 administration in severe combined also no differences in glomerular sclerosis, tubular atrophy, immunodeficient (SCID) mice with AN (AN SCID mice) was and interstitial expansion between AN SCID mice treated with examined. Serum IL-4, IL-5, and IL-13 levels and mRNA expres- IL-25 and those treated with saline (Figure 8, B and C). sion of IL-4 and IL-13 in kidney were not increased in AN SCID mice treated with IL-25 at both weeks 2 and 4 (Supplementary Figure S3, A and B). However, IL-4 and IL-13 expression in RDLN DISCUSSION was significantly increased at week 2 but not at week 4 in AN SCID mice treated with IL-25 (Supplementary Figure S3C). In this study, IL-25 induced a Th2 immune response and re- Furthermore, IL-25 failed to induce alternatively activated duced renal injury in immunocompetent mice with AN. The macrophages in the kidneys of AN SCID mice. IL-25 did not in- protective effect of IL-25 could be caused by its initiation of

1232 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 1229–1239, 2011 www.jasn.org BASIC RESEARCH

Figure 3. IL-25 suppressed endogenous renal macrophages in vivo and M1 macrophages in vitro. After administration of IL-25, CD11bϩ endogenous renal macrophages at week 2 and week 4 were purified by flow cytometry. The expression of TNF␣ and IL-12 by endogenous renal macrophages was analyzed by flow cytometry (A and B) and the mRNA expression of iNOS, CCL2, IL-1␤, and IL-6 was examined by real-time PCR (C). The values represent the mean Ϯ SEM of evaluations from each group (n ϭ 8 per group). *P Ͻ 0.05, and **P Ͻ 0.01 versus AN ϩ vehicle. (D) The mRNA expression of iNOS, TNF␣, CCL2, IL-1␤, IL-6, and IL-12 by bone marrow macrophages preincubated with medium (M) or IL-25 (100 ng/ml) for 1 hour and stimulated or not with LPS or IFN␥ for a further 6 h in vitro. The values represent the mean Ϯ SEM of evaluations from each group (n ϭ 4 per group). #P Ͻ 0.05 and ##P Ͻ 0.01 versus No IL-25. (E and F) Resting macrophages (M0) were cultured with LPS (to become M1 macrophages) in the presence of various concentrations (ng/ml) of mouse recombinant IL-25 for 24 hours. Cells were co-cultured with FITC-labeled dextran for 45 minutes. The uptake of fluorescence beads (mean fluorescence intensity) was determined by flow cytometry. In parallel, macrophages were cultured with LPS in the presence of various concentrations (ng/ml) of mouse recombinant IL-25 for 48 hours, and NO was measured in the culture supernatant. The values represent the mean Ϯ SEM of evaluations from each group (n ϭ 4 per group). @P Ͻ 0.05 and @@P Ͻ 0.01 versus M1.

Th2 responses, induction of alternatively activated (M2) mac- diabetes18 and EAE,7 whereas there is much less known about rophages, and deactivation of effector macrophages in kidney. its potential role in innate immune mechanisms of chronic Furthermore, induction of M2 macrophages by IL-25 was inflammatory diseases. AN is produced by injection of adria- shown to depend on Th2 immune responses, because IL-25 mycin, which leads to a chronic inflammatory kidney disease failed to induce M2 macrophages and protect renal injury ei- similar to human focal segmental glomerular sclerosis. Innate ther in AN BALB/c mice treated with IL-4/13 neutralizing an- immunity seems to be the dominant pathway of renal injury in- tibodies or in AN SCID mice. duction and progression in this model. AN mice treated with IL-25 has been shown to regulate cognate immunity in ex- IL-25 at an early stage of disease had less glomerular sclerosis, perimental models of autoimmune diseases including type I tubular atrophy, and interstitial expansion than control AN

J Am Soc Nephrol 22: 1229–1239, 2011 IL-25 Ameliorates Adriamycin Nephropathy 1233 BASIC RESEARCH www.jasn.org

Figure 4. IL-25 induced alternatively activated macrophages. CD11bϩ endogenous renal macrophages were sorted by flow cytometry at weeks 2 and 4. The expression of MR was assessed by flow cytometry (A), and the mRNA expression of arginase, FIZZ1, YM1, and IL-10 was quantified by real-time PCR (B). The values represent the mean Ϯ SEM of evaluations from each group (n ϭ 8 per group). **P Ͻ 0.01 and ***P Ͻ 0.001 versus AN ϩ vehicle and normal. (C) The mRNA expression of MR, arginase, FIZZ1, YM1, IL-10, and CCL-17 was examined by real-time PCR in bone marrow macrophages preincubated for 1 hour with medium (M) or IL-25 (100 ng/ml) combined or not with IL-4 (10 ng/ml) or IL-13 (10 ng/ml) for a further 6 hours in vitro. The values represent the mean Ϯ SEM of evaluations from each group (n ϭ 4 per group). #P Ͻ 0.05 versus No IL-25. (D) Naïve CD4ϩ T cells preincubated or not with mouse recombinant IL-25 were co-cultured with bone marrow–derived macrophages (M0) in the presence of IL-4/13 neutralizing antibodies or control rat IgG1 for 24 hours. The mRNA expression of MR, arginase, FIZZ1, YM1, IL-10, and CCL-17 in bone marrow macrophages was examined by real-time PCR. The values represent the mean Ϯ SEM of evaluations from each group (n ϭ 4 per group). &&P Ͻ 0.01, versus the other three groups.

BALB/c mice. AN mice infused with IL-25 also had significantly A most interesting finding in this study was the induction reduced proteinuria compared with control AN mice. This is the by IL-25 of alternatively activated (M2) macrophages in vivo, first report to show the ability of IL-25 to reduce renal injury in shown here for the first time. The number of renal M2 macro- chronic kidney disease. The mechanisms underlying the renopro- phages was significantly greater at 2 and 4 weeks in AN mice tective effects of IL-25 could involve its initiation and augmenta- treated with IL-25 than in control mice, whereas the elevation tion of Th2 cell–mediated immune responses. However, it is un- of Th2 cytokines by IL-25 was apparent at week 2 but had certain whether IL-25 would be protective against disease vanished by week 4. A persistent effect to induce M2 macro- progression in this model if administered at a later stage of disease. phages may be an important mechanism underlying IL-25’s IL-25 is able to induce Th2 cytokine production in vitro protective role in AN. Adoptive transfer of macrophages would directly from naive and memory T cells stimulated with anti- be a useful approach to prove the role of these M2 macro- CD3/CD28.2,19 In this study, IL-25 administration increased phages in AN. Indeed, in our previous study, either M2a or serum levels of IL-4, -5, and -13 and mRNA expression of IL-4 M2c macrophage administration ameliorated renal injury in and IL-13 in kidney and draining lymph nodes in comparison AN.21,22 Therefore, it is likely that IL-25 induction of M2 is to normal and untreated AN mice. Similarly, cultured T cells involved in the reduction of renal injury in AN mice. from spleens of AN mice treated with IL-25 showed a high Data from our study indicate that IL-25 is capable of sup- percentage of IL-4ϩ and IL-13ϩ cells and higher level secre- pressing effector macrophages, leading to reduced proinflam- tion of IL-4, -5, and -13. These data show that IL-25 was able to matory cytokine production in vitro. This finding is consistent induce high levels of IL-4 and IL-13 in both the periphery and with the report by Caruso et al.,8 in which IL-25 was a negative within the kidneys of AN mice. It has been shown that enhanc- regulator of monocyte proinflammatory cytokine responses in ing Th2 immunity with exogenous IL-4 and/or IL-10 and vitro and protected against LPS-induced lethal endotoxemia in IL-13 reduced renal injury in a model of experimental im- mice. Inhibition of cytokine responses by IL-25 occurred via a p38 mune-mediated GN.16,17,20 Thus, the protective effect of IL-25 MAP kinase–driven Socs-3–dependent mechanism.8 A novel in this study could be caused by its induction of Th2 responses. and interesting observation uncovered by our study was that

1234 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 1229–1239, 2011 www.jasn.org BASIC RESEARCH

Figure 5. IL-25 protected against injury in AN in an IL-4/13–dependent manner. (A) Serum creatinine, creatinine clearance, and proteinuria were assessed at weeks 2 and 4. (B) PAS-stained sections of renal cortices at week 4 (ϫ200). (C) Quantitative assessment of glomerular sclerosis, tubular damage, and interstitial volume expansion. The values represent the mean Ϯ SEM of evaluations from each group (n ϭ 8 per group). $P Ͻ 0.05 and $$P Ͻ 0.01 versus the other three groups.

IL-25 indeed acted on endogenous macrophages in situ within the In this study, we also found no direct effect of IL-25 to inflamed kidney. Thus, monocytes/macrophages responded to induce of M2 macrophages in vitro, except synergistically with IL-25 in vivo both by down-regulating their synthesis of proin- IL-4 or IL-13. An indirect effect of IL-25 on M2 macrophages flammatory cytokines and up-regulation of anti-inflammatory was shown by co-culture of IL-25–modulated Th2 cells and cytokines. Furthermore, our in vitro study showed that IL-25 sig- macrophages; in these experiments, IL-4/13 expressing CD4ϩ nificantly suppressed other functions of LPS-activated macro- T cells generated by IL-25 did induce M2 macrophages. The phages, including phagocytosis and NO production. effects on macrophages of T cells modified by IL-25 were To determine whether the protective effect of IL-25 in AN blocked by IL-4/13 neutralizing antibodies. Although IL-25 BALB/c mice was dependent on Th2 lymphocytes or caused by a suppression of macrophages was shown in vitro by a reduction direct effect of IL-25 on macrophages, the effects of IL-25 were of their proinflammatory cytokine production, this direct ef- further examined in AN SCID mice that are deficient in T and B fect is not seen in vivo in AN SCID mice. The predominant cells. IL-25 administration neither induced M2 macrophages nor effects of IL-25 on macrophages in vivo in immunocompetent protected against renal structural and functional injury in AN AN mice seem to be through the modulation of Th2 responses SCID mice. Thus, the lymphocyte-dependent protective role of and induction of M2 macrophages. Lack of interaction of Th2 IL-25 was shown by its failure to down-regulate production of cells and M2 macrophages with effector macrophages and ab- inflammatory cytokines from effector macrophages or to induce sence of an increase in M2 macrophages in kidney of SCID AN M2 macrophages and furthermore by its failure to protect against mice could explain why renal endogenous macrophages from renal injury in this innate immune model of chronic renal disease. SCID AN mice expressed similar levels of TNF-␣ and IL-12 In immunocompetent AN mice, we found that IL-25 did induce with or without IL-25 treatment. In addition to the effects of Th2 cytokines in CD4ϩ T cells in vivo and that blockade of Th2 IL-25 on T cells, IL-25 could regulate the production of Th2 responses by IL-4 and IL-13 neutralizing antibodies abolished the cytokines and M2 macrophages in vivo via the assistance of protective effects of IL-25 on renal function and histology. There- other cells. It is possible that renal tubular epithelial cells may be a fore, Th2 responses induced by IL-25 have a central protective cellular target of IL-25, because they express the IL-25 receptor. effect against renal injury. However, to determine whether IL-4 or However, we found that renal tubular epithelial cells stimulated IL-13 alone play an individual role in IL-25’s renoprotective effect, with IL-25 do not induce Th2 cytokines (unpublished data). It is further studies are required using anti-IL-4 or anti-IL-13 sepa- also possible that IL-25 acts on other innate immune cells includ- rately. ing mast, NKT, and dendritic cells, which play an important role

J Am Soc Nephrol 22: 1229–1239, 2011 IL-25 Ameliorates Adriamycin Nephropathy 1235 BASIC RESEARCH www.jasn.org

mg/kg body weight of Adriamycin (ADR; doxo- rubicin; Pharmacia & Upjohn Pty Ltd) for BALB/c mice and 5.4 mg/kg body weight of ADR for SCID mice. ADR was injected once via the tail vein of each mouse. All mice were weighed twice daily. BALB/c and SCID mice were divided into three groups: normal, AN with saline, and AN with IL-25 treatment. For IL-25 treatment alone, mice were administered 0.5 ␮g mouse recombinant IL-25 (R&D Systems) intraperitoneally on days 5 to 12 after ADR injection. The dose and duration were selected according to previous published studies.4,6 Control animals received PBS only. In another study, BALB/c mice were divided into four groups: normal, AN with saline, AN with IL-25 and rat IgG1, and AN with IL-25 and neutralizing anti-IL-4/13 antibodies. For IL-25 and neutralizing anti-IL-4/13 antibody treatment, mice were administered 0.5 ␮g mouse recombinant IL-25 intraperitoneally on days 5 to 12 after administration of 200 ␮g neutralizing antibodies IL-4/13 (eBiosicence) or control rat IgG1 (eBiosicence) on days 8 and 12 after ADR injection. Mice were killed at weeks 2 and 4 after ADR injection. Blood, urine, spleen, renal draining lymph nodes, and kidneys were harvested for analysis. All urine and blood specimens were analyzed by the Institute of Clinical Pathology and Medical Research (Westmead Hospital), using a BM/Hitachi 747 analyzer (Tokyo, Japan).

T Cell Culture and Assays Figure 6. IL-25 induced M2 macrophages and suppressed endogenous renal macro- CD4ϩ T cells were isolated from spleens of phages in an IL-4/13–dependent manner. The percentage of endogenous renal mac- BALB/c mice by FACS sorting at week 2 and week rophages expressing MR, TNF␣, and IL-12 was measured by flow cytometry (A and C) 4 after ADR injection. Cells were stimulated with and the mRNA expression of arginase, FIZZ1, YM1, IL-10, iNOS, CCL2, IL-1␤, and IL-6 anti-CD3/CD28 (1 ␮g/ml), anti-IFN␥ (10 ␮g/ml; Ϯ was quantified by real-time PCR (B and D). The values represent the mean SEM of BD Biosciences), and 50 U/ml of mouse IL-2 for 3 ϭ Ͻ Ͻ evaluations from each group (n 8 per group). $P 0.05 and $$P 0.01 versus the days. Cells were washed and restimulated with 1 other three groups. ␮g/ml of anti-CD3 for 24 hours, and culture supernatants were analyzed for cytokines by ELISA in early Th2 cytokine production and M2 macrophage formation. (IL-4, IL-5, and IL-13 kits; eBioscience). For intracellular cytokine anal- The (transient) production of Th2 cytokines in renal draining ysis, after 4 days of stimulation, CD4ϩ T cells were restimulated with 500 lymph nodes in SCID mice is consistent with this. ng/ml ionomycin and 50 ng/ml PMA (Sigma-Aldrich) in the presence of Taken together, our data showed that IL-25, via its induction of GolgiStop (BD Biosciences) for 5 hours. Cells were stained with FITC- Th2 responses, is able to induce protective macrophages, suppress conjugated anti-mouse CD4 (BD Biosciences) and permeabilized with effector macrophages, and protect against renal injury in AN. Cytofix/Cytoperm (BD Biosciences). Intracellular staining with antibodies against IL-4, IL-13, and IFN␥ (BD Biosciences) was performed and analyzed by flow cytometry. Cell viability was assessed by staining with CONCISE METHODS 7-amino-actinomycin D and Annexin V according to the manufacturer’s protocol. Cell viability of CD4ϩ T cells was Ͼ95%. AN Murine Model and IL-25 Administration Six- to 8-week-old male BALB/c and SCID mice obtained from the Animal Resources Centre (Perth, Australia) were used in this study. Macrophage Isolation and Culture The Animal Ethics Committee of Westmead Hospital approved all Kidneys were perfused with saline before removal and digested with procedures. Dose-finding studies defined an optimal dose of 10.4 collagenase and DNase as described previously.23 Kidneys were cut

1236 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 1229–1239, 2011 www.jasn.org BASIC RESEARCH

Figure 7. IL-25 reduced inflammatory infiltrates in a IL4/13-dependent manner. Numbers of F4/80ϩ macrophages (A) and CD4ϩ and CD8ϩ T cells (B and C) were assessed by immunofluorescence staining in renal cortex of mice at week 2 and week 4. The values represent the mean Ϯ SEM of evaluations from each group (n ϭ 8 per group). $P Ͻ 0.05, and $$P Ͻ 0.01 versus the other three groups. into 1- to 2-mm3 pieces and placed in DMEM containing 1 mg/ml cedure and stained with FITC-conjugated anti-mouse CD11b. collagenase D (Sigma Aldrich) and 100 ␮g/ml DNase I (Roche) for 40 CD11bϩ endogenous renal macrophages were sorted by FACS. For further minutes at 37°C with intermittent agitation. Mononuclear cells from purification of CD11bϩ macrophages, CD11bϩ cells were incubated at kidneys were separated using a step-gradient sucrose separation pro- 37°C for 40 minutes, and the culture supernatant that contained floating cells (e.g., T cells, natural killer cells, dendritic cells) was discarded. The adherent cells were 96Ϯ2.1% CD11b positive (macrophage marker), 94 Ϯ 3.5% F4/80 positive (macrophage marker), and 2.1 Ϯ 0.62% CD11c positive (dendritic cell marker). Cell viability was Ͼ95%. Sorted cells were used for real-time PCR analyses to detect phenotypes of these macrophages. Some sorted cells were stained with AF647 conju- gatedanti-mousemannosereceptor(Biolegend)and analyzed by flow cytometry. For intracellular cytokine analysis, CD11bϩ endogenous renal macrophages from each group were stimulated with LPS (100 ng/ml; Sigma Aldrich) in the presence of Gol- giStop (BD Biosciences) for 5 hours and examined ␣ Figure 8. IL-25 failed to protect against renal injury in AN SCID mice. (A) Proteinuria at for TNF- and IL-12 intracellular staining using flow weeks 2 and 4. (B) PAS-stained sections of renal cortices at week 4 (ϫ200). (C) Quantitative cytometry. assessment of glomerular sclerosis, tubular damage, and interstitial volume. The values Primary cultures of murine macrophages represent the mean Ϯ SEM of evaluations from each group (n ϭ 8 per group). were obtained from bone marrow of BALB/c

J Am Soc Nephrol 22: 1229–1239, 2011 IL-25 Ameliorates Adriamycin Nephropathy 1237 BASIC RESEARCH www.jasn.org mice by a technique previously described.24 Macrophages derived measuring the OD at 560 nm on a Dynatech MR5000 reader (Dy- from bone marrow were cultured in RPMI 1640 medium, supple- natech, Chantilly, VA). mented with 10% FBS, penicillin (100 U/ml), and streptomycin (100 ␮g/ml), plus 10 ng/ml macrophage colony-stimulating factor for 6 days, and CD11bϩ macrophages were sorted by flow cytometry. Cell Quantitative RT-PCR viability was Ͼ95%. Sorted cells were seeded onto 12-well culture One microgram of RNA isolated by the RNeasy Mini Kit (Qiagen) was plates (2 ϫ 105 cells/well), incubated with mouse recombinant IL-25 reverse-transcribed with the First Strand cDNA Synthesis Kit (Fer- (100 ng/ml; R&D Systems) for 1 hour, and stimulated with IL-4 (10 mantas), and real-time PCR was performed on the Rotogene-6000 ng/ml, Invitrogen), IL-13 (10 ng/ml; Invitrogen), LPS (100 ng/ml; Real-Time Thermo cycler (Corbett Research) using the SYBR master- 25 Sigma Aldrich), or IFN-␥ (100 U/ml; Roche) for 6 hours. Cells were mix (Invitrogen). The analysis method was as described before, and used for real-time PCR analyses to detect macrophage phenotype. In the PCR primer sequences are presented in Supplementary Table S1. parallel, cells were preincubated with IL-25 for 1 hour and stimulated with IL-4/IL-13 for a further 20 hours. The resulting cells were stained Histology and Immunofluorescence with AF647-conjugated anti-mouse MR and analyzed by flow cytom- Coronal sections of renal tissue were stained with periodic acid–Schiff etry. (PAS). Glomerulosclerosis, tubular damage, and interstitial volume were evaluated using methods described previously.26 Briefly, images CD4 T Cell Co-Culture with Macrophages were digitalized using a video camera and analyzed using image anal- CD4ϩ T cells isolated from spleens of BALB/c mice were stimulated ysis software (ImageJ; NIH). The degree of glomerulosclerosis was with or without mouse recombinant IL-25 in the presence of anti- measured using a quantitative method. The outline of the glomerular CD3/CD28 (1 ␮g/ml), anti-IFN-␥ (10 ␮g/ml; BD Biosciences), and capillary tuft was traced, and the computed area was used as a measure 50 U/ml of mouse IL-2 for 3 days. Cell viability was Ͼ95%. CD4ϩ T of total glomerular area. The area covered by PAS-positive staining in cells were washed and co-cultured with bone marrow–derived mac- the same glomerulus was determined. The percentage of glomerulo- rophages in the presence of IL-4/13 neutralizing antibodies (eBiosci- sclerosis for each glomerulus was calculated by dividing the total PAS- ence) or control rat IgG1 (eBioscience) for 24 hours. Macrophages positive area by the total glomerular area. The mean value of 20 ran- were used for real-time PCR analyses to detect macrophage pheno- domly selected glomeruli was determined for each section. Damaged type. In parallel, CD4ϩ T cells were restimulated with 1 ␮g/ml of tubules were identified by the presence of diffuse tubular dilation, anti-CD3 for 24 hours, and culture supernatants were analyzed for intraluminal casts, and/or tubular cell vacuolization and detachment cytokines by ELISA (IL-4 and IL-13 kits; eBioscience). in cortex and medulla in 10 to 15 high power fields (ϫ200 magnification) per PAS-stained section, in a blinded fashion. The number of ELISA of Cytokines damaged tubules was divided by the number of the total tubules in the IL-4, IL-5, and IL-13 levels in sera and culture supernatants were same field to obtain the percentage of damaged tubules. The degree of assayed using an ELISA kit purchased from eBioscience. ELISA was interstitial expansion was determined by quantitation of the relative performed according to the manufacturer’s protocol. interstitial volume in 10 to 15 high power fields (ϫ200 magnification) per PAS-stained section. The percentage of relative interstitial volume was calculated by dividing the total interstitial area by the total area. Phagocytic Activity To avoid selection bias, the areas to be viewed for morphometric Macrophages derived from bone marrow were cultured with LPS (100 analysis were anatomically identical for each section and positioned ng/ml; Sigma Aldrich) in the presence of various concentrations (25, before microscopic visualization. 50, 100, and 200 ng/ml) of mouse recombinant IL-25 for 24 hours. For immunofluorescence staining, rat anti-mouse F4/80 (1/100; Cells were co-cultured with 1 mg/ml FITC-labeled dextran (40,000 eBiosciences), CD4 (1/50), or CD8 (1/50; BD Biosciences) was used as kD; Molecular Probes) for 45 minutes. In controls for nonspecific the primary antibody and AF488 goat anti-rat IgG (1/800; Invitrogen) dextran attachment, cells were added to 0.02% azide or cultured at as the secondary antibody. Control rat IgG to primary antibodies was 4°C to stop energy-dependent cellular functions. Cell viability was included in staining. The number of interstitial F4/80ϩ, CD4ϩ, and Ͼ95%. To determine phagocytic activity, the uptake of FITC-labeled CD8ϩ cells was quantitated in 10 nonoverlapping cortical fields dextran was detected by multicolor flow cytometry. (ϫ400).

NO Production NO production by macrophages was determined by the measurement Statistical Analysis of the nitrite concentration with Griess assay.23 Briefly, macrophages Renal functional data (serum creatinine, creatinine clearance, and derived from bone marrow were cultured with LPS (100 ng/ml; Sigma proteinuria) were log-transformed before analysis to stabilize the Aldrich) in the presence of various concentrations (25, 50, 100, and variance. Statistical tests included unpaired, two-tailed t test using 200 ng/ml) of mouse recombinant IL-25. After 48 hours, 50 ␮lof Welch’s correction for unequal variances and one-way ANOVA with 14 mM 4Ј4-diaminodiphenylsulfone and 50 ␮lof4mMN-ethyl- Tukey’s multiple comparison test. Statistical analyses were done using enediamine were added to the culture supernatant and incubated Prism (Version 4; GraphPad). Results are expressed as the mean Ϯ at room temperature for 10 minutes, and NO was detected by SEM. P Ͻ 0.05 was considered statistically significant.

1238 Journal of the American Society of Nephrology J Am Soc Nephrol 22: 1229–1239, 2011 www.jasn.org BASIC RESEARCH

ACKNOWLEDGMENTS 12. Ferrario F, Castiglione A, Colasanti G, Barbiano di Belgioioso G, Bertoli S, D’Amico G: The detection of monocytes in human glomerulonephritis. Kidney Int 28: 513–519, 1985 This work was supported by the National Health and Medical Re- 13. Schreiner GF: Macrophages and cellular immunity in experimental search Council of Australia (Grants 457345 and 632665 to Y.W. nephrosis and glomerulonephritis. Contrib Nephrol 45: 115–122, and D.H.) and Johnson & Johnson Research Pty Ltd (focused 1985 funding to D.H.). 14. Wang Y, Wang YP, Tay YC, Harris DC: Progressive adriamycin nephropathy in mice: sequence of histologic and immunohistochemical events. Kidney Int 58: 1797–1804, 2000 15. Sandovici M, Henning RH, van Goor H, Helfrich W, de Zeeuw D, DISCLOSURES Deelman LE: Systemic gene therapy with interleukin-13 attenuates None. renal ischemia-reperfusion injury. Kidney Int 73: 1364–1373, 2008 16. Tam FW, Smith J, Karkar AM, Pusey CD, Rees AJ: Interleukin-4 ameliorates experimental glomerulonephritis and up-regulates glomerular gene expression of IL-1 decoy receptor. Kidney Int 52: 1224–1231, REFERENCES 1997 17. Sandovici M, Deelman LE, van Goor H, Helfrich W, de Zeeuw D, 1. Moseley TA, Haudenschild DR, Rose L, Reddi AH: Interleukin-17 family Henning RH: Adenovirus-mediated interleukin-13 gene therapy atten- and IL-17 receptors. Cytokine Growth Factor Rev 14: 155–174, 2003 uates acute kidney allograft injury. J Gene Med 9: 1024–1032, 2007 2. Angkasekwinai P, Park H, Wang YH, Wang YH, Chang SH, Corry DB, 18. Emamaullee JA, Davis J, Merani S, Toso C, Elliott JF, Thiesen A, Liu YJ, Zhu Z, Dong C: Interleukin 25 promotes the initiation of Shapiro AM: Inhibition of Th17 cells regulates autoimmune diabetes in proallergic type 2 responses. J Exp Med 204: 1509–1517, 2007 NOD mice. Diabetes 58: 1302–1311, 2009 3. Ikeda K, Nakajima H, Suzuki K, Kagami S, Hirose K, Suto A, Saito Y, 19. Wang YH, Angkasekwinai P, Lu N, Voo KS, Arima K, Hanabuchi S, Iwamoto I: Mast cells produce interleukin-25 upon Fc epsilon RI- Hippe A, Corrigan CJ, Dong C, Homey B, Yao Z, Ying S, Huston DP, mediated activation. Blood 101: 3594–3596, 2003 Liu YJ: IL-25 augments type 2 immune responses by enhancing the 4. Zaph C, Du Y, Saenz SA, Nair MG, Perrigoue JG, Taylor BC, Troy AE, expansion and functions of TSLP-DC-activated Th2 memory cells. J Kobuley DE, Kastelein RA, Cua DJ, Yu Y, Artis D: Commensal-depen- Exp Med 204: 1837–1847, 2007 dent expression of IL-25 regulates the IL-23-IL-17 axis in the intestine. 20. Tipping PG, Kitching AR, Huang XR, Mutch DA, Holdsworth SR: Im- J Exp Med 205: 2191–2198, 2008 mune modulation with interleukin-4 and interleukin-10 prevents cres- 5. Fort MM, Cheung J, Yen D, Li J, Zurawski SM, Lo S, Menon S, Clifford cent formation and glomerular injury in experimental glomerulone- T, Hunte B, Lesley R, Muchamuel T, Hurst SD, Zurawski G, Leach MW, phritis. Eur J Immunol 27: 530–537, 1997 Gorman DM, Rennick DM: IL-25 induces IL-4, IL-5, and IL-13 and 21. Wang Y, Wang YP, Zheng G, Lee VW, Ouyang L, Chang DH, Mahajan Th2-associated pathologies in vivo. Immunity 15: 985–995, 2001 D, Coombs J, Wang YM, Alexander SI, Harris DC: Ex vivo pro- 6. Fallon PG, Ballantyne SJ, Mangan NE, Barlow JL, Dasvarma A, Hewett grammed macrophages ameliorate experimental chronic inflamma- DR, McIlgorm A, Jolin HE, McKenzie AN: Identification of an interleu- tory renal disease. Kidney Int 72: 290–299, 2007 kin (IL)-25-dependent cell population that provides IL-4, IL-5, and 22. Cao Q, Wang Y, Zheng D, Sun Y, Lee VW, Zheng G, Tan TK, Ince J, IL-13 at the onset of helminth expulsion. J Exp Med 203: 1105–1116, Alexander SI, Harris DC: IL-10/TGF-beta-modified macrophages in- 2006 duce regulatory T cells and protect against adriamycin nephrosis. 7. Kleinschek MA, Owyang AM, Joyce-Shaikh B, Langrish CL, Chen Y, J Am Soc Nephrol 21: 933–942, 2010 Gorman DM, Blumenschein WM, McClanahan T, Brombacher F, Hurst 23. Kruger T, Benke D, Eitner F, Lang A, Wirtz M, Hamilton-Williams EE, SD, Kastelein RA, Cua DJ: IL-25 regulates Th17 function in autoim- Engel D, Giese B, Muller-Newen G, Floege J, Kurts C: Identification mune inflammation. J Exp Med 204: 161–170, 2007 and functional characterization of dendritic cells in the healthy murine 8. Caruso R, Stolfi C, Sarra M, Rizzo A, Fantini MC, Pallone F, MacDonald kidney and in experimental glomerulonephritis. J Am Soc Nephrol 15: TT, Monteleone G: Inhibition of monocyte-derived inflammatory cy- 613–621, 2004 tokines by IL-25 occurs via p38 Map kinase-dependent induction of 24. Johnson CR, Kitz D, Little JR: A method for the derivation and con- Socs-3. Blood 113: 3512–3519, 2009 tinuous propagation of cloned murine bone marrow macrophages. 9. Tamachi T, Maezawa Y, Ikeda K, Kagami S, Hatano M, Seto Y, Suto A, J Immunol Methods 65: 319–332, 1983 Suzuki K, Watanabe N, Saito Y, Tokuhisa T, Iwamoto I, Nakajima H: 25. Cao Q, Wang L, Du F, Sheng H, Zhang Y, Wu J, Shen B, Shen T, Zhang IL-25 enhances allergic airway inflammation by amplifying a TH2 cell- J, Li D, Li N: Downregulation of CD4ϩCD25ϩ regulatory T cells may dependent pathway in mice. J Allergy Clin Immunol 118: 606–614, underlie enhanced Th1 immunity caused by immunization with acti- 2006 vated autologous T cells. Cell Res 17: 627–637, 2007 10. Lee J, Ho WH, Maruoka M, Corpuz RT, Baldwin DT, Foster JS, God- 26. Rangan GK, Tesch GH: Quantification of renal pathology by image dard AD, Yansura DG, Vandlen RL, Wood WI, Gurney AL: IL-17E, a analysis. Nephrology (Carlton) 12: 553–558, 2007 novel proinflammatory ligand for the IL-17 receptor homolog IL- 17Rh1. J Biol Chem 276: 1660–1664, 2001 11. Noronha IL, Kruger C, Andrassy K, Ritz E, Waldherr R: In situ production of TNF-alpha, IL-1 beta and IL-2R in ANCA-positive glomerulo- Supplemental information for this article is available online at http:// nephritis. Kidney Int 43: 682–692, 1993 www.jasn.org/.

J Am Soc Nephrol 22: 1229–1239, 2011 IL-25 Ameliorates Adriamycin Nephropathy 1239 Supplementary Material

accompanying the manuscript

IL-25 induces alternatively-activated macrophages and reduces renal injury in Adriamycin nephropathy

Qi Cao, Changqi Wang, Dong Zheng, Ya Wang, Vincent W.S. Lee, Yuan Min Wang,

Guoping Zheng, Thian Kui Tan, Di Yu, Stephen I. Alexander, David C.H. Harris and

Yiping Wang

This PDF file includes:

Figs. S1 to S4

Table S1

Figure S1. IL-25 increased MR expression in macrophages cultured with IL-4 or IL-

13.

The expression of mannose receptor (MR) was assessed by flow cytometry (percentage and mean fluorescence intensity, MFI) in bone marrow macrophages preincubated for 1 hour with medium (M) or IL-25 (100 ng/ml) combined or not with IL-4 or IL-13 for a further 20 hours in vitro. The values represent the mean ± SEM of evaluations from each group (n=4 per group). *P<0.05. vs. No IL-25.

Figure S2. IL-25 promoted Th2 cell differentiation in vitro .

Naïve CD4+ T cells were stimulated with anti-CD3, anti-CD28, and IL-2 in the presence of recombinant IL-25. After 3 d, cells were restimulated with plate-bound anti-CD3 for

24 h, and cytokine production was measured by ELISA. The values represent the mean ±

SEM of evaluations from each group (n=4 per group). **P<0.01. vs. CD4.

Figure S3. The effects of IL-25 on Th2 immune responses in AN SCID mice. In SCID mice, IL-4, IL-5 and IL-13 levels in serum were assessed by ELISA (A) and the mRNA expression of IL-4 and IL-13 in kidney (B) and renal draining lymph nodes (RDLN) (C) was quantified by real-time PCR in normal, AN+vehicle and AN+IL-25 groups at week 2 and 4. The values represent the mean ± SEM from each group (n=8 per group). The values represent the mean ± SEM of evaluations from each group (n=4 per group).

**P<0.01. vs. AN+vehicle.

Figure S4. IL-25 failed to induce M2 macrophages and suppress endogenous renal macrophages in AN SCID mice. In SCID mice, the expression of MR, TNF α and IL-12 of endogenous renal macrophages was measured by flow cytometry (A, C and D) and the mRNA expression of arginase, FIZZ1, YM1, IL-10, iNOS, CCL2, IL-1β and IL-6 was quantified by real-time PCR (B and E). The values represent the mean ± SEM of evaluations from each group (n=8 per group).

Table S1. Real-time PCR primers

Gene primer sequence(5’-3’) Product

IL-4 (F) tcaacccccagctagttgtc 184

IL-4 (R) tctgtggtgttcttcgttgc

IL-13 (F) cagcatggtatggagtgtgg 153

IL-13 (R) aggctggagaccgtagtgg iNOS (F) caccttggagttcacccagt 170 iNOS (R) accactcgtacttgggatgc

TNF-α (F) gctgagctcaaaccctggta 118

TNF-α (R) cggactccgcaaagtctaag

MCP-1 (F) agcaccagccaactctcact 136

MCP-1 (R) cgttaactgcatctggctga

IL-1β(F) tgccaccttttgacagtgatg 136 atgtgctgctgcgagatttg IL-1β(R) cacaagtccggagaggagac 136 IL-6 (F) ttgccattgcacaactcttt IL-6 (R) gacatcacacgggaccaaac 160 IL-12 (F) taccaaggcacagggtcatc IL-12 (R) caaggaaggttggcatttgt 111 Mannose receptor (F) cctttcagtcctttgcaagc Mannose receptor (R) agtctggcagttggaagcat 104 Arginase (F) ctggttgtcaggggagtgtt Arginase (R) tgctgggatgactgctactg 156 FIZZ1 (F)

FIZZ1 (R) ctgggttctccacctcttca

YM1 (F) cagctgggatcttcctacca 141

YM1 (R) attctgcattccagcaaagg

IL10 (F) ccagtacagccgggaagaca 121

IL10 (R) cagctggtcctttgtttgaaaga

CCL17 (F) tgcttctggggacttttctg 147

CCL17 (R) catccctggaacactccact

F=forward, R=reverse.