DOCSLIB.ORG

A Functional Characterisation of the Pcsk6 Locus Associated with Handedness

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Functional Characterisation of the Pcsk6 Locus Associated with Handedness A FUNCTIONAL CHARACTERISATION OF THE PCSK6 LOCUS ASSOCIATED WITH HANDEDNESS Robert Shore A Thesis Submitted for the Degree of PhD at the University of St Andrews 2016 Full metadata for this thesis is available in St Andrews Research Repository at: http://research-repository.st-andrews.ac.uk/ Please use this identifier to cite or link to this thesis: http://hdl.handle.net/10023/15719 This item is protected by original copyright This item is licensed under a Creative Commons Licence http://creativecommons.org/licenses/by-nc-nd/4.0/ A functional characterisation of the PCSK6 locus associated with handedness Robert Shore This thesis is submitted in partial fulfilment for the degree of Doctor of Philosophy at the University of St Andrews Date of Submission: December 1 2015 1. Candidate’s declarations: I Robert Shore hereby certify that this thesis, which is approximately 40,000 words in length, has been written by me, and that it is the record of work carried out by me, or principally by myself in collaboration with others as acknowledged, and that it has not been submitted in any previous application for a higher degree. I was admitted as a research student in August 2012 and as a candidate for the degree of PhD in August 2012; the higher study for which this is a record was carried out in the University of St Andrews between 2012 and 2015. 2. Supervisor’s declaration: I hereby certify that the candidate has fulfilled the conditions of the Resolution and Regulations appropriate for the degree of PhD in the University of St Andrews and that the candidate is qualified to submit this thesis in application for that degree. Date …… signature of supervisor ……… 3. Permission for publication: (to be signed by both candidate and supervisor) In submitting this thesis to the University of St Andrews I understand that I am giving permission for it to be made available for use in accordance with the regulations of the University Library for the time being in force, subject to any copyright vested in the work not being affected thereby. I also understand that the title and the abstract will be published, and that a copy of the work may be made and supplied to any bona fide library or research worker, that my thesis will be electronically accessible for personal or research use unless exempt by award of an embargo as requested below, and that the library has the right to migrate my thesis into new electronic forms as required to ensure continued access to the thesis. I have obtained any third-party copyright permissions that may be required in order to allow such access and migration, or have requested the appropriate embargo below. The following is an agreed request by candidate and supervisor regarding the publication of this thesis: PRINTED COPY No embargo on print copy ELECTRONIC COPY Embargo on all or part of electronic copy for a period of 2 years (maximum five) on the following ground(s): Publication would preclude future publication Date …… signature of candidate …… signature of supervisor ……… Please note initial embargos can be requested for a maximum of five years. An embargo on a thesis submitted to the Faculty of Science or Medicine is rarely granted for more than two years in the first instance, without good justification. The Library will not lift an embargo before confirming with the student and supervisor that they do not intend to request a continuation. In the absence of an agreed response from both student and supervisor, the Head of School will be consulted. Please note that the total period of an embargo, including any continuation, is not expected to exceed ten years. Where part of a thesis is to be embargoed, please specify the part and the reason. ii Dedicated to the memory of my father, Joseph Shore (1949-2013) Ar dheis Dé go raibh a anam iii Abstract Humans display a 90% population level bias towards right-handedness, implying the vast majority of people have a left-hemisphere dominant for motor control. Although handedness presents a weak, but very consistent heritability across the literature (estimated to be approximately 25%), to date few genetic loci associated with this complex trait have been identified and replicated in subsequent studies. One such gene which has been found to be associated with handedness and subsequently replicated is PCSK6, most recently through a quantitative GWAS (P < 0.5*10-8, Brandler et al. (2013)). Interestingly, PCSK6 is known to activate Nodal, a morphogen involved in a highly conserved bilaterian pathway known to regulate left-right body axis determination. Here I present the first molecular characterisation of a handedness-associated region by conducting a detailed functional analysis of the PCSK6 locus, combining genetic analysis, in silico prediction and molecular assays to investigate how common genetic variants influence handedness-related phenotypes. Specifically, I defined the associated locus to be 12.7 kb in size, spanning a predicted 1.8 kb bidirectional promoter which controls the expression of both an antisense long non-coding RNA (lncRNA), and a novel short PCSK6 isoform. A series of luciferase-expressing constructs were generated to characterise the promoter, identifying a minimal sequence capable of driving transcription in a sense strand direction. I have demonstrated experimentally that one of the top associated markers in previous GWA studies, rs11855145, directly creates/disrupts a suspected transcription factor bind site in the vicinity of this bidirectional promoter. Further functional studies of the genetic variation within PCSK6 may help explain the molecular regulatory mechanisms affecting gene expression. This project provides a model for assays to study other GWAS-nominated candidate genes, and in particular for establishing the role of noncoding variants. The findings from this study support the role of common variants in influencing complex phenotypes, such as handedness. Thesis word count: 40,000 words iv Acknowledgements I would like to thank my supervisor Dr Silvia Paracchini for giving me not only the opportunity to come to St Andrews and complete a PhD in a topic I found enjoyable and intriguing in equal measure, but also for the advice and support you provided and the independence you allowed when required. For that I will always be grateful. I am indebted to my thesis committee; Professor Lindsey Kent and Professor Terry Smith who helped with their encouragement, ideas and patience; I am in no doubt how compromised my endeavours would have been without your help. A sincere appreciation also goes to Dr Catherine Botting for her mass spectrometry services, Dr Kerry Pettigrew for her toils in helping define the clinical cohorts and my internal and external examiners Dr Matt Holden and Dr Nick Bray for giving up so much of their time to improve this thesis. Finally, I would like to thank my parents, my family and my friends Liam Scally and Aleksandra Sobota for their infuriatingly persistent refusal to ever let me give up. v Table of Contents Abstract iv Acknowledgements v Table of Contents vi List of Figures xi List of Tables xiv Abbreviations xvi 1 Introduction 1 1.1 Handedness .............................................................................................................. 1 1.1.1 What is handedness? ...................................................................................... 1 1.1.2 Limb preference in the Animal Kingdom ....................................................... 2 1.1.3 Handedness in non-human primates ............................................................... 5 1.1.4 Right-hand dominance in the hominin lineage ............................................... 6 1.1.5 How did handedness evolve? ......................................................................... 7 1.1.6 Handedness and Language ............................................................................. 8 1.1.7 Why study handedness? ............................................................................... 10 1.1.8 The development of handedness .................................................................. 12 1.1.9 Genetic models of handedness ..................................................................... 13 1.1.10 Previous studies and candidate genes ........................................................... 14 1.2 PCSK6 ................................................................................................................... 22 1.2.1 The PCSK6 gene ......................................................................................... 22 1.2.2 PCSK6 role in complex traits and disease .................................................... 23 1.2.3 Nodal signalling pathway and cilia .............................................................. 24 1.2.4 RD candidate genes and cilia ....................................................................... 27 1.2.5 Role of regulatory elements during neuronal development ........................... 27 1.2.5.1 Non-coding RNA 28 vi 1.2.5.2 VNTRs 29 1.2.5.3 Bidirectional promoters 31 1.3 Conclusion ............................................................................................................. 32 1.3.1 Overall aim of this thesis ............................................................................. 32 1.3.2 Overview of the study methodology ............................................................ 33 2 ALSPAC Cohort Association Analysis 35 2.1 Abstract ................................................................................................................
Load more

Recommended publications
  • Isolated Levocardia with Situs Inversus Without Cardiac Abnormality in Fetus: Prenatal Diagnosis and Management
    A L J O A T U N R I N R A E L P Case Report P L E R A Perinatal Journal 2020;28(1):48–51 I N N R A U T A L J O ©2020 Perinatal Medicine Foundation Isolated levocardia with situs inversus without cardiac abnormality in fetus: prenatal diagnosis and management Mucize Eriç ÖzdemirİD , Oya Demirci İD Department of Perinatology, Zeynep Kamil Maternity and Children’s Diseases Training and Research Hospital., Health Sciences University, Istanbul, Turkey Abstract Özet: Kardiyak anomalisi olmayan fetüste situs inversuslu izole levokardi: Prenatal tan› ve yönetim Objective: Isolated levocardia is a situs abnormality that the heart is Amaç: ‹zole levokardi, kalbin normal levo pozisyonunda oldu¤u in the normal levo position, but the abdominal viscera are in dextro fakat abdominal iç organlar›n dekstro pozisyonunda oldu¤u bir si- position. Most cases are accompanied by structural heart anomalies. tus anomalisidir. Ço¤u olguda yap›sal kalp anomalileri de efllik et- In this case, we aimed to present a fetus with isolated levocardia with- mektedir. Çal›flmam›zda, kardiyak anomalisi olmayan izole levo- out cardiac abnormality. kardili bir fetüsü sunmay› amaçlad›k. Case: The mother was referred to our clinic with a suspicion of fetal Olgu: Olgumuz, 22. gebelik haftas›nda fetal dekstrokardi flüphe- dextrocardia at 22 weeks of gestation. When detailed examination was siyle klini¤imize sevk edildi. Planlanan detayl› ultrason muayene- planned by ultrasonography isolated levocardia was detected in fetus. sinde, fetüste izole levokardi tespit edildi. Fetal ekokardiyografide There were no cardiac abnormalities in fetal echocardiography. Fetus hiçbir kardiyak anomali görülmedi.
    [Show full text]
  • From the Left to the Right a Tale of Asymmetries, Environments, and Hippocampal Development
    From the left to the right A tale of asymmetries, environments, and hippocampal development by Matthew Case June, 2018 A thesis presented to the Graduate School of the Institute of Science and Technology Austria, Klosterneuburg, Austria in partial fulfilment of the requirements for the degree of Doctor of Philosophy The dissertation of Matthew Case, titled ‘From the left to the right: A tale of asymmetries, environments, and hippocampal development’, is approved by: Supervisor: [Name of Supervisor], IST Austria, Klosterneuburg, Austria Signature: Committee Member: [Name of Committee Member], IST Austria, Klosterneuburg, Austria Signature: Committee Member: [Name of Committee Member], [Institute], [City], [Country] Signature: Exam Chair: [Name of Exam Chair], IST Austria, Klosterneuburg, Austria Signature: © by Matthew Case, June, 2018 All Rights Reserved I hereby declare that this dissertation is my own work and that it does not contain other people’s work without this being so stated; this thesis does not contain my previous work without this being stated, and the bibliography contains all the literature that I used in writing the dissertation. I declare that this is a true copy of my thesis, including any final revisions, as approved by my thesis committee, and that this thesis has not been submitted for a higher degree to any other university or institution. I certify that any republication of materials presented in this thesis has been approved by the relevant publishers and co-authors. Signature: _______________________ [Matthew J Case] June 27, 2018 “Symmetry is what we see at a glance; based on the fact that there is no reason for any difference...” ― Blaise Pascal, Pensées Dedication I'd like to offer a joint dedication for this thesis.
    [Show full text]
  • Asymmetry Inside the Symmetry: Mechanisms and Disorders of Laterality
    Asymmetry Inside The Symmetry: Mechanisms and Disorders Of Laterality Yasemin ALANAY1, Ersin GÜMÜŞ2, Miray SEKKİN2, Sebile GÜLER2, A. Nur ÇAKAR3 Ankara-Turkey Asy mmetry of the left-right (L-R) axis is a feature of vertebrates that is apparent in the viscera and vas- culature. An understanding of L-R patterning in human development is aided by familiarity with key ev ents and important pathways in mammalian embryogenesis.The induction of L-R asymmetry follows the establishment of the anteroposterior (A-P or rostrocaudal) and dorsoventral (D-V) axes and re- quires the pre-existing midline symmetry to be broken before sidedness is induced via a series of complex, coordinated molecular signaling events. In this review, our aim is to describe the molecular background of this embryological process, and giv e brief knowledge concerning its clinical conse- quences. (Gynecol Obstet Reprod Med 2006; 12:000-000) Key Words: Heterotaxy, Laterality, Situs anomalies Many living creatures in nature, from Ascidians to man, T here are also many l ess defin ed asymmetries that hav e exhibit symmetry which can be described as correspondence been the focus of many studies to date. Human hand prefe- in size, shape and relative position of congruent components rence and the functional asymmetry of the brain hemispheres are still attractive research areas, and the basics of genetic about a plane or axis, as a feature of their external body plan. 1 Most animals possess symmetrical body plans such as; sphe- mechanisms are still controversial. Cell mediated immune 2 rical, radial, chiral, bilateral and pseudo-bilateral. In har- hypersensitivity is stronger on the left side of the body and mony with this, possession of a symmetrical body plan is the left side of the scrotum descends lower than the right in 3 one of the conspicuous morphological characteristics of ver- correlation with handedness.
    [Show full text]
  • Identification of Expression Qtls Targeting Candidate Genes For
    ISSN: 2378-3648 Salleh et al. J Genet Genome Res 2018, 5:035 DOI: 10.23937/2378-3648/1410035 Volume 5 | Issue 1 Journal of Open Access Genetics and Genome Research RESEARCH ARTICLE Identification of Expression QTLs Targeting Candidate Genes for Residual Feed Intake in Dairy Cattle Using Systems Genomics Salleh MS1,2, Mazzoni G2, Nielsen MO1, Løvendahl P3 and Kadarmideen HN2,4* 1Department of Veterinary and Animal Sciences, Faculty of Health and Medical Sciences, University of Copenhagen, Denmark Check for 2Department of Bio and Health Informatics, Technical University of Denmark, Lyngby, Denmark updates 3Department of Molecular Biology and Genetics-Center for Quantitative Genetics and Genomics, Aarhus University, AU Foulum, Tjele, Denmark 4Department of Applied Mathematics and Computer Science, Technical University of Denmark, Lyngby, Denmark *Corresponding author: Kadarmideen HN, Department of Applied Mathematics and Computer Science, Technical University of Denmark, DK-2800, Kgs. Lyngby, Denmark, E-mail: [email protected] Abstract body weight gain and net merit). The eQTLs and biological pathways identified in this study improve our understanding Background: Residual feed intake (RFI) is the difference of the complex biological and genetic mechanisms that de- between actual and predicted feed intake and an important termine FE traits in dairy cattle. The identified eQTLs/genet- factor determining feed efficiency (FE). Recently, 170 can- ic variants can potentially be used in new genomic selection didate genes were associated with RFI, but no expression methods that include biological/functional information on quantitative trait loci (eQTL) mapping has hitherto been per- SNPs. formed on FE related genes in dairy cows. In this study, an integrative systems genetics approach was applied to map Keywords eQTLs in Holstein and Jersey cows fed two different diets to eQTL, RNA-seq, Genotype, Data integration, Systems improve identification of candidate genes for FE.
    [Show full text]
  • Imaging Evaluation of the Heterotaxy Syndrome
    Gastroenterology & Hepatology: Open Access Review Article Open Access Imaging evaluation of the heterotaxy syndrome Abstract Volume 10 Issue 2 - 2019 Situs ambiguus, or heterotaxy, is a rare syndrome characterized by an abnormal José Maximiliano Garófano-Jerez,1,2,3 Elena arrangement of the internal organs in the chest and abdomen and is usually associated Benedicto-Hernández,2 Juan de Dios with congenital heart diseases. Despite its variable presentation, heterotaxy syndrome 4 can be classified into heterotaxy with polysplenia or left isomerism, and heterotaxy López-González Gila, Juan de Dios López- 1,2 with asplenia or right isomerism. The different imaging techniques reveal the González Garrido characteristic imaging findings that allow an accurate description of each patient’s 1Departamento de Radiología y Medicina Física, Spain 2 specific anatomy. Evaluation of the position of the following structures relative to Facultad de Medicina, Universidad de Granada, Spain 3 midline is crucial: atria, cardiac apex, venous drainage, aorta, stomach, liver and Servicio de Radiodiagnóstico, Hospital Universitario San Cecilio de Granada, Spain gallbladder, as well as the presence or absence of intestinal malrotation, number of 4Servicio de Nefrología del Hospital Universitario Virgen de las spleens, and presence of tri- or bilobed lungs. Nieves de Granada, Spain We present a case report of a 42-year-old man with dextrocardia underwent laparoscopic cholecystectomy for cholelithiasis. Subsequently, a complete resection Correspondence: Juan de Dios López-González Garrido, of the common bile duct required reconstruction of the biliary tract. During six years Profesor Titular de Universidad. Departamento de Radiología y Medicina Física de la Facultad de Medicina. Avda.
    [Show full text]
  • Supplementary Text Figures
    Supplementary Text Figures Figure S1: Comparison of cytokine-cytokine correlation in FINRISK07, FINRISK02, and YFS07. The heatmaps show the correlations between the normalised cytokines residuals in the discovery dataset, (A) FINRISK97, and the replication datasets, (B) FINRISK02 and (C) YFS07. Each square represents the Pearson’s correlation coefficient between the cytokines. The black box shows the correlation patterns among the 11 correlated cytokines (discovered using the FINRISK97) across the three datasets. The correlation matrix in FINRISK07 was subjected to hierarchical clustering using distance as 1 minus the absolute value of the correlations. The ordering of rows and columns in FINRISK02 and YFS07 was defined by the ordering in FINRISK07. The strength of the correlations is indicated by the colour on the scale, where red is a high positive correlation. Figure S2: Quantile-quantile (Q-Q) plots resulting from the multivariate GWAS in the three cohorts separately and meta-analysis. Q-Q plots of observed (y-axis) vs. expected P values (x-axis) for each SNP from the multivariate genome-wide association in (A) FINRISK97, (B) FINRISK02, (C) YFS07, and (D) Meta-analysis of the three cohorts. The diagonal red line (y=x) indicates null hypothesis of no association. The inflation factor (λ) was between 1.0 – 1.02 suggesting that inflation from population substructure or other confounders was appropriately adjusted for. Figure S3: Regional association plots for each of the 8 loci associated with the cytokine network from the meta-analysed multivariate GWA analysis. (A) VEGFA locus, rs7767396 is an intergenic SNP located 172.83kb downstream of vascular endothelial growth factor A (VEGFA) gene on chromosome 6p21.1.
    [Show full text]
  • Beyond the Genome—Towards an Epigenetic Understanding Of
    Progress in Neurobiology 159 (2017) 69–89 Contents lists available at ScienceDirect Progress in Neurobiology journal homepage: www.elsevier.com/locate/pneurobio Review article Beyond the genome—Towards an epigenetic understanding of handedness ontogenesis a, b a,c a Judith Schmitz *, Gerlinde A.S. Metz , Onur Güntürkün , Sebastian Ocklenburg a Institute of Cognitive Neuroscience, Department Biopsychology, Ruhr University Bochum, 44780 Bochum, Germany b Canadian Centre for Behavioural Neuroscience, Department of Neuroscience, 4401 University Drive, Lethbridge, Alberta, Canada c Stellenbosch Institute for Advanced Study (STIAS), Wallenberg Research Centre at Stellenbosch University, Stellenbosch 7600, South Africa A R T I C L E I N F O A B S T R A C T Article history: Received 28 February 2017 Hemispheric asymmetries represent one of the major organizational principles in vertebrate Received in revised form 18 September 2017 neurobiology, but their molecular determinants are not well understood. For handedness, the most Accepted 26 October 2017 widely investigated form of hemispheric asymmetries in humans, single gene explanations have been the Available online 31 October 2017 most popular ontogenetic model in the past. However, molecular genetic studies revealed only few specific genes that explain a small fraction of the phenotypic variance. In contrast, family studies Keywords: indicated heritability of up to 0.66. It has been suggested that the lack of recognizable genetic heritability Lateralization is partly accounted for by heritable epigenetic mechanisms. Based on recent neuroscientific findings Hemispheric asymmetry highlighting the importance of epigenetic mechanisms for brain function and disease, we review recent Functional preference findings describing non-genetic influences on handedness from conception to childhood.
    [Show full text]
  • A Heart on the Right Can Be More Complex Than It First Appears
    Images in... BMJ Case Reports: first published as 10.1136/bcr-2013-201046 on 19 September 2013. Downloaded from A heart on the right can be more complex than it first appears H R Haththotuwa, S W Dubrey Department of Cardiology, DESCRIPTION heart, transposition of the great arteries, atrial septal Hillingdon Hospital, Uxbridge, At first glance these chest radiographs appear defect and anomalous pulmonary venous return.3 Middlesex, UK similar. Closer inspection suggests ‘dextrocardia’ Correspondence to (figure 1A) and ‘dextroposition’ (figure 1B). ’ Dr Simon William Dubrey, Confusing terminology is helped if the heart s Learning points [email protected] position within the thorax and point of direction of the apex is described.1 A heart and apex on the ▸ ‘ ’ left is termed ‘levocardia’, a central heart with The heart in a dextrocardia position results midline apex as ‘mesocardia’ and a right-sided from cardiac chamber disarrangement and can heart and apex as ‘dextrocardia’. be associated with other cardiac malformations Dextroposition describes a heart on the right and malposition of viscera. ▸ with an apex to the left, secondary to extracardiac Situs ambiguous has a 100% association with causes (right lung hypoplasia, pneumonectomy or cardiac malformation and situs solitus is more diaphragmatic hernia). In contrast, dextrocardia likely to have associated cardiac malformations results from cardiac chamber disarrangement.2 than situs inversus. 2 ▸ ‘ ‘Dextrocardia’ (prevalence around 1/12 000) Around 20% of subjects with situs inversus ’ comprises three types, depending on the ‘situs’ (left totalis will have an abnormality of their cilia, or right orientation) of the atria and viscera. which may result in bronchiectasis and male ’ Normal orientation of the atria and viscera is infertility (Kartagener s syndrome).
    [Show full text]
  • Brain Structural and Functional Asymmetry in Human Situs Inversus Totalis
    Edinburgh Research Explorer Brain structural and functional asymmetry in human situs inversus totalis Citation for published version: Vingerhoets, G, Li, X, Hou, L, Bogaert, S, Verhelst, H, Gerrits, R, Siugzdaite, R & Roberts, N 2018, 'Brain structural and functional asymmetry in human situs inversus totalis' Brain Structure and Function. DOI: 10.1007/s00429-017-1598-5 Digital Object Identifier (DOI): 10.1007/s00429-017-1598-5 Link: Link to publication record in Edinburgh Research Explorer Document Version: Peer reviewed version Published In: Brain Structure and Function General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 24. Jul. 2019 Brain Structure and Function Brain Structural and Functional Asymmetry in Human Situs Inversus Totalis --Manuscript Draft-- Manuscript Number: BSAF-D-17-00474R1 Full Title: Brain Structural and Functional Asymmetry in Human Situs Inversus Totalis Article Type: Original Article Keywords: brain
    [Show full text]
  • PACE4 (PCSK6) (NM 138320) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC213553 PACE4 (PCSK6) (NM_138320) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: PACE4 (PCSK6) (NM_138320) Human Tagged ORF Clone Tag: Myc-DDK Symbol: PCSK6 Synonyms: PACE4; SPC4 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 PACE4 (PCSK6) (NM_138320) Human Tagged ORF Clone – RC213553 ORF Nucleotide >RC213553 representing NM_138320 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCTCCGCGCGCGCCGCCTGCGCCCGGGCCCCGGCCGCCGCCCCGGGCCGCCGCCGCCACCGACACCG CCGCGGGCGCGGGGGGCGCGGGGGGCGCGGGGGGCGCCGGCGGGCCCGGGTTCCGGCCGCTCGCGCCGCG TCCCTGGCGCTGGCTGCTGCTGCTGGCGCTGCCTGCCGCCTGCTCCGCGCCCCCGCCGCGCCCCGTCTAC ACCAACCACTGGGCGGTGCAAGTGCTGGGCGGCCCGGCCGAGGCGGACCGCGTGGCGGCGGCGCACGGGT ACCTCAACTTGGGCCAGATTGGAAACCTGGAAGATTACTACCATTTTTATCACAGCAAAACCTTTAAAAG ATCAACCTTGAGTAGCAGAGGCCCTCACACCTTCCTCAGAATGGACCCCCAGGTGAAATGGCTCCAGCAA CAGGAAGTGAAACGAAGGGTGAAGAGACAGGTGCGAAGTGACCCGCAGGCCCTTTACTTCAACGACCCCA TTTGGTCCAACATGTGGTACCTGCATTGTGGCGACAAGAACAGTCGCTGCCGGTCGGAAATGAATGTCCA GGCAGCGTGGAAGAGGGGCTACACAGGAAAAAACGTGGTGGTCACCATCCTTGATGATGGCATAGAGAGA
    [Show full text]
  • Visceral Situs, Heart Position, and Aortic Arch Position 69
    Visceral Situs, Heart Position, 7 and Aortic Arch Position The second step in interpretation of a chest radiograph and (6) the azygos vein. The basic concepts regarding vis- obtained in a new patient is to ascertain visceral situs, the ceral situs is discussed in detail in Chapter 2. heart position, and the position of the aortic arch relative In situs solitus, the gastric air bubble is on the left side, to the trachea. For example, the radiographic report may and the larger lobe of the liver is on the right side (Fig. 7.2). start with this sentence: “The radiograph shows situs solitus, The splenic tip can often be identified when the stomach levocardia and a left aortic arch.” and adjacent bowel loops are filled with air. When the bronchial air column can be traced, an asymmetric bronchial branching pattern with a short right and a long left main bronchus can be appreciated on the frontal radi- ■ Visceral Situs ograph. Normally the left main bronchus is 1.5 to 2 times longer than the right main bronchus. At the pulmonary Visceral situs refers to the pattern of arrangement of the hilum, the left pulmonary artery is seen slightly higher body organs relative to the midline. There are four types than the right pulmonary artery. The left pulmonary of visceral situs: situs solitus, situs inversus, heterotaxy artery is seen above the left upper lobe bronchus, with thoracic right isomerism, and heterotaxy with whereas the right pulmonary artery (in fact, its descend- thoracic left isomerism (Fig. 7.1).1–4 Visceral heterotaxy ing branch) is seen below the right upper lobe bronchus.
    [Show full text]
  • Increased Prevalence of Left-Handedness in Hemifacial Microsomia
    ORIGINAL ARTICLE Increased Prevalence of Left-Handedness in Hemifacial Microsomia Gary F. Rogers, MD, JD, MBA, MPH,* Stephen R. Sullivan, MD,* John B. Mulliken, MD,* Arin K. Greene, MD, MMSc,* and Albert K. Oh, MDÞ he body plan for humans is essentially symmetric around the Abstract: Ten percent of people are left handed, but a higher Tmidaxis. Nevertheless, asymmetric arrangement of organs in the frequency has been associated with certain craniofacial malforma- thoracoabdominal cavities indicates that cellular functions become tions, such as cleft lip and unilateral coronal synostosis. The purpose unequal early in development. Cellular symmetry persists through- of this study was to determine the frequency of left-handedness in out the gastrula stage and, thereafter, differential cascades of gene patients with hemifacial microsomia (HFM). Patients with HFM expression break the otherwise symmetrical internal structure.1 were identified in our craniofacial database. Normal controls were Animal models have provided some insight into the molecular and recruited by local pediatricians. Data gathered included age, sex, developmental mechanisms by which right-left symmetry is 1,2 and handedness (determined by writing and/or drawing); the orbit, altered. Nevertheless, investigators are still unclear why these mandible, ear, nerve, and soft tissue (OMENS)Yplus score and side structural asymmetries occur in a nonrandom, or unequal, distribu- tion. Nonrandom laterality is seen in the human brain, face, heart, of involvement were tabulated for patients with HFM. Hand pre- 2 great vessels, lungs, liver, gallbladder, biliary tract, gastrointestinal ference was compared between the groups using # analysis; pos- tract, spleen, and male genitalia.3,4 All but 0.01% of humans exhibit sible correlations were analyzed between handedness and age, the same asymmetric arrangement of their internal organs (situs or sex, the OMENS score, extracraniofacial findings, and side of in- situs solitus).5,6 Nevertheless, in extremely rare instances, the volvement.
    [Show full text]