New Gene Evolution: Little Did We Know

GE47CH14-Long ARI 29 October 2013 14:13

Manyuan Long,1,2,∗ Nicholas W. VanKuren,1,2 Sidi Chen,3 and Maria D. Vibranovski4

1Department of Ecology and Evolution, The University of Chicago, Chicago, Illinois 60637; email: [email protected] 2Committee on Genetics, Genomics, and Systems Biology, The University of Chicago, Chicago, Illinois 60637; email: [email protected] 3Department of Biology and the Koch Institute, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139; email: [email protected] 4Departamento de Genetica´ e Biologia Evolutiva, Instituto de Biociencias,ˆ Universidade de Sao˜ Paulo, Sao˜ Paulo, Brazil 05508; email: [email protected]

Annu. Rev. Genet. 2013. 47:307–33 Keywords First published online as a Review in Advance on evolutionary patterns, evolutionary rates, phenotypic evolution, brain September 13, 2013 evolution, sex dimorphism, gene networks The Annual Review of Genetics is online at genet.annualreviews.org Abstract This article’s doi: Genes are perpetually added to and deleted from genomes during 10.1146/annurev-genet-111212-133301 evolution. Thus, it is important to understand how new genes are Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org Copyright c 2013 by Annual Reviews. formed and how they evolve to be critical components of the genetic Access provided by Carnegie Mellon University on 08/20/15. For personal use only. All rights reserved systems that determine the biological diversity of life. Two decades of ∗ Corresponding author effort have shed light on the process of new gene origination and have contributed to an emerging comprehensive picture of how new genes are added to genomes, ranging from the mechanisms that generate new gene structures to the presence of new genes in different organisms to the rates and patterns of new gene origination and the roles of new genes in phenotypic evolution. We review each of these aspects of new gene evolution, summarizing the main evidence for the origination and importance of new genes in evolution. We highlight ﬁndings showing that new genes rapidly change existing genetic systems that govern various molecular, cellular, and phenotypic functions.

307 GE47CH14-Long ARI 29 October 2013 14:13

BACKGROUND AND which to investigate the evolution of new genes HISTORICAL OVERVIEW and to understand their properties. This idea was first manifested in the discovery of jingwei, Understanding how genes originate and a three-million-year-old gene in two species of subsequently evolve is crucial to explaining the African Drosophila (85). Jingwei revealed several genetic basis for the origin and evolution of interesting features of new gene evolution that novel phenotypes and, ultimately, biological are now known to be general: (a) recombina- diversity. Gene origination is thus a widely tion of existing genes, leading to a hybrid gene interesting, yet difficult, problem to study. structure; (b) rapid sequence evolution driven Perhaps unsurprisingly, the peculiar structures, by positive selection; and (c) acquisition of new functions, and evolution of new genes have biochemical functions (150, 162). attracted the interests of pioneers in genetics Today, it is clear that new gene origination is and evolution since the early twentieth century. a general process in evolution and that species- Sturtevant (129) was one of the first to identify specific or lineage-specific genes exist in many, a duplicated gene, the Bar duplication in if not all, organisms. Gigantic databases of ge- Drosophila melanogaster, from which Muller nomic sequences from thousands of species re- (103) developed the first prevalent model of veal that genomes contain huge numbers and new gene evolution in 1936. Muller (103, a large diversity of protein-coding genes. For p. 529) predicted that a new duplicate copy example, the plant Glycine max genome en- of a gene could acquire a novel function and codes more than 50,000 protein-coding genes, be preserved in the genome, and further that whereas the bacterial genome of Candidatus “there remains no reason to doubt the appli- Hodgkinia cicadicola contains only 189 genes. In cation of the dictum ‘all life from pre-existing addition, the abundance and diversity of non- life’ and ‘every cell from a pre-existing cell’ coding genes are only now beginning to be real- to the gene: ‘every gene from a pre-existing ized. Even genomes with similar gene numbers gene.’” This early thinking on single-gene can have very different, unrelated genes. These and whole-chromosome duplications (55) was recent data reveal a widespread process of birth greatly expanded in the 1970s. Ohno (112) and death of genes in organisms in which new further developed Muller’s model in 1970, genes enter the genome and old genes are lost. and Gilbert (52) proposed an entirely new What mechanisms and forces dictate gene birth model of new gene formation in 1978, whereby and death? Specifically, how are new genes and pieces of unrelated genes can be recombined novel functions added to genomes? into new genes rather than just be strictly In the two decades since the discovery duplicated. However, experimental work on of jingwei, there have been several hundred new genes did not begin until the early 1990s additional publications reporting various inter- Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. when a plausible framework for experimental esting and signiﬁcant observations of new genes studies of new gene formation and evolution and new gene functions in many different or- was proposed: studies must focus on genes that ganisms. Regrettably, we can only choose a few were recently formed because young genes representative publications to sketch several still carry all the signatures of the evolutionary lines of observation that can provide insight forces that shaped their origination and the into an emerging, global picture of new gene evolution of their new structures and functions evolution. We follow the growth of scientiﬁc (83). As genes age, they accumulate mutations information and underlying ideas and concepts that obscure the structural or evolutionary in new gene evolution, beginning by discussing signals from their early history (83, 84). In the methods for identifying new genes and eukaryotes, genes younger than 10–30 million mechanistic processes of new gene formation. years have not experienced much sequence We then describe the rates and patterns of evolution and thus constitute a valid system in new gene origination and evolution that may

308 Long et al. GE47CH14-Long ARI 29 October 2013 14:13

indicate some rules governing these processes This review provides an overview of efforts to and discuss the evolutionary forces that act on understand the answers to these problems. new genes. Finally, we review the rapid growth Fixation: the of studies of the phenotypic effects of new genes Approaches to Identifying New Genes population genetic and their impact on phenotypic evolution. process by which a All new gene identification methods are based mutation spreads to all on comparative analysis of the structures of individuals in a THE CONCEPT OF NEW genes and genomes. Within a group of closely population GENE ORIGINATION related species, we can define new genes as Monophyletic group: those that are present in all members of a a group of taxa that To understand various basic properties of new monophyletic group but absent from all out- share a common gene evolution, we need to have some concep- group species (Figure 1). Early studies often ancestor tion of the process of new gene origination and serendipitously identified new genes by ana- an operational definition for the process. This lyzing the phylogenetic distribution of genes definition helps us explore methods for new via characterization of small genomic regions gene identification. (e.g., 85, 108). Microarrays (42, 44, 45) and especially next-generation sequencing (168, 169) The Process of New Gene Origination have made recent searches for new genes more New gene origination begins in a microevolu- purposeful efforts. tionary process. A protogene structure is first generated by a mutation in a single germ-cell Multiple genomes. Syntenic alignments genome. This protogene structure must then (Figure 1) of genomes can be used to iden- spread through the population until it is fixed. tify new genes from related species whose Various evolutionary forces, such as natural se- phylogenetic relationship is known. Syntenic lection and genetic drift, govern the spread alignments of each gene in each species allow of the protogene through the population, thus identification of genes that are present or making protogene fixation a population genetic absent in one genome relative to another process. Both before and after fixation, the pro- (Figure 1). In these comparisons, a gene can togene accumulates mutations that confer on it be defined as a new gene candidate if it is new structures and beneficial, sometimes novel, present in a certain clade or single species functions that are acted on by natural selection. and absent in all outgroup species (Figure 1). From the point that the protogene carries an Additionally, the orthologous genes that flank optimized function and is fixed in the genome, the new gene candidate appear in all species un- it is essentially the same as most other, older der consideration. This strategy has been used genes in the genome and can be considered with great success in Drosophila and mammals Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. a new gene. New gene studies typically focus (35, 168, 169, 172). New genes formed by dif- on these first two stages (the fixation process ferent mechanisms also have correspondingly and acquisition of a beneficial function) and the different structural features that can be used consequences of accepted mutations on the se- to infer the mechanism of new gene formation quence, structure, and function of the new gene. and the ancestral and derived characters. Interest in new gene origination has raised several general problems. What molecular Single genomes. Duplicate genes within mechanisms generate new gene structures? a single genome can be identified using What are evolutionary forces that drive the exhaustive pairwise comparisons between all origination of new genes? How often are new annotated genes in that genome. Most mech- genes fixed in a species? Are there any rules anisms to form new gene structures (see be- or patterns of new gene origination? What are low) result in certain structural changes in the the roles of new genes in phenotypic evolution? new gene. For example, new genes created by

www.annualreviews.org • New Gene Evolution 309 GE47CH14-Long ARI 29 October 2013 14:13

b a G1 G2 G3 S1 D. simulans

S2 D. mauritiana

CdicSdic AnnX S3 D. melanogaster

S4 D. yakuba

Figure 1 New genes are deﬁned using syntenic and sequence comparisons between the genomes of a group of related species. (a) The general procedure to identify new genes. The phylogenetic relationship of species S1–S4 is shown by the blue tree. The linking relationship between the genes G1 ( yellow), G2 (red ),andG3(green)is shown within the species tree. Aligning the genomes of species S1–S4 shows that the new gene G2 is present in S1–S3 but absent in S4, indicating that G2 arose in the common ancestor of S1–S3. G2 was thus generated in the genome between old genes G1 and G3 in the common ancestor of S1, S2, and S3 (red star). (b) An example of using syntenic alignments to identify new genes. Sdic exists only in Drosophila melanogaster (110, 160). In this case, Sdic originated as a chimeric gene through recombination of duplicates of the two ﬂanking genes, a 5 piece of Cdic encoding a cytoplasmic dynein intermediate chain and a 3 piece of AnnX.

RNA-based duplication (retrogenes) most of- phism and divergence (60, 97) are often used to ten lack introns, contain a stretch of adenine predict whether the new gene is functional. A nucleotide at their 3 end, and contain a pair Ka/Ks ratio significantly lower than one (for sin- of short flanking direct repeats. These signals gle genome data, Ka/Ks < 0.5 in a comparison fade with evolutionary time. Betran´ et al. (11), between the new gene and its parental copy), for Bai et al. (4), and Meisel et al. (100) took ad- example, indicates functional constraint acting vantage of these new structures to identify new on the new gene, which we would expect if dis- retrogenes in fruit flies; Wang et al. (147) in ruptive mutations were being prevented from silkworm; and Emerson et al. (43), Marques accumulating in new protein-coding genes by et al. (92) and Vinckenbosch et al. (144) in pri- natural selection. These methods are widely mates and specifically humans. Divergence be- used as the first step to predict if a new gene is tween the new retrogene and the original gene likely functional (e.g., 4, 11, 43, 147, 168, 169). from which the retrogene was derived can be used to define the age of the new genes using a molecular clock. However, both strategies that MECHANISMS TO FORM NEW we have discussed so far can depend on the cur- GENE STRUCTURES Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. rent annotations, which are biased against the How are new gene structures formed? Muta- new genes, so caution must be taken when mak- tion toward a new gene structure is the ﬁrst step ing claims about the presence/absence of genes of new gene evolution, and 11 distinct molecu- in different genomes (167). lar processes are known that contribute to the formation of new genes. These mechanisms are Predicting functionality of new genes. It covered in depth elsewhere (27, 65, 84), so we is desirable to predict whether candidate new only brieﬂy touch on them here. We highlight genes are functional before beginning more several examples in Figure 2. laborious functional and phenotypic analyses. Comparisons of open reading frame length, transcription of new gene candidates, and sub- Gene Duplication stitution rates between nonsynonymous and Gene duplication is thought to contribute most

synonymous sites (Ka versus Ks) and polymor- to the generation of new genes. A single (or a

310 Long et al. GE47CH14-Long ARI 29 October 2013 14:13

few) new gene structure(s) can be formed at one stage in an evolutionary process leading to time by DNA-based duplication (the copying gene fission (Figure 2c). Okamura et al. (113) and pasting of a DNA sequence from one ge- demonstrated that frameshift mutations often Pseudogenes: genes nomic region to another) or retroposition. Al- generate new coding sequences and found that are thought to though DNA-based duplications are often tan- 470 human gene duplicates that had done so. have lost their ability dem (134), retroposed genes most often move Xue et al. (157) found that the Epstein-Barr to code for a to a new genomic environment (14, 15, 65, 172), virus contains an early gene that undergoes full-length protein where they must acquire new regulatory ele- frequent frameshifts, probably to combat ments or risk becoming processed pseudogenes. host immunity. In addition, divergence in An important gene duplication mechanism is alternative splicing patterns between duplicate whole-genome duplication (WGD), which has genes can generate distinct transcripts that occurred multiple times in eukaryote evolu- produce noncoding RNAs or polypeptides tion, particularly in plants (126). Hundreds to with slightly or entirely different functions thousands of duplicate genes are formed by a and rapidly alter duplicate gene structures and WGD event, and the vast majority of dupli- functions (51, 57, 69, 163, 173). cates are quickly lost. However, estimates of duplicate gene retention after WGDs in teleost fishes (∼15% after 350 million years) (16), yeast De Novo Genes (∼12% after 80 million years) (68), and Ara- New gene structures may arise from previ- bidopsis (∼30% after 80 million years) (13) all ously noncoding DNA (Figure 2d ). Chen et al. suggest that large fractions of duplicated loci (24) showed that antifreeze proteins of low can be retained. We show below that there are structural complexity, which bind and halt the a variety of ways that new gene structures can growth of ice crystals in the blood of some polar subsequently acquire new functions (2, 33, 61, fishes, were created by amplification of previ- 78, 158, 170). McLysaght et al. (98) showed that ously noncoding microsatellite DNA. Surpris- WGD may more easily generate new paralogs. ingly, a number of de novo genes of high structural complexity were first found to originate from noncoding regions in Drosophila (6, 75). Alteration of Existing Gene Structures Since then, more de novo genes were identi- New gene structures can be generated by fied in Drosophila (26, 168, 172) as well as in modifying existing genes, domains, or exons. humans (71, 153, 155, 169), primates (137), Gilbert (52) proposed that exons and domains murine rodents (104), protozoa (159), yeast (17, could be recombined to produce new chimeric 21), rice (154), and viruses (122). Similar to gene structures (Figure 2a,b). Chimeric pro- strict de novo gene origination, horizontal gene teins formed by gene recombination have been transfer (HGT), the exchange of genes between Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. found in many organisms since their discovery genomes from distantly related taxa, can im- in the LDL receptor gene (86, 130), including mediately add new genes and functions to a Drosophila (85, 118, 119), Caenorhabditis elegans genome (Figure 2f ). HGT is a major mecha- (67), mammals (92, 133), and plants (151), and nism for the addition of new genes to prokary- are estimated to have contributed ∼19% of otic genomes (73, 111) but has also been re- new exons in eukaryotes (see Reference 86 and ported in a number of eukaryotic organisms, in- references therein). In addition, retroposed cluding plants (8, 161), insects (102), and fungi sequences may jump into or near existing genes (56) (Figure 2f ). and recruit existing exons, or involve two adjacent protein-coding genes (164). Conversely, new gene structures may be formed by splitting Noncoding RNAs existing genes. Wang et al. (149), for example, Not all new genes code for proteins. Noncod- found that gene duplication is an intermediate ing RNAs were found to play an important

www.annualreviews.org • New Gene Evolution 311 GE47CH14-Long ARI 29 October 2013 14:13 Chr 1 Chr 10 Juncus Abelia Apium Actinidia Acorus Austrobaileya Amborella Betula Corylus Casuarina Fagus Oxalis Lonicera Nicotiana Sarracenia Buxus Platanus Caulophyllum Ranunculus Bocconia Sanguinaria Pandanus Magnolia Piper Nymphaea 20 ? rps2 PSMD4 40 rps11 rps11

' 3 60 80 rps11 PIPSL ENSMUSG00000078384 100 Time (Mya) 120 atp1 140 Mouse gene rps2 PIP5K1A rps11 Δ Δ ATGCT-AACATACCCGGACTTTGCCGATCTCATTCTTGTGGATGGAAATGTTGGTGTTGA ATGCTGAACATACCCGGACTTTGCCAATCTCATTCTTGTGGATGGAAATGTTGGTGTTGA CTGCTGTACATACCCGGACTCTGCCAAACTCGTTCTTGTGGATGGAAATGTTGGTGCCAA CTGCCACACATACCCGGACTTTGCCGATCTCGTCCTTGTGGATGGAGATGTTGGTGCCGA GAGTGGTCACAGTGACCTGTCTCACGTAGGACACAGCGGGGCTACCCCGGTTCTCATTCT GGGTGGTCACAGTGACCAGTCTCACATAGGACACGGCAGGGTTGCCTCGGTTCTCGTTCT GGGCAGACACGGTGACACGCTTCACGTAGGACACGGCAGGGCTGCCTCGGTTCTCGTTTT GGGCAGCCACGGTGACGACTCTCACGTAGGACACAGCAGGGTTGCCCCGGTTCTGGTTCT TGGTTGTGACAGTGAAGGGAGTCAGGCCCTCGGCATTGACCCCAGGACAGAGCGTTCCTG TGGTTGTGACAGTGAAGGGAGTCAGGCCCTCGGCATTGATCCCAGGACAGATTGTTCCTG TGGTGGTGACAGTGAAGGGTGTCAGGCCCTCAGCACTGACCCCCGGGCAGCCCACTGCTG TGGTGGTGACGGTGAAGGGTGTCAGGCCCTGGGTGCTGACCCCCGGGCAGCCAGTTGTTG E1 E2–E13 E14 E15 E1 E2–E10 180 160 0 Rat Rat Rat Mouse Mouse Mouse Human Human Human Guinea pig Guinea pig Guinea pig Foreign gene P P Att TGA TGA Intl Intl Read-through transcription Alternative splicing Reverse transcription TGA Integrase f Mutation to generate CDS (coding sequence regions) TTA GGA

TAG 400 1,600

1,500

350 1,400

ATG 300 1,300

1,200 250 1,100 1,000

200 900

b 150 800

700

100 600 50 500

400 B3 B1 B4 B1 B3 0 B3300 B1 B4 B1 B3 200 Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org Pseudoexons

ATG TAG 100 Access provided by Carnegie Mellon University on 08/20/15. For personal use only. mNSCI mNSCI 0 Duplication Complement degeneration Gene fission with sequence loss TAG ATG TAG ATG TAG Retroposition ATG TAG ATG ATG TAG ATG TAG -derived enzymatic domain Alu Alu Adh mkg mkg and

mkg-p1 mkg-p1 / / domain (observed) mauritiana mauritiana mauritiana (predicted) . . . Hydrophobic Duplication Duplication D D D simulans ancestral (hypothetical) . mkg-r3 mkg-r3 (ancestral gene) D Adh Ymp melanogaster . Jingwei a cd e D DAF DAF

312 Long et al. GE47CH14-Long ARI 29 October 2013 14:13

role in neuronal functions in the early 1990s moter but had acquired a new β2-tubulin-like (136). A large number of functional RNAs promoter by recruiting a novel 5 regulatory se- from noncoding regions have been reported quence. This regulatory sequence drives testis- to play vital roles in a wide variety of organ- specific expression of β2-tubulin and appears isms (7, 80). In Drosophila, microRNAs appear to still do so for Dntf-2r. In addition, the new to turn over rapidly, but can be strongly in- retrogene Xcbp1 recruited existing neuron pro- fluenced by positive selection (89, 90, 109). moters present at its site of integration (29). Strikingly, Dai et al. (34) showed that a new This co-opted mode of promoter recruitment long noncoding RNA influences courtship be- is also observed in human retrogenes (144) and havior in D. melanogaster. Pseudogenes are may be a general mode for retrogene promoter conventionally thought of as dead genes that gain (65). Additionally, Ni et al. (107) observed play no functional roles (41), but they may that eight new genes essential for Drosophila de- evolve functions in regulating expression of re- velopment evolved binding sites for the CC- lated genes. Zheng & Gerstein (171) recently CTC binding factor (CTCF) insulator under found that many mammalian pseudogenes positive selection, ensuring the delineation of are transcribed and thus may still function. the regulatory domains of these genes. McCarrey & Riggs (96) predicted that pseudogenes may regulate their parental genes, similar Transposable Elements to long noncoding RNAs or miRNAs. An ex- plicit mechanistic model of the use of pseudo- Transposable elements (TEs) can contribute to gene transcripts as decoys for cross-regulating functional divergence between duplicate genes expression of target genes was actually proposed through several ways, all similar to those de- and tested by Marques et al. (93, 94). scribed above (12). For instance, TEs can mediate gene recombination by carrying coding sequences from one part of the genome to another (63, 158) and can even themselves be in- New Gene Regulatory Systems corporated into existing coding sequences (46, New genes must acquire a specific transcrip- 88, 106). In addition, TEs were recently found tion regulatory system to ensure certain tempo- to be a source of micro-RNAs, which are ma- ral and spatial expression patterns. Betran´ et al. jor components of posttranscriptional regula- (10) investigated the origin of the male-specific tion of expression (116). expression of Dntf-2r, a retroposed gene in the Although we still have a developing picture D. melanogaster–Drosophila simulans clade. The of the contributions of each of these mecha- new retrogene did not contain the parental pro- nisms for new gene formation in different taxa, ←−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−− Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org Access provided by Carnegie Mellon University on 08/20/15. For personal use only. Figure 2 Representative new genes exhibiting various new gene origination mechanisms. (a) Jingwei, a new gene found only in Drosophila teissieri and Drosophila yakuba, was generated by a combination of retroposition, DNA-based duplication, and gene recombination, which formed a chimeric gene consisting of Adh-derived enzymatic domain and a hydrophobic domain from Ymp (85, 150). (b)PIPSLin humans is a consequence of gene fusion between two adjacent ancestral genes by read-through transcription and subsequent coretroposition (164). (c) Gene fission split the ancestral gene monkeyking into two distinct genes in Drosophila mauritiana, revealing an intermediate process of gene fission aided by gene duplication and complementary degeneration (149). (d) The gene ENSMUSG00000078384 in mouse revealed the evolutionary process of de novo gene origination (104). Red boxes are ancestral stop codons (TGA) with two triangles showing the positions of the enabling mutations, including a substitution and a deletion. (e)Twonew genes in humans, DAF and mNSCI, were generated by domesticating transposable elements, Alu, and short interspersed elements (B1–B4) (91, 106). DAF and Alu elements together make an interesting case in which alternative splicing generated a new isoform in the mammalian genome. ( f ) Horizontal gene transfer (HGT) is prevalent in bacteria with mechanisms such as homologous recombination (111). Antibiotic resistance genes can be acquired by host genomes containing the intl gene (which encodes integrase), a recombination site (Att), and a promoter to express the captured gene, as depicted by the process shown in the panels on the left.

www.annualreviews.org • New Gene Evolution 313 GE47CH14-Long ARI 29 October 2013 14:13

work in humans and Drosophila suggests that and gene recombination. Thus, the rates of new ∼80% of genes are formed by DNA-based du- gene origination we highlight should be viewed plication, 5% to 10% by de novo duplication, as serious underestimates. and ∼10% by retroposition (168, 169). And although these mechanisms may generate the ini- Drosophila tial gene structures, many new structures (in a The first estimate of the rate of new gene orig- large variety of taxa) undergo radical structural ination was made for retrogenes in Drosophila renovation to change exon-intron structure and in 2002 by Betran´ et al. (11), who identified even recruit new or existing coding sequences ∼150 retrogenes in D. melanogaster (4, 11) that into the new locus (30, 49, 151, 172). It has arose after the divergence of the Drosophila and been observed that the various mechanisms are Sophophora subgenera approximately 50 Mya. often combined to determine the structure of Their estimate of three new retrogenes new genes. per million years in the lineage leading to D. melanogaster was corroborated by an inde- Evolution of Transcription Units pendent estimation of ∼1.5 new retrogenes per Other than the origination and evolution of the million years based on cDNA hybridiza- macrostructure of genes described above, it was tion against salivary polytene chromosomes recently found that the transcription units in in species in the D. melanogaster subgroup the genes of vertebrates have been direction- (∼25 million years old) (158). Zhou et al. (172) ally evolving toward a productive transcription. computationally estimated via DNA-based Almada et al. (1) reported a highly significant duplication, retroposition, de novo origination, linear correlation between the gene age and the and gene recombination new gene origination critical signals to define transcription units in a rates in the D. melanogaster subgroup to be gene, including the U1 small nuclear ribonu- 5–11 new genes per million years and found cleoprotein recognition sites and polyadeny- different rates for the four mechanisms. In par- lation sites (PASs). The observed incremental ticular, approximately 80% of new genes added gain of the U1 sites and gradual loss of PASs to the D. melanogaster lineage genome were in the 5 end of protein-coding genes revealed generated by DNA-based duplication. More a selection for a U1-PAS axis for productive extensive and detailed analyses of DNA-based transcription. and RNA-based duplicates were conducted by Vibranovski et al. (142), Meisel et al. (100), and ABUNDANCE AND Zhang et al. (168). Zhang et al. (168) analyzed ORIGINATION RATES the 12 Drosophila genomes and estimated that OF NEW GENES ∼17 duplicate genes per million years arose

Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org in the Drosophila genome. Figure 3a shows

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. The advent of whole-genome sequences for the distribution of these new genes on the many organisms allowed identification of many Drosophila phylogeny. new DNA-based and RNA-based duplicate genes (e.g., 11, 43). With more genome sequences available, especially in closely related Mammals groups such as the twelve Drosophila species Emerson et al. (43) and Marques et al. (92) iden- (32), it became possible to investigate the rates tified ∼120 retrogenes in the human genome, of new gene origination in particular lineages. yielding an estimated retrogene origination rate We review these findings in Drosophila,mam- of one retrogene per million years in the lin- mals, and plants. There have been no re- eage leading to humans. Zhang et al. (166, 169) ports of new gene origination rates for mech- systematically identified new genes in verte- anisms other than DNA-based duplication, brates, especially in primates, and showed that RNA-based duplication, de novo origination, the rates of new gene origination are variable

314 Long et al. GE47CH14-Long ARI 29 October 2013 14:13

a Drosophila Mya 40 Branch 0 11,909

Branch 1 220 35

Branch 2 161

Branch 3 154

Branch 4 284 6

3 Branch 5 68 Br. 6 60 D D D D D D D D D D D D ...... melanogaster sechellia simulans yakuba erecta ananassae persimilis pseudoobscura willistoni grimshawi mojavensis virilis

b Vertebrates Mya 450 Branch 0 12,058

Branch 1 1,013 370

Branch 2 310 1,393

Branch 3 1,018 220

Branch 4 945 160

Branch 5 1,214 100 Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org 70 Branch 6 336 Access provided by Carnegie Mellon University on 08/20/15. For personal use only. Branch 7 113030 43 Branch 8 314 25 Branch 9 286 Branch 10 13 392 6 Branch 11 447 Br. 12 389 Human Chimp Orangutan Rhesus Marmoset Mouse Guinea pig Dog Cow Armadillo Opossum Platypus Chicken Lizard Frog Fugu Zebrafish Terec

Figure 3 The phylogenetic distribution of new gene origination events in (a) Drosophila and (b) vertebrates. These genes were generated by DNA-based duplication, retroposition, and de novo origination (168, 169). The number of new genes that originated in each time period is shown above the branch. For example, in a, branch 1 shows that 220 genes originated between 35 and 40 Mya in Drosophila.In b, red numbers are new genes that originated in the hominoid branches or speciﬁcally in humans.

www.annualreviews.org • New Gene Evolution 315 GE47CH14-Long ARI 29 October 2013 14:13

in different evolutionary stages of vertebrates (54), and C. elegans (81). Dopman & Hartl (40), (Figure 3b), although 25–30 genes generated Emerson et al. (42), Cardoso-Moreira & Long mostly by DNA-based and RNA-based dupli- (20), and Cardoso-Moreira et al. (19) identified cation arise per million years. Interestingly, this more than 1,000 partial and 100 complete rate is much higher on the branches closer to gene duplications/deletions in just 15 strains of human (66 new genes per million years in the D. melanogaster relative to the reference human lineage alone) (166). genome using microarray hybridization. In addition, next-generation sequencing Plants and microarrays have identified more than 1,200 partial and 600 complete gene du- In contrast to flies and mammals, Zhang plications/deletions in 179 individual human et al. (165) reported that 0.6 retrogenes per genomes relative to the reference genome (101, million years arose in the Arabidopsis thaliana 125). The recent sequencing of 43 genomes in genome, a rate comparable to Populus (174), two D. melanogaster populations revealed more and a microarray-based study in Arabidopsis CNVs, including 2,588 duplications and 3,336 identified 94 new genes created by DNA-based deletions relative to the reference genome (74). duplication and retroposition (45). Surpris- The large number of new genes segregating in ingly, Wang et al. (151) found that a very high populations is just now beginning to be appre- rate of retrogene and chimeric gene origination ciated and investigated further. An active area was present in rice: More than 1,000 retrogenes of research will be to perform functional and were identified in the rice genome, 380 of statistical analyses of these new genes to under- which evolved chimeric gene structures by stand their earliest stages of evolution. In all, recruiting previously existing genes into their these studies have shown that new gene origina- gene structures. These authors determined the tion rates can differ between taxa, yet are appre- rate of chimeric gene origination to be 7 per ciable in all groups studied. These results fur- million years in grass genomes in the lineage ther strengthen the conclusion that new gene leading to rice, 50 times the origination rate of origination is a general evolutionary process. chimeric genes in humans (144), and the high- est rate of chimeric gene origination known. In addition, Jiang et al. (63) identified more PATTERNS OF NEW GENE than 3,000 gene recombinants in rice mediated ORIGINATION by Pack-Mutator-like transposable elements (Pack-MULEs). These results suggest a huge Gene Traffic in Drosophila, Humans, potential for protein diversity in plant genomes. and Other Organisms Along with these extensive studies in With the large number of new genes identified

Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org Drosophila, mammals, and plants, there have

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. in various organisms, researchers were able been many valuable investigations of chimeric to investigate statistical patterns of new gene genes and retrogenes in Caenorhabditis elegans characteristics to explore the mechanistic and (66), fish (25, 49), silkworm (147), and chicken evolutionary forces that impact the formation, (62). origination, and evolution of new genes. Betran´ et al. (11) examined the chromosomal distri- Copy Number Variation bution of retrogenes and their parental copies Inexpensive whole-genome analysis has also in D. melanogaster (Figure 4a). Surprisingly, made it possible to identify genes at the these authors found a significant excess of very earliest stages of their evolution, before autosomal retrogenes derived from X-linked fixation. Abundant copy number variation parental genes (X→A) and a significant (CNV) of individual genes has been detected deficiency of retrogenes formed in the opposite in Drosophila (40, 42, 124), humans (47), mouse direction (A→X) or between autosomes

316 Long et al. GE47CH14-Long ARI 29 October 2013 14:13

b X a Drosophilia Humans

Excess male Excess male ExcessExcess nnon-sexon-sex aandnd EExcessxcess mmaleale biased functions biased functions femalefemale ffunctionsunctions biasedbiased ffunctionsunctions 114% 114% 2260%60% 299%299% –39% –39% –10 ~ –12% 4

–33% 232 3 Autosomes

Figure 4 Retrogene trafﬁc in (a) Drosophila (11, 142) and (b) humans (43). Each arrow indicates the movement of retrogenes from the parental gene chromosomal location to the retrogene’s location. The size of the arrow indicates the intensity of gene movement between chromosomes, and the percentages show quantitatively the excess of movement over the null expectation (random origination and insertion). The functions of the retrogenes are indicated.

(A→A). Dai et al. (34a) further revealed that chromosome, an autosomal chromosome arm retrogenes derived from autosomal parental that fused to the ancestral X chromosome in copies tend to locate to the same chromosome the Drosophila genus evolution, also shows the as the parental copies. However, 42 out of same excess of gene traffic (100, 142). the 43 retrogenes exhibited X→A movement; Relative to Drosophila, human and mouse only one retrogene moved X→X. These two studies revealed similar yet distinct patterns of observations clearly reveal a striking pattern gene traffic (43) (Figure 4b). Compared with of new gene origination in flies: Retrogenes a neutral expectation based on the chromo- derived from X-linked genes prefer to copy into somal distribution of processed pseudogenes, autosomes. This directional movement of new which are expected to be evolving neutrally, genes is called gene traffic (43). These results there is an excess of X→A retrogene move- hold in the 12 sequenced species of Drosophila ment and most X→A retrogenes exhibit testis (100, 142) and in Anopheles gambiae (5, 138). expression. However, there is also a significant Interestingly, 90% of X→A retrogenes in excess of A→X retrogene movement in hu- D. melanogaster are expressed in testis, a signif- mans, and these excess A→X retrogenes ex- icantly higher proportion of testis-expressed hibit either female expression or unbiased ex- Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. genes than average (11), suggesting that the ret- pression, with nonsignificant male expression. rogene’s function (in this case, male-beneficial A→A movement is very low in humans (43). function) can be associated with its reloca- The mouse genome shows a very similar pat- tion. The symmetric pattern was observed in tern. Zhang et al. (166, 168) have shown that silkworm, which has ZW sex determination these patterns exist for DNA-based duplicates, (females are ZW and males ZZ), whereby genes retrogenes, and de novo genes in Drosophila,hu- retroposed from Z→A tend to be ovary ex- mans, and mouse. pressed (147). Gene traffic appears to be general in Drosophila for different mechanisms of new gene formation, as Vibranovski et al. (142) also Consequences of Gene Traffic for showed that new genes created by DNA-based Genome Evolution duplication exhibit the same X→A movement If gene traffic has been historically impor- and testis expression. Moreover, the neo-X tant for genome evolution, the majority of

www.annualreviews.org • New Gene Evolution 317 GE47CH14-Long ARI 29 October 2013 14:13

testis-biased/male-biased genes should be genes in the male somatic cells, although these autosomal, contrary to the previous conclusion models need to be rigorously experimentally that the X was a hotbed for male-biased genes tested. MSCI model: X chromosome (148). Several microarray-based studies of inactivation during male-biased genes and their chromosome loca- spermatogenesis favors tions by Ranz et al. (117) and Parisi et al. (114) Correlation Between Gene Age relocation of genes in Drosophila, Khil et al. (70) in mouse, and later and Expression involved in by Zhang et al. (166) in humans and mouse Early studies revealed a connection be- spermatogenesis to autosomes have confirmed this prediction. In Drosophila, tween the expression and the ages of new Zhang et al. (168) showed a smooth transition genes. Betran´ & Long (10) showed that of new male-biased genes from X linkage to Dntf-2r,a∼10 million-year-old gene in the autosomal linkage over evolutionary time. D. melanogaster subgroup, is expressed only in testis; however, its parent Dntf-2 is expressed ubiquitously. Almost all retrogenes in Models to Interpret the Causes of Drosophila appear to have testis expression (4) Gene Traffic and to have maintained testis-biased or testis- In general, models to explain gene traffic, and specific expression independent of age (50). experimental evaluation of those models, show Vinckenbosch et al. (144) showed that new that natural selection is a major force govern- human retrogenes are often transcribed in ing gene traffic but that mutational processes testis and later evolve stronger and more likely also play a role (38). Meiotic sex chro- diverse spatial expression patterns, coining the mosome inactivation (MSCI) in the male germ “out of the testis” hypothesis. Whether or not line (11, 43, 139, 140), dosage compensation the testis is the starting point for new genes, in the heterogametic sex (3, 143), sexual an- a general survey of the expression patterns for tagonism between male- and female-beneficial new genes that originated within vertebrates genes (22, 128), and meiotic drive (131, 132) revealed strong positive correlation with age in have all been implicated in driving gene traf- both transcription intensity and spatial expres- fic. The relative role of each of these forces has sion (167). It is possible that this testis-biased been hotly debated. MSCI has a strong effect in pattern of retrogene expression is due to our mammals (70), and experimental evidence for inability to detect genes expressed at low levels MSCI in Drosophila comes from several studies in different tissues, but this issue should be (59, 139, 140). Vibranovski et al. (139) showed resolved soon with advances in next-generation that genes that are highly expressed in the sequencing. meiotic phase of spermatogenesis (when the X chromosome is predicted to be inactivated) are Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org EVOLUTIONARY FORCES Access provided by Carnegie Mellon University on 08/20/15. For personal use only. significantly enriched on the autosomes. Con- versely, genes expressed in the mitotic phases of ACTING ON NEW GENES spermatogenesis are randomly distributed Evolutionary forces, such as natural selection throughout the genome. Other studies sug- and genetic drift, operate on both facets of new gest reduced expression throughout spermato- gene evolution: the fixation of new gene loci and genesis, including in the spermatogonia, which their acquisition of a beneficial function. These also discredits dosage compensation models two facets may overlap. In this section, we dis- (99; however, see 141). A clear-cut single cell cuss theoretical models developed to describe transcriptome is needed to clarify these issues. how new genes arise and acquire novel func- Along with the MSCI model, other non-germ- tions as well as general approaches to studying line-based models, e.g., sexual antagonism, are new genes and the selective forces that act on also necessary to interpret the expression of new them.

318 Long et al. GE47CH14-Long ARI 29 October 2013 14:13

Selective Models of New functional improvement. EAC predicts that Gene Evolution the bifunctional ancestral gene is subject to selection before gene duplication, that adaptive Neofunctionalization: Muller (103) was among the first to recognize conflict between the ancestral function and the process by which a the potential importance of duplicate genes the new function constrains improvement of new gene acquires a in evolution. He proposed a simple model the selected function(s) before duplication, novel function whereby new duplicate genes could acquire and that adaptive changes and functional novel, beneficial functions distinct from those improvement occur in the daughter genes after of the original copies. Ohno (112) further duplication. elaborated on Muller’s duplication model For additional information on duplicate as a major means of neofunctionalization. gene evolution, see Conant & Wolfe (33), who However, Ohno also predicted that duplicate suggest that preservation of new genes stems genes are most often inactivated and become from the co-option of existing functions to serve pseudogenes. This classic model assumes that new purposes, and Walsh (145, 146), who gives the new gene is functional upon duplication a detailed mathematical description of the mod- and that the new gene subsequently acquires els and relative probabilities of neofunctionali- mutations that provide a novel beneficial zation and pseudogenization. function. The novel function is then preserved Examples of EAC (36), IAD (105), and AR in the genome by natural selection. (48) have been published, and each model has However, strictly duplicate genes are specific predictions for what we should observe redundant, and beneficial mutations are ex- if a new gene originated by each process (33). tremely rare. How do new duplicate genes However, none of these models can be used as a remain in the population long enough to accu- statistical framework for rigorously testing the mulate a beneficial, selected mutation(s)? This roles of evolutionary forces in new gene orig- problem led to the development of models that ination. Classic molecular population genetic predict selective preservation of both copies tests based on nucleotide substitution patterns at all stages of their evolution: adaptive and allele frequency spectra do provide this radiation (AR), innovation-amplification- framework and have been used extensively to divergence (IAD), and escape from adaptive detect selection on new genes. These tests, conflict (EAC). The AR model proposes that such as the M-K (McDonald-Kreitman) test gene duplication itself is favored, e.g., for in- (97) and the HKA (Hudson, Kreitman, and creased dosage of a gene product, and that the Aguade) test (60), detect elevated rates of amino new duplicates then undergo functional radia- acid substitutions (M-K) or reduced effective tion (48). Thus, AR posits that novel functions population size (HKA) at loci. In addition, are acquired after duplication. IAD and EAC, Thornton (135) introduced a coalescent-based Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. in contrast, propose that ancestral loci develop model that can be used to test for selection novel beneficial secondary functions before on CNV. The HKA test and Thornton’s test duplication (9, 36). Under IAD, repeated gene compare measurements of nucleotide variation duplication is favored to increase the dosage in genes with a distribution of parameter values of the novel secondary function. Different derived from neutral coalescent simulations. duplicates are then free to optimize the ances- Thus, the M-K, HKA, and Thornton’s tests tral or novel secondary function, and only the are used to test the classic model. Each of two best copies are retained in the genome. these five models (classic, AR, IAD, EAC, and The increase in the number of duplicate genes statistical) predicts that new genes should ex- within the AR and IAD models also provides perience strong natural selection after they are additional targets for beneficial mutations, formed. We now discuss some of the evidence thus increasing the probability and speed of indicating that this often appears to be the case.

www.annualreviews.org • New Gene Evolution 319 GE47CH14-Long ARI 29 October 2013 14:13

a c 65/32 Fixed retrogenes originating on autosomes/the X Polymorphic retrogenes KA = 0.018 originating on Adh Parental autosomes/the X KS = 0 genes 30/4 Adh-twain 0.01 D. simulans D. melanogaster D. simulans D. melanogaster In the clade of D. subobscura-guanchi 70/20 Fixed retrogenes from A A Polymorphic retrogenes from or X X copying over the A A or X X copying over KA = 0.020 retrogenes from A X the retrogenes from A X or K = 0 Jingwei Parental or X A copying X A copying Adh S genes 36/3 In the clade of 0.01 Chimpanzee Humans Chimpanzee Humans D. teissieri-yakuba

b Retroposition KA = 0.038 0/0 9/0 K = 0 Adh S

4/11 21/16 Adh-Finnegan 0.01 Adh 0/18 2/8 Jingwei 2/19 In the clade of D. hydei-mettleri D. teissieri D. yakuba D. teissieri D. yakuba

Siren Adh D ananassae KA = 0.064 In . and D. bipectinata complex KS = 0

0.02

Figure 5 Positive Darwinian selection acting on new genes. (a) Positive selection for the ﬁxation of new retrogenes in Drosophila (124) and humans (123). The numerator and denominator show the numbers of retrogenes that originate on the autosomes and the X, respectively. Tests based on the M-K framework indicate an excess of ﬁxed X→A retrogenes in both species and strong positive selection for X→A retrogene movement. (b)Thejingwei ( jgw) gene in Drosophila (85). The ratios over the branches are the numbers of nonsynonymous changes over the numbers of synonymous changes, and the ratios in the triangles are the ratios of divergence between the species and the polymorphisms. M-K tests and Ka/Ks ratios indicate strong positive selection acted on jgw shortly after it originated. (c) Selection acted on all Adh-derived chimeric genes in Drosophila (64), as indicated by elevated Ka/Ks ratios. Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. Fixation of New Genes et al. (42) found a genome-wide pattern con- The first study to identify signatures of selec- sistent with strong purifying selection on all tion on a new gene journeying to fixation was CNVs except duplications of whole genes. That performed by Llopart et al. (82), who analyzed is, single-gene duplications are under signif- a new variant of the jingwei gene in Drosophila icantly weaker purifying selection than par- teissieri, which lost its second intron. This tial gene duplications or partial or complete D. teissieri–specific intron presence-absence gene deletions. Similarly, Schrider et al. (123, polymorphism exhibits a significant excess of 124) showed a significant excess of fixed ver- rare alleles and patterns of nucleotide polymor- sus polymorphic retrogene CNV originating phism that is consistent with moderate natural from the X chromosome in both Drosophila and selection driving the polymorphism to fixation. humans, indicating that natural selection gov- Selection has also been detected on CNV in erns the patterns of retrogene CNV evolution D. melanogaster and other organisms. Emerson (Figure 5a). Overall, these studies show that

320 Long et al. GE47CH14-Long ARI 29 October 2013 14:13

natural selection can play a key role in driving ent Adh-derived fusion genes often accumulate new genes to fixation. In addition, they high- mutations at the same sites, regardless of to light the use of classic population genetic tests which other gene they have fused (Figure 5c). in determining whether selection acts on new In addition, each of the four Adh-derived fu- genes during their journeys to fixation. sion genes exhibits strong signals of accelerated amino acid substitution using classic population genetic statistical tests (e.g., M-K test). Selection on Sequence Changes Some of these observations have recently in New Genes been borne out by genome-wide studies. Xu In addition to studies of the evolutionary forces et al. (156) surveyed structural differences be- governing the fixation of new genes, many stud- tween more than 600 paralogous pairs of genes ies have investigated the effects of selection and in plants and found that most new genes un- drift on new gene sequences. Long & Langley derwent radical changes in exon/intron content (85) showed that the new chimeric gene jingwei and boundaries as well as insertion/deletions. in D. teissieri and Drosophila yakuba contains a And using molecular population genetic tests, significant excess of nonsynonymous substitu- Chen et al. (30) found that young genes in tions compared with nonsynonymous polymor- D. melanogaster show strong signals of selection. phisms (relative to the ratio of synonymous sub- These authors predicted that ∼25% of amino stitutions to polymorphisms), indicating that acid substitutions in young essential genes were amino acid substitutions were rapidly driven to fixed by natural selection. In addition, this sig- fixation shortly after the origination of jingwei nal of selection diminishes as genes grow older. (Figure 5b). Similarly, Nurminsky et al. (110) Altogether these studies indicate that there are showed that a D. melanogaster–specific gene general patterns to new gene evolution: New family, Sdic, involved in sperm motility rapidly genes often undergo rapid (or immediate) struc- acquired a new exon-intron structure and testis- tural and sequence renovations and expression specific expression (Figure 1). Sdic is a chimeric pattern changes that are driven by strong natu- gene composed of a 5 piece of Cdic, encoding ral selection. a cytoplasmic dynein intermediate chain, and a 3 piece of AnnX, a phospholipid binding pro- Analysis of New Gene Structure tein. This fusion protein underwent rapid struc- and Function tural renovations, including the conversion of a In addition to analyses of new gene frequen- Cdic intron into an exon and an AnnX exon and cies and nucleotide changes, many groups have Cdic intron into a testis-specific promoter. Low investigated the evolutionary forces acting on levels of sequence polymorphism, preservation new genes by analyzing new gene functions, ge- of coding potential, and the absence of Sdic in nomic locations, or expression patterns. This Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. other closely related species suggest that Sdic complementary approach has revealed several was rapidly swept to fixation. fundamental patterns of new gene origination. These first discoveries sparked searches Chen et al. (24) and Cheng & Chen (31), for for general evolutionary patterns in new example, investigated the antifreeze proteins genes. Jones & Begun (64) searched for com- found in the blood of several orders of Arc- mon patterns in the evolution of three Adh- tic and Antarctic fish. These proteins inde- derived chimeric genes in different lineages of pendently evolved in the different orders, yet Drosophila. All three new genes quickly accu- they consist of nearly identical tripeptide re- mulated a large number of amino acid replace- peats. These tripeptide repeats were generated ment substitutions, several at identical amino de novo by amplification of short nucleotide acid sites, in the Adh-derived region shortly af- sequences. These studies showed that similar ter they arose. Strikingly, Jones & Begun (64) environmental pressures may favor the genera- and Shih & Jones (127) showed that differ- tion of genes with similar functions.

www.annualreviews.org • New Gene Evolution 321 GE47CH14-Long ARI 29 October 2013 14:13

In addition, as we showed in the pre- sential, functions at the molecular, cellular, and vious section, testis-biased genes are under- individual level (27). These ﬁndings were sig- represented on the D. melanogaster and mam- niﬁcantly added to the classic reports of the malian X chromosome. Diaz-Castillo & Ranz’s diverged or novel functions in the genes cre- (38) analysis of the genomic location of genes ated by duplication (see 53, 79 for references relative to the position of chromosome domains therein). during spermatogenesis led the authors to alter- natively propose that the enrichment of testis- Biochemical Pathways biased retrogenes on the autosomes is caused New genes can generate new biochemical by an increased availability during spermato- pathways and products if they are enzymes or genesis of open chromatin domains that con- become enzymes. Zhang et al. (162) showed tain testis-expressed genes. This larger target that jingwei evolved the capacity to catalyze for retrogene integration allows a higher pro- breakdown of long-chain alcohols in D. yakuba portion of these retrogenes to acquire testis- and D. teissieri, whereas the parent Adh can biased expression. These general observations only act on short-chain alcohols. In Arabidopsis, of the location of sex-biased genes, and their Weng et al. (152) and Matsuno et al. (95) general movement off of the X chromosome, demonstrated that three recently evolved indicate that differences in expression alone can new duplicate genes from the P-450 family, dictate where in the genome new genes origi- Cyp98A9, Cyp98A8,andCyp84A4, assembled nate. Together, these results show that stud- two new biochemical pathways related to ies of general patterns of extant gene locations, phenolic metabolism that are required for structures, and expressions can be informative pollen development and α-pyrone synthesis. of new gene origination and evolution.

Gene Expression Networks PHENOTYPIC EFFECTS New genes can also be quickly integrated into OF NEW GENES existing gene networks. Chen et al. (30) ob- Studying the roles of new genes in phenotypic served that almost all young essential genes have evolution recently became feasible with the ad- been assimilated into protein-protein physical vent of sophisticated genetic tools and molec- interaction networks in Drosophila, and a signif- ular techniques as well as signiﬁcant progress icant number of these young genes have de- in related areas of important phenotypes in bi- veloped multiple interactions with old genes ology. Young genes are often assumed to be (Figure 6). Integration appears to be driven dispensable because important functions are by natural selection. Several new genes have thought to require a long evolutionary period become new hubs. Analysis of one new gene, Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. to be developed and optimized (76). However, Zeus, derived from the DNA-binding pro- studies in the past decade have found numerous tein Caf40 via retroposition (28), revealed that young genes with important, and sometimes es- it retained ∼30% of Caf40’s DNA-binding −−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−→

Figure 6 New genes integrated into gene networks and reshaped those networks. (a) New yeast genes that originated through duplication-based (blue) and non-duplication-based (red ) mechanisms since the recent whole-genome duplication (<100 Mya) were integrated into the physical interaction network (18). The orange box highlights a module composed of two new genes involved in the pathway to form and process actin. DID4 ( green box) interacts with 11 new genes within three steps. (b) New genes in Drosophila formed hubs in protein-protein interaction networks (30). (c)TheDrosophila melanogaster–Drosophila simulans-speciﬁc gene Zeus quickly accumulated more than 100 amino acid substitutions (red, yellow, blue, and light green) in its nucleotide-binding domains under positive selection. Consequently, it evolved into a new DNA-binding motif that evolved hundreds of new gene links to rewire the gene networks that control reproduction (28).

322 Long et al. GE47CH14-Long ARI 29 October 2013 14:13

a PAU16 RAD3 HSP150 YNR040W CRS5 YNL046W TCP1 QNS1 SPG3 YLR030W

YIL092W YBR184W YBL044W YCL049C YEL057C

CPR8 CAT2 YGR035C PFA3 NAB2 NIP1 YJL070C UBP15 YER121W CNM67 YLL023C EAF6 YPS5 ERD1 GCN3 ADY3 LSB3 MUK1 NDC1 DID4 YLL056C YPR096C YHL042W

YER186C HUA2 CDC36 GCD7 DDR48 MCM21 SBE2 SLA2 YLR125W TMA17 YDL118W ALD5 GTS1 YPL257W YGL010W ABP1 RSF1 PAM18 YSC84

SLA1 BSP1

TMN2 THP2 IRC10

b c Nucleic acid binding groove 2

1 Bits G A T CGA AA G GC G GAG AGG G G A CC CG C A ATC T A G T C T G C A A C A CT CC C T G C T AC T T 0 T 1 234 5 67 8 9 1011 1213 14 15 16 17 18 19 20 21 Caf40

107 amino acid 4–6 Mya after generating substitutions in Zeus Zeus through retroposition Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. Nucleic acid binding groove Zeus 2

1 Bits A AG C G GA G G G GA A T A GAG A C AT T G A AACG C T GA T G G G C C GCC T A T C C TT C CTC T 0 C C C 1 25834 67 9 1011 1213 14 15 16 1720 18 19 21

Zeus has created 193 new gene links and kept only 30% (129) of ancestral links of caf40

www.annualreviews.org • New Gene Evolution 323 GE47CH14-Long ARI 29 October 2013 14:13

sites. However, in a short evolutionary period heterochromatin protein 6 (HP6) 12–15 Mya. (4–6 million years) Zeus acquired 193 new bind- Subsequent loss of one of its two domains ing sites through which it activates or represses (the chromodomain) and the accumulation of hundreds of downstream genes involved in protein coding changes in the remaining chro- reproduction. This observation indicates that moshadow domain gave Umbrea a distinct chro- gene expression networks can be rapidly and matin localization pattern at the centromere. globally reshaped in evolution by new genes. Umbrea appears to have become essential only Li et al. (77) showed that a de novo gene in after it lost the chromodomain 5–7 Mya. Care- yeast can suppress a previously existing mating ful molecular dissection, ancestral protein res- type–control pathway, thus rewiring the struc- urrection, and population genetic analyses are ture of gene networks in the species. Capra the keys to understanding the processes and et al. (18) revealed that new genes in yeast be- time new genes take to acquire important roles come more integrated into cellular networks in organisms. over time. The modified networks are not nec- essarily novel or unimportant, either: Konikoff et al. (72) found that genes have been contin- Brain Evolution in Flies and Humans ually added and removed from the Wnt and Chen et al. (29) investigated the expression pat- TGF β-signaling pathways, ancient networks terns of new genes in Drosophila and found involved in animal development. that approximately five new genes per million years evolved brain expression patterns, mostly in structures involved in olfaction and learn- Development ing/memory. All new brain genes are expressed Surprisingly, new genes can quickly acquire in the α/β lobe, an evolutionarily new set of essential roles in development. Chen et al. neurons, implicating the roles of new genes (30) identified 59 genes that originated in in the evolution of this brain structure. Some the past ∼35 million years in Drosophila that of the new brain genes have significant ef- evolved essential developmental functions. fects on behavior. For example, Xcbp1 and Desr Silencing expression of these young genes influence foraging behaviors (29), and sphinx causes development failure in early to late influences courtship behaviors (34). The fre- pupae and in some cases at even earlier stages quent acquirement of new brain genes into the (Figure 7a,b). Furthermore, tissue-specific genome and the behavioral phenotypes of some knockdown of these young genes can cause of these genes suggested rapid evolution of be- morphological defects in adult flies. Silencing haviors, which is consistent with the remarkable new genes can also have a critical effect on observations of Rollman et al. (120) that de- reproduction, even when the individual can tected a great variation in the olfactory behav- Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. complete development. The duplicate gene nsr ioral response associated with odorant receptor (novel spermatogenesis regulator) exists only in gene duplicates within the natural population the four species of the D. melanogaster clade of D. melanogaster. The incorporation of new that diverged 3 Mya, yet it evolved an essential genes into the brain is not specific to Drosophila. function required for sperm individualization Zhang et al. (166) found a correlation between (39). Similarly, silencing Zeus, a gene in the new genes and brain evolution in the human lin- same group of Drosophila, causes sterility by eage. A high proportion of hominoid-specific disrupting testis and sperm development (28). and human-specific genes are expressed in the Recent work on Umbrea, a 12–15 million- prefrontal cortex and temporal lobe, the newest year-old gene in Drosophila, carefully dissected brain structures, in early fetal development. the evolutionary steps this young gene took Strikingly, 54 of 380 human-specific genes are to becoming essential in D. melanogaster (121). expressed in these two brain regions, regions Umbrea arose by DNA-based duplication of that are critical for proper cognitive function.

324 Long et al. GE47CH14-Long ARI 29 October 2013 14:13

G13463 CG6289 30 Mya 9 Mya Early pupa Early larva

G32376 18 Mya Pharate

b CG7627 Gene duplication YLL1 8

Mya 4

erecta erecta . yakuba teissieri . yakuba teissieri D . . simulans D . . simulans D D . D D . ananassae mauritiana mauritiana . D . D . D D melanogaster D melanogaster . . D D LINES METHOD/MUTATION PHENOTYPES 11343 P-element insertion Lethal, pupal stage SH2-0995 EMS/G717S Lethal, pupal stage SH2-1101 EMS/T765I Lethal, pupal stage SH2-0504 EMS/synonymous Viable V39539 RNAi/constitutive Gal4 Lethal, pupal stage V39540 RNAi/constitutive Gal4 Lethal, pupal stage

Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org Figure 7 Access provided by Carnegie Mellon University on 08/20/15. For personal use only. The essential effects of new genes on development. (a) Development was terminated in a developmental stage when three different genes were knocked down using RNA interference (RNAi). (b) YLL1 originated in the common ancestor of the Drosophila melanogaster subgroup species ∼6–10 Mya, yet showed lethal effects in the pupal stage when silenced by RNAi, mutated by EMS, or disrupted by the P element (30).

One of these genes, SRGAP2, is involved in sexual reproduction and sex determination (87). neocortical development (23, 37). As the aforementioned patterns of new gene origination show, the vast majority of new genes Sexual Dimorphism and are sex-biased, especially male-biased, and their Sexual Reproduction origination processes show directional copy- New genes impact sexual dimorphism by par- ing between the sex chromosomes and auto- ticipating in the genetic systems that control somes (e.g., 11, 43). A number of new genes

www.annualreviews.org • New Gene Evolution 325 GE47CH14-Long ARI 29 October 2013 14:13

have been identified with various phenotypic mechanisms, e.g., duplication and de novo effects, including testicular descent in theria origination, leaving open a vast array of mecha- (RLN3) (115), testis size in mouse (noncoding nisms to be investigated. Continued efforts will RNA gene, Poldi ) (58), sperm competition in be invaluable for understanding the abundance D. melanogaster (Sdic) (160), and spermatogen- of new genes, the mechanisms that have been esis in Drosophila (nsr) (39). neglected so far, and even new gene evolution The ability of new genes to be incorporated in nonmodel organisms. An outstanding chal- into such conserved pathways, networks, and lenge is to understand the roles of new genes developmental programs warrants considerable in the evolution and biology of phenotypes, further study. What specific roles can new and the studies we have highlighted have genes play, and what characteristics of new left important, unresolved questions to be genes enable them to become essential compo- answered. For example, what evolutionary nents of these processes so quickly? New genes forces drive gene traffic? How do new genes now appear to be potent drivers of phenotypic evolve essential developmental functions, and evolution and the genetic control of important how quickly? How is CNV driven to fixation, biological processes, and show that organismal and when do CNVs acquire novel functions? development and organ development have How are important structures, such as the evolved species-specific and lineage-specific human brain, able to incorporate new gene components. Understanding the evolution and functions, and how do new genes contribute modification of these components through the to novel cognitive function? Future studies of incorporation of new genes is crucial to further more diverse phenotypes will help shed light research. on the general patterns and modes of new gene evolution and on the influence of new genes on evolving systems. In addition, understanding CHALLENGES FOR THE FUTURE how phenotypes rapidly evolve will require a It is apparent that we have just a glimpse of deep understanding of the underlying local and the emerging world of new genes and that global gene networks. This will be a tremen- these genes play crucial roles in the rapid dous challenge, ranging from the experimental evolution of the genetic systems that govern deciphering and graphic description of the gene biological diversity. Questions about new gene networks to a valid comparative analysis of the evolution have opened many doors to both our ancestral and derived networks shaped by new understanding of existing diversity and to new genes and eventually to the causal relationship research. For example, most studies have of the altered networks with the evolution of examined new genes generated from a few phenotypes. Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org Access provided by Carnegie Mellon University on 08/20/15. For personal use only. DISCLOSURE STATEMENT The authors are not aware of any affiliations, memberships, funding, or financial holdings that might be perceived as affecting the objectivity of this review.

ACKNOWLEDGMENTS We thank all members of the Manyuan Long lab, past and present, for their scientiﬁc contributions to the relevant topics discussed in this review. We are indebted to our collaborators, including Antony Dean, Kevin White, Tim Karr, Liqun Luo, Liming Li, Wei Du, Xiaoxi Zhuang, Xiaochun Ni, and Maria Spletter. We also thank the NIH, the NSF, and the Packard Foundation as well as the late Edna K. Papazian for their support of the study of new genes throughout the past ﬁfteen years as we explored this new and exciting area. M.L. is currently supported by NIH grants

326 Long et al. GE47CH14-Long ARI 29 October 2013 14:13

1R01GM100768-01A1, NSF1051826, and NSF1026200; N.W.V. by the NSF Graduate Research Fellowship and partially by the NIH genetics training grant T32 GM007197; S.C. by the NSF Doctoral Dissertation Improvement Grant DEB-1110607; and M.D.V. by a Pew Latin American Postdoctoral Fellowship.

LITERATURE CITED 1. Almada AE, Wu X, Kriz AJ, Burge CB, Sharp PA. 2013. Promoter directionality is controlled by U1 snRNP and polyadenylation signals. Nature 499:360–63 2. Arguello JR, Chen Y, Yang S, Wang W, Long M. 2006. Origination of an X-linked testes chimeric gene by illegitimate recombination in Drosophila. PLoS Genet. 2(5):e77 3. Bachtrog D, Toda NRT, Lockton S. 2010. Dosage compensation and demasculinization of X chromosomes in Drosophila. Curr. Biol. 20(16):1476–81 4. Bai Y, Casola C, Feschotte C, Betran´ E. 2007. Comparative genomics reveals a constant rate of origination and convergent acquisition of functional retrogenes in Drosophila. Genome Biol. 8(1):R11.1–1.9 5. Baker DA, Russell S. 2011. Role of testis-specific gene expression in sex-chromosome evolution of Anopheles gambiae. Genetics 189(3):1117–20 6. Begun DJ, Lindfors HA, Kern AD, Jones CD. 2007. Evidence for de novo evolution of testis-expressed genes in the Drosophila yakuba/Drosophila erecta clade. Genetics 176(2):1131–37 7. Berezikov E. 2011. Evolution of microRNA diversity and regulation in animals. Nat. Rev. Genet. 12(12):846–60 8. Bergthorsson U, Adams KL, Thomason B, Palmer JD. 2003. Widespread horizontal transfer of mitochondrial genes in flowering plants. Nature 424(6945):197–201 9. Bergthorsson U, Andersson DI, Roth JR. 2007. Ohno’s dilemma: evolution of new genes under contin- uous selection. Proc. Natl. Acad. Sci. USA 104(43):17004–9 10. Betran´ E, Long M. 2003. Dntf-2r, a young Drosophila retroposed gene with specific male expression under positive Darwinian selection. Genetics 164(3):977–88 11. Betran´ E, Thornton K, Long M. 2002. Retroposed new genes out of the X in Drosophila. Genome Res. 12:1854–59 12. Bohne¨ A, Brunet F, Galiana-Arnoux D, Schultheis C, Volff J-N. 2008. Transposable elements as drivers of genomic and biological diversity in vertebrates. Chromosome Res. 16(1):203–15 13. Bowers JE, Chapman BA, Rong J. 2003. Unravelling angiosperm genome evolution by phylogenetic analysis of chromosomal duplication events. Nature 422:433–38 14. Brosius J. 1991. Retroposons: seeds of evolution. Science 251(4995):753 15. Brosius J. 2003. The contribution of RNAs and retroposition to evolutionary novelties. Genetica 118(2– 3):99–116 16. Brunet FG, Crollius HR, Paris M, Aury J-M, Gibert P, et al. 2006. Gene loss and evolutionary rates following whole-genome duplication in teleost fishes. Mol. Biol. Evol. 23(9):1808–16 Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. 17. Cai J, Zhao R, Jiang H, Wang W. 2008. De novo origination of a new protein-coding gene in Saccha- romyces cerevisiae. Genetics 179(1):487–96 18. Capra JA, Pollard KS, Singh M. 2010. Novel genes exhibit distinct patterns of function acquisition and network integration. Genome Biol. 11(12):R127 19. Cardoso-Moreira M, Emerson JJ, Clark AG, Long M. 2011. Drosophila duplication hotspots are associated with late-replicating regions of the genome. PLoS Genet. 7(11):e1002340 20. Cardoso-Moreira M, Long M. 2010. Mutational bias shaping ﬂy copy number variation: implications for genome evolution. Trends Genet. 26(6):243–47 21. Carvunis A-R, Rolland T, Wapinski I, Calderwood MA, Yildirim MA, et al. 2012. Proto-genes and de novo gene birth. Nature 487(7407):370–74 22. Charlesworth B, Coyne JA, Barton NH. 1987. The relative rates of evolution of sex chromosomes and autosomes. Am. Nat. 130(1):113–46 23. Charrier C, Joshi K, Coutinho-Budd J, Kim J-E, Lambert N, et al. 2012. Inhibition of SRGAP2 function by its human-speciﬁc paralogs induces neoteny during spine maturation. Cell 149(4):923–35

www.annualreviews.org • New Gene Evolution 327 GE47CH14-Long ARI 29 October 2013 14:13

24. Chen L, DeVries AL, Cheng CH. 1997. Evolution of antifreeze glycoprotein gene from a trypsinogen gene in Antarctic notothenioid fish. Proc. Natl. Acad. Sci. USA 94(8):3811–16 25. Chen M, Zou M, Fu B, Li X, Vibranovski MD, et al. 2011. Evolutionary patterns of RNA-based duplication in non-mammalian chordates. PLoS ONE 6(7):e21466 26. Chen S-T, Cheng H-C, Barbash DA, Yang H-P. 2007. Evolution of hydra, a recently evolved testis- expressed gene with nine alternative first exons in Drosophila melanogaster. PLoS Genet. 3(7):e107 27. Chen S, Krinsky BH, Long M. 2013. New genes as drivers of phenotypic evolution. Nat. Rev. Genet. 14:645–60 28. Chen S, Ni X, Krinsky BH, Zhang YE, Vibranovski MD, et al. 2012. Reshaping of global gene expression networks and sex-biased gene expression by integration of a young gene. EMBO J. 31(12):2798–809 29. Chen S, Spletter M, Ni X, White KP, Luo L, Long M. 2012. Frequent recent origination of brain genes shaped the evolution of foraging behavior in Drosophila. Cell Rep. 1(2):118–32 30. Chen S, Zhang YE, Long M. 2010. New genes in Drosophila quickly become essential. Science 330(6011):1682–85 31. Cheng C-HC, Chen L. 1999. Evolution of an antifreeze glycoprotein. Nature 401:443–44 32. Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, et al. 2007. Evolution of genes and genomes on the Drosophila phylogeny. Nature 450(7167):203–18 33. Conant GC, Wolfe KH. 2008. Turning a hobby into a job: how duplicated genes find new functions. Nat. Rev. Genet. 9(12):938–50 34. Dai H, Chen Y, Chen S, Mao Q, Kennedy D, et al. 2008. The evolution of courtship behaviors through the origination of a new gene in Drosophila. Proc. Natl. Acad. Sci. USA 105(21):7478–83 34a. Dai H, Yoshimatsu TF, Long M. 2007. Retrogene movement within- and between-chromosomes in the evolution of Drosophila genomes. Gene 385:96–102 35. Demuth JP, De Bie T, Stajich JE, Cristianini N, Hahn MW. 2006. The evolution of mammalian gene families. PLoS ONE 1(1):e85 36. Deng C, Cheng C-HC, Ye H, He X, Chen L. 2010. Evolution of an antifreeze protein by neofunctionalization under escape from adaptive conflict. Proc. Natl. Acad. Sci. USA 107(50):21593–98 37. Dennis MY, Nuttle X, Sudmant PH, Antonacci F, Graves TA, et al. 2012. Evolution of human-specific neural SRGAP2 genes by incomplete segmental duplication. Cell 149(4):912–22 38. Dıaz-Castillo´ C, Ranz JM. 2012. Nuclear chromosome dynamics in the Drosophila male germ line contribute to the nonrandom genomic distribution of retrogenes. Mol. Biol. Evol. 29(9):2105–8 39. Ding Y, Zhao L, Yang S, Jiang Y, Chen Y, et al. 2010. A young Drosophila duplicate gene plays essential roles in spermatogenesis by regulating several y-linked male fertility genes. PLoS Genet. 6(12):e1001255 40. Dopman EB, Hartl DL. 2007. A portrait of copy-number polymorphism in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 104(50):19920–25 41. Duret L, Chureau C, Samain S, Weissenbach J, Avner P. 2006. The Xist RNA gene evolved in eutherians by pseudogenization of a protein-coding gene. Science 312(5780):1653–55 42. Emerson JJ, Cardoso-Moreira M, Borevitz JO, Long M. 2008. Natural selection shapes genome-wide Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. patterns of copy-number polymorphism in Drosophila melanogaster. Science 320(5883):1629–31 43. Emerson JJ, Kaessmann H, Betran´ E, Long M. 2004. Extensive gene trafﬁc on the mammalian X chromosome. Science 303(5657):537–40 44. Fan C, Chen Y, Long M. 2008. Recurrent tandem gene duplication gave rise to functionally divergent genes in Drosophila. Mol. Biol. Evol. 25(7):1451–58 45. Fan C, Vibranovski MD, Chen Y, Long M. 2007. A microarray based genomic hybridization method for identiﬁcation of new genes in plants: case analyses of Arabidopsis and Oryza. J. Integr. Plant Biol. 49(6):915–26 46. Feschotte C. 2008. Transposable elements and the evolution of regulatory networks. Nat. Rev. Genet. 9(5):397–405 47. Feuk L, Carson AR, Scherer SW. 2006. Structural variation in the human genome. Nat. Rev. Genet. 7(2):85–97 48. Francino MP. 2005. An adaptive radiation model for the origin of new gene functions. Nat. Genet. 37(6):573–77

328 Long et al. GE47CH14-Long ARI 29 October 2013 14:13

49. Fu B, Chen M, Zou M, Long M, He S. 2010. The rapid generation of chimerical genes expanding protein diversity in zebraﬁsh. BMC Genomics 11(1):657 50. Gallach M, Chandrasekaran C, Betran´ E. 2010. Analyses of nuclearly encoded mitochondrial genes suggest gene duplication as a mechanism for resolving intralocus sexually antagonistic conﬂict in Drosophila. Genome Biol. Evol. 2:835–50 51. Gardiner A, Barker D, Butlin RK, Jordan WC, Ritchie MG. 2008. Evolution of a complex locus: exon gain, loss and divergence at the Gr39a locus in Drosophila. PLoS ONE 3(1):e1513 52. Gilbert W. 1978. Why genes in pieces? Nature 271:501 53. Gillespie J. 1991. The Causes of Molecular Evolution. New York: Oxford Univ. Press 54. Graubert TA, Cahan P, Edwin D, Selzer RR, Richmond TA, et al. 2007. A high-resolution map of segmental DNA copy number variation in the mouse genome. PLoS Genet. 3(1):e3 55. Haldane J. 1932. The time of action of genes, and its bearing on some evolutionary problems. Am. Nat. 66(702):5–24 56. Hall C, Brachat S, Dietrich FS. 2005. Contribution of horizontal gene transfer to the evolution of Saccharomyces cerevisiae. Eukaryot. Cell 4(6):1102–15 57. Harr B, Turner LM. 2010. Genome-wide analysis of alternative splicing evolution among Mus subspecies. Mol. Ecol. 19:228–39 58. Heinen TJAJ, Staubach F, Haming¨ D, Tautz D. 2009. Emergence of a new gene from an intergenic region. Curr. Biol. 19(18):1527–31 59. Hense W, Baines JF, Parsch J. 2007. X chromosome inactivation during Drosophila spermatogenesis. PLoS Biol. 5(10):e273 60. Hudson RR, Kreitman M, Aguade M. 1987. A test of neutral molecular evolution based on nucleotide data. Genetics 116:153–59 61. Innan H, Kondrashov F. 2010. The evolution of gene duplications: classifying and distinguishing between models. Nat. Rev. Genet. 11(2):97–108 62. Int. Chicken Genome Seq. Consort. 2004. Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 432(7018):695–716 63. Jiang N, Bao Z, Zhang X, Eddy SR, Wessler SR. 2004. Pack-MULE transposable elements mediate gene evolution in plants. Nature 431:569–73 64. Jones CD, Begun DJ. 2005. Parallel evolution of chimeric fusion genes. Proc. Natl. Acad. Sci. USA 102(32):11373–78 65. Kaessmann H, Vinckenbosch N, Long M. 2009. RNA-based gene duplication: mechanistic and evolutionary insights. Nat. Rev. Genet. 10(1):19–31 66. Katju V, Lynch M. 2003. The structure and early evolution of recently arisen gene duplicates in the Caenorhabditis elegans genome. Genetics 165(4):1793–803 67. Katju V, Lynch M. 2006. On the formation of novel genes by duplication in the Caenorhabditis elegans genome. Mol. Biol. Evol. 23(5):1056–67 68. Kellis M, Birren BW, Lander ES. 2004. Proof and evolutionary analysis of ancient genome duplication

Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org in the yeast Saccharomyces cerevisiae. Nature 428(6983):617–24

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. 69. Keren H, Lev-Maor G, Ast G. 2010. Alternative splicing and evolution: diversification, exon definition and function. Nat. Rev. Genet. 11(5):345–55 70. Khil PP, Smirnova NA, Romanienko PJ, Camerini-Otero RD. 2004. The mouse X chromosome is enriched for sex-biased genes not subject to selection by meiotic sex chromosome inactivation. Nat. Genet. 36(6):642–46 71. Knowles DG, McLysaght A. 2009. Recent de novo origin of human protein-coding genes. Genome Res. 19(10):1752–59 72. Konikoff CE, Wisotzkey RG, Stinchfield MJ, Newfeld SJ. 2010. Distinct molecular evolutionary mechanisms underlie the functional diversification of the Wnt and TGF β signaling pathways. J. Mol. Evol. 70:303–12 73. Koonin EV, Makarova KS, Aravind L. 2001. Horizontal gene transfer in prokaryotes: quantification and classification. Annu. Rev. Microbiol. 55:709–42 74. Langley CH, Stevens K, Cardeno C, Lee Y, Schrider DR, et al. 2012. Genomic variation in natural populations of Drosophila melanogaster. Genetics 192(2):533–98

www.annualreviews.org • New Gene Evolution 329 GE47CH14-Long ARI 29 October 2013 14:13

75. Levine MT, Jones CD, Kern AD, Lindfors HA, Begun DJ. 2006. Novel genes derived from noncoding DNA in Drosophila melanogaster are frequently X-linked and exhibit testis-biased expression. Proc. Natl. Acad. Sci. USA 103(26):9935–39 76. Lewin B, Krebs JE, Goldstein ES, Kilpatrick ST. 2011. Lewin’s Genes X. Sudbury, MA: Jones and Bartlett Publ. 77. Li D, Dong Y, Jiang Y, Jiang H, Cai J, Wang W. 2010. A de novo originated gene depresses budding yeast mating pathway and is repressed by the protein encoded by its antisense strand. Cell Res. 20(4):408–20 78. Li WH, Gojobori T. 1983. Rapid evolution of goat and sheep globin genes following gene duplication. Mol. Biol. Evol. 1(1):94–108 79. Li W-H. 1997. Molecular Evolution. Sunderland, MA: Sinauer Assoc. 80. Li Z, Liu M, Zhang L, Zhang W, Gao G, et al. 2009. Detection of intergenic non-coding RNAs expressed in the main developmental stages in Drosophila melanogaster. Nucleic Acids Res. 37(13):4308–14 81. Lipinski KJ, Farslow JC, Fitzpatrick KA, Lynch M, Katju V, Bergthorsson U. 2011. High spontaneous rate of gene duplication in Caenorhabditis elegans. Curr. Biol. 21(4):306–10 82. Llopart A, Comeron JM, Brunet G, Lachaise D, Long M. 2002. Intron presence: absence polymorphism in Drosophila. Proc. Natl. Acad. Sci. USA 99(12):8121–26 83. Long M. 1992. The origin and evolutionary mechanisms of new genes. PhD Diss. Univ. Calif., Davis. 139 pp. 84. Long M, Betran´ E, Thornton K, Wang W. 2003. The origin of new genes: glimpses from the young and old. Nat. Rev. Genet. 4(11):865–75 85. Long M, Langley CH. 1993. Natural selection and the origin of jingwei, a chimeric processed functional gene in Drosophila. Science 260(5104):91–95 86. Long M, Rosenberg C, Gilbert W. 1995. Intron phase correlations and the evolution of the intron/exon structure of genes. Proc. Natl. Acad. Sci. USA 92(26):12495–99 87. Long M, Vibranovski MD, Zhang YE. 2012. Evolutionary interactions between sex chromosomes and autosomes. In Rapidly Evolving Genes and Genetic Systems, ed. R Singh, J Xu, R Kulathinal, pp. 101–14. Oxford: Oxford Univ. Press 88. Lorenc A, Makałowski W. 2003. Transposable elements and vertebrate protein diversity. Genetica 118(2– 3):183–91 89. Lu J, Fu Y, Kumar S, Shen Y, Zeng K, et al. 2008. Adaptive evolution of newly emerged micro-RNA genes in Drosophila. Mol. Biol. Evol. 25(5):929–38 90. Lu J, Shen Y, Wu Q, Kumar S, He B, et al. 2008. The birth and death of microRNA genes in Drosophila. Nat. Genet. 40(3):351–55 91. Makalowski W. 1995. SINEs as a genomic scrap yard: an essay on genomic evolution. In The Impact of Short Interspersed Elements (SINEs) on the Host Genome, ed. R Maraia, pp. 81–104. Austin, TX: R.G. Landes 92. Marques AC, Dupanloup I, Vinckenbosch N, Reymond A, Kaessmann H. 2005. Emergence of young human genes after a burst of retroposition in primates. PLoS Biol. 3(11):e357 93. Marques AC, Tan J, Lee S, Kong L, Heger A, Ponting CP. 2012. Evidence for conserved post-

Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org transcriptional roles of unitary pseudogenes and for frequent bifunctionality of mRNAs. Genome Biol.

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. 13(11):R102 94. Marques AC, Tan J, Ponting CP. 2011. Wrangling for microRNAs provokes much crosstalk. Genome Biol. 12(11):132 95. Matsuno M, Compagnon V, Schoch GA, Schmitt M, Debayle D, et al. 2009. Evolution of a novel phenolic pathway for pollen development. Science 325(5948):1688–92 96. McCarrey JR, Riggs AD. 1986. Determinator-inhibitor pairs as a mechanism for threshold setting in development: a possible function for pseudogenes. Proc. Natl. Acad. Sci. USA 83(3):679–83 97. McDonald JH, Kreitman M. 1991. Adaptive protein evolution at the Adh locus in Drosophila. Nature 351:652–54 98. McLysaght A, Hokamp K, Wolfe KH. 2002. Extensive genomic duplication during early chordate evolution. Nat. Genet. 31(2):200–4 99. Meiklejohn CD, Landeen EL, Cook JM, Kingan SB, Presgraves DC. 2011. Sex chromosome-speciﬁc regulation in the Drosophila male germline but little evidence for chromosomal dosage compensation or meiotic inactivation. PLoS Biol. 9(8):e1001126

330 Long et al. GE47CH14-Long ARI 29 October 2013 14:13

100. Meisel RP, Han MV, Hahn MW. 2009. A complex suite of forces drives gene traffic from Drosophila X chromosomes. Genome Biol. Evol. 1:176–88 101. Mills RE, Walter K, Stewart C, Handsaker RE, Chen K, et al. 2011. Mapping copy number variation by population-scale genome sequencing. Nature 470(7332):59–65 102. Moran NA, Jarvik T. 2010. Lateral transfer of genes from fungi underlies carotenoid production in aphids. Science 328(5978):624–27 103. Muller HJ. 1936. Bar duplication. Science 83(2161):528–30 104. Murphy DN, McLysaght A. 2012. De novo origin of protein-coding genes in murine rodents. PloS ONE 7(11):e48650 105. Nasvall¨ J, Sun L, Roth JR, Andersson DI. 2012. Real-time evolution of new genes by innovation, amplification, and divergence. Science 338(6105):384–87 106. Nekrutenko A, Li WH. 2001. Transposable elements are found in a large number of human protein- coding genes. Trends Genet. 17(11):619–21 107. Ni X, Zhang YE, Negre` N, Chen S, Long M, White KP. 2012. Adaptive evolution and the birth of CTCF binding sites in the Drosophila genome. PLoS Biol. 10(11):e1001420 108. Nozawa M, Aotsuka T, Tamura K. 2005. A novel chimeric gene, siren, with retroposed promoter sequence in the Drosophila bipectinata complex. Genetics 171(4):1719–27 109. Nozawa M, Miura S, Nei M. 2010. Origins and evolution of microRNA genes in Drosophila species. Genome Biol. Evol. 2:180–89 110. Nurminsky DI, Nurminskaya MV, De Aguiar D, Hartl DL. 1998. Selective sweep of a newly evolved sperm-specific gene in Drosophila. Nature 396:572–75 111. Ochman H, Lawrence JG, Groisman EA. 2000. Lateral gene transfer and the nature of bacterial innovation. Nature 405(6784):299–304 112. Ohno S. 1970. Evolution by Gene Duplication. New York: Springer-Verlag. 160 pp. 113. Okamura K, Feuk L, Marques-Bonet` T, Navarro A, Scherer SW. 2006. Frequent appearance of novel protein-coding sequences by frameshift translation. Genomics 88(6):690–97 114. Parisi M, Nuttall R, Naiman D, Bouffard G, Malley J, et al. 2003. Paucity of genes on the Drosophila X chromosome showing male-biased expression. Science 299(5607):697–700 115. Park J, Semyonov J, Chang CL, Yi W, Warren W, et al. 2008. Origin of INSL3-mediated testicular descent in therian mammals. Genome Res. 18:974–85 116. Piriyapongsa J, Jordan IK. 2008. Dual coding of siRNAs and miRNAs by plant transposable elements. Bioinformatics 14:814–21 117. Ranz JM, Castillo-Davis CI, Meiklejohn CD, Hartl DL. 2003. Sex-dependent gene expression and evolution of the Drosophila transcriptome. Science 300(5626):1742–45 118. Rogers RL, Bedford T, Hartl DL. 2009. Formation and longevity of chimeric and duplicate genes in Drosophila melanogaster. Genetics 181(1):313–22 119. Rogers RL, Hartl DL. 2012. Chimeric genes as a source of rapid evolution in Drosophila melanogaster. Mol. Biol. Evol. 29(2):517–29

Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org 120. Rollmann SM, Wang P, Date P, West SA, Mackay TF, Anholt RR. 2010. Odorant receptor polymor-

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. phisms and natural variation behavior in Drosophila melanogaster. Genetics 186:687–97 121. Ross BD, Rosin L, Thomae AW, Hiatt MA, Vermaak D, et al. 2013. Stepwise evolution of essential centromere function in a Drosophila neogene. Science 340(6137):1211–14 122. Sabath N, Wagner A, Karlin D. 2012. Evolution of viral proteins originated de novo by overprinting. Mol. Biol. Evol. 29(12):3767–80 123. Schrider DR, Navarro FCP, Galante PAF, Parmigiani RB, Camargo AA, et al. 2013. Gene copy-number polymorphism caused by retrotransposition in humans. PLoS Genet. 9(1):e1003242 124. Schrider DR, Stevens K, Cardeno˜ CM, Langley CH, Hahn MW. 2011. Genome-wide analysis of retrogene polymorphisms in Drosophila melanogaster. Genome Res. 21(12):2087–95 125. Sebat J, Lakshmi B, Troge J, Alexander J, Young J, et al. 2004. Large-scale copy number polymorphism in the human genome. Science 305(5683):525–28 126. Semon´ M, Wolfe KH. 2007. Consequences of genome duplication. Curr. Opin. Genet. Dev. 17(6):505–12 127. Shih H-J, Jones CD. 2008. Patterns of amino acid evolution in the Drosophila ananassae chimeric gene, siren, parallel those of other Adh-derived chimeras. Genetics 180(2):1261–63

www.annualreviews.org • New Gene Evolution 331 GE47CH14-Long ARI 29 October 2013 14:13

128. Sturgill D, Zhang Y, Parisi M, Oliver B. 2007. Demasculinization of X chromosomes in the Drosophila genus. Nature 450(7167):238–41 129. Sturtevant AH. 1925. The effects of unequal crossing over at the bar locus in Drosophila. Genetics 10:117– 47 130. Sudhof TC, Goldstein JL, Brown MS, Russell DW. 1985. The LDL receptor gene: a mosaic of exons shared with different proteins. Science 228(4701):815–22 131. Tao Y, Araripe L, Kingan SB, Ke Y, Xiao H, Hartl DL. 2007. A sex-ratio meiotic drive system in Drosophila simulans. II: An X-linked distorter. PLoS Biol. 5(11):e293 132. Tao Y, Masly JP, Araripe L, Ke Y, Hartl DL. 2007. A sex-ratio meiotic drive system in Drosophila simulans. I: An autosomal suppressor. PLoS Biol. 5(11):e292 133. Thomson TM, Lozano JJ, Loukili N, Carrio R, Serra F, et al. 2000. Fusion of the human gene for the polyubiquitination coeffector UEV1 with Kua, a newly identified gene. Genome Res. 10(11):1743–56 134. Thornton KR. 2003. Gene conversion and natural selection at duplicate loci in Drosophila melanogaster. PhD Diss. Univ. Chicago. 181 pp. 135. Thornton KR. 2007. The neutral coalescent process for recent gene duplications and copy-number variants. Genetics 177(2):987–1000 136. Tiedge H, Chen W, Brosius J. 1993. Primary structure, neural-specific expression, and dendritic location of human BC200 RNA. J. Neurosci. 13:2382–90 137. Toll-Riera M, Bosch N, Bellora N, Castelo R, Armengol L, et al. 2009. Origin of primate orphan genes: a comparative genomics approach. Mol. Biol. Evol. 26(3):603–12 138. Toups MA, Hahn MW. 2010. Retrogenes reveal the direction of sex-chromosome evolution in mosquitoes. Genetics 186(2):763–66 139. Vibranovski MD, Lopes HF, Karr TL, Long M. 2009. Stage-specific expression profiling of Drosophila spermatogenesis suggests that meiotic sex chromosome inactivation drives genomic relocation of testis- expressed genes. PLoS Genet. 5(11):e1000731 140. Vibranovski MD, Zhang YE, Kemkemer C, Lopes HF, Karr TL, Long M. 2012. Re-analysis of the larval testis data on meiotic sex chromosome inactivation revealed evidence for tissue-specific gene expression related to the Drosophila X chromosome. BMC Biol. 10(1):49; author reply 50 141. Vibranovski MD, Zhang YE, Kemkemer C, VanKuren NW, Lopes HF, et al. 2012. Segmental dataset and whole body expression data do not support the hypothesis that non-random movement is an intrinsic property of Drosophila retrogenes. BMC Evol. Biol. 12:169 142. Vibranovski MD, Zhang Y, Long M. 2009. General gene movement off the X chromosome in the Drosophila genus. Genome Res. 19(5):897–903 143. Vicoso B, Charlesworth B. 2009. The deficit of male-biased genes on the D. melanogaster X Chromosome is expression-dependent: a consequence of dosage compensation? J. Mol. Evol. 68(5):576–83 144. Vinckenbosch N, Dupanloup I, Kaessmann H. 2006. Evolutionary fate of retroposed gene copies in the human genome. Proc. Natl. Acad. Sci. USA 103(9):3220–25 145. Walsh B. 2003. Population-genetic models of the fates of duplicate genes. Genetica 118(2–3):279–94 Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. 146. Walsh JB. 1995. How often do duplicated genes evolve new functions? Genetics 139(1):421–28 147. Wang J, Long M, Vibranovski MD. 2012. Retrogenes moved out of the Z chromosome in the silkworm. J. Mol. Evol. 74(3–4):113–26 148. Wang J, Mager J, Chen Y, Schneider E, Cross JC, et al. 2001. Imprinted X inactivation maintained by a mouse Polycomb group gene. Nat. Genet. 28(4):371–75 149. Wang W, Yu H, Long M. 2004. Duplication-degeneration as a mechanism of gene ﬁssion and the origin of new genes in Drosophila species. Nat. Genet. 36(5):523–27 150. Wang W, Zhang J, Alvarez C, Llopart A, Long M. 2000. The origin of the jingwei gene and the complex modular structure of its parental gene, yellow emperor, in Drosophila melanogaster. Mol. Biol. Evol. 17(9):1294–301 151. Wang W, Zheng H, Fan C, Li J, Shi J, et al. 2006. High rate of chimeric gene origination by retroposition in plant genomes. Plant Cell 18:1791–802 152. Weng J-K, Li Y, Mo H, Chapple C. 2012. Assembly of an evolutionarily new pathway for α-pyrone biosynthesis in Arabidopsis. Science 337(6097):960–64

332 Long et al. GE47CH14-Long ARI 29 October 2013 14:13

153. Wu D-D, Irwin DM, Zhang Y-P. 2011. De novo origin of human protein-coding genes. PLoS Genet. 7(11):e1002379 154. Xiao W, Liu H, Li Y, Li X, Xu C, et al. 2009. A rice gene of de novo origin negatively regulates pathogen-induced defense response. PLoS ONE 4(2):e4603 155. Xie C, Zhang YE, Chen J-Y, Liu C-J, Zhou W-Z, et al. 2012. Hominoid-specific de novo protein-coding genes originating from long non-coding RNAs. PLoS Genet. 8(9):e1002942 156. Xu G, Guo C, Shan H, Kong H. 2012. Divergence of duplicate genes in exon-intron structure. Proc. Natl. Acad. Sci. USA 109(4):1187–92 157. Xue S, Jones MD, Lu Q, Middeldorp JM, Griffin BE. 2003. Genetic diversity: frameshift mechanisms alter coding of a gene (Epstein-Barr virus LF3 gene) that contains multiple 102-base-pair direct sequence repeats. Mol. Cell. Biol. 23(6):2192–201 158. Yang S, Arguello JR, Li X, Ding Y, Zhou Q, et al. 2008. Repetitive element-mediated recombination as a mechanism for new gene origination in Drosophila. PLoS Genet. 4(1):e3 159. Yang Z, Huang J. 2011. De novo origin of new genes with introns in Plasmodium vivax. FEBS Lett. 585(4):641–44 160. Yeh S-D, Do T, Chan C, Cordova A, Carranza F, et al. 2012. Functional evidence that a recently evolved Drosophila sperm-specific gene boosts sperm competition. Proc. Natl. Acad. Sci. USA 109(6):2043–48 161. Yoshida S, Maruyama S, Nozaki H, Shirasu K. 2010. Horizontal gene transfer by the parasitic plant Striga hermonthica. Science 328:1128 162. Zhang J, Dean AM, Brunet F, Long M. 2004. Evolving protein functional diversity in new genes of Drosophila. Proc. Natl. Acad. Sci. USA 101(46):16246–50 163. Zhang PG, Huang SZ, Pin A-L, Adams KL. 2010. Extensive divergence in alternative splicing patterns after gene and genome duplication during the evolutionary history of Arabidopsis. Mol. Biol. Evol. 27(7):1686–97 164. Zhang Y, Lu S, Zhao S, Zheng X, Long M, Wei L. 2009. Positive selection for the male functionality of a co-retroposed gene in the hominoids. BMC Evol. Biol. 9:252 165. Zhang Y, Wu Y, Liu Y, Han B. 2005. Computational identification of 69 retroposons in Arabidopsis. Plant Physiol. 138:935–48 166. Zhang YE, Landback P, Vibranovski MD, Long M. 2011. Accelerated recruitment of new brain development genes into the human genome. PLoS Biol. 9(10):e1001179 167. Zhang YE, Landback P, Vibranovski M, Long M. 2012. New genes expressed in human brains: implications for annotating evolving genomes. BioEssays 34(11):982–91 168. Zhang YE, Vibranovski MD, Krinsky BH, Long M. 2010. Age-dependent chromosomal distribution of male-biased genes in Drosophila. Genome Res. 20(11):1526–33 169. Zhang YE, Vibranovski MD, Landback P, Marais GaB, Long M. 2010. Chromosomal redistribution of male-biased genes in mammalian evolution with two bursts of gene gain on the X chromosome. PLoS Biol. 8(10):e1000494 170. Zhen Y, Aardema ML, Medina EM, Schumer M, Andolfatto P. 2012. Parallel molecular evolution in an Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org herbivore community. Science 337(6102):1634–37 Access provided by Carnegie Mellon University on 08/20/15. For personal use only. 171. Zheng D, Gerstein MB. 2007. The ambiguous boundary between genes and pseudogenes: The dead rise up, or do they? Trends Genet. 23(5):219–24 172. Zhou Q, Zhang G, Zhang Y, Xu S, Zhao R, et al. 2008. On the origin of new genes in Drosophila. Genome Res. 18(9):1446–55 173. Zhou R, Moshgabadi N, Adams KL. 2011. Extensive changes to alternative splicing patterns following allopolyploidy in natural and resynthesized polyploids. Proc. Natl. Acad. Sci. USA 108(38):16122–27 174. Zhu Z, Zhang Y, Long M. 2009. Extensive structural renovation of retrogenes in the evolution of the populus genome. Plant Physiol. 151(4):1943–51

www.annualreviews.org • New Gene Evolution 333 GE47-FrontMatter ARI 2 November 2013 9:9

Annual Review of Contents Genetics

Volume 47, 2013 Causes of Genome Instability Andr´es Aguilera and Tatiana Garc´ıa-Muse ppppppppppppppppppppppppppppppppppppppppppppppppp1 Radiation Effects on Human Heredity Nori Nakamura, Akihiko Suyama, Asao Noda, and Yoshiaki Kodama ppppppppppppppppppp33 Dissecting Social Cell Biology and Tumors Using Drosophila Genetics Jos´e Carlos Pastor-Pareja and Tian Xu ppppppppppppppppppppppppppppppppppppppppppppppppppppp51 Estimation and Partition of Heritability in Human Populations Using Whole-Genome Analysis Methods Anna A.E. Vinkhuyzen, Naomi R. Wray, Jian Yang, Michael E. Goddard, and Peter M. Visscher pppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp75 Detecting Natural Selection in Genomic Data Joseph J. Vitti, Sharon R. Grossman, and Pardis C. Sabeti pppppppppppppppppppppppppppppppp97 Adaptive Translation as a Mechanism of Stress Response and Adaptation Tao Pan ppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp121 Organizing Principles of Mammalian Nonsense-Mediated mRNA Decay Maximilian Wei-Lin Popp and Lynne E. Maquat ppppppppppppppppppppppppppppppppppppppp139 Control of Nuclear Activities by Substrate-Selective and Protein-Group SUMOylation Stefan Jentsch and Ivan Psakhye ppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp167 Genomic Imprinting: Insights From Plants Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org

Access provided by Carnegie Mellon University on 08/20/15. For personal use only. Mary Gehring pppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp187 Regulation of Bacterial Metabolism by Small RNAs Using Diverse Mechanisms Maksym Bobrovskyy and Carin K. Vanderpool ppppppppppppppppppppppppppppppppppppppppppp209 Bacteria and the Aging and Longevity of Caenorhabditis elegans Dennis H. Kim pppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp233 The Genotypic View of Social Interactions in Microbial Communities Sara Mitri and Kevin Richard Foster ppppppppppppppppppppppppppppppppppppppppppppppppppppp247 SIR Proteins and the Assembly of Silent Chromatin in Budding Yeast Stephanie Kueng, Mariano Oppikofer, and Susan M. Gasser pppppppppppppppppppppppppppp275

v GE47-FrontMatter ARI 2 November 2013 9:9

New Gene Evolution: Little Did We Know Manyuan Long, Nicholas W. VanKuren, Sidi Chen, Maria D. Vibranovski ppppppppppp307 RNA Editing in Plants and Its Evolution Mizuki Takenaka, Anja Zehrmann, Daniil Verbitskiy, Barbara H¨artel, and Axel Brennicke pppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp335 Expanding Horizons: Ciliary Proteins Reach Beyond Cilia Shiaulou Yuan and Zhaoxia Sun ppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp353 The Digestive Tract of Drosophila melanogaster Bruno Lemaitre and Irene Miguel-Aliaga ppppppppppppppppppppppppppppppppppppppppppppppppp377 RNase III: Genetics and Function; Structure and Mechanism Donald L. Court, Jianhua Gan, Yu-He Liang, Gary X. Shaw, Joseph E. Tropea, Nina Costantino, David S. Waugh, and Xinhua Ji pppppppppppppppppppppppppppppppppppp405 Modernizing the Nonhomologous End-Joining Repertoire: Alternative and Classical NHEJ Share the Stage Ludovic Deriano and David B. Roth ppppppppppppppppppppppppppppppppppppppppppppppppppppppp433 Enterococcal Sex Pheromones: Signaling, Social Behavior, and Evolution Gary M. Dunny pppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp457 Control of Transcriptional Elongation Hojoong Kwak and John T. Lis ppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp483 The Genomic and Cellular Foundations of Animal Origins Daniel J. Richter and Nicole King ppppppppppppppppppppppppppppppppppppppppppppppppppppppppp509 Genetic Techniques for the Archaea Joel A. Farkas, Jonathan W. Picking, and Thomas J. Santangelo ppppppppppppppppppppppp539 Initation of Meiotic Recombination: How and Where? Conservation and Speciﬁcities Among Eukaryotes Bernard de Massy pppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp563

Annu. Rev. Genet. 2013.47:307-333. Downloaded from www.annualreviews.org Biology and Genetics of Prions Causing Neurodegeneration Access provided by Carnegie Mellon University on 08/20/15. For personal use only. Stanley B. Prusiner ppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp601 + Bacterial Mg2 Homeostasis, Transport, and Virulence Eduardo A. Groisman, Kerry Hollands, Michelle A. Kriner, Eun-Jin Lee, Sun-Yang Park, and Mauricio H. Pontes ppppppppppppppppppppppppppppppppppppppppppppppp625

Errata An online log of corrections to Annual Review of Genetics articles may be found at http://genet.annualreviews.org/errata.shtml

vi Contents