The Role of Nitric Oxide in Chondrocyte Models of Osteoarthritis
Dissertation
zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) des Fachbereichs für Biologie an der Universität Konstanz
vorgelegt von Anna Helena Mais
Tag der mündlichen Prüfung: 31.1.2006 1. Referent: Prof. Dr. Volker Ullrich 2. Referent: Priv. Doz. Dr. Christian Schudt
ACKNOWLEDGEMENTS
This work was performed in the Department of Biochemistry (RDR/B1), ALTANA Pharma AG, Konstanz.
I would like to express my deep and sincere gratitude to my supervisor Prof. Dr. Volker Ullrich for so much of his time, ideas and support.
I would like to thank Dr. Christian Schudt for his guidance, inspiring ideas and especially for always keeping his door open. I would also like to thank the organizers of the graduate program “Biomedical Drug Research” Prof. Dr. Albrecht Wendel and Prof. Dr. Klaus Schäfer for giving me the opportunity to participate in this excellent program. My special thanks go to Dr. Gereon Lauer for his support and motivation during the years. His scientific and technical advice was essential for the completion of this dissertation. I would like to thank Dr. Thomas Klein especially for his enthusiasm. Thomas continually stimulated me with new ideas and encouraged me to develop independent thinking not only in the research area. I would like to thank Marion Hirscher for her expert technical assistance and Nadine Kellner for help with chondrocyte culture. I am grateful to colleagues from RDR/PX and RDR/IT especially to Silke Müller, Dr. Sascha Dammeier, Dr. Hubert Paul, Dr. Gordana Bothe, Lydia Willems, Klaus Hägele and Gisela Schüßler for great support performing 2D-electrophoresis and protein identification as well Affymetrix analysis.
Colleagues and friends at ALTANA, especially Kathrin and Claudi, I thank for support at work but also friendship and help to make Germany my home.
Je dis merci beaucoup à Pierre pour son aide avec la langue anglaise.
My husband Georg for being my best friend, his patience and that he always believed in me. Special thanks to my family:
Mamie i Tacie, Babci i cioci Krysi dziękuję, za to że mnie zawsze kochali i wspierali, szczególnie za Nawojową mojego dzieciństwa. Tą pracę dedykuję pamięci Stanisława Ciołkiewicza, który kochał mnie tak jak nikt inny, co dało mi siłę i wiarę w siebie na całe życie.
Konstanz, 8th of December 2005
Some parts of this thesis have been already published:
Mais A, Klein T, Ullrich V, Schudt C, Lauer G: Prostanoid pattern and iNOS expression during chondrogenic differentiation of human mesenchymal stem cells. JCB, in press (2006 Jan 26 Epub
Brenner SS, Klotz U, Alscher DM, Mais A, Lauer G, Schweer H, Seyberth HW, Fritz P, Bierbach U: Osteoarthritis of the knee-clinical assessments and inflammatory markers. Osteoarthritis Cartilage 12: 469-475 (2004)
ZUSAMMENFASSUNG
Zusammenfassung
Osteoarthrose (OA) ist die häufigste musko-skeletale Erkrankung in der westlichen Welt. Die derzeit übliche Therapie der Erkrankung erlaubt zwar eine effektive Schmerzbehandlung aber es gibt keine pharmakologischen Ansätze, die die Progression des Knorpelabbaus verhindern, oder die Gelenkfunktion verbessern würden. Die Entwicklung der OA ist durch eine fortschreitende Zerstörung der Knorpelmatrix und einen fehlgeschlagenen Reparaturmechanismus charakterisiert. Als Grund wird hierbei ein Ungleichgewicht von anaboler und kataboler Aktivität vermutet. Da der Chondrozyte die einzige Zelle des Gelenkknorpels ist, hat jede Einschränkung seiner Funktion bzw. Vitalität eine Auswirkung auf das Knorpelgewebe. Auch bei der Zerstörung des Knorpelgewebes spielen die Chondrozyten eine wichtige Rolle, da sie inflammatorische Mediatoren und MMPs sezenieren. Zusätzlich produzieren die aktivierten Zellen auch große Mengen von NO. Dieses wasser- und fettlösliche, gasförmige Molekül fungiert nun selber als Mediator einer Vielzahl zellulärer Prozessen. Im Knorpel wird die Synthese von NO durch die iNOS vermittelt, die u.A. durch katabolische Zytokine induziert wird. Dem Interleukin-1 (IL-1) kommt in der OA eine zentrale Rolle zu, da es sowohl die iNOS Expression erhöht, als auch andere degenerative Prozesse induziert. Dabei gehen viele Studien davon aus, dass ein großer Teil der negativen Effekte des IL-1 durch NO vermittelt ist. Aus diesem Grund könnte eine pharmakologische Inhibition der iNOS durchaus als Behandlungsoption bei der OA Therapie in Frage kommen. Das Ziel der vorliegenden Arbeit war es den Einfluss von NO auf die Physiologie des Chondrozyten zu untersuchen, um mögliche positive und negative Effekte einer Inhibition der iNOS auf den humanen Gelenkknorpel zu identifizieren. Um die Rolle von NO aufzuklären wurden verschiedene Zellkulturmodelle verwendet: in situ Kultur von Knorpelstücken, isolierte OA-Chondrozyten in Monolayer oder in 3- dimensionaler Alginatmatrix und nicht zuletzt, als Alternative zur Kultur von gesunden Chondrozyten, ein chondrogenes hMSC basiertes Differenzierungsmodell. ZUSAMMENFASSUNG
Dieses Differenzierungsmodell ist nicht in der Lage gewesen „normalen“ Gelenkknorpel zu generieren. Viel mehr zeigten unsere Analysen, dass ein Knorpel–ähnliches Gewebe entsteht, dass sich in den Expressionsanalysen vom hyalinen Knorpel signifikant unterscheidet. Trotzdem konnten wir zeigen, dass die differenzierten hMSCs in der Lage waren iNOS zu Expremieren und NO freizusetzen. Zusätzlich wurde eine genaue Charakterisierung des Prostanoid-Spektrums während der Differenzierung durchgeführt. Da die Übereinstimmungen zwischen diesen Inflammationsmarkern in den hMSCs während der chondrogenen Differenzierung und Chondrozyten sehr gut war, vermuten wir, dass das Differenzierungsmodell in diesem Zusammenhang als tatsächliche Alternative zu primären Chondrozyten dienen kann. Des weiteren wurde die Regulation der iNOS Expression in Chondrozyten untersucht. Dabei konnten wir zeigen, dass sowohl Zellen aus OA-Patienten als auch aus gesundem Knorpel (Proben aus Schweine und Rindergelenken) mikromolare Mengen von NO nach der Stimulation mit IL-1 freisetzen. Zusätzliche Experimente zeigten, dass die Expression der iNOS in humanen Chondrozyten zentral von dem Transkriptionsfaktor NFκB reguliert wird. Auch die Beteiligung von intrazellulären cAMP an der iNOS-Regulation konnte gezeigt werden. Eine Besonderheit der iNOS-Regulation in Chondrozyten stellt die Nichtbeeinflussung durch Glukokortikoide dar. Wir konnten diese Befunde eindeutig bestätigen und zusätzlich zeigen, dass diese „Dex-Resistenz“ nicht nur bei Chondrozyten von OA- Patienten zu finden ist, sondern auch für andere Spezies und gesunden humanen Knorpel gilt. Darüber hinaus fanden wir diesen Effekt auch in dem hMSC-Modell und weitere Analysen zeigten, dass die „Dex-Resistenz“ nicht mit der NFκB oder cAMP- Signaltransduktion assoziiert ist. Anhand dieser Daten kammen wir zu der Schlussfolgerung, dass Induktion durch IL-1, sowie die fehlende Inhibition der NO- Produktion nach Glukokortikoidgabe, neben den bisher verwendeten Knorpelmatrix- Proteinen, als Marker des Differenzierungsstatus von Chondrozyten verwendet werden kann. Auch konnten wir zeigen, dass humane Chondrozyten nach IL-1 Stimulus COX-2 abhängig, große Mengen PGE2 produzieren. Diese COX-2 Expression ließ sich im Gegensatz zu der iNOS-Expression durch Dex hemmen.
ZUSAMMENFASSUNG
Außerdem war kein deutlicher Effekt von NO auf die Prostanoid-Synthese in unseren Modellen zu beobachten. Das COX-2 Enzym ließ sich nicht durch NO oder seine Derivate inhibieren. Im Gegensatz dazu konnte mit Peroxynitrit ein höherer „Peroxid Tonus“ generiert werden, der zur Aktivierung der COX-Enzyme beitrug. Als weiterer Aspekt wurde der Einfluss von NO auf die Apoptose von Chondrozyten untersucht, da frühere Studien hier einen Zusammenhang hergestellt hatten. Wir konnten jedoch zeigen, dass NO alleine keinen zytotoxischen Effekt auf die Zellen ausübt, dem gegenüber führten hohe Dosen von Peroxynitrit tatsächlich zu einer verstärkten Apoptose der Chondrozyten. Oxidativer Stress scheint im Knorpelgewebe eine Rolle zu spielen. So konnten wir Nitrotyrosin im Knorpelproben nachweisen. Zusätzlich konnten wir eine Reihe von Proteinen identifizieren bei denen Tyrosin-Reste nitriert waren. Interessanterweise waren darunter einige Proteine die mit dem Glukose-Metabolismus assoziiert sind. - Leider war es uns jedoch nicht möglich die O2 -Entstehung in Chondrozyten direkt nachzuweisen. Zusammenfassend kann also gesagt werden, dass sich Chondrozyten leicht durch IL-1 zur NO-Freisetzung stimulieren lassen. Außerdem scheinen diese Zellen ein hohes antioxidatives Potential zu besitzen und sind damit relativ resistent gegen die Folgen von oxidativem bzw. nitrosativem Stress. Da NO alleine offensichtlich keinen negativen Effekt auf die Vitalität der Chondrozyten hat, scheint es, als ob cytotoxische Effekte von - NO nur in Kombinationen mit O2 entstehen können. Wir vermuten dementsprechend, dass nicht nur das Gleichgewicht zwischen anabolen und katabolen Prozessen, sondern auch das antioxidative und oxidative Potential zentrale Bedeutung für die uneingeschränkte Funktion der Chondrozyten und damit für den Erhalt des Knorpelgewebes hat. So konnten wir zwar zeigen, dass IL-1 eine Vielzahl von Genen induziert die mit der Pathophysiologie der OA assoziiert sind, aber entgegen früheren Annahmen, sind diese Veränderungen im Expressionsprofil nicht die Folge der NO-Freisetzung, sondern werden direkt durch IL-1 vermittelt. Aus diesen Gründen zeigt die vorliegende Studie, dass eine Inhibition der iNOS bei OA-Patienten, vermutlich keinen positiven Effekt auf die Physiologie und Funktion von Chondrozyten hat.
SUMMARY AND CONCLUSIONS
Summary and conclusions
Osteoarthritis (OA) is the most common form of musculo-skeletal disorders in the Western world. Current OA therapy relieves pain but there is no pharmacological treatment available that retards the disease progression and improves joint function. The development of OA is characterized by excessive cartilage destruction and defective cartilage repair due to imbalance of the anabolic and catabolic activity of chondrocytes. Chondrocyte viability and function are crucial to articular cartilage as this is the only cell responsible for maintenance of this tissue. However, the chondrocyte plays also an active role in cartilage degradation in OA by releasing inflammatory mediators and matrix metalloproteases. Beside this, activated chondrocytes release high levels of nitric oxide (NO). NO is a gaseous water and lipid soluble molecule that serves as a mediator of a number of cellular processes. In cartilage elevated levels of NO are due to induction of inducible NO synthase (iNOS) in response to stimuli e.g. catabolic cytokines. Interleukin 1 (IL-1) has been shown to play a pivotal role in cartilage damage and is also a very potent stimulator of NO production in articular chondrocytes. It has been implicated that NO mediates many of the destructive effects of IL-1 in cartilage. Therefore pharmacological iNOS inhibition has been proposed as a treatment of OA.
The aim of the present study was to investigate the role of NO in the homeostasis of chondrocytes to evaluate potential beneficial or detrimental effects of iNOS inhibition in human articular cartilage.
To study the role of NO several cartilage-related cell culture models were used as OA cartilage in situ, isolated OA chondrocytes in monolayer and in 3-dimensional alginate matrix and as an alternative to a healthy cartilage a hMSCs chondrogenic differentiation model was established. However, differentiation of hMSCs led to the formation of cartilage-like tissue, which phenotypically differs, from hyaline cartilage in terms of gene expression. Interestingly in the present study we have demonstrated for the first time iNOS expression and NO production in hMSCs during chondrogenic differentiation. We SUMMARY AND CONCLUSIONS
have also provided a detailed characterization of prostanoid production during chondrogenesis. Our investigations suggest that hMSCs undergoing chondrogenic differentiation could be used to investigate the regulation of the production of these inflammatory mediators in a cell system relevant to chondrocytes.
We first studied iNOS expression and its regulation in articular chondrocytes. We could show that OA and normal cartilage (bovine and porcine samples) and chondrocytes released micromolar amounts of NO in response to IL-1 stimulation indicating that NO production is characteristic not only for OA chondrocytes. Further investigation on the regulation of iNOS expression revealed that NFκB is a key transcription factor regulating iNOS expression in human chondrocytes. Intracellular cAMP levels are also involved in iNOS regulation in chondrocytes. It was reported that iNOS expression in human OA chondrocytes is glucocorticoid insensitive. We demonstrated that Dex-resistant iNOS expression is not restricted to human OA chondrocytes but is true for human healthy chondrocytes and chondrocytes from different species. Additionally, glucocorticoid-resistant iNOS expression was even true for hMSCs differentiating to chondrocytes. However, glucocorticoid-insensitivity is not related to NFκB and cAMP signaling pathways. The chondrocyte differentiation status was classically categorized via gene expression of cartilage matrix proteins. We propose corticosteroid – insensitive NO production in response to IL-1β stimulation as additional marker of the chondrocyte differentiation status.
Human chondrocytes after stimulation with IL-1 release high levels of PGE2 due to expression of COX-2. In contrast to iNOS COX-2 expression in chondrocytes is glucocorticoid sensitive. In regard to our study under physiologic conditions the effect of NO on prostanoid synthesis in chondrocytes is not very pronounced. COX-2 was not inhibited by NO or its derivates. On the contrary peroxynitrite can provide a higher “peroxide tone” and activate COX-enzymes in human chondrocytes. In many previous studies NO production was correlated with the level of apoptosis in cartilage. Our results implicate that endogenous or exogenous NO is not cytotoxic to SUMMARY AND CONCLUSIONS
chondrocytes, however peroxynitrite at high concentrations can lead to apoptotic cell death.
Oxidative and nitrosative stresses are present in human OA cartilage as we detected nitrotyrosine in cartilage samples. We identified a number of nitrated proteins; interestingly several of them were related to glucose metabolism. However direct - measurement of ·O2 generation in stimulated chondrocytes was impossible.
To conclude, we have shown that chondrocytes are easily stimulated by IL-1. These cells seem to have a high antioxidative potential and are therefore quite resistant against oxidative and nitrosative stress. NO by itself is not cytotoxic to chondrocytes - and can exert detrimental effects only in combination with ·O2 . We suggest that not only a balance between anabolic and catabolic activity of chondrocytes but also in antioxidative and oxidative potential of the cells are critical for proper function of chondrocytes and maintenance of hyaline cartilage. Although we could show that IL-1 is a very potent inducer of OA-related genes, the observed gene expression changes are not mediated by NO, but are directly due to the action of IL-1. Therefore iNOS inhibition in OA would not be beneficial in regard of chondrocyte homeostasis.
1. Introduction...... 1
1.1. Osteoarthritis ……………………………………………………………………… 1 1.2. Articular cartilage …………………………………………………………………. 4 1.2.1. Chondrocytes ...... 4 1.2.2. Collagen …………………………………………………………………… 6 1.2.3. Aggrecan ………………………………………………………………….. 7 1.3. Human mesenchymal stem cells differentiation model ……………………… 8 1.4. Pathophysiology of OA ...... 10 1.4.1. Changes in cartilage by proinflammatory cytokines ………………….. 10 1.4.1.1. Pivotal role of IL-1β in the pathophysiology of OA …………..…... 10 1.4.2. Apoptosis in the pathophysiology of OA ……………………………….. 11 1.4.3. Prostanoids in the development of OA ………………………………… 12 1.4.3.1. Biosynthesis of prostanoids ………………………………………. 12 1.4.3.2. The role of prostanoids in cartilage ………………………………. 14 1.4.3.3. COX inhibition in OA ……………………………………………….. 15 1.4.4. Nitrosative and oxidative stress ………………………………………… 15
1.4.4.1. Nitric oxide and nitric oxide synthases ………………………….…. 15 1.4.4.1.1. iNOS (NOS-2) ………………………………………………………………….. 17 1.4.4.1.2. NOS inhibitors ...... …. 19 1.4.4.2. Peroxynitrite ...... …. 21 1.4.4.3. Formation of nitrotyrosine ……………………………………….…. 23 1.4.5 Interplay of prostaglandins and nitric oxide ……………………………. 24 1.4.6 Nitric oxide and the development of OA ……………………………….. 25 2. Aims of the study ………………………………………………………………..... 26 3. Materials and Methods ……………………………………………………...... 28 3.1. Chemicals …………………………………………………………………………. 28 3.2. Cartilage processing and cell culture ………………………….. ……………. . 28 3.2.1. Cartilage processing………………………………………………………. 28 3.2.2. Cartilage explants in culture ...... …. 28 3.2.3. Monolayer culture …………………………………………………………. 29 3.2.4. Alginate culture …………………………………………………………... 29
3.3. human Mesenchymal Stem Cells from bone marrow ……………...... 29 3.3.1 Chondrogenic differentiation …………………………………………. ... 30 3.3.2. Osteogenic differentiation ……………………………………………… 30 3.3.2.1. Assessment of osteogenic phenotype …………………………… 30 3.3.2.1.1. von Kossa staining ...... 30 3.3.2.1.2. Alkaline phosphatase staining ...... 31 3.3.3. Adipogenic differentiation ……………………………………………… 31 3.3.3.1. Assessment of adipogenic phenotype ………………………….. 31 3.3.3.1.1. Oil red “O” staining ………………………………………………………… 31 3.4. Cell treatment with growth factors, cytokines and inhibitors ………………. 32 3.4.1. Stimulation of chondrocytes …………………………………………… 33 3.4.2. Stimulation of hMSCs ………………………………………………….. 33 3.5. Biochemical methods …………………………………………………………. 33 3.5.1. Determination of cellular viability ……………………………………… 33
3.5.2. Toxicity: release of lactate dehydrogenase (LDH) ………………….. 33 3.5.3. Griess assay …………………………………………………………….. 33
3.5.4. PGE2 ELISA ……………………………………………………………... 34 3.5.5. GC/MS/MS ………………………………………………………………. 34 3.5.6. Cytochrome c assay ……………………………………………………. 34 3.5.7. Electron Spin Resonance (ESR) ……………………………………… 34 3.5.8. SDS-Page ...... 36 3.5.9. Western blotting and protein detection ……………………………. .. 36 3.5.10. Stripping of Western blots …………………………………………… 37 3.5.11. Two-dimensional gel electrophoresis ……………………………… 37 3.5.11.1. Cell extract ...... 37 3.5.11.2. Two-dimensional gel electrophoresis ...... 38 3.5.11.3. Western blot analysis ...... 39 3.5.11.4. Protein identification (MALDI-TOF)...... 39 3.6. Staining of cartilage and chondrocytes ………………………………….... 40 3.6.1. Preparation of cartilage sections ……………………………………. 40 3.6.2. . Histochemical and fluorescence staining of tissue samples ……. 41 3.6.3. Cytospin preparations ………………………………………………… 42
3.6.4. Evaluation of antibodies ……………………………………………… 42 3.6.4.1. iNOS TK2553 ……………………………………………………………………. 42 3.6.4.2. β-actin ……………………………………………………………………………. 42 3.6.4.3. Nitrotyrosine ……………………………………………………………………. 43 3.6.4.4. PCS ...... 43 3.6.5. TUNEL staining ...... 44 3.6.6. Haematoxylin staining ………………………………………………… 44 3.7. Molecular biology methods …………………………………………………. 45 3.7.1. RNA Extraction and TaqMan PCR ………………………………….. 45 3.7.2. Affymetrix and bioinformatics analysis ………………………………. 47 3.7.2.1. Microarray ……………………………………………………………………….. 47 3.7.2.2. Microarray data analysis ………………………………………………………. 47 4. Results …………………………………………………………………………… 49 4.1. Characterization of hMSC differentiation model ……………………………. 49 4.1.2. Collagen subtypes, aggrecan and SOX-9 expression during the course of chondrogenic differentiation …………………………. 53 4.1.3. Regulation of marker gene expression in pellets was similar to chondrocytes in alginate beads ……………………………………………… 56 4.1.4. Affymetrix gene chip characterization of chondrogenic differentiation 58 4.1.5. Comparison of gene expression of healthy cartilage and chondrogenic pellets …………………………………………………… 60 4.2. iNOS expression and NO production in chondrocytes …………………….. 64 4.2.2. Detection of iNOS in human articular cartilage ………………………. 64 4.2.3. Production of NO in response to inflammatory stimuli: IL-1α, IL-1ß, TNFα, and LPS …………………………………………………………... 66 4.2.3.1. The effect of IL-1ß on the iNOS induction in cartilage explants …………… 68 4.2.3.2. Cellular localization of iNOS in primary chondrocytes ……………………… 69 4.2.4. Time course of NO production, iNOS mRNA and protein expression in human chondrocytes after IL-1ß stimulation ………… 70 4.2.5. The effect of NOS inhibitors on NO synthesis in human chondrocytes 72 4.2.6. The effect of cycloheximide and Byk 17790 on iNOS protein expression ………………………………………………………... 73
4.2.7. Nitric oxide production and iNOS gene expression during the course of chondrogenic differentiation …………………………….. 75 4.3. Regulation of iNOS in chondrocytes …………………………………………… 77 4.3.1. The effect of Dexamethasone …………………………………………… 77 4.3.1.1. iNOS and COX-2 are differentially regulated in human chondrocytes …….. 77 4.3.1.2. Dexamethasone does not inhibit IL-1β induced NO formation in OA chondrocytes or in hMSCs undergoing chondrogenic differentiation . 78 4.3.1.3. Dexamethasone effect on NO production is species-independent ……….. 80 4.3.1.4. Dexamethasone effect on NO production is independent on stimuli …….. 81 4.3.2. Dexamethasone and the regulation mechanism of iNOS expression 82 4.3.2.1. NFκB ………………………………………………………………………………….. 82 4.3.2.2. cAMP …………………………………………………………………………………. 85
4.3.3. cAMP but not NFκB regulates PGE2 production in chondrocytes ….. 88 4.4. Effects of NO on the chondrocyte gene expression …………………………. 90 4.4.1. Effects of NO on chondrogenic differentiation ………………………… 90 4.4.2. Effects of NO on OA chondrocytes ……………………………………. 97 4.5. Effects of IL-1 on the chondrocyte gene expression ………………………… 103 4.5.1. Affymetrix gene chip characterization of IL-1β regulated genes in the hMSCs differentiation model ……………………………………… 103 4.5.2. Affymetrix gene chip characterization of IL-1β regulated genes in human chondrocytes, effect of iNOS inhibition …………………….. 104 4.6. Effects of NO on the eicosanoid production ………………………………….. 109 4.6.1. Eicosanoid production in human chondrocytes and hMSCs ………… 109 4.6.2. COX-2 expression during chondrogenic differentiation ………………. 112 4.6.3. COX-2 mRNA and protein expression in human chondrocytes ……… 113 4.6.4. Time course of eicosanoid production …………………………………. 114
4.6.5. Influence of NO-donors and iNOS inhibitors on PGE2 synthesis ……. 115 4.6.6. Experiments with exogenous Arachidonic Acid (AA)………………….. 119 4.6.6.1. AA concentration dependency of prostanoid formation ……………………. 119 4.6.6.2. Effect of NO-donors on AA stimulated prostanoid formation ……………… 120 4.6.6.3. Effect of NO-donors on AA stimulated Isoprostane formation ……………. 122 4.6.7. Prostacyclin synthase in human cartilage …………………………….. 123
4.6.7.1. Prostacyclin has no effect on the expression of extracellular matrix proteins ……………………………………………………………………………… 124
4.6.7.2. Influence of NO-donors and iNOS inhibitors on PGI2 synthesis …………. 125
4.6.7.3. Effect of NO-donors on AA stimulated PGI2 formation …………………….. 126 4.7. The effect of NO on apoptosis (TUNEL) …………………………………….. 128 4.8. Protein nitrotyrosine in chondrocytes ...... 134 4.8.1. Detection of nitrotyrosine in OA cartilage …………………………….. 134 4.8.2. Nitrotyrosine immunostaining correlates with iNOS in human chondrocytes (staining of IL-1β stimulated cells) ……………….. ….. 135 4.8.3. Detection of protein-nitrotyrosine in one- and two-dimensional gel electrophoresis ………………………………………………………….. 136 4.8.3.1. 2D-gel analyses revealed no COX-2 nitration ……………………………….. 140 4.9. Superoxide ……………………………………………………………………… 142 4.9.1. Measurement of ESR signal in chondrocytes supernatant ………… 142 4.9.2. Measurement of ESR signal in cell suspension …………………….. 143 4.9.3. Measurement of ESR signal generated by SIN-1 …………………… 145 4.9.4. Measurement of superoxide production by human macrophages … 146 4.9.5. Cytochrome c assay (human chondrocytes) ………………………… 148 5. Discussion ………………………………………………………………………… 151 5.1. In vitro studies on cartilage metabolism ………………………………………. 151 5.2. NO production and iNOS expression in chondrocytes ……………………… 157 5.3. iNOS regulation in chondrocytes ………………………………………………. 159 5.4. COX-2 and prostaglandin production in human chondrocytes …………….. 162 5.4.1. Non-enzymatic isoprostane formation in excess of AA ……………… 166 5.4.2. Redox-regulation of prostanoid synthesis …………………………….. 167 5.5. Apoptosis in the development of OA and the role of NO in this process ….. 169 - - 5.6. NO, O2 and ONOO ……………………………………………………………… 171 5.7. Protein tyrosine nitration ………………………………………………………… 176 5.8. IL-1 versus NO mediated effects ………………………………………………. 180 5.9. Clinical implications ……………………………………………………………… 183 6. References………………………………………………………………………… 186 7. Supplement ……………………………………………………………………….. 212
1. INTRODUCTION
1. INTRODUCTION
1.1. Osteoarthritis
Osteoarthritis (OA) is one of the most common forms of musculo-skeletal diseases and the most common form of arthritis that affects millions of patients. According to data in the “Ärzte Zeitung” every second person in Germany aged above 60 suffers from OA. In Europe, a joint is replaced due to OA every 1,5 min, in the USA the situation is even worse (Wieland et al., 2005). Therefore Kofi Annan, the Secretary-General of the United Nations signed the declaration to launch the Bone and Joint Decade 2000-2010 for the treatment and prevention of musculo-skeletal disorders. Clinically OA is characterized by joint paint, stiffness and movement limitation, crepitus, swelling, and finally instability and deformity of the affected joint. The prevalence of OA in all joints is strikingly correlated with age. It is uncommon in adults aged under 40 and becomes extremely prevalent in those aged above 60 (over 70% of people who are 65 or older have OA). Additionally OA is more prevalent in women than in men. OA affects both the small and large joints, either singly or in combination. However, there are joints commonly affected by OA as: knee, hip, interphalangeal joints of the hand, first MTP – metatarsophalangeal joint, cervical and lumbosacral spine. Notably, the ankle, wrist, elbow and shoulder are usually spared. The etiology of OA is unknown. At present the concept that OA represents not a single disease entity but a group of overlapping distinct diseases, which may have different etiologies but with similar biologic, morphologic and clinical outcomes is one of the most accepted. OA is a slowly developing degeneration of articular cartilage, but disease processes finally affect the entire joint including the subchondral bone, ligaments, capsule, synovial membrane, and periarticular muscles (Figure 1).
1 1. INTRODUCTION
normal OA Figure 1. Comparison of normal with OA joint. To see changes in cartilage and bone with secondary inflammatory changes, particularly in the synovium of OA joint. Cartilage fibrillation and destruction is observed. Bone may be most altered in subchondral sites: less stiff and less dense. In OA the development of osteophytes is seen very often (this involves the formation of a cap of new peripheral articular cartilage as well as new bone formation as part of an endochondral process. From: Wieland at el. “Osteoarthritis – an untreatable disease? Nature Reviews 2005
Classically, the diagnosis of OA has relied on the characteristic radiographic changes described by Kellgren and Lawrence (Kellgren and Lawrence, 1957), which include as cardinal feature joint space narrowing, changes in subchondral bone and the formation of osteophytes. The most potent systemic risk factors for developing OA are increasing age, obesity and female gender. The primary factors leading to joint susceptibility to OA are listed in the Table 1.
Table 1. Risk factors for development of OA:
- constitutional susceptibility: - mechanical factors: • heredity • trauma • gender / hormonal status • joint shape • race • usage: occupational, • obesity recreational. - aging
2 1. INTRODUCTION
In contrast to rheumatoid arthritis (RA) osteoarthritis is considered a non-inflammatory arthritis, however episodic inflammation of the synovium (synovitis) is also observed in OA. Short comparison between RA and OA is given in the Table 2.
Table 2. Short comparison between OA and RA: OA RA
strictly local cartilage systemic disease damage -eyes, lung, heart, general characteristic kidneys, blood vessels
slowly developing fast developing
prevalence increases with age younger people (>60 years) (prevalence much lower than OA)
origin bio-mechanical autoimmune disease
primary changes in cartilage synovium
inflammation secondary inflammation chronic inflammation
driven by chondrocytes T-cells, macrophages
cytokines IL-1, IL-6, (TNF-α) TNF-α, IL-1, IL-6
drugs with disease not available on the market modifying efficacy
3 1. INTRODUCTION
1.2. Articular cartilage
Articular cartilage is a type of hyaline cartilage (gr. hyalos = glass). Articular cartilage is a highly specialized tissue, 1-5 mm thick that covers the surface of synovial joints allowing smooth movement between adjacent bones. The structure of cartilage matrix determines biomechanical properties of this tissue: tensile strength and the ability to resist compression. Cartilage matrix comprises: - water (75%) - proteoglycans (5%): mainly aggrecan - collagens (20%): type 2, 6, 9, 11.
1.2.1. Chondrocytes Cartilage is synthesized and maintained by chondrocytes, the only type of cell found in the cartilage. In the adult human, these cells may occupy as little as 2% of the total volume of articular cartilage. Chondrocytes are located within lacunae (chondrons), which usually contain few chondrocytes and pericellular matrix bound within a discrete collagenous capsule (Poole, 1997) (Figure 2a). Under the light microscope chondrocytes appear round or oval in the deeper part of the cartilage, and lens-shaped near the surface (Figure 2b). a) b)
tidemark
surface Figure 2. Haematoxylin staining of human articular cartilage. a) lacunae (chondrons) surrounded by extracellular matrix; intensive staining of pericellular matrix due to higher content of proteoglycans b) cartilage cross-section, description in text (Photos: Anna Mais).
4 1. INTRODUCTION
Nutrition and oxygen are supplied to chondrocytes by the synovial fluid as cartilage is avascular, aneural and alymphatic tissue. Synovial fluid (stands for “egg white” in Greek) is produced by the synovial membrane and is similar in composition to blood plasma, except for the addition of hyaluronic acid, which is responsible for its viscosity. Chondrocytes are mesenchymal cells specialized to produce cartilage-specific matrix, with collagen type 2 and aggrecan, that are responsible for the tensile strength and resistance to mechanical stresses. However, the phenotype of chondrocytes shows multiple modulations. Phenotypic changes are occurring in differentiating chondroprogenitor cells of the fetal growth plate cartilage in vivo. The cells can differentiate from progenitor cells characterized by the expression of the alternative splice variant of type 2 collagen, through mature chondrocytes expressing the typical cartilage proteins: collagen type 2, type 9 and type 11 as well aggrecan to hypertrophic chondrocytes, which are characterized by synthesis of type 10 collagen (Aigner et al., 1993; von der Mark et al., 1992). These cells are found in the lowest zone of the cartilage of the fetal growth plate (Sandell and Aigner, 2001). Chondrocyte hypertrophy has been shown to be an initial event leading to cartilage mineralization (Kirsch et al., 1992) and endochondral ossification (Topping et al., 1994). Premature chondrocyte differentiation to hypertrophic chondrocytes was indicated by von der Mark (von der Mark et al., 1992) in OA cartilage.
In vitro, after isolation from cartilage and expansion in monolayer culture chondrocytes shift toward fibroblast-like morphology and lose their characteristic spherical shape. In this culture conditions not only cell shape is altered, but also production of collagens. Instead of cartilage-specific collagen 2, collagen type 1 and type 3 are synthesized. This process is known as dedifferentiation of chondrocytes. To preserve the chondrocyte specific phenotype 3-dimensional cell culture models were developed, as suspension of these cells in alginate beads.
5 1. INTRODUCTION
1.2.2. Collagen network is the major structural component of articular cartilage. Collagen fibers are bio-mechanically very stable and show an extremely long half-life estimated to be about 117 years (Verzijl et al., 2000). Type 2 collagen (80-90% of articular cartilage collagens) is the most important component of these fibers and a molecule specific for cartilage. However, other collagens such as collagen type 6, found mostly in the territorial matrix closer to the cell, collagen type 11 and collagen type 9 are also present in the ECM but to a much lower extent. These last two collagens may have a role in determining the thickness and assembly of the collagen 2 fibers. Some other molecules, which are bound to collagen fibrils, are fibromodulin, decorin, biglycans and other leucine-rich repeat proteins.
The fiber orientation is different in various parts of articular cartilage (see Figure 3). In the superficial (tangential) zone collagen fibers run parallel to the surface, and this layer has the greatest ability to resist shear stress. In the middle zone (transitional) collagen fibers run in variable directions and this structure is responsible for transition between the shearing forces of the surface layer to compression forces in the deeper layer. The middle zone is the richest of proteoglycans. In the deep (radial) zone of cartilage collagen fibers are perpendicular to the surface and anchored in the tidemark. The structure of this zone is important for the distribution of loads and compression resistance. The calcified zone is located between cartilage layer and subchondral bone. This zone contains the Tidemark Layer (basophilic line which straddles the boundary between calcified and uncalcified cartilage). Collagen 10 is charactreristic for calcified cartilage.
6 1. INTRODUCTION
Figure 3. Cross sections cut through the thickness of articular cartilage, showing the four zones of the cartilage: superficial, intermediate, radiate, and calcified. The foreground shows the organization of collagen fibers. From: Joseph M. Mansour Biomechanics of Cartilage
1.2.3. Aggrecan is the major non-collagenous component of articular cartilage. Aggrecan is a very large molecule consisting of a central protein core (about 2000 amino acids), to which numerous glycosaminoglycan chains of chondroitin sulfate are attached. Many molecules of aggrecan monomers are attached to a long, hyaluronic acid chain forming large aggregates. The glycosaminoglycan chains of aggrecan are negatively charged. Therefore they can bind many water molecules and generate an osmotic swelling pressure making articular cartilage resistant to compression. During loading, when cartilage is compressed, water is squeezed out from ECM. However, when the compressive force is removed, aggrecan again binds water molecules, cartilage swells generating a force equal to the compressive force of the next loading. A net loss of proteoglycan content is one of the hallmarks of OA cartilage degradation (Mankin et al., 1971; Mankin et al., 1981).
All matrix molecules of the articular cartilage are synthesized by chondrocytes and this process is controlled by hormones, cytokines and mechanical stimuli. There are several
7 1. INTRODUCTION endogenous anabolic factors released by chondrocytes that stimulate cartilage generation and remodelling. Among them are transforming growth factor β (TGFβ), bone morphogenic proteins (BMPs) and insulin growth factor 1 (IGF1). These factors are also very important during chondrogenesis. In normal adult cartilage matrix remodelling is a very slow process.
1.3. Human mesenchymal stem cells differentiation model
Human mesenchymal stem cells (hMSCs) are resident in the bone marrow throughout adult life and have the capacity to differentiate along a number of connective tissue lineages, including bone, cartilage and adipose tissue (Jaiswal et al., 1997; Johnstone et al., 1998; Mackay et al., 1998; Pittenger et al., 1999; Murphy et al., 2002). The availability of human chondrocytes is limited and they are difficult to expand in vitro. This is obviously a limiting factor for investigations on the regulation of the above- mentioned mediators. Bone marrow human mesenchymal stem cells (hMSCs) can be differentiated into chondrocytes and are able to synthesize cartilage matrix (You et al., 1998; Neumann et al., 2002). What makes hMSCs such an attractive alternative to primary chondrocytes is that they can be relatively easily expanded and harvested (Solchaga et al., 2004). hMSCs differentiated into chondrocytes could thus provide a solution for drug development projects and tissue replacement therapies targeting OA. Indeed, in recent years there has been increasing interest in hMSCs as an alternative to primary chondrocytes for drug discovery projects and tissue transplant therapies (Redman et al., 2005). However, it is known that currently used protocols are not able to induce homogenous differentiation leading to uniform hyaline cartilage, but rather to chondrocytic phenotype specific for OA cartilage or as recently reported intervertebral disc-like cells (Winter et al., 2003; Steck et al., 2005). Still, most studies were focussed on the expression of ECM-markers such as collagen subtypes. Beside this there was only limited interest in the inflammatory mediator production by hMSCs during and following chondrogenesis, although production of high levels of NO and PGE2 after stimulation of IL-1β is specific for chondrocytes.
8 1. INTRODUCTION
Recently subpopulations of mesenchymal progenitor cells were identified in normal and OA cartilage (Alsalameh et al., 2004; Fickert et al., 2004). These cells are potential sources of cartilage tissue repair, but also lead to the development of osteophytes often observed in OA (Gelse et al., 2003).
chondroblast chondrocyte
hMSCs osteoblast osteocyte
preadipocyte adipocyte
Figure 4. The diagram illustrates the sequence of events involved in the formation of cartilage, bone and adipose tissue from adult hMSCs. hMSCs proliferate (i.e., undergo multiple divisions) to generate increased numbers of MSCs. Many of these expanded hMSCs then undergo a commitment step and enter a particular lineage pathway, leading ultimately to the formation of differentiated, tissue-specific cells (adapted from Osiris Therapeutics, Inc.). hMSCs undergo chondrogenic differentiation when cultured in serum-free conditions and stimulated with TGFβ. Several transcription factors have been shown to be involved in the regulation of chondrogenesis. Sox-9 (SRY-related high mobility group-Box gene 9) is a key regulator of chondrogenic differentiation. This transcription factor regulates expression of cartilage specific collagen 2a1 (de Crombrugghe et al., 2001; de Crombrugghe et al., 2000; Lefebvre et al., 2001; Lefebvre et al., 1997) . Mice with mutated Sox-9 show numerous cartilage-derived skeletal disorders (Wright et al., 1995).
9 1. INTRODUCTION
Another transcription factor Runx2 (Cbfa 1) was shown to play a central role in skeletal development, primarily in osteoblast differentiation and bone formation. However recently it has been demonstrated that Runx2 promotes also early chondrogenic differentiation (Stricker et al., 2002). Interestingly, it has been shown that the chondrogenic and adipogenic activity of OA patient-derived hMSCs is reduced in comparison to hMSCs donors without any symptoms of OA (Murphy et al., 2002). The same authors reported the loss of proliferative capacity of cells from OA patients, which was not age- or site-dependent, but associated with the disease.
1.4. Pathophysiology of OA
1.4.1. Changes in cartilage by proinflammatory cytokines In pathological conditions such as OA, cartilage turnover may accelerate, leading to early regenerative changes, such as synthesis of extracellular matrix which are accompanied by chondrocyte proliferation (hyperplasia) as well as chondrocyte enlargement (hypertrophy). However this early attempt to repair the damaged matrix is followed by degenerative changes, such as insufficient synthesis of ECM, chondrocyte cell death and cartilage matrix erosion. Chondrocytes, but to a lesser extent also synovial cells, can release several catabolic cytokines among others interleukin 1 (IL-1) and tumor necrosis factor α (TNFα), which drive the breakdown of articular cartilage. IL-1β is the major pro-inflammatory cytokine found in synovial fluid (Thomas et al., 2002).
1.4.1.1. Pivotal role of IL-1β in the pathophysiology of OA Evidence has accumulated that IL-1 is by far a more destructive mediator for cartilage than TNFα (van Lent et al., 1995; van de Loo et al., 1995; Probert et al., 1995). IL-1β is synthesized by cells as a precursor, which is intracellulary converted by interleukin-1 converting enzyme (ICE) to produce the active form. IL-1 can stimulate its
10 1. INTRODUCTION own production through autocrine and paracrine mechanisms. IL-1 has been shown to activate matrix metalloproteinases (MMPs), which degradate cartilage matrix. MMP1, MMP8 and MMP13 cleave collagen; MMP3 cleaves proteoglycans (Shingu et al., 1995; Mengshol et al., 2000; Fernandes et al., 2002). It has been demonstrated that IL-1β induces the dedifferentiation process of chondrocytes by decreasing the expression of type 2 and 9 collagens and increasing type 1 and 3 collagen expression (Goldring et al., 1988).
IL-1β stimulates the expression of all enzymes of PGE2 biosynthesis pathway: phospholipase A2, cyclooxygenase 2 (COX-2) and prostaglandin E synthase 1 (PGES) resulting in increased PGE2 production (Massaad et al., 2000; Thomas et al., 2000; Masuko-Hongo et al., 2004). IL-1β is a very potent inducer of the expression of inducible nitric oxide synthase (iNOS) and nitric oxide (NO) production. The pathophysiological importance of IL-1β in OA has been confirmed by use of an ICE inhibitor pralnacasan (Vertex/Sanofi-Aventis) in two murine models of OA, and also by gene transfer of IL-1β receptor antagonist, where both treatments reduced joint damage (Rudolphi et al., 2003; Zhang et al., 2004).
1.4.2. Apoptosis in the pathophysiology of OA Several authors have suggested that apoptosis of chondrocytes is characteristic for OA, and is a reason for cartilage degeneration (Blanco et al., 1998; Hashimoto et al., 1998a; Kim et al., 2000; Goggs et al., 2003; Kirsch et al., 2000; Heraud et al., 2000). There are also opinions, contrary to previous suggestions, that apoptotic cell death is not a widespread phenomenon in aging or OA cartilage (Aigner et al., 2001). Chondrocyte apoptosis in vivo seem to differ from “classical apoptosis”. Unlike classical apoptosis chondrocyte apoptosis involves an initial increase in endoplasmic reticulum (ER) and Golgi apparatus, reflecting an increase in protein synthesis. Increase in ER membranes provides compartments within which cytoplasm and organells are digested what leads to the complete self-destruction of the chondrocyte and remaining empty lacunae. This mechanism may be of importance as there are no phagocytic cells within
11 1. INTRODUCTION the cartilage. It has been proposed to give chondrocyte apoptosis even a special name “chondroptosis” (Roach et al., 2004). Previous studies have linked NO and chondrocyte apoptosis, especially the data from animal models of OA suggested that NO could be a signal for apoptosis. Anterior cruciate ligament transaction in dogs resulted in an increase in NO levels in the affected joint and increase in apoptotic cells (Hashimoto et al., 1998b). Treatment with selective iNOS inhibitor (L-NIL) resulted in the reduced level of chondrocyte apoptosis and reduction of OA progression in this model (Pelletier et al., 2000). The data revealed an association between NO and apoptosis in vivo, however it is still unclear if chondrocytes underwent apoptosis in direct response to NO. Interestingly, in the rabbit model of OA hyaluronan injections decreased the level of apoptosis but not NO (Takahashi et al., 2000).
Whether apoptosis or cell disintegration is primary or secondary to the destruction of cartilage matrix is difficult to answer. There is also the possibility that chondrocyte death and matrix loss form a cycle, with the progression of one having effects on the other.
1.4.3. Prostanoids in the development of OA 1.4.3.1 Biosynthesis of prostanoids Prostanoids are a class of saturated fatty acid deriverates containing prostaglandins and thromboxanes. The prostanoid class is a subclass of eicosanoids (gr. Eicos – twenty) containing 20 carbon atoms in the molecular structure. The first step in prostanoid biosynthesis is the liberation of arachidonic acid from the membrane phospholipids by phospholipase A (PLA2). Arachidonic acid (AA) serves as precursor of all prostanoids. AA undergoes the cyclooxygenase reaction in which two molecules of oxygen are added to form a bicyclic endoperoxide with a hydroperoxy group in position 15 (PGG2). This hydroperoxide is then reduced by a functionally coupled peroxidase reaction to form the 15-hydroxy-9,11-endoperoxide (PGH2). This conversion of AA is catalyzed by cyclooxygenase, named also prostaglandin endoperoxide H2 synthase (COX or PGHS, respectively). COX exists in at least two
12 1. INTRODUCTION isoforms: COX-1, expressed constitutively and COX-2, which expression is induced in various cell types after exposure to bacterial endotoxins or proinflammatory cytokines.
PGH2 is subsequently converted to a variety of prostanoids that include: prostaglandin
E2 (PGE2), prostaglandin D2 (PGD2), prostaglandin F2α (PGF2α) , prostacyclin (PGI2) and thromboxane (TX), as ilustrated in Figure 5.
Figure 5. The biosynthesis of prostanoids from arachidonic acid by cyclooxygenase pathway. From: Narumiya et al., “Prostanoid receptors: Structures, Properties, and Functions”, Physiological Reviews, 1999, Vol. 79, 1193-1226
The proportions of the various enzymes of the prostanoid pathway and therefore produced prostaglandins differ according to the cell type. In 1990 Morrow reported prostaglandin-like molecules in humans that were result of peroxidation of AA by a free radical mechanism independent of COX activity (Morrow et
13 1. INTRODUCTION
al., 1990). As these compounds are isomeric to COX-derived PGF2α, they were termed F2-isoprostanes (isoprostanes). Interest in these molecules arises from the fact that they provide an index of free-radical induced lipid peroxidation. The level of isoprostanes can indicate several disorders, for example higher levels of 8-epi-PGF2α have been detected in the plasma of smokers. However COX-dependent formation of isoprostanes has been also postulated (Klein et al., 1997)
1.4.3.2 The role of prostanoids in cartilage Gene expression, cartilage matrix synthesis and proliferation have been shown to be regulated by prostaglandins in cartilage (Geng et al., 1995). In articular cartilage prostaglandins have been discussed as mediators of inflammation and tissue destruction. However recently prostglandins have been shown to play a role in a cartilage formation by stimulating the differentiation of prechondroblasts to chondrocytes (Jakob et al., 2004). Schwartz et al. have proposed that the effect of
PGE2 depends on its concentration, low levels promote differentiation, whereas high doses promote an anabolic response (Schwartz et al., 1998).
In regard to this PGE2 can exert both catabolic or anabolic effects in chondrocytes depending on the microenvironment and which of the four receptor subtypes are present. Indeed, PGE2 has also been shown to be involved in the development of OA.
PGE2 modulates proteoglycan and collagen synthesis (Abramson, 1999; Goldring et al., 1996), stimulates matrix metalloproteinase-2 expression (Choi et al., 2004) and enhances matrix metalloproteinase-3 production (Amin et al., 2000). In addition, PGE2 inhibits chondrocyte proliferation (Blanco and Lotz, 1995b) and induces chondrocyte apoptosis (Notoya et al., 2000; Amin et al., 1997). Strikingly, PGE2 was also the only parameter, which we recently found to correlate with the WOMAC-index scores of patients with knee OA (Brenner et al., 2004).
The overproduction and role of PGE2 in OA cartilage have been reported several times.
However, COX-2 overexpression in OA not only leads to the production of PGE2 but to a variety of prostanoid endproducts that have not been fully characterized in human cartilage.
14 1. INTRODUCTION
1.4.3.3 COX inhibition in OA COX inhibitors represent the most widely used class of drugs. Although aspirin and other non-steroidal anti-inflammatory drugs (NSAIDs) are used for the treatment of inflammation, pain and fewer for more than 100 years the mechanism of their action, namely COX inhibition, was demonstrated for the first time in 1971 by Sir John Vane. NSAIDs inhibit both COX isoforms. COX-2 inhibition accounts for the therapeutic benefits and inhibition of COX-1 for the side effects of NSAIDs. The most common side effect of NSAIDs is irritation damage of gastrointestinal mucosa leading to the development of gastric erosions and ulcerations. This effect is due to COX-1 inhibition. As COX-2 is primarily responsible for increased PG production in inflamed tissues specific COX-2 inhibitors have been developed to minimize the risk of side effects mainly in gastro-intestinal tract. Both classes of COX inhibitors are very often prescribed for the treatment of OA. Specific COX-2 inhibitors: celecoxib (Celebrex, Pfizer) and rofecoxib (Vioxx, Merck) have been shown to be more effective than placebo and similarly effective as standard doses of nonselective NSAIDs (Hochberg, 2005). Both classes of COX inhibitors provide effective relief from pain as a major subjective symptom of OA (Martel-Pelletier et al., 2003). However, clinical trial investigating rofecoxib revealed that patients at higher cardiovascular risk exhibit a significantly higher incidence of myocardial infraction receiving COX-2 specific inhibitor compared with NSAIDs (Bombardier et al., 2000). Interestingly, recently celecoxib was reported to have chondroprotective effects by enhancing proteoglycan content and therefore matrix integrity in OA cartilage (Mastbergen et al., 2005).
1.4.4. Nitrosative and oxidative stress 1.4.4.1. Nitric oxide and nitric oxide synthases Nitric oxide is a gaseous short lived regulatory molecule exerting a broad range of functions in many physiological and pathophysiological cell and tissue responses (Moncada et al., 1991). Under aqueous, aerobic conditions NO spontaneously oxidizes to its stable products nitrite and nitrate.
15 1. INTRODUCTION
The first described physiological effect of NO was activation of soluble guanylyl cyclase (Ignarro et al., 1999). The rise in cGMP (3`,5`-cyclic guanosine monophosphate) level accounts for many of cellular responses to NO. Relatively low reactivity combined with a high lipophilicity allow NO to diffuse away from the point of origin, and therefore to carry out its function as a messenger molecule beyond cell borders (Wink and Mitchell, 1998). NO has the potential to interact directly or indirectly with metals, thiols and oxides, and therefore affects proteins, nucleic acids, lipids and sugars (Davis et al., 2001). Effects of NO depend on its concentration and the redox state of the cell. NO is produced by nitric oxide synthases (NOS). These group of enzymes catalyse the production of NO and L-citrulline from L-arginine, NADPH and O2.
Figure 6. Nitric oxide biosynthesis. NO synthesis from L-arginine is a reaction which involves two separate mono-oxygenation steps. Nω-hydroxy- L-argninie is an intermediate formed by a reaction requiring O2 and NADPH in a presence of BH4. The second step results in the oxidation of Nω-hydroxy- L-argninie to form citrulline and NO.
From: Knowles, (1994) Nitric oxide synthases in mammals. Biochem J 298: 249-258
There are three NOS isoforms identified: endothelial NOS (eNOS, NOS III), neuronal NOS (nNOS, NOSI) and inducible NOS (iNOS, NOSII). NOSes are enzymes active only
16 1. INTRODUCTION
as dimers. They contain tightly-bound cofactors (6R)-5,6,7,8-tetra-hydrobiopterin (BH4), flavine-adenine dinucleotide (FAD), flavine mononucleotide (FMN) and iron protoporphyrin IX (haem)(Knowles and Moncada, 1994; Marletta et al., 1998; Alderton et al., 2001). The activity of eNOS and nNOS is calcium-dependent, as Ca2+ stabilizes the calmodulin binding to its binding site in these two NOS isoforms, thereby initiating NO synthesis (Bredt and Snyder, 1990; Abu-Soud and Stuehr, 1993). However in iNOS calmodulin is tightly bound and therefore its activity is calcium-independent (Vallance and Leiper, 2002; Ruan et al., 1996; Vallance and Leiper, 2002). eNOS and nNOS are regarded as constitutively expressed, however it has been shown that expression of these enzymes is to some extent also regulated at the transcriptional level by local environmental conditions (Xu et al., 1995; Liu et al., 1996; Kleinert et al., 2000; Forstermann et al., 1998). After activation eNOS and nNOS produce nanomolar concentrations of NO, and are active for relatively short periods of time. Both isoforms are principally considered to participate in the regulation of physiological processes in the cardiovascular and nervous system, were they were first found (Marletta et al., 1998). However, their expression has been found later in other tissues and cell types.
1.4.4.1.1. iNOS (NOS-2) iNOS was first described in activated macrophages (Hibbs et al., 1988). This isoform is not usually expressed in healthy quiescent cells, but is rapidly transcriptionally induced in multiple cell types in response to stimulation with bacterial endotoxins or proinflammatory cytokines (Vallance and Leiper, 2002). Once induced, iNOS produces high amounts of NO (about 100x higher concentrations as eNOS and nNOS) for a prolonged period of time (Nathan, 1992). These high levels of NO are important for a host defence against infectious organisms (Nathan, 1997; Stuehr et al., 1991; Schmidt and Walter, 1994; Nathan, 1997). NO produced by iNOS regulates also the functional activity, growth and death of many immune and inflammatory cell types including macrophages, T lymphocytes, antigen-presenting cells, mast cells, neutrophils and natural killer cells (Coleman, 2001). Expression of iNOS has been found in many cell types like in endothelium, epithelium and also in chondrocytes and synoviocytes after induction.
17 1. INTRODUCTION iNOS expression is regulated at the transcriptional level and at the level of iNOS mRNA stability (Kleinert et al., 2000). Activation of transcription factor NF-kappa B (NFκB) seems to be an essential step for iNOS induction in most cells (Förstermann and Kleinert, 1995). Glucocorticoids have been shown to interfere with iNOS expression in many cell types (Di Rosa et al., 1990). Inhibition of iNOS expression by glucocorticoids has been shown to result from inhibition of NFκB activation (Kleinert et al., 1996; Mukaida et al., 1994). cAMP activated transcription factors like CREB, C/EBP and ATF2 seem also to be involved in the regulation of iNOS expression (Bhat et al., 2002; Kleinert et al., 2003). However, regulation of iNOS expression is very complicated and can also involve other transcription factors like AP1 or STAT1.
Table 3. Short characteristics of nitric oxide synthases.
iNOS eNOS nNOS
expression inducible constitutive constitutive
LPS, proinflammatory stimulated by - - cytokines
calcium dependent - + + chondrocytes, macrophages, present in lymphocytes, epithelial endothelial cells neurons cells, smooth muscle cells etc.
The production of high NO levels in inflammation is considered to be responsible for many detrimental effects leading to tissue destruction. The overproduction of iNOS is implicated in a number of pathologies like septic shock (Titheradge, 1999), ulcerative colitis, Crohn`s disease (Cross and Wilson, 2003), asthma (Barnes and Liew, 1995; Ricciardolo et al., 2004; Moncada, 1999), rheumatoid arthritis (Henrotin et al., 2003), but iNOS may be also involved in the pathogenesis of other disorders associated with a low grade chronic inflammation state, such as atherosclerosis (Cromheeke et al., 1999; Behr-Roussel et al., 2000), diabetes (Shimabukuro et al., 1997; Shimabukuro et al., 1998; Zhou et al., 2000) or osteoarthritis (Amin and Abramson, 1998; Studer et al., 1999).
18 1. INTRODUCTION
1.4.4.1.2. NOS inhibitors As L-arginine is a substrate for NOS several NOS inhibitors are analogues of arginine competing for the active site of the enzyme. L-NMMA (NG-monomethyl-L-arginine) and L-NAME (NG-nitro-L-arginine methyl ester) represent the group of NOS unspecific substrate analogues and their inhibitory action on NOS can be antagonized by high concentrations of L-arginine. L-NAME exhibits slightly higher potency towards constitutive enzymes. AMT (2-amino-5,6-dihydro-6-methyl-4H-1,3-thiazine) is a very potent (about 1000-fold more potent than arginine analogues presented here) but a non-selective NOS inhibitor (Nakane et al., 1995; Boer et al., 2000). In recent years a dogma was established that the constitutive forms of nitric oxide synthases, eNOS and nNOS, are critical to normal physiology and inhibition of these enzymes causes damage, whereas induction of the iNOS is harmful and specific inhibition of this enzyme would be beneficial. Therefore, specific iNOS inhibitors have been developed. The first highly selective iNOS inhibitors were the bis-isothioureas reported by Garvey et al. (Garvey et al., 1994), which were ca. 200-fold more selective for iNOS than for eNOS, but only 5-fold in comparison to nNOS (Alderton et al., 2001). Improvement of iNOS selectivity was achieved with 1400W an amidine-derived iNOS inhibitor. 1400W is not only highly selective as an iNOS inhibitor versus both eNOS and nNOS but also penetrates cells and tissues (Garvey et al., 1997). 1400W does exhibit an acute toxicity at high doses, which is likely to prevent its safe therapeutic use in humans, but it can be used as a pharmacological tool in a variety of animal models (Alderton et al., 2001). BYK191023 is an imidazopyridine derivative developed by ALTANA Pharma. Imidazpyridine compounds represent a novel class of NO-synthase inhibitors with high selectivity for the inducible isoform (Strub et al., 2005). BYK191023 is 200-fold more selective for human iNOS versus nNOS and 1000-fold in comparison to eNOS. BYK191023 did not show any toxicity in various rodent and human cell lines up to high micromolar concentrations (Strub et al., 2005).
19 1. INTRODUCTION
Table 4. The selectivity of NOS inhibitors.
Selectivity (fold) Inhibitor Structure iNOS/eNOS iNOS/nNOS nNOS/eNOS
L-NMMA 0,3 0,8 0,3
L-NAME 0,05 0,05 1
AMT 3 0,8 3
1400W 200 20 10
BYK191023 >1000 >200 -
Selectivity was determined on the basis of IC50 values obtained for purified NOS isoforms in the same experimental conditions (except values for BYK191023). Source: Boer et al. The Inhibitory Potency and Selectivity of Arginine Substrate Site Nitric-Oxide Synthase Inhibitors Is Solely Determined by Their Affinity toward the Different Isoenzymes 2000, Molecular Pharmacology; 58:1026-1034. Data for BYK191023 from Strub et al. The Novel Imidazopyridine BYK191023 is a Highly Selective Inhibitor of the Inducible Nitric Oxide Synthase 2005 Molecular Pharmacology;
There are also NOS inhibitors with distinct mechanisms of action than competing with arginine for the active site of these enzymes. For example BH4 analogs, which act at
BH4 binding site, like 4-amino-H4-biopterin (Werner et al., 2003) or inhibitors of NOS dimerization like imidazole derivatives (Ohtsuka et al., 2002).
Clinical trials with NOS inhibitors were started in septic shock patients, however they were not successful till now and had to be stopped due to increased mortality. This was probably due to use of unspecific NOS inhibitors (L-NMMA) (Petros et al., 1991; Petros
20 1. INTRODUCTION et al., 1994). Still highly selective iNOS inhibitors have not yet been tested in published clinical trials.
1.4.4.2. Peroxynitrite
● ● - - NO reacts very rapidly with superoxide ( O2 ) to form peroxynitrite (ONOO ). The rate constant of this reaction is near the diffusion-controlled limit
9 -1 -1 ● - (k= 6,7x10 M ● s ) (Huie and Padmaja, 1993). Dismutation of O2 by superoxide 7 -1 -1 dismutases (SOD) was observed with k= 10 M ● s , which is 2-3 orders of magnitude slower than the reaction with NO, so formation of peroxynitrite is favored. Superoxide anion can be generated in cells either enzymatically (NADPH oxidases) or by processes that produce reactive oxygen species (ROS) such as the electron transport chain in mitochondria. Cellular sources of superoxide are given in the Figure 7.
• mitochondrial e- transport
• NADPH oxidases SOD
● - • Xanthine oxidase O2 H2O2
• NO-synthases
(Arg, BH4 deficiency)
ONOO- •OH RNS
●NO • NO-synthases
● - Figure 7. Cellular sources and fates of superoxide ( O2 ). Superoxide reacts with NO much faster than its detoxification reaction with superoxide dismutase (SOD) takes place. The product of superoxide and nitric oxide is peroxynitrate, which can undergo further reactions.
21 1. INTRODUCTION
● ● - - Although neither NO nor O2 is a strong oxidant, ONOO is a potent and versatile oxidant that can attack a wide range of biological targets (Pryor and Squadrito, 1995). Some of biologically important reactions of peroxynitrite are listed below.
Biological reactions of peroxynitrite:
- nitration of tyrosine residues of proteins (Haddad et al., 1994; Reiter et al., 2000) - triggering of lipid peroxidation (Radi et al., 1991b) - inhibition of mitochondrial electron transport (Radi et al., 1994) - oxidation of thiol compounds (Radi et al., 1991a) - DNA-strand breakage (Szabo, 2003; Szabo et al., 1996; Szabo, 1996; Zingarelli et al., 1996) - activation of MMP’s (Migita et al., 2005) - inactivation of TIMP (tissue inhibitor for MMP), and α1-proteinase inhibitor (Brown et al., 2004) - modulation of cyclooxygenase activity (Landino et al., 1996; Deeb et al., 2002; Schildknecht et al., 2005; Mollace et al., 2005) - apoptosis (Lin et al., 1995; Salgo et al., 1995; Virag et al., 2003)
22 1. INTRODUCTION
1.4.4.3. Formation of nitrotyrosine Peroxynitrite is a potent protein-nitrating agent. Especially aromatic tyrosine residues of proteins are susceptible to reaction with ONOO-, leading to the formation of 3- nitrotyrosine (Figure 8).
O O N O OH - OH NH N O NH 2 O 2 O O
OH OH
tyrosine 3-nitrotyrosine
Figure 8. Formation of 3-nitrotyrosine.
Protein nitrotyrosine formation alters the structure and function of proteins. It may prevent tyrosine phosphorylation leading to alterations in signal transduction, which has been considered as pathological event, but on the other hand it might be also a part of cellular signaling mechanisms. Increased levels of 3-nitrotyrosine have been reported in many diseases, such as cancer, Parkinson`s disease, Alzheimers disease, COPD, RA and OA. However, the group of Stuehr postulated that protein nitration is observed under normal conditions in all tissues (Aulak et al., 2004). The role protein nitration plays in cell physiology is unclear. Nitrotyrosine formation can be detected by immunostaining and has been used as a “footprint” of peroxynitrite. However a second mechanism of tyrosine nitration via heme peroxidase dependent reactions using nitrite as substrate to generate the nitrating agent nitrogen dioxide have been proposed. Thus nitrotyrosine staining can be used as an indicator for nitrosative stress in the tissue rather than a specific marker of peroxynitrite.
23 1. INTRODUCTION
1.4.5. Interplay of prostaglandins and nitric oxide After stimulation of iNOS and COX-2 expression NO and prostaglandins are released simultaneously in large amounts. There is also a cross-talk between these mediators, however there is more evidence that NO affects PG biosynthesis than vice versa. The effect of NO on PG biosynthesis is dependent on the cell type generating PG, stimulus, NO concentration and redox state of the cell (Mollace et al., 2005). Both augmentation and inhibition of prostaglandin synthesis by NO have been reported. NO could increase COX-1 activity in microsomal sheep seminal vesicles as well as the activity of murine recombinant enzyme (Salvemini et al., 1993). NO was shown to enhance the release of PGI2 from endothelial cells (Salvemini et al., 1996). NO via peroxynitrite increases also the activity of the COX-2 enzyme and the production of prostaglandins in various cellular systems and this effect seems to be independent of the known effects of NO on soluble guanylyl cyclase (Mollace 2005). However many experiments have shown that NO can inhibit prostaglandin production, mainly by inhibition of COX-2. This was demonstrated in a number of cell types like microglial cells (Minghetti et al., 1996; Guastadisegni et al., 1997), vascular endothelial cells (Doni et al., 2005), rat Kupffer cells (Stadler et al., 1993) and macrophages (Swierkosz et al., 1995). Peroxynitrite has been also shown to modulate COX activity. Landino et al. have shown that peroxynitrite activate purified COX enzymes. ONOO- may activate COX enzymes (peroxide tone) leading to the enhanced production of prostaglandin endoperoxides (Landino et al., 1996). Ullrich and coworkers have shown nitration of prostacyclin synthase by peroxynitrite and thereby decreased production of PGI2 (Zou and Ullrich, 1996; Zou et al., 1997; Zou et al., 1998).
There is contradictory evidence on the regulation of prostaglandin synthesis by NO in cartilage. Inhibition of NO production has been suggested to increase PGE2 release in chondrocytes (Fermor et al., 2002; Mathy-Hartert et al., 2002), but on the other hand also reduction in prostaglandin levels after NO inhibition has been proposed (Manfield et al., 1996; Blanco and Lotz, 1995a; Jouzeau et al., 2002).
24 1. INTRODUCTION
1.4.6. Nitric oxide and the development of OA Very low concentrations of IL-1 are sufficient to stimulate NO production in chondrocytes. This contrasts with most other human cell types where multiple stimuli are required for iNOS induction. Therefore, NO has been made responsible for much of IL-1 effects on chondrocytes. Interestingly, the synthesis of NO in human OA cartilage derives from a glucocorticoid- insensitive induction of iNOS expression (Vuolteenaho et al., 2001). It has been suggested that high concentrations of NO or its derivatives contribute to the development of OA by inhibiting the synthesis and promoting the degradation of cartilage extra-cellular matrix (ECM) (Abramson et al., 2001). As shown by Studer NO could inhibit response of chondrocytes to the anabolic growth factor IGF-I (Studer et al., 2000; Studer, 2004). NO was shown to promote joint inflammation by up-regulation of IL-1-converting enzyme (ICE) and proinflammatory cytokine IL-18 synthesis while decreasing the level of the ICE inhibitor: protease inhibitor-9 (Boileau et al., 2002). Furthermore, high levels of intracellular NO have been demonstrated to induce chondrocyte apoptosis (Oliver et al., 2004; Clancy et al., 2001). On the other hand, NO levels in synovial fluid failed to correlate with the clinical classification of OA knees (Brenner et al., 2004). Previous studies have shown that NO - is not cytotoxic to chondrocytes by itself but only in combination with O2 (Del Carlo M Jr, 2002). There are only two studies dealing with the development of OA in iNOS knockout mouse, unfortunately with contradictory results. Van den Berg reported that iNOS deficiency diminished cartilage lesions and osteophyte formation in OA model induced with intra-articular injection of collagenase into the knee joint (van den Berg et al., 1999). In contrary, Clements et al. in an OA model induced by transaction of the medial collateral ligament and partial medial menisectomy observed accelerated cartilage degeneration in iNOS knock-out animals (Clements et al., 2003).
25 2. AIMS OF THE STUDY
2. AIMS OF THE STUDY
Osteoarthritis is the most common musculo-skeletal disease, affecting millions of patients worldwide. To date only symptomatic treatment of OA using primarily analgesics is available. Therefore there is a strong need to develop drugs with disease- modifying efficacy. NO has been implicated as important factor in the pathogenesis of OA because iNOS overexpression and increased NO synthesis was observed in cartilage of OA patients. In recent years several studies dealing with the role of NO in the development of OA have been performed. Use of iNOS inhibitors has been proposed for the attenuation of cartilage degradation observed in OA, although the data on the effect of NO on cartilage degradation is still contradictory.
The aim of the present study was to investigate the role of NO in the homeostasis of chondrocytes and to further evaluate potential beneficial or detrimental effects of iNOS inhibition in human articular cartilage. All experiments presented in this study were performed in different cartilage and chondrocyte related models as cartilage explants, isolated chondrocytes in monolayer and in 3-dimensional alginate matrix as well as in a hMSCs – chondrogenic differentiation model. In brief the results of this study could help to answer the question if pharmacological iNOS inhibition is a promising approach for the treatment of OA.
Due to the complexity of the issue the present study was focused on the following objectives:
1. To evaluate a hMSC chondrogenic differentiation model as an alternative to healthy human articular cartilage as its availability was limited and we were interested in effects of NO on both OA and healthy cartilage.
26 2. AIMS OF THE STUDY
2. To investigate iNOS expression and NO production in OA cartilage and in hMSC during chondrogenic differentiation.
3. To elucidate some aspects of iNOS regulation in articular chondrocytes with focus on the insensitivity of iNOS expression from human OA cartilage to glucocorticoids.
4. To elaborate the effects of NO on the gene expression of chondrocytes. We were especially interested in genes, which are specific for the chondrocytic phenotype or related with OA.
5. To study the effect of NO on prostaglandin synthesis and apoptosis of chondrocytes as they are both considered essential factors in the cartilage degeneration observed in OA.
6. NO can very rapidly react with superoxide to form peroxynitrite. Since peroxynitrite formation is considered to be involved in pathology of several diseases, among others OA, we were interested in oxidative and nitrosative stress in OA cartilage. This implicated measurements of superoxide production and nitrotyrosine formation in cartilage and chondrocytes.
27 3. MATERIALS AND METHODS
3. MATERIALS and METHODS
3.1. Chemicals
Sigma (Munich, Germany), Merck (Darmstadt, Germany), Roche (Mannheim, Germany) and Cayman Chemicals (Ann Arbor, USA) supplied chemicals.
3.2. Cartilage processing and cell culture
3.2.1. Cartilage processing Cartilage specimens were obtained with institutional approval from OA patients undergoing total knee or hip joint replacement in a local orthopaedic hospital. The cartilage was dissected from the underlying bone and fibrocartilaginous areas were discarded. The cartilage surfaces were rinsed several times with DMEM/F12 (Gibco Life Technologies, Eggenstain, Germany), with gentamicin (Gibco). Scalpels were used to cut cartilage in sections 3 mm apart. These tissue pieces were then digested with pronase (Calbiochem, Bad Soden, Germany) 4 mg/ml over 90 min and collagenase P (Roche Biochemicals, Mannheim, Germany) 1 mg/ml overnight in DMEM/F12 supplemented with 5% FBS (Gibco) and gentamicin (50 µg/ml) to isolate chondrocytes. The released chondrocytes were washed with HBSS (Gibco) and filtered through a 70µ nylon membrane. Chondrocytes were than cultured either in monolayer or in a three-dimensional alginate matrix as indicated.
3.2.2. Cartilage explants in culture For in situ experiments cartilage pieces were prepared as for digestion (rinsed and cut), afterwards incubated in the cell culture medium DMEM/F12 supplemented with 20% FBS, 2 mM L-glutamine, 1 mM L-cysteine (Fluka Biochemicals, Buchs, Switzerland), 25 µg/ml ascorbate (Fluka) and 50 µg/ml gentamicin and incubated at 37°C in a humidified gas mixture containing 5% CO2.
28 3. MATERIALS AND METHODS
3.2.3. Monolayer culture Human chondrocytes after isolation were plated at high density (ca. 200 000 celles/cm2) in cell culture medium as for cartilage pieces. Chondrocytes were incubated at 37°C in a humidified gas mixture containing 5% CO2. Chondrocytes were used at confluency in primary culture or after passage.
3.2.4. Alginate culture Chondrocytes were encapsulated in alginate beads immediately after isolation according to the method of Häuselmann et al. (Häuselmann et al., 1994). Briefly, cells were suspended in 1,2% sodium alginate (Sigma-Aldrich Co., Taufkirchen, Germany) in 150 mM NaCl (4x106 cells/ml alginate solution). The chondrocyte suspension was passed drop-wise through a 22-gauge needle into a 102mM CaCl2 solution under constant stirring. Following 10 min polymerization, beads were washed with 150 mM NaCl and with DMEM/F12. Chondrocytes in alginate beads were cultured in the same medium and culture conditions as cartilage pieces and cells in monolayer. When required, alginate beads were dissolved by exposure to solubilization buffer (55 mM sodium citrate and 150 mM NaCl, pH 6,00) at 37°C for 10 -15 min. The cells were recovered by centrifugation.
3.3. human Mesenchymal Stem Cells (hMSCs) from bone marrow
Frozen hMSCs from healthy donors (age 18-30 y.) were purchased from Cambrex (Cambrex Bio Science, Verviers, Belgium). Cells were plated in 75 or 150 cm2 flasks and cultured in Mesenchymal Stem Cells Growth Medium (MSCGM), a low glucose Dulbecco's modified Eagle's medium supplemented with L-glutamine, penicillin, streptomycin and fetal calf serum (all from Cambrex). Cells were fed every 3-4 days. When the cells reached 80% confluency they were passaged. The cells used for chondrogenic differentiation procedure were derived from the 5th passage.
29 3. MATERIALS AND METHODS
3.3.1. Chondrogenic differentiation For chondrogenic differentiation 25x104 hMSCs were placed in a 15-ml conical polypropylene tube, washed with Incomplete Chondrogenesis Induction Medium (ICIM) consisting of Differentiation Basal Medium Chondrogenic (Cambrex) supplemented with 1 mM sodium pyruvate, 0.17 mM ascorbic acid–sodium salt, proline, glutamine, 100nM dexamethasone , 1% ITS+Premix, and antibiotics: Pen/Strep (supplementation available from Cambrex as Chondrogenic SingleQuots). After washing with ICIM cells were resuspended in 0.5-ml complete chondrogenic medium (CCM) consisting of supplemented ICIM and 0,01 µg/ml TGF-β3 (R&D Systems, Wiesbaden, Germany). Cells were centrifuged at 1000 rpm for 5 minutes at RT. The pellets were maintained in culture with 1 pellet/tube and 0.5 ml CCM/tube. Medium was changed every 2–3 days.
3.3.2. Osteogenic differentiation For osteogeneic differentiation, hMSCs were seeded in 6-well plates: 3x104 cells in 2ml MSCGM per well. After 6 hours when cells were adherent MSCBM was replaced by Osteogenic Induction Medium, containing 100nM dexamentasone, 0,05mM ascorbate and 10 mM ß-glycerophosphate (all from Cambrex). Control wells were cultured in MSCBM to the end of the experiment.
3.3.2.1. Assessment of osteogenic phenotype
3.3.2.1.1. von Kossa staining Cells were fixed with 60% acetone buffered with citrate for 30 sec followed by washing twice in deionized water. The fixed cells were incubated with 2% silver nitrate under direct light from a 60-W lamp for 1h and afterwords with 2,5% sodium thiosulfate for 5 min, rinsed with deionized water and counterstained with 0,33% neutral red for 5 min, finally rinsed in tap water and mounted with Aquatex (Merck) prior to examination under the microscope.
30 3. MATERIALS AND METHODS
3.3.2.1.2. Alkaline phosphatase staining Cells in wells of the 6-well plates were fixed with citrate buffered 60% acetone for 30 sec, then gently rinsed in deionized water for 45 sec and stained with a mixture of Fast Violet B salt and Naphthol AS-MX Phosphate Alkaline Solution for 30 min, according to the manufacturer’s instructions (Sigma, Procedure No. 85). Afterwards the cells were counterstained with Mayer’s hematoxylin (Sigma) for 10 min, rinsed in tap water and mounted with Aquatex prior to examination under the microscope.
3.3.3. Adipogenic differentiation hMSCs were plated at 200,000 cells/well in a 6-well plate and grown to confluence in MSC medium. Subjecting confluent monolayers to 3 rounds of adipogenic treatment induced adipogenic differentiation. Each round consisted of 48–72 hours in adipogenic induction medium: DMEM-high glucose (4,5g/l), 1µM dexamethasone, 0,2mM indomethacin, 0,5 mM 3-isobutyl-1-methyl-xanthine, 0,01 mg/ml insulin and 10% FCS, followed by 48–72 hours in maintenance medium: DMEM-high glucose, 10% FCS and 0,01 mg/ml insulin. Cells were assayed after an additional week in maintenance medium. Control wells were cultured in MSCBM to the end of the experiment.
3.3.3.1. Assessment of adipogenic phenotype 3.3.3.1.1. Oil red “O” staining Cells were fixed with 4% formaldehyde in PBS for 10 min followed by washing twice with PBS. The cells were pretreated with 60% 2-propanol for 2min and then stained with 0,2% oil red “O” in 60% 2-propanol for 10 min. The cells were washed with 2-propanol and then with PBS. Finally, to stain nuclei, the cells were treated with Mayer`s hematoxylin for 10 min and washed in tap water. Coverslips were mounted using AquaTex.
31 3. MATERIALS AND METHODS
3.4. Cell treatment with growth factors, cytokines and inhibitors
For experiments human recombinant cytokines and growth factors were used (all purchased from R&D Systems).
TGF-β3 used for chondrogenic differentiation was dissolved in 10mM HCl / 10% ethanol to prepare 20µg/ml stock. Siliconized tips and tubes were used to prevent adhesion of TGF molecules to plastic. TGF-β3 was stored after reconstitution at -80°C for not longer as one month.
Cytokines and LPS (Sigma) were dissolved in PBS and stored at –20°C.
Cytokine Mix “promoter” consisted of: TNFα 500 ng/ml IFN γ 10 000 U/ml IL-1ß 50 nM
NO donors: Stocks of NO donors were freshly prepared prior to cell stimulation. Spermine-NONOate and DETA NONOate (Cayman) were dissolved in 10mM NaOH pH12,5 and SIN-1 (Sigma) was dissolved in PBS.
Arachidonic acid (AA) was purchased from Cayman. AA was supplied as a solution in ethanol. To change the solvent ethanol was evaporated under a gentle stream of nitrogen and dissolved in DMSO. Stock solution was stored at –20°C.
Inhibitors: Inhibitors were dissolved in appropriate solvent. In most cases stock of inhibitor was prepared in DMSO and diluted to required concentration in assay medium. Final concentration of DMSO did not exceeded 0,1%. To exclude any solvent influence on the experiment control cells were treated with vehicle. The cells were incubated with inhibitors 30 minutes before stimulation with cytokines.
32 3. MATERIALS AND METHODS
3.4.1. Stimulation of chondrocytes Chondrocytes in monolayer were seeded in 6-well or 24 well plates chondrocytes in alginate beads and chondrogenic pellets were placed in 24-well dishes. Cells (calculated 1 bead/100µl medium) were stimulated with human 1nM IL-1β for 24h; when necessary cells were preincubated with substances for 30 min and then stimulated for next 24h with IL-1β.
3.4.2. Stimulation of hMSCs At indicated differentiation days hMSCs were stimulated with 1nM IL-1β for 24h (6 pellets/well, 0,75 ml medium/well: Bio Whittaker BE12-917, with 4,5 g/l Glucose, w/o L- Glutamine and Phenol Red + HMSC Chondrogenic SingleQuots). After 24h of incubation, Griess assay was performed and the rest of supernatant was frozen for prostaglandins assessment. Pellets were harvested and resuspended in RNA-isolation buffer (RLT Buffer, Qiagen), than frozen at -80°C.
3.5. Biochemical methods
3.5.1. Determination of cellular viability Viable cells were counted in a Neubauer chamber by the trypan blue exclusion method.
3.5.2. Toxicity: release of lactate dehydrogenase (LDH) The toxicity was determined by measuring the LDH activity using a CytoTox 96 Non- Radioactive Cytotoxicity Assay (Promega, Mannheim, Germany). 50 µl of cell cuture media were used as samples, the assay was performed according to the manufacture's instructions. As positive control cells were incubated with 1% triton X- 100 and the result was calculated as 100% of LDH release (total).
3.5.3. Griess assay 150µl of cell culture supernatant was mixed with 10 µl 1% sulphanilamide (Sigma) in 0.1N HCl and 10 µl 0.1% N-(1naphthyl)-ethylenediamine (Sigma). Absorbance was - read at 544 nm in reference to 690 nm in a microplate reader. Nitrite (NO2 )
33 3. MATERIALS AND METHODS
concentrations were calculated by using a NaNO2 standard curve (0-35 µM) in cell culture medium.
3.5.4. PGE2 ELISA Chondrocyte culture media were collected and frozen at –20°C.
The amount of PGE2 was determined with a commercially available ELISA kit (R&D Systems), according to the manufacture's instructions. Triplicate assays per sample were performed, and the data were converted to μg/ml.
3.5.5. GC/MS/MS
These measurements were performed in Marburg by Dr. Horst Schweer.
In parallel concentrations of COX-products in cell culture supernatants were determined using specific gas chromatography/triple stage quadrupole mass spectrometry (GC/MS/MS) as described by Schweer et al. (Schweer et al., 1994).
3.5.6. Cytochrome c assay Superoxide production was measured using the cytochrome c reduction assay. 75µM cytochrome c was added to the cell culture media of chondrocytes, after incubation time absorption measurements were made in cell culture media using wavelength 550nm (Spectramax 384plus, Molecular Devices), the absorption maximum of reduced cytochrome c.
3.5.7. Electron Spin Resonance (ESR) For measurement of superoxide production chondrocytes grown in monolayer were washed with PBS, scraped from the plastic surface and resuspended in ESR buffer. Equal cell numbers were used for each experiment. The high cell permeable and non-toxic spin trap: 1-hydroxy-3-methoxycarbonyl-2,2,5,5- tetramethylpyrrolidine hydrochloride (CM-H), was freshly prepared under N2 and added to a final concentration of 1mM.
34 3. MATERIALS AND METHODS
Table 5. The composition of ESR buffer (100ml). Substance: Amount: Final concentration:
NaH2PO4 235mg 8,75mM Na2HPO4 761mg 63mM Glucose 100mg 0,1% NaCl 15mg 2,5mM KCl 37mg 5mM
CaCl2 20mg 1,8mM
Samples without cells but with spin trap and with polyethylene-glycolated superoxide dismutase (PEG-SOD) 50U/ml 100U/ml were measured as internal control. Spectra were recorded at room temperature in a 15µl glass-capillary (Brand) using a Bruker e- spin spectrometer (Bruker, Rheinstetten, Germany) with the following parameters: Field Center field: 3487 G Sweep width: 65G Resolution: 512 points Microwawe Frequency: 9.776 GHz Power: 3.964 mW Receiver : Receiver gain: 2.24e+002 Phase: 0.36 deg Harmonic: 1 Mod. frequency: 86 kHz Mod. amplitude: 2.06G Signal channel: Conversion. 10.240 ms Time constant: 10.240 ms Sweep time: 5.243 s
35 3. MATERIALS AND METHODS
3.5.8. SDS-Page Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed as described in the work of Laemmli (Laemmli, 1970). Composition of gels is given in a table below (Table 6). Samples were boiled for 3 min at 95°C in Laemmli buffer and shortly centrifugated. Finally, samples and protein standards were loaded onto SDS- PAGE gels. As a molecular weight marker See Blue Plus2 (Invitrogen) was used. Gels were run at 50-170 V in the standard electrophoresis cell (Biometra) or Novex Mini-Cell (Invitrogen).
Table 6. Recipes for SDS-PAGE gel mixtures. Stacking gel Separating gel Separating gel
5% 8% 10%
H2O 1,4 ml 3,6 ml 3,1 ml Tris/HCl 1,5M, pH 8,8 0,6 ml 1,9 ml 1,9 ml Acrylamide 30% 0,4 ml 2 ml 2,5 ml SDS 20% 0,15 ml 0,15 ml 0,15 ml APS 10% 13 µl 30 µl 30 µl TEMED 3 µl 5 µl 5 µl
3.5.9. Western blotting and protein detection Proteins subjected to SDS-PAGE were electroblotted onto a Hydrobond-C nitrocellulose membrane (Amersham) using a semi-dry blotting system (Multiphor II) with blotting buffer at 1mA/cm2 for 1h. Nonspecific binding sites were blocked with 5% non-fat dried milk (NFDM) freshly made in TBS/Tween rocked on the orbital shaker for 1h. Afterwards blots were rinsed 3 times in TBS/Tween and incubated with the primary antibody, diluted in the TBS + 1% NFDM, overnight at 4°C on the rotating shaker (antibodies and dilution factors are listed in the table 7). On the next day membranes were washed 3 times with TBS/Tween for 10 min and incubated with horseradish peroxidase-conjugated secondary antibody, diluted in TBS/Tween for 1h at room temperature. For visualization, the membrane after washing with TBS/Tween (3x5min) was treated with SuperSignal West Pico or SuperSignal West Femto (used only for nitrotyrosine detection) chemiluminescent substrate (both from Pierce) according to the
36 3. MATERIALS AND METHODS manufacturer's instructions. Image capture was performed using a LAS-1000 Luminescence Image analyser (Fuji Film). Obtained images were analyzed using the Aida Image Analyzer software, version 3.22 (Raytest).
Table 7. Antibodies that were used for protein immunodetection on Western blots primary antibody dilution factor secondary antibody dilution factor iNOS (from Prof. Pfeilschifter) 1:500 GAR-POX (Dianova) 1:50 000 iNOS (Cayman, 160862) 1:800 GAR-POX 1:50 000 COX-2 (Cayman, 160116) 1:500 GAR-POX 1:30 000 nitrotyrosine 1:250 GAM-POX (Dianova) 1 :30 000 (Cayman, 189 542) PCS 3 ( Dr. Thomas Klein) 1:800 GAR-POX 1:50 000 k376 (Dr. Thomas Klein) 1:250 GAR-POX 1:50 000
3.5.10. Stripping of Western blots Bound antibody was removed from Western Blot membranes by incubation in Western blot stripping buffer for 30 min at 60°C. Afterwards membranes were washed three times in TBS and blocked with 5% BSA/TBS for 30 min. After this procedure Western blots were ready for another immunodetection of proteins.
3.5.11. Two-dimensional gel electrophoresis 3.5.11.1. Cell extract. Primary human chondrocytes after isolation were grown in plastic flasks in DMEM/F12 20%FCS for three days. Confluent cells were incubated with IL-1β 0,5nM or SIN-1 250µM in DMEM/F12 10%FCS w/o phenol red. After 24h Griess assay was performed in cell culture supernatant to test the stimulation. The medium was collected and the cells were washed with PBS, loosened by trypsin/ethylenediaminetetraacetic acid (EDTA) and centrifuged (5min, 1200rpm,RT). Afterwards the cells were washed with TBS and TBS/distillated water (50/50%). Then a lysis buffer [7 M Urea, 2M Thiourea, 4% CHAPS, 1% DTT; 2% IPG-ampholytes] was added to the cell pellets.
37 3. MATERIALS AND METHODS
Further analysis (two-dimensional gel electrophoresis and protein identification) was performed at ALTANA Pharma in the department RDR/PX (Head of the Department Dr. Sascha Dammeier).
3.5.11.2. Two-dimensional gel electrophoresis Two-dimensional gel electrophoresis was performed with the IEF system (Amersham Biosceineces; Multiphor II Sytem). The first dimension used 7-cm nonlinear pH 3–10, immobilizedpH gradient (IPG) strips loading 40 µg protein, or 7-cm nonlinear pH 6,2-7,5 strips loading 100µg protein (for COX-2). IPG strips were rehydrated over night as described in the supplier’s manual and then isoelectric focusing was performed using following programs:
IPG strips pH 3-10: Step V mA W Time (h) Vh 1 0 - 200 2 5 0,01 1 2 200 - 3500 2 5 1,3 2405 3 3500 2 5 1,05 3675
total: 2,36 h 6081 Vh
IPG strips pH 6,2-7,5: Step V mA W Time (h) Vh 1 0 - 200 2 5 0,01 1 2 200 - 3500 2 5 1,3 2405 3 3500 2 5 5,00 17500
total.: 6,3 h 19,9Vh
For the second dimension, the IPG strips were equilibrated 12 to 15 min in IPG strip reducing buffer and then alkylated for 5 min with JAA in IPG strip alkylating buffer. IPG strips were placed on top of the 12% SDS-PAGE gel and covered with melted agarose in Laemmli buffer. The second dimension SDS-PAGE was performed essentially according to Laemmli. After completion of the run, the acrylamide gels were soaked in transfer buffer (20 mM
38 3. MATERIALS AND METHODS
Tris-HCl, 96 mM glycine, and 20% methanol) and then partially transferred onto a polyvinylidene difluoride (PVDF) membrane by using a wet transfer apparatus as suggested by the manufacturer. The gels were then stained with colloidal Coomassie blue (Roti Blue stain; Roth), and Western blot analysis was performed on the PVDF membrane.
3.5.11.3. Western blot analysis. PVDF membranes were blocked for 2h by using a blocking buffer [20 mM Tris, 150 mM NaCl (pH 7.5), 0.1% Tween-20, and 5% BSA]. Membranes then were probed overnight at 4°C with a monoclonal antibody against nitrotyrosine (1:5,000; clone 1A6, Upstate Biotechnology; Lake Placid, NY) in blocking buffer. The membranes then were washed four times in washing buffer [20 mM Tris, 150 mM NaCl (pH 7.5), and 0.1%Tween-20] for 15 min each wash. The membranes were then probed with a goat anti-mouse antibody (horseradish peroxidase conjugate, 1:50,000). After the membranes were washed four times in a washing buffer, the immunopositive spots were visualized by using LumiLight-Plus (Roche) as directed by the manufacturer. In experiments where samples needed to be compared, the membranes were blotted on the same membrane and exposed simultaneously.
3.5.11.4. Protein identification (MALDI-TOF). Proteins were identified by matrix-assisted laser desorption ionization - time of flight (MALDI-TOF) mass spectrometric analysis of in-gel tryptic digests of immunopositive spots. The two-dimensional gel spots were excised and cut into ca. 1mm3 cubes, and Coomassie blue was washed away using following protocol: • distilled water MilliQ, ~50µl, 15min, RT • 50% acetonitrile in 50 mM ammonium bicarbonate 15min, RT, shaking • 50% acetonitrile in 15 mM N-ethylmorpholine till gel pieces are shrunken, then acetonitrile removed • rehydration in 50 mM ammonium bicarbonate ~50µl, 5min • 50% acetonitrile ~50µl, 15min • the excess of fluid removed
39 3. MATERIALS AND METHODS
• 50% acetonitrile till gel cubes are shrunken, then acetonitrile removed • dried in Speed Vac, ~5min.
After being destained and dried the gel pieces were rehydrated in 20-25µl ammonium bicarbonate containing 2,5ng/ml trypsin and incubated overnight at 37°C. The in-gel tryptic digest was extracted with 50% acetonitrile containing 1% trifluoroacetic acid. The extract was dried and after resolving in 0.2 % TFA desalted using Zip-Tipµ-C18 (Millipore). The desalted extract was subjected to MALDI-TOF mass spectrometric analysis by using a Bruker Ultraflex instrument in reflector mode equipped with a nitrogen laser (337 nm). α-Cyano-4-hydroxy-cinnamic acid was use as Matrix. The elution solution (1µl of CH3CN/0.2 % TFA 2/1) from Zip-Tipµ-C18 desalting was directly spotted on a thin layer of the matrix. Each spectrum was accumulated for ca. 300 laser shots. Measured peptide masses were used to search with Mascot the MSDB database for protein identifications.
3.6. Staining of cartilage and chondrocytes
3.6.1. Preparation of cartilage sections The cartilage was dissected from the underlying bone and fibro-cartilaginous areas were discarded. Cartilage samples were fixed with 7,5% paraformaldehyde in PBS pH 7.4 and stored at 4° for min. 1 week. After fixation the specimens were washed with tap water for 2 hours and then decalcified in TBD-2 solution, which is a formic acid solution. The decalcifier solution was replaced every 24h. Using this protocol cartilage sections were fully decalcified in 4-7 days. To remove decalcifier from the tissue, cartilage specimens were washed for 12 h in tap water, which was frequently changed. Decalcified cartilage was dehydrated in a graded series of alcohols (70% 2-propanol: 2h 15 min, 80% 2-propanol: 2h 15min, 90% 2-propanol: 2h 15min, 100% 2-propanol: 2h 15min, 100% 2-propanol: 2h 15min, 100% 2-propanol: 2h 15min, 100% 2-propanol: 2h 15min, xylol: 2h, xylol: 2h, xylol: 2h) and embedded in low-melting-point paraffin (paraffin 60°C: 3h, paraffin 60°C: 3h) using a Shandon Citadel 2000 tissue processor.
40 3. MATERIALS AND METHODS
Tissue sectioning: The paraffin blocks were placed in a microtome and trimmed down to the cartilage surface, then 4 or 5 µm cartilage sections were cut. Tissue sections were floated in a water bath at 46°C and collected on Histo Bond glass slides. Afterwards glass slides with tissue sections were dried for 1-2 h at 60°C.
3.6.2. Histochemical and fluorescence staining of tissue samples Tissue sections were deparaffinized in xylene, passed through decreasing gradations of ethanol (100%, 80%, 50%), and washed in TBS. To enhance protein antigen accessibility, the sections were incubated with digestive enzymes. For each antibody four digestion protocols were tested (all in humid chambers): 1. hyaluronidase (2mg/ml PBS, pH 5,5; 15 min at 37°C) and then pronase (1mg/ml PBS, pH 7,5; 30 min at 37°C), 2. protease (0,02mg/ml TBS, pH 7,6; 60 min at 37°C), 3. chondroitinase ABC (0,05U/ml in 0,1M Tris-acetat buffer, pH 7,6; 30 min at 37°C), 4. trypsin-EDTA (the same as for the cell culture, 60min at 37°C). Enzymes were removed with three 2 min washes with TBS or PBS and 5% BSA in PBS for 30min was placed on the sections to block the non-specific binding. Afterwards the sections were incubated with primary antibodies. Primary antibodies were diluted with TBS containing 1% BSA immediately prior to use and placed on the sections, followed by overnight incubation in humid chamber at 4°C. After washing with TBS to remove residual primary antibody, secondary antibody was used to visualise a presence of examined protein: For immunohistochemical staining: the sections were incubated with biotin conjugated secondary antibodies for 30 min in a humid chambers, followed by washes and incubation with streptavidin-avidin-biotin- alkaline phosphatase complex (StreptABComplex/AP, DAKO) for 30 min at room temp. Finally substrate reagent: Fast Red from Sigma was added. After 15-30min reaction sections were washed in distilled water and mounted with AquaTex.
41 3. MATERIALS AND METHODS
For immunofluorescence staining: the sections were incubated with Cy3 or Cy2 conjugated secondary antibody for 30 min at room temp. in a humid chamber. Finally, nuclei were stained with Hoechst (1:10 000, 5 min) and the sections were mounted with Gel Mount. Sections were observed and photographed using a DMLB fluorescence microscope from Leica, pictures were recorded, and if necessary overlayed, using IM1000 software from Leica.
3.6.3. Cytospin preparations Chondrocytes from digested cartilage, dissolved alginate beads or from trypsinized monolayer culture were dispersed by repeated pipetting to obtain a single-cell suspension in PBS. 100µl of cell suspension were placed in cytofunnel chamber and centrifuged for 3 min, 1500rpm at medium acceleration. Cytoslides were then air-dried for 1h, afterwards fixed in 100% methanol for 3min, washed with PBS and blocked with 5% BSA in PBS for 30min. Further staining was performed to the same protocol as cartilage sections.
3.6.4. Evaluation of antibodies 3.6.4.1. iNOS TK2553 Paraffin embedded cartilage: the best results were obtained with chondroitinase digestion. For all immunostainings: 1:100 dilutions in 1%BSA/TBS, as secondary antibody: - immunofluorescence: Cy3 Goat anti-Rabbit (Dianova 111-165-144) diluted in PBS 1:800.
- immunohistochemistry: Biotin-SP-conjugated Affini Pure Donkey Anti-Rabbit IgG (Dianova 711-065-152) diluted in TBS 1:1000
3.6.4.2. β-actin / Sigma A5441 clone AC-15 For immunofluorescence: 1:500 dilutions in 1%BSA/PBS, as secondary antibody: - Cy2 Goat anti-Mouse (Dianova 115-225-146) diluted in PBS 1:200.
42 3. MATERIALS AND METHODS
3.6.4.3. Nitrotyrosine Anti-Nitrotyrosine (rabbit immunoaffinity purified IgG) / Upstate Cat. # 06-284 - immunofluorescence (cytospin): dilution: 0,5µg/ml in 1%BSA/PBS, as secondary antibody Cy2 Goat anti-Rabbit (Dianova 111-225-144) diluted in PBS 1:800. - immunohistochemistry (tissue): dilution: 5µg/ml in 1%BSA/TBS, as secondary antibody Biotin-SP-conjugated Affini Pure Donkey Anti-Rabbit IgG (Dianova 711- 065-152) diluted in TBS 1:1000. Paraffin embedded cartilage: best results obtained with protease or hyaluronidase/pronase digestion.
Anti-Nitrotyrosine, clone 1A6 / Upstate Cat. # 05-233 - immunofluorescence (cytospin): dilution: 1µg/ml in 1%BSA/PBS, as secondary antibody Cy2 Goat anti-Mouse (Dianova 115-225-146) diluted in PBS 1:200.
Anti-Nitrotyrosine, Monoclonal Antibody / Cayman Cat. # 189542 - immunofluorescence (cytospin): dilution: 0,5µg/ml in 1%BSA/PBS, as secondary antibody Cy2 Goat anti-Mouse (Dianova 115-225-146) diluted in PBS 1:200. - immunohistochemistry (tissue): dilution: 10µg/ml in 1%BSA/TBS, as secondary antibody Biotin-SP-conjugated Affini Pure Donkey Anti-Mouse IgG (Dianova 715- 065-150) diluted in TBS 1:200. Paraffin embedded cartilage: the best results obtained with trypsin or chondroitinase digestion.
The best results for nitrotyrosine staining by immunofluorescence technique were observed with Upstate polyclonal antibody and monoclonal antibody from Cayman. For cartilage embedded in paraffin the best results obtained with polyclonal antibody from Upstate after protease digestion.
3.6.4.4. PCS “PCS2” Ab (kindly provided by Dr. Thomas Klein, ALTANA Pharma) Paraffin embedded cartilage: the best results were obtained with chondroitinase digestion.
43 3. MATERIALS AND METHODS
For all immunostainings: 1:50 dilutions in 1%BSA/TBS, as secondary antibody: - immunofluorescence: Cy2 Goat anti-Rabbit (Dianova 111-225-144) diluted in PBS 1:200.
- immunohistochemistry: Biotin-SP-conjugated Affini Pure Donkey Anti-Rabbit IgG (Dianova 711-065-152) diluted in TBS 1:1000
3.6.5. TUNEL staining TUNEL staining was performed using TACS•XL – BLUE LABEL apoptosis detection kit (Trevigen). Briefly, deparaffinized sections or cells grown on chamber slides and fixed with 3,7% paraformaldehyde for 10 min were incubated with proteinase K solution for
30 minutes at 37°C, with 3% H2O2 solution for 5 minutes at room temperature, and then with terminal deoxynucleotidyl transferase (TdT) enzyme for 30min at 37°C. TdT incorporates brominated nucleotide (BrdU) at the sites of DNA fragmentation. The incorporated BrdU was detected using a higly specific and sensitive biotinylated anti- BrdU antibody. Antibody solution was applied to the sections for 30 minutes at 37°C and developed with TACS-Blue Label, which generates an intense blue staining in cells with DNA fragmentation. Nuclei were counterstained with neutral red. As a negative control, staining was done without TdT application. As a positive control, sections were incubated with TACS-Nuclease for 30 minutes at 37°C to confirm that the permeabilization and labeling reaction had worked. Sections were observed and photographed using Leica DMLB microscope, pictures were recorded using IM1000 software from Leica.
3.6.6. Haematoxylin staining Tissue sections were deparaffinized in xylene, passed through decreasing gradations of ethanol (100%, 80%, 50%), and washed in PBS. Afterwards tissue slides were stained for 10 min in Gill`s haematoxylin III solution (Merck), washed in tap water for 10 min, than shortly in distilled water, dehydrated and finally embedded using Entellan (Merck).
44 3. MATERIALS AND METHODS
3.7. Molecular biology methods
3.7.1. RNA Extraction and TaqMan PCR RNA was prepared using RNeasy Mini Kit (Qiagen, Hilden, Germany). Briefly, cell pellets were harvested and homogenized in RLT Buffer (Qiagen). Total RNA was extracted from the homogenate using manufacturer`s instructions. DNA contaminations were removed with DNA-free kit (Ambion, Dresden, Germany). Finally RNA was eluted with 50µl distilled water (Ambion) and used as a template for cDNA synthesis. To generate cDNA, RNA was reversed-transcribed using RAV2-reverse polymerase (Amersham, Freiburg, Germany) and random hexanucleotide primers (Roche Diagnostics, Mannheim, Germany). Equal portions of the first strand synthesis reaction were used for the following quantitative PCR-analysis. Real Time PCR, using the ABI SDS 7900 (Applied Biosystems, Foster City, CA, USA), was performed in a total volume of 25 µl in a 96 well plate. For all genes the final reaction mix contained: TaqMan Universal PCR Master Mix (Applied Biosystems), forward and reverse primers at final concentrations of 0,9 µM for each primer, the corresponding probe at the final concentration of 0,2 µM. The primers and probes listed in the Table 8. were designed using Primer Express or were ordered as assay on demand as indicated (Applied Biosystems). For all PCRs 10 ng cDNA was added to the reaction mix. A no template control (NTC) that contained all the above reagents except for cDNA was also included to detect the presence of contaminating DNA. All experiments were performed in triplicates or quadruplicates. Amplification and fluorescence detection was conducted with a standard program of 40 cycles. A result was found negative where no amplification occurred, i.e. the threshold cycle (Ct) value was greater than 40 cycles. For standardization of the gene expression levels determined by TaqMan analysis mRNA derived cDNA signal in each sample was calculated relative to 18s ratio as an internal control.
Assays on demand (Applied Biosystems): SOX9 Hs00165814 RUNX2 Hs00231692
45 3. MATERIALS AND METHODS
IL-1β Hs00174097 IL-1RN Hs00277299 (IL-1 receptor antagonist) IL-6 Hs00174131 PTGIR Hs00168765 (IP receptor)
Table 8. Sequences of primer and probes used for TaqMan PCR gene sequences
S GGCTCGTGCAGGACTCACA iNOS A GAGCCTCATGGTGAACACGTT
probe ACCTCAGCAAAGCCCTCAGCAGCAT S ACCCGGACAGGATTCTATGGA COX2 A ACTGTGTTTGGAGTGGGTTTCAG
probe AACTGCTCAACACCGGAATTTTTGACAAGA S CCACGAAGCTAACCTTGAGAGATC Agg 1 A CCTCGCCTTCTTGAAATGTCA
probe TGGCCTAGGAGTGAGCGGCAGC
S GCTTCACCTAGAGCGTCACTGT
Col 1 A1 A TGGTTTTGTATTCAATCACTGTCTTG
probe ATGGCTGCACGAGTCACACCGG S GGCAATAGCAGGTTCACGTACAC Col 2 A1 A GATAACAGTCTTGCCCCACTTACC
probe CCTGAAGGATGGCTGCACGAAACATACC S ACCCAACACCAAGACACAGTTCT (MGB)
A CTTGCTCTCCTCTTACTGCTATACCTTT (MGB) Col 10 A1 probe ATTCCCTACACCATAAAGA (MGB)
S GCTGCCACCACACTCAAGACC
ADAMTS5 A CGTAGTGCTCCTCATGGTCATCT probe TTGCAAGTGGCAGCACCAACACAAC S CGGCTACCACATCCAAGGAA
A 18s GCTGGAATTACCGCGGCT probe TGCTGGCACCAGACTTGCCCTC
46 3. MATERIALS AND METHODS
3.7.2. Affymetrix and bioinformatics analysis
Affymetrix analysis was performed at ALTANA Pharma in the department RDR/PX in the Lab of Dr. Hubert Paul and at ARI/USA in the Lab of Dr. Guido Grentzmann.
3.7.2.1. Microarray. Experimental procedures for GeneChip microarray were performed according to the Affymetrix GeneChip Expression Analysis Technical Manual (Affymetrix, Santa Clara, CA). In brief, 3µg of total RNA was used to synthesize double- stranded DNA (Superscript cDNA synthesis kit, Invitrogen, Carlsbad, CA). The DNA was purified by using phenol/chloroform/isoamylalcohol extraction with Phase Lock Gel (Eppendorf) and concentrated by ethanol precipitation. In vitro transcription was performed to produce biotin-labeled cRNA by using a MEGAscript II Kit (Ambion) according to the manufacturer’s instructions. Biotinylated cRNA was cleaned with an RNeasy Mini Kit (Qiagen, Hilden, Germany), fragmented to 50 to 200 nucleotides, and hybridized 16 h at 45°C to Affymetrix HG-U133 A and B arrays, which contain together approximately 39,000 human transcripts. After being washed, the arrays were stained with streptavidin-phycoerythrin (Dianova, Hamburg, Germany). Staining signal was amplified by biotinylated anti-streptavidin (Vector Laboratories) and by second staining with streptavidin-phycoerythrin and then scanned with a GeneArray Scanner (Affymetrix). An Affymetrix Genechip Operating System 1.2 (GCOS1.2) was used to analyze the scanned image and to obtain and scale quantitative information (according to the Affymetrix Statistical Algorithms Reference Guide). The raw data was imported into the Analyst Software package (GeneData, Basel, Switzerland) for further quality and statistical analysis.
3.7.2.2. Microarray data analysis
Performed by Dr. Gordana Bothe at Altana Pharma / RDR/IT
Genedata Expressionist system was used to analyse the scanned images and to obtaine and scale quantitative information. Changes in intensity of signals were calculated.
47 3. MATERIALS AND METHODS
Student`s t-test and absence/presence analysis were used to analyse and determine the significance of changes (in the medians) of studied groups: e.g. day 0 vs. day 7 or control vs. IL-1.
Transcripts with p values calculated in each experimental setup were selected for further analysis and differentially expressed genes were filtered according to the criteria that are designated for each experimental setup in the results.
48 4. RESULTS
4. RESULTS
4.1. Characterization of hMSC differentiation model
Most of studies dealing with human cartilage physiology and the role of nitric oxide in chondrocyte homeostasis were performed on OA chondrocytes, as the availability of normal human samples from young individuals is limited. It has been reported that human mesenchymal stem cells (hMSCs) from bone marrow can differentiate into several mesenchymal lineages, including bone, adipose tissue and cartilage. In the last years the interest for this cells as an alternative to chondrocytes have been arising. Nevertheless, chondrogenic differentiation is still not sufficiently characterized, as this field of stem cell biology is relatively new and studies are time and resources consuming. Therefore, before we started to examine the role of iNOS in chondrogenic differentiation we performed initial experiments dealing with a better characterization of the used model mainly in terms of gene expression. The first approach was to control the multipotency of hMSCs. Thus hMSCs from four donors were subjected to osteogenic and adipogenic differentiation. Alkaline phospatase and von Kossa staining served as a marker of osteogenic differentiation; oil red O assay was used as an indicator of adipogenesis.
Human mesenchymal stem cells HMSCs from bone marrow had the typical spindle morphology of cultured fibroblasts (Figure 9a). These cells were capable of growth and cell division in monolayer culture. However, it has been reported that the differentiation potential of these cells is decreasing with the time of culture and the number of passages (Zhang et al., 2005). Therefore we used the cells from the 5th passage for all differentiation procedures to obtain comparable results.
49 4. RESULTS
Osteogenic differentiation Under osteogenic induction by dexamethasone, ß-glycerophosphate and ascorbic acid cells from all four donors showed changes in cell morphology, from spindle shaped hMSCs to rhomboid shape as they differentiate and mineralize. At the third week of differentiation osteocytes began to delaminate from the culture surface. At this time point, assays assessing osteogenic differentiation were performed. Von Kossa staining characterized calcium deposition in these cells and alkaline phosphatase assay was performed to demonstrate presence of this enzyme. The alkaline phosphatase activity is restricted to bone marrow osteoblasts, endothelial cells and granulocytes, therefore it is a very useful marker of osteogenic differentiation. We obtained positive results with both assays (Figure 9 b-d) indicating differentiation of the hMSCs into osteocytic lineage. Control, not differentiated hMSCs were von Kossa negative and showed no alkaline phosphatase activity (data not shown).
Adipogenic differentiation At 100 % of confluence of hMSCs, three cycles of induction / maintenance were performed to stimulate adipogenic differentiation. During adipogenic differentiation cells acquired morphological features characteristic for adipocytes as accumulation of lipid droplets, which could be microscopically observed (Figure 9e). The amount and size of lipid vacuoles was increasing with the course of adipogenic differentiation. After two weeks of adipogenic differentiation adipogenesis was assayed by staining triglyceride deposits within the cells by oil red O (Figure 9f). This staining revealed that almost all cells were loaded with lipids. In contrast control cells did not have any lipid vacuoles (data not shown).
50 4. RESULTS a) b)
c) d)
e) f)
Figure 9. Morphologic and histochemic analysis of human hMSCs before and after osteogenic and adipogenic differentiation: a) undifferentiated hMSCs in monolayer b) osteoblasts delaminating from the cell culture surface after 3 weeks of osteogenic differentiation, alkaline phosphatase staining c) osteoblasts, von Kossa staining d) osteoblasts, alkaline phosphatase staining (red) e) adipocytes f) oil red o staining of lipid droplets within adipocytes.
51 4. RESULTS
Chondrogenic differentiation To induce chondrogenic differentiation hMSCs were grown as pelleted micromass cultures in serum-free DMEM supplemented with TGF-ß3. These hMSCs cultures increased in size during the first weeks of chondrogenic differentiation. Increased hMSC pellet size was due to extracellular matrix production, because the number of cells after pellet digestion decreased with the time of culture. The differentiation and maturation process of hMSCs is associated with the expression of specific genes. For chondrogenesis these genes include extracellular matrix (ECM) components such as collagen type 2 which is the major extracellular protein in cartilage and essential for normal cartilage structure and function (Tanaka et al., 2000; Sandell and Aigner, 2001). Collagen type 2 is a marker for activated functional chondrocytes. Hypertrophic chondrocytes are characterized by the expression of type 10 collagen (Sandell and Aigner, 2001; von der Mark et al., 1992). Expression of collagen type 10 is also a hallmark for chondrocytes from OA cartilage (Nah et al., 2001).The expression of collagen type 1 is typical for fibroblastic cells and dedifferentiated chondrocytes (Sandell and Aigner, 2001). Except the specific pattern of collagen expression aggrecan, a large aggregating proteoglycan, is another ECM molecule, which is used as a marker of cartilage and chondrocytic phenotype (Kolettas et al., 1995; Sandell and Aigner, 2001). We first characterized the expression of collagens and aggrecan in hMSCs cultivated under conditions promoting chondrogenesis to determine the extent of differentiation. However, except ECM components we decided to characterize the expression of the master transcription factor in chondrocyte differentiation: SOX-9, which has been previously shown to regulate collagen type 2 expression (Bell et al., 1997; Ng et al., 1997).
52 4. RESULTS
4.1.2. Collagen subtypes, aggrecan and SOX-9 expression during the course of chondrogenic differentiation
Collagen 1 expression: The TGF β3 induced differentiation of hMSCs into chondrocytes as expected led to a decrease of collagen 1 gene transcript levels in the first week of differentiation compared to undifferentiated stem cells. Afterwards, the level of collagen 1 mRNA was stable during the remaining course of chondrogenic differentiation (Figure 10).
Collagen 1 expression
2
1 relative expression relative 0 monolayer 7 14 21 28
Figure 10. Relative gene expression levels of collagen 1 during chondrogenic differentiation. The expression level of undifferentiated hMSCs was set as one and fold-exchange was calculated. PCR was performed in quadruplicate. For standardization of the gene expression levels determined by TaqMan analysis mRNA derived cDNA signal in each sample was calculated relative to 18s ratio as an internal control. Data are presented as mean ±SD.
Collagen 2 expression: Collagen 2 was not expressed in hMSCs. The differentiation of hMSCs into chondrocytes led to an expression of cartilage specific collagen 2. Collagen 2 transcripts were present after 7 and 14 days of differentiation, but on relatively low levels in comparison to later differentiation points. Interestingly, the expression of collagen 2 reached highest levels in the third – fifth week of chondrogenic differentiation (Figure 11).
53 4. RESULTS
Collagen 2 expression
2000,00
1500,00
1000,00
500,00 rel. expression 0,00 monolayer 7 14 21 28 32 46
Figure 11. Relative gene expression levels of collagen 2 during chondrogenic differentiation. The expression level of undifferentiated hMSCs was set as one and fold-exchange was calculated. PCR was performed in triplicate, For standardization of the gene expression levels determined by TaqMan analysis mRNA derived cDNA signal in each sample was calculated relative to 18s ratio as an internal control. Data are presented as mean ±SD.
Collagen 10 expression: An increase in collagen 10 mRNA levels was observed already after 7 days of chondrogenic differentiation. Further increase of collagen 10 gene expression was observed after 14 days and this expression level remained constant for the next two weeks (Figure 12).
Collagen 10 expression
100,00
75,00
50,00
25,00 relative expression relative 0,00 monolayer 7 14 21 28
Figure 12. Relative gene expression levels of collagen 10 during chondrogenic differentiation. The expression level of undifferentiated hMSCs was set as one and fold-exchange was calculated. PCR was performed in quadruplicate, For standardization of the gene expression levels determined by TaqMan analysis mRNA derived cDNA signal in each sample was calculated relative to 18s ratio as an internal control. Data are presented as mean ±SD.
Detection of collagen 10 in chondrogenic aggregates indicates that differentiating cells are becoming hypertrophic.
54 4. RESULTS
Aggrecan expression: Interestingly, high amounts of aggrecan transcripts were found in undifferentiated hMSCs. Due to this phenomenon aggrecan levels were calculated not in comparison to undifferentiated hMSCs but to hMSCs after 6 days of chondrogenic differentiation. The highest expression of aggrecan was observed in the first two weeks of chondrogenic differentiation with increase at 7th and 14th day of differentiation, afterwards expression of the aggrecan gene declined (Figure 13). We were surprised to detect high levels of aggrecan transcripts in un- differentiated hMSCs, as until recently this large proteoglycan has been localized predominantly to skeletal tissue and considered a hallmark of cartilage differentiation. We believe, that in our case aggrecan expression is characteristic for multipotential mesenchymal stem cells and not only chondrogenic progenitors, as these cells were able to differentiate also into adipocytes and osteoblasts as shown before. Interestingly, presence of aggrecan has been already reported aside from cartilage in brain development (Schwartz et al., 1996; Milev et al., 1998). Despite reports demonstrating presence of aggrecan in tissues other than cartilage it remains a biochemical marker of the cartilage phenotype thereafter.
Aggrecan expression
14,00 12,00 10,00 8,00 6,00 4,00 2,00 relative expression relative 0,00 6 7 14 18 21
Figure 13. Relative gene expression levels of aggrecan during chondrogenic differentiation. The expression level of hMSCs after 6 days of differentiation was set as one and fold-exchange was calculated. PCR was performed in triplicate, For standardization of the gene expression levels determined by TaqMan analysis mRNA derived cDNA signal in each sample was calculated relative to 18s ratio as an internal control. Data are presented as mean ±SD.
SOX-9 expression: Expression of this transcription factor, which is known to be necessary for chondrogenic differentiation, was significantly upregulated at the
55 4. RESULTS beginning of the chondrogenic differentiation. Levels of SOX-9 transcripts were high in the first week of differentiation, and then the expression of this gene gradually declined and achieved low level after 3 weeks of differentiation (Figure 14). The observed expression pattern of SOX-9 agreed with the concept that pro- chondrocytic transcription factor should be highly expressed as differentiation begins. However expression of collagen 2 did not fully correlate with SOX-9 expression. Indeed, we have seen induction of collagen 2 after 7 days of chondrogenic differentiation, when the measured SOX-9 mRNA reached the highest level, however the maximum of collagen 2 expression was observed 3 weeks later, when levels of SOX-9 transcripts declined.
Sox 9 expression
12,00 10,00 8,00 6,00 4,00 2,00
relative expression relative 0,00 Monolayer 7 14 21 32 46
Figure 14. Relative gene expression levels of SOX-9 during chondrogenic differentiation. The expression level of undifferentiated hMSCs was set as one and fold-exchange was calculated. PCR was performed in triplicate, For standardization of the gene expression levels determined by TaqMan analysis mRNA derived cDNA signal in each sample was calculated relative to 18s ratio as an internal control. Data are presented as mean ±SD.
4.1.3. Regulation of marker gene expression in pellets vs. chondrocytes in alginate beads As a next point of hMSCs model evaluation comparison with human primary chondrocytes cultivated in alginate beads was performed. We were interested, if differentiating hMSCs in micromass culture react in the same way as chondrocytes in alginate to catabolic stimuli. Therefore influence of IL-1ß or a cytokine mix on the expression of the cartilage specific markers collagen 2 and aggrecan was tested. Chondrogenic pellets or chondrocytes were stimulated over 24h with 1nM IL-1ß and
56 4. RESULTS mixture of TNFα, IFNγ and IL-1ß (Cytokine Mix Promotor). In both cell culture models catabolic cytokines had the same effect: significant downregulation of the expression of collagen 2 and aggrecan (Figure 15).
a) c)
Collagen 2 expression Collagen 2 expression
2,00 2,00
1,00 1,00 relative expression relative relative expression relative 0,00 0,00 control IL-1 1 nM CM Promotor control IL 1b CM Promotor
b) d)
Aggrecan expression Aggrecan expression
2,00 2,00
1,00 1,00 relative expression relative expression
0,00 0,00 control IL-1 1 nM CM Promotor control IL-1 1nM CM Promotor
Figure 15. Comparison of relative gene expression levels of collagen 2 and aggrecan in chondrogenic pellets after 21 days of differentiation a),b) and in primary chondrocytes embedded in alginate beads c),d). The expression level of untreated cells (control) was set as one and fold-exchange was calculated. PCR was performed in triplicates. For standardization of the gene expression levels determined by TaqMan analysis mRNA derived cDNA signal in each sample was calculated relative to 18s ratio as an internal control. Data are presented as mean ±SD.
57 4. RESULTS
4.1.4. Affymetrix gene chip characterization of chondrogenic differentiation – general gene expression analysis
While the preliminary results obtained with TaqMan PCR on chondrogenic gene expression in hMSCs pellet model were promising further detailed analysis of gene expression in this model was performed. HMSC from 4 bone marrow donors were differentiated into chondrocytes. During the course of chondrogenic differentiation at days: 0, 7, 11, 14, 18, 20, 33, 53 pellets were harvested for RNA isolation. For gene expression profiling of hMSCs the Affymetrix GeneChip HG-U133A containing 22283 probe sets was used.
Generally the obtained data sets for each differentiation day studied were compared among each other and genes, which were regulated during the differentiation course, were selected. Two different analyses of obtained data were performed: Comparison of all days - ANOVA, p value cutoff 0.01; median fold change cutoff0.7/1.3x - 298 probe sets (ps) obtained - clustering according to regulation (7clusters)
comparisons between days 0-7, 0-11, 0-14, 7-11, 7-14, 11-14 absent/present analysis (modified Fischer test), p value cutoff 0.05 - union of result groups from single comparisons - 581 ps obtained - ANOVA of 581 ps with Affymetrix detection p value cutoff 1; ANOVA p value cutoff 0.01 and median fold change cutoff 0.7/1.3x - 150 ps obtained
The whole lists of the expression values from the profiling experiments are given in the supplement (Tables I and II).
58 4. RESULTS
Genes up- or down-regulated during chondrogenesis Using both methods between up regulated genes during chondrogenesis we have found: collagens type 6, 7, 8 10, 18, where all collagen types were upregulated already after induction of chondrogenesis (5 days), however expression of collagens 8, 10 increased further with the time of differentiation. Collagens type 7, 10,and 18 were not detected in undifferentiated hMSCs. WNT1 inducible signaling pathway protein 1 (WISP1) and cyclin D2 (CCND2), osteomodulin expression increased with the course of chondrogenic differentiation and the highest levels of transcription were noticed at the end of the experiment. SOX-4, cyclin I were upregulated at the beginning of differentiation, afterwards their mRNA levels declined. The member of the transforming growth factor β (TGFβ) superfamily was found to be upregulated with the induction of chondrogenesis in pellet model: bone morphogenetic protein 6 (BMP6). Another growth factor, which expression was enhanced during chondrogenesis was insulin-like growth factor 1 (IGF1), also the expression of insulin-like growth factor binding protein 5 (IGFBP5) was much higher than in undifferentiated hMSCs. The expression of matrix metalloproteinase 3 (MMP3) was enhanced. MMP 3 (progelatinase) was distinctly up-regulated after induction of chondrogenesis, and its induction declined already in the second week of differentiation. The expression of cathepsins B was as well enhanced in chondrogenic pellets. Additionally enzymes involved in eicosanoid metabolism were up-regulated during chondrogenesis: COX-1 (PTGS1) mRNA levels were very high especially in the first differentiation week. In contrast the highest levels of prostaglandin D2 synthase (PTGDS) were detected at the end of the differentiation period. Further interesting up-regulated genes were NFκB, NADPH oxidase 4 (NOX4), mitogen-activated protein kinase 1 (MAP2K1), SOD2 and interleukins: IL8, IL24. Several genes were identified as down-regulated in comparison to un-differentiated hMSCs during chondrogenic differentiation: among these genes were: different keratins (4, 18,19), a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1 (ADAMTS1), catenin (cadherin-associated protein), alpha-like 1
59 4. RESULTS
(CTNNAL1), homeo box A9 (HOXA9), cyclin E2, mitogen-activated protein kinase 3 (MAP2K3), signal transducer and activator of transcription 1 (STAT1). Regarding presented Affymetrix results one is surprised by absence of regulation of genes the expression of which was usually connected with the regulation of chondrogenesis as the hedgehog genes, the frizzled genes and SMAD genes. Some other regulatory pathways are also poorly represented; there is only one representative of HOX genes (HOXA9), SOX genes (SOX4) and Wnt genes (WISP1). On the other hand presence of genes belonging to TGFβ, and IGF1 – families is in agreement with present knowledge about regulation of chondrogenesis.
Regarding the presented PCR and Affymetrix results in respect to extracellular matrix encoding genes and other chondrogenic markers we were able to demonstrate chondrogenic differentiation of human mesenchymal stem cells from bone marrow. Furthermore we characterized in detail changes in the gene expression levels in this differentiation model. We have shown regulation of several genes, which have been already associated before with chondrogenic differentiation, but also some which for the first time seem to be connected with this process.
4.1.5. Comparison of gene expression of healthy cartilage and chondrogenic pellets
To ascertain which time point of the chondrogenic differentiation was the most similar to normal cartilage gene-profiling data obtained for normal human cartilage (7 donors) and chondrogenic pellets during the differentiation course were compared. Analysis of healthy cartilage samples was performed previously at ALTANA Pharma in the Lab of Dr. Gereon Lauer. For comparison three different scoring systems were used: assignment of cartilage experiments to the time point groups of the hMSCs data set (classification algorithm support vector machine, “svm”), search for probe sets detecting transcripts significantly differentially expressed in cartilage and hMSCs (T test + n-fold change, “TTn”) and search for probe sets detecting transcripts absent in cartilage and present in hMSCs at
60 4. RESULTS a particular time point and vice versa, present in cartilage and absent in hMSCs (“ap”). Scoring all above methods (“ap”, “TTn”, “svm”) resulted in the final ranking (Table 9).
Table 9. Ranking of three different scoring systems comparing gene expression assayed by microarray for chondrogenic pellets at different differentiation time points with data set obtained for normal human cartilage (description in text). Score svm: 1=most similar in classification; scores TTn & ap: 1= least no. of differentially expressed probe sets observed
Probe score total score TTn score ap description svm score 18 days 2 1 1 1 11 days 1 2 4 2 53 days 4 4 2 3 7 days 3 5 5 4 14 days 8 3 3 5 33 days 6 nd 8 5 20 days 7 6 6 7 monolayer 5 7 7 7
Comparison of gene expression profile of healthy cartilage with chondrogenic pellets during the differentiation course revealed that day 18th of chondrogenic differentiation has the most similar gene expression pattern to healthy cartilage. As one would expect, undifferentiated monolayer of hMSCs had the least similar gene expression pattern compared to healthy cartilage. As seen from the fig 1 the second week of chondrogenic differentiation had the most similarities with healthy cartilage. Days 18th and 11th got the best scores. In fact day 14, which is on 5th place in the final ranking could be on directly after day 11th if we consider “TTn” and “ap” scores, only last place in “svm” scoring determined that it placed on the later positioning in the total ranking. Interestingly, the last studied point of chondrogenic differentiation in pellet culture: day 53 showed a lot of similarities to healthy cartilage and is scored directly after days 18 and 11 in the final ranking. This result correlates with our PCR data where we observed expression of cartilage specific collagen type 2 at this late differentiation time point (data not shown). Day 7, the first studied point of chondrogenic differentiation was in the middle of the ranking. This result indicated that more than one week of differentiation is necessary to obtain a chondrocytic phenotype similar to normal cartilage.
61 4. RESULTS
Further, we were interested which differences in the gene expression exist between normal cartilage and chondrogenic pellets. Therefore data sets of normal cartilage and pellets at 18th day of differentiation were compared. The regulated transcripts were filtered using T test (10-4) and fold change 1,5x. Gene transcripts absent in chondrogenic pellets and present in at least 80% of cartilage samples were described as absent in chondrogenic pellets. Genes present in all pellet samples (100%) and at no more than in 20% of cartilage samples were identified as upregulated in chondrogenic pellets (all data for 18th day of chondrogenic differentiation). We identified several genes, which were regulated in cartilage but not in hMSCs on 18th day of differentiation. These genes are listed in the Supplement (Table III). Among these genes were e.g.: aggrecan, glypican 5, SOD3 (extracellular). We found also genes, which were regulated during chondrogenic differentiation but were not expressed or expressed to very low extent in human healthy cartilage (Supplement, Table V). Interestingly among these genes are: collagen type 4α1; collagen type 4α2; collagen type 5α3; collagen type 6α1; cadherin 2; ADAMTS2; MMP 19; MMP 28; BMP 1; HAS 1 (hyaluronan synthase 1); prostaglandin D2 synthase 21 kDa;
In conclusion, our results indicated that chondrogenic differentiation in the investigated model is a continuous process in which the chondrocyte phenotype undergoes frequent changes and it is difficult to define when this phenotype should be considered to be chondrocyte-specific and characteristic for normal cartilage. However most similarities between normal cartilage and chondrogenic pellets were observed during days 11-18 of chondrogenic differentiation. Despite similarities after careful analysis several alterations in gene expression levels between normal cartilage and chondrogenic pellets at 18th differentiation day were found. Interestingly on the list of genes, which were expressed in normal cartilage and not detected in chondrogenic pellets were no genes, which are at present considered markers of chondrocytic phenotype, except aggrecan, which was not regulated on 18th differentiation day, however expressed in hMSCs (Affymetrix data not shown). We could also show aggrecan expression with
62 4. RESULTS
PCR. Additionally expression of HAS1 was detected as up-regulated in differentiating pellets. Among other genes expressed in pellets, but absent in normal cartilage were for example genes encoding ECM proteins, growth factors but also cartilage matrix degrading enzymes. This implicates that ECM of cells undergoing chondrogenesis is in contrast to normal cartilage still under modeling.
63 4. RESULTS
4.2. iNOS expression and NO production in chondrocytes
4.2.2. Detection of iNOS in human articular cartilage
Immunohistochemical analysis of cartilage samples originating from patients undergoing knee or hip replacement surgery was performed. Cartilage samples were fixed in paraformaldehyde on the same day, as they were collected. Afterwards decalcification and staining procedures were performed as described in “Material and methods”. Staining with TK2533 anti- iNOS antibody revealed iNOS presence within osteoarthritic cartilage, however, only few cells were iNOS positive (Figure 16a). Furthermore iNOS expression was demonstrated by Western blot in cells isolated from human OA cartilage directly after joint replacement surgery (Figure 16b). iNOS signal was clear however not as prominent as in isolated cells stimulated with exogenous IL- 1β. OA cartilage explants placed in culture medium in the absence of exogenous stimuli produced significant amounts of NO (Figure 17). OA cartilage samples released 31 ± 7 µM of nitrite per gram (wet wt) of cartilage. a) b)
12 34 iNOS
1 – iNOS protein standard 2 - control (cells in beads) 3 – IL-1β 0,5nM, 24h (cells in beads)
4 – cells directly after cartilage isolation
Figure 16. a) Staining of iNOS protein (red) in OA cartilage using TK2533 antibody (DF 1:100), a representative section is shown. b) iNOS expression in articular cartilage analysed by Western blot
64 4. RESULTS
50
40 Figure 17. NO production by OA cartilage explants under basal conditions. Knee and hip articular cartilage from four separate OA-affected patients 30 was individually placed in organ culture. The - release of NO2 in the medium was monitored after 24 h. Data are expressed as micromolar nitrite per nitrite 20 gram (wet wt) of cartilage ± SD (n=4).
10 (µM/g wet tissue)
0
iNOS gene expression in human cartilage To study iNOS expression in human cartilage mRNA analysis of samples originating from different cartilage donors (healthy and OA subjects) was performed. Cartilage samples were frozen directly after collection, pulverized under liquid nitrogen in a freezer mill, mRNA was extracted, and finally iNOS mRNA was detected using TaqMan PCR (Figure 18). Interestingly in all three samples originating from donors without joint disease evidence relatively high levels of iNOS mRNA were observed. iNOS gene expression was detected in 10 from 19 studied OA cartilage samples. However expression levels were rather low comparing to healthy cartilage samples. Additionally expression levels of seven healthy cartilage samples were assessed by Affymetrix chip analysis. Four of them showed iNOS gene expression confirming results obtained with PCR (data not shown).
65 4. RESULTS
1,40
1,20
1,00
0,80
0,60
0,40 relative expression 0,20
0,00
althy 1althy 2althy 3OA 11OA 13OA 16OA 19OA 21OA 22OA 24OA 27OA 28OA 29OA 31OA 50OA 51OA 55OA 56OA 57OA 58OA 59OA 65 e e e H H H
Figure 18. TaqMan analysis of iNOS expression in human cartilage samples originating from healthy and OA cartilage donors. Cartilage was frozen directly after collection and PCR analysis was performed after mRNA extraction. PCR was performed in triplicate, results were normalized against 18S and are presented as mean ± SD.
4.2.3. Production of NO in response to inflammatory stimuli: IL-1α, IL-1ß, TNFα, and LPS
Resting chondrocytes in vitro produce spontaneously no or very low levels of NO. Different proinflammatory stimuli have been shown to induce iNOS expression and NO production in human chondrocytes (Palmer et al., 1993). To find the best stimulus for further experiments IL-1α, IL-1β, TNFα and LPS in different concentrations were tested (Figure 19). All stimuli used were able to induce marked NO synthesis in a dose- dependent manner. IL-1 (alpha and beta to the same extent) was the most potent stimulus of NO production in human chondrocytes in agreement with literature. After stimulation with TNFα, even at high concentrations (200 ng/ml), NO production was about 50% lower than after stimulation with IL-1. Chondrocytes stimulated with LPS produced higher levels of NO than after stimulation with TNFα, but lower as after stimulation with IL-1.
66 4. RESULTS
IL-1 beta IL-1 alpha 0.75 0.75 ] 0.50 ] 0.50 544-690 544-690 [A 0.25 [A 0.25 NO production NO production
0.00 0.00 l o M M M nM nM nM nM 5nM ,5nM 1nM 2nM 2nM 0,1 0 0.1nM 0.5nM contr ,001n ,005n 0,01 0,05 0,2 control 0.01 0.05nM 0.25n 0 0 0.005nM TNF alpha LPS 0.75 0.75 ] ] 0.50 0.50 544-690 544-690 [A [A 0.25 0.25 NO production NO production
0.00 0.00 l l l l l m ml m ml m ml m /ml ml trol / / / g/ml g/ g/ ng ng/ml ng/ ng/ml n ng/m on µg µ µg µ µg ontrol1 5ng/ml 5 c 5 5 1 2µg/ c 10 2 50 ,01µg/ 0.1 0.5 2,5 100 200ng/ml 0 0.0 0.2
Figure 19. Primary chondrocytes in alginat beads were stimulated with different concentrations IL-1β, IL- 1α, TNFα and LPS for in assay medium. After 24h incubation NO levels were measured in supernatant using Griess assay. Results are shown as mean ± SD, n=5.
Similar results were obtained if instead of NO COX-products were measured in the cell culture supernatant. IL-1β was the most potent stimulator of prostanoid generation. If chondrocytes had been stimulated with LPS production of prostanoids was approximately 50% lower than after IL-1 stimulation. TNFα had almost no stimulatory effect on the release of prostaglandins (data not shown). Based on these preliminary experiments we decided to use IL-1 in our further experiments as the best proinflammatory stimulus in respect to NO and prostaglandin production.
67 4. RESULTS
4.2.3.1. The effect of IL-1ß on the iNOS induction in cartilage explants To demonstrate a stimulatory effect of IL-1 on iNOS expression articular cartilage explants originating from knees and hips of OA patients were stimulated with 1nM IL-1ß for 24h. Afterwards NO levels were measured using Griess assay and explants were fixed in paraformaldehyde, decalcified and embedded in paraffin according to the standard protocol. Staining for iNOS was performed as described in “Material and methods”. a) b)
c) d)
Figure 20. iNOS staining in human articular cartilage explants after 24h of IL-1ß stimulation iNOS detected by TK 2533 1:100; a) control, b,c,d) IL-1β 0,5nM. Original magnification: a,b) 100x, c) 200x, d) 400x.
After 24 h of IL-1ß stimulation high levels of NO were measured in cell supernatants (data not shown). Immunohistochemical staining revealed iNOS protein in almost all cells present in cartilage explants (Figure 20), but not in control cells.
68 4. RESULTS
This result provided further confirmation for IL-1 as a very potent stimulus of iNOS in chondrocytes. Interestingly, there were no iNOS positive cells in control cartilage from OA patients. We suppose that it was due to intervals between cartilage isolation from the joint and fixation, which took more than 30h (stimulation time 24h). As iNOS was detected in samples that had been fixed briefly after surgery, presumably incubation in stimuli-free medium aborted iNOS expression.
4.2.3.2. Cellular localization of iNOS in primary chondrocytes The localization of iNOS protein in chondrocytes was assayed using primary chondrocytes cultivated on chamber slides or centifuged on cytoslides with cytospin technique. Double immunostaining was performed: iNOS was detected using polyclonal TK2533 antibody and secondary antibody labeled with the red fluorophore Cy3, actin was stained with monoclonal antibody and secondary antibody labeled with the green fluorophore Cy2. a) b)
Figure 21. Immunofluorescence images of human primary chondrocytes after 24h of IL-1β stimulation a) chamber slide b) cytospin preparation. iNOS (red) detected by TK 2533 1:100, actin (green); Sigma, nuclei stained by Hoechst (blue). Original magnification 400x.
As indicated by the staining iNOS protein was localized within cell cytoplasm, close to nuclei (Figure 21).
69 4. RESULTS
4.2.4. Time course of NO production, iNOS mRNA and protein expression in human chondrocytes after IL-1ß stimulation
Human chondrocytes in alginate beads were stimulated with IL-1ß and NO production was measured as nitrite accumulation in cell culture supernatant, iNOS mRNA expression was assayed by TaqMan RT-PCR and protein expression by SDS-PAGE and Western blotting. Figure 22a shows the induction of iNOS at mRNA level. The amount of iNOS transcripts was elevated already after 2h of stimulation with IL-1β, the maximum of iNOS transcription was observed after 6h, afterwards the iNOS mRNA level slowly decreased, but after 24h was still significantly higher than in control cells (ca. 75 fold-increase compared to control). Figure 22b illustrates the induction of iNOS on the protein level. A delay of about 2h between mRNA and protein expression was observed. iNOS protein was detectable after 4h of IL-1β stimulation. The staining became more intensive after 6 and 8h of stimulation with a maximum at 12h. After 24h still high levels of iNOS protein were detected. Finally the time course of iNOS dependent NO production was analysed. Figure 22c shows accumulation of nitrite in cell culture medium. Slight increase in nitrite accumulation was observed after 8 and 12h, but it was at the detection limit of the Griess reaction. Significant accumulation of NO was detected after 24h of IL-1β stimulation.
70 4. RESULTS a) iNOS mRNA expression after stimulation with IL-1ß 0,5nM
250,00
200,00
150,00
100,00
50,00 relative expression 0,00 control IL1 2h IL1 6h IL1 8h IL1 24h
IL-1β b) kDA c 2h 4h 6h 8h 12h 24h 188
98 iNOS (120kDa)
62 49 38
28 17 14
c) 0,250
0,200
0,150
0,100 A544-690
0,050
0,000 control 24h IL-1 2h IL-1 6h IL-1 8h IL-1 12h IL-1 24h
- Figure 22. Time course of iNOS mRNA a) and protein expression b) and NO2 production c) of human chondrocytes in alginate beads. Chondrocytes were incubated with IL-1β 0,5nM and incubations were terminated at indicated time points. As control served unstimulated cells after 24h of incubation. One representative experiment is shown. a) iNOS mRNA was measured by TaqMan PCR, results were normalized against 18S, b) Western blot analysis of chondrocyte cell lysates with the same protein content was performed using iNOS ab: Cayman 160862 (1:800) c) NO was measured as nitrite in cell culture supernatant.
71 4. RESULTS
4.2.5. The effect of NOS inhibitors on NO synthesis in human chondrocytes
Human chondrocytes in alginate beads were stimulated with IL-1β in the presence of NO-synthesis inhibitors: 1400W, AMT, L-NMMA and Byk 191023. Intracellular L- arginine levels are critical for NO production as arginine is a substrate for NOS and several NOS inhibitors are competing for its binding side to the enzyme. Therefore experiments were performed in two culture media: standard culture medium with 147,5mg/l arginine and culture medium without arginine.
1400W AMT 120 120 with arginine with arginine 100 100 pIC50 = -5,3 pIC50 = -4,8 slope = -1,3 slope = -1 80 80 w/o arginine w/o arginine 60 60
pIC50 = -6,3 pIC50 = -6,4 40 slope = -1,4 40 slope = -1,1 production[%] production[%] - - 2 2 20 20 NO NO 0 0 -7 -6 -5 -4 -3 -7 -6 -5 -4 -3 log 1400W [M] log AMT [M]
L-NMMA 191023 120 120 with arginine with arginine 100 100 pIC50 = -4,7 pIC50 = -4,5 slope = -1,1 slope = -1,4 80 80 w/o arginine w/o arginine 60 60
pIC50 = -5,5 pIC50 = -5,5 40 slope = -0,9 40 slope = -0,7 production[%] production[%] - - 2 2 20 20 NO NO 0 0 -7 -6 -5 -4 -3 -7 -6 -5 -4 -3 log L-NMMA [M] log 191023 [M]
Figure 23. The effect of various iNOS inhibitors on the IL-1β induced NO production in human chondrocytes cultured in alginate beads. Cells were preincubated with iNOS inhibitors in concentrations indicated for 30 min, and then IL-1β 0,5nM was added to the culture media, following 24h incubation. Afterwards Griess assay in cell culture supernatants was performed. All inhibitors were tested in two different culture media: with arginin (red), or arginin depleted (blue). NO production after IL-1β stimulation was set as 100% in each experiment and % of NO production with inhibitors was calculated. n=4 mean ± SD
72 4. RESULTS
After 24h of incubation NO production was measured as nitrite accumulation in cell culture supernatant. All inhibitors tested inhibited NO production in a concentration-dependent fashion in human OA chondrocytes stimulated with IL-1β in the following order of potency (for medium with arginin): 1400W (highly selective iNOS inhibitor) with half maximum inhibition (IC50) at 5µM, AMT (not selective NOS inhibitor) with IC50 of 16µM, L-NMMA
(not selective NOS inhibitor) with IC50 of 20µM and Byk 191023 (highly selective iNOS inhibitor) with IC50 of 32µM.
In arginin-depleted medium all inhibitors were ca. 10 fold more potent (1400W, IC50
0,5µM; AMT IC50 0,4µM;L-NMMA IC50 3,2µM; Byk 191023 IC50 3,2µM). The depletion of arginin for 24 h had no effect on cellular vitality (data not shown).
4.2.6. The effect of cycloheximide and Byk 17790 on iNOS protein expression
The expression of iNOS protein was detected by SDS-PAGE and Western blotting. As control measurement of nitrite accumulation in cell culture media was performed. Human OA chondrocytes in alginat beads were stimulated with IL-1ß in the presence of protein synthese inhibitor: cycloheximide and transcription inhibitor: BYK 17790. BYK 17790 is a novel compound detected in ALTANA Pharma screening, which inhibits transcription of many inflammatory genes, however the mechanism of action of this compound is not fully elucidated (personal communication, Dr. Thomas Klein). After 24h of stimulation in the presence of these compounds cell lysates with the same protein content were prepared. Both NO production and iNOS protein expression were abrogated by treatment with cycloheximide and Byk17790 (Figure 24). This result clearly demonstrates that NO production in chondrocytes is derived from de novo synthesized iNOS.
73 4. RESULTS
a)
125 1 – control 100 2 - IL-1β 1nM 24h 75 3 – cycloheximide 10µM + IL-1β 4 – Byk 17790 10µM + IL-1β
production 50 - 2 IL-1=100%
NO 25 *** *** 0 1234 b) 1 2 3 1` 2` 3` 4 5 6 7 8
kDA 170 116
76 53
36
Figure 24. a) nitrite accumulation in cell culture supernatant after 24h of chondrocyte incubation. NO production after IL-1β stimulation was set as 100% in each experiment and % of NO production with inhibitors was calculated. n=4 mean ± SD b) Western blot analysis of chondrocyte cell lysates from two separate experiments with the same protein content was performed using iNOS polyclonal ab from Prof. Pfeilschifter (1:500) 1,1´ - control 2,2´ - IL-1β 0,5nM, 24h 3,3´ - cycloheximide 10µM + IL-1β, 24h 4 - Byk 17790 10µM + IL-1β, 24h 5 - iNOS standard (RMCs from Dr. Thomas Klein) 6 - iNOS standard 7 - eNOS standard 8 - nNOS standard
74 4. RESULTS
4.2.7. Nitric oxide production and iNOS gene expression during the course of chondrogenic differentiation
Undifferentiated hMSCs did not produce NO spontaneously or in response to IL-1β - (Figure 25a, day “0”). On the contrary, chondrogenic pellets released low levels of NO2 spontaneously already after 7 days of differentiation and enhanced production of this mediator was observed after stimulation with IL-1β (twofold change). Moreover, IL-1β- - induced NO2 release increased during the course of chondrogenesis and reached highest levels in the third week of differentiation. At this time point IL-1β enhanced the - synthesis of NO2 16-fold in these cells (Figure 25a, day 18). The subsequent decline in - th the rate of NO2 synthesis after IL-1β stimulation occurred from 18 day of pellet culture. The reason for this phenomenon might be reduction of cellular viability, as we observed a decrease of mRNA levels and lower number of cells if the pellets were digested (data not shown). - The level of spontaneously generated NO2 in control pellets was stable during the differentiation course (0,2-0,33 µM). IL-1β induced iNOS gene expression during chondrogenic differentiation correlates with - NO2 generation (Griess assay). According to this we found no iNOS expression in undifferentiated hMSCs in monolayer under basal conditions or after stimulation with IL- 1. However, during chondrogenic differentiation iNOS expression increased in response to IL-1β and reached highest levels in the third week of differentiation (Figure 25b).
75 4. RESULTS a)
7 NO-production control 6 IL-1b 1nM 5 4 [µM] - 2 3 NO 2 1
0 d 7 d 11 d 14 d 18 d 21 d 28 d b)
14 iNOS-expression 12 control IL-1b 1nM 10 8 6 4 rel. expression 2 no expression 0 0 d 7 d 14 d 21 d 28 d
- Figure 25. Induction of NO2 production a) and iNOS gene-expression b) by IL-1 during chondrogenic differentiation (undifferentiated hMSC in monolayer monolayer are given as 0d, than 7, 11, 14, 18, 21, 28 days of differentiation with TGFβ3). Cells were stimulated with IL-1b [1nM] for 24 h. Nitrite accumulation in culture supernatants was measured using Griess assay. Results are given as the mean ±SD (n=2). The expression level of hMSC after 7 days of differentiation was set as one and fold-exchange was calculated. PCR was performed in quadruplicates and data is presented as mean ±SD.
76 4. RESULTS
4.3. Regulation of iNOS in chondrocytes
4.3.1. The effect of Dexamethasone
The evidence regarding the regulation of iNOS expression in chondrocytes through the anti-inflammatory glucocorticoid dexamethasone (Dex) is contradictory. Shalom-Barak demonstrated inhibition of IL-17-induced iNOS protein expression by Dex in normal human articular chondrocytes (Shalom-Barak et al., 1998). In contrast Vuolteenaho has shown Dex insensitivity of iNOS expression in human OA cartilage and murine H4 chondrocyte cell line (Vuolteenaho et al., 2001). Tung reported that IL-1 stimulated iNOS expression in equine articular chondrocytes is Dex sensitive (Tung et al., 2002). The purpose of our investigations was to elucidate the effect of Dex on iNOS expression in chondrocytes. We started with comparison of the Dex effect on COX-2 and iNOS expression in human OA chondrocytes.
4.3.1.1. iNOS and COX-2 are differentially regulated in human chondrocytes To study the effect of Dex on iNOS and COX-2 expression chondrocytes were stimulated with IL-1β in the presence of 10µM Dex over 24h. As control cells stimulated with the iNOS inhibitor AMT, which has no effect on translation or transcription of both enzymes, were used. Afterwards Western blot analysis was performed. Interestingly, dexamethasone failed to inhibit iNOS expression in cells stimulated with IL-1β (Figure 26a), however COX-2 expression was completely inhibited by this anti- inflammatory steroid (Figure 26b). As expected, AMT showed no effect on iNOS and COX-2 expression.
77 4. RESULTS
a) b)
kDA 1 2 3 4 5 1 2 3 4 5 kDA 250 250 148 148
98 98 64 64 50
50 36 36 1 – protein standard a) NOS; b) COX-2 4 – Dex 10µM + IL-1β, 24h 2 - control 5 - AMT 30µM + IL-1β, 24h
3 – IL-1β 1nM, 24h
Figure 26. The effect of Dex and AMT on a) iNOS and b) COX-2 protein expression in human chondrocytes embedded in alginate. Cells were stimulated with IL-1β 1nM in the presence of indicated compounds for 24h and then harvested for protein extraction. iNOS and COX-2 protein were detected by Western blot. Ab: iNOS: kind gift from prof. Pfeilschifter, COX-2 (Cayman).
4.3.1.2. Dexamethasone does not inhibit IL-1β induced NO formation in OA chondrocytes or in hMSCs undergoing chondrogenic differentiation In the next experimental setting we investigated NO formation and iNOS mRNA expression in OA chondrocytes and hMSCs undergoing chondrogenic differentiation. The approach to use hMSCs had two purposes: on the one hand it was a test of iNOS regulation in differentiating hMSCs and on the other hand it served to examine if the Dex phenomenon is limited only to OA affected cartilage or could be specific for all human chondrocytes. We observed that human chondrocytes from OA cartilage cultured in alginate beads - and chondrogenic pellets of differentiated hMSCs generated significant amounts of NO2 after stimulation with 1nM IL-1β (Figure 27). - OA chondrocytes spontaneously released low levels of NO2 in the culture medium - [0,5µM]. IL-1β enhanced NO2 synthesis 30-fold in these cells. Addition of Dex had no - inhibitory effect on NO2 levels (Figure 27a).
78 4. RESULTS
- hMSCs spontaneously released small amounts of NO2 [0,3µM] after having undergone - 14 days of chondrogenic differentiation. IL-1β induced a 10-fold increase in NO2 levels. - Again, Dex had no inhibitory effect on this induction of NO2 production (Figure 27b). a) b)
30 6 25 Chondrocytes 5 hMSC 20 4 [µM] [µM] - - 2
2 15 3 NO NO 10 2 5 1 0 0
nM -1b L .5 I control control + b 0 x -1b 0.5nM IL-1 Dex + IL-1b IL De - Figure 27. NO2 content of culture supernatants of a) articular chondrocytes b) chondrogenic pellets after 14 days of differentiation. The cells were stimulated with IL-1β 1nM for 24h in the absence or presence of 10µM dexamethasone. Values given are means ±SD (a, n=4; b, n=3).
iNOS expression in OA chondrocytes and hMSCs differentiated to chondrocytes correlated with results obtained for NO release (Figure 28). Dexamethasone revealed no inhibitory effect on iNOS mRNA expression. Furthermore even an increase in iNOS mRNA transcripts was observed if the cells were stimulated with IL-1β in the presence of this glucocorticoid. a) b)
Chondrocytes hMSCs
120,00 60,00 100,00 50,00 80,00 40,00 60,00 30,00 40,00 20,00 20,00 10,00 relative expression relative 0,00 expression relative 0,00 control IL-1 Dex + IL-1 control IL-1 Dex + IL-1
Figure 28. Relative gene expression levels of iNOS in a) human chondrocytes embedded in alginate b) chondrogenic pellets after 14 days of differentiation. Cells were stimulated for 24 h with IL-1β 1nM in the absence or presence of dexamethasone 10µM. The expression level of unstimulated cells (control) was set as one and fold-exchange was calculated. PCR was performed in triplicate, For standardization of the gene expression levels determined by TaqMan analysis mRNA derived cDNA signal in each sample was calculated relative to 18s ratio as an internal control. Data are presented as mean ±SD.
79 4. RESULTS
4.3.1.3. Dexamethasone effect on NO production is species-independent We were interested if the Dex effect on chondrocytes was species-specific. Therefore we tested the influence of this glucocorticoid on IL-1 stimulated NO production in bovine, porcine and murine chondrocytes. Chondrocytes from these species were stimulated with IL-1α, which had been shown to be a better stimulus as IL-1β (personal communication, Dr. Gereon Lauer). Chondrocytes from all species after isolation from cartilage were cultured in monolayer under the same culture conditions. Experiments were performed when the cells reached confluency, but not later as 5 days after seeding, to elude dedifferentiation. In chondrocytes from all tested species Dex did not have an inhibitory effect on NO production. Even more a stimulatory effect was observed. Dex elevated the level of IL-1 - stimulated NO2 production from 13,8µM to 22,8µM in porcine chondrocytes (Figure 29a), from 11,6µM to 22,5µM in bovine chondrocytes (Figure 29b) and from 5,9µM to 7,3µM in mouse chondrocytes. Interestingly the Dex stimulatory effect was enhanced in porcine and bovine chondrocytes (murine not tested) if the cells were older and already passaged twice (Figure 29 “old”). In these dedifferentiated cells IL-1 stimulated NO generation was much lower than in fresh cells, however in cells stimulated in the presence of Dex production of high levels of NO after stimulation could be restored. a) b)
fresh 1000 3000 fresh old old 800 2500 2000 600 1500 400 1000 IL-1 = 100% = IL-1 IL-1 = 100% = IL-1 200
nitrite generation 500 nitrite generation 0 0 control IL-1 Dex + IL-1 control IL-1 Dex + IL-1
Figure 29. Effect of dexamethasone on NO generation in a) porcine and b) bovine chondrocytes. The - cells were stimulated with IL-1β 1nM and Dex 10µM for 24h. The level of NO2 was measured in cell - culture supernatant using Griess assay. NO2 level after stimulation with IL-1β was set as 100% in each experiment and other concentrations were calculated. Values given are means ±SD (n=3).
80 4. RESULTS
In dedifferentiated porcine chondrocytes IL-1 stimulated NO production decreased to 2,6µM and was restored to 11,4µM with Dex. In bovine chondrocytes the effect was even more pronounced: from 1,1µM after stimulation with IL-1 to 22µM after Dex treatment. In human OA chondrocytes after cultivation in monolayer Dex did not have this stimulatory effect, but if the cells were cultivated for more than 10 weeks in an alginate bead system similar stimulating effects were observed and the cells produced ca.10x more NO if Dex was present as if they were stimulated only with IL-1 (data not shown).
4.3.1.4. Dexamethasone effect on NO production is independent on stimuli To test if the effect of Dex is IL-1 specific other stimuli known to induce iNOS expression and NO production in chondrocytes were tested. Experiments were performed on dedifferentiated porcine chondrocytes (passage 2) while Dex effect in these cells was more pronounced than in human chondrocytes. For this purpose we tested IL-1, IL-17 alone or in combination with IL-1, TNFα and LPS.
0,35 0,30 0,25 0,20 0,15 A544-690 0,10 0,05 0,00
1 7 x x K ex - ex 1 ex 17 e F ex e IL D - N D PS D L- IL T L + D + D + 1 1+I 7 + - - 1 17 F IL IL - N PS + D IL- IL T L -1+ IL
Figure 30. Effect of dexamethasone [10µM] on NO generation in porcine chondrocytes (passage 2). The cells were stimulated with IL-1β 1nM, IL-17 20ng/ml + IL-1 0,05nM, IL-17 20ng/ml, TNFα 20ng/ml, LPS - 10µg/ml for 24h. The level of NO2 was measured in cell culture supernatant using Griess assay. Values given are means ±SD (n=2).
81 4. RESULTS
To summarize Dex had no inhibitory effect on NO generation independently on used stimuli (Figure 30). However distinct stimulatory effects on NO production were only observed if cells were stimulated with IL-1.
4.3.2. Dexamethasone and the regulation mechanism of iNOS expression
4.3.2.1. NFκB In this part the aim of our study was to investigate effects of Dex on some signalling pathways known to be involved in iNOS regulation in chondrocytes. The transcriptional regulation of iNOS expression is well studied. Heterogeneous signal transduction pathways have been shown to be involved in the regulation of iNOS expression. NFκB is a key transcription factor involved in the expression of iNOS in human cells. Negative regulation of NFκB activation and function by glucocorticoids has been shown as one of the anti-inflammatory mechanism of action of steroids (Smoak and Cidlowski, 2004; Hayashi et al., 2004). Therefore the aim of our experimental setting was to determine the contribution of NFκB to iNOS expression in human chondrocytes and to ascertain if Dex interferes with NFκB signalling pathway in these cells. We used two NFκB inhibitors: Kamebakaurin (KA), which targets directly the DNA binding activity of NFκB and Hypoestoxide (HE), which is a selective and direct inhibitor of IκB kinase. These compounds in concentrations used in performed experiments did not affect chondrocyte viability (data not shown). Human chondrocytes in monolayer or embedded in alginate were preincubated for half an hour with studied compounds and stimulated with IL-1β for the next 24h. As expected Hypoestoxide significantly and in a dose-dependent manner inhibited the NO formation in stimulated human chondrocytes (Figure 31). 10µM HE inhibited IL-1 induced NO formation by about 70%. The inhibitory effect of hypoestoxide was more pronounced in cells grown in monolayer compared to alginate beads. This could depend on the often-observed effect that substances lose their potency if the cells are embedded in alginate.
82 4. RESULTS
a)
125 * 100
75 production
- ** 2 50 (IL-1 = 100%) 25 % of NO 0
l 1 x x M -1 e -1 tro n IL-1 Dex + IL- co + D ex -1 + HE 1µMM 1 + De HE 10µ µM + Dex D 0 µM + IL 1µ 1µM + IL 10 1 + IL E + IL- E E M HE H µ H H 1µM E 10 H HE
b) ns 125
100
75 * production - 2 50 (IL-1 = 100%) 25 % ofNO 0 l -1 -1 tro L ex L n IL-1 I D I + co M+ M + µ L-1 Dex + IL-1 I IL-1 + Dex + 1 µ 10 E E M H H µ 10 E 1 µM + E H H
Figure 31. Effect of dexamethasone [10µM] and hypoestoxide (HE) on NO generation in human chondrocytes a) in monolayer (passage 0 or 1), b) in alginate beads. The cells were preincubated with compounds in indicated concentrations for ½ h followed by stimulation with IL-1β 1nM over 24h. The level - - of NO2 was measured in cell culture supernatant using Griess assay. NO2 level after stimulation with IL- 1β was set as 100% in each experiment and other concentrations were calculated. Values given are means ±SD (a) n=10, b) n=4) Statistical analysis: paired t test ** P<0,01, * P<0,05.
83 4. RESULTS
In the presence of dexamethasone NO generation was significantly higher compared to cells incubated only with NFκB inhibitor and IL-1. This increase in NO production was comparable to enhancement induced by Dex in cells stimulated with IL-1. The data obtained with Kamebakaurin confirmed results obtained with Hypoestoxide. KA, an inhibitor of NFκB binding to DNA, was an even more potent inhibitor of NO formation than Hypoestoxide (Figure 32). 10µM KA almost completely inhibited NO formation. At 1µM KA generation of NO was still more than 50% decreased compared to IL-1 (1µM HE ca. 20% inhibition). These results demonstrate that NFκB mediates IL-1β induced iNOS expression in human chondrocytes hence inhibition of this transcription factor prevents NO production.
125
100
75 production - 2 50 (IL-1 = 100%) 25 % of NO 0
l 1 x 1 x o - M e - e tr µ L n IL-1 IL 0 D I o + 1 + + D c x M + M KA 1µM M + IL-1-1 KA µ µ µ L De 0 0 I A 1 + A 1 A 1 KA 1µMK + DexM K K µ 1 A K KA 10µM + IL-1 + Dex
Figure 32. Effect of dexamethasone [10µM] and kamebakaurin (KA) on NO generation in human chondrocytes in monolayer (passage 0 or 1). Experiments were performed exactly as with HE (Figure 31). n=5
If Dex was present during incubation with KA, slightly higher NO levels were measured in cell culture supernatants.
84 4. RESULTS
The data obtained with Dex and NFκB inhibitors regarding NO synthesis in human chondrocytes indicate that HE and KA did not impair the slight stimulatory effect of Dex, however Dex could not bypass inhibitory effects of NFκB inhibitors on NO synthesis. This indicates that the effect of dexamethasone is not related to NFκB.
4.3.2.2. cAMP cAMP through cyclic AMP-responsive element binding protein (CREB) have been shown to participate in the regulation of iNOS expression. The intracellular concentrations of cAMP are dependent on cAMP formation by adenylate cyclase and by the degradation rate due to PDEs activity. Tenor et al. have shown that PDE4 inhibitors Piclamilast and Roflumilast inhibited IL-1 stimulated NO formation in human chondrocytes by about 40% (Tenor et al., 2002). Influence of Dex on the cAMP signalling pathway had been shown in osteosarcoma cells, where Dex reduced PDE4 expression (Ahlstrom et al., 2005). Rizzoli et al. have shown an increase of adenylate cyclase activity with Dex in rat osteoblastic-like cells (Rizzoli et al., 1986). The aim of the next experimental setting was to investigate if Dex interferes with cAMP regulation of iNOS expression in human chondrocytes. Experiments were performed in the same way as those with NFκB inhibitors. In the first experimental setting dibutyryl cyclic adenosine monophosphate (cAMP), a cell-permeable cAMP analog that preferentially activates cAMP-dependent protein kinases, was used. Dibutyryl-cAMP significantly inhibited NO formation in human chondrocytes (Figure 33a). 50% inhibition of NO generation was observed if chondrocytes were incubated with 1mM cAMP. Interestingly, the slight increase in NO generation, which was noted in cells stimulated with IL-1 or with NFκB inhibitors and IL-1 in the presence of Dex was not observed.
Furthermore, we were interested if PGE2, which is known to increase the intracellular cAMP level (Regan, 2003) (Gerlo et al., 2004; Aronoff et al., 2004), had the same effect as dibutyryl cAMP. Therefore, the experiment was repeated, but with PGE2 in place of cAMP. Both concentrations of PGE2 used (300 and 100nM) inhibited NO formation by about 50% (Figure 33b).
85 4. RESULTS
a)
150
125
100
production 75 - 2 50 (IL-1 = 100%) = (IL-1
25 % of NO 0 1 1 rol -1 IL-1 Dex + + IL-1 + IL-1 x +IL- cont x M ex +IL 300µM e 1000µM µM P µM + IL- De P 0 D 0 M 0 cAM 3 cA µM + D 0 MP 0 cAMP 300µMcA + Dex cAMP 1000µcAMP 100 1000µM + P M cAMP 3 cA
b)
150
125
100
production 75 - 2 50 (IL-1 = 100%) = (IL-1
25 % of NO 0
-1 1 M 1 1 IL IL- IL- IL- + 00nM + control 300n 1 2 2 Dex + Dex +IL-1 Dex +IL-1 0nM 0nM + PGE 300nM 30+ Dex PGE 100nM 10+ Dex 2 E 2 2 E 2 PGE PG 300nM + PGE PG 100nM E 2 E 2 PG PG
Figure 33. Effect of dexamethasone [10µM] and a) dibutyryl-cAMP b) PGE2 on NO generation in human chondrocytes in monolayer (passage 0 or 1). The cells were preincubated with compounds in indicated - concentrations for ½ h followed by stimulated with IL-1β 1nM over 24h. The level of NO2 was measured - in cell culture supernatant using Griess assay. NO2 level after stimulation with IL-1β was set as 100% in each experiment and other concentrations were calculated. Values given are means ±SD a) n=4, b) n=6.
These data confirmed results obtained with cAMP. Additionally, the stimulatory effect of
Dex on NO formation was gone if the cells were stimulated in the presence of PGE2.
86 4. RESULTS
This indicates that the slight stimulatory effect of Dex observed in human chondrocytes could be due to an inhibitory effect of Dex on PGE2 synthesis, which in turn results in lower intracellular cAMP levels and higher expression of iNOS. This hypothesis was also confirmed by experiments performed with Indomethacin (Indo), which is a nonselective COX inhibitor and the Rp-diastereomer of cAMP (Rp- cAMP), a specific membrane-permeable inhibitor of cAMP-dependent protein kinase activation, resistant towards cyclic nucleotide phosphodiesterases (PDEs).
175 150 125 100 production -
2 75
(IL-1 = 100%) = (IL-1 50 25 % of NO 0
l 1 1 1 1 1 ro - - - nt IL-1 IL-1 IL IL- IL IL- IL + co M + M µ µ µM + µM + 0 0 Dex + 0 Dex + 10 0 0 1 3 + + M M do µ Dex In 0 AMP AMP 1 c 30 c 100µ P P Rp Rp AM AM
Rp c Rp c
Figure 34. Effect of dexamethasone [10µM], indomethacin and Rp-cAMP on the NO generation in human chondrocytes in beads. The cells were preincubated with compounds in indicated concentrations for ½ h - followed by stimulated with IL-1β 1nM over 24h. The level of NO2 was measured in cell culture - supernatant using Griess assay. NO2 level after stimulation with IL-1β was set as 100% in each experiment and other concentrations were calculated. Values given are means ±SD n=3
Both compounds showed a reproducible stimulatory effect on NO generation compared with the effect of IL-1. NO production was enhanced by about 25% when COX activity was inhibited or Rp-cAMP antagonized the action of intracellular cAMP (Figure 34). As expected Dex together with Rp-cAMP showed synergistic effects, and in the presence of both compounds the level of NO was ca. 40% higher as by stimulation with IL-1.
87 4. RESULTS
- We could show an inhibitory effect of PGE2 on NO2 formation in human chondrocytes, which confirms the results obtained by Tenor et al. Enhanced NO formation in the presence of Dex resulted from COX-2 inhibition and a PGE2 mediated decrease in intracellular cAMP level.
4.3.3. cAMP but not NFκB regulates PGE2 production in chondrocytes
We controlled the effect of NFκB inhibitors used in our experimental settings on the
PGE2 production and we have not seen any significant inhibitory effect of these compounds on the PGE2 generation in chondrocytes (data not shown).
We were also interested if cAMP levels had an influence on the generation of PGE2 in chondrocytes. Interestingly, we found not only iNOS but also COX-2 to be regulated by cAMP. Figure 35 illustrates the effect of cAMP-level regulating agents: dibutyryl-cAMP and two PDEs inhibitors: PDE4 specific Byk RP73401 and the nonselective PDE inhibitor IBMX on the PGE2 generation in human chondrocytes.
All tested compounds significantly decreased IL-1 stimulated PGE2 production. PGE2 generation was 30% reduced in the presence of cAMP, 40% reduced if PDE4 was inhibited by RP 73401 and finally 50% reduction was observed if the cells were stimulated in the presence of IBMX.
100 Figure 35. Effect of dibutyryl-cAMP, RP 73401 and IBMX on the PGE generation in human 75 2 chondrocytes in monolayer. Cells were preincubated with compounds in indicated 50 concentrations for ½ h followed by stimulated generation
2 with IL-1β 1nM over 24h. The level of PGE2
(IL-1=100%) 25 was measured in cell culture supernatant using PGE GC/MS/MS. PGE2 level after stimulation with IL-1β was set as 100% in each experiment and 0 other concentrations were calculated. Values given are means ±SD n=3 ntrol o IL-1b IL-1b c + + IL-1b M M µM + IL-1b 0 1m 401 1µ 3 cAMP IBMX 30 RP 7
88 4. RESULTS
To elucidate Dex influence on the regulation of iNOS expression in chondrocytes several aspects of this phenomenon were investigated. We could show that effect of Dex is not restricted to OA chondrocytes, but is true for all chondrocytes, as bovine, porcine and murine chondrocytes originating from young animals responded in the same way. Further, we even had the possibility to test Dex on human elbow chondrocytes originating from donor without joint disease history and we observed the same effect as in knee or hip OA chondrocytes (data not shown). Additionally Dex-resistant iNOS expression was even true for human mesenchymal stem cells differentiating to chondrocytes. Furthermore, experiments on chondrocytes originating from diverse animals demonstrated that effect of Dex is not human specific or species specific. However one cannot exclude that there are species where this regulation is different. The iNOS expression was Dex insensitive independently on the used stimulus. A very potent stimulatory effect of Dex on NO production in dedifferentiated chondrocytes was observed, when these cells almost lost their ability to produce NO in response to IL-1 stimulation. Two aspects of signaling mechanism involved in the IL-1 induced NO production in human chondrocytes were investigated: NFκB and cAMP regulation of iNOS expression. IL-1 induced NO production in human chondrocytes is dependent on the NFκB activation hence inhibition of NFκB DNA binding aborted the production of nitrite. Intracellular cAMP levels also regulate NO production. We conclude that both signalling pathways are involved in iNOS regulation in human chondrocytes and are not influenced by Dex. Furthermore, the stimulatory effect of Dex on NO production in human chondrocytes compared to cells stimulated only with IL-1 could be due to COX-2 inhibition followed by a decrease in intracellular cAMP. An interesting “side effect” of our control experiments is a new insight in the COX-2 regulation in human chondrocytes. NFκB inhibitors had no impact on COX-2 expression. In contrast to this we could show that intracellular cAMP levels regulate not only iNOS, but also COX-2 expression.
89 4. RESULTS
4.4. Effects of NO on the chondrocyte gene expression
4.4.1. Effects of NO on chondrogenic differentiation
As we were able to demonstrate chondrogenic differentiation and expression of chondrocyte specific genes in the hMSCs pellet model (chapter 4.1) we were interested if NO has an influence on chondrogenic differentiation. Therefore hMSCs were differentiated in the presence of NO donors. In the first experimental setting hMSCs from two bone marrow donors were pelleted and cultured in the presence of 2,5µM DETA NONOate. The NO-donor was present in the culture medium during the whole differentiation time (up to 3 weeks), medium with freshly prepared NO donor was changed every 48h. DETA NONOate spontaneously dissociates in a pH-dependent, first-order process with a half-life of 20 hours at 37°C, pH 7.4, to liberate 2 moles of NO per mole of parent compound. Decomposition of NONOates is nearly instantaneous at pH 5 (Hrabie et al., 1993). The concentration of DETA NONOate was chosen in connection with reported levels of NO in synovial fluid of patients with OA: 3.4 ± 2.0 µM (Brenner et al., 2004). During the differentiation course chondrogenic pellets were harvested after 6, 13, 20 and 27 days of differentiation. After RNA isolation PCR analysis concerning SOX-9, HIF-1α, VEGF, iNOS, COX-2, PCS, collagen II, collagen I, collagen X and aggrecan expression levels was performed. In this preliminary experiment there were almost no differences in the expressions levels of studied genes between cells differentiated with and without NO-donor. Slight increases in SOX-9, collagen II, VEGF and PCS transcript levels could be detected if DETA NONOate was present in the differentiation medium (data not shown). Collagen 10 levels were lower, when NO was present during the differentiation time (data not shown). We believed, that lack of a distinct effect of NO on chondrogenic differentiation could be due to the low concentration of DETA NONOate. Therefore in the next experimental setting concentration of DETA NONOate was increased to 50µM during the whole differentiation course of hMSCs originating from two bone marrow donors. Additionally
90 4. RESULTS
after 6, 13, 20, 27 days of differentiation in the presence of NO donor cells were stimulated for further 24h with IL-1β (NO-donor was still present in the culture medium). Again analysis of expression levels of several genes important for chondrocyte physiology was performed.
Collagen 1 expression: The expression of this collagen was quite stable during the whole differentiation course. DETA NONOate had no effect on collagen 1 expression. The decrease in collagen 1 transcripts level was observed after incubation with IL-1β on the day 14 and 21 (Figure 36).
Col 1 expression control IL-1 1nM 2,00 NONO 50µM NONO+IL-1 1,50
1,00
0,50 relative expression relative 0,00 7142128 days
Figure 36. The effect of DETA NONOate and IL-1β on the relative gene expression levels of collagen 1 during chondrogenic differentiation. The expression level of control cells after 7 days of chondrogenesis was set as one and fold-exchange was calculated. PCR was performed in triplicates. For standardization of the gene expression levels determined by TaqMan analysis mRNA derived cDNA signal in each sample was calculated relative to 18s ratio as an internal control. Data are presented as mean ±SD.
Collagen 2 expression: Collagen 2 was differently expressed during the differentiation cycle (Figure 37). Expression values detected under the basal differentiation conditions were very low. Suprisingly the expression rate in cells differentiated in the presence of 50µM DETA NONOate was much higher. The incubation of cells with IL-1β led to suppression of collagen 2 expression.
91 4. RESULTS
Col 2 expression control IL-1 1nM 8000,00 NONO 50µM 7000,00 NONO+IL-1 6000,00 5000,00 4000,00 3000,00 2000,00 1000,00 relative expression relative 0,00 7142128 days
Figure 37. The effect of DETA NONOate and IL-1β on the relative gene expression level of collagen 2 during chondrogenic differentiation. Experiments were performed in the same way as for Col 1.
Collagen 10 expression: DETA NONOate had no effect on collagen 10 expression (Figure 38). Number of collagen 10 transcripts in the first three weeks of chondrogenic differentiation was significantly down-regulated if the cells had been exposed to IL-1β.
Col 10 expression control IL-1 1nM 5,00 NONO 50µM 4,00 NONO+IL-1
3,00
2,00
1,00 relative expression 0,00 7142128 days
Figure 38. The effect of DETA NONOate and IL-1β on the relative gene expression levels of collagen 10 during chondrogenic differentiation. Experiments were performed in the same way as for Col 1.
92 4. RESULTS
iNOS expression: iNOS was not expressed in hMSC monolayer nor basal neither after stimulation with IL-1β and NONOate incubation. After 7 days of chondrogenic differentiation low levels of iNOS transcripts were found also in the control cells, however IL-1β was able to increase this level 30- fold (Figure 39). Interestingly the highest iNOS expression has been observed in cells which were differentiated in the presence of DETA NONOate and then stimulated for 24h with IL-1β. This tendency was observed in the first three weeks of differentiation. In the 4th week of differentiation expression of iNOS after 24h of stimulation with IL-1β in the cells differentiated with NO- donor was decreased in comparison to control cells.
iNOS expression control 120,00 IL-1 1nM 100,00 NONO 50µM NONO+IL-1 80,00 60,00 40,00 20,00 relative expression relative 0,00 7142128 days
Figure 39. The effect of DETA NONOate and IL-1β on the relative gene expression levels of iNOS during chondrogenic differentiation. Experiments were performed in the same way as for Col 1.
COX-2 expression: The expression of COX-2 was highest on the7th day of differentiation, afterwards basal and IL-1 stimulated expression of COX-2 gene declined. DETA NONOate decreased basal and IL-1β stimulated amounts of COX-2 mRNA transcripts (Figure 40).
93 4. RESULTS
COX-2 expression control 14,00 IL-1 1nM 12,00 NONO 50µM 10,00 NONO+IL-1 8,00 6,00 4,00 2,00 relative expression 0,00 7 142128 days
Figure 40. The effect of DETA NONOate and IL-1β on the relative gene expression levels of COX-2 during chondrogenic differentiation. Experiments were performed in the same way as for Col 1.
IL-1 expression: IL-1 expression was strongly upregulated in hMSC monolayer after stimulation with IL-1β (data not shown). Interestingly, after beginning of chondrogenic differentiation there were several samples where any IL-1β transcripts were detected although the cells had been stimulated (day 14th).
IL-1 expression control IL-1 1nM 300,00 NONO 50µM 250,00 NONO+IL-1 200,00 150,00 100,00 50,00 relative expression relative 0,00 7142128 days
Figure 41. The effect of DETA NONOate and IL-1β on the relative gene expression levels of IL-1 during chondrogenic differentiation. Experiments were performed in the same way as for Col 1.
94 4. RESULTS
However, in other stimulated cells high expression of IL-1β was observed. Therefore it is difficult to evaluate the results obtained with DETA NONOate. Clearly, there was no expression of IL-1β in unstimulated chondrogenic pellets (Figure 41).
IL-6 expression: This cytokine was not expressed in unstimulated cells independently on the differentiation status and presence of NO-donor. After treatment with IL-1β levels of IL-6 mRNA transcripts significantly increased. DETA NONOate had no effect on the rate of IL-6 transcription (Figure 42).
IL-6 expression control IL-1 1nM 500,00 NONO 50µM 400,00 NONO+IL-1
300,00
200,00
100,00 relative expression relative 0,00 7142128 days
Figure 42. The effect of DETA NONOate and IL-1β on the relative gene expression levels of IL-6 during chondrogenic differentiation. Experiments were performed in the same way as for Col 1.
RUNX-2 expression: High levels of RUNX-2 expression were observed in stem cells before differentiation (data not shown). In the first week of differentiation the expression of this transcription factor declined to about 30% of control, but with the course of differentiation increasing levels of RUNX-2 were detected. Regulation of RUNX-2 expression could only be seen on the 21st day of chondrogenic differentiation; a slight increase in mRNA levels in pellets differentiated in the presence of DETA NONOate was observed and suppression of RUNX-2 expression by IL-1β; NO donors had no influence on this suppression (Figure 43).
95 4. RESULTS
RUNX-2 expression control IL-1 1nM 12,00 NONO 50µM NONO+IL-1 10,00 8,00 6,00 4,00 2,00 relative expression relative 0,00 7 142128 days
Figure 43. The effect of DETA NONOate and IL-1β on the relative gene expression levels of RUNX-2 during chondrogenic differentiation. Experiments were performed in the same way as for Col 1.
ADAMTS 5 expression: Expression of this aggrecanase was observed in undifferentiated hMSCs and was slightly up-regulated with IL-1β (data not shown). In the first week of chondrogenic differentiation the expression level of ADAMTS 5 was very low, but continously increased with the differentiation time. The expression of ADAMTS 5 was elevated by the stimulation with IL-1β, but there was no effect noticed with DETA NONOate (Figure 44).
ADAMTS 5 expression control IL-1 1nM 25,00 NONO 50µM 20,00 NONO+IL-1
15,00
10,00
5,00 relative expression 0,00 7 142128 days
Figure 44. The effect of DETA NONOate and IL-1β on the relative gene expression levels of ADAMTS 5 during chondrogenic differentiation. Experiments were performed in the same way as for Col 1.
96 4. RESULTS
4.4.2. Effects of NO on OA chondrocytes
NO has been discussed as a mediator of chondrocyte catabolism and the driving force of cartilage pathophysiology since more than 10 years. To test this hypothesis chondrocytes were incubated with the NO donor: DETA NONOate and the peroxynitrite donor: SIN-1 with or without IL-1β for 24h, afterwards several analyses of chondrocyte – physiology - related gene expression were performed. Experiments were run in three replicates, two of them on OA chondrocytes embedded in alginate beads and third on chondrocytes in monolayer (primary culture, without passage to avoid dedifferentiation). Experiments in monolayers served as a control, to prove that the alginate matrix had not protected chondrocytes from action of tested agents. The results obtained from both cell culture types were very consistent.
Collagen 1 expression: interestingly relative high expression levels of collagen 1 were found in human chondrocytes cultured in alginate beads and in monolayer. IL-β significantly decreased collagen 1 expression. Neither DETA NONOate, nor SIN-1 had effects on collagen1 expression in human chondrocytes (Figure 45).
collagen 1 Figure 45. The effect of DETA NONOate and SIN-1 on the relative 150 gene expression levels of collagen 1 in human chondrocytes. Experiments were run in three replicates, two of 100 them on chondrocytes embedded in alginate beads and third on chondrocytes in monolayer. The c=100% 50 expression level of control cells was set as 100% and fold-exchange was calculated. For standardization of the collagen 1 expression 0 gene expression levels determined l by TaqMan analysis mRNA derived o r -1b t L cDNA signal in each sample was on IL-1b I c calculated relative to 18s ratio as an SIN 50µM DETA 50µM internal control. Data are presented
SIN 50µM + as mean ±SD. DETA 50µM + IL-1b
97 4. RESULTS
Collagen 2 expression: High expression levels of collagen II were observed in unstimulated human chondrocytes. Collagen 2 levels decreased after treatment with IL- 1β. NO- and peroxynitrite donors had no effect on collagen 2 expression (Figure 46)
collagen 2 150
Figure 46. The effect of DETA 100 NONOate and SIN-1 on the relative gene expression levels of collagen 2 in human chondrocytes. Experiments c=100% 50 were performed in the same way as by collagen 1.
collagen 2 expression 0 l o r -1b -1b µM L µM L IL-1b 0 I 0 I cont + + TA 5 M M E SIN 5 µ D 0µ 5 A IN 50 ET S D
Collagen 10 expression: collagen 10 transcription rate was regulated in the same way as collagens 1 and 2. IL-1β down regulated expression of this collagen, DETA NONOate and SIN-1 had no effect (Figure 47).
collagen 10 150 Figure 47. The effect of DETA NONOate and SIN-1 on the relative 100 gene expression levels of collagen 10 in human chondrocytes. Experiments were performed in the same way as by c=100% 50 collagen 1.
collagen 10 expression 0 l o r -1b -1b µM L µM L IL-1b 0 I 0 I cont + + TA 5 M M E SIN 5 µ D 0µ 5 A IN 50 ET S D
98 4. RESULTS
Aggrecan expression: Aggrecan was highly expressed in chondrocytes. DETA NONOate and SIN-1 did not change the expression rate of this gene. The slight decrease in aggrecan expression had been noted, if the cells were incubated with IL-1β. But inhibitory effect of IL-1 on aggrecan expression was not so abundant as effects of this cytokine on collagen expression (Figure 48).
Aggrecan 150
Figure 48. The effect of DETA 100 NONOate and SIN-1 on the relative gene expression levels of aggrecan in human chondrocytes. Experiments
c=100% 50 were performed in the same way as by collagen 1.
aggrecan expression 0 l o r -1b -1b µM L µM L IL-1b 0 I 0 I cont + + TA 5 M M E SIN 5 µ D 0µ 5 A IN 50 ET S D
SOX-9 expression: this transcription factor was present in OA chondrocytes. IL-1, DETA NONOate and SIN-1 weakly decreased expression of SOX-9. IL-1β had had stronger inhibitory effect than DETA NONOate and SIN-1. Co-treatment with IL-1β and NO donors had the strongest inhibitory effect, which was a sum of individual effects of both used agents (Figure 49).
99 4. RESULTS
SOX-9 150 Figure 49. The effect of DETA NONOate and SIN-1 on the relative 100 gene expression levels of SOX-9 in human chondrocytes. Experiments were performed in the same way as by
c=100% 50 collagen 1.
SOX-9 expression
0 l o r -1b -1b µM L µM L IL-1b 0 I 0 I cont + + TA 5 M M E SIN 5 µ D 0µ 5 A IN 50 ET S D
iNOS expression: as expected IL-1β upregulated iNOS mRNA synthesis, DETA NONOate and SIN-1 had slight inhibitory effect on iNOS expression (Figure 50).
Figure 50. The effect of DETA iNOS NONOate and SIN-1 on the relative gene expression levels of iNOS in 150 human chondrocytes. Experiments were run in three replicates, two of them on chondrocytes embedded in 100 alginate beads and third on chondrocytes in monolayer. The expression level of cells stimulated
IL-1=100% 50 with IL-1 was set as 100% and fold- exchange was calculated. For iNOS expression standardization of the gene 0 expression levels determined by l o TaqMan analysis mRNA derived r -1b -1b µM L µM L IL-1b 0 I 0 I cDNA signal in each sample was cont + + TA 5 M M calculated relative to 18s ratio as an E SIN 5 µ D 0µ 5 internal control. Data are presented A IN 50 ET S as mean ±SD. D
100 4. RESULTS
COX-2 expression: IL-1β stimulated expression of COX-2 gene, DETA NONOate and SIN-1 had no effect on basal COX-2 expression, but significantly down-regulated stimulated with IL-1 expression of this gene (Figure 51).
COX-2 150
Figure 51. The effect of DETA 100 NONOate and SIN-1 on the relative gene expression levels of COX-2 in human chondrocytes. Experiments were performed in the same way as by IL-1=100% 50 iNOS.
COX-2 expression
0 l o r -1b L-1b ont I IL c + SIN 50µMµM DETA 50µM 0 5 IN S DETA 50µM + IL-1b IL-1β and IL-1 receptor antagonist expression: both genes were up-regulated with IL-1β, DETA NONOate and SIN-1 had a weak inhibitory effect on the expression of IL- 1β (Figures 52 and 53). DETA NONOate inhibited also slightly IL-1 receptor antagonist expression, however SIN-1 had no effect (Figure 53).
IL-1beta
150
Figure 52. The effect of DETA 100 NONOate and SIN-1 on the relative gene expression levels of IL-1β in human chondrocytes. Experiments were performed in the same way as by
IL-1=100% 50 iNOS. IL-1 expression
0 l o b r -1b -1 -1b L µM L L I 0 I 0µM I + 5 + cont A 5 N T I M S µ DE 0 5 A 50µM N T I E S D
101 4. RESULTS
IL-1 receptor antagonist
150 Figure 53. The effect of DETA NONOate and SIN-1 on the relative 100 gene expression levels of IL-1 receptor antagonist in human chondrocytes. Experiments were
IL-1=100% 50 performed in the same way as by iNOS. IL-1 Ra expression 0
ol b r M M -1b IL-1 0µ 0µ cont 5 + IL-1b 5 M IN ETA S D
SIN 50µM + IL DETA 50µ
In conclusion: catabolic action of IL-1β on cartilage shown often previously was confirmed by our results. IL-1β decreased expression of collagens, aggrecan and the important chondrogenic transcription factor – SOX-9. Proinflammatory genes as iNOS, COX-2, IL-1 were strongly up-regulated by this cytokine. On the other hand also IL-1 receptor antagonist was up-regulated after stimulation with IL-1β, this can represent a negative feedback-loop regulation. DETA NONOate and SIN-1 had no effect on the expression of studied ECM molecules. This shows that IL-1acts directly as a catabolic factor and not via NO. This was also verified by incubation of the cells with IL-1β and iNOS inhibitor AMT, where AMT did not abolished the effect of IL-1 (data not shown). Slight down regulation of COX-2 mRNA transcripts in the presence of DETA NONOate and SIN-1 could be a result of 1) down-regulation of transcription rate or 2) faster degradation of COX-2 transcripts in the presence of nitric oxide or its derivates. These results show how important it is to distinguish between action of IL-1β and nitric oxide.
102 4. RESULTS
4.5. Effects of IL-1 on the chondrocyte gene expression
4.5.1. Affymetrix gene chip characterization of IL-1β regulated genes in the hMSCs differentiation model
Many of IL-1β effects on chondrocyte gene expression were postulated to be due to up regulation of iNOS and enhanced NO production, however many of them were based just on the correlation between increased NO production and observed effects. Therefore we performed a detailed analysis of IL-1 regulated genes also in the cells, which were stimulated in the presence of iNOS inhibitors to elucidate direct effects of IL- 1 on gene expression and these which could be NO mediated. In our first experimental setting we investigated IL-1 regulated genes in chondrogenic pellets from 4 bone marrow donors. Pellets were stimulated for 24h with 1nM IL-1β at different time points of differentiation (0, 7, 11, 14, 18, 20, 33, 52 days). Afterwards results obtained for cells stimulated with IL-1 were compared with results obtained for control pellets at each differentiation time point using following calculations:
• T test, median fold change cutoff 0.7/1.3x; p value cutoff 0.001 (comparisons at days 0 and 11) and 0.01 (comparisons at days 7 and 14)
• log log plots of all vs all within a certain day group, fold change cutoff 1.5x (comparisons at days 18 and 53), 2x (comparison at day 20) and 3x (comparison at day 33); all days where further reduced by median fold change cutoff 0.7/1.3x
• total probe sets (ps) from above methods: – 139 upregulated ps – 35 downregulated ps
103 4. RESULTS
• absent/present analysis, p value cutoff 0.05 combinations days: 0-7, 0-11, 0-14, 7-11, 7-14, 11-14 – 70 upregulated ps – 8 downregulated ps
Lists of IL-1 regulated genes are presented in the supplement: Tables: VII - X.
Among up-regulated genes after IL-1 treatment are e.g. NFκB, COX-2 (PTGS2), PTGES, PTGER4 (prostaglandin E receptor subtype EP4), interleukins (1β, 6, 8 and 11), chemokines, metalloproteases (MMP1, MMP3, MMP12, ADAMTS5), GTP cyclohydrolase 1 (GCH1), enzyme which synthesizes tetrahydrobiopterin, a cofactor for iNOS, genes related to TNFα but also adhesion molecules as ICAM1, VCAM1 and NRCAM. Some anabolic genes like BMP2 and FGF2 were also up-regulated. Interestingly significantly elevated levels of metallothioneins (1F, 1G, 1H, 1K, 1X, 2A) were expressed after IL-1β stimulation and also SOD2 was heavily induced.
Interestingly, among up-regulated genes there are several genes like proteases which have been shown as related to the development of OA but also genes, which haven’t been previously associated with this disease and could serve as potential targets for further investigations.
4.5.2. Affymetrix gene chip characterization of IL-1β regulated genes in human chondrocytes, effect of iNOS inhibition
The predominant role of IL-1β in the development of OA is well established, however several detrimental effects of this cytokine have been implicated to be dependent on up- regulation of iNOS and NO synthesis.
104 4. RESULTS
To elucidate which effects are mediated by NO and which are directly due to the action of IL-1 human chondrocytes in alginate beads were stimulated for 24h with IL-1β in presence or absence of iNOS inhibitors. We used two inhibitors: 1400W (10µM) and BYK191023 (30µM) to exclude substance-specific effects. Additionally substances were also tested in control conditions. After 24h stimulation was controlled with Griess assay and cells were harvested for RNA isolation. Experiments were performed in 5 replicates. RNA was assayed with Affymetrix chips HG-U133_Plus_2 containing 54675 probe sets.
Calculations of results was performed as listed below: • comparisons performed: – control vs IL1B – IL1B vs IL1B+1400W Æ target effects – IL1B vs IL1B+191023 Æ target effects – control vs 1400W Æ off-target effects – control vs 191023 Æ off-target effects None of the genes which were regulated already by iNOS inhibitors in control conditions (off-target effects) were upregulated in cells stimulated with IL-1 (target effects).
• tests applied for filtering of regulated probe sets in obtained data: – absence / presence anlysis, p value cutoff 0.05 – T-test, p value cut-off 0.001; median fold change, cutoff 0.7/1.3x
Using the t-test method 441 probe sets were identified as increased over 1,3-fold after IL-1β treatment in comparison to control. Additionally 149 probe sets were detected using absence/presence analysis. Both analyses revealed 590 probe sets up regulated after IL-1 treatment in human chondrocytes.
All IL-1β up-regulated genes are listed in the supplement Table XI.
105 4. RESULTS
Between IL-1β up-regulated genes we have found: NFκB, several chemokine ligands, interleukins (IL-1α and β, 10, 11, 20, 24), iNOS, GCH1, PLA2 (phospholipase A2), COX-2, PTGER2 (prostaglandin E receptor subtype EP2), MMP10, TNFα and a number of genes related to TNFα, GCH1 and ICAM1. Interestingly also genes related to chondrocyte differentiation were up-regulated by IL- 1β as e.g. SOX 7,11,17, WNT5A, BMP6. Afterwards a search for IL-1 up-regulated genes, which were down regulated with iNOS inhibitors, was performed (T-test, p value cutoff 0.001; median fold change IL-1 vs IL-1 + inhibitor cutoff 0.7x; additionally absence/presence analysis, p value cutoff 0.05).
Analysis revealed 5 genes down-regulated by treatment with Byk191023 and upregulated in IL-1 alone and 30 genes down-regulated by treatment with 1400W.
All Byk191023 down-regulated genes in IL-1 stimulated cells are listed in the Table11.
Table 11. Genes detected as down-regulated by Byk191023 [30µM] and upregulated in IL-1 alone. In the table are given: gene symbol; the mean of normalized expression values for control cells, IL-1 stimulated cells, cells stimulated in the presence of Byk191023 and 1400W (for comparison); description of the gene and Affymetrix identifier.
Symbol control IL1B IL1+191023 IL1+1400W Description Probe set Hypothetical protein LOC338817, 1557826_at 0 164 0 0 mRNA 1557826_at 1568799_at 0 162 0 132 Clone IMAGE:4798168, mRNA 1568799_at 225033_at 2449 8606 6530 6627 Clone IMAGE:4401795, mRNA 225033_at ENO2 3068 10580 3681 2704 enolase 2 (gamma, neuronal) 201313_at glucan (1,4-alpha-), branching GBE1 28370 38100 27130 25160 203282_at enzyme 1
All 1400W down-regulated genes in IL-1 stimulated cells are listed in the Table 12.
Both iNOS inhibitors down regulated only two genes: enolase 2 gamma, neuronal (ENO2) and glucan (1,4-alpha-), branching enzyme1 (glycogen branching enzyme) (GBE1).
106 4. RESULTS
Table 12. Genes detected as down-regulated by 1400W [10µM] and upregulated in IL-1 alone. In the table are given: gene symbol; the mean of normalized expression values for control cells, IL-1 stimulated cells, cells stimulated in the presence of 1400W and Byk191023 (for comparison); description of the gene and Affymetrix identifier.
Symbol control IL1B IL1+1400W IL1+191023 Description Probe set agmatine ureohydrolase 219792_at AGMAT 0 168 0 176 (agmatinase) chromosome 20 open reading frame 225252_at C20orf139 2774 4650 3010 4273 139 cyclin-dependent kinase inhibitor 1A 202284_s_at CDKN1A 3554 7398 5686 6006 (p21, Cip1) EGLN3 622 1164 517 407 egl nine homolog 3 (C. elegans) 219232_s_at ENO2 3068 10580 2704 3681 enolase 2 (gamma, neuronal) 201313_at ERO1L 1528 3093 1446 1758 ERO1-like (S. cerevisiae) 225750_at EVC 0 312 0 279 Ellis van Creveld syndrome 219432_at glucan (1,4-alpha-), branching GBE1 28370 38100 25160 27130 203282_at enzyme 1 HK2 3710 12730 6680 6872 hexokinase 2 202934_at heterogeneous nuclear 214280_x_at HNRPA1 9823 15010 9661 9382 ribonucleoprotein A1 insulin-like growth factor binding 212143_s_at IGFBP3 20060 76840 28900 37170 protein 3 JMJD1A 2042 4632 2483 2696 jumonji domain containing 1A 212689_s_at LIMK2 511 1116 399 554 LIM domain kinase 2 221756_at LOC284207 10650 20400 14440 15114 hypothetical protein LOC284207 225955_at LOC56270 3596 6001 4406 3933 hypothetical protein 628 209076_s_at low density lipoprotein receptor- 227337_at Lrp2bp 2190 4353 2244 2702 related protein binding protein MXI1 5584 10050 4185 4356 MAX interactor 1 202364_at 6-phosphofructo-2-kinase/fructose- 202464_s_at PFKFB3 6984 17230 8865 9544 2,6-biphosphatase 3 PFKP 9251 17647 11360 13190 phosphofructokinase, platelet 201037_at RAI3 846 1776 974 1040 retinoic acid induced 3 212444_at RIS1 2201 6993 2713 4274 Ras-induced senescence 1 213338_at SLC16A1 1176 3426 1685 2041 solute carrier family 16 member 1 202234_s_at SLC2A1 1889 5156 1652 2421 solute carrier family 2 member 1 201250_s_at SUI1 26771 47233 32953 37010 putative translation initiation factor 202021_x_at SUI1 28650 46808 35450 38792 putative translation initiation factor 212130_x_at TFRC 17347 26073 17873 21340 transferrin receptor (p90, CD71) 207332_s_at TNFRSF10 7299 12320 9072 9522 tumor necrosis factor receptor 227345_at D superfamily, member 10d TRIM16 537 2125 868 1111 tripartite motif-containing 16 204341_at TXNIP 8775 14190 6764 8779 thioredoxin interacting protein 201010_s_at 232484_at 706 1135 823 874 LOC388443 (LOC388443), mRNA 232484_at
The same criteria was used for selection of IL-1 down-regulated genes. 1343 probe sets were found as down-regulated after IL-1 treatment in human chondrocytes. As expected expression of several genes related to cartilage matrix was down-regulated (collagens, integrins, hyaluronan and proteoglycan link protein 1).
All IL-1β down-regulated genes are listed in the supplement Table XII.
107 4. RESULTS
Analysis revealed 175 genes up-regulated by treatment with 1400W and 91 genes up- regulated by treatment with Byk191023. These genes are listed in the supplement Table XIII and XIV. However, iNOS inhibitors used had very weak effect on the gene expression in human chondrocytes. This was confirmed by clustering analysis, were experiments formed two main clusters: control and IL-1 (Figure 54).
Figure 54. Clustering analysis of Affymetrix experiments obtained for human chondrocytes in alginate beads (description in text).
108 4. RESULTS
4.6. Effects of NO on the eicosanoid production
4.6.1. Eicosanoid production in human chondrocytes and hMSCs
PGE2 is a proinflammatory mediator, which role in the development of OA is well established. An effect of nitric oxide on PGE2 production in cartilage was speculated before (Amin et al., 2000). There is also evidence from other cell types showing an influence of NO on PGE2 production (Landino et al., 1996; Bunderson et al., 2002; Clancy et al., 2000; Goodwin et al., 1999). We were interested if there is an effect of NO on prostaglandin synthesis in human chondrocytes. Although there are many studies dealing with the role of PGE2 in OA pathophysiology other aspects of COX-activity have not been sufficiently studied. Therefore, before we started to investigate NO – COX interactions in chondrocytes a detailed characterization of COX-2 expression and eicosanoid production was essential.
Eicosanoid production Figure 55.a shows the spectrum of prostanoid production by human chondrocytes from OA cartilage cultured in alginate beads. Human chondrocytes released a broad spectrum of prostanoids: PGE2, PGI2 (shown as 6-keto-PGF1α the stable product of prostacyclin hydrolysis), TxB2, PGD2, PGF2α, F-isoprostanes and 8-epi- PGF2α. Under
basal conditions PGE2, TxB2B , and isoprostanes were the major COX-products released by human chondrocytes (for exact concentrations see Table 13.a).
IL-1β treatment resulted in average 14-fold induction of PGE2 synthesis in comparison to control. The production of 6-keto-PGF1α, PGD2, PGF2α and 8-epiPGF2α was also
upregulated (1,6-4 fold) whereas synthesis of TxBB2 and isoprostanes remained unchanged. The total amount of other prostanoids was several fold smaller than the amount of PGE2. Enhanced production of prostanoids after IL-1β stimulation was inhibited by dexamethasone and diclofenac.
109 4. RESULTS
350 Chondrocytes 250
control 150 IL-1b 1nM 40 IL-1b + Dex IL-1b + Diclo 20 Prostaglandin [ng/ml] Prostaglandin 0 2 2 1a D 2a st. GF o PGE2 TxB2 P PG PGF i pr -PGF so -I 6-k 8-ep F
1300 800 hMSC 300 control IL-1b 1nM IL-1b + Dex 30 20 10 Prostaglandin [ng/ml] Prostaglandin 0 2 E2 1a B D2 F x G PG T P iPGF2 -PG PGF2a k -ep 6- 8 F-Isoprost.
Figure 55. Prostanoids content [ng/ml] of culture supernatants of a) articular chondrocytes and b) chondrogenic pellets after 6 days of differentiation, ca.0,5 mln cells/ml. The cells were stimulated with IL- 1β 1nM for 24h in the absence or presence of 3µM dexamethasone and 10µM diclofenac (data only for chondrocytes). Values given are means ±SEM (a, n=4; b, n=3).
110 4. RESULTS
Table 13. Prostanoids content [ng/ml] of culture supernatants of articular chondrocytes (a) and chondrogenic pellets after 6 days of differentiation (b). The cells were stimulated with IL-1β 1nM for 24h in the absence or presence of 3µM dexamethasone. Values given are means ±SEM (a, n=4; b, n=3). a) Chondrocytes IL-1b 1nM control IL-1β 1nM + 10µM Dex PGE2 14,36±16,51 202±52 18,81±8,81 6-k-PGF1a 0,54±0,26 2,05±1,6 0,64±0,5 TxB2 9,79±2,59 10,06±2,32 8,81±4,29 PGD2 0,15±0,03 0,29±0,13 0,18±0,13 PGF2a 0,81±0,3 3,32±1,52 2,39±3,09 F-Isoprost. 7,74±4,87 10,27±3,02 4,73±1,98 8-epiPGF2 0,09±0,05 0,15±0,08 0,09±0,01 b) hMSCs IL-1b 1nM control IL-1β 1nM + 10µM Dex PGE2 546 ±363 862±355 13,02±10,15 6-k-PGF1a 2,69±1,98 3,39±1 0,26±0,26 TxB2 0,31±0,21 0,32±0,14 0,12±0,12 PGD2 0,07±0,05 0,11±0,07 0,02±0,00 PGF2a 9,86±6,48 15±6,34 0,54±0,1 F-Isoprost. 0,00±0,00 0,00±0,00 0,00±0,00 8-epiPGF2 1,72±1,14 0,72±1,17 0,16±0,01
The spectrum of eicosanoid production by hMSCs differentiated into chondrocytes in the pellet culture system is shown on the Figure 55.b. hMSCs released PGE2, PGI2,
TxB2, PGD2, and PGF2α during chondrogenic differentiation (for exact concentrations see Table 13.b). We did not detect F-isoprostanes except 8-epi PGF2α. Interestingly spontaneous release of PGE2 was much higher in pellets at the beginning of differentiation than in chondrocytes.
Additionally, there was a big difference in spontaneous PGE2 release between chondrogenic pellets using hMSCs originating from different bone marrow donors. Both spontaneous and IL-1β-induced PGE2 production was inhibited by dexamethasone.
111 4. RESULTS
Chondrogenic pellets under basal and stimulated conditions released higher amounts of
PGF2α than chondrocytes, while production of TxB2 was higher in chondrocytes.
4.6.2. COX-2 expression during chondrogenic differentiation
As mentioned before we noted wide-ranging differences in amounts of prostanoids generated by differentiating hMSCs. To better characterize this phenomenon COX-2 expression was assessed during the differentiation course of hMSCs. Very high levels of COX-2 transcripts were found in unstimulated hMSCs after 6 days of chondrogenic differentiation, afterwards this expression of COX-2 gene declined, to achieve very low levels already at day 11 (Figure 56).
6.5 COX-2-exp control IL-1ß 5.0 3.5 2.0 1.25 1.00 0.75
relative expression relative 0.50 0.25 0.00 6 7 11 13 14 18 21 25 32 46 Figure 56. Relative gene expression levels of COX-2 during chondrogenic differentiation. The expression level of hMSCs after 6 days of chondrogenic differentiation was set as one and fold-exchange was calculated. PCR was performed in triplicate. For standardization of the gene expression levels determined by TaqMan analysis mRNA derived cDNA signal in each sample was calculated relative to 18s ratio as an internal control. Data are presented as mean ±SD.
IL-1 stimulated COX-2 gene expression at all points of chondrogenic differentiation which were assessed. Interestingly the stimulation rate was high in the first two differentiation weeks, then the level of COX-2 transcription after IL-1β stimulation
112 4. RESULTS
declined for two weeks and was again very high at the last two time points measured (32 and 46 days). COX-2 has been several times indicated as important factor in differentiation of adipocytes (Yan et al., 2003), osteoblasts and keratinocytes (Tiano et al., 2002), its role has been also studied in tumorgenesis (Bishop-Bailey et al., 2002; Ruegg et al., 2004; Tiano et al., 2002). Our data indirectly point to the role of COX-2 also in chondrogenic differentiation.
4.6.3. COX-2 mRNA and protein expression in human chondrocytes
To precisely characterize activation of COX-2 in human chondrocytes the induction of COX-2 mRNA and protein in response to IL-1β were investigated in human OA chondrocytes in alginate beads using TaqMan PCR and Western bloting. The time course of eicosanoid production was assessed by GC/MS/MS. Levels of COX-2 mRNA transcripts increased markedly already after 2h of IL-1β stimulation and achieved the highest levels after 6h. Levels of COX-2 mRNA transcripts stayed elevated up to the end of measurement, after 24h of stimulation (Figure 57).
COX-2 expression
200,00
150,00
100,00
50,00 relative expression 0,00 control IL1 2h IL1 6h IL1 8h IL1 24h
Figure 57. Time course of COX-2 gene expression after IL-1β [0,5nM] stimulation of human chondrocytes in alginate beads. The expression level of control cells was set as one and fold-exchange was calculated. For standardization of the gene expression levels determined by TaqMan analysis mRNA derived cDNA signal in each sample was calculated relative to 18s ratio as an internal control. PCR was performed in triplicate. Data are presented as mean ±SD.
113 4. RESULTS
COX-2 protein expression measured by Western blot analysis (Figure 58) was almost undetectable in control cells. A weak induction of COX-2 protein expression was seen already after 2h of IL-1β stimulation and increased with time of incubation. The pattern of COX-2 protein reached a plateau at 8h. COX-2 protein expression stayed on the plateau level also after 24h of stimulation.
IL-1β kDA c 2h 4h 6h 8h 12h 24h
188
98 COX-2 (74kDa) 62 49 38
28
17 14
Figure 58. COX-2 protein expression after IL-1β stimulation of human chondrocytes in alginate beads. As control (c) unstimulated cells after 24h of incubation. COX-2 ab: Cayman160116 (1:500)
4.6.4. Time course of eicosanoid production
An increase in PGE2 level was detectable after 4h of IL-1β stimulation and increased constantly during the whole incubation time.
A 2-fold increase in PGE2 level was observed after 4h of incubation with IL-1 comparing to 2h, after 12h of stimulation this level was already 10 fold increased and 23-fold increased after 24h. The levels of 6-keto-PGF1α and TxB2 were significantly elevated after 8 and 12h of stimulation, respectively. The level of isoprostanes was also slightly increased after 24h of IL-1β stimulation (Figure 59). The difference between very early measured PGE2 induction and other prostanoids might be due to low levels of 6-keto-PGF1α and TxB2, which could have been under detection limit at early stimulation time points.
114 4. RESULTS
A relatively high accumulation of prostanoids in the control is a result of measurement after 24h incubation in medium (without stimulus) and represents basal eicosanoid production in chondrocytes.
450 chondrocytes 250 control IL-1b 2h IL-1b 4h 50 IL-1 6h IL-1 8h IL-1 12h IL-1 24h 30
20 Prostaglandin [ng/ml] Prostaglandin 10
0 2 a 2 E B G F2a ost. P Tx PGD2 G -PGF1 P opr -k -epiPGF2 6 8 F-Is
Figure 59. Eicosanoid production by human chondrocytes in alginate beads after 0,5nM IL-1β stimulation. 10 alginat beads were placed in 1ml medium, stimulated with IL-1 and incubated for the time indicated, then supernatant was collected. As control unstimulated cells after 24h of incubation in assay medium. Levels of prostanoids were measured with GC/MS/MS.
4.6.5. Influence of NO-donors and iNOS inhibitors on PGE2 synthesis
The effect of NO on PGE2 production was already studied in different culture systems. Both activation and inhibition of COX enzymes had been shown depending on cell type, source of NO and redox status of cells. In chondrocytes, which are known to produce high levels of both mediators the issue of NO influence on PGE2 production was discussed several times, but without a clear answer. Both inhibition of COX-enzymes and activation of prostanoid production have been published.
115 4. RESULTS
To test the effect of NO on COX-2 activity in human chondrocytes three different experimental approaches were employed:
1. assessment of the production of PGE2 in the presence of iNOS inhibitors and NO donors in standard culture conditions and long incubation times (24h); 2. experiments with exogenous arachidonic acid to assess COX condition and prostanoid production in short time periods (10min); 3. finally 2D-gel analyses were performed to check a possible nitration of COX-2 protein in human chondrocytes (for results see page 140).
In the first experimental setting human chondrocytes were incubated with NO donors or iNOS inhibitors for 24h, thereafter prostanoid levels in cell culture supernatants were measured with GC/MS/MS or PGE2 was assessed with EIA.
To check a possible effect of NO on the formation of other than PGE2 eicosanoids released by human chondrocytes detailed analysis with GC/MS/MS was necessary. However, this precise analysis of minor prostanoids is time and cost consuming, therefore where possible COX activity was assessed via PGE2 ELISA.
Results regarding PGE2 concentration obtained with these two methods were very similar. Furthermore, we found that the effect of NO level-regulating compounds on all prostanoids assessed was similar; therefore we decided to enclose the results obtained for PGE2 as representative.
We noted considerable differences in the basal and stimulated production of PGE2 through chondrocytes from different cell isolations. To make results obtained from different experiments and with two different methods of PGE2 assesment comparable,
PGE2 production after stimulation with IL-1β was set as 100% and all other results were calculated as % of IL-1.
Interestingly a slight increase in the PGE2 release was observed after incubation with all tested iNOS inhibitors: 1400W, AMT, 191023 (Figure 60). However, the effect was not significant, despite the fact that experiments with different concentrations of iNOS inhibitors were performed up to 13 times. This was due to very high variations between individual experiments. While increases in PGE2 levels was not dependent on the
116 4. RESULTS
concentration of iNOS inhibitors also in individual experimental settings this makes it questionable whether the effect of iNOS inhibitors on PGE2 synthesis is according to iNOS inhibition or another cellular phenomenon.
1400W AMT 200 200
150 150
100 100 generation generation 2 2 (IL-1=100%) 50 (IL-1=100%) 50 PGE PGE
0 0 β b b trol -1 -1 1 β b n IL IL- -1 1 L- co + IL I IL-1b µM + IL µM control 1 0 M + 1 µ W 0 0 10µM + 0 4 T T 3 1 1400 W 3µM00 + WIL-1b 14 1400 W 30µM + IL-1b AM AM
191023 200
150
100 generation 2
(IL-1=100%) 50 PGE
0 β -1 -1b IL L control
191023 3µM + I 191023 30µM + IL-1b 191023 100µM + IL-1b
Figure 60. Effect of iNOS inhibitors on the PGE2 content in culture supernatants of articular chondrocytes. Cells were incubated with iNOS inhibitors in indicated concentrations and with IL-1β 1nM for 24h. PGE2 release was measured in cell culture supernatant using PGE2 EIA and with GC/MS/MS. PGE2 level after stimulation with IL-1β was set as 100% in each experiment and all other concentrations were calculated. Values given are means ±SD (n>7).
In the next experimental settings the following NO donors were tested: DETA NONOate, Spermine NONOate (NO donors), and the peroxynitrite donor: SIN-1. There was no significant effect of all these compounds on PGE2 production (Figure 61). Slight inhibition of PGE2 generation by these compounds in the highest - 500µM concentration was according to cytotoxicity (compare with TUNEL results).
117 4. RESULTS
a) b)
DETA + IL SIN + IL 150 150
100 100
** generation generation 2 2 50 50 (IL-1=100%) (IL-1=100%) PGE PGE
0 0 l o β b β b tr -1 -1b L L-1 -1 -1b -1 -1b n IL I I ntrol L o + + IL IL IL I c o + M M c + + µ µ M M M 0 0 µ µ µ 5 0 0 0µM + IL-1b 2 5 00 5 A N 5 1 TA IN 2 DETA 50µM + IL-1b ET E SI DETA 100µMD + IL-1bD SIN S SIN 500
c) d)
DETA SIN 10.0 10.0
7.5 7.5
5.0 5.0 generation generation 2 2
(IL-1=100%) 2.5 (IL-1=100%)
PGE 2.5 PGE
0.0 0.0
M M M 0µ rol M M 00µ µ control 5 0 A cont 10 DETA 50µ SIN 50µM N DETA 10 DETA 250µMDET SI SIN 250µ SIN 500µM e) f)
Spermine + IL 150 Spermine NO 20
100 15 generation 2 50 10 (IL-1=100%) generation 2 PGE
(IL-1=100%) 5 0 PGE
l β b ro -1 -1 -1b L L 0 nt IL I I co + M + trol µM µM µM µM 0µ n 0 0 0 0 00µM 50µM + IL-1b 1 2 co e e 10 ine 5 n ine 5 n m i m er rm rmine er rmi rmine 25 rmine 50 p e e e Sp S p p p Spe Spe Spermine 500µM + IL-1b S S S
Figure 61. Effect of NO donors on PGE2 content in culture supernatants of articular chondrocytes. The cells were incubated with NO donors in indicated concentrations for 24h (IL-1β 1nM). PGE2 release was measured in cell culture supernatant using PGE2 EIA or with GC/MS/MS. PGE2 level after stimulation with IL-1β was set as 100% in each experiment and other concentrations were calculated. Values given are means ±SD (n>7).
118 4. RESULTS
4.6.6. Experiments with exogenous Arachidonic Acid (AA)
This experimental setting in which COX activity was assessed by the exogenously added substrate arachidonic acid (AA) was employed to exclude the possibility that long incubation times (24h) with NO-donors and inhibitors had influence on results respecting COX activity. If COX-2 was inhibited e.g. by nitration then the measurement of its activity for a short period of time should exclude eventuality that not active enzyme was replaced by newly synthesized protein or underwent denitration.
4.6.6.1. AA concentration dependency of prostanoid formation To investigate the effect of exogenous AA on the production of prostaglandins chondrocytes were preincubated for 24h under control conditions or with 0,5nM IL-1β, medium was removed, cells were washed and then stimulated for the next 10 min with increasing concentrations of AA in PBS. Incubation of chondrocytes with AA [0-30µM] resulted in a concentration dependent increase of prostaglandin synthesis in both control and IL-1β stimulated cells (Table 14). Preferential formation of isoprostanes irrespective of stimulation was observed, which indicates a COX-2 independent mechanism of their formation in the presence of excess of AA. The second abundant product was, as expected, PGE2, which increased proportionally to AA in the concentration range tested. Formation of 6-keto-PGF1α was maximal at 15µM AA. This concentration was also chosen for further experiments with NO donors.
Minimal amounts of TxB2, PGD2 were measured; PGF2α and 8-epi-PGF2α were under the detection limits in this preliminary experiment.
119 4. RESULTS
Table 14. Arachidonic acid concentration dependency of COX enzyme activity. Human chondrocytes in alginate beads were incubated in a) control conditions or b) with IL-1β for 24h. Afterwards cells were washed with PBS and incubated for the next 10 min with AA in concentrations indicated. Prostanoid content in cell culture supernatant was analysed by GC/MS/MS [ng/ml]. a) control 0µM AA 3µM AA 10µM AA 15µM AA 30µM AA PGE2 1,50 1,32 3,47 7,60 19,70 6-k-PGF1a 0,01 0,04 0,11 0,50 0,33 TxB2 0,05 0,05 0,05 0,09 0,07 PGD2 0,01 0,05 0,00 0,00 0,00 PGF2a 0,00 0,00 0,00 0,00 0,00 8-epiPGF2 0,00 0,00 0,00 0,00 0,00 F-Isoprost. 0,10 1,14 14,05 29,45 91,32 b) IL-1 0µM AA 3µM AA 10µM AA 15µM AA 30µM AA PGE2 8,76 9,03 11,83 30,97 47,28 6-k-PGF1a 0,00 0,26 0,17 1,23 0,65 TxB2 0,03 0,03 0,09 0,03 0,07 PGD2 0,00 0,12 0,00 0,00 0,00 PGF2a 0,00 0,00 0,00 0,00 0,00 8-epiPGF2 0,00 0,00 0,00 0,00 0,00 F-Isoprost. 0,84 2,09 25,95 29,84 103,49
4.6.6.2. Effect of NO-donors on AA stimulated prostanoid formation To assess the effect of DETA NONOate and SIN-1α in an experimental system with exogenously added AA human chondrocytes were pre-treated with these compounds for 15min. Thereafter cells were washed with PBS and stimulated for 10min with AA 15µM. Finally the generation of prostanoids was measured in cell culture supernatants with GC/MS/MS.
Significant amounts of prostanoids (pooled: PGE2, 6-keto-PGF1α, TxB2B , PGD2) were measured in both control and stimulated cells after incubation with exogenous AA. Chondrocytes generated ca. 6ng/ml prostanoids under control conditions and this production was increased to ca. 47 ng/ml in cells stimulated with IL-1β. PGE2 was the predominant COX-product and represented more than 90% of measured prostanoids (without the isoprostane fraction). Interestingly preincubation of chondrocytes with DETA NONOate or SIN-1 had no inhibitory effect on the prostanoid generation.
120 4. RESULTS
In contrary a slight increase in COX-product level was observed if DETA NONOate or SIN-1 were added (Figure 62). Formation of all assessed prostanoids was increased. Especially in unstimulated cells the effect of tested compounds was pronounced and the formation of prostanoids increased by almost 100% compared to controls (Figure 62 c and d). a) b)
DETA + IL SIN + IL 100 100
75 75
50 50
25 25 Prostanoids [ng/ml] Prostanoids [ng/ml]
0 0 β -1 -1b -1b ol β L IL I control + IL-1 contr µM 50 2 A T E IN 100µM + IL-1b DETA 100µM + DIL S SIN 250µM + IL-1b c) d)
DETA SIN 25 25
20 20
15 15
10 10
5 5 Prostanoids [ng/ml] Prostanoids [ng/ml]
0 0 l M l tro µ o n 0 µM 5 0 co 2 contr N 10 N 250µM SI DETA 100µM DETA SI
Figure 62. Effect of NO donors on prostanoid content (pooled: PGE2, 6-keto-PGF1α, TxB2, PGD2, PGF2α) in culture supernatants of articular chondrocytes in alginate beads. The cells were incubated with or without IL-1β 1nM for 24h. Afterwards beads were washed with PBS and incubated with NO donors in indicated concentrations for 15 min at 37°C. Thereafter beads were washed again with PBS and incubated with 15µM AA in PBS or PBS for next 10min at 37°C. Prostanoid release was measured in cell culture supernatant using GC/MS/MS, levels of prostanoids obtained in the incubation with PBS were substracted. Values given are means ±SD (n=3).
121 4. RESULTS
4.6.6.3. Effect of NO-donors on AA stimulated Isoprostane formation In our experimental setting exogenously added AA had distinct stimulating effect on isoprostane formation in human chondrocytes. Large amounts of isoprostanes were generated independently on stimulation: 22,6 ± 11,1 ng/ml in control conditions and 21,4 ± 8,2 ng/ml in cells preincubated with IL-1β. a) b)
DETA + IL SIN + IL 200 400
150 300
100 200 generation Isoprostanes (IL-1=100%) 50 generation ** Isoprostanes (IL-1=100%) 100 ** 0 l 0 o β b b -1 tr L β IL-1 I IL-1 trol 1 -1b con + + n IL- IL M M µ co + 0µ M 0 5 A 100 A 25 2 T T E E D D SIN 100M + IL-1bSIN
c) d)
DETA SIN 200 200
100 100 generation generation Isoprostanes (IL-1=100%) Isoprostanes (IL-1=100%)
0 0 l M M µ M M 0µ trol µ ontro 00 5 n 0 c 1 2 o 0 A A c 1 IN DET DET S SIN 250µ
Figure 63. Effect of NO donors on isoprostane formation in articular chondrocytes . The cells were incubated with or without IL-1β 1nM for 24h. Afterwards beads were washed with PBS and incubated with NO donors in concentrations indicated for 15 min at 37°C. Thereafter beads were again washed with PBS and incubated with 15µM AA in PBS or PBS for next 10min at 37°C. Isoprostane release was measured in cell culture supernatant using GC/MS/MS, levels of isoprostanes obtained in the incubation with PBS were substracted. Values given are means ±SD (n=3).
122 4. RESULTS
Interestingly DETA NONOate and SIN-1 showed opposite effects on isoprostane formation stimulated by 15µM AA. DETA NONOate significantly and in dose-dependent manner inhibited generation of isoprostanes (Figure 63 a, c), whereas SIN-1 increased formation of isoprostanes (Figure 63 b and d).
4.6.7. Prostacyclin synthase in human cartilage
As shown in the Table 13 our detailed analysis of prostanoid production in human chondrocytes revealed, that these cells release prostacyclin (PGI2). We measured about 0,5 ng/ml/0,5mln cells under control conditions. After stimulation with IL-1β levels of PGI2 in cell culture supernatants increased 4-fold. The generation of was PGI2 inhibited by Dex.
There is only very limited data on PGI2 synthesis in human chondrocytes, however production of this mediator was reported in rat, bovine and rabbit chondrocytes (Okiji et al., 1993; Mitrovic et al., 1982; Malemud et al., 1981). Therefore we performed immunohistochemical analysis of prostacyclin synthase (PCS, PGIS) in human cartilage samples. Staining with anti PCS antibody showed presence of PCS in human cartilage, however not all cells were PCS positive (Figure 64).
Figure 64. Staining of PCS protein (red) in human OA cartilage using anti-PCS polyclonal antibody (“PCS2 Ab”), DF 1:50. Two representative sections are shown.
123 4. RESULTS
We were also interested if human chondrocytes express PGI2 receptor, called IP- receptor. Therefore TaqMan analysis was performed, which demonstrated presence of IP-receptor mRNA transcripts in human chondrocytes (Figure 65). Levels of IP-receptor mRNA were slightly down-regulated if the cells were stimulated with IL-1β 0,5nM for 7 days. Stronger inhibitory effect was observed when chondrocytes were incubation with prostacyclin analogue Iloprost. Iloprost together with IL-1 reduced expression of IP- receptor to about 40% of control levels.
IP - receptor expression
1,20
1,00
0,80
0,60
0,40 rel. expression rel. 0,20
0,00 Control 7days IL-1b 7days IL-1b + Iloprost 10µM
Figure 65. TaqMan analysis of IP receptor expression on human chondrocytes cultured in alginate beads. Cells were cultivated one week in the presence of IL-1β 0,5nM or Iloprost 10µM and IL-1β afterwards RNA was isolated. PCR was performed in triplicate, results were normalized against 18S and are presented as mean ± SD.
4.6.7.1. Prostacyclin has no effect on the expression of extracellular matrix proteins
To test if PGI2 has an effect on the expression of extracellular matrix proteins human chondrocytes in alginate beads were incubated for 24h or one week with Iloprost in the presence or absence of IL-1β 0,5nM. In the one-week experiments medium with substances was changed every second day. Afterwards RNA was isolated and TaqMan PCR analysis of collagens type 2, 1, 10 and aggrecan was performed. Iloprost showed no effect on the expression of extracellular matrix proteins. As representative, results regarding expression of collagen 2 are presented on the Figure 66.
124 4. RESULTS
As expected IL-1β exerted catabolic effect on the expression of collagens and aggrecan. Iloprost could not overcome the effect of this cytokine.
Collagen 2 expression
2,50 2,00 1,50
1,00 0,50 rel. expression 0,00 Control 7days IL-1b 7days Iloprost 3µM IL-1b + Iloprost 3µM
Figure 66. TaqMan analysis of collagen2 expression in human chondrocytes cultured in alginate beads. Cells were cultivated one week in the presence of IL-1β 0,5nM or Iloprost 3µM and IL-1β afterwards RNA was isolated. PCR was performed in triplicate, results were normalized against 18S and are presented as mean ± SD.
4.6.7.2. Influence of NO-donors and iNOS inhibitors on PGI2 synthesis
To elucidate the effect of NO on PGI2 synthesis human chondrocytes were incubated with NO donors or inhibitors for 24h, thereafter PGI2 (measured as 6-keto-PGF1α) levels in cell culture supernatants were determined using GC/MS/MS.
To make results obtained from different experiments comparable, PGI2 production after stimulation with IL-1β was set as 100% and other results were calculated as % of IL-1.
We observed the same tendency as by PGE2 measurements. A slight, not significant increase in the PGI2 release was observed after incubation with tested iNOS inhibitors:
1400W and AMT (Figure 67a). However an increase in PGI2 levels was not dependent on the concentration of iNOS inhibitors also in individual experimental settings what makes it questionable whether the effect of iNOS inhibitors on PGI2 synthesis was according to iNOS inhibition or another cellular phenomenon. In the next experimental settings SIN-1 and DETA NONOate were tested. SIN-1 significantly increased PGI2 generation, however the effect was not dependent on SIN-1 concentration. DETA NONO ate showed almost no effect on PGI2 production (Figure 67b).
125 4. RESULTS
a) b)
175 175 * * 150 150 125 125 2 2 100 100 PGI PGI 75 75 IL-1=100% 50 IL-1=100% 50 25 25 0 0
ol β β b tr 1b -1b -1b -1 -1b -1b n IL-1 IL- IL IL IL-1b IL-1 L IL co + + + control + I + IL + IL-1b + M M M M + M 1µ 0µ 0µM 10µ 30µ 10µ 50µM T T 10 M M W A A SIN 50µM TA 1400 W SIN 10 DETA E 1400 D
Figure 67. Effect of NO donors on PGI2 content in culture supernatants of articular chondrocytes. The cells were incubated with a) iNOS inhibitors or b) NO donors in indicated concentrations for 24h (IL-1β 1nM). PGI2 release was measured in cell culture supernatant with GC/MS/MS. PGI2 level after stimulation with IL-1β was set as 100% in each experiment and other concentrations were calculated. Values given are means ±SD (n>4) * P<0,05
4.6.7.3. Effect of NO-donors on AA stimulated PGI2 formation As for other prostanoids assessment of the effect of DETA NONOate and SIN-1 on the
PGI2 formation in an experimental system with exogenously added AA was performed. Human chondrocytes were pre-treated with NO-donors for 15min, thereafter cells were washed with PBS and stimulated for 10min with AA 15µM. Finally the 6-keto-PGF1α was measured in cell culture supernatants with GC/MS/MS. Interestingly preincubation of chondrocytes with SIN-1 or DETA NONOate had stimulatory effect on the PGI2 generation. SIN-1 100µM increased PGI2 release more than 2-fold and 250µM about 4-fold. DETA NONOate 100µM increased PGI2 generation almost 3-fold, however higher concentration (250µM) of this NO donor did not further increase production of PGI2, but even slight down-regulation in comparison to 10µM DETA NONOate was observed (Figure 68). As the experiments were performed only 3 times and there are differences between values obtained from single experiments data are not significant.
126 4. RESULTS
SIN + IL DETA + IL 600 600
500 500
400 400
300 300 generation generation 2 2 200 200 IL-1=100% IL-1=100% PGI PGI 100 100
0 0 l β β b ro 1b -1b -1 nt L-1 ntrol L o I IL- o IL-1 c + c + I M µ µM + IL M 0 00 1 25 100µM + IL-1b A TA E ET SIN SIN 250µ D D
Figure 68. Effect of NO donors on PGI2 (measured as 6-keto-PGF1α) in culture supernatants of articular chondrocytes in alginate beads. The cells were incubated with IL-1β 1nM for 24h. Afterwards beads were washed with PBS and incubated with NO donors in indicated concentrations for 15 min at 37°C. Thereafter beads were washed again with PBS and incubated with 15µM AA in PBS or PBS for next 10min at 37°C. 6-keto-PGF1α release was measured in cell culture supernatant using GC/MS/MS, levels of PGI2 obtained in the incubation with PBS were substracted. PGI2 level after stimulation with IL-1β was set as 100% in each experiment and other concentrations were calculated. Values given are means ±SD (n=3).
The data presented here indicate that however nitration of prostacyclin synthase by peroxynitrite was postulated in other cell types, this enzyme is active in human chondrocytes even if high concentrations of NO are present.
127 4. RESULTS
4.7. The effect of NO on apoptosis (TUNEL)
Apoptotic death of articular chondrocytes has been implicated in the pathogenesis of OA (Blanco et al., 1998; Goggs et al., 2003; Hashimoto et al., 1998; Heraud et al., 2000). A number of reports have suggested that NO can trigger apoptosis of chondrocytes (Blanco et al., 1995; Boileau et al., 2002; Pelletier et al., 2003; Pelletier et al., 2001). We were interested if endogenously produced NO and NO generated exogenously by chemical compounds induces apoptosis of chondrocytes. The evaluation of the effect of IL-1, TNFα and high concentrations of NO-donors on apoptosis was also very important for other experimental settings, to avoid effects resulting from decreased cellular viability.
Human chondrocytes isolated from OA cartilage were seeded in equal numbers in chamber slides and grown for 5 days, then cells were treated with indicated agents for next 24h. Afterwards cells were washed, fixed and stained for DNA strand breaks with terminal transferase-mediated dUTP nick end labeling (TUNEL). To visualize non- apoptotic nuclei counterstaining with neutral red was performed. As positive control for TUNEL assay cells were treated for 1h with nuclease and then labeling was performed. Figure 71 (page 132) shows typical images of cells under tested experimental conditions. The TUNEL assay functioned properly as indicated by black staining of all nuclei on the slide treated with nuclease. In the demonstrated experiment several positive apoptotic cells were found in untreated cells, but the percentage of apoptotic chondrocytes was less than 20%. Presence of cell death under control conditions is not surprising, if we consider long enzymatic isolation from extracellular matrix and culture of chondrocytes in monolayer, which is certainly not representative for the in vivo situation. For this reason TUNEL assay was also performed on paraffin sections of OA cartilage and revealed less than 1% of apoptotic cells (Figure 69).
128 4. RESULTS
a) b)
Figure 69. Detection of apoptotic chondrocytes in OA cartilage. Apoptotic cells were detected using TUNEL immunostaining method in cartilage paraffin sections, nuclei were counterstained with neutral red. Cells with black nuclei were considered apoptotic. a) nuclease treated control (TUNEL positive control), b) a section of OA cartilage
To analyze whether endogenously generated NO induces apoptosis of chondrocytes cells were stimulated with proinflammatory cytokines to induce iNOS expression and NO production. Treatment of chondrocytes with IL-1β 0,5nM or TNFα 10ng/ml for 24h failed to reveal any significant increase of cell death compared to control cells (Figure 71; page 132). To test the effect of exogenously added NO chondrocytes were incubated with increasing concentrations of NO donors (50-1000µM). DETA NONOate, NO-donor did not affect chondrocyte viability in concentrations up to 250µM (Figure 71; page 132). Treatment with 500µM DETA NONOate, or in higher concentrations, over 24h increased level of apoptotic cells from ca. 20% at control to ca. 35-45%. SIN-1, a peroxynitrite-generating compound showed higher apoptosis rate as DETA NONOate (Figure 72; page 133). Already SIN-1 at concentration 250µM decreased cellular viability to ca. 70%, at concentration 500µM almost all cells were TUNEL-
129 4. RESULTS
positive, at 1000µM there were almost no nuclei present on the slide, and these still found there were apoptotic. Spermine NONOate as NO donor at concentrations higher than 250µM induced cell death (Figure 72; page 133). Changes in cellular morphology, shrinking of cells, which is characteristic for early apoptosis were evident especially at concentrations higher than 500, and 1000µM, although staining of the nuclei was not as intensive as in the treatment with SIN-1 or DETA NONOate. Co-treatment of chondrocytes with NO-donors and IL-1β and TNFα did not change significantly the results obtained by treatment of cells only with NO-donors. Still SIN-1 is the most potent inducer of cell death. In general we observed that there were differences in the magnitude of the nuclei between analysed cells. Furthermore all mitototic nuclei were TUNEL positive; we believe that it should be considered as artifact.
We had several technical difficulties performing TUNEL assay on isolated chondrocytes grown on chamber slides. Firstly a problem with cell adherence. Chondrocyte growth on chamber slides was limited to peripheral areas of chambers and central areas of each slide remained almost empty. Secondly, long processing time and many washing steps during TUNEL assay leading to loss of cells. Because of these difficulties and differences in growth pattern and level of apoptosis in control cells from different cell isolations we decided not to quantify the total number of cells undergoing apoptosis but to evaluate single, but representative experiment.
Different NO-donors released comparable levels of NO in the culture medium (Figure 70). Interestingly, although SIN-1 has similar kinetics of NO generation as Spermine- NONOate and comparable amounts of nitrite were measured in medium SIN-1 was more efficient inducer of chondrocyte cell death. Although DETA NONOate generated the highest levels of nitrite this compound was not efficient in initiating apoptosis in human chondrocytes. These results implicate that the amount of NO produced by the NO-donor does not correlate with chondrocyte death.
130 4. RESULTS
DETA NONOate SIN-1 75 75
50 50
25 nitrite [µM] 25 nitrite [µM] nitrite
0 0 M M µ µ 0 M M M M 00 0µ 0µ A 10 A 5 IN 50µ DETA 50µM ET ET S IN 10 IN 50 D DETA 250µM D S SIN 250µ S
Spermine-NONOate 75
50 Figure 70. Quantification of nitrite accumulation in cell culture medium after 24h 25 nitrite [µM] nitrite incubation with different NO- donor compounds. 0
M µ 250 ine 50µM ine rm e rm e Sp Spermine100µMSp Spermine 500µM
131 4. RESULTS
nuclease treated control untreated cells
IL-1β 0,5nM TNFα 10ng/ml
DETA NONOate 50µM DETA NONOate 250µM
DETA NONOate 500µM DETA NONOate 1000µM
Figure 71. Detection of apoptotic chondrocytes cultured on chamber slides. Apoptotic cells were detected using TUNEL immunostaining method, nuclei were counterstained with neutral red. Cells with blue-black nuclei were considered apoptotic.
132 4. RESULTS
SIN-1 100µM SIN-1 250µM
SIN-1 500µM SIN-1 1000µM
Spermine-NONOate 50µM Spermine-NONOate 250µM
Spermine-NONOate 500µM Spermine-NONOate 1000µM
Figure 72. Detection of apoptotic chondrocytes cultured on chamber slides. Apoptotic cells were detected using TUNEL immunostaining method, nuclei were counterstained with neutral red. Cells with blue-black nuclei were considered apoptotic.
133 4. RESULTS
4.8. Protein nitrotyrosine in chondrocytes
Free radicals and reactive nitrogen species are widely believed to be involved in the development of age-related diseases. OA is considered an age-related pathophysiology and contribution of reactive species to development of this disorder were implicated several times (Henrotin et al., 2003). As protein nitrotyrosine has been previously reported in aging and OA cartilage (Loeser et al., 2002) and also in synovial tissue of patients with RA and OA (Sandhu et al., 2003) we were interested if we could also detect nitrotyrosine in cartilage samples, and further characterize protein nitration in human chondrocytes. Additionally, identification of nitrated proteins was of our special interest.
4.8.1. Detection of nitrotyrosine in OA cartilage Nitrotyrosine staining was present in OA cartilage (Figure 73a). Especially superficial regions of articular cartilage were nitrotyrosine positive. This is consistent with the results obtained by Loeser et al. (Loeser et al., 2002). Interestingly, intensive staining for nitrotyrosine was detected only within the cells and not in the cartilage matrix (Figure 73b). a) b)
Figure 73. Immunochistochemical staining for nitrotyrosine in human OA cartilage. Positive staining for nitrotyrosine is red. a) middle zone of knee OA cartilage, stained with polyclonal anti-nitrotyrosine antibody (Upstate), original magnification x 100; b) superficial zone of knee OA cartilage, stained with monoclonal anti-nitrotyrosine antibody (Cayman), original magnification x 400.
134 4. RESULTS
4.8.2. Nitrotyrosine immunostaining correlates with iNOS in human chondrocytes (staining of IL-1β stimulated cells) As next step we performed fluorescent staining of nitrotyrosine and iNOS in isolated human chondrocytes. Cells were stimulated with IL-1β and afterwards cytospin preparation was performed. The double staining revealed that iNOS over- expressing cells were positive also for nitrotyrosine (Figure 74).
a) b)
c)
Figure 74. Colocalization of iNOS (red) and nitrotyrosine (green) in human chondrocytes. Isolated cells were cultured in monolayer and stimulated for 4 days with IL-β, afterwards cytospin preparation was performed. Immunostaining using TK2553 for iNOS and monoclonal anti-nitrotyrosine antibody (Cayman), original magnification x 630.
135 4. RESULTS
4.8.3. Detection of protein-nitrotyrosine in one- and two-dimensional gel electrophoresis As already shown nitrotyrosine was present in both cartilage samples and isolated chondrocytes, therefore further analysis of protein nitration was performed employing electrophoresis and Western blotting. One dimensional electrophoresis and Western blotting revealed presence of nitrotyrosine in studied samples (Figure 75). Especially samples from chondrocytes stimulated with IL-1β were nitrotyrosine positive. There was one protein band with ca. 40kDa, which was repetitively nitrotyrosine positive in IL-1 stimulated cells. However the staining of other proteins was not intensive and clear. Because of low abundancy of nitrated proteins signal detection was possible only with SuperSignal West Femto chemiluminescent substrate and long exposure times, therefore the standard band with nitrated BSA is very intensive.
kDa 1 2 3 4 5 6 7 8 9 250 148
98
64
50
36
22 16
1 – protein standard : nitro-BSA 6 – control 2 - control 7 – IL-1β 1nM, 24h 3 – IL-1β 1nM, 24h 8– control
4 – control 9 - IL-1β 1nM, 24h
5 - IL-1β 1nM, 24h
Figure 75. Western blot of chondrocyte protein lysates immunostained with anti-nitrotyrosine antibody (Cayman 10µg/ml).
136 4. RESULTS
To further investigate protein nitration in human chondrocytes two-dimensional gels were used. Chondrocytes used for experiments were isolated from cartilage, cultured in monolayer for three days and then for further 24h under experimental conditions. Western blotting and incubation with anti-nitrotyrosine antibody was used for detection of nitrated proteins. Two distinct anti-nitrotyrosine antibodies were used: polyclonal antibody from Chemicon and monoclonal antibody clone 1A6 from Upstate. In experiments where samples needed to be compared, the gels were blotted on the same membrane and exposed simultaneously. Proteins detected with antibodies in Western blot as nitrated were matched with Coomassie blue stained protein spots in parental acrylamide gels. Corresponding spots were then excised from the gels, digested and identified using MALDI-TOF mass spectrometry. At the beginning of 2-D gel analysis we used anti-nitrotyrosine polyclonal antibody from Chemicon, but the signal obtained with this antibody was week. However we were able to identify cellular filament proteins: actin and vimentin as nitrated (Figure 76). This staining was also confirmed by the anti-nitrotyrosine monoclonal antibody from Cayman (data not shown).
kDa
97,4
vimentin actin Figure 76. Anti-nitrotyrosine positive proteins in human
45,0 chondrocytes stimulated with IL- 1β 1nM, 24h detected with polyclonal antibody from Chemicon. Arrows indicate immunopositive 31,0 spots, which were identified by mass spectrometry as vimentin
21,5 and actin. 144µg protein
pH 3 - 6
137 4. RESULTS
Further analysis was performed using monoclonal 1A6 antibody, which meanwhile had been well characterised (Aulak et al., 2001; Koeck et al., 2004; Miyagi et al., 2002) and revealed clear nitrotyrosine staining in our experimental settings (Figure 77). The excision and analysis of immunopositive protein spots was performed. Via this analysis pyruvate kinase M1/M2 isoenzymes, fructose-bisphosphate aldolase A, glyceraldehydes - 3-phosphate dehydrogenase, MnSOD and proteasome subunit β1 were identified as nitrated. a) b)
control
41 2 5 3 6 4 7
IL-1β
MS identification: 1 - pyruvate kinase M1/M2 isoenzymes 2 - fructose-bisphosphate aldolase A 3 – glyceraldehydes - 3-phosphate dehydrogenase 4- MnSOD and proteasome subunit β1 SIN-1
Figure 77. a) anti-nitrotyrosine positive proteins in human chondrocytes detected with monoclonal antibody 1A6 (Upstate), b) the 2D acrylamide gel stained with Coomassie blue of IL-1β stimulated chondrocytes. Spots corresponding with immunopositive proteins (indicated by arrows) were excised from the parent gel, digested and analysed by mass spectroscopy, pH 3 - 10
138 4. RESULTS
Because most of nitrotyrosine-positive spots were detected in the pH range 6 - 7,5 (Figure 77) gels with pH range 6,2 – 7,5 were used for further analysis, to better separate proteins located in this area. Use of gels with pH range 6,2 – 7,5 allowed identification of further nitrated proteins: annexin A2, alpha enolase, and confirmed nitration of MnSOD (Figure 78). a) b) control 5
7
6 IL-1β
MS identification: 5 - alpha enolase 6 – MnSOD 7 – annexin A2
Figure 78. a) anti-nitrotyrosine positive proteins in human chondrocytes detected with SIN-1 monoclonal antibody 1A6 (Upstate), b) the 2D acrylamide gel of IL-1β stimulated chondrocytes stained with Coomassie blue. Spots corresponding with immunopositive proteins (indicated by arrows) were excised from the parent gel, digested and analysed by mass spectroscopy,
pH 6,2 – 7,5
139 4. RESULTS
4.8.3.1. 2D-gel analyses revealed no COX-2 nitration
To investigate possible COX-2 protein nitration in human chondrocytes two-dimensional gels were used. Chondrocytes used for experiments were isolated from cartilage, cultured in monolayer for three days and then for further 24h with IL-1β 0,5nM or SIN-1 250µM. For comparison (control, IL-1, SIN-1) the gels were blotted on the same membrane and exposed simultaneously. Western blots were first incubated with monoclonal anti- nitrotyrosine antibody (1A6, Upstate) for detection of nitrated proteins; afterwards the membrane was stripped and stained with polyclonal COX-2 antibody. Several nitrotyrosine positive spots were detected in all examined samples. A COX-2 expression was detected only in IL-1β stimulated cells. There was no correlation between anti-nitrotyrosine and COX-2 staining. These data indicate that at least in our experimental setting COX-2 is not nitrated.
Figure 79. Anti- nitrotyrosine staining detected with monoclonal antibody 1A6 (Upstate) on the left and COX-2 staining on the right for comparison. One representative experiment of three replicates is presented. Anti-nitrotyrosine positive spots corresponding with COX-2 spot were not detected.
140 4. RESULTS
To sum up, two-dimensional gels showed that nitrated proteins are present in human chondrocytes. Nitrotyrosine was detected in unstimulated chondrocytes and protein nitration was slightly increased after stimulation with IL-1β or incubation with peroxynitrite generating compound: SIN-1. With further mass-spectrometric analysis several proteins were identified as nitrated: MnSOD, a principal antioxidant enzyme of mitochondria, which converts superoxide radical to hydrogen peroxide; annexin A2, a member of a large family of annexins characterized by their ability to bind to phospholipids in a calcium dependent manner (Liemann and Lewit-Bentley, 1995; Moss et al., 1991). Interestingly alpha enolase, pyruvate kinase M1/M2 isoenzymes, fructose- bisphosphate aldolase A, glyceraldehydes- 3-phosphate dehydrogenase found to be nitrated are all enzymes of glycolytic pathway. To our knowledge this is the first report identifying nitrated proteins in human chondrocytes.
141 4. RESULTS
4.9. Superoxide
We were able to show the presence of nitrotyrosine and to identify some nitrated proteins in chondrocytes originating from OA tissue. 3-nitrotyrosine is the stable product of tyrosine residue nitration by peroxynitrite and therefore used as marker for reactions involving peroxynitrite, which has a very short half-life. Peroxynitrite is a product of a very rapid reaction of NO with superoxide, so nitrotyrosine is indirectly an indicator of oxidative stress in the tissue. As production of high levels of nitric oxide by chondrocytes had been shown we were interested in the rate of superoxide generation. Superoxide anion was determined by two methods: spectrophotometric measurement of cytochrome c reduction and by electron spin resonance (ESR). Several spin traps were tested for ESR measurements on chondrocytes: CPH, DMPO, DEPMO and CMH. Finally we decided to use CMH (1-hydroxy-3-methoxycarbonyl-2,2,5,5- tetramethylpyrrolidine hydrochloride) as a high-cell permeable and non-toxic spin probe, adequate for the quantification of slow released intracellular superoxide anion production. Oxidation of CMH by reactive oxygen species (ROS) leads to the formation of 3-methoxy-carbonyl-proxyl (CM•), which is a stable radical and can be detected by ESR spectroscopy. Each ESR measurement contained one probe in which cells were treated with polyethylene glycol-superoxide dismutase (PEGSOD) to quantify SOD- inhibitable formation of CM•. This radical formation inhibited by SOD was considered as superoxide generation. Dieethylenetriamine-pentaacetic acid was added to all samples to inhibit iron-catalysed reactions.
4.9.1. Measurement of ESR signal in chondrocytes supernatant
In our first attempt to quantify the rate of superoxide generation by human chondrocytes cells grown in monolayer were stimulated with IL-1β 6h prior to incubation with spin trap CMH. ESR spectra were recorded in ESR buffer every 30min of incubation with the cells. The three-line ESR spectrum of CM• was observed after incubation of CMH with chondrocytes indicating superoxide generation. The ESR signal increased with the time
142 4. RESULTS
of incubation. In the Figure 80 ESR spectra obtained after 4h of incubation are shown. Interestingly, differences seen between stimulated and unstimulated cells were not signifficant. Surprisingly, the ESR signal was slightly higher at control as in IL-1β stimulated chondrocytes. As expected CM• generation decreased in the presence of PEG-SOD. a) b) [*10^ 3] [*10^ 3] 300 300
250 250 200 200 150 150
100 100
50 50
0 0 -50 -50 -100 -100
-150 -150 -200 -200 -250 -250
-300 -300
-350 -350 3460 3470 3480 3490 3500 3510 3460 3470 3480 3490 3500 3510 [G] [G] c) d)
[*10^ 3] [*10^ 3]
300 300 250 250 200 200 150 150 100 100
50 50 0 0 -50 -50 -100 -100 -150 -150 -200 -200 -250 -250
-300 -300 -350 -350 3460 3470 3480 3490 3500 3510 3460 3470 3480 3490 3500 3510 [G] [G]
Figure 80. ESR spectra of 3-methoxy-carbonyl-proxyl (CM•) illustrating superoxide generation by human chondrocytes. Cells were grown in monolayer, stimulated with IL-1β over 6h. Afterwards cells were washed with PBS and incubated for 4h in ESR-buffer containing 1mM CMH, PEGSOD (50U/ml) at 37°C. ESR measurements were performed in cell culture supernatant. a) control cells b) cells stimulated for 24h with IL-1β c) cells stimulated for 24h with IL-1β and incubated in the ESR buffer with PEG-SOD d) cells without CMH.
143 4. RESULTS
4.9.2. Measurement of ESR signal in cell suspension
The ESR signal measured in suspension of chondrocytes is shown in Figure 81. There were almost no differences between signals measured in suspension of control and stimulated chondrocytes. Again CM• generation was slightly higher in control cells. Thus results obtained in cell suspension and cell culture supernatant were comparable. However we decided to perform further measurements in cell suspension as it is known from literature (Kuzkaya et al., 2005).
a) b)
[*10^ 3] [*10^ 3] 200 200 150 150
100 100
50 50
0 0 -50 -50 -100 -100
-150 -150
-200 -200 3460 3470 3480 3490 3500 3510 3460 3470 3480 3490 3500 3510 [G] [G]
Figure 81. ESR spectra of 3-methoxy-carbonyl-proxyl (CM•) illustrating superoxide generation by human chondrocytes. Cells were grown in monolayer, stimulated with IL-1β over 6h. Afterwards cells were washed with PBS, scraped from the surface and incubated for 2h in ESR-buffer containing 1mM CMH at 37°C. ESR measurements was performed in cell suspension a) control cells b) cells stimulated for 6h with IL-1 β.
To optimize our experimental system we were interested if we can enhance the signal by increasing the number of cells in the suspension. In fact, the ESR signal correlated with the cell number used for measurement. However, it was difficult to prepare a homogeneous suspension of high number of cells, in small volume (capillaries used in our experiment had 15µl volume) and additionally cell number available for each experiment was limited by the cartilage amount.
144 4. RESULTS
0,5mln cells 2mln cells
[*10^ 3] [*10^ 3] 150 150 125 125 100 100
75 75 50 50 25 25 0 0 -25 -25 -50 -50 -75 -75 -100 -100
-125 -125 -150 -150 3460 3470 3480 3490 3500 3510 3460 3470 3480 3490 3500 3510 [G] [G] Figure 82. ESR spectra of 3-methoxy-carbonyl-proxyl (CM•) illustrating dependence of superoxide generation on the chondrocyte number. Cells were grown in monolayer, washed with PBS, scraped from the plastic surface, centrifugated and resuspended in ESR buffer containing 1mM CMH. ESR measurements were performed after 2h of incubation at 37°C.
4.9.3. Measurement of ESR signal generated by SIN-1
Surprised by the data revealing higher rate of CM• generation by unstimulated human chondrocytes in comparison to IL-1β stimulated cells obtained in previous measurements we were concerned about the method of radical quantification used. Therefore as next we decided to test our system by measurement of the superoxide generation by SIN-1, a compound known to generate both superoxide and nitric oxide. Freshly prepared 250µM SIN-1 was incubated in the same conditions as chondrocyte suspension. ESR spectrum was measured after 1min, 5 min and 30min of incubation. The ESR signal of CM• radical generated by SIN-1 increased with the time of incubation. Results shown on the Figure 83 are spectra recorded after 30 min of incubation. CM• radical generation by SIN-1 was inhibited by incubation with PEG-SOD (c) or SOD (d), which demonstrates that measured signal, is superoxide dependent and that PEG-SOD is as efficient as SOD in scavenging superoxide radical. Interestingly, if chondrocytes were present during the incubation of SIN-1 with CMH, formation of CM• was decreased (b). Presence of chondrocytes was almost as potent as SOD in inhibition of ESR signal generated by SIN-1.
145 4. RESULTS
SIN-1 250µM a) b)
[*10^ 3] [*10^ 3] 140 140 120 120 100 100 80 80 60 60
40 40 20 20 0 0 -20 -20 -40 -40 -60 -60 -80 -80 -100 -100 -120 -120 -140 -140 3460 3470 3480 3490 3500 3510 3460 3470 3480 3490 3500 3510 [G] [G] c) d)
[*10^ 3] [*10^ 3] 140 140
120 120
100 100
80 80
60 60
40 40
20 20
0 0
-20 -20
-40 -40 -60 -60 -80 -80 -100 -100 -120 -120 -140 -140 3460 3470 3480 3490 3500 3510 3460 3470 3480 3490 3500 3510 [G] [G]
Figure 83. ESR spectra of 3-methoxy-carbonyl-proxyl (CM•) illustrating superoxide generation by SIN-1. All compounds and cell suspension were incubated for 30 min in ESR-buffer containing 1mM CMH at room temp. in 15µl capillaries in which ESR measurement was performed. a) SIN-1 250µM b) SIN-1 250µM + human chondrocytes c) SIN-1 250µM PEG-SOD 100U/ml d) SIN-1 250µM + SOD 100U/ml.
4.9.4. Measurement of superoxide production by human macrophages
For comparison, we were interested in the rate of superoxide generation in human macrophages, as these cells are known to posses NADPH oxidase generating high
- levels of •O2 , which is important in cellular immune defence. Therefore freshly isolated human macrophages (kind gift of Dr. Tobias Kanacher) where stimulated in the ESR buffer with phorbol myristate acetate (PMA). Stimulation of macrophages resulted in time-dependent generation of high amounts of superoxide (Figure 84). Already 30 min
146 4. RESULTS
after the cell stimulation accumulation of high levels of CM• resulting in prominent ESR signal was observed.
1 min [*10^ 3] 5 min 100 [*10^ 3] 60 80 50 60 40
30 40
20 20 10 0 0 -10 -20 -20 -40 -30 -60 -40 -80 -50 -60 -100 3460 3470 3480 3490 3500 3510 3460 3470 3480 3490 3500 3510 [G] [G]
30 min Figure 84. ESR spectra of 3-methoxy- [*10^ 3] • 600 carbonyl-proxyl (CM ) illustrating 500 superoxide generation by human 400 primary macrophages. Cells directly after 300 isolation from blood, were washed with 200 PBS and stimulated with PMA a) 1min 100 0 b) 5min and c) 30min prior to ESR -100 measurement in ESR buffer containing -200 1mM CMH, at room temp (0,65mln cells/ -300 15µl volume of capillaries). -400 -500 -600 3460 3470 3480 3490 3500 3510 [G]
Control macrophages generated low levels of superoxide (Figure 85a). However, PMA stimulation resulted in significant increase in the ESR signal (Figure 85b). CM• generation was inhibited by SOD present in ESR buffer, which confirmed that - respective ESR signals are dependent on •O2 formation (Figure 85c).
147 4. RESULTS
a) b)
[*10^ 3] [*10^ 3] 600 600 500 500 400 400 300 300 200 200 100 100 0 0 -100 -100 -200 -200 -300 -300 -400 -400 -500 -500 -600 -600 3460 3470 3480 3490 3500 3510 3460 3470 3480 3490 3500 3510 [G] [G] c) d)
[*10^ 3] [*10^ 3] 600 600
500 500
400 400 300 300 200 200
100 100
0 0 -100 -100 -200 -200
-300 -300 -400 -400 -500 -500 -600 -600 3460 3470 3480 3490 3500 3510 3460 3470 3480 3490 3500 3510 [G] [G]
Figure 85. ESR spectra of 3-methoxy-carbonyl-proxyl (CM•) illustrating superoxide generation by human primary macrophages. Cells directly after isolation from blood, were washed with PBS and stimulated with PMA 30 min prior to ESR measurement in ESR buffer containing 1mM CMH, at room temp (0,65mln cells/ 15µl volume of capillaries). a) control cells b) macrophages stimulated with PMA 100nM c) macrophages stimulated with PMA 100nM in the presence of SOD 100U/ml d) ESR buffer without cells.
4.9.5. Cytochrome c assay (human chondrocytes)
We repeated measurements of superoxide generation by chondrocytes with the cytochrome c assay, which is a sensitive indicator of ROS formation, however not as specific for O2•- as ESR with CMH as spin trap. Again PEG-SOD was used as control for superoxide generation.
148 4. RESULTS
Experiments using cytochrome c confirmed results obtained with ESR. Chondrocytes - generated very low levels of superoxide. Interestingly, •O2 production slightly decreased if the cells were stimulated with IL-1β (Figure 86).
120
100
80
60
40 % of control 20
0 control C + SOD IL-1 0,5nM IL-1 + SOD
Figure 86. Cytochrome c assay illustrating superoxide generation by human chondrocytes. Primary cells were grown in monolayer in 24-well plates. After reaching confluency cells were stimulated with IL-1β 1nM over 16h, afterwards PEG-SOD 100U/ml and cytochrome c 75µM were added for the next - 24h. Reduction of cytochrome c was measured at 550nm in cell culture supernatant. The level of O2 measured in control was set as 100% in each experiment and other concentrations were calculated. Values given are means ±SD (n=4).
Taken together our results show that ESR experimental system we had been using is suitable for measurement of superoxide generation. However, in contrast to macrophages both untreated and stimulated chondrocytes showed minimal SOD- inhibitable superoxide generation as had been demonstrated by both: ESR and cytochrome c assay. Neither IL-1 nor TNFα or LPS (data not shown) were able to stimulate superoxide generation by human chondrocytes. In contrary, pre-treatment with IL-1 even reduced the rate of superoxide generation compared to control cells. It has been previously reported that chondrocytes posses an NADPH oxidase (NOX) complex (Hiran et al., 1997; Moulton et al., 1997).and release oxygen radicals (Rathakrishnan and Tiku, 1993). We detected expression of NOX-2, NOX-4, and NOX-5 by Affymetrix analysis in cartilage samples. All three are members of a family of gp91phox. gp91phox is a plasma membrane-associated catalytic moiety of the NADPH- oxidase, that catalyses the NADPH-dependent reduction of O2 to form superoxide
149 4. RESULTS
(Lambeth et al., 2000). On the other hand MnSOD was one the highest up-regulated genes after IL-1β stimulation (Affymetrix data). MnSOD is an enzyme, which catalyses the dismutation of superoxide anions into hydrogen peroxide and molecular oxygen. We should also not forget that stimulation of chondrocytes with pro-inflammatory stimuli as IL-1, TNF or LPS induces expression of iNOS and production of high amounts of NO, which is highly efficient superoxide scavenger. These two effects: up-regulation of - SOD and iNOS could be responsible for decreased detection of •O2 after cell stimulation. However, use of iNOS inhibitors hadn’t got significant effect on superoxide - generation, only very slight enhancing tendency of •O2 generation have been observed (data not shown). In conclusion, we could detect only very low levels of superoxide generation by human chondrocytes, and therefore we believe, that rather low but persistent generation of superoxide is related to protein nitration observed in human chondrocytes.
150 5. DISCUSSION
5. DISCUSSION
Defective repair and excessive degradation of articular cartilage are the main features of OA. Chondrocytes are the only cell type present in cartilage and responsible for synthesis and maintenance of this tissue, but also degradation of cartilage occurring in OA. During the development of OA chondrocytes undergo changes leading them to produce an altered cartilage matrix and to degrade ECM molecules. This is thought to occur because they are under the influence of mechanical stress and multiple mediators, among others prostaglandins, NO and reactive oxygen species. High local concentrations of these intermediates in OA cartilage modulate chondrocyte metabolism in an autocrine and paracrine fashion. Interfering with the production of catabolic mediators would be a key goal for the treatment of OA. Therefore studies on chondrocyte metabolism are necessary to understand the pathophysiology of OA and to find future therapies interfering with cartilage degradation.
5.1. In vitro studies on cartilage metabolism
The problem of most studies dealing with OA is the availability of cartilage specimens from donors with early stages of OA and a healthy cartilage for control studies. Typically cartilage is obtained during joint replacement surgery from patients with advanced OA. Patients` age, medication prior to surgery may represent additional factors, which cannot be standardized in most studies. There are several cell culture models for chondrocytes. The simplest is cultivation of cartilage explants in culture media. The advantage of this model is that chondrocytes stay in their own extracellular matrix. However there are several problems with standardization of this model. A limited amount of material obtained from a single patient is usually not sufficient to test several parameters in a single experiment. Furthermore preparation of samples equal in size and thickness, which is very important because of penetration of nutrients and e.g. substances of therapeutic interest limits use of cartilage explants for pharmacological studies. Therefore most studies are performed on isolated chondrocytes cultivated in monolayer or in 3-dimensional matrix.
151 5. DISCUSSION
Monolayer culture was shown to rapidly cause dedifferentiation of chondrocytes, which assume the morphology of fibroblastic cells and alter also their physiological responses in these culture conditions. Therefore a better solution is culture of chondrocytes in 3- dimensional matrix resembling cartilage ECM; the chondrocyte phenotype is stable in these conditions for several weeks. Additionally this model is well established and often used enabling comparisons of obtained results. According to this most of experiments performed in this study were done on chondrocytes in 3-dimensional alginate matrix. A major disadvantage of this model is that the isolation of the cells from ECM and embedding in alginate is a very time consuming process. To reduce donor dependency of our results cartilage samples from 4 days (Monday-Thursday) were collected and digested together on Thursday. Usually we had about 10-20g cartilage from 10-12 donors, giving 10-20 x 106 cells, which were than embedded in alginate on Friday. Another very interesting model are hMSCs from bone marrow differentiating into chondrocytes. We believed that hMSCs which chondrogenic differentiation capacity has been previously demonstrated are a possibility to overcome limitations when using primary chondrocytes. The hMSCs differentiation model could provide a system to study in vitro normal physiology of cartilage or early OA changes. This model has also the advantage that hMSCs from young bone marrow donors are not modified in their responses by prolonged medical treatment prior to OA as cartilage is. When we started our studies little was known concerning hMSCs physiology other than that they are able to synthesize extracellular matrix molecules. However even here only few studies were published and the differentiation process was not fully characterized. Our first step was to validate the extent and quality of hMSCs chondrogenic differentiation by studying the expression of relevant marker genes. Cartilage development is initiated by mesenchymal cell condensation, followed by chondrocyte maturation. This differentiation and maturation process is associated with the expression of specific genes. These genes include extracellular matrix components such as collagen type 2 which is a major extracellular protein in cartilage and essential for normal cartilage structure and function (Tanaka et al., 2000; Sandell and Aigner, 2001). So collagen type 2 can serve as a marker for activated functional chondrocytes.
152 5. DISCUSSION
Hypertrophic chondrocytes are characterized by the expression of type 10 collagen (Sandell and Aigner, 2001; Kirsch et al., 1992; von der Mark et al., 1992). Expression of collagen type 10 is also a hallmark for chondrocytes from OA cartilage (Nah et al., 2001). The expression of collagen type 1 is typical for fibroblastic cells and dedifferentiated chondrocytes (Sandell and Aigner, 2001). We first characterized the expression of collagen type 2, type 10 and collagen type 1 in hMSCs put under conditions promoting chondrogenesis to determine the extent of differentiation using real time TaqMan PCR. Expression of articular cartilage-specific collagen 2 occurred late in the differentiation process. The highest levels of expression were reached only after four-five weeks under conditions promoting differentiation. The early pattern of expression, i.e. a rapid up- regulation after 7 days of differentiation was consistent with previous reports. Yang et al. (Yang et al., 2004) observed a rapid increase in collagen 2 mRNA levels after 7 days of hMSCs differentiation in pellet culture system. Hering et al. and Barry et al. made similar observations and concluded that expression of collagen type 2 is low in immature cartilage and increases with maturation (Hering et al., 2004; Barry et al., 2001). In the present study, collagen 10 expression was observed already after 7 days of chondrogenic differentiation. Detection of collagen 10 in chondrogenic aggregates is suggestive of a hypertrophic phenotype. Presence of collagen 10 during in vitro chondrogenic differentiation was also reported by Yoo et al. and Winter et al. in similar cell culture models (You et al., 1998; Winter et al., 2003). Collagen 10 transcripts reached high levels already in the second week of differentiation and remained stable thereafter. Our findings are consistent with results obtained by Topping et al. regarding fracture repair in rats. This group detected collagen 10 in the ECM shortly after collagen 2 (Topping et al., 1994). Unfortunately most differentiation studies were conducted for periods of only two or three weeks limiting the extent to which comparisons can be made (Mais et al., 2005). Interestingly, it was shown in animal models and human biopsy samples that while MSC migrating into a site of injured cartilage do indeed differentiate into chondrocytes, they
153 5. DISCUSSION
synthesize fibrocartilage, characterized by presence of collagen 1, rather than hyaline cartilage (Yoo et al., 1998). Undifferentiated hMSCs expressed high levels of collagen 1, fitting well with the fibroblastic morphology of these cells in primary monolayer culture (You et al., 1998). Collagen type 1 was expressed during the whole differentiation process but to a lower extent than in monolayer. On the other hand we have also observed presence of collagen 1 transcripts in human chondrocytes cultured in alginate beads, however levels of collagen 1 transcripts in this culture conditions were significantly lower than if chondrocytes are cultured in monolayer. Except collagens we examined also expression of the most important articular cartilage proteoglycan, aggrecan. Levels of aggrecan transcripts increased in the first two weeks of chondrogenic differentiation, however afterwards the expression of the aggrecan gene declined. This could be due to very intensive matrix synthesis in the first two weeks of chondrogenic differentiation as distinct increase in pellet size was observed in this time. As shown by Sekiya the weight of pellets increases about 4-fold in the chondrogenic differentiation process (Sekiya et al., 2002). Interestingly expression of SOX-9, a transcription factor essential for chondrogenesis (Ng et al., 1997) was significantly up-regulated at the beginning of chondrogenic differentiation and gradually declined with the course of differentiation. This corresponds to the concept that expression of pro-chondrogenic transcription factors should be high at the beginning of chondrogenesis. This particular transcription factor is responsible for enhancement of collagen 2 synthesis (Bell et al., 1997; Lefebvre et al., 1997), however we observed induction of collagen 2 synthesis after 7 days of differentiation. The highest levels of mRNA for this matrix molecule were observed three weeks later, when SOX-9 levels already declined. We speculate that this discrepancy could result from the fact that very high SOX-9 levels are necessary to induce chondrogenic differentiation, however later also lower levels of SOX-9 are sufficient for collagen 2 transcription. As a next point of hMSC model evaluation comparison with human primary chondrocytes in alginate beads in terms of the influence of catabolic stimulation on the expression of matrix molecules was performed using TaqMan PCR. In both cell culture models catabolic cytokines showed the same effect, they down- regulated the expression of collagen 2 and aggrecan.
154 5. DISCUSSION
We performed also Affymetrix chip characterization of chondrogenic differentiation and compared these results with data sets obtained for healthy human cartilage samples (analysis of healthy cartilage samples was performed in the Osteoarthritis Project by ALTANA Pharma under the leadership of Dr. Gereon Lauer). This comparison revealed that the gene expression pattern in the second and third week of chondrogenic differentiation had the most similarities with healthy cartilage. Moreover we identified several differences in the gene expression pattern at 18th day of chondrogenesis and in normal cartilage. Among genes, which were detected as regulated in cartilage but not in hMSCs on the 18th differentiation day were: aggrecan, glypican 5 (both belonging to the superfamily of proteoglycans), adhesion molecule ICAM2 and extracellular superoxide dismutase (SOD-3). On the other hand there were also genes the expression of which was up-regulated in hMSCs but not in healthy cartilage, among them were collagens type 4, type 5 and type 6, glypican 1 and 4, cadherin-2, BMP1, WNT5B, hyaluronan synthase 1, prostaglandin
D2 synthase and proteases: ADAMTS2, MMPs 19 and 28. Simultaneous expression of anabolic genes with proteases indicates that extracellular matrix is still under remodeling in chondrogenic pellets. Detection of genes as BMPs and WNT in chondrogenic pellets confirms importance of these proteins in the regulation of chondrocyte maturation (Dong et al., 2005; Fischer et al., 2002a; Fischer et al., 2002b), also glypicans have been shown to regulate cellular growth and morphogenesis (Saunders et al., 1997).
Additionally we identified several genes up- und down-regulated during the course of chondrogenic differentiation. Several collagens were up-regulated already after 5 days of chondrogenesis. Expression of some other extracellular matrix proteins as dermatopontin and osteomodulin was also enhanced. Also BMPs were up-regulated which is consistent with the knowledge of the role of TGFβ superfamily in the regulation of chondrogenesis (Izzo et al., 2002; Schmitt et al., 2003; Majumdar et al., 2001; Carlberg et al., 2001; Hanada et al., 2001). We observed significant increases in SOX-4 mRNA levels especially in first two weeks of differentiation. Sekiya also detected this
155 5. DISCUSSION
member of the SOX family during chondrogenic differentiation in a similar microarray analysis (Sekiya et al., 2002).
Some discrepancies in the gene expression data which were not detected as up- or down- regulated on the 18th differentiation day in chondrogenic pellets, could be a result of high variability of results obtained for cells originating from different hMSCs donors. Large differences in the relative expression values for the particular gene between hMSCs donors lead to high variance and obtained results are not significant although the gene is expressed in all samples. Another biological explanation for absence of some genes in the group of regulated probe sets could be the fact that small changes in the mRNA levels of these genes are sufficient to have significant effects on cell physiology. These divergences could be also due to a limited number of samples tested. This was due to problems with isolation of sufficient amounts of high quality RNA. RNA isolation is extremely problematic from both cartilage and also chondrogenic pellets, because of complicated homogenization and on the other hand low cellularity and high concentrations of extracellular matrix molecules; especially negatively charged proteoglycans impair isolation of mRNA from these tissues. Therefore getting sufficient amounts of mRNA for hybridization (3µg) was sometimes very difficult additionally samples where RNA did not pass quality control were not hybridized.
In summary, we performed a very detailed evaluation of “the pellet” hMSC differentiation model. hMSCs in pellet culture entered the chondrogenic differentiation, as shown by the expression of matrix molecules and transcription factors important for chondrogenesis. However differentiating cells rapidly progressed to the hypertrophic state as indicated by collagen 10 expression. There were several similarities in the gene expression profile of chondrogenic pellets and healthy cartilage, however also a number of divergences. The differentiation protocol used is not able to induce differentiation of hMSC into healthy articular cartilage but leads to the formation of “cartilage-like tissue”, which phenotypically differs from hyaline cartilage. Several authors made the same
156 5. DISCUSSION
observation, and concluded that currently used protocols are not capable to induce homogenous differentiation leading to uniform hyaline cartilage, but rather to a phenotype more similar to OA cartilage or as recently reported intervertebral disc-like cells (Winter et al., 2003; Steck et al., 2005). However the hMSCs differentiation model is a transient model and the expectation to obtain in a few weeks cartilage with the same phenotype as articular cartilage after 20 or 40 years of remodelling is unrealistic. Still the hMSCs differentiation model can be very useful in tasks like understanding of chondrogenesis regulation or regulation of gene expression by catabolic cytokines.
5.2. NO production and iNOS expression in chondrocytes
NO was considered one of the major factors in the OA development and therefore a preferred pharmacological target. It was implicated previously that NO production is enhanced in OA cartilage (Abramson et al., 2001). We could not confirm these results. On the one hand we have found iNOS protein in OA cartilage samples; also OA cartilage explants cultured without exogenous stimuli produced significant amounts of NO. However in our experiments we observed large differences in iNOS mRNA expression levels between cartilage samples originating from different OA patients. Additionally iNOS mRNA expression was even higher in human healthy cartilage samples than in OA samples, however we could test only a very limited number of healthy cartilage samples.
Nitric oxide was synthesized by human chondrocytes in alginate beads in micromolar amounts after exposure to IL-1β. Chondrogenic pellets developed the capability to produce NO after stimulation with IL-1β as a result of chondrogenic differentiation. The subsequent increase in NO production after IL-1β stimulation during the differentiation course of hMSCs is consistent with other studies showing that IL-1β effects are dependent on the differentiation status of the mesenchymal cells (Blanco and Lotz, 1995). In chondrocytes it has been shown that IL-1β responsiveness depends upon
157 5. DISCUSSION
expression of the differentiated chondrocyte phenotype (Goldring and Berenbaum, 1999). Insensitivity of NO production to corticosteroids differentiates the regulation of iNOS in chondrocytes from other cell types, such as macrophages and hepatocytes (Amin et al., 2000). Interestingly iNOS expression and NO production was dexamethasone- insensitive not only in human chondrocytes but also in hMSCs during chondrogenic differentiation. We observed that undifferentiated hMSCs and hMSCs that had undergone adipogenic and osteogenic differentiation did not produce NO after IL-1β stimulation. In addition, dedifferentiated chondrocytes lose their ability to release NO after IL-1β stimulation. We therefore postulate that the phenomenon of NO production after IL-1β stimulation and corticosteroid insensitive iNOS expression can be used as marker of chondrogenic differentiation. The influence of NO on the chondrocytic phenotype and therefore on the pathology of OA was the aim of this study. Earlier studies on the expression of iNOS and NO production in the joint diseases have focused on its potential toxicity and on the role in the inflammatory process. However, recently it has been reported that NO by itself is not cytotoxic to cultured chondrocytes and can even be protective under conditions of oxidative stress (Del Carlo M Jr, 2002). Furthermore, in recent years opinions have changed concerning the role of iNOS in inflammation. Results are accumulating on a protective and regulatory role of iNOS (Darmani et al., 2004; Tatemichi et al., 2003; Suschek et al., 2004). Interestingly, potential beneficial effects of NO have been reported in environments other than cartilage. NO has been shown to have positive effects in wound healing (Luo and Chen, 2005), NO has also been shown to positively influence the differentiation processes of cardiomyocytes (Kanno et al., 2004) and neurons (Gibbs, 2003). Still, it remains to be clarified whether NO could contribute to chondrogenic differentiation.
158 5. DISCUSSION
5.3. iNOS regulation in chondrocytes iNOS is primarily regulated at the expression level by transcriptional and post- transcriptional mechanisms. Activation of transcription factors like NFκB and STAT-1α, and thereby activation of the iNOS promoter is an essential step for iNOS induction in most cells. In the human system, also post-transcriptional mechanism like regulation of iNOS mRNA stability plays an important role in the regulation of NO production (Kleinert et al., 2003). Signal transduction pathways involved in the regulation of iNOS expression are heterogeneous and specific for species and the cell type. IL-1 is a potent inducer of the NFκB pathway. Although the activation of NFκB is regulated on the protein level we have also seen prominent enhancement of NFκB transcription after IL-1 stimulation (Affymetrix data).
We could show that NFκB is a key transcription factor regulating iNOS expression in human chondrocytes. Stimulation of chondrocytes with IL-1 in the presence of the NFκB inhibitors hypoestoxide or kamebakaurin abrogated NO production. cAMP through cyclic AMP-responsive element binding protein (CREB) has been shown to participate in the regulation of iNOS expression. However the data on the cAMP effect on iNOS expression in human chondrocytes were contradictory (Geng et al., 1995). We could confirm results obtained by Tenor showing that increased cAMP levels have inhibitory effects on the NO production in human chondrocytes. The regulation of iNOS expression by intracellular cAMP levels indicates that prostaglandins acting via receptors, increasing cAMP levels in the cell, as EP2 and EP4 or IP reduce NO production. The decrease in NO generation due to increase in intracellular cAMP levels in IL-1 stimulated cells was ca. 50% in human chondrocytes as shown in the results. It seems that the effect of intracellular cAMP levels on the iNOS expression is species and cell type dependent. Interestingly the effect of cAMP on the iNOS expression in chondrocytes differs between species. In human and murine chondrocytes increases in cAMP levels inhibit NO production, on the contrary in rat chondrocytes enhance NO synthesis.
159 5. DISCUSSION
Interestingly it was reported that iNOS expression in human OA chondrocytes is glucocorticoid-insensitive. We could even observe a very potent stimulatory effect of Dex on NO production in dedifferentiated chondrocytes. We demonstrated that this effect of Dex is not restricted to OA chondrocytes, but is true for all chondrocytes, as bovine, porcine and murine chondrocytes originating from young animals responded in the same way. Further, in human elbow chondrocytes originating from donor without joint disease history we observed the same effect as in knee or hip OA chondrocytes. Additionally Dex-resistant iNOS expression was even true for human mesenchymal stem cells differentiating to chondrocytes. Furthermore, experiments on chondrocytes originating from diverse animals demonstrated that the effect of Dex is not human specific or species specific, but cell- type specific. However one cannot exclude that there may be species where this regulation is different. The iNOS expression was Dex insensitive independently on the stimulus used. Additionally a potent stimulatory effect of Dex on NO production in dedifferentiated chondrocytes was observed, when these cells almost lost their ability to produce NO in response to IL-1 stimulation.
The insensitivity of iNOS induction is highly interesting since glucocorticoids are very often used anti-inflammatory drugs. Intraarticular corticosteroids have been widely used for the treatment of osteoarthritis in patients where treatment with NSAIDs is ineffective. An injection of the knee joint with a corticosteroid may improve the patient's symptoms for up to three weeks after the injection (Roskos, 2005). However there are no guidelines for the administration of corticosteroids, and multiple intra-articular injections can accelerate cartilage damage and are associated with increased risk of tendon rupture and infection (Walker-Bone et al., 2000; Snibbe and Gambardella, 2005). In a classical mechanism of glucocorticoid action the effect of glucocorticoids is mediated by binding to a cytosolic glucocorticoid receptor (GR), which then is activated and rapidly translocates to the nucleus. Within the nucleus, the GR binds to the promoter regions of responsive genes to a specific deoxyribonucleic acid element called
160 5. DISCUSSION
glucocorticoid-responsive element (GRE) either inducing or reducing gene transcription (Adcock and Ito, 2000). In this traditional model of glucocorticoid action anti- inflammatory properties of these drugs are related to the suppression of pro- inflammatory genes like cytokines, COX-2 and iNOS. However recently alternative mechanisms of action of glucocorticoids have been proposed. One such mechanism is protein-protein interaction of GR with transcription factors. This interaction leads to inactivation of the transcription factor and/or inhibition of translocation into nucleus finally inhibiting expression of genes dependent on this transcription factor. Such interactions have been shown for NFκB and are relatively well studied (Barry et al., 2001; Ray et al., 1995; Ray and Prefontaine, 1994; Scheinman et al., 1995). In addition, an alternative mechanism of repression of NFκB by Dexamethasone was proposed. This involved up-regulation of the cytoplasmatic NFκB inhibitor IκBα resulting in the retention of NFκB heterodimers in the cytoplasm and prevention of nuclear translocation (Newton, 2000). However our results implicate that in chondrocytes there is no interaction between Dex and NFκB. Glucocorticoids have been shown to regulate cAMP-mediated effects by interference with CREB and C/EBPbeta, the major transcription factors mediating cAMP responses. Interactions of glucocorticoids with CREB and C/EBPbeta have been shown in many cell types (Eberhardt et al., 2002; Antonicelli et al., 2001; Wang and Tai, 1999). However it was also reported that Dexamethasone significantly increased intracellular cAMP levels (Al Wadei et al., 2005). In our experimental settings lack of inhibition of iNOS expression by glucocorticoids in human chondrocytes was not related to cAMP signalling pathway. However Dex showed a slight stimulatory effect on NO production related to inhibition of COX-2 expression and prostanoid production resulting in lower intracellular cAMP levels and enhanced NO synthesis.
In conclusion we could show that IL-1 induced NO production in human chondrocytes is strikingly dependent on the NFκB activation hence inhibition of NFκB DNA binding
161 5. DISCUSSION
aborted the production of nitrite. Intracellular cAMP levels also regulate NO production since agents elevating cAMP levels in the cell have inhibitory effect on NO synthesis in chondrocytes. However both signalling pathways are not influenced by Dex. Interestingly NFκB inhibitors had no impact on COX-2 expression. In contrast to this we could show that intracellular cAMP levels regulate COX-2 expression. Dex inhibits COX-2 expression in chondrocytes, probably via the classical mechanism of glucocorticoid action.
5.4. COX-2 and prostaglandin production in human chondrocytes
COX-2 also represents a key inflammatory enzyme and the role of PGE2 is well documented in the inflammatory process. Hyperalgesic effects of PGE2 or involvement in the generation of fever are well studied (Ferreira et al., 1978; Stock et al., 2001;
Aronoff and Neilson, 2001), however little is known about functions PGE2 plays in cartilage homeostasis and development of OA. According to literature synovial fluid of OA patients contains high concentrations of
PGE2 and cartilage as well as isolated chondrocytes of these patients spontaneously release more PGE2 than material obtained from healthy subjects (Miwa et al., 2000; Notoya et al., 2000; Amin et al., 1997; Jacques et al., 1999). Although it was also shown that levels of PGE2 in synovial fluid of OA patients can also vary widely (38-6380 pg/ml) (Brenner et al., 2004).
The issue of COX-2 induction in chondrocytes is even more complicated because PGE2 is far from being the only prostanoid produced by chondrocytes. Different eicosanoids which are induced parallely with PGE2 act via different receptors and there are many signaling pathways involved, which can exert multiple and divergent effects on chondrocyte metabolism. Although there are many reports dealing with PGE2 in cartilage pathophysiology production of other eicosanoids were even not characterized in detail. In this work we provide the first complete characterization of prostanoid production in human chondrocytes and hMSC undergoing chondrogenic differentiation.
162 5. DISCUSSION
In our experimental settings we used IL-1β as an OA-relevant stimulus to induce prostaglandin production. As revealed by presented Affymetrix analysis IL-1β is a very potent inducer of prostanoid pathway. We observed overexpression of PLA-2, COX-2 and PGES. This analysis revealed as well that the expression of prostanoid receptors EP2 and EP4 was up-regulated after IL-1 treatment. Indeed, IL-1β treatment of human chondrocytes in alginate beads resulted in an average 14-fold induction of PGE2 synthesis in comparison to control. The production of
6-keto-PGF1α, PGD2, PGF2α and 8-epiPGF2α was also up-regulated (1,6-4 fold) whereas synthesis of TxB2 and isoprostanes remained unchanged. The total amount of other prostanoids was several-fold smaller than the amount of PGE2. IL-1β-induced production of prostanoids in chondrocytes was inhibited by Dexamethasone, which implicates involvement of glucocorticoid-sensitive COX-2 (Masferrer et al., 1992). In our
study the failure of Dexamethasone to reduce spontaneous PGE2 and TxB2B release in chondrocytes suggests involvement of constitutively expressed COX-1 (Masferrer and Seibert, 1994).
PGE2 was by far the predominant COX-product in IL-1β stimulated chondrocytes.
Predominance of PGE2 over other prostanoids could be related to the up regulation of microsomal prostaglandin E synthase1 (mPGES-1), the final enzyme in the PGE2 biosynthesis pathway which was recently reported to be overexpressed in OA cartilage and in human chondrocytes stimulated with IL-1β (Masuko-Hongo et al., 2004). We could also show an increase in mRNA levels of this enzyme after IL-1 stimulation.
hMSCs after 6 days of chondrogenic differentiation released PGE2 as the predominant
product but PGI2, TxBB2, PGD2, and PGF2α were also generated although in much lower quantities. We did not detect F-isoprostanes except 8-epi PGF2α. Interestingly, spontaneous release of PGE2 was very high in pellets at the beginning of chondrogenic differentiation and exceeded even PGE2 production in chondrocytes after IL-1 stimulation. These results were confirmed by COX-2 PCR which revealed high COX-2 mRNA levels in unstimulated hMSCs at the beginning of chondrogenic differentiation. Affymetrix analysis showed also up- regulation of the constitutive COX isoform after
163 5. DISCUSSION
induction of chondrogenesis. However inhibition by dexamethasone indicates that high production of prostaglandins was due to COX-2 activity. Spontaneous PGE2 production declined at later time points of differentiation (data not shown). Production of very high levels of PGE2 at the beginning of chondrogenic differentiation suggest importance of this prostaglandin in cell differentiation. COX-2 and PGE2 have been shown to be involved in the differentiation of multiple cell types, however the role of PGE2 in chondrogenic differentiation is not quite clear. There have been reports on a negative influence of PGE2 on chondrocyte differentiation (Jacob et al., 2004). On the other hand already more than twenty years ago there have been reports indicating positive effects of PGE2 and PGI2 on chondrogenic differentiation by elevating cAMP levels by these prostaglandins (Kosher and Walker, 1983; Ballard and Biddulph, 1983). Clark et al. have recently shown that EP2 and EP4 receptor activation leading to the increase in intracellular cAMP levels may represent a central axis of events that facilitate the impact of PGE2 on the processes of hMSC commitment to chondrogenesis and ultimate chondrocyte maturation (Clark et al., 2005). Furumatsu et al. have shown that cAMP- response element binding protein (CBP/p300) acts as an important SOX-9 co-activator during chondrogenesis (Furumatsu et al., 2004). This transcription factor is necessary for chondrogenic differentiation by providing transcriptional signals for expression of the collagen 2 gene. These observations indicate that PGE2 exerts positive effects on collagen synthesis and chondrogenic differentiation (Goldring et al., 1990; Schwartz et al., 1998). However, in addition to its modulatory role on chondrocyte differentiation and homeostasis, PGE2 is also known to play an important role in synovial inflammation indicating an additional indirect role in the pathogenesis of arthritis. High concentrations of PGE2 produced by OA tissue might have a role in the degradation of bone and cartilage associated with OA (Hardy et al., 2002). On the other hand COX inhibition is the most common form of OA therapy and leads to pain relieve but does not improve cartilage structure.
6-keto-PGF1α, TxB2, PGF2α and in very low levels of PGD2 and 8-epi-PGF2α are other eicosanoids released by human chondrocytes and hMSCs during chondrogenic
164 5. DISCUSSION
differentiation. Jacob et al. reported that PGD2 and PGF2α enhanced chondrogenic differentiation and hyaline cartilage matrix deposition (collagen 2 and glycosaminoglycans) of dedifferentiated articular chondrocytes (Jakob et al., 2004).
The role prostacyclin plays in cartilage and chondrocyte homeostasis is not clear. PGI2 could have a positive effect on chondrogenic differentiation by elevating cAMP levels as indicated before. To our knowledge this is also the first report directly demonstrating prostacyclin synthase (PCS) staining in human cartilage and expression of the IP receptor on human chondrocytes. IP receptor activation results in the increase of intracellular cAMP (Bley et al., 1998), which exerts anti-inflammatory effects. However activation of PGE2 receptors EP2 and EP4 leads also to elevation of cAMP levels and therefore anti-inflammatory effects. One could speculate that cAMP elevation under basal conditions is through the IP receptor and through EP2 and 4 receptors after stimulation as expression of IP receptor was down-regulated after IL-1 stimulation. In contrary the expression of EP receptors was elevated.
Isoprostanes are often used as a sensitive marker of oxidative stress and their generation has been shown to increase in several pathologies. The rate of radical formation and oxidation is increased in the lipid phase because NO and O2 are 6-20 times more soluble in lipid layers compared with aqueous fractions (Gow et al., 1996). Isoprostanes were under detection limit in hMSCs, but human chondrocytes under basal conditions released significant amounts of isoprostanes. Interestingly 8-epi-PGF2α and other isoprostanes were not only a product of non-enzymatic arachidonic acid oxidation, but seemed to be to large extent generated by COX-2 as their formation could be inhibited by Dexamethasone and Diclofenac. The phenomenon of COX-2 dependent formation of isoprostanes was also observed in other biological systems, which limits their use as a marker of free radical generation (Klein et al., 2001b; Pratico et al., 1995).
165 5. DISCUSSION
5.4.1. Non-enzymatic isoprostane formation in excess of AA Increasing concentrations of exogenous AA led to a preferential formation of isoprostanes irrespective of cell stimulation, what indicates a COX-independent mechanism of their formation. Interestingly DETA NONOate and SIN-1 exerted distinct effects on the isoprostane formation. DETA NONOate in a dose-dependent manner inhibited isoprostane formation whereas SIN-1 enhanced formation of isoprostanes. Enhancement of isoprostane formation by SIN-1 is not surprising as oxidizing agents are known for the nonenzymatic oxidation of AA to isoprostanes (Klein et al., 2001a). A very interesting and important finding indicating that NO can be cytoprotective and reduce the generation of ROS under the conditions of oxidative stress in chondrocytes was the observation that DETA NONOate significantly inhibited the generation of - isoprostanes probably due to ONOO scavenging by NO (HOONO + 2NO → N2O3 + HONO). Results obtained for isoprostanes indicate that their formation can be COX-dependent as shown before (inhibition by Dex of isoprostane formation), or they can result directly from interaction of AA with ROS.
However, it seems that in chondrocytes under physiological conditions formation of isoprostanes is mostly COX-dependent. This could be due to low ROS production or under these conditions the redox potential of chondrocytes is high and therefore non- enzymatic isoprostane formation does not take place. We should not forget that the experiments with excess of AA are not relevant to the in vivo situation and they were performed only to demonstrate that COX enzymes are not inhibited by SIN-1 or DETA NONOate even in relatively high concentrations of tested agents (up to 250µM). In long lasting experiments without exogenous AA the effect of NO donors was not prominent.
166 5. DISCUSSION
5.4.2. Redox-regulation of prostanoid synthesis As indicated in the introduction there are contradictory opinions about the regulation of prostanoid generation by NO. Both inhibition and stimulation of COX-enzymes by NO in human chondrocytes was suggested. Therefore we performed detailed analysis of the regulation of prostanoid production in human chondrocytes by nitric oxide. Generally the effect of NO-donors and inhibitors on prostanoid production in physiologic related conditions was not very pronounced in our experimental settings. As shown in results NO donors had inhibitory effects on the COX-2 mRNA expression. Therefore a slight increase in prostanoid levels after the cells were stimulated with IL-1 in the presence of iNOS inhibitors was not surprising. However experiments using NO donors did not show inhibition of prostanoid synthesis. One can speculate that this could be due to compensation of COX-2 mRNA inhibition by increased levels of peroxides and therefore higher enzymatic activity of COX (as discussed later). In experiments with exogenously added arachidonic acid we observed a concentration- dependent increase in prostaglandin synthesis in both unstimulated and stimulated cells. These results indicate that AA availability is a limiting factor in COX-activity and further that prostaglandin synthesis is regulated by phospholipase activity. DETA NONOate or SIN-1 in experiments with exogenous AA slightly increased formation of prostanoids in chondrocytes. This effect was more prominent in unstimulated cells and could be due to the peroxide tone. The catalytic cycle of COX-enzymes is initiated by peroxides, which oxidize the heme prostetic group of the enzyme initiating the generation of PGG2 leading further to PGH2. Therefore the constant presence of low levels of intracellular peroxides is necessary for the activity of COX and formation of prostaglandins over the time (Capdevila et al., 1995; Margalit et al., 1998). The activation of COX by peroxides is called “peroxide tone”. The estimated peroxide tone for COX-2 was 2nM (Kulmacz and Wang, 1995) and about 10-fold higher for COX-1 (21nM). In contrast to COX-1 prostanoid generation by COX-2 is controlled rather at the transcriptional level and the regulation on the enzyme activity level due to peroxide tone is not so important. Therefore we think that the effect of NO donors was more prominent in resting cells, where the levels of peroxides are kept low to inhibit prostanoid generation by
167 5. DISCUSSION
constitutively expressed COX-1. The addition of exogenous peroxynitrite activated COX-1 in these resting cells. Further the increased levels of prostaglandins after
● - incubation of chondrocytes with DETA NONOate indicate that sufficient levels of O2 are present in the cells to react with NO to form ONOO- and provide the peroxide tone to COX enzymes.
Prostacyclin synthase (PCS) Nitration of PCS has been shown in a number of cell types under pathophysiological conditions like endotoxemia, ischemia-reperfusion, diabetes and atherosclerosis (Zou and Ullrich, 1996; Zou et al., 1997; Zou et al., 1999). We could not find nitration of this enzyme in OA chondrocytes. It has been shown that nanomolar levels of peroxynitrite (50-100nM) are sufficient to nitrate PCS (Zou et al., 1997(Schmidt et al., 2003) Schmidt), because of the heme nature of the enzyme. Although we assumed that PCS in chondrocytes should be nitrated due to on the one hand, nitration susceptibility of this enzyme and on the other, production of high levels of NO and formation of ONOO- as indicated by presence of nitrotyrosine, PCS did not show any nitration in chondrocytes. Western blots probed with anti-nitrotyrosine antibody did not reveal any nitration of this enzyme (data not shown). On the contrary stimulation of cells with IL-1 or addition of
SIN-1 increased PGI2 synthesis. This could be due to a peroxide tone generated by - ONOO , increased generation of PGH2 by COX and therefore enhanced availability of substrate for PCS resulting in increased PGI2 synthesis. Our data are in agreement with those obtained in SMC by Schildknecht et al. where 2-
3-fold increase in PGI2 generation was observed after exposure to IL-1 (Schildknecht et al., 2004).
To conclude, chondrocytes produce very high levels of prostaglandins after IL-1 stimulation due to COX-2 activity, which is regulated on the transcriptional level. The dependence of prostanoid formation on the peroxides means that prostaglandin synthesis is controlled also by the redox-state of the cell. Under conditions of oxidative
168 5. DISCUSSION
stress increased generation of prostanoids could be due to enhanced activity of constitutively expressed COX-1. NO can interfere with prostanoid production on both transcriptional and enzymatic activity level, however its effects in chondrocytes are not very prominent.
5.5. Apoptosis in the development of OA and the role of NO in this process
Adult articular cartilage is considered as a postmitotic tissue with resident cells enclosed in their lacunae, however several studies have shown that there is a low proliferative activity in OA chondrocytes (Meachim and Collins, 1962; Rothwell and Bentley, 1973; Mankin et al., 1971) leading to chondrocyte clustering, a characteristic feature of OA cartilage (Sandell and Aigner, 2001). On the other hand lacunar emptying has been shown in OA cartilage (Mitrovic et al., 1983; Bullough, 1997) and it was suggested that chondrocyte death is a main reason of OA cartilage degeneration (Bullough, 1992; Vignon et al., 1976; Meachim et al., 1965) and that chondrocytes die by apoptosis (Blanco et al., 1998; Hashimoto et al., 1998; Kim et al., 2000; Kouri et al., 2000). Authors suggest that cell death in cartilage samples range from 22 to 51% of cells in OA and from 5 to 11% in normal cartilage. However as remarked by Aigner these numbers are overestimated, because if they were correct even normal cartilage would loose soon the capacity to undergo biosynthesis and other biochemical parameters measured in cartilage would be impossible to assess. Indeed, Aigner observed apoptotic cell death in OA cartilage but at a very low rate with approximately 0,1% of the total cell population (Sandell and Aigner, 2001; (Aigner and Kim, 2002). A significant but lesser then in OA increase in the empty lacunae was also observed with age in normal cartilage (Aigner et al., 2001). We made similar observations as TUNEL assays performed on paraffin sections of OA cartilage revealed almost no apoptotic cells in this tissue. It has been also shown that cultured chondrocytes are highly resistant to apoptosis in comparison to other cells (Ogawa et al., 2003) probably because of the powerful free radical scavenging system (Toda et al., 2002).
169 5. DISCUSSION
On the other hand it has been suggested that NO triggers chondrocyte apoptosis in OA (Blanco et al., 1995; Kim et al., 2003; Relic et al., 2002; Yoon et al., 2003). Therefore we investigated the effect of NO donors and endogenously generated NO after IL-1 and TNF stimulation on cell death in these cells. In our experimental settings treatment with IL-1β or TNFα did not increase the rate of chondrocyte apoptosis. NO-donors: DETA NONOate or Spermine NONOate induced apoptosis but only at very high concentrations (from 0,5mM). The peroxynitrite- generating SIN-1 was a more potent inducer of apoptosis. Already 250µM SIN-1 decreased cellular viability to only 30 % of control. This result was not due to the amount of NO generated by particular donors, as diazeniumdiolates are more potent NO generators than SIN-1. In contrast to several publications these results indicate that endogenous or exogenous NO is not cytotoxic to chondrocytes, however peroxynitrite at high doses can induce chondrocyte apoptosis. The mechanism of chondrocyte apoptosis mediated by peroxynitrite is not very well elucidated. However mitochondrial dysfunction and energy depletion through ONOO- was suggested in cell death of chondrocyte-like ATDC5 cells (Yasuhara et al., 2005). Furthermore Whiteman et al. could show in human articular chondrocytes that peroxynitrite mediates a calcium-dependent mitochondrial dysfunction that leads to caspase-independent apoptosis mediated by calpains (Whiteman et al., 2004). Results obtained by Mistry et al. in murine OA model confirm that caspases are unlikely to be involved in apoptosis pathway in chondrocytes (Mistry et al., 2004).
In many previous studies iNOS expression or NO production was correlated with the level of apoptosis in the tissue. If NO would be an initial signal for apoptosis than we should also observe apoptosis in all cells that were iNOS positive after IL-1 stimulation. However we have not observed increased levels of apoptosis after IL-1β or TNFα stimulation. This is consistent with recently published data (Kuhn et al., 2000; Kim and Song, 2002). There is also a possibility that a lack of chondrocyte apoptosis after IL-1 or TNF stimulation, despite NO production, is due to an anti-apoptotic mechanism induced by
170 5. DISCUSSION
these cytokines. Treatment with IL-1 was previously suggested to protect chondrocytes from apoptosis by a mechanism that involves tyrosine phosphorylation events and NFκB-dependent gene activation (Kuhn et al., 2000).
Greisberg performed double staining of the same OA cartilage sections for apoptosis (TUNEL) and nitrotyrosine and there was no difference in the nitrotyrosine staining between in apoptotic and not apoptotic cells. He concluded also that it is improbable that all the cells, which were nitrotyrosine positive, were about to undergo apoptosis (Greisberg et al., 2002). Recently nitrite was even found to exert a protective effect upon hypochlorous acid- induced chondrocyte toxicity (Whiteman et al., 2003). The discrepancy between results from different studies demonstrating chondrocyte apoptosis after incubation with NO donors may be attributed to the use of chemical NO donors, which generate not only NO but additional toxic agents e.g. SNP (sodium nitroprusside). Primary byproducts of the decomposition of SNP, such as cyanide anion or pentacyanoferrate complex, might contribute to its cytotoxicity (Kim et al., 2005). In summary our results indicate that NO is not cytotoxic to chondrocytes even in high concentrations. Therefore a revision of the opinion on the role NO plays in chondrocyte apoptosis is necessary. We think that the effect of apoptosis on the pathology of OA is limited as rapid loss of the cells (in rates indicated by many authors) would lead to a complete degradation of the whole cartilage in some months or even weeks. It has been also shown that age predisposes articular cartilage to apoptosis and its possible that such changes are a prelude to the age-related development of OA (Todd Allen et al., 2004).
- - 5.6. NO, O2 and ONOO
The reactivity of NO per se has been greatly overestimated in vitro. In fact NO in cellular environment is relatively stable and persist in solutions for several minutes in micromolar concentrations. The rapid diffusion of NO between cells allows to locally
171 5. DISCUSSION
integrate the responses of tissues e.g. blood vessels or neuronal networks (Beckman and Koppenol, 1996). NO reacts with oxygen to form much stronger oxidants like nitrogen dioxide. ●NO reacts
● - also with O2 in a very fast, only diffusion limited reaction. Astoundingly both molecules
● - ● - O2 and NO are not very reactive towards biological macromolecules, however ONOO is a very potent oxidant. Therefore the availability of O2 and its reduced state regulate
- ● - the actions of NO. In contrast to NO and ONOO , O2 cannot easily pass biological membranes therefore compartment-specific actions of this molecule can be supposed.
Concentrations of NO and O2 are decisive for the final product of the reaction of both
● ● - - molecules. Equal rates of NO and O2 generation result in the formation of ONOO ,
● - however excess of NO can lower the ONOO levels because than production of NO2 is favored. NO2 can then react further to produce the nitrosating agent N2O3. Finally the acidic form of peroxynitrite ONOOH can decompose to the highly reactive
● ● oxidants NO2 and OH.
The oxidative stress induced alterations in physiological responses are discussed as important factors in the aging processes and in the development of several diseases. Production of oxygen radicals have been shown in articular chondrocytes and ROS were implicated in the regulation of redox sensitive pathways in chondrocytes (Rathakrishnan and Tiku, 1993; Hiran et al., 1998; Rathakrishnan et al., 1992; Tiku et al., 1990). Furthermore ROS production has been found to increase in OA (Henrotin et al., 2003).
● - There are several sources of O2 in the cell, as NADPH oxidases, xanthine oxidase and uncoupled NOSes but also mitochondria release this radical during the course of aerobic respiration. The presence of NADPH oxidases was demonstrated in chondrocytes. Moulton et al. detected various components of the NADPH oxidase complex in an immortalized human chondrocyte line: p22-phox, p40-phox, p47-phox and p67-phox were present at mRNA level. Western blot analysis showed the presence of p47-phox and p67-phox polypeptide components. However no significant superoxide generation was seen using
172 5. DISCUSSION
cytochrome c assay if the cells were stimulated with IL-1β, IL-4, TNFα. Stimulation with ionomycin or PMA enhanced the rate of superoxide generation by only 24 or 31% respectively (Moulton et al., 1997). Hiran et.al. detected p67-phox in porcine chondrocytes (Hiran et al., 1997). Further expression of gp91-phox mRNAin the immortalized chondrogenic cell line C-20/A4, as well as in chondrocytes derived from a patient undergoing joint-replacement therapy was shown (Moulton et al., 1998).
We found NOX2 mRNA expression in cartilage tissue samples (both normal and OA) and in chondrocytes in alginate beads, however no expression of NOX2 was detected in hMSC pellets (Affymetrix, data not shown). NOX2 is a phagocytic NADPH-oxidase, a membrane-bound enzyme complex that generates large quantities of superoxide and microbicidal oxidants upon activation. We found also mRNA expression of some gp91-phox homologs in human
● - chondrocytes. NOX4 (renal NADPH oxidase), which has been shown to generate O2 constitutively (Maturana et al., 2002); expression was found in cartilage tissue samples (normal and OA), in all hMSC pellets and in chondrocytes cultivated in the half of investigated alginate beads samples.
● - 2+ NOX5, which produces O2 in a Ca -dependent manner (Banfi et al., 2001) was expressed mainly in chondrocytes in culture (beads and hMSC pellets) and was seldom detected in the tissue samples.
● - Another source of O2 in chondrocytes, which was discussed in the literature, is the mitochondrium. However chondrocytes are mostly anaerobic working cells. Articular cartilage is an avascular and low oxygen environment therefore chondrocytes are highly glycolytic, as also confirmed by the prominence of lactate dehydrogenase (LDH) in chondrocytes (Tushan et al., 1969). Interestingly the basal respiratory rate of chondrocytes in culture is very low e.g. less than 10% of that in cultured fibroblasts or hepatocytes (Stefanovic-Racic et al., 1995; Johnson et al., 2000). Mitochondrial respiration accounts for only up to 25% of total in situ ATP production in articular chondrocytes and possibly more under conditions of increased energy demands
173 5. DISCUSSION
associated with tissue stress (Terkeltaub et al., 2002). Therefore it has been suggested that although in healthy cartilage mitochondria probably do not play an important role in energy generation, in conditions of biomechanical or inflammatory stress increased supply of ATP is required for an adaptation and e.g. matrix synthesis. In such conditions mitochondrial impairment and insufficient energy production would contribute to pathogenesis of cartilage. Indeed alterations in mitochondrial function were implicated in the development of OA (Terkeltaub et al., 2002). At the beginning of OA an increase in a number and size of mitochondria was observed what would confirm the role of aerobic respiration in matrix synthesis as at the beginning of OA increased anabolic activity of chondrocytes is observed. In addition at the end stages of OA the number of mitochondria in chondrocytes decreases (Weiss and Mirow, 1972; Weiss, 1973). Mitochondrial dysfunction would be a parallel between OA and other age-related diseases. However it is still not clear if oxidative damage is a primary or secondary event in pathogenesis of age-related diseases. Due to the glycolytic activity of chondrocytes in normal cartilage the secondary role of superoxide production due to mitochondrial dysfunction in the development of OA is more probable.
● - NOS enzymes were shown to generate O2 under particular conditions. In case of reduced availability of L-arginine or under oxidative conditions accompanied by decreased levels of the NOS cofactor BH4 uncoupling can take place and the
● - enzyme instead of NO releases O2 (Stuehr et al., 2001). Kuzkaya reported that BH4 is a target for oxidation by peroxynitrite, and this oxidation is 6-10 times faster than reaction of ONOO- with ascorbate or thiols (Kuzkaya et al., 2003). Especially under these conditions inhibition of uncoupled iNOS would be a rationale to prevent the generation of ROS. However to our knowledge till now there are no reports on the uncoupling of iNOS in chondrocytes.
● - We could not assess the source of O2 in chondrocytes as in our experiments levels of
● - O2 generated in induced chondrocytes were very low and direct measurements were
● - almost impossible. Measurement of O2 in the cell generating NO is very difficult
● - because the reaction of O2 with NO is much faster than with e.g. cytochrome c. The - 9 -1 -1 rate constants for the reaction of O2 with NO and cytochrome c are 6.7x10 M s and
174 5. DISCUSSION
1.1x106 M-1s-1 respectively. Additionally reduced cytochrome c can be reoxidized by peroxynitrite, further diminishing its effectiveness in measuring superoxide (Thomson et al., 1995) This could be an explanation for our results where we measured slightly
● - higher levels of superoxide in control cells probably due to trapping of O2 by NO in
● - stimulated cells. However levels of O2 measured in cells stimulated in the presence of iNOS inhibitors were also not higher (data not shown). This can be explained by the fact that even very small concentrations of NO are sufficient to quench superoxide, and iNOS inhibition was not 100%. Another explanation could be also a higher anti-oxidative potential of stimulated cells as we detected expression of several genes of proteins involved in radical scavenging as SOD and metallothioneins after IL-1 stimulation (Affymetrix analysis). Interestingly MnSOD was one of the highest up-regulated genes after IL-1 stimulation in chondrogenic pellets. MnSOD upregulation after cytokine stimulation was already reported in OA chondrocytes (Mazzetti et al., 2001). Additionally it has been also demonstrated in other cell types that cytokines besides inducing radical production can in parallel modulate the expression and activity of radical scavengers (Flanders et al., 1997; Niwa et al., 1996). In particular IL-1 and TNFα are able to induce SOD expression (Sugino et al., 1998; Tannahill et al., 1997). Except for SOD human chondrocytes constitutively express catalase, glutathione peroxidase (GPX) and peroxiredoxins (Henrotin et al., 2005; Chae et al., 1999; Knoops et al., 1999).
Different cell types differ in their antioxidative capacity and sensitivity to oxidative and nitrosative stress. We think that chondrocytes are very robust cells that have a high antioxidative potential, similar to e.g. smooth muscle cells as shown by Schildknecht (Schildknecht et al., 2005). This antioxidant potential could be due to the presence of several radical scavengers, which expression was very prominent in chondrocytes and also in differentiating stem cells and to high activities of GSH-reductase, thioredoxin or glutoredoxin.
175 5. DISCUSSION
5.7. Protein tyrosine nitration
Nitrotyrosine formation has been shown in numerous tissues under pathological conditions. However the opinion about tyrosine nitration changes during the last years. Recently the group of Stuehr postulated that this protein modification is observed under normal conditions in all tissues and is a reversible process (Koeck et al., 2004; Aulak et al., 2004). It could represent a novel mechanism of regulation of tyrosine kinase signaling. Initially it was suggested that nitration of tyrosine residues in tyrosine kinase substrates may prevent phosphorylation and therefore inhibit tyrosine kinase signaling (Kong et al., 1996). Recently it has been reported that peroxynitrite promotes the nitration and/or phosphorylation of regulatory sites at tyrosine kinase receptors coupled to well-known antiapoptotic pathways, such as those involving phosphoinositide 3- kinase/Akt or mitogen-activated protein kinases (Bolanos et al., 2004a), what would implicate a regulatory role of tyrosine nitration. Still the mechanisms, regulation and role protein tyrosine nitration plays in biological systems are controversial.
Nitrotyrosine was present in human OA cartilage samples as demonstrated by immunohistochemical staining and western blot analysis. A detailed analysis revealed that a number of proteins were nitrated in chondrocytes. Interestingly although experiments were performed several times we obtained very reproducible results. As nitrated following proteins were found in human chondrocytes: annexin A2, actin, vimentin, MnSOD, and enzymes of the glycolytic pathway: alpha enolase, pyruvate kinase M1/M2, fructose-bisphosphate aldolase A and glyceraldehyde-3-phosphate dehydrogenase. Reproducibility of results indicates that tyrosine nitration could be a strikingly controlled and selective process. Some proteins are more susceptible to tyrosine nitration because of: • their structure and nature as e.g. formation of tyrosyl radical during the course of catalysis (as PCS and ribonucleotide reductase) • distance to the source of nitrating agent.
176 5. DISCUSSION
It is also possible that with present methods detection and identification of only very abundant nitrated proteins becomes possible and with more sensitive tools also other proteins would be detected. From the nitrations observed so far one might speculate on metabolic changes occurring upon chondrocyte differentiation.
Annexin II is a component of plasma membrane vesicles and is involved in regulation of membrane trafficking events (Liemann and Lewit-Bentley, 1995). In chondrocytes annexin II has been shown to play a role in the mineralization process of cartilage (Kirsch et al., 2000b) and is therefore considered as a marker of terminally differentiated chondrocytes. It has been shown that OA chondrocytes express annexin II and undergo terminal differentiation leading to cartilage mineralization and destruction (Kirsch et al., 2000a). However this is the first report showing nitration of annexin II in OA chondrocytes. Previously annexin II nitration was shown in A549 cells, a lung epithelial cell line, treated with ONOO- (Rowan et al., 2002). Results of this study suggest that liposome aggregation was inhibited by nitration of annexin II in these cells. This could indicate that nitration of annexin II in human chondrocytes could have positive effect on cartilage structure due to inhibition of mineralization.
Actin and vimentin are members of the cytoskeletal system of filaments in nonmuscle cells. These microfilaments are involved in cell motility, organelle transport and cytokinesis. Although nitration of vimentin has never been detected previously there are some reports on actin nitration. In sickle cell disease nitration of actin tyrosine residues at positions that significantly modify actin assembly led to disorganisation of the actin fibers that altered cytoskeleton and caused cell death (Aslan et al., 2003). Peroxynitrite dependent increase in permeability of pulmonary microvessel endothelial monolayers was also associated with generation of nitrated actin and disorganisation of cell cytoskeleton (Neumann et al., 2005). Interestingly actin was markedly (>50%) carbonylated and nitrated in inflamed tissues of active IBD (Inflammatory Bowel Disease), and less in normal appearing tissues suggesting that oxidant induced cytoskeletal disruption is a part of the tissue injury (Keshavarzian et al., 2003).
177 5. DISCUSSION
MnSOD was found previously nitrated in human renal allografts and nitration probably inhibited MnSOD activity (MacMillan-Crow et al., 1996). Consistent with this hypothesis MnSOD is inactivated by peroxynitrite treatment in vitro (Yamakura et al., 1998). Nitration of MnSOD responsible for scavenging of superoxide in the mitochondria, may cause mitochondrial dysfunction (Davies et al., 2001). On the other hand MnSOD is a very abundant protein. Very high levels of SOD are necessary to provide a protection against superoxide since the formation of peroxynitrite in the reaction of superoxide with NO is much quicker than reaction of dismutation and therefore only much higher concentrations of SOD than NO can prevent formation of this reactive molecule. Aerobic cells generally contain enormous concentrations of SOD; it is the major fraction of cellular protein. The concentration of Cu,Zn SOD is a billion times greater than the concentration of superoxide itself (Beckman, 1999). Interestingly there are several reports showing the prominent regulatory role of NO and - O2 preferably in mitochondria. Peroxynitrite was reported to inhibit mitochondrial complexes I, II, IV and V, inhibit aconitases that catalyse the isomerization of citrate and creatinine kinase. Peroxynitrite was also shown to induce mitochondrial swelling, depolarization, calcium release, membrane damage and permeability transition (Yamakura et al., 1998; Terkeltaub et al., 2002). Additionally peroxynitrite can contribute to DNA damage and inappropriate transcription of mitochondrial proteins. - Therefore inhibition of MnSOD resulting in increased ·O2 generation in mitochondria, which can react with NO, easily passing mitochondrial membrane, leading to the formation of peroxynitrite can be critical forming a cycle contributing to further damage of mitochondria resulting in dysfunction and decrease in energy production.
In addition we found several enzymes of glycolytic pathway nitrated in human chondrocytes: alpha enolase, pyruvate kinase M1/M2, fructose-bisphosphate aldolase A and glyceraldehyde-3-phosphate dehydrogenase. Nitration of enzymes belonging to glycolytic pathway could be due to their abundance in chondrocytes. On the other hand nitration could be also a mechanism of the regulation of energy metabolism in chondrocytes. Till now there were data indicating an effect of peroxynitrite on the
178 5. DISCUSSION
respiratory rate of mitochondria in chondrocytes. Our results indicate that also glycolytic pathway can be regulated by this oxidant. A number of studies revealed nitration of enzymes involved in energy metabolism in other tissues. Aldolase A and glyceraldehyde-3-phosphate dehydrogenase (interestingly also annexin II) were nitrated in rat retina and this nitration was modulated by light (Miyagi et al., 2002). Glyceraldehyde-3-phosphate dehydrogenase was found nitrated in vivo in livers of LPS-treated rats (Aulak et al., 2001). Pyruvate kinase, aldolase A and glyceraldehyde-3-phosphate dehydrogenase were nitrated in aging skeletal muscle of 34-month-old Fisher 344/Brown Norway F1 hybrid rats, a well accepted animal model for biological aging (Kanski et al., 2005b). Similar data were also obtained for hearts in the same model (Kanski et al., 2005a). Both tyrosine nitration and alterations in energy metabolism were associated with biological aging (Beal, 2002). Accumulated oxidative stress resulting from a gradual shift in the redox status of tissues is now considered to be a key mechanism of the aging process (Merry, 2004). It has been proposed that the effect of caloric restriction is due to a lower rate of superoxide generation in mitochondria slowing the rate of oxidative damage of the cell. Chondrocytes are a perfect example of caloric restricted cell additionally with very low oxygen consumption and would be therefore an interesting model for aging studies.
In summary, the effect protein nitration has on chondrocytes is not clear. It seems that it is specific as we always detected the same nitrotyrosine-positive spots. However still there are many questions regarding reversibility of this process and its possible function.
Except protein nitration NO influences cellular signal transduction and provides a mechanism for redox-based physiological regulation by another protein modification: S- nitrosation. S-nitrosation, the covalent attachment of a nitrogen monoxide group to the thiol side chain of cysteine, has emerged as an important mechanism for dynamic, post- translational protein regulation.
179 5. DISCUSSION
S-nitrosation regulates a wide range of cellular functions including apoptosis, metabolism, membrane trafficking, protein phosphorylation, the activity of enzymes through both allosteric and active-site modification, transcription-factor stability and activity, receptor-coupled and other ion-channel activity, and maintenance of cellular redox equilibrium (Hess et al., 2005; Choi et al., 2002).
5.8. IL-1 versus NO mediated effects
A number of IL-1β effects on chondrocyte functions were postulated to be mediated by NO, however many of them were based just on the correlation between increased NO production and observed effect. Therefore we performed a very detailed analysis of the effect of NO on the gene expression in human chondrocytes. Designing our experiments we put special attention to distinguish between IL-1 influence on the gene expression and NO-mediated effects. In our experiments monitored over 4 weeks 50µM DETA NONOate was present during the whole course of hMSCs chondrogenic differentiation. Presence of NO had no effect on collagen 1 and 10 expression on IL-6, RUNX-2 and ADAMTS 5 expression, interestingly presence of NO in differentiation medium enhanced expression of cartilage specific collagen 2. The presence of NO-donor had an inhibitory effect on COX-2 expression in IL-1 stimulated cells; on the contrary iNOS expression was slightly up-regulated if the cells were stimulated with IL-1 in the presence of DETA NONOate in the first three weeks of chondrogenic differentiation. As expected IL-1 down-regulated expression of collagens and up-regulated expression of ADAMTS 5 and pro-inflammatory genes as iNOS, COX-2, IL-1 and IL-6. To further differentiate effects of NO and IL-1 we tested the effect of NO-donors: DETA NONOate and SIN-1, and IL-1 in another model: human OA chondrocytes in alginate culture and monolayer. Independently on culture conditions we did not observed any effects of both NO-donors on the expression of extracellular matrix molecules like collagens and aggrecan although IL-1 inhibited expression of ECM molecules.
180 5. DISCUSSION
Both NO donors had significant inhibitory effect (ca. 40% inhibition) on IL-1 stimulated COX-2 expression. The basal expression of SOX-9 and IL-1 stimulated iNOS and IL-1 expression was weakly and not significantly down regulated by NO-donors.
Affymetrix gene expression analysis of human OA chondrocytes in alginate beads using two iNOS inhibitors: 1400W and BYK 191023 and IL-1 as stimulus demonstrated that almost all effects on gene expression in these cells were directly due to IL-1 without NO as secondary mediator. After IL-1 stimulation we observed down-regulation of genes related to extracellular matrix like collagens, what is consistent with literature, but also genes regulating chondrocyte differentiation as e.g. frizzled homologs, WNT1, SOX 4 and 8. In contrast some genes related to chondrocyte differentiation as SOX 7, 11 and 17, WNT5A were up regulated after IL-1 treatment. As expected up-regulated were also pro-inflammatory genes like NFκB, GTP-cyclohydrolase, iNOS, COX-2, a number of interleukins and genes related to TNFα. We found only two genes (in 590 IL-1 up-regulated probe sets), which were down- regulated with both iNOS inhibitors in IL-1 stimulated cells indicating the role of NO in their regulation. These genes were: enolase 2 (gamma, neuronal) and glucan (1,4- alpha-), branching enzyme 1 (glycogen branching enzyme). Both enzymes are involved in energy metabolism of the cell as enolases catalyze the conversion of 2- phosphoglycerate to phosphoenolpyruvate in the glycolytic pathway and glycogen branching enzyme is involved in glycogen synthesis. Branching of the glycogen chains is essential to pack a very large number of glycosyl units into a spherical molecule. Some more genes were found to be down-regulated by IL-1 and up-regulated by iNOS inhibitors, here we found genes related to ER, Golgi aparatus and protein transport, genes of proteins involved in transcription and intracellular signaling but also related to energy metabolism as HSPA5, which is regulated by glucose levels (glucose-regulated protein 78 GRP78) (Lee et al., 1983).
Interestingly results presented in this work may suggest that NO is involved in the regulation of energy metabolism in chondrocytes. The glycolytic pathway, which is the
181 5. DISCUSSION
main energy supplier in chondrocytes seems to be regulated on the transcriptional and post-translational level by NO. We could show transcriptional regulation of enolase and nitration of several enzymes belonging to glycolytic pathway as enolase, pyruvate kinase M1/M2, fructose-bisphosphate aldolase A and glyceraldehyde-3-phosphate dehydrogenase. Furthermore genes related to glucose metabolism as glucan (1,4- alpha-), branching enzyme 1 and HSPA5 were also regulated in respect to NO in human chondrocytes. It was previously shown that IL-1 increase the rate of glycolysis in chondrocytes and NO was implicated in the regulation of this process (Stefanovic-Racic et al., 1995). Inhibition of mitochondrial respiration by generation of peroxynitrite was shown in a number of cell types (Tatsumi et al., 2000; Tomasiak et al., 2004; Mander et al., 2005) and believed to have detrimental effects on the cell. However recently it was reported that the inhibition of mitochondrial respiration by nitric oxide leads to an up-regulation of glycolysis by NO and affords cytoprotection against energy failure (Cidad et al., 2004; Almeida et al., 2004). Additionally it was reported that NO increases levels of glucose transporters (GLUT3) in astrocytes resulting in increased rate of glucose uptake. The increase in glucose uptake in astrocytes would have a neuroprotective role under conditions in which NO formation is combined with hypoglycaemia, such as in brain ischemia (Cidad et al., 2001). Further transformation of GLUT3-lacking HEK-293T cells with GLUT3 afforded cytoprotection against low-glucose-induced apoptotic death. These results suggest that the inhibition of mitochondrial respiration by NO and the simultaneous stimulatory effect on glucose uptake represents a novel survival pathway during pathophysiological conditions involving transient reductions in the supply of cellular glucose (Cidad et al., 2004). Interestingly it seems that peroxynitrite is involved in this regulation of glucose metabolism and additionally in the glutathione regeneration (Garcia-Nogales et al., 2003). Additionally, in neurons peroxynitrite triggers signaling pathways leading to glucose oxidation through the pentose-phosphate pathway to form reducing equivalents in the form of NADPH (Almeida et al., 2005). In summary these data strongly suggests that NO and NO-derived species modulate key regulatory steps of glucose metabolism. These involve up-regulation of high-affinity
182 5. DISCUSSION
glucose transporter, stimulation of glycolysis at 6-phosphofructo-1-kinase, and activation of pentose-phosphate pathway at glucose-6-phosphate dehydrogenase (Bolanos et al., 2004b).
NO is progressively emerging as a modulator of O2 consumption and there is an increasing evidence demonstrating that inhibition of cytochrome c oxidase by nitric oxide (NO) could be a part of a signalling cascade involved in the physiologic regulation of cell functions (Fiorucci et al., 2004). The mitochondrial impairment may serve as a cellular sensor of energy charges, hence modulating metabolic pathways, such as glycolysis (Almeida et al., 2005).
Therefore our data suggest that also in chondrocytes O2 consumption and glucose metabolism are modulated by NO. However this data is very preliminary and requires further investigation.
We performed also analysis of IL-1 regulated genes in hMSC differentiation model, which further confirmed the role of IL-1 as a very potent inducer of proinflammatory genes (NFκB, IL-1, IL-6, COX-2) and genes related to cartilage degradation (ADAMTS5, MMP1, MMP3, MMP12).
Considering all the data on the gene expression presented in this work we conclude that however IL-1 is a very powerful inducer of changes in the gene expression levels in human chondrocytes only very few of them are due to NO.
5.9. Clinical implications
There is convincing evidence that IL-1 is a key mediator of cartilage loss observed in OA. Therefore interfering with the production of this mediator would be a promising therapy for prevention of cartilage structural changes in OA. Studies in different animal models of OA using intraarticular IL-1Ra injections have shown its efficacy to slow the progression of cartilage lesions (Caron et al., 1996). In the first phase II study on IL-1Ra (anakinra, Amgen) patients with painful knee OA well tolerated the intraarticular IL-1Ra and their responses suggest a therapeutic effect, however further placebo controlled
183 5. DISCUSSION
studies are necessary (Chevalier et al., 2005). Also IL-1 receptor antagonist gene transfer to arthritic joints has shown promising results (Evans et al., 2004; Fernandes et al., 2002). Anti IL-1 therapy would combine attenuation of cartilage destruction with an analgesic effect, as this cytokine is responsible for the COX-2 up-regulation and production of high levels of pain mediator PGE2 (Samad et al., 2001). In contrast as suggested by our results iNOS inhibition would not have significant effects on prostaglandin production in chondrocytes. The selective inhibition of iNOS was suggested as promising treatment of OA, however in context of the study presented here the benefit of iNOS inhibition in articular chondrocytes is difficult to define and questionable. It seems that NO modulates a number of important processes in chondrocytes like the glucose metabolism.
It was previously suggested that the balance between the levels of NO and O2 regulate the respiratory rate of mitochondria (Forfia et al., 1999). It could be possible that NO regulates the energy metabolism in human chondrocytes not only by modulation of the rate of mitochondrial respiration but also due to the regulation of glycolytic pathway. - Our results demonstrate that one can not study the biology of NO without studying O2 - as in point of fact levels of O2 modulate the effect of NO. Therefore we believe that NO - itself is not cytotoxic, but peroxynitrite the product of the reaction between NO and O2 can exert many detrimental actions in the cell, however it can play also a regulatory role e.g. in prostanoid synthesis. The modulation of cell signalling by NO and free radicals is an emerging area of research, as in last years it became clear that this molecules regulate an extraordinary diverse range of physiological and pathophysiological functions (Huwiler and Pfeilschifter, 2003). However this research brings with it many troubles: these signalling molecules are very short living, extremely reactive and do not have classical receptors as hormones or growth factors, in return they can react with a number of macromolecules including proteins, lipids and nucleic acids.
184 5. DISCUSSION
Still the balance between oxidative and antioxidative effects is of high importance for cell homeostasis. If the redox potential of the cell is high generation of even high levels of ROS will not be toxic. NO in cartilage can become cytotoxic only under the conditions of oxydative stress. Therefore in chondrocytes a superoxide-inhibiting therapy appears more promising than iNOS inhibition.
We believe that it will be very difficult to develop an anti-OA therapy as it is not just a single disease event, but a dynamic and continuously changing process differing in terms of time, etiology, mediators and outcome between patients. It seems that not only inflammatory mediators are important but also mechanical stress is a critical factor in the cartilage destruction as cartilage of the same OA joint can reveal distinct grades of degradation. Very often cartilage of low bearing areas remains unaffected however this cartilage is exposed to the same mediators present in the synovium. Therefore probably it is impossible to develop one therapy for all OA patients, as this collective is very complex. However in regard to results presented here anti-IL-1 therapy could be advantageous for many patients. The data presented here suggests that iNOS inhibition would not attenuate cartilage degradation in OA patients. There is still the possibility that iNOS inhibition could prevent early mitochondrial dysfunction and late apoptosis of chondrocytes, but both events do not seem to be primarily involved in OA. Our study was limited only to articular cartilage. However, one should not forget that in the late stages of OA the synovium and subchondral bone are involved in the disease progression. Indeed infiltration of immune cells into synovial space was observed. Therefore the possibility that for the whole OA joint iNOS inhibition would exert a protective effect cannot be excluded. Further studies in articulation-relevant models are required to answer the question if iNOS inhibition could have a protective effect on other aspects of OA.
185 6. REFERENCES
6. REFERENCES
Abramson, S. B. 1999. The role of COX-2 produced by cartilage in arthritis. Osteoarthritis and Cartilage 7:380-381.
Abramson, S. B., Attur, M., Amin, A. R., and Clancy, R. 2001. Nitric oxide and inflammatory mediators in the perpetuation of osteoarthritis. Curr Rheumatol Rep 3:535-541.
Abu-Soud, H. M. and Stuehr, D. J. 1993. Nitric Oxide Synthases Reveal a Role for Calmodulin in Controlling Electron Transfer. Proceedings of the National Academy of Sciences 90:10769-10772.
Adcock, I. M. and Ito, K. 2000. Molecular mechanisms of corticosteroid actions. Monaldi Arch Chest Dis. 55:256-66.
Ahlstrom, M., Pekkinen, M., Huttunen, M., and Lamberg-Allardt, C. 2005. Dexamethasone down- regulates cAMP-phosphodiesterase in human osteosarcoma cells. Biochemical Pharmacology 69:267- 275.
Aigner, T., Hemmel, M., Neureiter, D., Gebhard, P. M., Zeiler, G., Kirchner, T., and McKenna, L. 2001. Apoptotic cell death is not a widespread phenomenon in normal aging and osteoarthritis human articular knee cartilage: a study of proliferation, programmed cell death (apoptosis), and viability of chondrocytes in normal and osteoarthritic human knee cartilage. Arthritis Rheum. 44:1304-12.
Aigner, T. and Kim, H. A. 2002. Apoptosis and cellular vitality: issues in osteoarthritic cartilage degeneration. Arthritis Rheum. 46:1986-96.
Aigner, T., Reichenberger, E., Bertling, W., Kirsch, T., Stoss, H., and der Mark, K. 1993. Type X collagen expression in osteoarthritic and rheumatoid articular cartilage. Virchows Arch B.Cell Pathol 63:205-211.
Al Wadei, H. A. N., Takahasi, T., and Schuller, H. M. 2005. PKA-dependent growth stimulation of cells derived from human pulmonary adenocarcinoma and small airway epithelium by dexamethasone. European Journal of Cancer 41:2745-2753.
Alderton, W. K., Cooper, C. E., and Knowles, R. G. 2001. Nitric oxide synthases: structure, function and inhibition. Biochem J. 357:593-615.
Almeida, A., Cidad, P., Delgado-Esteban, M., Fernandes, E., Garcia-Nogales, P., and Bolanos, J. P. 2005. Inhibition of mitochondrial respiration by nitric oxide: its role in glucose metabolism and neuroprotection. J Neurosci Res. 79:166-171.
Almeida, A., Moncada, S., and Bolanos, J. P. 2004. Nitric oxide switches on glycolysis through the AMP protein kinase and 6-phosphofructo-2-kinase pathway. Nat Cell Biol. 6:45-51.
186 6. REFERENCES
Alsalameh, S., Amin, R., Gemba, T., and Lotz, M. 2004. Identification of mesenchymal progenitor cells in normal and osteoarthritic human articular cartilage. Arthritis Rheum. 50:1522-32.
Amin, A. and Abramson, S. 1998. The role of nitric oxide in articular cartilage breakdown in osteoarthritis. Curr Opin Rheumatol 10:263-268.
Amin, A. R., Attur, M., Patel, R. N., Thakker, G. D., Marshall, P. J., Rediske, J., Stuchin, S. A., Patel, I. R., and Abramson, S. B. 1997. Superinduction of Cyclooxygenase-2 Activity in Human Osteoarthritis- affected Cartilage . Influence of Nitric Oxide. Journal of Clinical Investigation 99:1231-1237.
Antonicelli, F., De Coupade, C., Russo-Marie, F., and Le Garrec, Y. 2001. CREB is involved in mouse annexin A1 regulation by cAMP and glucocorticoids. FEBS Journal 268:62-69.
Aronoff, D. M., Canetti, C., and Peters-Golden, M. 2004. Prostaglandin E2 Inhibits Alveolar Macrophage Phagocytosis through an E-Prostanoid 2 Receptor-Mediated Increase in Intracellular Cyclic AMP. The Journal of Immunology 173:559-565.
Aronoff, D. M. and Neilson, E. G. 2001. Antipyretics: mechanisms of action and clinical use in fever suppression. The American Journal of Medicine 111:304-315.
Aslan, M., Ryan, T. M., Townes, T. M., Coward, L., Kirk, M. C., Barnes, S., Alexander, C. B., Rosenfeld, S. S., and Freeman, B. A. 2003. Nitric Oxide-dependent Generation of Reactive Species in Sickle Cell Disease. Actin Tyrosine Nitration Induces Defective Cytoskeletal Polymerization. Journal of Biological Chemistry 278:4194-4204.
Aulak, K. S., Koeck, T., Crabb, J. W., and Stuehr, D. J. 2004. Dynamics of protein nitration in cells and mitochondria. AJP - Heart and Circulatory Physiology 286:H30-H38.
Aulak, K. S., Miyagi, M., Yan, L., West, K. A., Massillon, D., Crabb, J. W., and Stuehr, D. J. 2001. Proteomic method identifies proteins nitrated in vivo during inflammatory challenge. Proceedings of the National Academy of Sciences 98:12056-12061.
Ballard, T. A. and Biddulph, D. M. 1983. Effects of prostaglandins on cyclic AMP levels in isolated cells from developing chick limbs. Prostaglandins. 25:471-80.
Banfi, B., Molnar, G., Maturana, A., Steger, K., Hegedus, B., Demaurex, N., and Krause, K. H. 2001. A Ca2+-activated NADPH Oxidase in Testis, Spleen, and Lymph Nodes. Journal of Biological Chemistry 276:37594-37601.
Barnes, P. J. and Liew, F. Y. 1995. Nitric oxide and asthmatic inflammation. Immunology Today 16:128- 130.
Barry, F., Boynton, R. E., Liu, B., and Murphy, J. M. 2001. Chondrogenic Differentiation of Mesenchymal Stem Cells from Bone Marrow: Differentiation-Dependent Gene Expression of Matrix Components. Experimental Cell Research 268:189-200.
Beal, M. F. 2002. Oxidatively modified proteins in aging and disease. Free Radical Biology and Medicine 32:797-803.
187 6. REFERENCES
Beckman, J. The ABC`s of the Reactions between Nitric Oxide, Superoxide, Peroxynitrite and Superoxide Dismutase. Oxygen`99[Sunrise Free Radical School]. 1999. Ref Type: Conference Proceeding
Beckman, J. S. and Koppenol, W. H. 1996. Nitric oxide, superoxide, and peroxynitrite: the good, the bad, and ugly. AJP - Cell Physiology 271:C1424-C1437.
Behr-Roussel, D., Rupin, A., Simonet, S., Bonhomme, E., Coumailleau, S., Cordi, A., Serkiz, B., Fabiani, J. N., and Verbeuren, T. J. 2000. Effect of Chronic Treatment With the Inducible Nitric Oxide Synthase Inhibitor N-Iminoethyl-L-Lysine or With L-Arginine on Progression of Coronary and Aortic Atherosclerosis in Hypercholesterolemic Rabbits. Circulation 102:1033-1038.
Bell, D. M., Leung, K. K. H., Wheatley, S. C., Ng, L. J., Zhou, S., Wing Ling, K., Har Sham, M., Koopman, P., Tam, P. P. L., and Cheah, K. S. E. 1997. SOX9 directly regulates the type-ll collagen gene. Nat Genet 16:174-178.
Bhat, N. R., Feinstein, D. L., Shen, Q., and Bhat, A. N. 2002. p38 MAPK-mediated Transcriptional Activation of Inducible Nitric-oxide Synthase in Glial Cells. Roles of Nuclear Factors, Nuclear Factor kappa B, cAMP Response Element-Binding Protein, CCAAT/Enhancer-Binding Protein-beta , and Activating Transcription Factor-2. Journal of Biological Chemistry 277:29584-29592.
Bishop-Bailey, D., Calatayud, S., Warner, T. D., Hla, T., and Mitchell, J. A. 2002. Prostaglandins and the regulation of tumor growth. J Environ Pathol Toxicol Oncol. 21:93-101.
Blanco, F. J., Guitian, R., Vazquez-Martul, E., de Toro, F. J., and Galdo, F. 1998. Osteoarthritis chondrocytes die by apoptosis. A possible pathway for osteoarthritis pathology. Arthritis Rheum 41:284- 289.
Blanco, F. J. and Lotz, M. 1995. IL-1-Induced Nitric Oxide Inhibits Chondrocyte Proliferation via PGE2. Experimental Cell Research 218:319-325.
Bley, K. R., Hunter, J. C., Eglen, R. M., and Smith, J. A. M. 1998. The role of IP prostanoid receptors in inflammatory pain. Trends in Pharmacological Sciences 19:141-147.
Boer, R., Ulrich, W. R., Klein, T., Mirau, B., Haas, S., and Baur, I. 2000. The Inhibitory Potency and Selectivity of Arginine Substrate Site Nitric-Oxide Synthase Inhibitors Is Solely Determined by Their Affinity toward the Different Isoenzymes. Molecular Pharmacology 58:1026-1034.
Boileau, C., Martel-Pelletier, J., Jouzeau, J. Y., Netter, P., Moldovan, F., Laufer, S., Tries, S., and Pelletier, J. P. 2002a. Licofelone (ML-3000), a dual inhibitor of 5-lipoxygenase and cyclooxygenase, reduces the level of cartilage chondrocyte death in vivo in experimental dog osteoarthritis: inhibition of pro-apoptotic factors. J Rheumatol. 29:1446-53.
Boileau, C., Martel-Pelletier, J., Moldovan, F., Jouzeau, J. Y., Netter, P., Manning, P. T., and Pelletier, J. P. 2002b. The in situ up-regulation of chondrocyte interleukin-1-converting enzyme and interleukin-18 levels in experimental osteoarthritis is mediated by nitric oxide. Arthritis Rheum. 46:2637- 47.
188 6. REFERENCES
Bolanos, J. P., Garcia-Nogales, P., and Almeida, A. 2004a. Provoking neuroprotection by peroxynitrite. Curr Pharm Des. 10:867-77.
Bolanos, J. P., Cidad, P., Garcia-Nogales, P., Delgado-Esteban, M., Fernandez, E., and Almeida, A. 2004b. Regulation of glucose metabolism by nitrosative stress in neural cells. Molecular Aspects of Medicine 25:61-73.
Bombardier, C., Laine, L., Reicin, A., Shapiro, D., Burgos-Vargas, R., Davis, B., Day, R., Ferraz, M. B., Hawkey, C. J., Hochberg, M. C., Kvien, T. K., Schnitzer, T. J., and The VIGOR Study Group. 2000. Comparison of Upper Gastrointestinal Toxicity of Rofecoxib and Naproxen in Patients with Rheumatoid Arthritis. The New England Journal of Medicine 343:1520-1528.
Bredt, D. S. and Snyder, S. H. 1990. Isolation of Nitric Oxide Synthetase, a Calmodulin-Requiring Enzyme. Proceedings of the National Academy of Sciences 87:682-685.
Brenner, S. S., Klotz, U., Alscher, D. M., Mais, A., Lauer, G., Schweer, H., Seyberth, H. W., Fritz, P., and Bierbach, U. 2004. Osteoarthritis of the knee - clinical assessments and inflammatory markers. Osteoarthritis and Cartilage 12:469-475.
Brown, D. J., Lin, B., Chwa, M., Atilano, S. R., Kim, D. W., and Kenney, M. C. 2004. Elements of the nitric oxide pathway can degrade TIMP-1 and increase gelatinase activity. Mol Vis. 10:281-8.
Bullough, P. 1992. The pathology of osteoarthritis. In Osteoarthritis.Edited by Moskowitz R, Howell D, Goldberg V, Mankin H.Philadelphia: WB Saunders,39-69.
Bullough, P. G. 1997. Orthopaedic pathology. Mosby-Wolfe, London.
Bunderson, M., Coffin, J. D., and Beall, H. D. 2002. Arsenic Induces Peroxynitrite Generation and Cyclooxygenase-2 Protein Expression in Aortic Endothelial Cells: Possible Role in Atherosclerosis. Toxicology and Applied Pharmacology 184:11-18.
Capdevila, J. H., Morrow, J. D., Belosludtsev, Y. Y., Beauchamp, D. R., DuBois, R. N., and Falck, J. R. 1995. The catalytic outcomes of the constitutive and the mitogen inducible isoforms of prostaglandin H2 synthase are markedly affected by glutathione and glutathione peroxidase(s). Biochemistry 34:3325- 37.
Carlberg, A. L., Pucci, B., Rallapalli, R., Tuan, R. S., and Hall, D. J. 2001. Efficient chondrogenic differentiation of mesenchymal cells in micromass culture by retroviral gene transfer of BMP-2. Differentiation. 67:128-38.
Caron, J. P., Fernandes, J. C., Martel-Pelletier, J., Tardif, G., Mineau, F., Geng, C., and Pelletier, J.- P. 1996. Chondroprotective effect of intraarticular injections of interleukin-1 receptor antagonist in experimental osteoarthritis. Suppression of collagenase-1 expression. Arthritis Rheum. 39:1535-44.
Chae, H. Z., Kang, S. W., and Rhee, S. G. 1999. Isoforms of mammalian peroxiredoxin that reduce peroxides in presence of thioredoxin. Methods Enzymol. 300:219-26.
189 6. REFERENCES
Chevalier, X., Giraudeau, B., Conrozier, T., Marliere, J., Kiefer, P., and Goupille, P. 2005. Safety study of intraarticular injection of interleukin 1 receptor antagonist in patients with painful knee osteoarthritis: a multicenter study. J Rheumatol. 32:1317-1323.
Choi, B. M., Pae, H. O., Jang, S. I., Kim, Y. M., and Chung, H. T. 2002. Nitric oxide as a pro-apoptotic as well as anti-apoptotic modulator. J Biochem Mol Biol. 35:116-26.
Choi, Y. A., Lee, D. J., Lim, H. K., Jeong, J. H., Sonn, J. K., Kang, S. S., and Baek, S. H. 2004. Interleukin-1beta stimulates matrix metalloproteinase-2 expression via a prostaglandin E2-dependent mechanism in human chondrocytes. EXP Mol Med. 36:226-232.
Cidad, P., Almeida, A., and Bolanos, J. P. 2004. Inhibition of mitochondrial respiration by nitric oxide rapidly stimulates cytoprotective GLUT3-mediated glucose uptake through 5'-AMP-activated protein kinase. Biochem J. 384:629-36.
Cidad, P., Garcia-Nogales, P., Almeida, A., and Bolanos, J. P. 2001. Expression of glucose transporter GLUT3 by endotoxin in cultured rat astrocytes: the role of nitric oxide. J Neurochem. 79:17- 24.
Clancy, R., Rediske, J., Koehne, C., Stoyanovsky, D., Amin, A., Attur, M., Iyama, K., and Abramson, S. B. 2001. Activation of stress-activated protein kinase in osteoarthritic cartilage: evidence for nitric oxide dependence. Osteoarthritis and Cartilage 9:294-299.
Clancy, R., Varenika, B., Huang, W., Ballou, L., Attur, M., Amin, A. R., and Abramson, S. B. 2000. Nitric Oxide Synthase/COX Cross-Talk: Nitric Oxide Activates COX-1 But Inhibits COX-2-Derived Prostaglandin Production. The Journal of Immunology 165:1582-1587.
Clark, C. A., Schwarz, E. M., Zhang, X., Ziran, N. M., Drissi, H., O'Keefe, R. J., and Zuscik, M. J. 2005. Differential regulation of EP receptor isoforms during chondrogenesis and chondrocyte maturation. Biochemical and Biophysical Research Communications 328:764-776.
Clements, K. M., Price, J. S., Chambers, M. G., Visco, D. M., Poole, A. R., and Mason, R. M. 2003. Gene deletion of either interleukin-1beta, interleukin-1beta-converting enzyme, inducible nitric oxide synthase, or stromelysin 1 accelerates the development of knee osteoarthritis in mice after surgical transection of the medial collateral ligament and partial medial meniscectomy. Arthritis Rheum. 48:3452- 63.
Coleman, J. W. 2001. Nitric oxide in immunity and inflammation. International Immunopharmacology 1:1397-1406.
Cromheeke, K. M., Kockx, M. M., De Meyer, G. R. Y., Bosmans, J. M., Bult, H., Beelaerts, W. J. F., Vrints, C. J., and Herman, A. G. 1999. Inducible nitric oxide synthase colocalizes with signs of lipid oxidation/peroxidation in human atherosclerotic plaques. Cardiovascular Research 43:744-754.
Cross, R. K. and Wilson, K. T. 2003. Nitric oxide in inflammatory bowel disease. Inflamm Bowel Dis. 9:179-89.
190 6. REFERENCES
Darmani, H., Crossan, J. C., and Curtis, A. 2004. Single dose of inducible nitric oxide synthase inhibitor induces prolonged inflammatory cell accumulation and fibrosis around injured tendon and synovium. Mediators Inflamm. 13:157-64.
Davis, K. L., Martin, E., Turko, I. V., and Murad, F. 2001. Novel effects of nitric oxide. Annu Rev Pharmacol Toxicol. 41:203-236. de Crombrugghe, B., Lefebvre, V., Behringer, R. R., Bi, W., Murakami, S., and Huang, W. 2000. Transcriptional mechanisms of chondrocyte differentiation. Matrix Biology 19:389-394. de Crombrugghe, B., Lefebvre, V., and Nakashima, K. 2001. Regulatory mechanisms in the pathways of cartilage and bone formation. Current Opinion in Cell Biology 13:721-728.
Deeb, R. S., Resnick, M. J., Mittar, D., McCaffrey, T., Hajjar, D. P., and Upmacis, R. K. 2002. Tyrosine nitration in prostaglandin H2 synthase. Journal of Lipid Research 43:1718-1726.
Del Carlo M Jr, L. RF. 2002. Nitric oxide-mediated chondrocyte cell death requires the generation of additional reactive oxygen species. Arthritis Rheum. 46:394-403.
Di Rosa, M., Radomski, M., Carnuccio, R., and Moncada, S. 1990. Glucocorticoids inhibit the induction of nitric oxide synthase in macrophages. Biochem Biophys Res Commun. 172:1246-52.
Dong, Y., Drissi, H., Chen, M., Chen, D., Zuscik, M. J., Schwarz, E. M., and O`Keefe, R. J. 2005. Wnt- mediated regulation of chondrocyte maturation: modulation by TGF-beta. J Cell Biochem. 95:1057-68.
Doni, M. G., Whittle, B. J. R., Palmer, R. M., and Moncada, S. 2005. Actions of nitric oxide on the release of prostacyclin from bovine endothelial cells in culture. Eur J Pharmacol. 151:19-25.
Eberhardt, W., Engels, C., Muller, R., and Pfeilschifter, J. 2002. Mechanisms of dexamethasone- mediated inhibition of cAMP-induced tPA expression in rat mesangial cells. Kidney Int. 62:809-21.
Evans, C. H., Gouze, J. N., Gouze, E., Robbins, P. D., and Ghivizzani, S. C. 2004. Osteoarthritis gene therapy. Gene Ther. 11:379-89.
Fermor, B., Weinberg, J. B., Pisetsky, D. S., Misukonis, M. A., Fink, C., and Guilak, F. 2002. Induction of cyclooxygenase-2 by mechanical stress through a nitric oxide-regulated pathway. Osteoarthritis and Cartilage 10:792-798.
Fernandes, R. C., Martel-Pelletier, J., and Pelletier, J. P. 2002. The role of cytokines in osteoarthritis pathophysiology. Biorheology. 39:237-46.
Ferreira, S. H., Nakamura, M., and de Abreu Castro, M. S. 1978. The hyperalgesic effects of prostacyclin and prostaglandin E2. Prostaglandins. 16:31-7.
Fickert, S., Fiedler, J., and Brenner, R. E. 2004. Identification of subpopulations with characteristics of mesenchymal progenitor cells from human osteoarthritic cartilage using triple staining for cell surface markers. Arthritis Res Ther. 6:422-32.
191 6. REFERENCES
Fiorucci, S., Mencarelli, A., Distrutti, E., Baldoni, M., del Soldato, P., and Morelli, A. 2004. Nitric Oxide Regulates Immune Cell Bioenergetic: A Mechanism to Understand Immunomodulatory Functions of Nitric Oxide-Releasing Anti-Inflammatory Drugs. The Journal of Immunology 173:874-882.
Fischer, L., Boland, G., and Tuan, R. S. 2002. Wnt-3A Enhances Bone Morphogenetic Protein-2- mediated Chondrogenesis of Murine C3H10T1/2 Mesenchymal Cells. Journal of Biological Chemistry 277:30870-30878.
Flanders, K. C., Bhandiwad, A. R., and Winokur, T. S. 1997. Transforming Growth Factor-[beta]s Block Cytokine Induction of Catalase and Xanthine Oxidase mRNA Levels in Cultured Rat Cardiac Cells. Journal of Molecular and Cellular Cardiology 29:273-280.
Forfia, P. R., Hintze, T. H., Wolin, M. S., and Kaley, G. 1999. Role of nitric oxide in the control of mitochondrial function. Adv Exp Med Biol. 471:381-88.
Förstermann, U. and Kleinert, H. 1995. Nitric oxide synthase: expression and expressional control of the three isoforms. Naunyn Schmiedebergs Arch Pharmacol. 352:351-64.
Forstermann, U., Boissel, J. p., and Kleinert, H. 1998. Expressional control of the `constitutive' isoforms of nitric oxide synthase (NOS I and NOS III). The FASEB Journal 12:773-790.
Furumatsu, T., Tsuda, M., Taniguchi, N., Tajima, Y., and Asahara, H. 2004. Smad3 Induces Chondrogenesis through the Activation of SOX9 via CBP/p300 Recruitment. JBC Papers in Press.
Garcia-Nogales, P., Almeida, A., and Bolanos, J. P. 2003. Peroxynitrite Protects Neurons against Nitric Oxide-mediated Apoptosis. A Key Role For Glucose-6-Phosphate Dehydrogenase Activity in Neuroprotection. Journal of Biological Chemistry 278:864-874.
Garvey, E. P., Oplinger, J. A., Tanoury, G. J., Sherman, P. A., Fowler, M., Marshall, S., Harmon, M. F., Paith, J. E., and Furfine, E. S. 1994. Potent and selective inhibition of human nitric oxide synthases. Inhibition by non-amino acid isothioureas. Journal of Biological Chemistry 269:26669-26676.
Garvey, E. P., Oplinger, J. A., Furfine, E. S., Kiff, R. J., Laszlo, F., Whittle, B. J. R., and Knowles, R. G. 1997. 1400W Is a Slow, Tight Binding, and Highly Selective Inhibitor of Inducible Nitric-oxide Synthase in Vitro and in Vivo. Journal of Biological Chemistry 272:4959-4963.
Gelse, K., Soder, S., Eger, W., Diemtar, T., and Aigner, T. 2003. Osteophyte development--molecular characterization of differentiation stages. Osteoarthritis and Cartilage 11:141-148.
Geng, Y., Blanco, F. J., Cornelisson, M., and Lotz, M. 1995a. Regulation of Cyclooxygenase-2 Expression in Normal Human Articular Chondrocytes. J.Immunol. 152 (2):796-801.
Geng, Y., Maier, R., and Lotz, M. 1995b. Tyrosine kinases are involved with the expression of inducible nitric oxide synthase in human articular chondrocytes. J Cell Physiol. 163:545-54.
Gerlo, S., Verdood, P., Gellersen, B., Hooghe-Peters, E. L., and Kooijman, R. 2004. Mechanism of Prostaglandin (PG)E2-Induced Prolactin Expression in Human T Cells: Cooperation of Two PGE2
192 6. REFERENCES
Receptor Subtypes, E-Prostanoid (EP) 3 and EP4, Via Calcium- and Cyclic Adenosine 5'- Monophosphate-Mediated Signaling Pathways. The Journal of Immunology 173:5952-5962.
Gibbs, S. M. 2003. Regulation of neuronal proliferation and differentiation by nitric oxide. Mol Neurobiol. 27:107-20.
Goggs, R., Carter, S. D., Schulze-Tanzil, G., Shakibaei, M., and Mobasheri, A. 2003. Apoptosis and the loss of chondrocyte survival signals contribute to articular cartilage degradation in osteoarthritis. The Veterinary Journal 166:140-158.
Goldring, M. B. and Berenbaum, F. 1999. Human chondrocyte culture models for studying cyclooxygenase expression and prostaglandin regulation of collagen gene expression. Osteoarthr Cart 7:386-388.
Goldring, M. B., Birkhead, J., Sandell, L. J., Kimura, T., and Krane, S. M. 1988. Interleukin 1 suppresses expression of cartilage-specific types II and IX collagens and increases types I and III collagens in human chondrocytes. J Clin Invest. 82:2026-2037.
Goldring, M. B., Sohbat, E., Elwell, J. M., and Chang, J. Y. 1990. Etodolac preserves cartilage-specific phenotype in human chondrocytes: effects on type II collagen synthesis and associated mRNA levels. Eur J Rheumatol Inflamm. 10:10-21.
Goldring, M. B., Suen, L. F., Yamin, R., and Lai, W. F. 1996. Regulation of Collagen Gene Expression by Prostaglandins and Interleukin-1beta in Cultured Chondrocytes and Fibroblasts. Am J Ther. 3:9-16.
Goldring, M. B., Tsuchimochi, K., and Ijiri, K. 2005. The control of chondrogenesis. J Cell Biochem. Epub ahead of print.
Goodwin, D. C., Landino, L. M., and Marnett, L. J. 1999. Effects of nitric oxide and nitric oxide-derived species on prostaglandin endoperoxide synthase and prostaglandin biosynthesis. The FASEB Journal 13:1121-1136.
Gow, A. J., Duran, D., Malcolm, S., and Ischiropoulos, H. 1996. Effects of peroxynitrite-induced protein modifications on tyrosine phosphorylation and degradation. FEBS Lett. 385:63-66.
Greisberg, J., Bliss, M., and Terek, R. 2002. The prevalence of nitric oxide in apoptotic chondrocytes of osteoarthritis. Osteoarthritis and Cartilage 10:207-211.
Guastadisegni, C., Minghetti, L., Nicolini, A., Polazzi, E., Ade, P., Balduzzi, M., and Levi, G. 1997. Prostaglandin E2 synthesis is differentially affected by reactive nitrogen intermediates in cultured rat microglia and RAW 264.7 cells. FEBS Letters 413:314-318.
Haddad, I. Y., Pataki, G., Hu, P., Galliani, C., and Beckman, J. S. 1994. Quantitation of nitrotyrosine levels in lung sections of patients and animals with acute lung injury. J Clin Invest. 94:2407-2413.
Hanada, K., Solchaga, L. A., Caplan, A. I., Hering, T. M., Goldberg, V. M., Yoo, J. U., and Johnstone, B. 2001. BMP-2 induction and TGF-beta 1 modulation of rat periosteal cell chondrogenesis. J Cell Biochem. 81:284-94.
193 6. REFERENCES
Hardy, M. M., Seibert, K., Manning, P. T., Currie, M. G., Woerner, B. M., and Edwards, D. 2002. Cyclooxygenase 2-dependent prostaglandin E2 modulates cartilage proteoglycan degradation in human osteoarthritis explants. Arthritis Rheum 46:1789-1803.
Hashimoto, S., Ochs, R. L., Komiya, S., and Lotz, M. 1998a. Linkage of chondrocyte apoptosis and cartilage degradation in human osteoarthritis. Arthritis Rheum 41:1632-1638.
Hashimoto, S., Takahashi, K., Amiel, D., Coutts, R. D., and Lotz, M. 1998b. Chondrocyte apoptosis and nitric oxide production during experimentally induced osteoarthritis. Arthritis Rheum 41:1266-1274.
Häuselmann, H. J., Fernandes, R. J., Mok, S. S., Schmid, T. M., Block, J. A., Aydelotte, M. B., Kuetnner, K. E., and Thonar, E. J. 1994. Phenotypic stability of bovine articular chondrocytes after long- term culture in alginate beads. J.Cell Sci. 107:17-27.
Hayashi, R., Wada, H., Ito, K., and Adcock, I. M. 2004. Effects of glucocorticoids on gene transcription. European Journal of Pharmacology 500:51-62.
Henrotin, Y., Kurz, B., and Aigner, T. 2005. Oxygen and reactive oxygen species in cartilage degradation: friends or foes? Osteoarthritis and Cartilage 13:643-654.
Henrotin, Y. E., Bruckner, P., and Pujol, J.-P. L. 2003. The role of reactive oxygen species in homeostasis and degradation of cartilage. Osteoarthritis and Cartilage 11:747-755.
Heraud, F., Heraud, A., and Harmand, M. F. 2000. Apoptosis in normal and osteoarthritic human articular cartilage. Annals of the Rheumatic Diseases 59:959-965.
Hering, T. M., Kazmi, N. H., Huynh, T. D., Kollar, J., Xu, L., Hunyady, A. B., and Johnstone, B. 2004. Characterization and chondrocyte differentiation stage-specific expression of KRAB zinc-finger protein gene ZNF470. Experimental Cell Research 299:137-147.
Hess, D. T., Matsumoto, A., Kim, S. O., Marshall, H. E., and Stamler, J. S. 2005. Protein S- nitrosylation: purview and parameters. Nat Rev Mol Cell Biol. 6:150-166.
Hibbs, J. B. J., Taintor, R. R., Vavrin, Z., and Rachlin, E. M. 1988. Nitric oxide: a cytotoxic activated macrophage effector molecule. Biochem Biophys Res Commun. 157:87-94.
Hiran, T. S., Moulton, P. J., and Hancock, J. T. 1998. In situ detection of superoxide anions within porcine articular cartilage. Br J Biomed Sci. 55:199-203.
Hiran, T. S., Moulton, P. J., and Hancock, J. T. 1997. Detection of Superoxide and NADPH Oxidase in Porcine Articular Chondrocytes. Free Radical Biology and Medicine 23:736-743.
Hochberg, M. C. 2005. COX-2 selective inhibitors in the treatment of arthritis: a rheumatologist perspective. Curr Top Med Chem. 5:443-8.
Hrabie, J. A., Klose, J. R., and Wink, D. A. 1993. New nitric oxide-releasing zwitterions derived from polyamines. J.Org.Chem. 58:1472-1476.
194 6. REFERENCES
Huie, R. E. and Padmaja, S. 1993. The reaction of NO with superoxide. Free Radic Res Commun. 18:195-9.
Huwiler, A. and Pfeilschifter, J. 2003. Nitric Oxide Signalling with a Special Focus on Lipid-Derived Mediators. Biol Chem. 384:1379-1389.
Ignarro, L. J., Cirino, G., Casini, A., and Napoli, C. 1999. Nitric oxide as a signaling molecule in the vascular system: an overview. J Cardiovasc Pharmacol. 34:879-86.
Izzo, M. W., Pucci, B., Tuan, R. S., and Hall, D. J. 2002. Gene expression profiling following BMP-2 induction of mesenchymal chondrogenesis in vitro. Osteoarthritis and Cartilage 10:23-33.
Jacques, C., Sautet, A., Moldovan, M., Thomas, B., Humbert, L., and Berenbaum, F. 1999. Cyclooxygenase activity in chondrocytes from osteoarthritic and healthy cartilage. Rev Rhum Engl Ed. 66:701-4.
Jaiswal, N., Haynesworth, S. E., Caplan, A. I., and Bruder, S. P. 1997. Osteogenic differentiation of purified, culture-expanded human mesenchymal stem cells in vitro. J Cell Biochem. 64:295-312.
Jakob, M., Demarteau, O., Suetterlin, R., Heberer, M., and Martin, I. 2004. Chondrogenesis of expanded adult human articular chondrocytes is enhanced by specific prostaglandins. Rheumatology 43:852-857.
Johnson, K., Jung, A. S., Andreyev, A., Murphy, A., Dykens, J., and Terkeltaub, R. 2000. Mitochondrial oxidative phosphorylation is a downstream regulator of nitric oxide effects on chondrocyte matrix synthesis and mineralization. Arthritis Rheum. 43:1560-1570.
Johnstone, B., Hering, T. M., Caplan, A. I., Goldberg, V. M., and Yoo, J. U. 1998. In VitroChondrogenesis of Bone Marrow-Derived Mesenchymal Progenitor Cells. Experimental Cell Research 238:265-272.
Jouzeau, J. Y., Pacquelet, S., Boileau, C., Nedelec, E., Presle, N., Netter, P., and Terlain, B. 2002. Nitric oxide (NO) and cartilage metabolism: NO effects are modulated by superoxide in response to IL-1. Biorheology. 39:201-14.
Kanno, S., Kim, P. K., Sallam, K., Lei, J., Billiar, T. R., and Shears, L. L. 2. 2004. Nitric oxide facilitates cardiomyogenesis in mouse embryonic stem cells. Proc Natl Acad Sci 101:12277-81.
Kanski, J., Behring, A., Pelling, J., and Schoneich, C. 2005a. Proteomic identification of 3- nitrotyrosine-containing rat cardiac proteins: effects of biological aging. AJP - Heart and Circulatory Physiology 288:H371-H381.
Kanski, J., Hong, S. J., and Schoneich, C. 2005b. Proteomic Analysis of Protein Nitration in Aging Skeletal Muscle and Identification of Nitrotyrosine-containing Sequences in Vivo by Nanoelectrospray Ionization Tandem Mass Spectrometry. Journal of Biological Chemistry 280:24261-24266.
Kellgren, J. H. and Lawrence, J. S. 1957. Radiological assessment of osteo-arthrosis. Ann Rheum Dis. 16:494-501.
195 6. REFERENCES
Keshavarzian, A., Banan, A., Farhadi, A., Komanduri, S., Mutlu, E., Zhang, Y., and Fields, J. Z. 2003. Increases in free radicals and cytoskeletal protein oxidation and nitration in the colon of patients with inflammatory bowel disease. Gut 52:720-728.
Kim, A. and Song, W. 2002. TNF-[alpha]-mediated apoptosis in chondrocytes sensitized by MG132 or actinomycin D. Biochemical and Biophysical Research Communications 295:937-944.
Kim, H. A., Lee, Y. J., Seong, S. C., Choe, K. W., and Song, Y. W. 2000. Apoptotic chondrocyte death in human osteoarthritis. J Rheum 27:455-462.
Kim, H., Lee, K. B., and Bae, S. c. 2005. The mechanism of low-concentration sodium nitroprusside- mediated protection of chondrocyte death. Arthritis Research & Therapy 7:R526-R535.
Kim, S. J., Hwang, S. G., Kim, I. C., and Chun, J. S. 2003. Actin Cytoskeletal Architecture Regulates Nitric Oxide-induced Apoptosis, Dedifferentiation, and Cyclooxygenase-2 Expression in Articular Chondrocytes via Mitogen-activated Protein Kinase and Protein Kinase C Pathways. Journal of Biological Chemistry 278:42448-42456.
Kirsch, T., Swoboda, B., and der Mark, K. 1992. Ascorbate independent differentiation of human chondrocytes in vitro: simultaneous expression of types I and X collagen and matrix mineralization. Differentiation 52:89-100.
Kirsch, T., Swoboda, B., and Nah, H. D. 2000a. Activation of annexin II and V expression, terminal differentiation, mineralization and apoptosis in human osteoarthritic cartilage. Osteoarthr Cart 8:294-302.
Kirsch, T., Harrison, G., Golub, E. E., and Nah, H. D. 2000b. The Roles of Annexins and Types II and X Collagen in Matrix Vesicle-mediated Mineralization of Growth Plate Cartilage. Journal of Biological Chemistry 275:35577-35583.
Klein, T., Neuhaus, K., Reutter, F., and Nusing, R. 2001. Generation of 8-epi-prostaglandin F(2alpha) in isolated rat kidney glomeruli by a radical-independent mechanism. Br J Pharmacol. 133:643-650.
Klein, T., Reutter, F., Schweer, H., Seyberth, H. W., and Nusing, R. M. 1997. Generation of the Isoprostane 8-Epi-prostaglandin F2alpha In Vitro and In Vivo via the Cyclooxygenases. Journal of Pharmacology And Experimental Therapeutics 282:1658-1665.
Kleinert, H., Boissel, J. P., Schwarz, P. M., and Förstermann, U. 2000. Regulation of the expression of nitric oxide synthase isoforms. 105-128.
Kleinert, H., Euchenhofer, C., Ihrig-Biedert, I., and Forstermann, U. 1996. Glucocorticoids inhibit the induction of nitric oxide synthase II by down-regulating cytokine-induced activity of transcription factor nuclear factor-kappa B. Molecular Pharmacology 49:15-21.
Kleinert, H., Schwarz, P. M., and Förstermann, U. 2003. Regulation of the expression of inducible nitric oxide synthase. Biol Chem. 384:1343-1364.
196 6. REFERENCES
Knoops, B., Clippe, A., Bogard, C., Arsalane, K., Wattiez, R., Hermans, C., Duconseille, E., Falmagne, P., and Bernard, A. 1999. Cloning and Characterization of AOEB166, a Novel Mammalian Antioxidant Enzyme of the Peroxiredoxin Family. Journal of Biological Chemistry 274:30451-30458.
Knowles, R. G. and Moncada, S. 1994. Nitric oxide synthases in mammals. Biochem J 298:249-258.
Koeck, T., Fu, X., Hazen, S. L., Crabb, J. W., Stuehr, D. J., and Aulak, K. S. 2004. Rapid and Selective Oxygen-regulated Protein Tyrosine Denitration and Nitration in Mitochondria. Journal of Biological Chemistry 279:27257-27262.
Kolettas, E., Buluwela, L., Bayliss, M. T., and Muir, H. I. 1995. Expression of cartilage-specific molecules is retained on long-term culture of human articular chondrocytes. Journal of Cell Science 108:1991-1999.
Kong, S. K., Yim, M. B., Stadtman, E. R., and Chock, P. B. 1996. Peroxynitrite disables the tyrosine phosphorylation regulatory mechanism: Lymphocyte-specific tyrosine kinase fails to phosphorylate nitrated cdc2(6-20)NH2 peptide. Proceedings of the National Academy of Sciences 93:3377-3382.
Kosher, R. A. and Walker, K. H. 1983. The effect of prostaglandins on in vitro limb cartilage differentiation. Exp Cell Res. 145:145-53.
Kouri, J. B., Aguilera, J. M., Reyes, J., Lozoya, K. A., and Gonzalez, S. 2000. Apoptotic chondrocytes from osteoarthrotic human articular cartilage and abnormal calcification of subchondral bone. J Rheum 27:1005-1019.
Kuhn, K., Hashimoto, S., and Lotz, M. 2000. IL-1{beta} Protects Human Chondrocytes from CD95- Induced Apoptosis. The Journal of Immunology 164:2233-2239.
Kulmacz, R. J. and Wang, L. H. 1995. Comparison of Hydroperoxide Initiator Requirements for the Cyclooxygenase Activities of Prostaglandin H Synthase-1 and -2. Journal of Biological Chemistry 270:24019-24023.
Kuzkaya, N., Weissmann, N., Harrison, D. G., and Dikalov, S. 2003. Interactions of Peroxynitrite, Tetrahydrobiopterin, Ascorbic Acid, and Thiols: Implications for Uncoupling Endothelial Nitric-Oxide Synthase. Journal of Biological Chemistry 278:22546-22554.
Kuzkaya, N., Weissmann, N., Harrison, D. G., and Dikalov, S. 2005. Interactions of peroxynitrite with uric acid in the presence of ascorbate and thiols: Implications for uncoupling endothelial nitric oxide synthase. Biochemical Pharmacology 70:343-354.
Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.
Lambeth, J. D., Cheng, G., Arnold, R. S., and Edens, W. A. 2000. Novel homologs of gp91phox. Trends in Biochemical Sciences 25:459-461.
197 6. REFERENCES
Landino, L. M., Crews, B. C., Timmons, M. D., Morrow, J. D., and Marnett, L. J. 1996. Peroxynitrite, the coupling product of nitric oxide and superoxide, activates prostaglandin biosynthesis. Proceedings of the National Academy of Sciences 93:15069-15074.
Lee, A. S., Delegeane, A. M., Baker, V., and Chow, P. C. 1983. Transcriptional regulation of two genes specifically induced by glucose starvation in a hamster mutant fibroblast cell line. Journal of Biological Chemistry 258:597-603.
Lefebvre, V., Behringer, R. R., and de Crombrugghe, B. 2001. L-Sox5, Sox6 and Sox9 control essential steps of the chondrocyte differentiation pathway. Osteoarthritis and Cartilage 9:S69-S75.
Lefebvre, V., Huang, W., Harley, V. R., Goodfellow, P. N., and de Crombrugghe, B. 1997. SOX9 is a potent activator of the chondrocyte-specific enhancer of the pro alpha1(II) collagen gene. Molecular and Cellular Biology 17:2336-2346.
Liemann, S. and Lewit-Bentley, A. 1995. Annexins: a novel family of calcium- and membrane-binding proteins in search of a function. Structure 3:233-237.
Lin, K. T., Xue, J. Y., Nomen, M., Spur, B., and Wong, P. Y. K. 1995. Peroxynitrite-induced Apoptosis in HL-60 Cells. Journal of Biological Chemistry 270:16487-16490.
Liu, S. F., Adcock, I. M., Old, R. W., Barnes, P. J., and Evans, T. W. 1996. Differential regulation of the constitutive and inducible nitric oxide synthase mRNA by lipopolysaccharide treatment in vivo in the rat. Crit Care Med. 24:1219-25.
Loeser, R. F., Carlson, C. S., Del Carlo, M., and Cole, A. A. 2002. Detection of nitrotyrosine in aging and osteoarthritic cartilage. Arthritis Rheum 46:2349-2357.
Luo, J. D. and Chen, A. F. 2005. Nitric oxide: a newly discovered function on wound healing. Acta Pharmacol Sin. 26:259-64.
Mackay, A. M., Beck, S., Murphy, J. M., Barry, F. P., Chichester, C. O., and Pittenger, M. F. 1998. Chondrogenic differentiation of cultured human mesenchymal stem cells from marrow. Tissue Eng. 4:28.
MacMillan-Crow, L. A., Crow, J. P., Kerby, J. D., Beckman, J. S., and Thompson, J. A. 1996. Nitration and inactivation of manganese superoxide dismutase in chronic rejection of humanárenaláallografts. Proceedings of the National Academy of Sciences 93:11853-11858.
Mais, A., Klein, T., Ullrich, V., Schudt, C., and Lauer, G. 2005. Prostanoid pattern and iNOS expression during chondrogenic differentiation of human mesenchymal stem cells. Submitted.
Majumdar, M. K., Wang, E., and Morris, E. A. 2001. BMP-2 and BMP-9 promotes chondrogenic differentiation of human multipotential mesenchymal cells and overcomes the inhibitory effect of IL-1. J Cell Physiol. 189:275-84.
Malemud, C. J., Moskowitz, R. W., and Hassid, A. 1981. Prostaglandin biosynthesis by lapine articular chondrocytes in culture. Biochim Biophys Acta. 663:480-90.
198 6. REFERENCES
Mander, P., Borutaite, V., Moncada, S., and Brown, G. C. 2005. Nitric oxide from inflammatory- activated glia synergizes with hypoxia to induce neuronal death. J Neurosci Res. 79:208-15.
Manfield, L., Jang, D., and Murrell, G. A. 1996. Nitric oxide enhances cyclooxygenase activity in articular cartilage. Inflamm Res. 45:254-8.
Mankin, H. J., Dorfman, H., Lippiello, L., and Zarins, A. 1971. Biochemical and metabolic abnormalities in articular cartilage from osteo-arthritic human hips. II. Correlation of morphology with biochemical and metabolic data. J Bone Joint Surg Am. 53A:523-537.
Mankin, H. J., Johnson, M. E., and Lippiello, L. 1981. Biochemical and metabolic abnormalities in articular cartilage from osteoarthritic human hips. III. Distribution and metabolism of amino sugar- containing macromolecules. J Bone Joint Surg Am 63:131-139.
Margalit, A., Hauser, S. D., Zweifel, B. S., Anderson, M. A., and Isakson, P. C. 1998. Regulation of prostaglandin biosynthesis in vivo by glutathione. AJP - Regulatory, Integrative and Comparative Physiology 274:R294-R302.
Marletta, M. A., Hurshman, A. R., and Rusche, K. M. 1998. Catalysis by nitric oxide synthase. Curr Opin Chem Biol. 2:656-663.
Martel-Pelletier, J., Pelletier, J. P., and Fahmi, H. 2003. Cyclooxygenase-2 and prostaglandins in articular tissues. Semin Arthritis Rheum. 33:155-67.
Masferrer, J. L. and Seibert, K. 1994. Regulation of prostanoid synthesis by glucocorticoids. Receptor 4:25-30.
Masferrer, J. L., Seibert, K., Zweifel, B., and Needleman, P. 1992. Endogenous glucocorticoids regulate an inducible cyclooxygenase enzyme. Proc Natl Acad Sci 89 (9):3917-3921.
Massaad, C., Paradon, M., Jacques, C., Salvat, C., Bereziat, G., Berenbaum, F., and Olivier, J. L. 2000. Induction of Secreted Type IIA Phospholipase A2 Gene Transcription by Interleukin-1beta . ROLE OF C/EBP FACTORS. Journal of Biological Chemistry 275:22686-22694.
Mastbergen, S. C., Bijlsma, J. W., and Lafeber, F. P. 2005. Selective COX-2 inhibition is favorable to human early and late-stage osteoarthritic cartilage: a human in vitro study. Osteoarthritis and Cartilage 13:519-526.
Masuko-Hongo, K., Berenbaum, F., Humbert, L., Salvat, C., Goldring, M. B., and Thirion, S. 2004. Up-regulation of microsomal prostaglandin E synthase 1 in osteoarthritic human cartilage: Critical roles of the ERK-1/2 and p38 signaling pathways. Arthritis Rheum. 50:2829-2838.
Mathy-Hartert, M., Deby-Dupont, G. P., Reginster, J.-Y. L., Ayache, N., Pujol, J.-P., and Henrotin, Y. E. 2002. Regulation by reactive oxygen species of interleukin-1[beta], nitric oxide and prostaglandin E2 production by human chondrocytes. Osteoarthritis and Cartilage 10:547-555.
Maturana, A., Krause, K. H., and Demaurex, N. 2002. NOX Family NADPH Oxidases: Do They Have Built-in Proton Channels? J.Gen.Physiol. 120:781-6.
199 6. REFERENCES
Mazzetti, I., Grigolo, B., Pulsatelli, L., Dolzani, P., Silvestri, T., Roseti, L., Meliconi, R., and Facchini, A. 2001. Differential roles of nitric oxide and oxygen radicals in chondrocytes affected by osteoarthritis and rheumatoid arthritis. Clin Sci (Lond). 101:593-9.
Meachim, G. and Collins, D. 1962. Cell counts of normal and osteoarthritic articular cartilage in relation to the uptake of sulphate (35SO4) in vitro. Annals of the Rheumatic Diseases 21:45-50.
Meachim, G., Ghadially, F., and Collins, D. 1965. Regressive changes in the superficial layer of human articular cartilage. Annals of the Rheumatic Diseases 24:23-30.
Mengshol, J. A., Vincenti, M. P., Coon, C. I., Barchowsky, A., and Brinckerhoff, C. E. 2000. Interleukin-1 induction of collagenase 3 (matrix metalloproteinase 13) gene expression in chondrocytes requires p38, c-Jun N-terminal kinase, and nuclear factor kappaB: differential regulation of collagenase 1 and collagenase 3. Arthritis Rheum. 43:801-11.
Merry, J. B. Oxidative stress and mitochondrial function with aging--the effects of calorie restriction. 3, 7- 12. 2004. Ref Type: Conference Proceeding
Migita, K., Maeda, Y., Abiru, S., Komori, A., Yokoyama, T., Takii, Y., Nakamura, M., Yatsuhashi, H., Eguchi, K., and Ishibashi, H. 2005. Peroxynitrite-mediated matrix metalloproteinase-2 activation in human hepatic stellate cells. FEBS Letters 579:3119-3125.
Milev, P., Maurel, P., Chiba, A., Mevissen, M., Popp, S., Yamaguchi, Y., Margolis, R. K., and Margolis, R. U. 1998. Differential Regulation of Expression of Hyaluronan-Binding Proteoglycans in Developing Brain: Aggrecan, Versican, Neurocan, and Brevican. Biochemical and Biophysical Research Communications 247:207-212.
Minghetti, L., Polazzi, E., Nicolini, A., Creminon, C., and Levi, G. 1996. Interferon-gamma and nitric oxide down-regulate lipopolysaccharide-induced prostanoid production in cultured rat microglial cells by inhibiting cyclooxygenase-2 expression. J Neurochem. 66:1963-70.
Mistry, D., Oue, Y., Chambers, M. G., Kayser, M. V., and Mason, R. M. 2004. Chondrocyte death during murine osteoarthritis. Osteoarthritis and Cartilage 12:131-141.
Mitrovic, D., McCall, E., and Dray, F. 1982. The in vitro production of prostanoids by cultured bovine articular chondrocytes. Prostaglandins. 23:17-28.
Mitrovic, D., Quintero, M., Stankovic, A., and Ryckewaert, A. 1983. Cell density of adult human femoral condylar articular cartilage. Joints with normal and fibrillated surfaces. Lab Invest 49:309-316.
Miwa, M., Saura, R., Hirata, S., Hayashi, Y., Mizuno, K., and Itoh, H. 2000. Induction of apoptosis in bovine articular chondrocyte by prostaglandin E(2) through cAMP-dependent pathway. Osteoarthritis Cartilage 8:17-24.
Miyagi, M., Sakaguchi, H., Darrow, R. M., Yan, L., West, K. A., Aulak, K. S., Stuehr, D. J., Hollyfield, J. G., Organisciak, D. T., and Crabb, J. W. 2002. Evidence That Light Modulates Protein Nitration in Rat Retina. Molecular Cellular Proteomics 1:293-303.
200 6. REFERENCES
Mollace, V., Muscoli, C., Masini, E., Cuzzocrea, S., and Salvemini, D. 2005. Modulation of Prostaglandin Biosynthesis by Nitric Oxide and Nitric Oxide Donors. Pharmacological Reviews 57:217- 252.
Moncada, S. 1999. Nitric oxide: discovery and impact on clinical medicine. J R Soc Med. 92:164-9.
Moncada, S., Palmer, R. M., and Higgs, E. A. 1991. Nitric oxide: physiology, pathophysiology, and pharmacology. Pharmacol Rev. 43:109-142.
Morrow, J. D., Hill, K. E., Burk, R. F., Nammour, T. M., Badr, K. F., and Roberts LJ, I. I. 1990. A Series of Prostaglandin F2-Like Compounds are Produced in vivo in Humans by a Non-Cyclooxygenase, Free Radical-Catalyzed Mechanism. Proceedings of the National Academy of Sciences 87:9383-9387.
Moss, S., Edwards, H. C., and Crumpton, M. J. 1991. Diversity in the annexin family. Novel calcium- binding proteins.Springer-Verlag KG, Berlin, Germany535-566.
Moulton, P. J., Goldring, M. B., and Hancock, J. T. 1998. NADPH oxidase of chondrocytes contains an isoform of the gp91phox subunit. Biochem J. 329:449-51.
Moulton, P. J., Hiran, T. S., Goldring, M. B., and Hancock, J. T. 1997. Detection of protein and mRNA of various components of the NADPH oxidase complex in an immortalized human chondrocyte line. Rheumatology 36:522-529.
Mukaida, N., Morita, M., Ishikawa, Y., Rice, N., Okamoto, S., Kasahara, T., and Matsushima, K. 1994. Novel mechanism of glucocorticoid-mediated gene repression. Nuclear factor-kappa B is target for glucocorticoid-mediated interleukin 8 gene repression. Journal of Biological Chemistry 269:13289-13295.
Murphy, J. M., Dixon, K., Beck, S., Fabian, D., Feldman, A., and Barry, F. 2002. Reduced chondrogenic and adipogenic activity of mesenchymal stem cells from patients with advanced osteoarthritis. Arthritis Rheum. 46:704-713.
Nah, H. D., Swoboda, B., Birk, D. E., and Kirsch, T. 2001. Type IIA procollagen: expression in developing chicken limb cartilage and human osteoarthritic articular cartilage. Dev Dyn. 220:307-22.
Nakane, M., Klinghofer, V., Kuk, J. E., Donnelly, J. L., Budzik, G. P., Pollock, J. S., Basha, F., and Carter, G. W. 1995. Novel potent and selective inhibitors of inducible nitric oxide synthase. Molecular Pharmacology 47:831-834.
Nathan, C. 1992. Nitric oxide as a secretory product of mammalian cells. The FASEB Journal 6:3051- 3064.
Nathan, C. 1997. Inducible Nitric Oxide Synthase: What Difference Does It Make? Journal of Clinical Investigation 100:2417-2423.
Neumann, A., Dennis, J., Staudenmaier, R., Rotter, N., Aigner, J., Ziegelaa, B., Happ, T., Rasp, G., and Caplan, A. I. 2002. Mesenchymal stem cells - a new pathway for tissue engineering in reconstructive surgery. Laryngorhinootologie 81:521-7.
201 6. REFERENCES
Neumann, P. H., Gertzberg, N. B., Vaughan, E., Weisbrot, J., Wodburn, R., Lambert, W., and Johnson, A. 2005. Peroxynitrite mediates TNF-{alpha} induced endothelial barrier dysfunction and nitration of actin. AJP - Lung Cellular and Molecular Physiology00391.
Newton, R. 2000. Molecular mechanisms of glucocorticoid action: what is important? Thorax 55:603-613.
Ng, L. J., Wheatley, S., Muscat, G. E. O., Conway-Campbell, J., Bowles, J., Wright, E., Bell, D. M., Tam, P. P. L., Cheah, K. S. E., and Koopman, P. 1997. SOX9 Binds DNA, Activates Transcription, and Coexpresses with Type II Collagen during Chondrogenesis in the Mouse. Developmental Biology 183:108-121.
Niwa, Y., Ozaki, Y., Kanoh, T., Akamatsu, H., and Kurisaka, M. 1996. Role of Cytokines, Tyrosine Kinase, and Protein Kinase C on Production of Superoxide and Induction of Scavenging Enzymes in Human Leukocytes. Clinical Immunology and Immunopathology 79:303-313.
Notoya, K., Jovanovic, D. V., Reboul, P., Martel-Pelletier, J., Mineau, F., and Pelletier, J. P. 2000. The Induction of Cell Death in Human Osteoarthritis Chondrocytes by Nitric Oxide Is Related to the Production of Prostaglandin E2 Via the Induction of Cyclooxygenase-2. The Journal of Immunology 165:3402-3410.
Ogawa, Y., Takahashi, T., Kobayashi, T., Toda, M., Nishioka, A., Kariya, S., Seguchi, H., Yamamoto, H., and Yoshida, S. 2003. Comparison of radiation-induced reactive oxygen species formation in adult articular chondrocytes and that in human peripheral T cells: possible implication in radiosensitivity. Int J Mol Med. 11:455-459.
Ohtsuka, M., Konno, F., Honda, H., Oikawa, T., Ishikawa, M., Iwase, N., Isomae, K., Ishii, F., Hemmi, H., and Sato, S. 2002. PPA250 [3-(2,4-Difluorophenyl)-6-{2-[4-(1H-imidazol-1-ylmethyl) Phenoxy]ethoxy}-2-phenylpyridine], a Novel Orally Effective Inhibitor of the Dimerization of Inducible Nitric-Oxide Synthase, Exhibits an Anti-Inflammatory Effect in Animal Models of Chronic Arthritis. Journal of Pharmacology And Experimental Therapeutics 303:52-57.
Okiji, T., Morita, I., Kawashima, N., Kosaka, T., Suda, H., and Murota, S. 1993. Immunohistochemical detection of prostaglandin I2 synthase in various calcified tissue-forming cells in rat. Arch Oral Biol. 38:31-6.
Oliver, B. L., Cronin, C. G., Zhang-Benoit, Y., Goldring, M. B., and Tanzer, M. L. 2004. Divergent stress responses to IL-1beta, nitric oxide, and tunicamycin by chondrocytes. J Cell Physiol. [Epub ahead of print].
Palmer, R. M. J., Hickery, M. S., Charles, I. G., Moncada, S., and Bayliss, M. T. 1993. Induction of Nitric Oxide Synthase in Human Chondrocytes. Biochemical and Biophysical Research Communications 193:398-405.
Pelletier, J. P., Fernandes, J. C., Jovanovic, D. V., Reboul, P., and Martel-Pelletier, J. 2001. Chondrocyte death in experimental osteoarthritis is mediated by MEK 1/2 and p38 pathways: role of cyclooxygenase-2 and inducible nitric oxide synthase. J Rheumatol. 28:2509-19.
202 6. REFERENCES
Pelletier, J. P., Mineau, F., Boileau, C., and Martel-Pelletier, J. 2003. Diacerein reduces the level of cartilage chondrocyte DNA fragmentation and death in experimental dog osteoarthritic cartilage at the same time that it inhibits caspase-3 and inducible nitric oxide synthase. Clin Exp Rheumatol. 21:171-7.
Pelletier, J.-P., Jovanovic, D., Lascau-Coman, V., Fernandes, J. C., Manning, P., Connor, J. R., Currie, M. G., and Martel-Pelletier, J. 2000. Selective inhibition of inducible nitric oxide synthase reduces progression of experimental osteoarthritis in vivo: possible link with the reduction in chondrocyte apoptosis and caspase 3 level. Arthritis Rheum. 43:1290-9.
Pittenger, M. F., Mackay, A. M., Beck, S. C., Jaiswal, R. K., Douglas, R., Mosca, J. D., Moorman, M. A., Simonetti, D. W., Craig, S., and Marshak, D. R. 1999. Multilineage Potential of Adult Human Mesenchymal Stem Cells. Science 284:143-147.
Poole, C. A. 1997. Articular cartilage chondrons: form, function and failure. J Anat. 191:1-13.
Pratico, D., Lawson, J. A., and FitzGerald, G. A. 1995. Cylooxygenase-dependent Formation of the Isoprostane, 8-Epi Prostaglandin F[IMAGE]. J.Biol.Chem. 270:9800-9808.
Probert, L., Plows, D., Kontogeorgos, G., and Kollias, G. 1995. The type I interleukin-1 receptor acts in series with tumor necrosis factor (TNF) to induce arthritis in TNF-transgenic mice. Eur J Immunol. 25:1794-7.
Pryor, W. A. and Squadrito, G. L. 1995. The chemistry of peroxynitrite: a product from the reaction of nitric oxide with superoxide. Am J Physiol 268:697-8.
Radi, R., Beckman, J. S., Bush, K. M., and Freeman, B. A. 1991a. Peroxynitrite oxidation of sulfhydryls. The cytotoxic potential of superoxide and nitric oxide. Journal of Biological Chemistry 266:4244-4250.
Radi, R., Beckman, J. S., Bush, K. M., and Freeman, B. A. 1991b. Peroxynitrite-induced membrane lipid peroxidation: the cytotoxic potential of superoxide and nitric oxide. Arch Biochem Biophys. 288:481- 487.
Radi, R., Rodriguez, M., Castro, L., and Telleri, R. 1994. Inhibition of Mitochondrial Electron Transport by Peroxynitrite. Archives of Biochemistry and Biophysics 308:89-95.
Rathakrishnan, C., Tiku, K., Raghavan, A., and Tiku, M. L. 1992. Release of oxygen radicals by articular chondrocytes: a study of luminol-dependent chemiluminescence and hydrogen peroxide secretion. J Bone Miner Res. 7:1139-48.
Rathakrishnan, C. and Tiku, M. L. 1993. Lucigenin-dependent chemiluminescence in articular chondrocytes. Free Radic Biol Med. 15:143-9.
Ray, A. and Prefontaine, K. E. 1994. Physical Association and Functional Antagonism Between the p65 Subunit of Transcription Factor NF-{kappa}B and the Glucocorticoid Receptor. Proceedings of the National Academy of Sciences 91:752-756.
203 6. REFERENCES
Ray, A., Siegel, M. D., Prefontaine, K. E., and Ray, P. 1995. Anti-inflammation: direct physical association and functional antagonism between transcription factor NF-KB and the glucocorticoid receptor. Chest 107:139S.
Redman, S. N., Oldfield, S. F., and Archer, C. W. 2005. Current strategies for articular cartilage repair. Eur Cell Mater. 14:23-32.
Regan, J. W. 2003. EP2 and EP4 prostanoid receptor signaling. Life Sciences 74:143-153.
Reiter, C. D., Teng, R. J., and Beckman, J. S. 2000. Superoxide Reacts with Nitric Oxide to Nitrate Tyrosine at Physiological pH via Peroxynitrite. Journal of Biological Chemistry 275:32460-32466.
Relic, B., Bentires-Alj, M., Franchimont, N., Guerne, P. A., Benoit, P. A., Merville, M. P., Bours, V., and Malaise, M. G. 2002. TNF-alpha protects human primary articular chondrocytes from nitric oxide- induced apoptosis via nuclear factor-kappaB. Lab Invest. 82:1661-1672.
Ricciardolo, F. L. M., Sterk, P. J., Gaston, B., and Folkerts, G. 2004. Nitric Oxide in Health and Disease of the Respiratory System. Physiological Reviews 84:731-765.
Rizzoli, R., Tscharner, V., and Fleisch, H. 1986. Increase of adenylate cyclase catalytic-unit activity by dexamethasone in rat osteoblast-like cells. Biochem J 237:447-54.
Roach, H. I., Aigner, T., and Kouri, J. B. 2004. Chondroptosis: a variant of apoptotic cell death in chondrocytes? Apoptosis 9:265-77.
Rothwell, A. G. and Bentley, G. 1973. Chondrocyte multiplication in osteoarthritic articular cartilage. J Bone Joint Surg Brit 55:588-594.
Rowan, W. H. 3., Sun, P., and Liu, L. 2002. Nitration of annexin II tetramer. Biochemistry 41:1409-20.
Ruan, J., Xie, Q. w., Hutchinson, N., Cho, H., Wolfe, G. C., and Nathan, C. 1996. Inducible Nitric Oxide Synthase Requires Both the Canonical Calmodulin-binding Domain and Additional Sequences in Order to Bind Calmodulin and Produce Nitric Oxide in the Absence of Free Ca2+. Journal of Biological Chemistry 271:22679-22686.
Rudolphi, K., Gerwin, N., Verzijl, N., van der Kraan, P., and van den Berg, W. 2003. Pralnacasan, an inhibitor of interleukin-1[beta] converting enzyme, reduces joint damage in two murine models of osteoarthritis. Osteoarthritis and Cartilage 11:738-746.
Ruegg, C., Dormond, O., and Mariotti, A. 2004. Endothelial cell integrins and COX-2: mediators and therapeutic targets of tumor angiogenesis. Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 1654:51-67.
Salgo, M. G., Squadrito, G. L., and Pryor, W. A. 1995. Peroxynitrite Causes Apoptosis in Rat Thymocytes. Biochemical and Biophysical Research Communications 215:1111-1118.
204 6. REFERENCES
Salvemini, D., Misko, T. P., Masferrer, J. L., Seibert, K., Currie, M. G., and Needleman, P. 1993. Nitric Oxide Activates Cyclooxygenase Enzymes. Proceedings of the National Academy of Sciences 90:7240- 7244.
Samad, T. A., Moore, K. A., Sapirstein, A., Billet, S., Allchorne, A., Poole, S., Bonventre, J. V., and Woolf, C. J. 2001. Interleukin-1[beta]-mediated induction of Cox-2 in the CNS contributes to inflammatory pain hypersensitivity. Nature 410:471-475.
Sandell, L. and Aigner, T. 2001. Articular cartilage and changes in arthritis. An introduction: cell biology of osteoarthritis. Arthritis Res 3:107-13.
Sandhu, J. K., Robertson, S., Birnboim, H. C., and Goldstein, R. 2003. Distribution of protein nitrotyrosine in synovial tissues of patients with rheumatoid arthritis and osteoarthritis. J Rheumatol. 30:1173-81.
Saunders, S., Paine-Saunders, S., and Lander, A. D. 1997. Expression of the Cell Surface Proteoglycan Glypican-5 Is Developmentally Regulated in Kidney, Limb, and Brain. Developmental Biology 190:78-93.
Scheinman, R. I., Gualberto, A., Jewell, C. M., Cidlowski, J. A., and Baldwin, A. S., Jr. 1995. Characterization of mechanisms involved in transrepression of NF-kappa B by activated glucocorticoid receptors. Molecular and Cellular Biology 15:943-953.
Schildknecht, S., Bachschmid, M., Baumann, A., and Ullrich, V. 2004. COX-2 inhibitors selectively block prostacyclin synthesis in endotoxin exposed vascular smooth muscle cells. The FASEB Journal03- 0609fje.
Schildknecht, S., Bachschmid, M., and Ullrich, V. 2005. Peroxynitrite provides the peroxide tone for PGHS-2-dependent prostacyclin synthesis in vascular smooth muscle cells. The FASEB Journal04- 3465fje.
Schmidt, H. H. and Walter, U. 1994. NO at work. Cell 78:919-925.
Schmidt, P., Youhnovski, N., Daiber, A., Balan, A., Arsic, M., Bachschmid, M., Przybylski, M., and Ullrich, V. 2003. Specific Nitration at Tyrosine 430 Revealed by High Resolution Mass Spectrometry as Basis for Redox Regulation of Bovine Prostacyclin Synthase. Journal of Biological Chemistry 278:12813- 12819.
Schmitt, B., Ringe, J., Haupl, T., Notter, M., Manz, R., Burmester, G. R., Sittinger, M., and Kaps, C. 2003. BMP2 initiates chondrogenic lineage development of adult human mesenchymal stem cells in high- density culture. Differentiation. 71:567-77.
Schwartz, N. B., Domowicz, M., Krueger, R. C. J., Li, H., and Mangoura, D. 1996. Brain aggrecan. Perspect Dev Neurobiol. 3:291-306.
Schwartz, Z., Gilley, R. M., Sylvia, V. L., Dean, D. D., and Boyan, B. D. 1998. The effect of prostaglandin E2 on costochondral chondrocyte differentiation is mediated by cyclic adenosine 3`,5`- monophosphate and protein kinase C. Endocrinology 139:1825-34.
205 6. REFERENCES
Schweer, H., Watzer, B., and Seyberth, H. W. 1994. Determination of seven prostanoids in 1 ml of urine by gas chromatography-negative ion chemical ionization triple stage quadrupole mass spectometry. J Chromatogr 652:221-7.
Shalom-Barak, T., Quach, J., and Lotz, M. 1998. Interleukin-17-induced Gene Expression in Articular Chondrocytes Is Associated with Activation of Mitogen-activated Protein Kinases and NF-kappa B. Journal of Biological Chemistry 273:27467-27473.
Shimabukuro, M., Ohneda, M., Lee, Y., and Unger, R. H. 1997. Role of Nitric Oxide in Obesity-induced beta áCell Disease. Journal of Clinical Investigation 100:290-295.
Shimabukuro, M., Zhou, Y. T., Levi, M., and Unger, R. H. 1998. Fatty acid-induced beta ácell apoptosis: A link between obesity andádiabetes. Proceedings of the National Academy of Sciences 95:2498-2502.
Shingu, M., Miyauchi, S., Nagai, Y., Yasutake, C., and Horie, K. 1995. The role of IL-4 and IL-6 in IL-1- dependent cartilage matrix degradation. Br J Rheumatol. 34:101-6.
Smoak, K. A. and Cidlowski, J. A. 2004. Mechanisms of glucocorticoid receptor signaling during inflammation. Mechanisms of Ageing and Development 125:697-706.
Snibbe, J. C. and Gambardella, R. A. 2005. Use of injections for osteoarthritis in joints and sports activity. Clin Sports Med. 24:83-91.
Solchaga, L. A., Welter, J. F., Lennon, D. P., and Caplan, A. I. 2004. Generation of pluripotent stem cells and their differentiation to the chondrocytic phenotype. Methods Mol Med. 100:53-68.
Stadler, J., Harbrecht, B. G., Di Silvio, M., Curran, R. D., Jordan, M. L., Simmons, R. L., and Billiar, T. R. 1993. Endogenous nitric oxide inhibits the synthesis of cyclooxygenase products and interleukin-6 by rat Kupffer cells. J Leukoc Biol. 53:165-72.
Steck, E., Bertram, H., Abel, R., Chen, B., Winter, A., and Richter, W. 2005. Induction of intervertebral disc-like cells from adult mesenchymal stem cells. Stem Cells 23:403-11.
Stefanovic-Racic, M., Stadler, J., Georgescu, H. I., and Evans, C. H. 1995. Nitric oxide and energy production in articular chondrocytes. J Cell Physiol. 159:274-80.
Stock, J. L., Shinjo, K., Burkhardt, J., Roach, M., Taniguchi, K., Ishikawa, T., Kim, H. S., Flannery, P. J., Coffman, T. M., McNeish, J. D., and Audoly, L. P. 2001. The prostaglandin E2 EP1 receptor mediates pain perception and regulates blood pressure. Journal of Clinical Investigation 107:325-331.
Stricker, S., Fundele, R., Vortkamp, A., and Mundlos, S. 2002. Role of Runx Genes in Chondrocyte Differentiation. Developmental Biology 245:95-108.
Strub, A., Ulrich, W. R., Hesslinger, C., Eltze, M., Fuchss, T., Strassner, J., Strand, S., Lehner, M., and Boer, R. 2005. The Novel Imidazopyridine BYK191023 is a Highly Selective Inhibitor of the Inducible Nitric Oxide Synthase. Molecular Pharmacologymol.
206 6. REFERENCES
Studer, R., Jaffurs, D., Stefanovic-Racic, M., Robbins, P. D., and Evans, C. H. 1999. Nitric oxide in osteoarthritis. Osteoarthr Cart 7:377-379.
Studer, R. K. 2004. Nitric oxide decreases IGF-1 receptor function in vitro; glutathione depletion enhances this effect in vivo. Osteoarthritis and Cartilage 12:863-869.
Studer, R. K., Levicoff, E., Georgescu, H. J., Miller, L., Jaffurs, D., and Evans, C. H. 2000. Nitric oxide inhibits chondrocyte resonse to IGF-I: inhibition of IGF-IRbeta tyrosine phosphorylation. Am J Physiol Cell Physiol 279:C961-C969.
Stuehr, D. J., Cho, H. J., Kwon, N. S., Weise, M. F., and Nathan, C. F. 1991. Purification and Characterization of the Cytokine-Induced Macrophage Nitric Oxide Synthase: An FAD- and FMN- Containing Flavoprotein. Proceedings of the National Academy of Sciences 88:7773-7777.
Stuehr, D., Pou, S., and Rosen, G. M. 2001. Oxygen Reduction by Nitric-oxide Synthases. Journal of Biological Chemistry 276:14533-14536.
Sugino, N., Telleria, C. M., and Gibori, G. 1998. Differential Regulation of Copper-Zinc Superoxide Dismutase and Manganese Superoxide Dismutase in the Rat Corpus Luteum: Induction of Manganese Superoxide Dismutase Messenger Ribonucleic Acid by Inflammatory Cytokines. Biology of Reproduction 59:208-215.
Suschek, C. V., Schnorr, O., and Kolb-Bachofen, V. 2004. The role of iNOS in chronic inflammatory processes in vivo: is it damage-promoting, protective, or active at all? Curr Mol Med. 4:763-75.
Swierkosz, T. A., Mitchell, J. A., Warner, T. D., Botting, R. M., and Vane, J. R. 1995. Co-induction of nitric oxide synthase and cyclo-oxygenase: interactions between nitric oxide and prostanoids. Br J Pharmacol. 114:1335-42.
Szabo, C. 1996. DNA strand breakage and activation of poly-ADP ribosyltransferase: A cytotoxic pathway triggered by peroxynitrite. Free Radical Biology and Medicine 21:855-869.
Szabo, C. 2003. Multiple pathways of peroxynitrite cytotoxicity. Toxicology Letters 140-141:105-112.
Szabo, C., Zingarelli, B., O'Connor, M., and Salzman, A. L. 1996. DNA strand breakage, activation of poly(ADP-ribose) synthetase, and cellular energy depletion are involved in the cytotoxicity in macrophages and smooth muscle cells exposed to peroxynitrite. Proceedings of the National Academy of Sciences 93:1753-1758.
Takahashi, K., Hashimoto, S., Kubo, T., Hirasawa, Y., Lotz, M., and Amiel, D. 2000. Effect of hyaluronan on chondrocyte apoptosis and nitric oxide production in experimentally induced osteoarthritis. J Rheumatology 27:1713-20.
Tanaka, K., Matsumoto, Y., Nakatani, F., Iwamoto, Y., and Yamada, Y. 2000. A Zink finger Transcription Factor, alphaA-Crystallin Binding Protein 1, Is a Negative Regulator of the Chondrocyte- Specific Enhancer of the alpha1(II) Collagen Gene. Mol.Cell.Biol. 20:4428-35.
207 6. REFERENCES
Tannahill, C. L., Stevenot, S. A., Eaker, E. Y., Sallustio, J. E., Nick, H. S., and Valentine, J. F. 1997. Regulation of superoxide dismutase in primary cultures of rat colonic smooth muscle cells. AJP - Gastrointestinal and Liver Physiology 272:G1230-G1235.
Tatemichi, M., Ogura, T., Sakurazawa, N., Nagata, H., Sugita, M., and Esumi, H. 2003. Roles of inducible nitric oxide synthase in the development and healing of experimentally induced gastric ulcers. International Journal of Experimental Pathology 84:213-220.
Tatsumi, T., Matoba, S., Kawahara, A., Keira, N., Shiraishi, J., Akashi, K., Kobara, M., Tanaka, T., Katamura, M., and Nakagawa, C. 2000. Cytokine-induced nitric oxide production inhibits mitochondrial energy production and impairs contractile function in rat cardiac myocytes. Journal of the American College of Cardiology 35:1338-1346.
Tenor, H., Hedbom, E., Hauselmann, H. J., Schudt, C., and Hatzelmann, A. 2002. Phosphodiesterase isoenzyme families in human osteoarthritis chondrocytes[thinsp]-[thinsp]functional importance of phosphodiesterase 4. Br J Pharmacol. 135:609-618.
Terkeltaub, R., Johnson, K., Murphy, A., and Ghosh, S. 2002. Invited review: the mitochondrion in osteoarthritis. Mitochondrion 1:301-319.
Thomas, B., Thirion, S., Humbert, L., Tan, L., Goldring, B., Bereziat, G., and Berenbaum, F. 2002. Differentiation regulates interleukin-1beta-induced cyclo-oxygenase-2 in human articular chondrocytes: role of p38 mitogen-activated protein kinase. Biochem.J. 362:367-73.
Thomas, B., Berenbaum, F., Humbert, L., Bian, H., Bereziat, G., Crofford, L., and Olivier, J. L. 2000. Critical role of C/EBP{delta} and C/EBP{beta} factors in the stimulation of the cyclooxygenase-2 gene transcription by interleukin-1{beta} in articular chondrocytes. FEBS Journal 267:6798-6809.
Thomson, L., Trujillo, M., Telleri, R., and Radi, R. 1995. Kinetics of Cytochrome C2+ Oxidation by Peroxynitrite: Implications for Superoxide Measurements in Nitric Oxide-Producing Biological-Systems. Archives of Biochemistry and Biophysics 319:491-497.
Tiano, H. F., Loftin, C. D., Akunda, J., Lee, C. A., Spalding, J., Sessoms, A., Dunson, D. B., Rogan, E. G., Morham, S. G., Smart, R. C., and Langenbach, R. 2002. Deficiency of Either Cyclooxygenase (COX)-1 or COX-2 Alters Epidermal Differentiation and Reduces Mouse Skin Tumorigenesis. Cancer Research 62:3395-3401.
Tiku, M. L., Liesch, J. B., and Robertson, F. M. 1990. Production of hydrogen peroxide by rabbit articular chondrocytes. Enhancement by cytokines. The Journal of Immunology 145:690-696.
Titheradge, M. A. 1999. Nitric oxide in septic shock. Biochim Biophys Acta. 1411:437-55.
Toda, M., Takahashi, T., Kobayashi, T., Seguchi, H., Ogawa, Y., Yoshida, S., and Yamamoto, H. 2002. The role of apoptotic resistance in irradiated adult articular chondrocytes. Int J Mol Med. 9:349-352.
Todd Allen, R., Robertson, C. M., Harwood, F. L., Sasho, T., Williams, S. K., Pomerleau, A. C., and Amiel, D. 2004. Characterization of mature vs aged rabbit articular cartilage: analysis of cell density, apoptosis-related gene expression and mechanisms controlling chondrocyte apoptosis. Osteoarthritis and Cartilage 12:917-923.
208 6. REFERENCES
Tomasiak, M., Stelmach, H., Rusak, T., and Wysocka, J. 2004. Nitric oxide and platelet energy metabolism. Acta Biochim Pol. 51:789-803.
Topping, R. E., Bolander, M. E., and Balian, G. 1994a. Type X collagen in fracture callus and the effects of experimental diabetes. Clin Orthop Relat Res. 308:8.
Topping, R. E., Bolander, M. E., and Balian, G. 1994b. Type X collagen in fracture callus and the effects of experimental diabetes. Clin Orthop Relat Res. 308:220-8.
Tung, J. T., Venta, P. J., and Caron, J. P. 2002. Inducible nitric oxide expression in equine articular chondrocytes: effects of antiinflammatory compounds. Osteoarthritis and Cartilage 10:5-12.
Tushan, F. S., Rodnan, G. P., Altman, M., and Robin, E. D. 1969. Anaerobic glycolysis and lactate dehydrogenase (LDH) isoenzymes in articular cartilage. J Lab Clin Med. 73:649-656.
Vallance, P. and Leiper, J. 2002. Blocking NO synthesis: how, where and why? Nat Rev Drug Discov. 1:939-50. van de Loo, F., Joosten, L. A., van Lent, P. L., Arntz, O. J., and van den Berg, W. B. 1995. Role of interleukin-1, tumor necrosis factor alpha, and interleukin-6 in cartilage proteoglycan metabolism and destruction. Effect of in situ blocking in murine antigen- and zymosan-induced arthritis. Arthritis Rheum. 38:194-72. van den Berg, W. B., van de Loo, F., Joosten, L. A. B., and Arntz, O. J. 1999. Animal models of arthritis in NOS2-deficient mice. Osteoarthritis and Cartilage 7:413-415. van Lent, P. L., van de Loo, F. A., Holthuysen, A. E., van den Berseelaar, L. A., Vermeer, H., and van den Berg, W. B. 1995. Major role for interleukin 1 but not for tumor necrosis factor in early cartilage damage in immune complex arthritis in mice. J Rheumatol. 22:2250-8.
Verzijl, N., DeGroot, J., Thorpe, S. R., Bank, R. A., Shaw, J. N., Lyons, T. J., Bijlsma, J. W. J., Lafeber, F. P. J. G., Baynes, J. W., and TeKoppele, J. M. 2000. Effect of Collagen Turnover on the Accumulation of Advanced Glycation End Products. Journal of Biological Chemistry 275:39027-39031.
Vignon, E., Arlot, M., Patricot, L. M., and Vignon, G. 1976. The cell density of human femoral head cartilage. Clin Orthop Rel Res303-308.
Virag, L., Szabo, E., Gergely, P., and Szabo, C. 2003. Peroxynitrite-induced cytotoxicity: mechanism and opportunities for intervention. Toxicology Letters 140-141:113-124. von der Mark, K., Kirsch, T., Nerlich, A., Kuss, A., Weseloh, G., Gluckert, K., and Stoss, H. 1992. Type X collagen synthesis in human osteoarthritic cartilage. Indication of chondrocyte hypertrophy. Arthritis Rheum. 35:806-11.
Vuolteenaho, K., Moilanen, T., Al Saffar, N., Knowles, R. G., and Moilanen, E. 2001. Regulation of the nitric oxide production resulting from the glucocorticoid-insensitive expression of iNOS in human osteoarthritic cartilage. Osteoarthritis and Cartilage 9:597-605.
209 6. REFERENCES
Walker-Bone, K., Javaid, K., Arden, N., and Cooper, C. 2000. Regular review: Medical management of osteoarthritis. BMJ 321:936-940.
Wang, Z. and Tai, H.-H. 1999. Cyclic AMP response element mediates dexamethasone induced suppression of prostaglandin H synthase-2 gene expression in human amnion derived WISH cells. Prostaglandins, Leukotrienes and Essential Fatty Acids 60:243-248.
Weiss, C. 1973. Ultrastructural characteristics of osteoarthritis. Fed Proc. 32:1459-66.
Weiss, C. and Mirow, S. 1972. An ultrastructural study of osteoarthritis changes in the articular cartilage of human knees. J Bone Joint Surg Am. 54:954-972.
Werner, E. R., Gorren, A. C. F., Heller, R., Werner-Felmayer, G., and Mayer, B. 2003. Tetrahydrobiopterin and Nitric Oxide: Mechanistic and Pharmacological Aspects. Experimental Biology and Medicine 228:1291-1302.
Whiteman, M., Rose, P., Siau, J. L., and Halliwell, B. 2003. Nitrite-mediated protection against hypochlorous acid-induced chondrocyte toxicity: a novel cytoprotective role of nitric oxide in the inflamed joint? Arthritis Rheum. 48:3140-3150.
Whiteman, M., Armstrong, J. S., Cheung, N. S., Siau, J. L., Rose, P., Schantz, J. T., Jones, D. P., and Halliwell, B. 2004. Peroxynitrite mediates calcium-dependent mitochondrial dysfunction and cell death via activation of calpains. The FASEB Journal03-1096fje.
Wieland, H. A., Michaelis, M., Kirschbaum, B. J., and Rudolphi, K. A. 2005. Osteoarthritis - an untreatable disease? Nature Reviews Drug Discovery 4:331-344.
Wink, D. A. and Mitchell, J. B. 1998. Chemical biology of nitric oxide: Insights into regulatory, cytotoxic, and cytoprotective mechanisms of nitric oxide. Free Radic Biol Med. 25:434-456.
Winter, A., Breit, S., Parsch, D., Benz, K., Steck, E., Hauner, H., Weber, R. M., Ewerbeck, V., and Richter, W. 2003. Cartilage-like gene expression in differentiated human stem cell spheroids: a comparison of bone marrow-derived and adipose tissue-derived stromal cells. Arthritis Rheum 48:418- 429.
Xu, X. P., Pollock, J. S., Tanner, M. A., and Myers, P. R. 1995. Hypoxia activates nitric oxide synthase and stimulates nitric oxide production in porcine coronary resistance arteriolar endothelial cells. Cardiovascular Research 30:841-847.
Yamakura, F., Taka, H., Fujimura, T., and Murayama, K. 1998. Inactivation of Human Manganese- superoxide Dismutase by Peroxynitrite Is Caused by Exclusive Nitration of Tyrosine 34áto 3- Nitrotyrosine. Journal of Biological Chemistry 273:14085-14089.
Yan, H., Kermouni, A., Abdel-Hafez, M., and Lau, D. C. W. 2003. Role of cyclooxygenases COX-1 and COX-2 in modulating adipogenesis in 3T3-L1 cells. Journal of Lipid Research 44:424-429.
210 6. REFERENCES
Yang, I. H., Kim, S. H., Kim, Y. H., Sun, H. J., Kim, S. J., and Lee, J. W. 2004. Comparison of Phenotypic Characterisation between "Alginate Bead" and "Pellet" Culture Systems as Chondrogenic Differentiation Models for Human Mesenchymal Stem Cells. Yonsei Med J 45:891-900.
Yasuhara, R., Miyamoto, Y., Akaike, T., Akuta, T., Nakamura, M., Takami, M., Morimura, N., Yasu, K., and Kamijo, R. 2005. Interleukin-1beta induces death in chondrocyte-like ATDC5 cells through mitochondrial dysfunction and energy depletion in a reactive nitrogen and oxygen species-dependent manner. Biochem J. 389:315-23.
Yoo, J. U., Barthel, T. S., Nishimura, K., Solchaga, L., Caplan, A. I., Goldberg, V. M., and Johnstone, B. 1998. The Chondrogenic Potential of Human Bone-Marrow-Derived Mesenchymal Progenitor Cells. J Bone Joint Surg. 80:1745-57.
Yoon, J. B., Kim, S. J., Hwang, S. G., Chang, S., Kang, S. S., and Chun, J. S. 2003. Non-steroidal Anti-inflammatory Drugs Inhibit Nitric Oxide-induced Apoptosis and Differentiation of Articular Chondrocytes Independent of Cyclooxygenase Activity. Journal of Biological Chemistry 278:15319-25.
Zhang, F. B., Li, L., Fang, B., Zhu, D. L., Yang, H. T., and Gao, P. J. 2005. Passage-restricted differentiation potential of mesenchymal stem cells into cardiomyocyte-like cells. Biochemical and Biophysical Research Communications 336:784-792.
Zhang, X., Mao, Z., and Yu, C. 2004. Suppression of early experimental osteoarthritis by gene transfer of interleukin-1 receptor antagonist and interleukin-10. Journal of Orthopaedic Research 22:742-750.
Zhou, Y. T., Grayburn, P., Karim, A., Shimabukuro, M., Higa, M., Baetens, D., Orci, L., and Unger, R. H. 2000. Lipotoxic heart disease in obese rats: Implications for human obesity. Proceedings of the National Academy of Sciences 97:1784-1789.
Zingarelli, B., O'Connor, M., Wong, H., Salzman, A. L., and Szabo, C. 1996. Peroxynitrite-mediated DNA strand breakage activates poly-adenosine diphosphate ribosyl synthetase and causes cellular energy depletion in macrophages stimulated with bacterial lipopolysaccharide. The Journal of Immunology 156:350-358.
Zou, M. H., Jendral, M., and Ullrich, V. 1999. Prostaglandin endoperoxide-dependent vasospasm in bovine coronary arteries after nitration of prostacyclin synthase. Br J Pharmacol. 126:1283-92.
Zou, M. H., Klein, T., Pasquet, J. P., and Ullrich, V. 1998. Interleukin 1beta decreases prostacyclin synthase activity in rat mesangial cells via endogenous peroxynitrite formation. Biochem J. 336:507-12.
Zou, M. H., Martin, C., and Ullrich, V. 1997. Tyrosine nitration as a mechanism of selective inactivation of prostacyclin synthase by peroxynitrite. Biol Chem. 378:707-13.
Zou, M. H. and Ullrich, V. 1996. Peroxynitrite formed by simultaneous generation of nitric oxide and superoxide selectively inhibits bovine aortic prostacyclin synthase. FEBS Lett. 382:101-4.
211 7. SUPPLEMENT
7. SUPPLEMENT
AFFYMETRIX DATA
Affymetrix gene chip characterization of hMSCs chondrogenic differentiation
C1 5000 C2 4500 C3
4000 C4 C5 3500 C6 3000 C7
2500
2000 relative expression relative 1500
1000
500
0 0d 5/6/7d 10/11d 13/14d 17/18d 20d 33d 52/53d differentiation course
Clustering analysis of differentially expressed genes during chondrogenic differentiation. Genes were clustered into seven groups according to clustering algorithm. Each of the seven clusters represents a unique pattern of expression during the differentiation course. Genes, which are grouped in one cluster have similar course of expression pattern during the chondrogenic differentiation process. All genes belonging to each cluster are given in the Table I.
212 7. SUPPLEMENT
Table I showing genes detected as differentially expressed during chondrogenic differentiation using ANOVA calculation. In the table are given: gene symbol; the median of normalized expression values for each differentiation day, cluster (C) and description of the gene (ordered by clusters).
Gene Symbol 0d 7d 11d 14d 18d 20d 33d 53d C Description ATP1B1 1861 1438 2433 2857 3632 3810 5595 7094 1 ATPase, Na+/K+ transporting, beta 1 polypeptide C18orf1 138 252 500 584 676 1187 1590 1043 1 chromosome 18 open reading frame 1 CDH4 276 264 0 0 295 266 0 393 1 cadherin 4, type 1, R-cadherin (retinal) COL8A2 1458 770 2493 2325 4580 7931 7586 8641 1 collagen, type VIII, alpha 2 CTNNB1 8783 10890 13300 13810 12732 15250 13710 14300 1 catenin beta 1, 88kDa FABP5 1377 1485 1922 3092 6028 7959 7260 5491 1 fatty acid binding protein 5 (psoriasis-associated) LMCD1 852 1048 1484 1696 1856 2528 2842 2428 1 LIM and cysteine-rich domains 1 NAV2 468 1397 1635 2519 1756 3265 3287 1573 1 neuron navigator 2 NFIB 549 735 822 918 997 0 0 826 1 nuclear factor I/B PHLDA3 1236 1301 1586 1718 1941 2090 2384 2253 1 pleckstrin homology-like domain, family A RASL11B 223 618 1509 1430 2553 3342 4536 2862 1 RAS-like, family 11, member B SLC35F2 300 533 693 612 666 737 726 712 1 solute carrier family 35, member F2 transient receptor potential cation channel, subfamily C, TRPC1 415 486 493 654 611 819 1019 779 1 member 1 UBTD1 378 495 404 406 463 587 590 555 1ubiquitin domain containing 1 WISP1 381 656 1279 1136 1044 1059 666 1145 1 WNT1 inducible signaling pathway protein 1 BAT1 6109 2999 4209 4953 4530 4518 4432 4725 2 HLA-B associated transcript 1 C7orf32 928 254 346 305 628 557 537 468 2chromosome 7 open reading frame 32 CGI-49 745 253 454 391 422 428 513 522 2CGI-49 protein cysteine and histidine-rich domain (CHORD)-containing, zinc CHORDC1 1489 540 1107 1099 890 1147 1372 1349 2 binding protein 1 COBLL1 542 104 124 147 226 287 373 508 2COBL-like 1 COMMD8 3546 1540 1642 1983 2198 2035 2063 2755 2 COMM domain containing 8 COP9 constitutive photomorphogenic homolog subunit 7A COPS7A 2231 1173 1477 1473 1701 1780 1635 1838 2 (Arabidopsis) COPZ2 5504 1082 2161 2619 3619 4406 3826 4400 2 coatomer protein complex, subunit zeta 2 CSE1L 2954 777 1423 1486 1341 1504 1420 1552 2 CSE1 chromosome segregation 1-like (yeast) DET1 598 268 432 400 460 494 415 582 2de-etiolated 1 DMN 623 214 323 269 449 319 542 791 2desmuslin DNAJB4 2536 849 1121 1268 1276 1523 1855 1733 2 DnaJ (Hsp40) homolog, subfamily B, member 4 DNAJB6 1367 798 1010 949 912 894 1099 1257 2 DnaJ (Hsp40) homolog, subfamily B, member 6 DT1P1A10 726 465 614 616 649 700 662 789 2hypothetical protein DT1P1A10 EPLIN 6152 2225 3091 2751 3441 3763 3558 4045 2 epithelial protein lost in neoplasm beta GPAA1 2946 1384 2020 2346 2348 2595 2539 3005 2 GPAA1P anchor attachment protein 1 homolog (yeast) GPAA1 3370 1930 2397 2747 2829 2942 2683 3080 2 GPAA1P anchor attachment protein 1 HMGN2 13114 4172 6540 6790 7504 7771 7716 8022 2 high-mobility group nucleosomal binding domain 2 HSPC135 805 489 468 629 602 696 542 574 2HSPC135 protein HSPC142 1508 732 956 1199 982 1099 901 1119 2 HSPC142 protein KIAA1393 8714 2268 3452 3529 4340 4628 4005 4185 2 KIAA1393 KPNA1 1580 827 0 0 1163 1185 1268 1452 2 karyopherin alpha 1 (importin alpha 5) LOC57019 812 458 571 688 654 637 611 764 2hypothetical protein LOC57019 MYL9 14210 4013 8236 11110 12650 12000 8909 13073 2 myosin, light polypeptide 9, regulatory MYO5A 867 298 393 293 484 693 799 791 2myosin VA (heavy polypeptide 12, myoxin) NAGA 795 482 688 746 862 834 817 773 2N-acetylgalactosaminidase, alpha- NY-REN- 58 253 163 256 242 292 316 303 273 2NY-REN-58 antigen PHKB 1548 724 892 855 1029 1133 1083 1005 2 phosphorylase kinase, beta PPIC 8313 3685 6510 8118 8461 10850 11285 9608 2 peptidylprolyl isomerase C (cyclophilin C) QDPR 2132 586 1043 1023 1659 1441 1264 2206 2 quinoid dihydropteridine reductase SCLY 234 107 132 132 170 180 136 199 2selenocysteine lyase SFRS7 1240 377 700 803 736 750 580 659 2splicing factor, arginine/serine-rich 7, 35kDa solute carrier family 35 (UDP-galactose transporter), member SLC35A2 380 138 190 313 287 329 311 337 2 A2 STOML1 983 316 454 515 746 902 813 1078 2 stomatin (EPB72)-like 1 SYNCOILI N 2402 661 944 945 1556 1274 1078 1778 2 intermediate filament protein syncoilin THY1 5288 1520 2734 3225 4743 6451 6378 7090 2 Thy-1 cell surface antigen THY1 4569 950 1767 1998 3316 5478 4902 5574 2 Thy-1 cell surface antigen TPM1 16220 1681 3587 2877 5254 7030 7099 6017 2 tropomyosin 1 (alpha) TPM1 24178 5908 10540 9990 14770 16364 16680 16120 2 tropomyosin 1 (alpha) TPM1 21053 4247 5964 6864 10760 10060 10490 11590 2 tropomyosin 1 (alpha) USP49 909 465 600 599 730 700 593 716 2ubiquitin specific protease 49 VPS45A 938 548 745 744 783 893 875 1144 2 vacuolar protein sorting 45A (yeast) ZCWCC2 1124 518 632 593 771 953 816 899 2 zinc finger, CW-type with coiled-coil domain 2 ANXA1 15698 7280 7211 7949 9138 10182 11048 10601 3 annexin A1 ASNS 6915 722 592 830 1001 2072 3701 2126 3 asparagine synthetase BACH 2472 1152 807 835 999 1208 1404 1123 3 brain acyl-CoA hydrolase BLCAP 3279 1810 2032 2042 2065 2482 2285 2605 3 bladder cancer associated protein CAP2 1968 308 446 362 506 987 1057 681 3 CAP, adenylate cyclase-associated protein, 2 (yeast) CDC16 3834 2066 1589 1641 1826 2265 2277 1814 3 CDC16 cell division cycle 16 homolog (S. cerevisiae) CDH2 7145 2223 2467 2339 2733 3134 4343 3035 3 cadherin 2, type 1, N-cadherin (neuronal) DAG1 4135 2214 1793 1784 1803 2028 2074 2503 3 dystroglycan 1 (dystrophin-associated glycoprotein 1) DDEF2 2708 1459 1074 1095 1042 1192 1603 1422 3 development and differentiation enhancing factor 2 DSP 6675 4787 3465 3106 4169 7370 8580 4729 3 desmoplakin DUSP14 3081 1003 844 922 1115 1091 1318 1666 3 dual specificity phosphatase 14 EIF2S2 11770 5632 4403 4369 4803 5517 7764 6254 3 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa ELOVL1 2100 1035 920 1054 962 1360 1349 1204 3 elongation of very long chain fatty acids EPRS 4576 1533 1408 1491 1703 2119 2506 2429 3 glutamyl-prolyl-tRNA synthetase FLJ10719 1019 313 272 0 0 0 0 0 3hypothetical protein FLJ10719 GYG 2406 1116 1161 935 1412 1310 1453 1605 3 glycogenin GYG 3721 2047 1534 1639 2212 2188 2052 2673 3 glycogenin HAX1 4995 2462 2243 2327 3034 2822 3107 3003 3 HS1 binding protein IARS 12000 3205 4412 3875 5578 6782 8369 7542 3 isoleucine-tRNA synthetase
213 7. SUPPLEMENT
Gene Symbol 0d 7d 11d 14d 18d 20d 33d 53d C Description JTV1 3470 1755 1686 1698 1958 2358 2238 2340 3 JTV1 gene LARP 5841 3944 3758 3790 3305 3718 4308 4350 3 likely ortholog of mouse la related protein MARS 3614 1208 1074 1065 1280 1839 2304 1937 3 methionine-tRNA synthetase likely ortholog of mouse membrane bound C2 domain MBC2 2712 1375 1348 1096 1822 1556 1726 1715 3 containing protein ME2 2108 1144 988 862 1100 1229 1293 1264 3 malic enzyme 2, NAD(+)-dependent, mitochondrial MEST 8406 422 259 359 995 0 0 3799 3 mesoderm specific transcript homolog (mouse) MYBL1 1825 293 234 115 198 231 395 260 3 v-myb myeloblastosis viral oncogene homolog (avian)-like 1 NEK7 12570 4503 4154 4125 4671 6233 6561 5007 3 NIMA (never in mitosis gene a)-related kinase 7 ODC1 8151 1644 1036 1157 1185 1712 2158 1739 3 ornithine decarboxylase 1 PEA15 5971 1989 1707 1916 2496 2813 3020 2866 3 phosphoprotein enriched in astrocytes 15 PHLDA2 3794 1420 811 760 1407 2925 3239 1358 3 pleckstrin homology-like domain, family A, 2 PVRL3 884 622 441 581 518 688 681 500 3poliovirus receptor-related 3 RNH 12220 6990 6470 6237 6494 6528 8040 7938 3 ribonuclease/angiogenin inhibitor solute carrier family 1 (glutamate/neutral amino acid SLC1A4 2699 498 527 758 734 1158 1672 1349 3 transporter), solute carrier family 1 (glutamate/neutral amino acid SLC1A4 1729 587 530 560 682 960 1471 1087 3 transporter), solute carrier family 1 (glutamate/neutral amino acid SLC1A4 2195 723 768 804 974 1270 1785 1372 3 transporter), solute carrier family 7 (cationic amino acid transporter, y+ SLC7A1 4955 1898 1489 1367 1683 2279 3286 2824 3 system), solute carrier family 7, (cationic amino acid transporter, y+ SLC7A11 5416 1486 909 1082 1122 1564 2635 1740 3 system) member 11 SPUVE 10090 3983 3445 4874 6318 9533 10071 8418 3 protease, serine, 23 STK17A 1060 605 640 541 784 940 892 924 3serine/threonine kinase 17a (apoptosis-inducing) TUFT1 1875 639 564 543 628 682 926 720 3tuftelin 1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur UQCRFS1 7043 5490 5143 5193 5911 5746 5693 6159 3 polypeptide 1 USP14 5136 3244 2551 2705 2942 3259 3596 3393 3 ubiquitin specific protease 14 (tRNA-guanine transglycosylase) WSB2 7060 3636 3491 3521 4028 5927 5550 5204 3 WD repeat and SOCS box-containing 2 ADAMTS1 9014 998 904 1237 938 709 950 1122 4 a disintegrin-like and metalloprotease (reprolysin type) ARPC1A 6499 3410 2935 3205 2990 2860 3287 2681 4 actin related protein 2/3 complex, subunit 1A, 41kDa C16orf33 1615 729 928 1004 737 947 663 994 4 chromosome 16 open reading frame 33 core 1 UDP-galactose:N-acetylgalactosamine-alpha-R beta C1GALT1 1988 646 786 862 788 805 930 958 4 1,3-galactosyltransferase C2F 1893 851 1033 1074 1031 1067 1022 1266 4 C2f protein CALM3 1883 902 1040 1287 1073 991 834 1164 4 calmodulin 3 CCNE2 330 88 92 97 77 99 106 70 4 cyclin E2 CDC25B 2474 1075 1073 1336 1264 1001 998 1108 4 cell division cycle 25B CDC42EP3 5400 658 636 709 624 608 717 767 4 CDC42 effector protein (Rho GTPase binding) 3 CDC42EP3 3663 330 376 301 371 352 544 443 4 CDC42 effector protein (Rho GTPase binding) 3 CDC42EP3 8966 965 1820 1699 1710 1380 1833 2034 4 CDC42 effector protein (Rho GTPase binding) 3 CDC6 611 194 270 162 197 252 257 206 4 CDC6 cell division cycle 6 homolog (S. cerevisiae) CDC6 733 151 245 159 171 239 266 232 4 CDC6 cell division cycle 6 homolog (S. cerevisiae) CKAP2 2210 554 486 495 595 617 580 725 4cytoskeleton associated protein 2 COMMD4 1543 723 897 1060 1002 968 772 1048 4 COMM domain containing 4 CRIM1 4463 701 607 639 544 558 672 732 4cysteine-rich motor neuron 1 CRIM1 3162 685 560 542 533 442 616 538 4cysteine-rich motor neuron 1 DCK 965 396 398 420 389 450 489 451 4deoxycytidine kinase DHFR 1119 476 532 589 707 637 406 550 4dihydrofolate reductase DIA1 15160 11190 11090 11370 10630 11110 11610 10990 4 diaphorase (NADH) (cytochrome b-5 reductase) DIPA 2610 743 800 726 659 981 903 640 4hepatitis delta antigen-interacting protein A DRAP1 3280 1270 1139 1164 1258 1257 1337 1048 4 DR1-associated protein 1 (negative cofactor 2 alpha) ELOVL6 1741 394 540 690 530 614 513 692 4 ELOVL family member 6, elongation of long chain fatty acids ELOVL6 680 149 205 221 210 240 203 251 4 ELOVL family member 6, elongation of long chain fatty acids FHL2 13720 3734 3372 3146 3503 4011 3580 2782 4 four and a half LIM domains 2 FLG 5082 74 55 51 59 66 0 175 4 filaggrin FLJ13096 302 129 183 171 164 205 199 194 4hypothetical protein FLJ13096 FLJ22794 1230 556 494 509 651 481 433 580 4FLJ22794 protein GPR1 1947 492 436 553 574 609 512 594 4G protein-coupled receptor 1 H2AFX 3236 698 635 670 636 689 742 864 4H2A histone family, member X HCAP-G 535 82 107 125 89 121 118 124 4 chromosome condensation protein G HRIHFB21 22 3225 964 1123 1180 1226 1411 1287 959 4 Tara-like protein HRIHFB21 22 1716 568 404 461 437 601 515 421 4Tara-like protein HRIHFB21 22 3350 1267 1103 1030 1085 1217 1209 954 4 Tara-like protein HUMGT19 8A 249 95 101 117 139 102 117 114 4GT198, complete ORF IGFBP7 27890 15920 16640 18730 18630 18870 17634 15850 4 insulin-like growth factor binding protein 7 JUNB 1204 417 607 485 546 511 523 509 4jun B proto-oncogene [BLAST] KLIP1 1280 181 220 230 214 179 222 215 4 KSHV latent nuclear antigen interacting protein 1 LAMC1 7145 3086 3378 2888 3412 3173 3741 3364 4 laminin, gamma 1 (formerly LAMB2) LDB2 1752 312 704 580 504 338 210 144 4LIM domain binding 2 LSM4 homolog, U6 small nuclear RNA associated (S. LSM4 2742 986 978 1205 1268 1324 1329 1347 4 cerevisiae) MAP2K3 2286 1010 717 861 770 906 685 912 4mitogen-activated protein kinase kinase 3 MCM2 minichromosome maintenance deficient 2, mitotin (S. MCM2 1213 389 497 405 486 391 527 436 4 cerevisiae) MELK 3062 319 345 274 596 401 493 457 4maternal embryonic leucine zipper kinase NUSAP1 2093 281 319 276 339 320 352 254 4nucleolar and spindle associated protein 1 OIP106 842 324 321 394 371 360 426 501 4OGT(O-Glc-NAc transferase)-interacting protein 106 KDa PCK2 1850 760 746 825 762 914 1152 954 4 phosphoenolpyruvate carboxykinase 2 (mitochondrial) PGBD3 1164 317 339 350 329 398 334 271 4piggyBac transposable element derived 3 PKP4 1197 521 451 474 531 606 525 525 4 plakophilin 4 POLR2L 11543 3904 4888 4373 5052 4930 3994 5208 4 polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa POLR3B 1198 756 723 696 739 820 732 806 4 polymerase (RNA) III (DNA directed) polypeptide B PSIP1 1435 524 550 547 465 378 405 526 4PC4 and SFRS1 interacting protein 1 PSPH 1318 337 420 402 362 508 524 542 4phosphoserine phosphatase
214 7. SUPPLEMENT
Gene Symbol 0d 7d 11d 14d 18d 20d 33d 53d C Description RAB32 3665 1602 1514 1673 1523 1599 1578 1716 4 RAB32, member RAS oncogene family RANGNRF 1037 703 646 890 763 814 659 715 4RAN guanine nucleotide release factor RFC3 896 394 329 313 328 387 282 281 4 replication factor C (activator 1) 3, 38kDa RNF34 1814 1219 1183 1086 1090 1201 1188 1019 4 ring finger protein 34 SIP 1629 742 801 829 742 993 932 967 4Siah-interacting protein solute carrier family 1 (neutral amino acid transporter), member SLC1A5 2097 680 967 892 938 1049 1068 1177 4 5 SMURF2 4403 1133 1080 979 869 1299 1096 909 4 E3 ubiquitin ligase SMURF2 SNRPA 1680 724 1011 928 950 818 757 941 4small nuclear ribonucleoprotein polypeptide A STAT1 9017 2906 3019 3399 3688 4044 3759 4643 4 signal transducer and activator of transcription 1, 91kDa TBCE 1246 655 797 0 748 821 738 829 4 tubulin-specific chaperone e TFDP1 3208 1524 1544 1485 1668 1778 1635 1797 4 transcription factor Dp-1 THBS1 7712 531 783 503 1181 792 1679 1578 4 thrombospondin 1 TIMELESS 754 256 301 307 236 291 230 297 4timeless homolog (Drosophila) TNFRSF11 tumor necrosis factor receptor superfamily, member 11b B 2537 217 126 132 358 76 70 170 4 (osteoprotegerin) TRIP6 3421 1902 2031 2338 2092 1989 1834 2333 4 thyroid hormone receptor interactor 6 TXNRD1 10130 3337 2676 3486 2971 2333 2726 2986 4 thioredoxin reductase 1 TYMS 3516 620 856 928 990 1137 1254 1139 4 thymidylate synthetase UBE2C 2438 335 640 432 639 645 708 466 4ubiquitin-conjugating enzyme E2C VDAC3 6117 4200 4464 4665 4165 5078 5295 5002 4 voltage-dependent anion channel 3 ZWINT 1971 270 445 441 515 603 585 541 4ZW10 interactor ALDOC 528 3148 2505 1678 942 1275 1653 811 5 aldolase C, fructose-bisphosphate AP1G1 3761 14482 9002 8077 5918 6419 8165 5409 5 adaptor-related protein complex 1, gamma 1 subunit BCL3 444 918 622 382 330 250 303 255 5B-cell CLL/lymphoma 3 BHC80 720 1371 969 891 592 673 803 672 5BRAF35/HDAC2 complex (80 kDa) BTG1 2323 11170 6851 6552 3978 2801 4482 2902 5 B-cell translocation gene 1, anti-proliferative BZW1 6772 8463 6180 6234 5258 6016 6045 4819 5 basic leucine zipper and W2 domains 1 CA12 2677 15210 8914 8791 4955 5002 7002 4378 5 carbonic anhydrase XII CA12 1018 6476 3495 3329 1636 1715 2311 1656 5 carbonic anhydrase XII CA12 1435 9044 4957 3492 2559 2737 4309 2056 5 carbonic anhydrase XII CA12 3429 14020 9164 8333 6399 6430 8191 5696 5 carbonic anhydrase XII CCNI 6076 14877 11809 12890 8709 8060 8456 8707 5 cyclin I FLJ20719 6999 11337 8732 7973 8412 7898 8398 7301 5 hypothetical protein FLJ20719 guanine nucleotide binding protein (G protein), alpha activating GNAL 572 2096 1617 1385 806 691 759 529 5 activity polypeptide H3F3B 672 1910 995 916 853 453 435 392 5H3 histone, family 3B (H3.3B) HGS 2105 3211 1944 1753 1636 1833 1929 2048 5 hepatocyte growth factor-regulated tyrosine kinase substrate KIAA0794 607 1165 949 845 662 612 710 603 5KIAA0794 protein KIAA1008 120 368 234 163 188 201 161 149 5KIAA1008 v-maf musculoaponeurotic fibrosarcoma oncogene homolog F MAFF 2282 6375 3002 2164 949 1152 2906 946 5 (avian) MCL1 4851 10590 6392 6760 5304 5772 5545 5471 5 myeloid cell leukemia sequence 1 (BCL2-related) MGC5306 1906 4237 1708 1679 1507 1587 1515 1044 5 hypothetical protein MGC5306 macrophage migration inhibitory factor (glycosylation-inhibiting MIF 11374 19088 17360 18182 11850 15592 16216 12160 5 factor) MTMR4 595 1024 823 753 735 585 453 580 5myotubularin related protein 4 NDRG1 3212 17550 12900 10530 6167 6557 12420 5377 5 N-myc downstream regulated gene 1 PBEF1 584 3898 1332 1426 702 406 449 442 5pre-B-cell colony enhancing factor 1 PBEF1 824 5699 2035 1967 961 669 739 656 5pre-B-cell colony enhancing factor 1 PHF1 2401 4635 2859 3349 3043 3222 3659 3049 5 PHD finger protein 1 phosphatidylinositol glycan, class A (paroxysmal nocturnal PIGA 215 580 225 268 207 267 339 188 5 hemoglobinuria) PITPNC1 376 1630 1124 915 450 457 534 409 5phosphatidylinositol transfer protein, cytoplasmic 1 phosphatase and tensin homolog (mutated in multiple PTEN 1619 4781 2733 2402 1880 2158 2570 1552 5 advanced cancers 1) PTGS1 197 3751 2588 1960 986 689 1169 417 5 prostaglandin-endoperoxide synthase 1 (COX-1) PTMA 7907 13798 11800 11449 8940 7865 7578 6442 5 prothymosin, alpha (gene sequence 28) PTMA 6819 13319 10218 9122 7127 7090 6381 4988 5 prothymosin, alpha (gene sequence 28) RELA 2056 4490 2449 2055 2041 2018 2208 2181 5 v-rel reticuloendotheliosis viral oncogene homolog A RPL18 13880 18869 15240 17860 14200 12070 10320 8910 5 ribosomal protein L18 RPS16 19187 23410 18460 21862 19319 16800 15680 14770 5 ribosomal protein S16 SFRS4 1546 2706 2035 2195 1752 1793 2050 1875 5 splicing factor, arginine/serine-rich 4 SOD2 523 7737 2054 1166 669 850 983 892 5superoxide dismutase 2, mitochondrial TNIP1 1114 2914 1617 2193 1307 1337 1524 1726 5 TNFAIP3 interacting protein 1 UBAP1 895 1567 1164 1080 911 915 1003 1162 5 ubiquitin associated protein 1 USP3 1271 2281 1678 1458 1261 1162 1226 1257 5 ubiquitin specific protease 3 ALCAM 5637 2159 1250 1606 1027 907 1143 1184 6 activated leukocyte cell adhesion molecule BCL7B 830 703 434 418 420 455 520 525 6B-cell CLL/lymphoma 7B BUB3 budding uninhibited by benzimidazoles 3 homolog BUB3 3702 2778 2007 2228 2003 2404 2654 2202 6 (yeast) C18orf8 728 713 573 545 571 551 561 541 6 chromosome 18 open reading frame 8 CGI-128 3078 2954 2087 2354 1841 2043 1859 1775 6 CGI-128 protein CSNK2B 5224 5534 4292 4415 3461 3781 3335 3301 6 casein kinase 2, beta polypeptide CTNNAL1 3541 2062 1519 1789 1686 1615 1620 1450 6 catenin (cadherin-associated protein), alpha-like 1 DEK 4314 3791 2743 2693 2263 2134 2203 2470 6 DEK oncogene (DNA binding) EFTUD1 973 1459 681 616 540 744 838 652 6elongation factor Tu GTP binding domain containing 1 ETHE1 2391 1877 1659 1493 1426 1404 1415 1329 6 ethylmalonic encephalopathy 1 FNBP1 1408 1516 714 904 732 916 1062 920 6 formin binding protein 1 HOXA9 910 441 536 677 452 381 375 222 6homeo box A9 LOX 21450 13760 8217 5553 4102 5601 7999 3287 6 lysyl oxidase LOX 7198 2163 1435 1127 863 975 1194 632 6 lysyl oxidase MET 5435 1803 1499 1298 1007 855 967 957 6 met proto-oncogene (hepatocyte growth factor receptor) NRP1 2941 1092 1010 907 1089 780 733 843 6 neuropilin 1 PALM2 4218 2945 2327 2095 1970 1900 1947 2075 6 paralemmin 2 PIK3CB 910 662 455 499 429 413 366 541 6phosphoinositide-3-kinase, catalytic, beta polypeptide PPAP2B 2605 1104 1107 1316 660 631 424 293 6phosphatidic acid phosphatase type 2B PPAP2B 4105 1892 2205 1885 1373 1056 814 627 6 phosphatidic acid phosphatase type 2B PRG1 14680 12440 7932 7392 4035 2949 2652 1932 6 proteoglycan 1, secretory granule PSIP1 2670 1195 1131 1278 1107 675 845 795 6 PC4 and SFRS1 interacting protein 1 RPL3 25117 27060 23870 25760 23220 22130 20607 19605 6 ribosomal protein L3
215 7. SUPPLEMENT
Gene Symbol 0d 7d 11d 14d 18d 20d 33d 53d C Description RRAS2 1639 708 501 510 433 513 508 505 6related RAS viral (r-ras) oncogene homolog 2 RRAS2 3270 1516 1056 1101 893 1033 1009 1107 6 related RAS viral (r-ras) oncogene homolog 2 SEC14L1 1738 1868 1311 1176 958 1123 1129 1171 6 SEC14-like 1 (S. cerevisiae) SH3BP4 4582 2367 2291 1923 1537 1771 1891 1798 6 SH3-domain binding protein 4 SLC38A2 15540 11720 11720 12490 9986 10250 11850 10140 6 solute carrier family 38, member 2 SLIT2 919 438 327 377 284 323 284 299 6slit homolog 2 (Drosophila) SSH1 1556 1474 1045 852 817 697 618 932 6slingshot homolog 1 (Drosophila) transcription elongation factor B (SIII), polypeptide 1 (15kDa, TCEB1 4603 3964 2979 2924 2819 2907 2925 2722 6 elongin C) THAP10 681 416 404 359 322 271 250 280 6THAP domain containing 10 TM4SF1 8590 7323 1539 1303 1186 826 1197 727 6 transmembrane 4 superfamily member 1 TM4SF1 4806 4468 892 792 663 532 724 352 6transmembrane 4 superfamily member 1 TM4SF1 3558 2607 494 434 454 358 536 209 6transmembrane 4 superfamily member 1 TXNDC4 3409 2335 1953 2060 1886 1669 2268 2273 6 thioredoxin domain containing 4 (endoplasmic reticulum) ABCA1 374 4996 5229 3708 4325 6462 5592 3854 7 ATP-binding cassette, sub-family A (ABC1), member 1 ABCA1 270 3117 2662 2312 2490 3458 2507 2115 7 ATP-binding cassette, sub-family A (ABC1), member 1 ANKRD10 563 1695 1289 1239 1198 1323 1287 1270 7 ankyrin repeat domain 10 AREG 81 5496 2406 2253 1722 151 0 407 7 amphiregulin (schwannoma-derived growth factor) BTB and CNC homology 1, basic leucine zipper transcription BACH2 113 280 308 491 530 339 347 446 7 factor 2 branched chain keto acid dehydrogenase E1, alpha BCKDHA 462 1155 935 945 803 832 887 868 7 polypeptide BCL6 1541 7616 5654 6118 5515 4339 4413 4537 7 B-cell CLL/lymphoma 6 (zinc finger protein 51) C1orf38 126 803 566 490 698 917 791 726 7chromosome 1 open reading frame 38 CENTD2 519 852 734 733 814 577 810 835 7centaurin, delta 2 COL6A2 12220 25304 26002 27210 23530 23500 19400 21360 7 collagen, type VI, alpha 2 CTSB 3688 10703 9022 9069 8587 7751 6554 6874 7 cathepsin B ELK3 3059 8067 7956 6800 6919 7080 6705 6070 7 ELK3, ETS-domain protein (SRF accessory protein 2) FLJ10134 3184 10220 10300 10670 7759 8632 11345 6671 7 hypothetical protein FLJ10134 FLJ12178 1004 1835 1751 1789 1693 1910 2122 2029 7 hypothetical protein FLJ12178 FOXO1A 195 3766 4657 5585 3930 3304 2169 3646 7 forkhead box O1A (rhabdomyosarcoma) GABARAP L1 1585 7546 4989 5775 4348 3097 2781 3155 7 GABA(A) receptor-associated protein like 1 GFPT2 464 5527 3240 2300 1709 1983 2114 1422 7 glutamine-fructose-6-phosphate transaminase 2 IGFBP5 846 13450 11670 9238 3766 10860 8285 3281 7 insulin-like growth factor binding protein 5 IGFBP5 4317 27550 26390 25232 20932 27462 29398 19960 7 insulin-like growth factor binding protein 5 JUN 3250 6178 7564 10330 7468 7203 7307 6807 7 v-jun sarcoma virus 17 oncogene homolog (avian) LOC56901 326 2126 1974 2805 1656 2352 3026 1600 7 NADH:ubiquinone oxidoreductase MLRQ subunit homolog MAN1A2 1070 2022 1960 2007 1792 1570 1705 1660 7 mannosidase, alpha, class 1A, member 2 MAN2B1 750 2115 2149 2585 1688 1642 1314 1332 7 mannosidase, alpha, class 2B, member 1 MLP 1288 4513 4134 4479 3586 4143 2091 1528 7 MARCKS-like protein MTSS1 538 3586 3193 2926 2590 1990 2604 1906 7 metastasis suppressor 1 NBL1 2653 9728 10990 12670 8315 7707 7315 11640 7 neuroblastoma, suppression of tumorigenicity 1 NMB 710 5112 3825 3290 2450 3760 2966 3044 7 neuromedin B PBX1 291 618 755 661 719 610 334 642 7pre-B-cell leukemia transcription factor 1 PDGFRB 1619 6091 6784 6097 6827 8385 7340 8137 7 platelet-derived growth factor receptor, beta polypeptide PSAP 15380 21795 20116 23550 21845 21730 19850 23150 7 prosaposin RAB13 5641 9863 9199 10251 8301 8020 6733 5879 7 RAB13, member RAS oncogene family RAB31 3699 14450 14620 18896 16950 17600 15273 17528 7 RAB31, member RAS oncogene family RAB31 2455 11450 11594 16160 13214 13530 12810 12300 7 RAB31, member RAS oncogene family RAB31 4239 16030 16910 18742 19020 18280 17190 18698 7 RAB31, member RAS oncogene family RGS2 400 9420 10519 8451 10650 10390 13640 6105 7 regulator of G-protein signalling 2, 24kDa SERPINB1 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), 3 110 145 156 0 149 165 85 147 7 member 13 SOX4 877 5734 5808 6687 3142 3413 1706 2098 7 SRY (sex determining region Y)-box 4 SPON1 184 1528 2018 2106 1779 1342 2200 3267 7 spondin 1, extracellular matrix protein SREBF1 471 1000 766 809 651 621 577 955 7 sterol regulatory element binding transcription factor 1 SRPX2 630 2709 3764 3573 3368 3882 2791 3346 7 sushi-repeat-containing protein, X-linked 2 TRIB1 387 3285 1918 1560 1531 2031 1818 1375 7 tribbles homolog 1 (Drosophila) TRIM38 396 707 698 760 663 522 582 643 7tripartite motif-containing 38 WASPIP 860 3372 3316 3546 2549 2307 2092 1855 7 Wiskott-Aldrich syndrome protein interacting protein ZFP36L1 210 663 701 495 480 887 896 474 7 zinc finger protein 36, C3H type-like 1 ZNF430 243 546 487 625 392 427 584 462 7zinc finger protein 430
216 7. SUPPLEMENT
Table II showing genes detected as differentially expressed during chondrogenic differentiation using absent/present calculation. In the table are given: gene symbol; the median of normalized expression values for each differentiation day and description of the gene (alphabetical order).
Gene Symbol 0d 7d 11d 14d 18d 20d 33d 53d Description 214803_at 546 274 0 0 0 0 0 0 MRNA; cDNA DKFZp564N1116 (from clone DKFZp564N1116) ABCG1 0 252 306 317 377 263 176 771 ATP-binding cassette, sub-family G (WHITE), member 1 ADSL 2524 0 0 1227 0 0 0 1040 adenylosuccinate lyase AK5 530 0 228 229 0 307 0 0 adenylate kinase 5 ANGPTL4 0 10860 5008 3450 3229 4607 8674 5106 angiopoietin-like 4 ANK3 483 0 181 247 0 0 0 0 ankyrin 3, node of Ranvier (ankyrin G) APOD 0 19820 21020 34380 20260 8240 7908 15079 apolipoprotein D ASE-1 885 567 0 0 0 0 0 832 CD3-epsilon-associated protein; antisense to ERCC-1 ASPN 0 1013 1036 1638 2295 3028 5605 7869 asporin (LRR class 1) ASTN2 178 0 199 200 211 263 194 291 astrotactin 2 ATAD2 458 221 265 0 0 0 0 0 ATPase family, AAA domain containing 2 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, B3GALT3 299 0 160 96 202 284 272 238 polypeptide 3 BM039 425 200 0 150 249 216 0 0 uncharacterized bone marrow protein BM039 BMP6 0 1591 0 650 0 0 0 0 bone morphogenetic protein 6 BRPF1 292 510 0 449 0 385 0 389 bromodomain and PHD finger containing, 1 BST1 1210 0 0 0 0 0 0 0 bone marrow stromal cell antigen 1 BTG2 0 1127 1279 1283 1298 0 0 0 BTG family, member 2 C10orf3 1490 0 232 195 201 157 176 169 chromosome 10 open reading frame 3 C14orf116 0 684 0 733 876 0 948 803 chromosome 14 open reading frame 116 C14orf133 968 839 0 1168 1031 1090 0 1131 chromosome 14 open reading frame 133 C1orf38 0 548 455 458 541 750 908 697 chromosome 1 open reading frame 38 C1QTNF1 0 1806 1338 1189 694 0 0 0 C1q and tumor necrosis factor related protein 1 C21orf5 309 159 170 0 227 227 0 217 chromosome 21 open reading frame 5 C6orf32 0 850 656 459 0 320 265 0 chromosome 6 open reading frame 32 CA9 0 1714 1266 779 0 386 586 199 carbonic anhydrase IX CCND2 0 210 525 549 824 1902 4729 3651 cyclin D2 CCNE2 263 149 169 0 168 148 0 134 cyclin E2 CDC2 1720 0 909 0 0 0 0 0 cell division cycle 2, G1 to S and G2 to M CDH6 374 0 0 0 0 0 0 0 cadherin 6, type 2, K-cadherin (fetal kidney) CENPF 407 0 143 101 0 111 139 88 centromere protein F, 350/400ka (mitosin) collagen, type X, alpha 1(Schmid metaphyseal COL10A1 0 5143 9229 4254 9195 15810 20705 16890 chondrodysplasia) COL18A1 0 1113 775 1103 913 1584 1593 1077 collagen, type XVIII, alpha 1 collagen, type VII, alpha 1 (epidermolysis bullosa, dystrophic, COL7A1 0 3191 3039 1342 1866 2197 1772 1203 dominant and recessive) COMMD4 1406 661 0 1001 0 1006 0 1095 COMM domain containing 4 CST6 499 91 0 0 0 0 0 218 cystatin E/M CSTF2 787 0 461 387 0 467 0 554 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa CTH 273 183 165 0 0 0 164 205 cystathionase (cystathionine gamma-lyase) DGUOK 703 0 0 521 0 482 449 436 deoxyguanosine kinase DKFZP434 F0318 385 0 315 0 0 0 0 0 hypothetical protein DKFZp434F0318 DOCK5 788 0 0 0 0 0 0 0 dedicator of cytokinesis 5 DPT 0 3372 6754 9591 11340 4031 6024 13090 dermatopontin DPT 0 2131 3503 6608 7085 1308 2858 8398 dermatopontin DUSP4 0 3665 1861 545 822 1562 2200 690 dual specificity phosphatase 4 ECGF1 0 693 867 753 732 875 732 708 endothelial cell growth factor 1 (platelet-derived) EEF1A2 0 1257 0 0 0 0 0 0 eukaryotic translation elongation factor 1 alpha 2 EHD1 426 411 0 0 0 0 0 0 EH-domain containing 1 EHD1 1237 1010 0 330 0 0 0 0 EH-domain containing 1 EPAS1 776 299 0 234 248 312 0 291 endothelial PAS domain protein 1 EXO1 296 0 0 0 0 0 0 0 exonuclease 1 FGF5 721 0 0 0 0 0 0 0 fibroblast growth factor 5 FLJ10719 301 0 0 0 0 0 0 0 hypothetical protein FLJ10719 FLJ10858 380 0 231 123 145 0 118 0 DNA glycosylase hFPG2 FLJ12649 795 0 0 579 537 559 527 575 hypothetical protein FLJ12649 FLJ21195 1635 0 0 463 343 0 0 0 protein related to DAN and cerberus FLJ22624 0 507 0 487 0 0 0 0 FLJ22624 protein FLJ31821 0 998 839 728 820 0 0 935 hypothetical protein FLJ31821 FLOT2 264 0 246 0 0 0 0 0 flotillin 2 FNDC4 622 1255 0 985 0 799 657 1195 fibronectin type III domain containing 4 FOXO1A 0 3847 4797 5623 3033 2589 1623 2914 forkhead box O1A (rhabdomyosarcoma) GBA 1925 0 1029 808 0 982 889 1307 glucosidase, beta; acid (includes glucosylceramidase) GNA11 1195 851 655 0 0 0 0 0 guanine nucleotide binding protein (G protein), alpha 11 GPR 957 816 514 0 0 0 275 0 putative G protein coupled receptor GPR56 0 677 0 0 0 0 0 0 G protein-coupled receptor 56 HNMT 91 0 98 80 109 126 153 118 histamine N-methyltransferase HOMER2 472 0 363 387 503 398 591 640 homer homolog 2 (Drosophila) IGF1 0 288 535 947 1476 0 0 620 insulin-like growth factor 1 (somatomedin C) IL24 0 862 0 0 0 0 0 0 interleukin 24 IL8 0 10620 493 319 0 0 0 0 interleukin 8 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 ITGA3 924 787 0 0 0 272 0 0 receptor) KIAA0101 480 0 129 0 0 0 0 0 KIAA0101 KIAA0186 644 0 274 211 210 0 0 140 KIAA0186 gene product KIAA0286 536 328 0 225 0 0 233 0 KIAA0286 protein KNSL7 274 0 0 0 0 0 0 0 kinesin-like 7 KNTC2 619 0 151 62 0 0 0 0 kinetochore associated 2 KRT18 5453 0 0 0 0 0 0 0 keratin 18 KRT19 2944 0 0 0 0 0 0 0 keratin 19 KRTAP1-1 941 0 0 0 0 0 0 0 keratin associated protein 1-1 KRTHA4 1654 0 0 0 0 0 0 0 keratin, hair, acidic, 4
217 7. SUPPLEMENT
Gene Symbol 0d 7d 11d 14d 18d 20d 33d 53d Description LIM 244 0 0 0 0 0 0 0 LIM protein (similar to rat protein kinase C-binding enigma) LIM 297 0 0 198 228 168 0 173 LIM protein (similar to rat protein kinase C-binding enigma) LMNB2 1049 291 0 449 0 0 0 300 lamin B2 LOC14690 9 947 0 343 171 186 183 190 168 hypothetical protein LOC146909 LOC51619 823 0 0 432 707 741 618 790 ubiquitin-conjugating enzyme HBUCE1 LRP4 0 384 467 526 308 316 0 460 low density lipoprotein receptor-related protein 4 LTBP4 0 639 0 0 0 0 0 0 latent transforming growth factor beta binding protein 4 MAP2K3 1603 1084 0 0 0 933 0 0 mitogen-activated protein kinase kinase 3 MCM7 minichromosome maintenance deficient 7 (S. MCM7 1318 1071 0 1033 0 0 0 0 cerevisiae) MDFI 0 220 531 679 706 2345 1432 1377 MyoD family inhibitor MGC29643 1946 0 553 265 0 0 0 0 hypothetical protein MGC29643 MKI67 642 0 254 155 210 135 288 270 antigen identified by monoclonal antibody Ki-67 MKI67 1010 0 497 303 434 478 384 388 antigen identified by monoclonal antibody Ki-67 MMP3 0 2657 823 965 1117 0 0 963 matrix metalloproteinase 3 (stromelysin 1, progelatinase) NAV3 1601 0 669 0 0 0 0 728 neuron navigator 3 NDST2 849 866 0 0 0 0 0 704 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2 NEK2 797 0 283 0 107 0 0 0 NIMA (never in mitosis gene a)-related kinase 2 NGFB 951 221 0 0 0 0 0 0 nerve growth factor, beta polypeptide NIF3L1 1041 714 0 800 0 0 0 674 NIF3 NGG1 interacting factor 3-like 1 (S. pombe) NINJ2 0 1143 1313 1885 1553 1911 1478 1777 ninjurin 2 NPDC1 1001 0 0 0 0 0 0 505 neural proliferation, differentiation and control, 1 NR1D1 0 3161 2469 2489 4390 3533 7008 4452 nuclear receptor subfamily 1, group D, member 1 OIP5 558 0 0 0 0 0 0 0 Opa-interacting protein 5 OMD 0 654 651 1477 1450 1374 1247 1860 osteomodulin 6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of PCBD 824 0 0 0 0 0 0 0 hepatocyte nuclear factor 1 alpha (TCF1) PCDH16 0 627 919 1104 938 1263 973 911 protocadherin 16 dachsous-like (Drosophila) PCSK1 0 3081 3820 5467 2888 1973 1169 1670 proprotein convertase subtilisin/kexin type 1 PCSK5 0 498 658 664 484 162 212 397 proprotein convertase subtilisin/kexin type 5 PCSK5 0 393 606 724 843 0 224 436 proprotein convertase subtilisin/kexin type 5 PDGFRA 0 1165 0 0 0 0 0 0 platelet-derived growth factor receptor, alpha polypeptide PECAM1 0 686 614 378 0 435 364 0 platelet/endothelial cell adhesion molecule (CD31 antigen) PER1 0 1135 1175 1212 616 0 0 764 period homolog 1 (Drosophila) PODXL 1665 786 495 0 0 0 0 0 podocalyxin-like PRSS3 209 321 0 0 0 0 0 0 protease, serine, 3 (mesotrypsin) PSG3 961 0 0 0 0 0 0 0 pregnancy specific beta-1-glycoprotein 3 PSG9 554 297 234 0 0 279 244 0 pregnancy specific beta-1-glycoprotein 9 prostaglandin-endoperoxide synthase 1 (prostaglandin G/H PTGS1 0 1706 570 409 0 0 0 0 synthase and cyclooxygenase) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H PTGS1 0 3787 2315 1646 815 546 796 589 synthase and cyclooxygenase) PVR 519 0 0 0 0 0 0 0 poliovirus receptor RABIF 980 524 557 0 673 803 719 619 RAB interacting factor ras-related C3 botulinum toxin substrate 2 (rho family, small RAC2 438 624 0 472 0 0 0 0 GTP binding protein Rac2) RAD51 672 0 0 0 0 0 0 0 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) RAMP 802 0 182 0 0 0 0 0 RA-regulated nuclear matrix-associated protein RAPGEF4 0 108 123 143 88 156 163 94 Rap guanine nucleotide exchange factor (GEF) 4 RASL12 0 406 583 467 632 0 0 0 RAS-like, family 12 RGS4 6658 801 0 0 0 0 0 0 regulator of G-protein signalling 4 RGS7 243 89 126 0 0 0 0 123 regulator of G-protein signalling 7 RNF144 0 898 1598 774 1146 1651 1825 1269 ring finger protein 144 SE57-1 0 789 727 615 615 275 0 715 CTCL tumor antigen se57-1 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), SERPINB2 1450 916 0 0 0 0 386 142 member 2 SH2D4A 898 218 0 0 0 281 296 381 SH2 domain containing 4A solute carrier family 1 (neuronal/epithelial high affinity SLC1A1 517 547 0 318 0 0 0 0 glutamate transporter, system Xag), member 1 solute carrier family 25 (mitochondrial carrier; adenine SLC25A4 1476 679 623 0 0 0 0 517 nucleotide translocator), member 4 solute carrier family 7, (cationic amino acid transporter, y+ SLC7A11 522 0 0 0 0 0 389 347 system) member 11 SMAD3 918 0 0 0 0 0 0 0 SMAD, mothers against DPP homolog 3 (Drosophila) SNAP25 0 630 663 529 763 242 312 662 synaptosomal-associated protein, 25kDa SOX4 0 1284 1362 1595 0 1094 0 949 SRY (sex determining region Y)-box 4 Spc25 341 0 0 0 0 0 0 0 kinetochore protein Spc25 SPON1 0 510 467 455 518 445 532 661 spondin 1, extracellular matrix protein SPON1 0 522 680 708 536 539 711 847 spondin 1, extracellular matrix protein SPTBN1 430 212 213 0 273 234 232 0 spectrin, beta, non-erythrocytic 1 STC1 0 3506 1135 832 0 0 536 0 stanniocalcin 1 T1A-2 0 427 584 350 485 410 1040 1383 lung type-I cell membrane-associated glycoprotein TARBP2 931 0 822 647 0 0 0 696 TAR (HIV) RNA binding protein 2 TBC1D2 831 0 0 0 0 478 454 885 TBC1 domain family, member 2 TNFRSF11 tumor necrosis factor receptor superfamily, member 11b B 2699 0 0 0 0 0 0 0 (osteoprotegerin) TPD52L1 2159 0 0 0 0 1391 1339 2457 tumor protein D52-like 1 TPD52L1 846 0 371 0 464 446 609 734 tumor protein D52-like 1 TREM1 0 5146 2836 1638 833 911 771 506 triggering receptor expressed on myeloid cells 1 TTK 739 0 192 93 113 105 139 0 TTK protein kinase WBSCR20 859 0 431 453 0 0 511 742 Williams Beuren syndrome chromosome region 20C XPO6 1744 1409 1323 0 0 1335 0 0 exportin 6
218 7. SUPPLEMENT
Table III Genes, which were not detected as regulated in hMSCs pellets on 18th differentiation day and were up-regulated in normal cartilage are given. In the table are given: gene symbol; description of the gene and relative expression value (cartilage).
Gene Symbol Gene Description Expression SOD3 superoxide dismutase 3, extracellular 5,06E-10 AGC1 aggrecan 1 (chondroitin sulfate proteoglycan 1, large aggregating proteoglycan, antigen identified by monoclonal antibody A0122) 5,09E-10 AGC1 aggrecan 1 (chondroitin sulfate proteoglycan 1, large aggregating proteoglycan, antigen identified by monoclonal antibody A0122) 1,57E-09 GASP G protein-coupled receptor-associated sorting protein 3,64E-09 AGC1 aggrecan 1 (chondroitin sulfate proteoglycan 1, large aggregating proteoglycan, antigen identified by monoclonal antibody A0122) 3,98E-09 SPINT2 serine protease inhibitor, Kunitz type, 2 1,10E-08 FRZB frizzled-related protein 1,97E-08 TPD52L1 tumor protein D52-like 1 2,73E-08 MID1 midline 1 (Opitz/BBB syndrome) 9,35E-08 ATP8A1 ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1 2,13E-07 PLA2G2A phospholipase A2, group IIA (platelets, synovial fluid) 2,36E-07 SEMA3E sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E 2,47E-07 NR3C2 nuclear receptor subfamily 3, group C, member 2 3,80E-07 NOVA1 neuro-oncological ventral antigen 1 6,33E-07 CD14 CD14 antigen 1,17E-06 HSRTSBETA rTS beta protein 1,24E-06 ZNF288 zinc finger protein 288 1,24E-06 LOC153561 hypothetical protein LOC153561 1,71E-06 C11orf8 chromosome 11 open reading frame 8 1,79E-06 MGC11349 hypothetical protein MGC11349 2,79E-06 LONP peroxisomal lon protease 3,06E-06 TPD52 tumor protein D52 3,43E-06 WBSCR20C Williams Beuren syndrome chromosome region 20C 3,70E-06 FLJ20152 hypothetical protein FLJ20152 5,12E-06 DNCI1 dynein, cytoplasmic, intermediate polypeptide 1 5,15E-06 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 5,24E-06 FLJ12270 hypothetical protein FLJ12270 6,64E-06 LONP peroxisomal lon protease 6,79E-06 ADCY2 adenylate cyclase 2 (brain) 7,40E-06 NAP1L2 nucleosome assembly protein 1-like 2 8,86E-06 FLJ13105 hypothetical protein FLJ13105 9,28E-06 PRO2275 mRNA, complete cds 9,61E-06 FLJ20010 hypothetical protein FLJ20010 9,76E-06 IL17RB interleukin 17 receptor B 1,00E-05 BARX1 BarH-like homeobox 1 1,02E-05 ZF HCF-binding transcription factor Zhangfei 1,05E-05 NEBL nebulette 1,43E-05 ELL3 elongation factor RNA polymerase II-like 3 1,57E-05 KIAA0971 KIAA0971 1,62E-05 PFAAP5 phosphonoformate immuno-associated protein 5 1,92E-05 WBSCR20C Williams Beuren syndrome chromosome region 20C 2,04E-05 LAG3 lymphocyte-activation gene 3 2,33E-05 SERPINA1 serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 2,82E-05 TYMS thymidylate synthetase 3,96E-05 FLJ22624 FLJ22624 protein 4,11E-05 S100A1 S100 calcium binding protein A1 4,49E-05 MRNA; cDNA DKFZp434A202 (from clone DKFZp434A202) 4,61E-05 GPR126 G protein-coupled receptor 126 5,38E-05 ZNF395 zinc finger protein 395 5,52E-05 FLT1 fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) 5,75E-05 ICAM2 intercellular adhesion molecule 2 5,88E-05 SMAD1 SMAD, mothers against DPP homolog 1 (Drosophila) 5,99E-05 CDNA FLJ14136 fis, clone MAMMA1002744 6,72E-05 RAPGEF5 Rap guanine nucleotide exchange factor (GEF) 5 6,76E-05 GPC5 glypican 5 6,82E-05 HSPC049 HSPC049 protein 6,88E-05 FXYD6 FXYD domain containing ion transport regulator 6 6,94E-05 S100B S100 calcium binding protein, beta (neural) 6,94E-05 KIAA1598 KIAA1598 7,55E-05 MAPRE2 microtubule-associated protein, RP/EB family, member 2 8,30E-05 DLEU2 deleted in lymphocytic leukemia, 2 8,32E-05 TPD52 tumor protein D52 8,94E-05 GARNL4 GTPase activating RANGAP domain-like 4 1,03E-04 TNFSF13 tumor necrosis factor (ligand) superfamily, member 13 1,06E-04 PRDX2 peroxiredoxin 2 1,09E-04 CDNA FLJ11817 fis, clone HEMBA1006421 1,20E-04 RUFY2 RUN and FYVE domain containing 2 1,20E-04 HLF hepatic leukemia factor 1,20E-04 MAPK8IP3 mitogen-activated protein kinase 8 interacting protein 3 1,26E-04 EPB41L3 erythrocyte membrane protein band 4.1-like 3 1,29E-04 GATM glycine amidinotransferase (L-arginine:glycine amidinotransferase) 1,29E-04 SMA5 SMA5 1,45E-04 MAOB monoamine oxidase B 1,47E-04 SMAD3 SMAD, mothers against DPP homolog 3 (Drosophila) 1,47E-04 PILRB paired immunoglobin-like type 2 receptor beta 1,50E-04 ICAM2 intercellular adhesion molecule 2 1,55E-04 GPRC5B G protein-coupled receptor, family C, group 5, member B 1,72E-04 ETS2 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) 1,76E-04 Consensus includes gb:AL080112.1 /DEF=Homo sapiens mRNA; cDNA DKFZp586H0722 (from clone DKFZp586H0722). 1,81E-04 /FEA=mRNA /DB_XREF=gi:5262539 /UG=Hs.332731 Homo sapiens mRNA; cDNA DKFZp586H0722 (from clon ... NACA nascent-polypeptide-associated complex alpha polypeptide 1,81E-04 ANK3 ankyrin 3, node of Ranvier (ankyrin G) 1,92E-04 KLHL3 kelch-like 3 (Drosophila) 2,02E-04 GTSE1 G-2 and S-phase expressed 1 2,05E-04 TNFRSF11B tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) 2,08E-04
219 7. SUPPLEMENT
Gene Symbol Gene Description Expression ING1 inhibitor of growth family, member 1 2,15E-04 SYNGR2 synaptogyrin 2 2,21E-04 RAI2 retinoic acid induced 2 2,30E-04 RoXaN ubiquitous tetratricopeptide containing protein RoXaN 2,32E-04 ITM2A integral membrane protein 2A 2,64E-04 ZNF42 zinc finger protein 42 (myeloid-specific retinoic acid-responsive) 2,72E-04 GPRC5C G protein-coupled receptor, family C, group 5, member C 2,72E-04 PON3 paraoxonase 3 2,75E-04 SFRS15 splicing factor, arginine/serine-rich 15 2,79E-04 RRAGD Ras-related GTP binding D 2,80E-04 CDNA FLJ25134 fis, clone CBR06934 2,84E-04 INPP5B inositol polyphosphate-5-phosphatase, 75kDa 2,95E-04 TNFSF13 tumor necrosis factor (ligand) superfamily, member 13 3,20E-04 NINJ1 ninjurin 1 3,30E-04 CDNA FLJ12055 fis, clone HEMBB1002049 3,31E-04 CACNB1 calcium channel, voltage-dependent, beta 1 subunit 3,33E-04 TMF1 TATA element modulatory factor 1 3,35E-04 KIAA1622 KIAA1622 3,46E-04 SEC24D SEC24 related gene family, member D (S. cerevisiae) 3,51E-04 RPL17 ribosomal protein L17 3,73E-04 HBA2 hemoglobin, alpha 2 3,99E-04 PDE4D phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) 4,13E-04 SORL1 sortilin-related receptor, L(DLR class) A repeats-containing 4,13E-04 KIAA1117 KIAA1117 4,52E-04 FLJ11267 hypothetical protein FLJ11267 4,66E-04 ZNF198 zinc finger protein 198 4,70E-04 WBSCR20C Williams Beuren syndrome chromosome region 20C 4,78E-04 CATSPER2 cation channel, sperm associated 2 4,88E-04 METTL3 methyltransferase like 3 4,95E-04 CDNA FLJ11443 fis, clone HEMBA1001330 5,18E-04 GENX-3414 genethonin 1 5,92E-04 CD8B1 CD8 antigen, beta polypeptide 1 (p37) 5,96E-04 MGC22679 hypothetical protein MGC22679 6,02E-04 FOXD2 forkhead box D2 6,43E-04 vesicle-associated membrane protein 8 (endobrevin) 6,47E-04 SH2D1A SH2 domain protein 1A, Duncan's disease (lymphoproliferative syndrome) 6,54E-04 PTPN22 protein tyrosine phosphatase, non-receptor type 22 (lymphoid) 6,94E-04 Homo sapiens mRNA; cDNA DKFZp586A0617 (from clone DKFZp586A0617) 7,13E-04 EFHD1 EF hand domain containing 1 7,18E-04 TPD52 tumor protein D52 7,19E-04 ALDH1A2 aldehyde dehydrogenase 1 family, member A2 7,40E-04 DKFZp586I14 7,52E-04 20 hypothetical protein DKFZp586I1420 TRIM29 tripartite motif-containing 29 7,57E-04 MLL myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 7,73E-04 PRKRIP1 PRKR interacting protein 1 (IL11 inducible) 7,79E-04 TPD52 tumor protein D52 8,11E-04 ETS2 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) 8,60E-04 KIAA0870 KIAA0870 protein 9,33E-04 PTPN22 protein tyrosine phosphatase, non-receptor type 22 (lymphoid) 9,36E-04 MTUS1 mitochondrial tumor suppressor 1 9,40E-04 PPT2 palmitoyl-protein thioesterase 2 9,49E-04 ZNF337 zinc finger protein 337 9,60E-04 Homo sapiens transcribed sequence with moderate similarity to protein ref:NP_060265.1 (H.sapiens) hypothetical protein FLJ20378 9,80E-04 217586_x_at [Homo sapiens] IRF1 interferon regulatory factor 1 9,81E-04 MED6 mediator of RNA polymerase II transcription, subunit 6 homolog (yeast) 0,001029 ZNF291 zinc finger protein 291 0,001039
Table IV Genes, which were detected in more than 80% of normal cartilage samples an in less than 20% hMSCs pellets on 18th differentiation day (low hMSCs/high normal cartilage). In the table are given: gene symbol; description of the gene, relative expression value (cartilage) and fold change (normal cartilage/hMSCs).
Gene Symbol Gene Description Expression Fold change HF1 H factor 1 (complement) 2,93E-09 47,04 WWP2 Nedd-4-like ubiquitin-protein ligase 6,59E-09 22,15 clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate 8,09E-09 23,46 CLU message 2, apolipoprotein J) clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate 1,59E-08 17,46 CLU message 2, apolipoprotein J) clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate 2,36E-08 22 CLU message 2, apolipoprotein J) MTUS1 mitochondrial tumor suppressor 1 2,44E-08 17,03 MBNL1 muscleblind-like (Drosophila) 3,80E-08 2,664 KIAA0527 KIAA0527 protein 2,07E-07 5,803 ZNF238 zinc finger protein 238 4,60E-07 3,983 TOB1 transducer of ERBB2, 1 5,01E-07 5,025 PCOLCE2 procollagen C-endopeptidase enhancer 2 5,52E-07 9,838 PPP1R3C protein phosphatase 1, regulatory (inhibitor) subunit 3C 8,41E-07 5,297 MKRN4 makorin, ring finger protein, 4 9,07E-07 4,123 LOC56901 NADH:ubiquinone oxidoreductase MLRQ subunit homolog 9,46E-07 7,86 VAMP4 vesicle-associated membrane protein 4 1,01E-06 3,747 RBM5 RNA binding motif protein 5 1,31E-06 4,131 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 1,75E-06 6,547 NRN1 neuritin 1 1,94E-06 7,249 EGLN3 egl nine homolog 3 (C. elegans) 1,94E-06 6,915 NEXN nexilin (F actin binding protein) 2,44E-06 4,848
220 7. SUPPLEMENT
Gene Symbol Gene Description Expression Fold change HHL expressed in hematopoietic cells, heart, liver 2,64E-06 4,558 FLJ20343 hypothetical protein FLJ20343 2,65E-06 2,039 C6orf111 chromosome 6 open reading frame 111 2,83E-06 7,921 KIAA1008 KIAA1008 3,02E-06 3,187 ALDOC aldolase C, fructose-bisphosphate 3,81E-06 2,74 C2H2 zinc finger protein pseudogene, mRNA sequence 3,81E-06 6,21 CCND2 cyclin D2 3,97E-06 5,058 KLF4 Kruppel-like factor 4 (gut) 4,10E-06 3,31 ITSN2 intersectin 2 4,28E-06 3,634 PFAAP5 phosphonoformate immuno-associated protein 5 4,98E-06 10,25 RALGDS ral guanine nucleotide dissociation stimulator 5,09E-06 3,027 ZNF395 zinc finger protein 395 5,20E-06 4,408 MRNA; cDNA DKFZp564F112 (from clone DKFZp564F112) 5,27E-06 13,17 PNN pinin, desmosome associated protein 5,75E-06 7,443 GCC2 GRIP and coiled-coil domain containing 2 5,81E-06 2,088 WBSCR20A Williams Beuren syndrome chromosome region 20A 5,97E-06 1,981 LITAF lipopolysaccharide-induced TNF factor 6,31E-06 5,634 GPR88 G-protein coupled receptor 88 6,34E-06 14,24 Clone IMAGE:5288883, mRNA 6,48E-06 2,451 KIAA0220 PI-3-kinase-related kinase SMG-1-like 7,07E-06 5,942 C6orf111 chromosome 6 open reading frame 111 7,80E-06 6,119 CDNA FLJ37094 fis, clone BRACE2018337 8,69E-06 2,157 BEXL1 brain expressed X-linked-like 1 8,88E-06 11,61 DKFZp434P1 hypothetical protein DKFZp434P162 9,00E-06 4,424 62 leucine zipper-like protein 9,67E-06 2,559 ITGA10 integrin, alpha 10 9,97E-06 4,181 C20orf13 chromosome 20 open reading frame 13 1,00E-05 2,01 MGC5395 hypothetical protein MGC5395 1,02E-05 2,958 COBLL1 COBL-like 1 1,06E-05 12,96 SWAP70 SWAP-70 protein 1,10E-05 3,3 FLJ20152 hypothetical protein FLJ20152 1,10E-05 11,1 NET1 neuroepithelial cell transforming gene 1 1,11E-05 3,591 MRNA for CMP-N-acetylneuraminic acid hydroxylase, complete cds. [BLAST] 1,11E-05 9,523 SLC39A8 solute carrier family 39 (zinc transporter), member 8 1,17E-05 10,49 BRD8 bromodomain containing 8 1,24E-05 1,849 Transcribed sequences 1,24E-05 4,365 H3F3B H3 histone, family 3B (H3.3B) 1,32E-05 2,339 SFRS5 splicing factor, arginine/serine-rich 5 1,36E-05 3,416 POT1 protection of telomeres 1 1,48E-05 2,412 FMOD fibromodulin 1,54E-05 14,57 WSB1 WD repeat and SOCS box-containing 1 1,60E-05 6,618 C14orf124 chromosome 14 open reading frame 124 1,62E-05 1,898 STC2 stanniocalcin 2 1,62E-05 7,382 Transcribed sequences 1,95E-05 9,338 CMKOR1 chemokine orphan receptor 1 2,03E-05 6,993 PSIP1 PC4 and SFRS1 interacting protein 1 2,11E-05 2,65 HNRPL heterogeneous nuclear ribonucleoprotein L 2,11E-05 3,131 HFL1 H factor (complement)-like 1 2,19E-05 17,27 ADAMTSL3 ADAMTS-like 3 2,22E-05 8,089 BTAF1 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) 2,30E-05 5,026 Homo sapiens Alu repeat (LNX1) mRNA sequence 2,34E-05 4,767 FBXW11 F-box and WD-40 domain protein 11 2,42E-05 2,317 LOC285231 F-box- and WD40-repeat-containing protein 2,53E-05 3,224 DONSON downstream neighbor of SON 2,66E-05 3,111 FLJ10948 hypothetical protein FLJ10948 2,71E-05 3,42 HNRPA1 heterogeneous nuclear ribonucleoprotein A1 2,73E-05 3,878 TNRC11 trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit) 2,80E-05 1,885 chromosome 1 open reading frame 6 2,90E-05 2,485 SET8 PR/SET domain containing protein 8 3,31E-05 2,88 SFPQ splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated) 3,37E-05 7,619 TRIAD3 TRIAD3 protein 3,44E-05 1,65 ZNF506 zinc finger protein 506 3,75E-05 2,274 ATP7A ATPase, Cu++ transporting, alpha polypeptide (Menkes syndrome) 3,86E-05 2,465 HS3ST3A1 heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1 3,93E-05 5,524 STK3 serine/threonine kinase 3 (STE20 homolog, yeast) 3,98E-05 2,69 SHARP SMART/HDAC1 associated repressor protein 4,07E-05 2,809 RBKS ribokinase 4,10E-05 1,879 CADPS2 Ca2+-dependent activator protein for secretion 2 4,18E-05 2,762 GARNL1 GTPase activating RANGAP domain-like 1 4,19E-05 4,331 CDO1 cysteine dioxygenase, type I 4,21E-05 20,43 EPM2AIP1 EPM2A (laforin) interacting protein 1 4,35E-05 2,256 NCOA1 nuclear receptor coactivator 1 4,49E-05 4,138 ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 4,62E-05 2,277 ERG v-ets erythroblastosis virus E26 oncogene like (avian) 4,78E-05 7,564 BCL7A B-cell CLL/lymphoma 7A 4,91E-05 3,715 ZNF331 zinc finger protein 331 4,93E-05 2,765 ARFGEF2 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) [BLAST] 5,04E-05 3,679 MDC1 mediator of DNA damage checkpoint 1 5,07E-05 2,899 LUC7L2 LUC7-like 2 (S. cerevisiae) 5,07E-05 2,866 NKTR natural killer-tumor recognition sequence 5,40E-05 3,505 TARDBP TAR DNA binding protein 5,96E-05 2,704 DDIT4 DNA-damage-inducible transcript 4 6,08E-05 5,415 BCL2 B-cell CLL/lymphoma 2 6,11E-05 6,329 CPNE3 copine III 6,14E-05 1,581 AK3 adenylate kinase 3 6,23E-05 2,717 ZNF451 zinc finger protein 451 6,37E-05 3,349 SLC1A4 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 6,64E-05 5,619 FLJ20700 hypothetical protein FLJ20700 6,74E-05 5,264 KIAA0467 KIAA0467 protein 6,76E-05 1,999 KIAA0220 PI-3-kinase-related kinase SMG-1-like 6,93E-05 2,991 SLC1A4 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 7,07E-05 8,44
221 7. SUPPLEMENT
Gene Symbol Gene Description Expression Fold change CP110 CP110 protein 7,10E-05 2,146 C6orf75 chromosome 6 open reading frame 75 7,18E-05 3,941 LUC7L2 LUC7-like 2 (S. cerevisiae) 7,23E-05 3,291 PFKFB3 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 7,55E-05 11,81 SRRM1 serine/arginine repetitive matrix 1 7,71E-05 1,857 PER2 period homolog 2 (Drosophila) 7,90E-05 5,109 DHRS6 dehydrogenase/reductase (SDR family) member 6 8,22E-05 2,055 NEBL nebulette 8,61E-05 27,6 NALP1 NACHT, leucine rich repeat and PYD containing 1 8,82E-05 3,036 EIF2AK3 eukaryotic translation initiation factor 2-alpha kinase 3 8,85E-05 3,095 OFD1 oral-facial-digital syndrome 1 8,93E-05 3,411 MRNA; cDNA DKFZp586K1123 (from clone DKFZp586K1123) 9,13E-05 2,644 LPXN leupaxin 9,15E-05 3,226 MLLT2 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 2 9,19E-05 3,34 CDNA FLJ11452 fis, clone HEMBA1001435 9,36E-05 4,397 GOLGB1 golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1 9,71E-05 2,151 ZNF42 zinc finger protein 42 (myeloid-specific retinoic acid-responsive) 9,90E-05 2,783 LRIG2 leucine-rich repeats and immunoglobulin-like domains 2 9,99E-05 2,402 KCNK1 potassium channel, subfamily K, member 1 1,01E-04 3,193 ABCA5 ATP-binding cassette, sub-family A (ABC1), member 5 1,01E-04 11,7 SFTPB surfactant, pulmonary-associated protein B 1,01E-04 3,01 AHI1 Abelson helper integration site 1,05E-04 3,365 ZNF500 zinc finger protein 500 1,07E-04 2,309 KIAA1102 KIAA1102 protein 1,09E-04 5,649 FLJ11029 hypothetical protein FLJ11029 1,10E-04 3,269 PLA2G4B phospholipase A2, group IVB (cytosolic) 1,11E-04 1,827 FOXC1 forkhead box C1 1,12E-04 7,077 MT1X metallothionein 1X 1,14E-04 2,714 KIAA0907 KIAA0907 protein 1,15E-04 2,872
Table V Genes, which were detected as up-regulated in hMSCs pellets on 18th differentiation day and not regulated in normal cartilage. In the table are given: gene symbol; description of the gene and relative expression value (hMSCs 18th day of chondrogenic differentiation).
Gene Symbol Gene Description Expression CHN1 chimerin (chimaerin) 1 2,74E-10 GSR glutathione reductase 3,46E-09 NQO1 NAD(P)H dehydrogenase, quinone 1 3,65E-09 PTPLA protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a 4,32E-08 BICD2 bicaudal D homolog 2 (Drosophila) 4,64E-08 WNT5A wingless-type MMTV integration site family, member 5A 4,74E-08 COL4A2 collagen, type IV, alpha 2 7,16E-08 LGALS3BP lectin, galactoside-binding, soluble, 3 binding protein 7,78E-08 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 1,04E-07 IGFBP3 insulin-like growth factor binding protein 3 1,32E-07 ADAMTS2 a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2 1,70E-07 DBN1 drebrin 1 2,34E-07 NR2F1 nuclear receptor subfamily 2, group F, member 1 2,74E-07 BTN3A3 butyrophilin, subfamily 3, member A3 3,57E-07 GPC4 glypican 4 3,63E-07 COL4A1 collagen, type IV, alpha 1 3,75E-07 PAWR PRKC, apoptosis, WT1, regulator 3,82E-07 APEH N-acylaminoacyl-peptide hydrolase 4,06E-07 RAC2 ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) 6,10E-07 CDH11 cadherin 11, type 2, OB-cadherin (osteoblast) 7,09E-07 CSRP2 cysteine and glycine-rich protein 2 1,08E-06 GPC1 glypican 1 1,13E-06 CNN1 calponin 1, basic, smooth muscle 1,19E-06 MARCKS myristoylated alanine-rich protein kinase C substrate 1,24E-06 MYL9 myosin, light polypeptide 9, regulatory 1,25E-06 MPV17 MpV17 transgene, murine homolog, glomerulosclerosis 1,29E-06 PDLIM7 PDZ and LIM domain 7 (enigma) 1,52E-06 KRT14 keratin 14 (epidermolysis bullosa simplex, Dowling-Meara, Koebner) 1,84E-06 PTGDS prostaglandin D2 synthase 21kDa (brain) 2,04E-06 NDST1 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 2,94E-06 ELN elastin (supravalvular aortic stenosis, Williams-Beuren syndrome) 3,61E-06 CSRP2 cysteine and glycine-rich protein 2 4,60E-06 PDLIM7 PDZ and LIM domain 7 (enigma) 4,60E-06 CA12 carbonic anhydrase XII 5,16E-06 G6PD glucose-6-phosphate dehydrogenase 5,25E-06 MRPL4 mitochondrial ribosomal protein L4 5,37E-06 HN1 hematological and neurological expressed 1 5,57E-06 CGI-37 comparative gene identification transcript 37 5,61E-06 TBX3 T-box 3 (ulnar mammary syndrome) 6,17E-06 WNT5B wingless-type MMTV integration site family, member 5B 6,41E-06 TTLL1 tubulin tyrosine ligase-like family, member 1 6,84E-06 FZD2 frizzled homolog 2 (Drosophila) 8,53E-06 CAPN1 calpain 1, (mu/I) large subunit 9,48E-06 PLXND1 plexin D1 9,72E-06 FHL3 four and a half LIM domains 3 9,82E-06 CTNS cystinosis, nephropathic 1,07E-05 EBP emopamil binding protein (sterol isomerase) 1,24E-05 GPR124 G protein-coupled receptor 124 1,29E-05 ARF5 ADP-ribosylation factor 5 1,31E-05 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) 1,35E-05 NNT nicotinamide nucleotide transhydrogenase 1,41E-05 LOC57228 hypothetical protein from clone 643 1,47E-05
222 7. SUPPLEMENT
Gene Symbol Gene Description Expression SPHK1 sphingosine kinase 1 1,48E-05 CDK5 cyclin-dependent kinase 5 1,54E-05 RAP2A RAP2A, member of RAS oncogene family 1,60E-05 DKFZp566C0 1,86E-05 424 putative MAPK activating protein PM20,PM21 TNFRSF6 tumor necrosis factor receptor superfamily, member 6 2,14E-05 MCAM melanoma cell adhesion molecule 2,60E-05 NOTCH3 Notch homolog 3 (Drosophila) 2,64E-05 DCPS mRNA decapping enzyme 2,92E-05 DUSP4 dual specificity phosphatase 4 3,27E-05 ALDH1B1 aldehyde dehydrogenase 1 family, member B1 3,28E-05 ARSA arylsulfatase A 3,33E-05 PITX2 paired-like homeodomain transcription factor 2 3,38E-05 TRIM16 tripartite motif-containing 16 3,40E-05 KIAA0882 KIAA0882 protein 3,48E-05 TRD@ T cell receptor delta locus 3,89E-05 CUGBP1 CUG triplet repeat, RNA binding protein 1 4,02E-05 MCART1 mitochondrial carrier triple repeat 1 4,29E-05 ABHD5 abhydrolase domain containing 5 4,36E-05 AP1S1 adaptor-related protein complex 1, sigma 1 subunit 4,80E-05 TRD@ T cell receptor delta locus 5,31E-05 LIMK2 LIM domain kinase 2 5,39E-05 CA12 carbonic anhydrase XII 5,44E-05 CKIP-1 CK2 interacting protein 1; HQ0024c protein 5,75E-05 HMGA1 high mobility group AT-hook 1 5,88E-05 CDNA clone IMAGE:5093665, partial cds 5,94E-05 ODZ4 odz, odd Oz/ten-m homolog 4 (Drosophila) 6,01E-05 IGSF4B immunoglobulin superfamily, member 4B 6,08E-05 AP1G1 adaptor-related protein complex 1, gamma 1 subunit 6,12E-05 CGI-63 nuclear receptor binding factor 1 6,22E-05 IRX5 iroquois homeobox protein 5 6,23E-05 SLC36A1 solute carrier family 36 (proton/amino acid symporter), member 1 6,53E-05 Sep 11 septin 11 6,68E-05 PTK9L PTK9L protein tyrosine kinase 9-like (A6-related protein) 6,69E-05 HMOX1 heme oxygenase (decycling) 1 6,86E-05 E2F6 E2F transcription factor 6 7,10E-05 AP1S1 adaptor-related protein complex 1, sigma 1 subunit 7,13E-05 ALDH1B1 aldehyde dehydrogenase 1 family, member B1 7,68E-05 COL6A1 collagen, type VI, alpha 1 7,79E-05 HUMAGCGB chromosome 3p21.1 gene sequence 7,85E-05 OLFML2A olfactomedin-like 2A 7,87E-05 KRT7 keratin 7 7,90E-05 KRT17 keratin 17 8,16E-05 NAGPA N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase 8,21E-05 F2RL1 coagulation factor II (thrombin) receptor-like 1 8,24E-05 ENC1 ectodermal-neural cortex (with BTB-like domain) 8,34E-05 SMARCD3 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 8,42E-05 PKIA protein kinase (cAMP-dependent, catalytic) inhibitor alpha 9,27E-05 TNPO1 transportin 1 9,30E-05 VEGFC vascular endothelial growth factor C 9,39E-05 ADD3 adducin 3 (gamma) 1,03E-04 CA12 carbonic anhydrase XII 1,06E-04 BLMH bleomycin hydrolase 1,10E-04 TPST2 tyrosylprotein sulfotransferase 2 1,19E-04 ABLIM3 actin binding LIM protein family, member 3 1,20E-04 TM4SF9 transmembrane 4 superfamily member 9 1,22E-04 ELOVL1 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 1,24E-04 CLIC3 chloride intracellular channel 3 1,27E-04 LOXL1 lysyl oxidase-like 1 1,30E-04 NEU1 sialidase 1 (lysosomal sialidase) 1,33E-04 QPCT glutaminyl-peptide cyclotransferase (glutaminyl cyclase) 1,33E-04 TBC1D16 TBC1 domain family, member 16 1,36E-04 MID1 midline 1 (Opitz/BBB syndrome) 1,36E-04 PPM2C protein phosphatase 2C, magnesium-dependent, catalytic subunit 1,38E-04 LIMS2 LIM and senescent cell antigen-like domains 2 1,51E-04 KIAA0676 KIAA0676 protein 1,57E-04 GAP43 growth associated protein 43 1,60E-04 LAMB1 laminin, beta 1 1,66E-04 VAX2 ventral anterior homeobox 2 1,70E-04 TXNL2 thioredoxin-like 2 1,76E-04 EN1 engrailed homolog 1 1,79E-04 FBLN5 fibulin 5 1,86E-04 SNAP25 synaptosomal-associated protein, 25kDa 1,93E-04 Consensus includes gb:D50604 /DEF=Human beta-cytoplasmic actin (ACTBP9) pseudogene /FEA=CDS /DB_XREF=gi:2094759 2,02E-04 /UG=Hs.248007 Human beta-cytoplasmic actin (ACTBP9) pseudogene CDNA: FLJ23224 fis, clone ADSU02206 2,02E-04 ZAP128 peroxisomal long-chain acyl-coA thioesterase 2,04E-04 KIAA0317 KIAA0317 2,17E-04 SRR serine racemase 2,21E-04 CDC42EP1 CDC42 effector protein (Rho GTPase binding) 1 2,28E-04 LIMK2 LIM domain kinase 2 2,36E-04 RIS1 Ras-induced senescence 1 2,39E-04 HOMER1 homer homolog 1 (Drosophila) 2,43E-04 DLAT dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex) 2,44E-04 DNAJC12 DnaJ (Hsp40) homolog, subfamily C, member 12 2,45E-04 MAGED4 melanoma antigen, family D, 4 2,47E-04 UCHL1 ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) 2,62E-04 HOXB6 homeo box B6 2,65E-04 PSMC4 proteasome (prosome, macropain) 26S subunit, ATPase, 4 2,72E-04 RAB23 RAB23, member RAS oncogene family 2,75E-04 BMP1 bone morphogenetic protein 1 2,86E-04 FLJ10260 hypothetical protein FLJ10260 2,93E-04
223 7. SUPPLEMENT
Gene Symbol Gene Description Expression MARCKS myristoylated alanine-rich protein kinase C substrate 2,94E-04 BTD biotinidase 2,95E-04 FBLN1 fibulin 1 3,00E-04 ROR1 receptor tyrosine kinase-like orphan receptor 1 3,12E-04 MGC52022 Similar to RIKEN cDNA 1810038N08 gene 3,17E-04 ELTD1 EGF, latrophilin and seven transmembrane domain containing 1 3,18E-04 FLJ21308 hypothetical protein FLJ21308 3,28E-04 KRT17 keratin 17 3,57E-04 TNFRSF21 tumor necrosis factor receptor superfamily, member 21 3,70E-04 GGCX gamma-glutamyl carboxylase 4,07E-04 LOC254531 PlSC domain containing hypothetical protein 4,14E-04 KCNS3 potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 4,28E-04 DKFZp566C0 4,48E-04 424 putative MAPK activating protein PM20,PM21 BMP1 bone morphogenetic protein 1 4,49E-04 TFPI2 tissue factor pathway inhibitor 2 4,51E-04 ARHGAP22 Rho GTPase activating protein 22 4,54E-04 LRFN4 leucine rich repeat and fibronectin type III domain containing 4 4,58E-04 RABIF RAB interacting factor 4,64E-04 UBL5 ubiquitin-like 5 4,75E-04 ALOX15B arachidonate 15-lipoxygenase, second type 4,81E-04 CTNS cystinosis, nephropathic 4,85E-04 CDH2 cadherin 2, type 1, N-cadherin (neuronal) 4,85E-04 MMP28 matrix metalloproteinase 28 4,85E-04 ACAA2 acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase) 4,85E-04 ACTN3 actinin, alpha 3 4,86E-04 MIPEP mitochondrial intermediate peptidase 4,87E-04 C1orf38 chromosome 1 open reading frame 38 5,06E-04 LOC90355 hypothetical gene supported by AF038182; BC009203 5,08E-04 STMN1 stathmin 1/oncoprotein 18 5,21E-04 ASTN2 astrotactin 2 5,27E-04 KIAA0676 KIAA0676 protein 5,35E-04 BLOC1S1 biogenesis of lysosome-related organelles complex-1, subunit 1 5,41E-04 OPRS1 opioid receptor, sigma 1 5,69E-04 KIAA0676 KIAA0676 protein 6,02E-04 IFI16 interferon, gamma-inducible protein 16 6,30E-04 MARCKS myristoylated alanine-rich protein kinase C substrate 6,60E-04 DGKA diacylglycerol kinase, alpha 80kDa 6,62E-04 HSPH1 heat shock 105kDa/110kDa protein 1 6,87E-04 HSPA5BP1 heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1 6,88E-04 LPHN1 latrophilin 1 6,91E-04 FLJ11856 putative G-protein coupled receptor GPCR41 6,95E-04 ROD1 ROD1 regulator of differentiation 1 (S. pombe) 7,35E-04 LDB2 LIM domain binding 2 7,39E-04 MRPS11 mitochondrial ribosomal protein S11 7,66E-04 Clone 23718 mRNA sequence 7,74E-04 COL5A3 collagen, type V, alpha 3 7,96E-04 COL6A1 collagen, type VI, alpha 1 8,05E-04 OSBPL3 oxysterol binding protein-like 3 8,07E-04 GBP1 guanylate binding protein 1, interferon-inducible, 67kDa 8,35E-04 C18orf10 chromosome 18 open reading frame 10 8,95E-04 MMP19 matrix metalloproteinase 19 8,96E-04 BMP1 bone morphogenetic protein 1 9,75E-04 MME membrane metallo-endopeptidase (neutral endopeptidase, enkephalinase, CALLA, CD10) 9,75E-04 HAS1 hyaluronan synthase 1 1,00E-03
Table VI Genes, which were detected in more than 80% of hMSCs pellet samples on 18th day of differentiation and in less than 20% of normal cartilage samples (high hMSCs/low normal cartilage). In the table are given: gene symbol; description of the gene, relative expression value (hMSCs) and fold change (hMSCs/normal cartilage).
Gene Symbol Gene Description Expression Fold change TPM2 tropomyosin 2 (beta) 8,55E-08 4,473 HOMER3 homer homolog 3 (Drosophila) 1,35E-07 2,991 Similar to RIKEN cDNA 2900024C23 (LOC388650), mRNA 1,72E-07 3,716 HOXB7 homeo box B7 2,76E-07 11,12 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 4,53E-07 2,221 PDGFRB platelet-derived growth factor receptor, beta polypeptide 6,86E-07 8,48 PEA15 phosphoprotein enriched in astrocytes 15 6,86E-07 3,14 AP2S1 adaptor-related protein complex 2, sigma 1 subunit 8,03E-07 4,757 hypothetical protein MGC2198 9,02E-07 2,867 TALDO1 transaldolase 1 9,53E-07 2,757 C10orf56 chromosome 10 open reading frame 56 1,64E-06 3,561 HOXB7 homeo box B7 2,15E-06 8,861 AP2S1 adaptor-related protein complex 2, sigma 1 subunit 2,55E-06 4,325 RPL5 ribosomal protein L5 2,73E-06 3,206 WIG1 p53 target zinc finger protein 3,91E-06 6,348 MRPS12 mitochondrial ribosomal protein S12 4,26E-06 2,198 CORO1B coronin, actin binding protein, 1B 4,38E-06 2,17 ROD1 ROD1 regulator of differentiation 1 (S. pombe) 4,91E-06 3,351 FKBP1A FK506 binding protein 1A, 12kDa 5,07E-06 3,643 KPNA3 karyopherin alpha 3 (importin alpha 4) 5,75E-06 3,671 FKBP1A FK506 binding protein 1A, 12kDa 5,79E-06 4,275 DAPK3 death-associated protein kinase 3 5,88E-06 3,709 GCLM glutamate-cysteine ligase, modifier subunit 6,19E-06 8,745 ASNA1 arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) 6,93E-06 2,509 NQO1 NAD(P)H dehydrogenase, quinone 1 7,58E-06 6,892
224 7. SUPPLEMENT
Gene Symbol Gene Description Expression Fold change PGD phosphogluconate dehydrogenase 7,64E-06 4,544 RKHD1 ring finger and KH domain containing 1 8,01E-06 3,87 LAMC1 laminin, gamma 1 (formerly LAMB2) 8,25E-06 7,132 ADAM10 a disintegrin and metalloproteinase domain 10 1,00E-05 3,059 ADAM10 a disintegrin and metalloproteinase domain 10 1,11E-05 3,354 SH3GLB1 SH3-domain GRB2-like endophilin B1 1,13E-05 2,419 BICD2 bicaudal D homolog 2 (Drosophila) 1,28E-05 3,438 AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) 1,35E-05 2,33 MIRAB13 molecule interacting with Rab13 1,38E-05 3,892 PLOD3 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 1,43E-05 2,149 FLNA filamin A, alpha (actin binding protein 280) 1,47E-05 4,25 TXNRD1 thioredoxin reductase 1 1,48E-05 3,033 HEAB ATP/GTP-binding protein 1,74E-05 2,254 FLNA filamin A, alpha (actin binding protein 280) 1,74E-05 3,749 UROD uroporphyrinogen decarboxylase 1,88E-05 1,921 FKBP1A FK506 binding protein 1A, 12kDa 1,90E-05 3,64 CUGBP1 CUG triplet repeat, RNA binding protein 1 1,93E-05 1,812 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1 2,18E-05 2,686 BTN3A2 butyrophilin, subfamily 3, member A2 2,32E-05 3,406 HMGB3 high-mobility group box 3 2,43E-05 2,988 C21orf106 chromosome 21 open reading frame 106 2,57E-05 2,117 RAB31 RAB31, member RAS oncogene family 2,98E-05 12,74 ICMT isoprenylcysteine carboxyl methyltransferase 3,04E-05 2,356 MLP MARCKS-like protein 3,06E-05 9,716 RASL11B RAS-like, family 11, member B 3,19E-05 6,206 NUTF2 nuclear transport factor 2 3,55E-05 3,696 ZDHHC3 zinc finger, DHHC domain containing 3 3,73E-05 2,099 TAGLN transgelin 3,75E-05 90,53 TNFAIP1 tumor necrosis factor, alpha-induced protein 1 (endothelial) 4,03E-05 3,046 PSMD8 proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 4,04E-05 2,335 APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 4,11E-05 2,14 MAP4K4 mitogen-activated protein kinase kinase kinase kinase 4 4,20E-05 5,244 ITGB4BP integrin beta 4 binding protein 4,23E-05 2,007 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 4,58E-05 3,005 PFN1 profilin 1 4,60E-05 4,714 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide 4,86E-05 2,644 TPM1 tropomyosin 1 (alpha) 4,86E-05 8,243 RNH ribonuclease/angiogenin inhibitor 4,92E-05 2,178 SH3GLB1 SH3-domain GRB2-like endophilin B1 5,09E-05 2,179 NQO1 NAD(P)H dehydrogenase, quinone 1 5,26E-05 6,606 HMGA2 high mobility group AT-hook 2 5,28E-05 3,294 GALNT14 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14) 5,48E-05 2,869 MGAT4B mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B 5,71E-05 2,899 RAB5C RAB5C, member RAS oncogene family 6,04E-05 2,066 LPHN2 latrophilin 2 6,94E-05 3,417 MFAP5 microfibrillar associated protein 5 7,08E-05 20,05 CTSB cathepsin B 7,16E-05 4,152 HSPH1 heat shock 105kDa/110kDa protein 1 7,45E-05 3,352 POP5 processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) 7,52E-05 1,79 PPP1R7 protein phosphatase 1, regulatory subunit 7 7,52E-05 1,891 PLSCR3 phospholipid scramblase 3 7,62E-05 1,932 COPS8 COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis) 8,02E-05 2,324 ADD3 adducin 3 (gamma) 8,04E-05 3,829 ZNHIT1 zinc finger, HIT domain containing 1 8,16E-05 2,37 RAP2B RAP2B, member of RAS oncogene family 8,28E-05 2,319 RAB31 RAB31, member RAS oncogene family 8,31E-05 20,71 ATF7IP activating transcription factor 7 interacting protein 8,53E-05 2,718 SPOCK sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 8,58E-05 12,66 CDK4 cyclin-dependent kinase 4 8,60E-05 2,175 SIX2 sine oculis homeobox homolog 2 (Drosophila) 8,70E-05 1,516 MMD monocyte to macrophage differentiation-associated 8,90E-05 4,881 EI24 etoposide induced 2.4 mRNA 9,67E-05 2,188 SH3BP4 SH3-domain binding protein 4 9,72E-05 2,398 RPS27L ribosomal protein S27-like 9,85E-05 1,974 MAP1B microtubule-associated protein 1B 1,00E-04 9,867 MSF MLL septin-like fusion 1,03E-04 2,181 C10orf56 chromosome 10 open reading frame 56 1,15E-04 2,914 ACTR3 ARP3 actin-related protein 3 homolog (yeast) 1,17E-04 3,901 VCL vinculin 1,18E-04 3,535 LOC55831 30 kDa protein 1,18E-04 1,687 TCTEL1 t-complex-associated-testis-expressed 1-like 1 1,18E-04 2,243 OK/SW-cl.56 beta 5-tubulin 1,18E-04 2,669
225 7. SUPPLEMENT
Table VII showing genes detected as IL-1 up-regulated in hMSC during chondrogenic differentiation (absent/present analysis) In the table are given: gene symbol; the median of normalized expression values for each differentiation day (control and IL-1) and description of the gene.
Gene Symbol 0/c 0/IL 7/c 7/IL 11/c 11/IL 14/c 14/IL 18/c 18/IL 20/c 20/IL 33/c 33/IL 53/c 53/IL Description 213700_s_at 0 300 286 247 308 302 188 227 192 390 0 463 0 0 263 219 H.sapiens (xs157) mRNA, 315bp 216735_x_at 74 84 90 98 0 78 0 150 0 87 98 0 128 0 114 0 Sapiens cDNA: FLJ20900 fis, Homo sapiens transcribed sequence with moderate similarity to protein ref:NP_004563.1 (H.sapiens) plakophilin 222335_at 116 193 108 228 0 161 217 274 175 235 226 0 134 0 192 108 2 [Homo sapiens] ABR 453 386 436 404 0 353 468 0 383 542 363 504 417 480 422 514 active BCR-related gene ADIPOR2 1733 1991 1520 1699 0 1509 1437 1676 0 0 0 0 0 0 1924 1319 adiponectin receptor 2 AP1GBP1 0 0 0 0 0 784 760 703 0 0 0 958 0 0 0 0 AP1 gamma subunit binding protein 1 BAK1 612 560 489 474 0 412 705 0 580 729 619 606 449 0 485 669 BCL2-antagonist/killer 1 BIRC3 0 318 175 168 0 173 0 346 0 126 0 103 0 243 40 138 baculoviral IAP repeat-containing 3 BMP2K 88 63 84 51 0 77 79 0 0 42 90 83 100 58 104 0 BMP2 inducible kinase C10orf28 0 172 231 228 187 212 194 231 160 224 202 218 236 236 204 276 chromosome 10 open reading frame 28 C14orf116 0 470 684 869 0 705 733 847 876 0 0 780 948 814 803 0 chromosome 14 open reading frame 116 C3 0 1955 1049 1387 1796 2373 2899 4397 3994 8203 0 2966 0 0 1946 1708 complement component 3 C9orf127 579 370 654 691 0 692 679 582 806 825 838 915 820 788 726 665 chromosome 9 open reading frame 127 chaperone, ABC1 activity of bc1 complex CABC1 574 603 799 886 0 575 642 716 759 612 351 466 0 0 1064 826 like (S. pombe) CCL5 0 599 604 285 0 745 0 822 0 635 0 2087 0 1022 0 525 chemokine (C-C motif) ligand 5 CDC2L2 326 317 316 338 0 331 289 314 415 217 330 366 274 0 421 380 cell division cycle 2-like 2 CLDN14 0 244 425 683 267 331 156 0 529 603 594 768 1089 934 481 635 claudin 14 CXCL2 0 4202 861 1415 217 583 0 488 0 312 0 587 0 200 0 0 chemokine (C-X-C motif) ligand 2 CXCL3 0 2537 398 1434 0 433 0 308 0 95 0 277 0 0 0 0 chemokine (C-X-C motif) ligand 3 CXCL5 0 2059 254 1726 122 1127 80 2042 71 749 0 280 0 77 57 88 chemokine (C-X-C motif) ligand 5 CXCL5 0 654 952 1732 0 307 0 644 0 0 0 119 0 0 0 0 chemokine (C-X-C motif) ligand 5 DKFZP564M082 961 902 679 642 0 638 690 633 756 725 705 663 0 0 844 752 DKFZP564M082 protein DKFZP566K0524 145 151 86 117 0 98 78 153 199 149 132 115 160 132 163 119 DKFZP566K0524 protein likely ortholog of mouse ubiquitin- E2-230K 0 122 0 279 0 336 0 0 0 204 0 317 0 0 0 0 conjugating enzyme E2-230K EP400 582 576 532 636 0 437 460 0 0 389 641 535 565 0 507 579 E1A binding protein p400 EXOSC2 0 607 381 460 0 399 525 0 0 0 0 0 0 0 445 0 exosome component 2 EXOSC4 704 710 626 597 0 581 786 784 0 819 816 803 0 0 732 838 exosome component 4 FLJ10439 399 382 348 360 0 407 357 517 0 331 401 399 0 0 582 303 hypothetical protein FLJ10439 FLJ10853 437 644 723 667 0 786 682 726 0 0 0 620 0 0 0 666 hypothetical protein FLJ10853 FLJ13236 66 74 86 72 88 70 0 115 83 109 89 76 110 0 0 132 hypothetical protein FLJ13236 FLJ20152 0 0 382 634 0 640 0 704 0 0 0 0 0 0 644 771 hypothetical protein FLJ20152 FLJ22624 0 0 507 556 0 431 487 0 0 0 0 0 0 0 0 0 FLJ22624 protein FLJ23231 0 988 1365 1841 0 1333 582 1392 0 1198 0 1540 0 1002 0 987 hypothetical protein FLJ23231 FLJ23451 286 279 474 370 350 284 0 315 421 412 0 0 0 0 0 167 hypothetical protein FLJ23451 FNDC4 622 663 1255 1337 0 1070 985 1014 0 821 799 612 657 0 1195 963 fibronectin type III domain containing 4 GPD2 270 252 167 194 208 136 0 108 155 227 173 233 260 232 170 156 glycerol-3-phosphate dehydrogenase 2 HSPC049 219 0 0 375 0 363 441 0 0 0 0 0 0 0 0 0 HSPC049 protein ICAM1 0 1631 1224 1756 493 688 957 728 0 1533 545 2907 1083 5249 922 3274 intercellular adhesion molecule 1 (CD54), ICAM1 0 516 694 707 0 410 346 0 0 714 0 800 0 1427 341 1211 intercellular adhesion molecule 1 (CD54), IL1B 0 1016 1569 1656 0 419 0 0 0 0 0 0 0 0 0 0 interleukin 1, beta IL8 0 21966 10620 19210 493 6028 319 7676 0 3942 0 8265 0 2538 0 544 interleukin 8 IL8 0 13510 5820 8922 542 1871 0 1849 0 1278 0 3758 0 1208 0 332 interleukin 8 potassium voltage-gated channel, KCNG1 305 361 434 419 0 278 190 0 0 437 447 307 578 0 350 160 subfamily G, member 1 KIAA0240 477 393 674 601 0 558 468 0 0 0 0 514 518 0 500 390 KIAA0240 KIAA0376 1310 1153 916 904 0 958 941 941 0 919 821 870 704 0 947 1013 KIAA0376 protein KIAA0564 132 117 0 58 99 121 114 76 102 112 124 104 157 116 166 84 KIAA0564 protein KRT3 0 103 0 0 132 116 135 95 150 191 175 0 0 0 0 0 keratin 3 LOC51161 407 300 302 338 0 390 375 286 0 402 305 307 0 0 0 0 g20 protein hypothetical protein from EUROIMAGE LOC56926 510 560 304 0 0 196 274 0 207 322 251 223 0 0 452 251 2021883 matrix metalloproteinase 12 (macrophage MMP12 100 485 136 298 126 402 0 499 0 457 112 276 0 0 0 0 elastase) matrix metalloproteinase 3 (stromelysin 1, MMP3 0 1355 2657 6336 823 4267 965 2968 1117 2805 0 1365 0 1354 963 1616 progelatinase) membrane protein, palmitoylated 2 MPP2 0 0 689 645 0 522 0 0 0 0 0 535 0 0 0 0 (MAGUK p55 subfamily member 2) MSCP 0 118 156 151 0 125 133 151 105 155 0 197 0 130 127 155 mitochondrial solute carrier protein N-deacetylase/N-sulfotransferase NDST2 849 948 866 879 0 731 0 0 0 702 0 799 0 0 704 759 (heparan glucosaminyl) 2 transmembrane 4 superfamily member NET-7 0 120 205 185 312 516 318 503 328 385 494 371 493 514 579 271 tetraspan NET-7 non-imprinted in Prader-Willi/Angelman NIPA2 804 1002 558 554 0 623 435 351 0 520 758 727 1090 0 0 765 syndrome 2 PIGO 687 877 0 705 0 561 0 0 0 0 0 0 0 0 824 757 phosphatidylinositol glycan, class O PLCL2 139 108 130 83 138 103 0 157 75 159 157 130 120 165 124 131 phospholipase C-like 2 Ral GEF with PH domain and SH3 RALGPS2 82 106 66 95 0 91 81 0 78 0 69 97 106 116 0 84 binding motif 2 v-rel reticuloendotheliosis viral oncogene homolog B, nuclear factor of kappa light polypeptide gene enhancer in B-cells 3 RELB 165 395 666 771 0 515 399 588 0 422 201 556 0 422 0 458 (avian) RNA guanylyltransferase and 5'- RNGTT 273 275 222 269 211 317 0 201 312 0 326 292 248 189 276 0 phosphatase retinal outer segment membrane protein ROM1 0 0 188 151 0 163 165 163 0 0 0 0 0 0 99 0 1 SIN3 homolog B, transcriptional regulator SIN3B 297 287 444 474 0 366 172 0 0 334 0 383 0 0 0 253 (yeast) solute carrier family 11 (proton-coupled SLC11A2 0 1005 0 1066 0 946 0 0 0 0 0 989 0 0 0 0 divalent metal ion transporters), SLC25A28 285 307 387 512 0 407 393 383 376 478 311 645 0 363 288 419 solute carrier family 25, member 28 SPATA5L1 179 166 220 227 0 196 204 0 0 191 0 245 0 0 234 216 spermatogenesis associated 5-like 1 SV2A 363 463 252 445 0 376 491 0 364 564 525 547 0 0 466 353 synaptic vesicle glycoprotein 2A TBX21 220 0 226 241 499 179 0 243 0 0 247 0 0 0 273 0 T-box 21 TERE1 339 358 437 352 0 266 302 352 305 375 348 298 268 0 304 327 transitional epithelia response protein TULP3 784 735 713 679 0 580 581 595 487 508 668 673 589 444 515 489 tubby like protein 3
226 7. SUPPLEMENT
Table VIII showing genes detected as IL-1 up-regulated in hMSC during chondrogenic differentiation (T-test) In the table are given: gene symbol; relative fold change IL-1 vs. control for each differentiation day and description of the gene.
Gene Symbol 0d 7d 11d 14d 18d 20d 33d 53d Description 203973_s_at 1,1 1,3 1,4 1,1 1,1 4,2 2,0 1,0 KIAA0146 protein 213817_at 1,1 1,6 1,6 2,9 2,2 3,5 0,0 1,2 MRNA; cDNA DKFZp586B0220 (from clone DKFZp586B0220) Consensus includes gb:AL031602 /DEF=Human DNA sequence from 216336_x_at 1,9 0,9 1,3 1,3 1,9 2,8 1,2 1,1 clone RP5-1174N9 on chromosome 1p34.1-35.3. ACSL1 1,1 1,1 1,6 0,9 1,1 3,2 1,1 1,0 acyl-CoA synthetase long-chain family member 1 ACSL4 1,3 1,8 1,7 1,0 1,9 1,6 1,1 1,2 acyl-CoA synthetase long-chain family member 4 a disintegrin-like and metalloprotease (reprolysin type) with ADAMTS5 3,5 1,7 1,7 0,5 1,1 3,6 2,0 1,7 thrombospondin type 1 motif, 5 (aggrecanase-2) ADD3 0,9 1,1 1,0 1,0 1,0 1,7 2,4 1,6 adducin 3 (gamma) AKR1B1 1,8 1,3 1,8 1,4 1,3 2,4 2,1 1,6 aldo-keto reductase family 1, member B1 (aldose reductase) AP1G1 1,5 1,0 1,4 1,7 1,4 2,0 1,2 1,1 adaptor-related protein complex 1, gamma 1 subunit ASS 1,2 1,2 1,5 1,4 1,3 3,3 1,6 1,1 argininosuccinate synthetase BCL3 1,8 1,2 1,9 2,2 1,8 3,4 1,5 1,8 B-cell CLL/lymphoma 3 BLZF1 1,0 1,6 1,4 0,6 1,3 0,8 0,7 1,0 basic leucine zipper nuclear factor 1 (JEM-1) BMP2 1,6 1,2 1,3 0,6 1,9 2,0 1,4 2,2 bone morphogenetic protein 2 BMP2 0,0 1,3 0,8 0,1 2,4 2,6 1,5 2,0 bone morphogenetic protein 2 BNC1 1,4 1,0 0,9 0,9 1,0 0,8 1,0 0,9 basonuclin 1 C19orf13 1,0 1,1 1,3 1,1 1,2 1,1 1,0 1,0 chromosome 19 open reading frame 13 C1QTNF1 0,0 1,4 2,0 2,0 2,2 0,0 0,0 0,0 C1q and tumor necrosis factor related protein 1 C1R 1,1 1,1 1,3 1,4 1,7 1,7 1,6 1,2 complement component 1, r subcomponent C7orf25 0,9 1,2 1,2 0,7 1,8 1,0 1,0 1,1 chromosome 7 open reading frame 25 CA12 1,7 1,0 1,5 1,6 1,8 2,7 1,4 1,3 carbonic anhydrase XII CA12 2,0 1,2 1,8 1,8 1,7 3,4 1,3 1,2 carbonic anhydrase XII CA12 1,9 1,0 1,2 1,9 1,5 2,8 1,3 1,4 carbonic anhydrase XII CA12 1,8 1,0 1,4 1,6 1,4 1,9 1,2 1,1 carbonic anhydrase XII CCL2 13,0 0,0 2,1 3,1 0,0 0,0 0,0 0,0 chemokine (C-C motif) ligand 2 CGI-49 0,9 1,4 0,8 0,8 1,1 1,1 0,9 1,1 CGI-49 protein CH25H 6,6 0,3 0,8 1,6 2,7 5,5 2,8 2,5 cholesterol 25-hydroxylase CNOT2 0,9 1,0 1,3 0,8 1,2 0,8 1,0 1,1 CCR4-NOT transcription complex, subunit 2 CRSP9 0,8 1,1 0,9 0,7 1,2 0,8 1,2 1,1 cofactor required for Sp1 transcriptional activation, subunit 9, 33kDa CXCL13 0,0 1,2 1,6 2,8 1,2 6,4 0,0 0,7 chemokine (C-X-C motif) ligand 13 (B-cell chemoattractant) CXCL2 161,0 12,0 21,5 30,8 29,2 31,8 3,6 3,2 chemokine (C-X-C motif) ligand 2 CXCL5 0,0 6,8 9,2 25,6 10,5 0,0 0,0 1,5 chemokine (C-X-C motif) ligand 5 DHRS9 1,8 1,0 0,8 1,4 0,0 0,0 0,0 0,0 dehydrogenase/reductase (SDR family) member 9 EIF4B 1,1 0,8 1,2 1,5 1,3 1,0 0,8 1,0 eukaryotic translation initiation factor 4B [BLAST] ENC1 1,2 1,6 1,5 1,8 1,2 1,4 0,0 2,4 ectodermal-neural cortex (with BTB-like domain) ENC1 1,5 1,2 1,4 1,6 1,9 3,2 2,2 1,4 ectodermal-neural cortex (with BTB-like domain) EREG 2,1 2,7 1,6 0,5 2,3 4,1 4,9 2,7 epiregulin EXOSC9 1,0 1,2 1,0 0,5 1,7 0,9 0,7 1,3 exosome component 9 FBLN5 0,8 1,0 1,9 1,7 1,7 2,9 1,6 1,0 fibulin 5 FGF2 1,8 1,4 1,3 1,5 1,9 3,3 1,5 1,5 fibroblast growth factor 2 (basic) FLJ10055 1,3 1,1 1,4 1,0 1,4 1,5 0,8 1,2 hypothetical protein FLJ10055 FLJ10134 1,2 1,1 1,3 1,2 1,3 1,4 1,2 1,0 hypothetical protein FLJ10134 FLJ11259 3,6 1,1 1,3 1,2 1,5 2,2 2,1 1,6 hypothetical protein FLJ11259 FLJ13105 2,2 0,9 1,5 1,6 0,0 0,8 1,3 1,0 hypothetical protein FLJ13105 FLJ20507 0,9 1,2 1,3 0,8 1,0 1,2 0,9 0,9 hypothetical protein FLJ20507 FLJ20701 2,4 1,2 2,0 2,1 1,5 3,9 2,8 1,1 hypothetical protein FLJ20701 FTH1 1,4 1,1 1,6 1,6 1,6 2,9 2,4 1,5 ferritin, heavy polypeptide 1 G1P2 1,3 1,0 1,2 0,8 1,6 2,8 3,1 2,0 interferon, alpha-inducible protein (clone IFI-15K) G1P3 1,6 0,8 1,1 1,1 1,2 1,5 3,1 1,2 interferon, alpha-inducible protein (clone IFI-6-16) GCH1 3,1 1,4 2,5 1,5 2,1 6,8 5,0 3,0 GTP cyclohydrolase 1 (dopa-responsive dystonia) GFPT2 2,5 1,3 1,6 1,7 2,3 3,2 1,8 1,6 glutamine-fructose-6-phosphate transaminase 2 GPC1 0,7 1,4 1,2 1,1 0,9 0,9 0,8 0,9 glypican 1 HIST2H2AA 2,1 1,5 2,1 2,3 1,4 3,9 2,4 0,7 histone 2, H2aa HMGA1 0,9 1,0 1,3 1,0 1,4 0,8 0,3 0,8 high mobility group AT-hook 1 HOXA7 1,1 1,6 1,0 1,2 1,2 0,9 1,1 0,6 homeo box A7 HSD11B1 9,0 1,3 1,8 1,1 1,6 18,4 0,0 2,8 hydroxysteroid (11-beta) dehydrogenase 1 ICAM1 0,0 1,4 1,4 0,8 0,0 5,3 4,8 3,6 intercellular adhesion molecule 1 (CD54), human rhinovirus receptor ICAM1 4,8 1,3 1,8 3,4 3,8 4,1 4,3 3,3 intercellular adhesion molecule 1 (CD54), human rhinovirus receptor IER3 2,7 1,0 1,5 3,3 2,3 2,2 1,9 1,9 immediate early response 3 IFITM1 1,1 1,2 1,3 1,9 1,7 2,0 2,3 1,3 interferon induced transmembrane protein 1 (9-27) IL11 1,8 1,0 2,1 1,8 1,3 3,0 0,0 0,0 interleukin 11 IL6 9,2 1,9 2,8 2,2 11,0 20,7 7,3 6,8 interleukin 6 (interferon, beta 2) KAI1 2,6 1,3 1,1 0,8 2,1 1,7 3,3 1,4 kangai 1 (suppression of tumorigenicity 6, prostate; CD82 antigen
227 7. SUPPLEMENT
Gene Symbol 0d 7d 11d 14d 18d 20d 33d 53d Description KIAA1102 1,6 1,7 2,4 1,5 1,8 2,6 2,3 1,7 KIAA1102 protein KYNU 0,0 1,1 2,2 2,0 4,4 6,9 4,2 4,6 kynureninase (L-kynurenine hydrolase) lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte LCP2 1,0 1,4 0,8 0,3 1,6 2,3 3,6 2,2 protein of 76kDa) LGALS8 1,2 1,1 1,4 1,0 1,1 1,2 1,1 1,1 lectin, galactoside-binding, soluble, 8 (galectin 8) LRIG1 3,9 1,1 1,2 1,4 1,2 1,6 0,8 1,0 leucine-rich repeats and immunoglobulin-like domains 1 MAFF 2,0 1,3 1,6 2,4 3,0 2,9 1,6 2,2 v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) MAP2K1 1,2 0,9 1,3 1,4 1,3 1,2 0,8 0,9 mitogen-activated protein kinase kinase 1 MAPKAPK2 1,0 1,2 1,2 1,4 1,1 1,2 1,0 1,0 mitogen-activated protein kinase-activated protein kinase 2 MMP1 17,5 0,9 0,8 3,7 8,3 17,7 20,6 3,4 matrix metalloproteinase 1 (interstitial collagenase) MMP3 0,0 2,4 5,2 3,1 2,5 0,0 0,0 1,7 matrix metalloproteinase 3 (stromelysin 1, progelatinase) MRPS14 0,9 1,0 1,3 0,7 1,1 1,2 1,1 1,0 mitochondrial ribosomal protein S14 MSCP 0,9 1,3 1,3 1,5 1,9 2,3 1,5 1,4 mitochondrial solute carrier protein MT1F 2,7 1,5 1,9 1,7 1,9 3,6 1,6 0,8 metallothionein 1F (functional) MT1F 2,7 1,3 1,8 2,1 1,5 3,7 1,4 1,0 metallothionein 1F (functional) MT1G 1,9 1,0 0,7 2,6 1,4 2,6 1,1 1,2 metallothionein 1G MT1H 1,2 0,8 1,2 1,3 1,3 2,2 0,8 0,7 metallothionein 1H MT1K 2,9 1,2 3,5 3,7 1,3 3,6 2,4 1,0 metallothionein 1K MT1X 2,0 0,9 1,1 1,2 1,6 2,2 1,1 1,2 metallothionein 1X MT1X 1,5 0,9 1,0 1,2 1,6 2,1 1,2 1,3 metallothionein 1X MT2A 2,5 1,1 1,5 1,8 1,9 3,2 1,1 1,1 metallothionein 2A MYO10 0,8 0,9 1,3 1,5 1,5 1,0 0,6 1,0 myosin X NAB1 3,0 1,4 1,6 1,3 1,4 1,7 1,4 1,2 NGFI-A binding protein 1 (EGR1 binding protein 1) NAGA 0,9 0,7 1,0 0,7 1,0 1,3 1,0 0,6 N-acetylgalactosaminidase, alpha- NALP1 1,5 1,2 1,0 0,9 1,1 1,3 1,0 1,0 NACHT, leucine rich repeat and PYD containing 1 NAV2 2,5 1,1 1,4 0,9 1,6 1,0 1,2 1,0 neuron navigator 2 NDUFB8 1,0 1,1 0,9 1,1 2,0 1,0 0,8 0,8 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa NFE2L1 1,5 1,1 1,2 1,4 1,5 1,9 1,6 1,2 nuclear factor (erythroid-derived 2)-like 1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 NFKB2 1,9 1,1 1,3 0,9 1,4 2,3 1,6 1,8 (p49/p100) nuclear factor of kappa light polypeptide gene enhancer in B-cells NFKBIA 4,1 1,7 1,8 1,6 2,5 6,0 7,1 2,3 inhibitor, alpha NMB 4,7 1,1 1,4 1,3 1,8 2,8 1,6 1,2 neuromedin B NMT1 0,9 1,4 1,0 1,4 1,0 1,4 0,0 0,8 N-myristoyltransferase 1 NOTCH2 1,5 1,1 1,1 1,1 1,0 1,1 0,9 0,9 Notch homolog 2 (Drosophila) NP220 1,2 1,2 1,4 1,2 1,4 1,4 0,9 1,1 NP220 nuclear protein NPAS2 1,2 1,4 2,1 1,8 1,1 1,8 0,8 0,9 neuronal PAS domain protein 2 NRCAM 0,0 1,9 2,3 2,2 1,6 0,0 0,0 0,8 neuronal cell adhesion molecule PAK1IP1 0,9 1,2 1,6 1,1 1,7 0,7 1,2 1,0 PAK1 interacting protein 1 PBEF1 5,2 2,1 4,1 3,9 3,4 6,9 1,7 1,7 pre-B-cell colony enhancing factor 1 PBEF1 4,8 1,8 3,3 3,5 3,7 6,5 1,5 2,1 pre-B-cell colony enhancing factor 1 PHLDA1 1,5 1,1 1,3 0,9 1,7 0,9 0,7 1,1 pleckstrin homology-like domain, family A, member 1 phosphatidylinositol glycan, class A (paroxysmal nocturnal PIGA 1,1 1,1 1,5 0,8 1,4 1,1 0,7 0,9 hemoglobinuria) PPIA 1,5 1,4 1,1 1,2 1,6 0,8 1,3 0,9 peptidylprolyl isomerase A (cyclophilin A) PRG1 1,0 1,2 1,2 1,4 1,3 3,8 3,1 1,8 proteoglycan 1, secretory granule PTBP1 1,1 1,0 1,1 1,1 1,7 1,0 1,1 0,9 polypyrimidine tract binding protein 1 PTGER4 2,0 1,2 1,6 1,4 1,8 2,0 1,3 1,2 prostaglandin E receptor 4 (subtype EP4) PTGES 1,8 1,2 1,1 1,1 1,9 3,3 1,5 2,3 prostaglandin E synthase PTPNS1 1,4 1,3 1,6 1,4 1,3 1,7 1,6 1,2 protein tyrosine phosphatase, non-receptor type substrate 1 PTX3 1,5 1,3 2,7 4,6 2,7 7,2 6,7 2,1 pentaxin-related gene, rapidly induced by IL-1 beta RDBP 0,8 1,0 1,4 0,7 1,1 0,9 0,8 1,1 RD RNA binding protein RNF121 0,9 0,8 1,2 1,4 0,6 1,3 1,5 0,9 ring finger protein 121 solute carrier family 11 (proton-coupled divalent metal ion SLC11A2 2,0 1,4 2,1 1,9 1,9 1,8 1,3 1,5 transporters), member 2 SLC35A2 1,0 1,5 1,4 0,8 1,0 0,8 0,8 0,8 solute carrier family 35 (UDP-galactose transporter), member A2 SLC39A14 1,9 1,2 2,0 3,0 2,5 2,0 1,8 1,4 solute carrier family 39 (zinc transporter), member 14 SLC39A8 2,2 2,1 2,7 5,8 2,8 4,3 3,0 2,2 solute carrier family 39 (zinc transporter), member 8 SLC39A8 2,3 1,7 2,6 1,3 2,4 3,8 2,4 1,9 solute carrier family 39 (zinc transporter), member 8 SOD2 15,0 1,6 3,9 8,3 9,5 15,7 11,9 7,6 superoxide dismutase 2, mitochondrial SOD2 12,9 1,8 3,8 7,9 7,3 8,8 10,6 6,9 superoxide dismutase 2, mitochondrial SOD2 13,1 1,7 2,8 6,5 4,0 7,6 7,9 5,0 superoxide dismutase 2, mitochondrial SQRDL 1,3 1,1 1,4 1,7 1,5 2,5 1,8 1,5 sulfide quinone reductase-like (yeast) serum response factor (c-fos serum response element-binding SRF 0,7 1,0 0,0 1,5 1,0 0,0 0,0 0,0 transcription factor) STEAP 2,3 1,3 1,8 2,3 2,1 2,8 1,6 1,3 six transmembrane epithelial antigen of the prostate SVIL 1,6 1,2 1,1 1,1 1,2 1,2 1,2 1,1 supervillin TBC1D3 1,1 1,2 1,1 2,4 0,9 1,5 0,7 1,0 TBC1 domain family, member 3 TFPI2 10,5 1,1 1,2 0,6 4,3 2,5 1,4 2,2 tissue factor pathway inhibitor 2 TFPI2 7,9 1,0 1,4 1,1 3,0 2,9 1,0 1,6 tissue factor pathway inhibitor 2 TNFAIP3 4,2 2,1 1,7 2,4 1,6 1,7 1,4 1,3 tumor necrosis factor, alpha-induced protein 3
228 7. SUPPLEMENT
Gene Symbol 0d 7d 11d 14d 18d 20d 33d 53d Description TNFAIP3 3,2 1,7 2,5 2,8 2,7 3,3 2,4 1,9 tumor necrosis factor, alpha-induced protein 3 TNFAIP6 7,4 2,0 2,8 9,3 2,0 2,5 2,4 2,9 tumor necrosis factor, alpha-induced protein 6 TNFAIP6 6,6 1,9 2,9 8,1 1,9 1,5 1,7 1,9 tumor necrosis factor, alpha-induced protein 6 TNFAIP8 2,5 1,3 1,5 1,0 1,7 3,1 2,9 2,0 tumor necrosis factor, alpha-induced protein 8 TNFSF10 1,6 1,8 2,2 1,5 1,9 1,3 1,9 1,8 tumor necrosis factor (ligand) superfamily, member 10 TNIP1 1,7 1,2 1,7 1,4 1,9 2,5 1,9 1,3 TNFAIP3 interacting protein 1 TRIB1 2,1 0,9 1,1 1,1 1,1 1,0 1,0 1,0 tribbles homolog 1 (Drosophila) ubiquitin protein ligase E3A (human papilloma virus E6-associated UBE3A 1,1 1,0 1,3 0,9 1,3 0,9 0,7 0,8 protein, Angelman syndrome) USP24 0,9 1,2 0,9 1,2 1,6 0,6 0,3 1,1 ubiquitin specific protease 24 VCAM1 1,3 0,9 1,2 1,2 2,2 3,4 3,3 3,1 vascular cell adhesion molecule 1 WTAP 2,8 1,3 1,8 1,8 2,3 2,7 2,4 1,7 Wilms tumor 1 associated protein WTAP 3,0 1,4 1,5 2,1 1,6 3,0 2,3 1,8 Wilms tumor 1 associated protein
Table IX showing genes detected as IL-1 down-regulated in hMSC during chondrogenic differentiation (absent/present analysis) In the table are given: gene symbol; the median of normalized expression values for each differentiation day (control and IL-1) and description of the gene.
Gene Symbol 0/c 0/IL 7/c 7/IL 11/c 11/IL 14/c 14/IL 18/c 18/IL 20/c 20/IL 33/c 33/IL 53/c 53/IL Description RARG 623 0 0 0 0 0 0 0 0 0 864 786 770 0 833 0 retinoic acid receptor, gamma TLL1 43 0 52 72 65 0 0 0 0 0 0 0 46 0 0 47 tolloid-like 1 pleckstrin homology, Sec7 and PSCD3 246 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 coiled-coil domains 3 gelsolin (amyloidosis, Finnish GSN 916 0 1394 1102 1565 1514 2278 2141 3697 1949 2324 1390 2993 2153 2201 1610 type) glycine amidinotransferase (L- arginine:glycine GATM 110 146 125 0 112 92 100 113 117 0 210 0 0 0 131 128 amidinotransferase) D4, zinc and double PHD fingers, DPF3 263 235 304 0 347 344 290 327 293 189 382 0 0 257 0 241 family 3 CENTB2 58 0 0 104 113 0 0 120 0 0 140 0 0 0 0 0 centaurin, beta 2 collagen, type IV, alpha 3 COL4A3 54 66 42 86 68 0 77 76 0 103 62 78 0 55 54 111 (Goodpasture antigen)
Table X showing genes detected as IL-1 down-regulated in hMSC during chondrogenic differentiation (T test) In the table are given: gene symbol; relative fold change IL-1 vs. control for each differentiation day and description of the gene.
Gene Symbol 0d 7d 11d 14d 18d 20d 33d 53d Description ACSL5 0,0 0,7 1,0 1,0 1,2 0,0 0,0 1,0 acyl-CoA synthetase long-chain family member 5 ALDH7A1 0,8 0,9 1,1 0,7 1,0 0,9 1,1 1,1 aldehyde dehydrogenase 7 family, member A1 ARID4B 0,9 1,2 0,7 0,9 1,1 0,8 1,0 1,0 AT rich interactive domain 4B (RBP1- like) C3AR1 0,0 0,9 1,0 1,4 1,8 2,4 3,6 1,2 complement component 3a receptor 1 CAMKK2 0,7 1,0 0,9 0,8 1,0 0,9 1,1 1,0 calcium/calmodulin-dependent protein kinase kinase 2, beta CELSR2 1,2 0,7 0,7 1,2 1,1 1,2 1,8 1,3 cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) CGI-41 1,0 0,7 0,7 1,0 2,2 1,0 0,8 0,8 CGI-41 protein CGI-48 0,6 0,8 0,7 0,0 1,5 0,0 0,0 0,0 CGI-48 protein DNCLI1 0,9 0,8 0,9 0,7 1,0 1,0 0,8 0,9 dynein, cytoplasmic, light intermediate polypeptide 1 DOK1 0,8 1,1 1,0 0,8 0,9 1,1 0,6 0,9 docking protein 1, 62kDa (downstream of tyrosine kinase 1) DSPP 1,2 0,9 0,5 1,1 0,5 1,3 1,5 0,9 dentin sialophosphoprotein F2RL1 1,2 0,7 1,2 0,5 0,9 0,3 0,6 0,8 coagulation factor II (thrombin) receptor-like 1 FKBP1A 0,9 1,1 1,0 0,7 0,9 1,0 0,8 0,9 FK506 binding protein 1A, 12kDa GAP43 0,7 1,0 0,4 0,3 1,0 0,4 0,6 0,7 growth associated protein 43 GPR12 0,0 0,8 0,5 0,9 1,0 0,8 1,3 0,0 G protein-coupled receptor 12 HNRPH3 1,0 1,0 1,0 0,7 1,0 0,8 0,9 0,9 heterogeneous nuclear ribonucleoprotein H3 (2H9) HOM-TES-103 0,6 0,8 1,1 1,0 0,9 1,1 1,1 1,1 HOM-TES-103 tumor antigen-like KIAA0830 0,5 0,8 0,9 0,7 0,8 0,6 0,7 0,7 KIAA0830 protein LDB2 0,6 0,7 0,9 0,5 0,9 0,7 0,5 0,0 LIM domain binding 2 LRRC2 0,8 0,5 1,1 0,9 0,6 0,0 0,0 0,7 leucine rich repeat containing 2 MAPKAPK3 0,8 0,8 1,0 0,6 1,4 0,9 0,0 1,8 mitogen-activated protein kinase-activated protein kinase 3 MTAP 1,0 0,9 0,7 1,0 0,8 1,0 1,3 1,2 methylthioadenosine phosphorylase MUS81 1,0 0,7 0,9 0,9 1,0 1,0 1,0 1,0 MUS81 endonuclease homolog (yeast) MYO6 1,0 0,8 1,1 0,7 0,9 0,7 0,9 0,9 myosin VI NARG2 1,0 1,0 0,9 0,7 0,9 1,0 0,7 1,1 NMDA receptor-regulated gene 2 NDRG3 0,9 0,9 1,1 0,7 0,8 1,0 0,9 0,9 NDRG family member 3 NOV 0,7 1,0 1,1 1,2 0,8 0,4 0,4 0,9 nephroblastoma overexpressed gene PLCL1 1,2 0,6 0,9 0,4 0,5 0,7 1,8 0,9 phospholipase C-like 1 RAB14 0,9 1,1 1,2 0,7 1,0 1,0 0,9 0,9 RAB14, member RAS oncogene family RNGTT 0,9 0,8 1,0 0,5 1,1 0,8 0,9 1,0 RNA guanylyltransferase and 5'-phosphatase S100A1 0,0 0,0 0,0 0,0 0,0 0,0 0,3 0,3 S100 calcium binding protein A1 SBNO1 1,0 0,5 0,8 0,0 0,8 0,9 0,3 0,0 sno, strawberry notch homolog 1 (Drosophila) SRY (sex determining region Y)-box 9 (campomelic dysplasia, autosomal sex- 0,9 0,9 0,7 0,6 1,0 1,0 0,7 0,7 SOX9 reversal) SSR3 1,0 0,9 1,1 0,9 0,3 0,9 0,9 1,2 signal sequence receptor, gamma (translocon-associated protein gamma) T1A-2 0,0 0,0 1,6 0,0 0,0 0,0 4,0 2,4 lung type-I cell membrane-associated glycoprotein
229 7. SUPPLEMENT
Table XI Genes which were IL-1 up-regulated in human OA chondrocytes In the table are given: gene symbol (or Affymetrix identifier); relative expression values and description of the gene. Symbol control IL1B IL1B+1400W IL1B+191023 Description ABCC1 5569 13600 10660 12060 ATP-binding cassette, sub-family C (CFTR/MRP), member 1 ABTB2 1231 2796 2121 2347 ankyrin repeat and BTB (POZ) domain containing 2 ACSL3 2813 4989 4659 4349 acyl-CoA synthetase long-chain family member 3 ADORA2A 424 9010 8425 8307 adenosine A2a receptor ADSSL1 0 340 422 0 adenylosuccinate synthase like 1 AFURS1 3988 13010 12840 12940 ATPase family homolog up-regulated in senescence cells AGMAT 0 168 0 176 agmatine ureohydrolase (agmatinase) AGRN 400 890 830 1013 agrin AKR1C1 0 552 465 616 aldo-keto reductase family 1, member C1 AKR1C1 2932 8759 7352 8508 aldo-keto reductase family 1, member C1 ALCAM 968 2959 3392 3523 activated leukocyte cell adhesion molecule ALCAM 252 644 947 738 activated leukocyte cell adhesion molecule AMIGO2 797 12613 14600 15180 amphoterin induced gene 2 AMPD3 0 323 329 380 adenosine monophosphate deaminase (isoform E) AMPD3 2183 9343 7272 8217 adenosine monophosphate deaminase (isoform E) ANKRD12 1092 2603 2640 2427 ankyrin repeat domain 12 ANKRD6 414 693 582 669 ankyrin repeat domain 6 AOC2 991 2547 1931 2095 amine oxidase, copper containing 2 (retina-specific) APBA3 1390 2232 1994 1922 amyloid beta (A4) precursor protein-binding, family A, member 3 (X11-like 2) APOL3 838 1512 1186 1359 apolipoprotein L, 3 ARHGAP24 0 363 374 336 Rho GTPase activating protein 24 ARHGAP24 0 323 384 503 Rho GTPase activating protein 24 ARL4A 524 1125 1363 1217 ADP-ribosylation factor-like 4A ARRDC2 876 1534 1452 1545 arrestin domain containing 2 ATP2B1 6961 24060 27510 24470 ATPase, Ca++ transporting, plasma membrane 1 ATP2B1 1439 8558 8958 8809 ATPase, Ca++ transporting, plasma membrane 1 ATP2B1 2502 15620 16730 16440 ATPase, Ca++ transporting, plasma membrane 1 AXIN2 804 3032 2431 2597 axin 2 (conductin, axil) B3GNT5 0 517 594 738 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 B3GNT7 857 1900 1656 1761 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7 B3GNT7 987 1742 1734 1528 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7 BACH1 1220 4491 3337 3807 BTB and CNC homology 1, basic leucine zipper transcription factor 1 BCL11A 0 124 0 0 B-cell CLL/lymphoma 11A (zinc finger protein) BCL2A1 2481 32523 34578 34090 BCL2-related protein A1 BDKRB1 1215 2303 1692 1626 bradykinin receptor B1 BID 394 977 1381 1141 BH3 interacting domain death agonist BIRC2 8136 23110 20540 21150 baculoviral IAP repeat-containing 2 BIRC3 2937 26290 23769 20303 baculoviral IAP repeat-containing 3 BIRC3 577 3480 3881 3580 baculoviral IAP repeat-containing 3 BMP6 2102 3570 4209 3824 bone morphogenetic protein 6 BNIP3 19651 41370 24213 27148 BCL2/adenovirus E1B 19kDa interacting protein 3 BNIP3L 11740 24750 13090 14680 BCL2/adenovirus E1B 19kDa interacting protein 3-like BTBD7 0 209 238 274 BTB (POZ) domain containing 7 BTG2 1970 3387 4068 4266 BTG family, member 2 BTG3 7797 18220 22681 19714 BTG family, member 3 BTG3 5381 12260 14545 14370 BTG family, member 3 C10orf46 1662 3642 3712 3432 chromosome 10 open reading frame 46 C10orf59 0 124 124 0 chromosome 10 open reading frame 59 C10orf72 0 466 382 310 chromosome 10 open reading frame 72 C12orf22 1267 2241 2225 2339 chromosome 12 open reading frame 22 C15orf21 826 3724 2967 2598 chromosome 15 open reading frame 21 C1orf24 1859 6046 6389 5986 chromosome 1 open reading frame 24 C1orf24 592 1758 1530 1674 chromosome 1 open reading frame 24 C1QTNF1 855 2986 3858 3366 C1q and tumor necrosis factor related protein 1 C1QTNF1 328 1143 1217 1187 C1q and tumor necrosis factor related protein 1 C20orf139 2774 4650 3010 4273 chromosome 20 open reading frame 139 C20orf42 0 311 233 255 chromosome 20 open reading frame 42 C20orf42 0 483 525 0 chromosome 20 open reading frame 42 C6orf105 1095 4725 3385 4306 chromosome 6 open reading frame 105 C6orf60 0 178 0 173 chromosome 6 open reading frame 60 C8orf1 1923 6461 6362 6057 chromosome 8 open reading frame 1 C8orf1 787 2022 1815 1588 chromosome 8 open reading frame 1 C9orf16 4171 8398 8971 9003 chromosome 9 open reading frame 16 CALM1 15660 26680 25796 28092 calmodulin 1 (phosphorylase kinase, delta) CALM1 5192 11913 12674 11770 calmodulin 1 (phosphorylase kinase, delta) CALM1 12189 19528 19470 17810 calmodulin 1 (phosphorylase kinase, delta) CARD15 289 1649 1187 1059 caspase recruitment domain family, member 15 CAV1 9877 35426 25319 24707 caveolin 1, caveolae protein, 22kDa CAV1 2105 11950 8062 8281 caveolin 1, caveolae protein, 22kDa CAV2 5565 16160 15080 16896 caveolin 2 CAV2 1886 4107 3913 3601 caveolin 2
230 7. SUPPLEMENT
Symbol control IL1B IL1B+1400W IL1B+191023 Description CBR3 1228 3166 2056 2607 carbonyl reductase 3 CCL3 356 27600 34042 30473 chemokine (C-C motif) ligand 3 CCL4 0 10769 16360 17090 chemokine (C-C motif) ligand 4 CCL5 600 10800 11750 10528 chemokine (C-C motif) ligand 5 CCL5 644 13470 15780 15974 chemokine (C-C motif) ligand 5 CCL8 0 485 792 566 chemokine (C-C motif) ligand 8 CCNA1 0 315 628 477 cyclin A1 CCNI 0 197 174 199 cyclin I CD44 6398 18600 17870 17425 CD44 antigen (homing function and Indian blood group system) CD44 9032 18409 16995 16930 CD44 antigen (homing function and Indian blood group system) CD44 15171 32429 29505 30030 CD44 antigen (homing function and Indian blood group system) CD44 7791 12770 12358 12338 CD44 antigen (homing function and Indian blood group system) CDK6 0 615 500 552 cyclin-dependent kinase 6 CDK6 379 968 861 1043 cyclin-dependent kinase 6 CDKN1A 3554 7398 5686 6006 cyclin-dependent kinase inhibitor 1A (p21, Cip1) CEBPG 1023 1638 1853 1733 CCAAT/enhancer binding protein (C/EBP), gamma CFLAR 2095 3681 4022 3735 CASP8 and FADD-like apoptosis regulator CGGBP1 1563 2623 2123 2259 CGG triplet repeat binding protein 1 CHST11 427 1203 1128 1194 carbohydrate (chondroitin 4) sulfotransferase 11 CHST11 1212 2787 2190 2532 carbohydrate (chondroitin 4) sulfotransferase 11 CHUK 989 1407 1659 1608 conserved helix-loop-helix ubiquitous kinase CLC 1091 2818 2964 3067 cardiotrophin-like cytokine CMKOR1 9076 35603 34220 30208 chemokine orphan receptor 1 CNNM4 0 483 378 376 cyclin M4 COLEC12 6393 12040 11270 11010 collectin sub-family member 12 CPAMD8 1074 2074 1754 1882 C3 and PZP-like, alpha-2-macroglobulin domain containing 8 CPD 4402 6878 7242 7367 carboxypeptidase D CPEB2 1472 3739 4668 4822 cytoplasmic polyadenylation element binding protein 2 CSF1 0 666 723 518 colony stimulating factor 1 (macrophage) CSF1 12880 34860 23375 24790 colony stimulating factor 1 (macrophage) CSF1 1908 5285 3247 4176 colony stimulating factor 1 (macrophage) CSF2 0 1901 2167 1656 colony stimulating factor 2 (granulocyte-macrophage) CSF3 0 3245 4945 4751 colony stimulating factor 3 (granulocyte) CTSS 1484 5804 5624 5815 cathepsin S CTSS 540 2157 2339 2018 cathepsin S CTSS 2116 5579 6448 5554 cathepsin S CXCL2 5008 77048 69804 74797 chemokine (C-X-C motif) ligand 2 CXCL2 28695 104510 109744 106954 chemokine (C-X-C motif) ligand 2 CXCL3 1527 65780 51993 49516 chemokine (C-X-C motif) ligand 3 CXCL5 1924 15650 23410 19530 chemokine (C-X-C motif) ligand 5 CXCL6 13380 39490 48199 40720 chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) CXCR4 0 668 277 357 chemokine (C-X-C motif) receptor 4 CYB5R2 1210 3641 3945 3465 cytochrome b5 reductase b5R.2 CYLD 0 436 446 387 cylindromatosis (turban tumor syndrome) CYLD 1140 2806 2518 2590 cylindromatosis (turban tumor syndrome) CYLD 754 2350 2020 1946 cylindromatosis (turban tumor syndrome) CYLD 1547 3980 3354 4072 cylindromatosis (turban tumor syndrome) CYP3A5 297 4007 3690 3757 cytochrome P450, family 3, subfamily A, polypeptide 5 CYP3A5 301 3828 3782 3495 cytochrome P450, family 3, subfamily A, polypeptide 5 CYP3A5 234 2427 3162 2765 cytochrome P450, family 3, subfamily A, polypeptide 5 CYP7B1 145 390 896 668 cytochrome P450, family 7, subfamily B, polypeptide 1 DAAM1 1146 2124 2055 2071 dishevelled associated activator of morphogenesis 1 DAAM1 818 1292 1318 1381 dishevelled associated activator of morphogenesis 1 DAPK3 0 312 366 200 death-associated protein kinase 3 DKFZP564O0823 1109 1820 2312 2571 DKFZP564O0823 protein DOCK4 459 1136 1319 1288 dedicator of cytokinesis 4 DRCTNNB1A 0 344 421 373 down-regulated by Ctnnb1, a DRCTNNB1A 703 1494 1097 1284 down-regulated by Ctnnb1, a diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth 646 3572 3732 3426 DTR factor) DTX2 0 900 963 911 deltex homolog 2 (Drosophila) DUSP10 896 1967 2380 2461 dual specificity phosphatase 10 DUSP16 629 1243 1162 1270 dual specificity phosphatase 16 DUSP5 1436 3910 3027 2992 dual specificity phosphatase 5 EGLN1 1881 4126 2820 2712 egl nine homolog 1 (C. elegans) EGLN1 6731 11978 7354 7800 egl nine homolog 1 (C. elegans) EGLN3 622 1164 517 407 egl nine homolog 3 (C. elegans) EHD1 0 475 404 588 EH-domain containing 1 EHD1 507 1719 1746 1642 EH-domain containing 1 EHD1 561 2351 2856 2654 EH-domain containing 1 EHD1 703 2228 2729 2708 EH-domain containing 1 EHD1 383 1301 1715 1787 EH-domain containing 1 EIF5 8514 11430 9996 10670 eukaryotic translation initiation factor 5 ELF3 414 1158 1319 1233 E74-like factor 3 (ets domain transcription factor, epithelial-specific ) ELF3 603 1256 1362 1341 E74-like factor 3 (ets domain transcription factor, epithelial-specific )
231 7. SUPPLEMENT
Symbol control IL1B IL1B+1400W IL1B+191023 Description ELF3 1037 2710 2780 2639 E74-like factor 3 (ets domain transcription factor, epithelial-specific ) ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, 0 208 249 240 ELOVL5 SUR4/Elo3-like, yeast) ELOVL7 428 4462 5642 5061 ELOVL family member 7, elongation of long chain fatty acids (yeast) EML1 1233 2185 2379 2597 echinoderm microtubule associated protein like 1 ENO2 3068 10580 2704 3681 enolase 2 (gamma, neuronal) EPHB2 0 774 657 645 EphB2 EPHB2 0 861 895 1085 EphB2 EPHB2 0 436 370 456 EphB2 EPS15L1 0 231 290 269 epidermal growth factor receptor pathway substrate 15-like 1 EPS8L2 939 1987 2007 1996 EPS8-like 2 EREG 709 16220 18884 17480 epiregulin ERO1L 1528 3093 1446 1758 ERO1-like (S. cerevisiae) ESM1 260 2933 2579 2789 endothelial cell-specific molecule 1 ESPL1 356 837 733 833 extra spindle poles like 1 (S. cerevisiae) ETV5 0 427 440 0 ets variant gene 5 (ets-related molecule) EVC 0 312 0 279 Ellis van Creveld syndrome F3 0 542 475 434 coagulation factor III (thromboplastin, tissue factor) FAD104 5557 9409 8510 8272 FAD104 FBLN5 0 2476 2131 2329 fibulin 5 FBN2 0 364 371 355 fibrillin 2 (congenital contractural arachnodactyly) FBXO42 380 599 460 565 F-box protein 42 FGF18 0 406 481 460 fibroblast growth factor 18 FGF18 0 345 415 354 fibroblast growth factor 18 FGF18 215 1439 1681 1643 fibroblast growth factor 18 FGF2 3175 13165 15120 15554 fibroblast growth factor 2 (basic) FGF2 7060 22660 26580 24979 fibroblast growth factor 2 (basic) FKSG87 134 4694 4493 4466 FKSG87 protein FLJ11196 2783 6119 6041 6023 acheron FLJ11259 3594 8385 8291 8376 hypothetical protein FLJ11259 FLJ12886 514 758 563 665 hypothetical protein FLJ12886 FLJ13105 612 6907 5159 6146 hypothetical protein FLJ13105 FLJ14490 0 1113 1616 1644 hypothetical protein FLJ14490 FLJ20701 22108 38448 34561 33900 hypothetical protein FLJ20701 FLJ21986 1659 4694 5242 4992 hypothetical protein FLJ21986 FLJ21986 298 660 665 771 hypothetical protein FLJ21986 FLJ23231 1674 9520 10720 9416 hypothetical protein FLJ23231 FLJ25590 217 820 705 693 hypothetical protein FLJ25590 FLJ30999 434 1069 859 1037 hypothetical protein FLJ30999 FLJ33069 0 407 279 336 hypothetical protein FLJ33069 FMNL3 0 323 425 456 formin-like 3 FRMD4 0 445 431 447 FERM domain containing 4 FSTL1 27585 45076 41407 44768 follistatin-like 1 FUT4 1005 1539 1448 1512 fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific) G0S2 27824 57038 63348 58898 putative lymphocyte G0/G1 switch gene G3BP 2364 3850 3598 4070 Ras-GTPase-activating protein SH3-domain-binding protein UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- 558 1306 937 959 GALNT12 acetylgalactosaminyltransferase 12 (GalNAc-T12) GAS2L3 0 161 164 0 growth arrest-specific 2 like 3 glucan (1,4-alpha-), branching enzyme 1 (glycogen branching enzyme, 28370 38100 25160 27130 GBE1 Andersen disease, glycogen storage disease type IV) GBP1 833 2185 2391 2420 guanylate binding protein 1, interferon-inducible, 67kDa GCH1 25689 47559 49910 49213 GTP cyclohydrolase 1 (dopa-responsive dystonia) GFPT1 6986 12000 15230 14260 glutamine-fructose-6-phosphate transaminase 1 GFPT2 6790 19360 17490 20510 glutamine-fructose-6-phosphate transaminase 2 GJB2 450 965 2406 2272 gap junction protein, beta 2, 26kDa (connexin 26) GK 0 555 584 665 glycerol kinase GK 238 550 655 656 glycerol kinase GNPDA2 1343 3137 2566 2914 glucosamine-6-phosphate deaminase 2 GPR84 422 3520 3811 3702 G protein-coupled receptor 84 GRPEL1 2263 3899 3183 3598 GrpE-like 1, mitochondrial (E. coli) GSK3B 1545 3659 2722 3102 glycogen synthase kinase 3 beta HIVEP2 1052 1792 1749 2003 human immunodeficiency virus type I enhancer binding protein 2 HK2 3710 12730 6680 6872 hexokinase 2 HM13 3594 5551 5592 5961 histocompatibility (minor) 13 HMGA2 423 2171 1755 1885 high mobility group AT-hook 2 HNMT 2667 5668 3767 3572 histamine N-methyltransferase HNRPA1 9823 15010 9661 9382 heterogeneous nuclear ribonucleoprotein A1 HOMER1 275 589 494 449 homer homolog 1 (Drosophila) HSD11B1 11530 62567 52807 61885 hydroxysteroid (11-beta) dehydrogenase 1 HSPA1A 12970 20790 22500 22574 heat shock 70kDa protein 1A heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 733 2138 2335 2081 HSPA5BP1 1 HTLF 1215 2166 2681 2738 human T-cell leukemia virus enhancer factor IBRDC2 441 902 684 866 IBR domain containing 2 IBRDC3 1402 3060 2547 2904 IBR domain containing 3 ICAM1 17173 40539 39965 40770 intercellular adhesion molecule 1 (CD54), human rhinovirus receptor
232 7. SUPPLEMENT
Symbol control IL1B IL1B+1400W IL1B+191023 Description ICOSL 0 960 0 0 inducible T-cell co-stimulator ligand ICOSL 0 996 818 831 inducible T-cell co-stimulator ligand ID2 5957 17090 18580 16360 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein IER3 61307 110300 99003 107420 immediate early response 3 IER5 4522 13170 13243 12610 immediate early response 5 IFNAR2 2209 5345 4866 4997 interferon (alpha, beta and omega) receptor 2 IFNGR2 6595 13480 12050 12694 interferon gamma receptor 2 (interferon gamma transducer 1) IGFBP3 20060 76840 28900 37170 insulin-like growth factor binding protein 3 IL10 0 493 597 494 interleukin 10 IL11 0 4228 8796 6266 interleukin 11 IL11 0 1050 1759 1477 interleukin 11 IL15RA 652 3807 3084 3535 interleukin 15 receptor, alpha IL1A 0 2897 4015 4702 interleukin 1, alpha IL1B 807 36750 38104 37038 interleukin 1, beta IL1F8 0 470 315 322 interleukin 1 family, member 8 (eta) IL1F9 0 3365 2754 3125 interleukin 1 family, member 9 IL1RN 0 358 390 255 interleukin 1 receptor antagonist IL1RN 362 2920 3065 2733 interleukin 1 receptor antagonist IL20 0 420 613 464 interleukin 20 IL23A 324 8700 15090 15967 interleukin 23, alpha subunit p19 IL24 0 326 482 377 interleukin 24 IL7R 0 488 501 577 interleukin 7 receptor INSIG1 12140 22200 27000 23520 insulin induced gene 1 INSIG2 2886 7794 5492 5562 insulin induced gene 2 IRAK2 2481 11030 10610 10750 interleukin-1 receptor-associated kinase 2 IRF1 658 2606 2296 2266 interferon regulatory factor 1 ISG20 2304 8877 6403 6460 interferon stimulated gene 20kDa ISG20 2537 9429 6678 6790 interferon stimulated gene 20kDa ITPR3 5448 13460 10480 10591 inositol 1,4,5-triphosphate receptor, type 3 ITPR3 2234 6339 4730 4498 inositol 1,4,5-triphosphate receptor, type 3 IVNS1ABP 5171 8635 7355 7043 influenza virus NS1A binding protein IVNS1ABP 8179 19205 18001 18619 influenza virus NS1A binding protein JARID2 0 969 810 980 Jumonji, AT rich interactive domain 2 JARID2 860 2301 2061 1783 Jumonji, AT rich interactive domain 2 JMJD1A 2042 4632 2483 2696 jumonji domain containing 1A JMJD3 712 2006 2077 1720 jumonji domain containing 3 JUN 1803 4465 3273 3524 v-jun sarcoma virus 17 oncogene homolog (avian) KCNK5 625 1048 732 943 potassium channel, subfamily K, member 5 KIAA0247 3321 7061 6938 7648 KIAA0247 KIAA0303 1492 3827 3136 3638 KIAA0303 protein KIAA0303 1533 2969 2551 2441 KIAA0303 protein KIAA0802 0 269 261 0 KIAA0802 KIAA0828 1483 4137 3530 3133 KIAA0828 protein KIAA0999 2629 4051 4595 3928 KIAA0999 protein KIAA1217 0 176 220 286 KIAA1217 KIAA1387 2843 4044 2887 3588 KIAA1387 protein KIAA1404 2157 3615 3603 3414 KIAA1404 protein KIAA1718 809 2952 2132 2512 KIAA1718 protein KIAA1726 1016 3069 3271 2698 KIAA1726 protein KIRREL 1751 3517 2894 2875 kin of IRRE like (Drosophila) KLF5 350 1791 2508 1997 Kruppel-like factor 5 (intestinal) KLHL5 497 813 808 719 kelch-like 5 (Drosophila) KLHL5 1980 3207 3071 3105 kelch-like 5 (Drosophila) LAMB3 6591 27230 21130 21510 laminin, beta 3 LGALS8 451 1097 1087 1176 lectin, galactoside-binding, soluble, 8 (galectin 8) LGALS8 1555 2586 2071 2248 lectin, galactoside-binding, soluble, 8 (galectin 8) LIF 4811 51209 50202 53794 leukemia inhibitory factor (cholinergic differentiation factor) LIMK2 511 1116 399 554 LIM domain kinase 2 LOC115294 0 213 189 233 similar to hypothetical protein FLJ10883 LOC116238 409 882 1299 1121 hypothetical protein BC014072 LOC117584 2343 4418 3734 3884 fring LOC124491 245 517 495 652 LOC124491 LOC134285 0 435 593 600 hypothetical protein LOC134285 LOC150759 0 360 418 308 hypothetical protein LOC150759 LOC151963 368 827 983 1016 similar to BcDNA:GH11415 gene product LOC283551 275 2258 1683 2231 hypothetical protein LOC283551 LOC283551 248 1222 802 1019 hypothetical protein LOC283551 LOC284207 10650 20400 14440 15114 hypothetical protein LOC284207 LOC338758 959 3100 4502 3700 hypothetical protein LOC338758 LOC387763 33161 49404 50995 46098 hypothetical LOC387763 LOC51255 11510 15112 16690 15575 hypothetical protein LOC51255 LOC54103 0 239 0 0 hypothetical protein LOC54103 LOC54103 2274 5293 5678 5736 hypothetical protein LOC54103 LOC54103 3232 6259 7099 6670 hypothetical protein LOC54103 LOC56270 3596 6001 4406 3933 hypothetical protein 628
233 7. SUPPLEMENT
Symbol control IL1B IL1B+1400W IL1B+191023 Description LPXN 1804 4574 4247 4578 leupaxin Lrp2bp 2190 4353 2244 2702 low density lipoprotein receptor-related protein binding protein LYN 713 1443 1684 1527 v-yes-1 Yamaguchi sarcoma viral related oncogene homolog LYN 567 1316 1420 1569 v-yes-1 Yamaguchi sarcoma viral related oncogene homolog MAD 1564 4081 3196 3350 MAX dimerization protein 1 MAD 1924 6998 5448 5126 MAX dimerization protein 1 MADD 0 699 755 745 MAP-kinase activating death domain MAFF 19321 36228 35095 34555 v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) molecule possessing ankyrin repeats induced by lipopolysaccharide (MAIL), 17650 42819 43706 41952 MAIL homolog of mouse MAML2 2428 4843 4303 4238 mastermind-like 2 (Drosophila) MAP1LC3B 5124 10330 9166 9878 microtubule-associated protein 1 light chain 3 beta MAP2K1 2657 6345 4480 5165 mitogen-activated protein kinase kinase 1 MAP3K8 2311 7841 7986 6725 mitogen-activated protein kinase kinase kinase 8 MARCKS 12890 25722 32012 28142 myristoylated alanine-rich protein kinase C substrate MARCKS 3776 10230 11086 10960 myristoylated alanine-rich protein kinase C substrate MARK3 1587 2201 2151 2243 MAP/microtubule affinity-regulating kinase 3 MESDC1 922 2396 2690 2538 mesoderm development candidate 1 MGC17337 2017 4662 3699 4512 similar to RIKEN cDNA 5730528L13 gene MGC17337 1501 2634 2575 2529 similar to RIKEN cDNA 5730528L13 gene MGC19764 0 457 502 504 hypothetical protein MGC19764 MGC2654 1167 1724 1511 1653 hypothetical protein MGC2654 MGC29814 1345 1814 1640 1717 hypothetical protein MGC29814 MGC33365 2699 6129 4151 4148 hypothetical protein MGC33365 MGC33887 667 3445 2720 3156 hypothetical protein MGC33887 MGC5370 0 538 463 446 hypothetical protein MGC5370 MGC5370 2640 5911 3580 4309 hypothetical protein MGC5370 MIG-6 31189 50281 36709 33430 mitogen-inducible gene 6 MK2S4 0 380 313 320 protein kinase substrate MK2S4 MLL5 2831 5872 5281 4697 myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); 0 274 280 225 MLLT4 translocated to, 4 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); 3246 6155 5689 5655 MLLT4 translocated to, 4 MMP10 607 1886 2192 1997 matrix metalloproteinase 10 (stromelysin 2) MPP2 358 771 468 545 membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) MRGX3 0 351 588 328 G protein-coupled receptor MRGX3 MXI1 5584 10050 4185 4356 MAX interactor 1 MYO10 0 436 418 488 myosin X MYO1B 1394 2988 2708 2539 myosin IB MYO5A 585 1163 1160 1283 myosin VA (heavy polypeptide 12, myoxin) MYO9B 348 491 602 514 myosin IXB NDP 8197 23891 23117 21140 Norrie disease (pseudoglioma) NEDD4 642 1264 1336 1421 neural precursor cell expressed, developmentally down-regulated 4 NFE2L1 5588 7621 6618 7238 nuclear factor (erythroid-derived 2)-like 1 NFE2L2 9393 14800 15888 14178 nuclear factor (erythroid-derived 2)-like 2 NFKB1 2313 7438 7859 7632 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (p105) NFKB2 439 1094 1370 1446 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, 19494 76284 51512 66200 NFKBIA alpha nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, 0 773 731 741 NFKBIB beta nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, 1061 1996 2190 2026 NFKBIE epsilon NGFB 0 1577 1599 1632 nerve growth factor, beta polypeptide NKX3-1 2439 7997 6962 7159 NK3 transcription factor related, locus 1 (Drosophila) NOS2A 1105 8146 10060 9584 nitric oxide synthase 2A (inducible, hepatocytes) NPEPL1 0 555 0 0 aminopeptidase-like 1 NR4A3 0 1426 2092 1545 nuclear receptor subfamily 4, group A, member 3 NRP2 8812 14844 15690 15245 neuropilin 2 NRP2 2070 4499 4630 4375 neuropilin 2 NRP2 3127 6039 6537 5666 neuropilin 2 NS5ATP13TP2 876 1577 1978 2534 NS5ATP13TP2 protein PANX1 0 192 0 303 pannexin 1 PANX1 1522 3395 3225 3415 pannexin 1 PAPPA 0 547 637 573 pregnancy-associated plasma protein A PAPPA 583 2853 2624 2484 pregnancy-associated plasma protein A PAPPA 3324 16450 17120 15400 pregnancy-associated plasma protein A PAPPA 4188 22120 20370 14280 pregnancy-associated plasma protein A PAPPA 1905 14260 12470 11160 pregnancy-associated plasma protein A PAPPA 1209 6045 5213 4804 pregnancy-associated plasma protein A PAX8 1157 1648 1593 1509 paired box gene 8 PDCD1LG1 975 2250 2649 2501 programmed cell death 1 ligand 1 PDK1 416 906 539 572 pyruvate dehydrogenase kinase, isoenzyme 1 PDZRN3 1158 6413 7211 6641 PDZ domain containing RING finger 3 PELI1 1913 3696 3512 3854 pellino homolog 1 (Drosophila) PFKFB3 6984 17230 8865 9544 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
234 7. SUPPLEMENT
Symbol control IL1B IL1B+1400W IL1B+191023 Description PFKP 9251 17647 11360 13190 phosphofructokinase, platelet PHLDA2 5729 10910 14290 14108 pleckstrin homology-like domain, family A, member 2 PI3 0 1130 1477 1040 protease inhibitor 3, skin-derived (SKALP) PIGA 1144 3314 3393 3392 phosphatidylinositol glycan, class A (paroxysmal nocturnal hemoglobinuria) PILRA 324 2676 3028 2685 paired immunoglobin-like type 2 receptor alpha PILRA 1047 6332 6497 6229 paired immunoglobin-like type 2 receptor alpha PIM1 577 1062 924 881 pim-1 oncogene PLA2G4A 8931 19070 22100 19995 phospholipase A2, group IVA (cytosolic, calcium-dependent) PLAT 250 2401 3148 3058 plasminogen activator, tissue PLAUR 4069 12810 12440 11740 plasminogen activator, urokinase receptor PLAUR 5065 15130 12830 12745 plasminogen activator, urokinase receptor PMAIP1 440 1071 1117 1382 phorbol-12-myristate-13-acetate-induced protein 1 POMZP3 2110 6841 6414 5954 POM (POM121 homolog, rat) and ZP3 fusion POPDC3 668 2317 1700 2073 popeye domain containing 3 POU2F2 0 889 1027 985 POU domain, class 2, transcription factor 2 POU2F2 0 656 1073 763 POU domain, class 2, transcription factor 2 PPAP2B 4360 15408 14390 13130 phosphatidic acid phosphatase type 2B PPP1R14C 1887 3252 2429 2794 protein phosphatase 1, regulatory (inhibitor) subunit 14C PPP2R5B 294 570 487 543 protein phosphatase 2, regulatory subunit B (B56), beta isoform protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform 835 2383 2161 1989 PPP3CC (calcineurin A gamma) protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform 928 1906 1906 1910 PPP3CC (calcineurin A gamma) PSMB10 1423 2805 2929 3023 proteasome (prosome, macropain) subunit, beta type, 10 PTGER2 3505 8423 8433 8448 prostaglandin E receptor 2 (subtype EP2), 53kDa prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and 13520 78560 73601 80907 PTGS2 cyclooxygenase) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and 3044 39770 39964 39490 PTGS2 cyclooxygenase) PTP4A2 24200 34482 32082 32777 protein tyrosine phosphatase type IVA, member 2 PTP4A2 10480 16795 14920 14544 protein tyrosine phosphatase type IVA, member 2 PTPN12 6049 14865 13714 14734 protein tyrosine phosphatase, non-receptor type 12 PTPNS1 4842 7835 8315 7480 protein tyrosine phosphatase, non-receptor type substrate 1 PTX3 3077 6505 6921 7612 pentaxin-related gene, rapidly induced by IL-1 beta RAB6IP1 3821 11080 9081 9751 RAB6 interacting protein 1 RAB8B 635 1253 1254 1284 RAB8B, member RAS oncogene family RAI3 846 1776 974 1040 retinoic acid induced 3 RAI3 2222 4494 2877 2912 retinoic acid induced 3 RASGRP1 0 638 682 554 RAS guanyl releasing protein 1 (calcium and DAG-regulated) RASSF5 463 1737 1781 1737 Ras association (RalGDS/AF-6) domain family 5 RBM17 2793 4135 4050 4028 RNA binding motif protein 17 RBPSUH 4122 8833 7450 7879 recombining binding protein suppressor of hairless (Drosophila) RBPSUH 7091 14770 10130 11030 recombining binding protein suppressor of hairless (Drosophila) v-rel reticuloendotheliosis viral oncogene homolog A, nuclear factor of kappa 4464 7735 5752 6020 RELA light polypeptide gene enhancer in B-cells 3, p65 (avian) v-rel reticuloendotheliosis viral oncogene homolog A, nuclear factor of kappa 736 2316 1389 1649 RELA light polypeptide gene enhancer in B-cells 3, p65 (avian) RGMB 0 511 507 536 RGM domain family, member B RHOQ 4252 5967 6861 6394 ras homolog gene family, member Q RIPK2 3453 13812 13333 14191 receptor-interacting serine-threonine kinase 2 RIPK2 647 3057 3643 3892 receptor-interacting serine-threonine kinase 2 RIS1 2201 6993 2713 4274 Ras-induced senescence 1 RNF159 2491 3610 3419 3329 ring finger protein (C3HC4 type) 159 RRAS2 1657 2550 2253 2764 related RAS viral (r-ras) oncogene homolog 2 RTTN 584 2644 1978 2744 rotatin RUNX1 0 248 240 347 runt-related transcription factor 1 (acute myeloid leukemia 1; aml1 oncogene) RUNX1 457 860 940 769 runt-related transcription factor 1 (acute myeloid leukemia 1; aml1 oncogene) SDCBP 29280 38941 38150 38020 syndecan binding protein (syntenin) SEC61G 20800 35670 33170 33165 Sec61 gamma subunit SELE 0 3764 4696 3770 selectin E (endothelial adhesion molecule 1) SELK 16260 27882 30554 29700 selenoprotein K sema domain, transmembrane domain (TM), and cytoplasmic domain, 0 1243 753 720 SEMA6D (semaphorin) 6D sema domain, transmembrane domain (TM), and cytoplasmic domain, 0 947 730 740 SEMA6D (semaphorin) 6D sema domain, transmembrane domain (TM), and cytoplasmic domain, 843 7477 5450 6417 SEMA6D (semaphorin) 6D SERPINB3 0 137 265 318 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3 SERPINB7 0 3212 3664 3526 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7 SERPINB8 1109 1843 1849 2254 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8 SESN2 613 1022 1098 1074 sestrin 2 SGPP2 0 692 1321 1651 sphingosine-1-phosphate phosphotase 2 SGPP2 0 594 802 808 sphingosine-1-phosphate phosphotase 2 SGPP2 126 2548 3291 3116 sphingosine-1-phosphate phosphotase 2 SIAT4A 925 2005 1712 1953 sialyltransferase 4A (beta-galactoside alpha-2,3-sialyltransferase) SIAT4C 0 500 0 481 sialyltransferase 4C (beta-galactoside alpha-2,3-sialyltransferase) SIPA1L2 2644 4536 3191 3903 signal-induced proliferation-associated 1 like 2 SKIL 1011 1703 1695 1507 SKI-like SLAMF9 0 414 338 223 SLAM family member 9
235 7. SUPPLEMENT
Symbol control IL1B IL1B+1400W IL1B+191023 Description solute carrier family 11 (proton-coupled divalent metal ion transporters), 2893 5942 5583 5599 SLC11A2 member 2 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 0 1376 1050 978 SLC13A3 3 SLC15A4 3122 5320 4481 4894 solute carrier family 15, member 4 SLC16A1 1596 4697 2597 2613 solute carrier family 16 (monocarboxylic acid transporters), member 1 SLC16A1 1176 3426 1685 2041 solute carrier family 16 (monocarboxylic acid transporters), member 1 SLC16A1 464 1148 748 689 solute carrier family 16 (monocarboxylic acid transporters), member 1 SLC2A1 1889 5156 1652 2421 solute carrier family 2 (facilitated glucose transporter), member 1 SLC41A2 341 1348 1333 1566 solute carrier family 41, member 2 SLC41A2 409 1293 1079 1158 solute carrier family 41, member 2 SLC43A3 1330 5369 6485 5481 solute carrier family 43, member 3 SLC4A4 0 156 96 109 solute carrier family 4, sodium bicarbonate cotransporter, member 4 SLC4A4 241 1084 1166 1221 solute carrier family 4, sodium bicarbonate cotransporter, member 4 SLC7A1 4332 8651 9121 9379 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 SLC7A11 2449 9606 8119 9436 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 SLC7A11 1710 7326 6564 7346 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 SLC7A2 744 5240 4290 5455 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 SLC7A7 495 2707 3493 3532 solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 SLCO3A1 590 1085 1776 1334 solute carrier organic anion transporter family, member 3A1 SLCO3A1 618 1176 1246 1241 solute carrier organic anion transporter family, member 3A1 SLCO4A1 0 340 0 0 solute carrier organic anion transporter family, member 4A1 SMAD5 0 184 235 261 SMAD, mothers against DPP homolog 5 (Drosophila) SMAD7 1406 3256 3235 2945 SMAD, mothers against DPP homolog 7 (Drosophila) SMS 3712 9171 8896 9591 spermine synthase SMTN 2335 5545 5064 5109 smoothelin SMTN 2093 4598 4676 5058 smoothelin SMURF1 855 1810 1949 2015 E3 ubiquitin ligase SMURF1 SNX11 482 838 868 720 sorting nexin 11 SOX11 0 242 319 302 SRY (sex determining region Y)-box 11 SOX11 0 527 620 449 SRY (sex determining region Y)-box 11 SOX17 0 161 235 217 SRY (sex determining region Y)-box 17 SOX7 115 216 231 241 SRY (sex determining region Y)-box 7 SPATA5L1 0 140 153 0 spermatogenesis associated 5-like 1 SPATA5L1 1503 3391 3246 3194 spermatogenesis associated 5-like 1 SRPK1 3009 5587 6265 5955 SFRS protein kinase 1 SSB4 0 302 358 348 SPRY domain-containing SOCS box protein SSB-4 SSTR2 0 656 394 398 somatostatin receptor 2 STAT4 0 614 946 978 signal transducer and activator of transcription 4 STIM2 0 254 0 365 stromal interaction molecule 2 STK10 0 892 1009 951 serine/threonine kinase 10 STK10 702 1427 1105 1145 serine/threonine kinase 10 STX11 0 572 680 740 syntaxin 11 SUI1 28650 46808 35450 38792 putative translation initiation factor SUI1 33481 50441 41715 44310 putative translation initiation factor SUI1 26771 47233 32953 37010 putative translation initiation factor T2BP 2569 4525 4570 4635 TRAF2 binding protein TAB3 0 162 179 179 TAK1-binding protein 3 TBK1 2663 3926 3883 4020 TANK-binding kinase 1 TBX3 0 425 556 552 T-box 3 (ulnar mammary syndrome) TDG 0 775 802 560 thymine-DNA glycosylase TFPI2 10260 29370 31363 26404 tissue factor pathway inhibitor 2 TFRC 17347 26073 17873 21340 transferrin receptor (p90, CD71) TGFB1I4 0 419 510 468 transforming growth factor beta 1 induced transcript 4 THSD2 3514 12200 14830 14770 thrombospondin, type I, domain 2 TIAM2 2731 6509 6229 6158 T-cell lymphoma invasion and metastasis 2 TIC 392 989 752 851 SEC7 homolog TIPARP 2887 5713 4645 5299 TCDD-inducible poly(ADP-ribose) polymerase TLE1 1014 2062 2691 2538 transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) TLE1 525 1350 1256 1443 transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) TNF 0 260 356 364 tumor necrosis factor (TNF superfamily, member 2) TNFAIP2 1954 9478 11830 11180 tumor necrosis factor, alpha-induced protein 2 TNFAIP3 790 3213 3453 3403 tumor necrosis factor, alpha-induced protein 3 TNFAIP3 2030 7940 8388 8265 tumor necrosis factor, alpha-induced protein 3 TNFAIP8 2600 18310 18520 19490 tumor necrosis factor, alpha-induced protein 8 TNFAIP8 3793 25840 26405 24997 tumor necrosis factor, alpha-induced protein 8 tumor necrosis factor receptor superfamily, member 10d, decoy with truncated 7299 12320 9072 9522 TNFRSF10D death domain TNFRSF19L 0 605 0 750 tumor necrosis factor receptor superfamily, member 19-like TNFRSF1B 507 5406 4224 4445 tumor necrosis factor receptor superfamily, member 1B TNFRSF9 168 912 954 1008 tumor necrosis factor receptor superfamily, member 9 TNIP1 5112 12650 13800 11947 TNFAIP3 interacting protein 1 TOSO 0 1469 1695 1769 regulator of Fas-induced apoptosis TOSO 463 2838 3233 3495 regulator of Fas-induced apoptosis TP53RK 973 2246 2411 2442 TP53 regulating kinase TPM1 2760 6559 5551 5718 tropomyosin 1 (alpha)
236 7. SUPPLEMENT
Symbol control IL1B IL1B+1400W IL1B+191023 Description TRAF1 372 2433 2202 2428 TNF receptor-associated factor 1 TRAF1 570 3743 3482 3563 TNF receptor-associated factor 1 TRIF 488 927 736 807 TIR domain containing adaptor inducing interferon-beta TRIM16 537 2125 868 1111 tripartite motif-containing 16 TRIO 676 1703 1213 1289 triple functional domain (PTPRF interacting) TTLL4 911 1806 1573 1691 tubulin tyrosine ligase-like family, member 4 TXNIP 8775 14190 6764 8779 thioredoxin interacting protein TXNRD1 4141 10120 6136 7160 thioredoxin reductase 1 UBD 0 353 570 484 ubiquitin D UBE2E2 1972 3137 3533 3469 ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast) UBE2H 716 1552 1386 1302 ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) USP12 1784 4526 5153 5109 ubiquitin specific protease 12 USP13 768 1425 1452 1687 ubiquitin specific protease 13 (isopeptidase T-3) USP13 1759 2471 3159 3028 ubiquitin specific protease 13 (isopeptidase T-3) VIK 3952 6524 6070 6183 vav-1 interacting Kruppel-like protein VLDLR 2071 4125 2224 3335 very low density lipoprotein receptor VMD2 421 935 678 759 vitelliform macular dystrophy (Best disease, bestrophin) VNN1 251 2215 2131 1433 vanin 1 VNN1 646 4866 4271 4213 vanin 1 VNN3 0 706 834 613 vanin 3 WBSCR19 164 2618 2529 2392 Williams Beuren syndrome chromosome region 19 WNT5A 1452 4666 5150 4561 wingless-type MMTV integration site family, member 5A WNT5A 1111 3735 3878 3775 wingless-type MMTV integration site family, member 5A XTP2 0 244 236 311 HBxAg transactivated protein 2 ZCWCC3 1039 2907 2322 2850 zinc finger, CW-type with coiled-coil domain 3 ZFHX1B 0 463 349 597 zinc finger homeobox 1b ZFP91 3615 5225 5908 6076 zinc finger protein 91 homolog (mouse) ZFYVE27 795 1258 1221 1179 zinc finger, FYVE domain containing 27 ZNF217 1323 4009 3518 3654 zinc finger protein 217 ZNF267 457 1220 1105 1275 zinc finger protein 267 ZNRF1 202 324 274 333 zinc and ring finger protein 1 ZNRF1 1072 1737 1393 1792 zinc and ring finger protein 1 ZRANB1 0 499 405 517 zinc finger, RAN-binding domain containing 1 239876_at 0 390 480 332 Transcribed sequences 236202_at 0 137 144 0 Transcribed sequences 241592_at 0 440 603 524 Transcribed sequences 230327_at 0 335 532 483 CDNA FLJ43932 fis, clone TESTI4013675 227571_at 0 431 276 337 CDNA FLJ35556 fis, clone SPLEN2004844 235670_at 0 846 1255 1491 Transcribed sequences Transcribed sequence with weak similarity to protein sp:P39192 (H.sapiens) 238725_at 0 1210 1335 1385 ALU5_HUMAN Alu subfamily SC sequence contamination warning entry 229975_at 0 473 773 551 Transcribed sequences 1565579_at 0 430 398 491 CDNA clone IMAGE:3689276, partial cds 1567224_at 0 153 216 188 1556221_a_at 0 171 181 217 Homo sapiens cDNA FLJ35137 fis, clone PLACE6009419. 1560982_at 0 346 425 382 Full length insert cDNA clone ZD81C11 229523_at 0 184 242 156 Transcribed sequences 235122_at 0 233 221 223 Transcribed sequences 238457_at 0 216 227 310 CDNA FLJ26292 fis, clone DMC07053 242579_at 0 358 337 294 Transcribed sequences 242853_at 0 263 0 0 Transcribed sequences 230671_at 0 169 0 0 Full length insert cDNA clone ZD43G04 Hypothetical protein LOC338817, mRNA (cDNA clone IMAGE:5267955), 1557826_at 0 164 0 0 partial cds Transcribed sequence with moderate similarity to protein sp:P00722 (E. coli) 237154_at 0 1241 1003 918 BGAL_ECOLI Beta-galactosidase 231384_at 0 230 225 198 CDNA FLJ42708 fis, clone BRAMY3007311 229814_at 0 532 628 624 Transcribed sequences Transcribed sequence with moderate similarity to protein pdb:1LBG (E. coli) B 235661_at 0 563 728 764 Chain B, Lactose Operon Repressor Bound To 21-Base Pair Symmetric Operator Dna, Alpha Carbons Only 228976_at 0 927 1092 1174 Transcribed sequences 232504_at 0 959 1956 1542 MRNA full length insert cDNA clone EUROIMAGE 2005635 Transcribed sequence with moderate similarity to protein pdb:1LBG (E. coli) B 227749_at 0 1282 1690 1760 Chain B, Lactose Operon Repressor Bound To 21-Base Pair Symmetric Operator Dna, Alpha Carbons Only Transcribed sequence with moderate similarity to protein pdb:1LBG (E. coli) B 242866_x_at 0 578 579 634 Chain B, Lactose Operon Repressor Bound To 21-Base Pair Symmetric Operator Dna, Alpha Carbons Only 1568799_at 0 162 132 0 Clone IMAGE:4798168, mRNA 1570452_at 0 162 219 176 Clone IMAGE:4290135, mRNA 213038_at 1340 4229 3340 3819 hypothetical protein FLJ90005 232484_at 706 1135 823 874 LOC388443 (LOC388443), mRNA 225033_at 2449 8606 6627 6530 Clone IMAGE:4401795, mRNA 235242_at 887 1792 2224 2054 CDNA FLJ41375 fis, clone BRCAN2007700 227755_at 2556 6469 5144 5959 CDNA FLJ42435 fis, clone BLADE2006849 Transcribed sequence with moderate similarity to protein sp:P39195 235299_at 1050 2808 2751 2967 (H.sapiens) ALU8_HUMAN Alu subfamily SX sequence contamination warning entry
237 7. SUPPLEMENT
213817_at control IL1B IL1B+1400W IL1B+191023 Description 229055_at 1083 2247 2706 2454 MRNA; cDNA DKFZp586B0220 (from clone DKFZp586B0220) Transcribed sequence with strong similarity to protein prf:2124311A 236266_at 470 2473 1604 2047 (H.sapiens) 2124311A G protein-coupled receptor [Homo sapiens] 242329_at 509 1197 788 862 CDNA FLJ31407 fis, clone NT2NE2000137 1556332_at 287 489 521 534 LOC402472 (LOC402472), mRNA 227125_at 270 1242 1033 1005 CDNA FLJ38412 fis, clone FEBRA2009385 226682_at 925 2416 1990 2174 CDNA FLJ41728 fis, clone HLUNG2015617 Hypothetical protein LOC283666, mRNA (cDNA clone IMAGE:4415549), 214182_at 2576 5521 3501 3661 partial cds 227167_s_at 3349 7526 6343 5380 CDNA FLJ42196 fis, clone THYMU2033816 229437_at 520 1235 1328 1384 Mesenchymal stem cell protein DSC96 mRNA, partial cds 228812_at 303 1596 939 1063 BIC noncoding mRNA, complete sequence [BLAST] Transcribed sequence with weak similarity to protein sp:P39188 (H.sapiens) 236616_at 345 1430 1893 1691 ALU1_HUMAN Alu subfamily J sequence contamination warning entry 230383_x_at 724 1527 1206 1334 CDNA FLJ41623 fis, clone CTONG3009227 227792_at 631 1433 1817 1541 Transcribed sequences 226936_at 8307 14130 11560 12660 CDNA: FLJ22994 fis, clone KAT11918 239876_at 642 981 1141 1146 CDNA clone IMAGE:4448513, partial cds
238 7. SUPPLEMENT
Table XII IL-1 down-regulated genes in human OA chondrocytes In the table are given: gene symbol (or Affymetrix identifier), relative expression values and description of the gene. Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description Homo sapiens cDNA FLJ10967 fis, clone PLACE1000798. 171 0 232 207 1555461_at [BLAST] CDNA FLJ30424 fis, clone BRACE2008881, weakly similar to 1555967_at 518 0 681 588 ZINC FINGER PROTEIN 195 1557135_at 191 0 0 0 LOC388244 (LOC388244), mRNA 1557270_at 194 0 131 0 CDNA FLJ36375 fis, clone THYMU2008226 1558568_a_at 275 0 192 0 MRNA; cDNA DKFZp313I1032 (from clone DKFZp313I1032) 1561868_at 139 0 0 0 MRNA full length insert cDNA clone EUROIMAGE 592473 1562080_at 116 0 0 0 CDNA FLJ32789 fis, clone TESTI2002326 1564139_at 344 166 134 183 CDNA FLJ32290 fis, clone PROST2000463 1569577_x_at 67 0 0 0 Clone IMAGE:3865586, mRNA 201003_x_at 3095 1957 2076 2129 ubiquitin-conjugating enzyme E2 variant 1 202254_at 473 0 344 318 CDNA clone IMAGE:5286091, partial cds 202546_at 1816 984 1339 1325 vesicle-associated membrane protein 8 (endobrevin) Transcribed sequence with moderate similarity to protein 203306_s_at 3806 2368 2794 2486 pir:JC5023 (H.sapiens) JC5023 CMP-sialic acid transporter - human [BLAST] 205081_at 893 0 0 0 cysteine-rich protein 1 (intestinal) gb:NM_031245.1 /DEF=Homo sapiens hypothetical protein PP1345 (PP1345), mRNA. /FEA=mRNA /GEN=PP1345 208144_s_at 126 0 0 0 /PROD=hypothetical protein PP1345 /DB_XREF=gi:13786118 /FL=gb:NM_031245.1 211538_s_at 3385 1970 1887 2094 heat shock 70kDa protein 2 211973_at 303 0 461 484 Clone 23872 mRNA sequence 212608_s_at 1852 1090 1221 1440 Clone 23872 mRNA sequence MRNA; cDNA DKFZp566E183 (from clone DKFZp566E183) 213248_at 735 0 0 0 [BLAST] 213388_at 1301 547 742 671 MRNA; cDNA DKFZp586I1823 (from clone DKFZp586I1823) 213429_at 1944 535 545 639 MRNA; cDNA DKFZp564B222 (from clone DKFZp564B222) 213725_x_at 6659 2937 3817 3732 Clone IMAGE:4791553, mRNA 213929_at 101 0 0 86 MRNA; cDNA DKFZp586F1223 (from clone DKFZp586F1223) 214036_at 1353 557 366 423 CDNA: FLJ22256 fis, clone HRC02860 214744_s_at 431 0 247 301 CDNA FLJ11898 fis, clone HEMBA1007322 214807_at 1436 597 667 792 MRNA; cDNA DKFZp564O0862 (from clone DKFZp564O0862) 215132_at 138 0 108 135 MRNA; cDNA DKFZp434E2423 (from clone DKFZp434E2423) 215306_at 674 227 212 0 MRNA; cDNA DKFZp586N2020 (from clone DKFZp586N2020) 216051_x_at 274 0 0 0 CDNA FLJ11983 fis, clone HEMBB1001337 216467_s_at 141 0 0 0 MRNA; cDNA DKFZp564L102 (from clone DKFZp564L102) (clone B3B3E13) Huntington's disease candidate region mRNA 217257_at 304 0 226 291 fragment. 217657_at 181 0 160 172 Transcribed sequences Transcribed sequence with moderate similarity to protein 217703_x_at 896 0 0 0 sp:P39194 (H.sapiens) ALU7_HUMAN Alu subfamily SQ sequence contamination warning entry Transcribed sequence with moderate similarity to protein 222288_at 262 0 0 0 sp:P39194 (H.sapiens) ALU7_HUMAN Alu subfamily SQ sequence contamination warning entry Hypothetical gene supported by BC044751; NM_175923 223791_at 242 0 194 0 (LOC401523), mRNA 224565_at 20990 8347 8470 10082 MRNA; cDNA DKFZp686L01105 (from clone DKFZp686L01105) 224741_x_at 14050 9333 7343 8300 CDNA clone IMAGE:6022744, partial cds 225220_at 3488 1670 1990 2063 Clone IMAGE:4249217, mRNA 225710_at 1930 1136 1427 1398 CDNA FLJ34013 fis, clone FCBBF2002111 225728_at 1162 404 769 464 CDNA FLJ37284 fis, clone BRAMY2013590 226116_at 1463 905 1117 930 CDNA FLJ12540 fis, clone NT2RM4000425 226243_at 2012 1316 1188 1255 Similar to ENSANGP00000018456 (LOC391356), mRNA 226587_at 308 0 0 0 Clone IMAGE:5288750, mRNA 226590_at 346 0 0 0 FP13169 mRNA, complete cds 226592_at 495 182 254 247 FP13169 mRNA, complete cds 226806_s_at 2943 758 750 792 MRNA; cDNA DKFZp686J23256 (from clone DKFZp686J23256) 226885_at 1276 661 717 584 Transcribed sequences 227061_at 5029 834 735 632 CDNA FLJ44429 fis, clone UTERU2015653 Transcribed sequence with weak similarity to protein 227092_at 2008 936 958 887 ref:NP_001448.1 (H.sapiens) filamin B, beta 227138_at 861 397 368 309 MRNA; cDNA DKFZp586B1024 (from clone DKFZp586B1024) 227193_at 894 258 296 376 Clone IMAGE:4828750, mRNA 227376_at 3690 1290 1274 1157 LOC402485 (LOC402485), mRNA 227498_at 738 367 343 373 CDNA FLJ11723 fis, clone HEMBA1005314 CDNA FLJ90790 fis, clone THYRO1001529, weakly similar to 227752_at 303 0 0 0 SERINE PALMITOYLTRANSFERASE 2 (EC 2.3.1.50). 227955_s_at 1376 599 578 543 CDNA: FLJ22256 fis, clone HRC02860 227995_at 1761 595 711 718 MRNA; cDNA DKFZp564O0862 (from clone DKFZp564O0862) 228108_at 460 0 155 0 CDNA FLJ30761 fis, clone FEBRA2000538 228718_at 277 198 188 0 zinc finger protein 44 (KOX 7) Transcribed sequence with strong similarity to protein sp:P00722 228773_at 241 0 0 191 (E. coli) BGAL_ECOLI Beta-galactosidase 228855_at 239 0 0 0 Similar to coenzyme A diphosphatase (LOC388299), mRNA Transcribed sequence with weak similarity to protein sp:P39188 229082_at 234 0 0 0 (H.sapiens) ALU1_HUMAN Alu subfamily J sequence contamination warning entry Transcribed sequence with weak similarity to protein 229088_at 3356 784 1082 1005 ref:NP_060265.1 (H.sapiens) hypothetical protein FLJ20378 [Homo sapiens] 229242_at 347 0 0 0 Transcribed sequences 229296_at 886 0 0 0 LOC389793 (LOC389793), mRNA Transcribed sequence with moderate similarity to protein 229444_at 791 0 0 0 ref:NP_077270.1 (H.sapiens) hypothetical protein MGC4614 [Homo sapiens]
239 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description 229506_at 170 0 0 0 CDNA FLJ30761 fis, clone FEBRA2000538 229544_at 1484 981 1511 1323 Clone IMAGE:5315196, mRNA 229602_at 171 0 185 0 Transcribed sequences 229956_at 146 0 0 0 Transcribed sequences 230118_at 288 0 0 305 Transcribed sequences 230305_at 649 334 466 405 Transcribed sequences Hypothetical gene supported by AK094963 (LOC400618), 230419_at 434 0 0 184 mRNA Hypothetical gene supported by AK094796 (LOC400764), 230433_at 428 154 262 251 mRNA Transcribed sequence with weak similarity to protein sp:P39193 230493_at 710 277 209 313 (H.sapiens) ALU6_HUMAN Alu subfamily SP sequence contamination warning entry 230570_at 130 0 0 0 Transcribed sequences 230591_at 340 0 0 0 CDNA clone IMAGE:6176570, partial cds 230596_at 200 0 0 0 CDNA FLJ39261 fis, clone OCBBF2009391 230958_s_at 3051 685 720 727 MRNA; cDNA DKFZp686J23256 (from clone DKFZp686J23256) 230986_at 121 0 151 171 CDNA FLJ30065 fis, clone ADRGL2000328 231040_at 140 0 156 153 CDNA FLJ43172 fis, clone FCBBF3007242 CDNA FLJ42053 fis, clone SPLEN2042535, moderately similar 231838_at 239 0 0 0 to POLYADENYLATE-BINDING PROTEIN 1 232254_at 198 0 0 0 CDNA: FLJ20913 fis, clone ADSE00630 232594_at 468 238 0 0 CDNA FLJ10967 fis, clone PLACE1000798 232667_at 296 0 0 0 CDNA FLJ13690 fis, clone PLACE2000097 232710_at 140 0 0 0 LOC392730 (LOC392730), mRNA 233346_at 281 0 0 0 CDNA FLJ11048 fis, clone PLACE1004516 233506_at 8945 4604 3731 3714 CDNA: FLJ21531 fis, clone COL06036 233677_at 213 0 0 0 Clone IMAGE:3460539, mRNA, partial cds 233931_at 156 0 186 0 CDNA FLJ11919 fis, clone HEMBB1000274 235173_at 906 361 586 607 CDNA FLJ44453 fis, clone UTERU2023550 235201_at 1201 339 313 235 Transcribed sequences 235753_at 1299 633 885 866 CDNA FLJ34835 fis, clone NT2NE2010150 235888_at 197 0 177 0 Transcribed sequences 235987_at 163 0 163 0 CDNA FLJ38474 fis, clone FEBRA2022255 236161_at 187 0 0 0 Transcribed sequences 236220_at 247 0 77 103 Transcribed sequences 236311_at 157 0 0 0 LOH12CR2 (LOH12CR2) mRNA, partial cds 236798_at 2191 1397 1828 1794 CDNA FLJ32438 fis, clone SKMUS2001402 237212_at 332 0 0 0 Transcribed sequences 237415_at 115 0 0 0 Transcribed sequences 237476_at 149 0 118 0 Transcribed sequences 238604_at 1232 764 821 888 CDNA FLJ25559 fis, clone JTH02834 238826_x_at 246 0 285 0 Full length insert cDNA clone ZE12C10 238953_at 418 0 215 245 CDNA clone IMAGE:5206119, partial cds 239049_at 170 0 136 0 Homo sapiens cDNA FLJ13202 fis, clone NT2RP3004503. 239466_at 183 0 0 0 Clone IMAGE:5300025, mRNA 239710_at 154 0 115 0 Transcribed sequences 239797_at 140 0 0 0 Transcribed sequences 239848_at 223 0 0 0 Sarcoma antigen NY-SAR-79 mRNA, partial cds 239893_at 669 287 326 271 Transcribed sequences 239999_at 116 0 0 0 LOC388815 (LOC388815), mRNA 240015_at 184 0 0 127 Transcribed sequences 241300_at 281 0 373 0 Transcribed sequences 241787_at 613 0 247 0 LOC389361 (LOC389361), mRNA Transcribed sequence with moderate similarity to protein 242270_at 147 0 0 88 sp:P39192 (H.sapiens) ALU5_HUMAN Alu subfamily SC sequence contamination warning entry 242305_at 157 0 160 205 CDNA FLJ42757 fis, clone BRAWH3001712 242449_at 140 0 0 0 Transcribed sequences 242481_at 189 0 0 0 Transcribed sequences 242590_at 402 222 173 223 Full length insert cDNA clone YZ58H09 Transcribed sequence with moderate similarity to protein 242676_at 134 0 0 0 sp:P39188 (H.sapiens) ALU1_HUMAN Alu subfamily J sequence contamination warning entry 242688_at 219 0 0 152 Transcribed sequences 242835_s_at 148 0 0 0 CDNA FLJ37859 fis, clone BRSSN2015369 243116_at 306 0 0 0 Transcribed sequences 243221_at 286 184 0 171 Transcribed sequences Transcribed sequence with weak similarity to protein sp:P39192 243984_at 131 0 0 0 (H.sapiens) ALU5_HUMAN Alu subfamily SC sequence contamination warning entry 244387_at 109 0 0 0 Transcribed sequences 244441_at 66 0 0 0 Transcribed sequences Transcribed sequence with strong similarity to protein sp:P00722 244587_at 811 460 534 466 (E. coli) BGAL_ECOLI Beta-galactosidase 244623_at 5663 2441 2739 2562 Transcribed sequences 244749_at 159 0 0 0 CDNA FLJ42484 fis, clone BRACE2032182 3'HEXO 1148 657 549 688 3' exoribonuclease 65472_at 301 168 258 194 CDNA FLJ42818 fis, clone BRCAN2015371 achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple- AAAS 761 452 652 736 A) AACS 1858 1361 1723 1390 acetoacetyl-CoA synthetase ABCC10 501 0 0 0 ATP-binding cassette, sub-family C (CFTR/MRP), member 10 ABCC5 320 0 230 0 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 ABCC6 356 0 0 0 ATP-binding cassette, sub-family C (CFTR/MRP), member 6 acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl- ACAA1 2036 1279 1595 1408 Coenzyme A thiolase) ACACB 371 0 0 0 acetyl-Coenzyme A carboxylase beta ACAD9 1299 767 877 893 acyl-Coenzyme A dehydrogenase family, member 9 ACAS2 777 550 577 429 acetyl-Coenzyme A synthetase 2 (ADP forming) acetyl-Coenzyme A acetyltransferase 1 (acetoacetyl Coenzyme ACAT1 3984 1901 2250 2400 A thiolase)
240 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description ACP6 1624 899 995 975 lysophosphatidic acid phosphatase ACTG1 48095 28990 34992 30800 actin, gamma 1 ACTG1 59669 39772 44210 40520 actin, gamma 1 ACY1 2367 1668 2011 1902 aminoacylase 1 a disintegrin-like and metalloprotease (reprolysin type) with ADAMTS1 17210 2908 5295 4110 thrombospondin type 1 motif, 1 a disintegrin-like and metalloprotease (reprolysin type) with ADAMTS1 3579 639 1102 832 thrombospondin type 1 motif, 1 a disintegrin-like and metalloprotease (reprolysin type) with ADAMTS5 10950 2829 4811 3507 thrombospondin type 1 motif, 5 (aggrecanase-2) a disintegrin-like and metalloprotease (reprolysin type) with ADAMTS5 6865 1924 3467 2781 thrombospondin type 1 motif, 5 (aggrecanase-2) a disintegrin-like and metalloprotease (reprolysin type) with ADAMTS5 586 177 338 258 thrombospondin type 1 motif, 5 (aggrecanase-2) a disintegrin-like and metalloprotease (reprolysin type) with ADAMTS5 7257 2902 4719 3653 thrombospondin type 1 motif, 5 (aggrecanase-2) ADAMTSL3 916 421 357 371 ADAMTS-like 3 ADCY3 1517 542 870 716 adenylate cyclase 3 ADD1 3105 2218 2228 2373 adducin 1 (alpha) ADSL 3014 2014 2854 3102 adenylosuccinate lyase AEBP1 13520 5535 3826 4256 AE binding protein 1 AGR2 462 0 0 0 anterior gradient 2 homolog (Xenopus laevis) AHCY 2385 1128 1472 1456 S-adenosylhomocysteine hydrolase AIG1 6187 1134 1228 1211 androgen-induced 1 AIG1 437 0 0 0 androgen-induced 1 AK1 1087 334 398 0 adenylate kinase 1 AK1 18670 7171 7758 8852 adenylate kinase 1 AKAP1 1602 875 816 699 A kinase (PRKA) anchor protein 1 aldo-keto reductase family 7, member A2 (aflatoxin aldehyde AKR7A2 1978 1260 1088 1093 reductase) ALDH6A1 1960 837 1189 998 aldehyde dehydrogenase 6 family, member A1 ALDH6A1 1842 905 968 960 aldehyde dehydrogenase 6 family, member A1 asparagine-linked glycosylation 8 homolog (yeast, alpha-1,3- ALG8 3303 1978 2541 2161 glucosyltransferase) ALMS1 682 0 0 0 Alstrom syndrome 1 AMT 714 0 0 0 aminomethyltransferase (glycine cleavage system protein T) ANAPC5 8174 5998 7986 7173 anaphase promoting complex subunit 5 ANAPC5 7176 3867 4666 4904 anaphase promoting complex subunit 5 ANAPC5 2348 1374 1984 1766 anaphase promoting complex subunit 5 ANGPT1 174 0 0 0 angiopoietin 1 ANGPTL2 6084 668 515 615 angiopoietin-like 2 ANGPTL2 6921 922 814 1066 angiopoietin-like 2 ANGPTL2 943 318 221 244 angiopoietin-like 2 ANK3 628 0 0 0 ankyrin 3, node of Ranvier (ankyrin G) ANKH 3414 813 890 951 ankylosis, progressive homolog (mouse) ANKH 24960 6761 6278 6581 ankylosis, progressive homolog (mouse) ANKH 1755 477 464 436 ankylosis, progressive homolog (mouse) ANKH 2657 761 773 838 ankylosis, progressive homolog (mouse) ANKH 916 0 0 0 ankylosis, progressive homolog (mouse) ANKRD25 2772 978 1239 1138 ankyrin repeat domain 25 ANP32B 10640 7637 7425 8025 acidic (leucine-rich) nuclear phosphoprotein 32 family, member B ANTXR1 8675 3707 3890 3665 anthrax toxin receptor 1 ANTXR1 407 0 182 0 anthrax toxin receptor 1 ANXA4 7073 2649 2912 2995 annexin A4 ANXA4 6706 3139 3467 3306 annexin A4 AP2M1 10816 5903 5748 5289 adaptor-related protein complex 2, mu 1 subunit AP2S1 9196 5601 6147 6145 adaptor-related protein complex 2, sigma 1 subunit AP2S1 3158 1994 2080 1973 adaptor-related protein complex 2, sigma 1 subunit AP3S1 25870 12650 13156 13580 adaptor-related protein complex 3, sigma 1 subunit AP4B1 172 0 156 164 adaptor-related protein complex 4, beta 1 subunit APEG1 296 0 0 0 aortic preferentially expressed protein 1 APEH 1219 741 1061 993 N-acylaminoacyl-peptide hydrolase APEX1 6819 2966 3205 3613 APEX nuclease (multifunctional DNA repair enzyme) 1 APLP2 18265 10080 10500 10480 amyloid beta (A4) precursor-like protein 2 APLP2 22189 12902 11720 13130 amyloid beta (A4) precursor-like protein 2 APOA1BP 4862 2189 2858 2671 apolipoprotein A-I binding protein APRT 1858 925 1062 1029 adenine phosphoribosyltransferase APRT 1207 609 598 521 adenine phosphoribosyltransferase ARG99 3253 399 492 648 ARG99 protein ARG99 4426 640 851 855 ARG99 protein ARG99 7650 1585 1799 1785 ARG99 protein ARHGAP21 172 0 0 0 Rho GTPase activating protein 21 ARHGDIB 1825 238 323 252 Rho GDP dissociation inhibitor (GDI) beta ARID5B 6614 4043 4148 3659 AT rich interactive domain 5B (MRF1-like) ARL6IP4 4043 2395 2149 2668 ADP-ribosylation-like factor 6 interacting protein 4 ARRB1 216 0 0 0 arrestin, beta 1 ARRB2 224 0 0 0 arrestin, beta 2 ARSA 804 418 489 555 arylsulfatase A ASAH1 5588 2281 2593 2231 N-acylsphingosine amidohydrolase (acid ceramidase) 1 ASAH1 3326 1922 1824 1772 N-acylsphingosine amidohydrolase (acid ceramidase) 1 ASPN 820 0 0 0 asporin (LRR class 1) ATF6 2168 1528 1525 1724 activating transcription factor 6 ATF7IP 1058 563 935 847 activating transcription factor 7 interacting protein 5-aminoimidazole-4-carboxamide ribonucleotide ATIC 5329 3003 3923 3860 formyltransferase/IMP cyclohydrolase ATP synthase, H+ transporting, mitochondrial F1 complex, alpha ATP5A1 28530 21131 22960 21600 subunit, isoform 1, cardiac muscle ATP synthase, H+ transporting, mitochondrial F1 complex, delta ATP5D 3304 1707 2064 1707 subunit ATP synthase, H+ transporting, mitochondrial F0 complex, ATP5G2 10803 6573 7690 7837 subunit c (subunit 9), isoform 2 ATP8B4 148 0 0 0 ATPase, Class I, type 8B, member 4
241 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description ATPIF1 6004 3517 3511 3816 ATPase inhibitory factor 1 AUTS2 10770 4365 3805 3713 autism susceptibility candidate 2 B1 578 0 603 575 parathyroid hormone-responsive B1 gene UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, B3GALT3 493 247 314 255 polypeptide 3 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, B3GALT3 182 0 0 0 polypeptide 3 B7 423 0 0 0 B7 gene B7H3 2066 1330 1578 1440 B7 homolog 3 BA108L7.2 1528 572 551 581 similar to rat tricarboxylate carrier-like protein BAALC 770 0 0 0 brain and acute leukemia, cytoplasmic BAALC 493 0 0 0 brain and acute leukemia, cytoplasmic BACE1 351 0 0 0 beta-site APP-cleaving enzyme 1 BAT8 549 0 0 208 HLA-B associated transcript 8 BBS1 1900 1239 1160 1241 Bardet-Biedl syndrome 1 BCAT2 912 461 417 450 branched chain aminotransferase 2, mitochondrial BCL3 4425 1174 1299 1361 B-cell CLL/lymphoma 3 BCL6 1780 818 639 594 B-cell CLL/lymphoma 6 (zinc finger protein 51) BCS1L 1277 861 1098 975 BCS1-like (yeast) BENE 13380 2846 1532 1936 BENE protein BIN1 1254 0 0 0 bridging integrator 1 BLVRB 2711 1406 1081 1271 biliverdin reductase B (flavin reductase (NADPH)) BMPER 498 0 0 0 BMP-binding endothelial regulator precursor protein BOC 5904 1491 943 1136 brother of CDO BOC 1372 0 0 0 brother of CDO BOC 330 0 0 0 brother of CDO BRE 2782 1975 2138 1820 brain and reproductive organ-expressed (TNFRSF1A modulator) BRP44L 3497 2440 3216 3321 brain protein 44-like BSCL2 3492 1545 1991 1768 Bernardinelli-Seip congenital lipodystrophy 2 (seipin) BTBD11 2282 553 355 527 BTB (POZ) domain containing 11 BTBD6 3087 1638 1869 1768 BTB (POZ) domain containing 6 BZRP 11090 4923 5075 4823 benzodiazapine receptor (peripheral) C10orf116 5515 1445 2034 2108 chromosome 10 open reading frame 116 C10orf56 3624 1147 1701 1348 chromosome 10 open reading frame 56 C10orf58 2347 766 807 845 chromosome 10 open reading frame 58 C10orf61 2916 1389 1915 1871 chromosome 10 open reading frame 61 C10orf61 1608 1061 1369 1219 chromosome 10 open reading frame 61 C10orf70 2719 1399 1402 1530 chromosome 10 open reading frame 70 C13orf18 1737 330 583 518 chromosome 13 open reading frame 18 C13orf18 1610 477 610 592 chromosome 13 open reading frame 18 C14orf116 1624 885 839 808 chromosome 14 open reading frame 116 C14orf116 1619 1129 1069 1144 chromosome 14 open reading frame 116 C14orf139 1185 712 593 690 chromosome 14 open reading frame 139 C14orf173 894 0 0 0 chromosome 14 open reading frame 173 C14orf78 1558 265 123 136 chromosome 14 open reading frame 78 C14orf79 356 0 0 311 chromosome 14 open reading frame 79 C14orf94 1605 739 758 777 chromosome 14 open reading frame 94 C16orf23 1103 0 0 0 chromosome 16 open reading frame 23 C16orf23 1506 0 778 598 chromosome 16 open reading frame 23 C17orf27 345 0 0 0 chromosome 17 open reading frame 27 C18orf10 2874 1642 1680 1716 chromosome 18 open reading frame 10 C18orf30 214 0 0 0 chromosome 18 open reading frame 30 core 1 UDP-galactose:N-acetylgalactosamine-alpha-R beta 1,3- C1GALT1 1463 429 543 545 galactosyltransferase core 1 UDP-galactose:N-acetylgalactosamine-alpha-R beta 1,3- C1GALT2 4507 2979 3045 2807 galactosyltransferase 2 C1orf38 254 0 0 0 chromosome 1 open reading frame 38 C1orf38 215 0 0 0 chromosome 1 open reading frame 38 C20orf161 407 0 0 0 chromosome 20 open reading frame 161 C20orf55 4991 3658 4367 4059 chromosome 20 open reading frame 55 [BLAST] C20orf82 20338 2973 4113 3655 chromosome 20 open reading frame 82 C21orf87 181 0 0 0 chromosome 21 open reading frame 87 C22orf16 1837 688 766 688 chromosome 22 open reading frame 16 C2orf22 973 535 506 505 chromosome 2 open reading frame 22 C2orf28 17360 11520 11580 11080 chromosome 2 open reading frame 28 C5orf13 2541 1155 702 897 chromosome 5 open reading frame 13 C6orf148 381 0 0 0 chromosome 6 open reading frame 148 C6orf151 616 0 0 0 chromosome 6 open reading frame 151 C6orf31 361 0 0 0 chromosome 6 open reading frame 31 C6orf31 238 0 0 0 chromosome 6 open reading frame 31 C6orf48 6020 3260 3764 4183 chromosome 6 open reading frame 48 C6orf49 6847 4377 4633 4454 chromosome 6 open reading frame 49 C6orf65 289 0 0 0 chromosome 6 open reading frame 65 C6orf74 11300 7367 9179 8601 chromosome 6 open reading frame 74 C6orf82 10974 3062 3793 3320 chromosome 6 open reading frame 82 C6orf84 207 0 0 0 chromosome 6 open reading frame 84 C7orf26 1550 990 1207 1145 chromosome 7 open reading frame 26 C9orf123 4677 3027 3032 2830 chromosome 9 open reading frame 123 C9orf3 11400 5061 4605 4760 chromosome 9 open reading frame 3 C9orf78 1501 924 1639 1379 chromosome 9 open reading frame 78 C9orf89 1906 1415 1438 1331 chromosome 9 open reading frame 89 C9orf95 4826 3416 4167 3960 chromosome 9 open reading frame 95 C9orf99 1749 835 1103 1057 chromosome 9 open reading frame 99 CA11 373 0 0 0 carbonic anhydrase XI CABLES1 725 310 306 328 Cdk5 and Abl enzyme substrate 1 CALD1 1509 666 856 809 caldesmon 1 CALD1 15223 6850 6242 6668 caldesmon 1 calcium/calmodulin-dependent protein kinase (CaM kinase) II CAMK2D 1332 734 648 569 delta CAMKK2 475 312 361 428 calcium/calmodulin-dependent protein kinase kinase 2, beta CAPG 4850 2471 2972 2663 capping protein (actin filament), gelsolin-like CAPN6 357 0 0 0 calpain 6
242 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description CAPS 792 0 0 0 calcyphosine CAPS2 162 0 119 0 calcyphosphine 2 CARHSP1 3911 1650 933 1043 calcium regulated heat stable protein 1, 24kDa caspase 2, apoptosis-related cysteine protease (neural precursor CASP2 255 0 0 309 cell expressed, developmentally down-regulated 2) CAT 7059 2777 3168 2846 catalase CAT 1675 686 619 655 catalase core-binding factor, runt domain, alpha subunit 2; translocated CBFA2T1 160 0 0 0 to, 1; cyclin D-related CBX6 3175 1707 2112 1811 chromobox homolog 6 CCDC5 2208 1283 1782 1821 coiled-coil domain containing 5 (spindle associated) CCDC6 4810 2849 2978 3332 coiled-coil domain containing 6 CCDC8 233 0 0 0 coiled-coil domain containing 8 CCNB1IP1 1719 1051 1347 1250 cyclin B1 interacting protein 1 CCND3 2928 1884 2603 2440 cyclin D3 CD79B 438 0 0 0 CD79B antigen (immunoglobulin-associated beta) CD81 20072 12200 10930 11530 CD81 antigen (target of antiproliferative antibody 1) CD99 24650 13707 10114 10280 CD99 antigen CD99L2 2254 1115 1256 1172 CD99 antigen-like 2 CDA 223 0 0 0 cytidine deaminase CDH11 5342 1187 1645 1411 cadherin 11, type 2, OB-cadherin (osteoblast) CDH11 236 0 0 0 cadherin 11, type 2, OB-cadherin (osteoblast) CDH11 321 0 0 212 cadherin 11, type 2, OB-cadherin (osteoblast) CDK5RAP2 3387 1309 1368 1666 CDK5 regulatory subunit associated protein 2 CDK5RAP2 1822 1090 998 986 CDK5 regulatory subunit associated protein 2 CDKN1C 847 447 390 392 cyclin-dependent kinase inhibitor 1C (p57, Kip2) CDKN2C 1725 838 586 666 cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) cyclin-dependent kinase inhibitor 3 (CDK2-associated dual CDKN3 598 290 353 324 specificity phosphatase) CDO1 19049 4176 5024 4513 cysteine dioxygenase, type I CDO1 584 0 0 0 cysteine dioxygenase, type I CDW92 371 189 190 152 CDW92 antigen CECR2 127 0 0 0 cat eye syndrome chromosome region, candidate 2 CEPT1 192 0 0 0 choline/ethanolaminephosphotransferase CETN2 5909 3576 4803 4084 centrin, EF-hand protein, 2 CGI-30 1774 0 0 1299 CGI-30 protein CGI-30 1887 0 1282 1177 CGI-30 protein CGI-30 186 0 0 0 CGI-30 protein CGI-49 566 355 394 334 CGI-49 protein CGI-51 2577 1563 1647 1720 CGI-51 protein CHD4 2495 1506 1915 1587 chromodomain helicase DNA binding protein 4 CHI3L1 3785 823 1212 1120 chitinase 3-like 1 (cartilage glycoprotein-39) CHST10 829 516 505 532 carbohydrate sulfotransferase 10 CHST3 2579 1032 1083 973 carbohydrate (chondroitin 6) sulfotransferase 3 CHST6 1065 0 646 522 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6 CIB2 188 0 0 0 calcium and integrin binding family member 2 CIRBP 358 0 0 0 cold inducible RNA binding protein Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy- CITED2 10905 4152 3742 3326 terminal domain, 2 CKAP1 6937 3678 3408 3652 cytoskeleton associated protein 1 CKAP1 6786 3788 3814 3980 cytoskeleton associated protein 1 CKAP1 6683 4199 4221 4362 cytoskeleton associated protein 1 CKLFSF5 222 0 0 0 chemokine-like factor super family 5 CKLFSF7 3937 2214 1839 1773 chemokine-like factor super family 7 CKS1B 3406 1892 2513 2390 CDC28 protein kinase regulatory subunit 1B CLCN4 609 0 449 460 chloride channel 4 chloride channel 5 (nephrolithiasis 2, X-linked, Dent disease) CLCN5 168 0 202 134 [BLAST] CLIC3 1587 0 0 0 chloride intracellular channel 3 CLSTN1 6990 4578 4266 4420 calsyntenin 1 CMKLR1 288 0 0 0 chemokine-like receptor 1 CNN2 1546 685 960 843 calponin 2 CNN3 5845 3443 3918 3496 calponin 3, acidic CNNM2 408 0 0 275 cyclin M2 CNP 2412 1325 1422 1329 2',3'-cyclic nucleotide 3' phosphodiesterase COL11A1 13620 2472 4386 3257 collagen, type XI, alpha 1 COL11A1 19940 5187 5407 4298 collagen, type XI, alpha 1 COL11A1 852 285 379 260 collagen, type XI, alpha 1 COL14A1 432 0 134 0 collagen, type XIV, alpha 1 (undulin) COL1A1 541 0 0 0 collagen, type I, alpha 1 COL1A2 2229 469 608 589 collagen, type I, alpha 2 COL27A1 938 0 0 0 collagen, type XXVII, alpha 1 COL5A1 3294 1920 874 1229 collagen, type V, alpha 1 COL5A2 8302 3438 3568 2639 collagen, type V, alpha 2 COL8A2 1819 406 428 399 collagen, type VIII, alpha 2 COL8A2 2727 782 665 848 collagen, type VIII, alpha 2 COLM 22390 3682 3687 4017 collomin COMMD1 5175 3365 3837 3589 copper metabolism (Murr1) domain containing 1 COMMD4 1664 1022 1258 1018 COMM domain containing 4 COP9 constitutive photomorphogenic homolog subunit 6 COPS6 5997 3945 4400 4459 (Arabidopsis) COP9 constitutive photomorphogenic homolog subunit 7A COPS7A 2504 1787 2000 1945 (Arabidopsis) COPZ1 4247 2844 4271 4372 coatomer protein complex, subunit zeta 1 CORO1B 1872 1285 1408 1404 coronin, actin binding protein, 1B COX7A1 7804 4055 4694 4860 cytochrome c oxidase subunit VIIa polypeptide 1 (muscle) CPNE3 4366 2026 2228 2193 copine III CPS1 356 0 240 0 carbamoyl-phosphate synthetase 1, mitochondrial CPT1A 155 0 0 0 carnitine palmitoyltransferase 1A (liver) CRI1 16250 11180 12390 11544 CREBBP/EP300 inhibitor 1 CROCC 249 0 0 0 ciliary rootlet coiled-coil, rootletin CRR9 6777 4798 6227 6238 cisplatin resistance related protein CRR9p
243 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description CRTAP 15950 8268 6972 7478 cartilage associated protein CRYAB 6760 2495 3416 3177 crystallin, alpha B CSDA 11450 5209 5281 5014 cold shock domain protein A CSDA 29390 15780 17790 17090 cold shock domain protein A CSGlcA-T 2511 1335 1871 1704 KIAA1402 protein CSGlcA-T 1722 1170 1529 1404 KIAA1402 protein CTGF 23800 3905 3945 3052 connective tissue growth factor CTMP 497 0 0 537 C-terminal modulator protein CTSB 6430 1979 1748 2090 cathepsin B CTSB 3571 1114 1015 1155 cathepsin B CTSB 3488 1749 1505 1792 cathepsin B CTSB 17020 9853 10310 9390 cathepsin B CTSD 1465 426 423 423 cathepsin D (lysosomal aspartyl protease) CTSK 10010 4815 4591 4556 cathepsin K (pycnodysostosis) CTSZ 454 249 347 347 cathepsin Z CUL4B 2238 1281 1333 1332 cullin 4B CXCL14 311 0 0 0 chemokine (C-X-C motif) ligand 14 CXX1 9887 5896 5302 5401 CAAX box 1 CYBRD1 16130 4641 5184 5069 cytochrome b reductase 1 CYBRD1 2213 1083 1063 1111 cytochrome b reductase 1 CYFIP2 528 0 0 0 cytoplasmic FMR1 interacting protein 2 CYP19A1 125 0 0 0 cytochrome P450, family 19, subfamily A, polypeptide 1 CYR61 9832 1871 2202 2238 cysteine-rich, angiogenic inducer, 61 CYR61 20150 3899 5925 5210 cysteine-rich, angiogenic inducer, 61 DAAM2 689 0 0 0 dishevelled associated activator of morphogenesis 2 disabled homolog 2, mitogen-responsive phosphoprotein DAB2 5761 1646 1782 1744 (Drosophila) disabled homolog 2, mitogen-responsive phosphoprotein DAB2 6023 2048 1845 2087 (Drosophila) DBN1 1141 479 607 547 drebrin 1 DCL-1 3006 1217 1255 1356 type I transmembrane C-type lectin receptor DCL-1 DCN 3432 1094 1291 1490 decorin DCTN1 1675 0 0 0 dynactin 1 (p150, glued homolog, Drosophila) DCTN3 6132 4472 5100 4786 dynactin 3 (p22) DCXR 2098 933 1084 1081 dicarbonyl/L-xylulose reductase DDAH1 6847 1774 2133 2237 dimethylarginine dimethylaminohydrolase 1 DDAH2 900 0 0 0 dimethylarginine dimethylaminohydrolase 2 DDAH2 1049 0 0 0 dimethylarginine dimethylaminohydrolase 2 DDO 242 0 0 0 D-aspartate oxidase DDX6 5984 3529 3133 3807 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 DEFB1 2696 824 950 842 defensin, beta 1 DHRS1 680 338 412 316 dehydrogenase/reductase (SDR family) member 1 DIO3 840 358 347 0 deiodinase, iodothyronine, type III DIXDC1 1219 574 626 648 DIX domain containing 1 DJ971N18.2 4324 3044 3019 3142 hypothetical protein DJ971N18.2 DKFZP434B044 1831 602 359 537 hypothetical protein DKFZp434B044 DKFZp434C0328 152 0 0 0 hypothetical protein DKFZp434C0328 DKFZp434D0215 2175 959 997 1097 SH3 domain protein D19 DKFZp434L142 301 0 0 0 hypothetical protein DKFZp434L142 DKFZp547K1113 314 0 172 0 hypothetical protein DKFZp547K1113 DKFZP564C186 719 0 753 0 DKFZP564C186 protein DKFZp564I1922 1005 234 248 269 adlican DKFZP564K0822 7373 3992 3692 3892 hypothetical protein DKFZp564K0822 DKFZp761A132 644 0 0 0 hypothetical protein DKFZp761A132 DKFZp762C186 889 373 483 436 tangerin DLX5 342 0 0 0 distal-less homeo box 5 DMPK 597 264 303 313 dystrophia myotonica-protein kinase DNAJC8 1489 1025 1218 1007 DnaJ (Hsp40) homolog, subfamily C, member 8 DNASE1L1 2430 1317 1464 1336 deoxyribonuclease I-like 1 DOC1 251 0 0 175 downregulated in ovarian cancer 1 DOK1 2226 641 699 722 docking protein 1, 62kDa (downstream of tyrosine kinase 1) DPYSL3 3362 934 735 728 dihydropyrimidinase-like 3 DSCR2 5778 3238 4506 3980 Down syndrome critical region gene 2 DSPG3 226 0 0 0 dermatan sulfate proteoglycan 3 DST 4760 2923 2764 2252 dystonin DST 712 0 0 672 dystonin DSTN 33190 23300 23556 24057 destrin (actin depolymerizing factor) DTYMK 443 0 0 0 deoxythymidylate kinase (thymidylate kinase) DTYMK 210 0 0 0 deoxythymidylate kinase (thymidylate kinase) DUT 8143 5251 5228 5257 dUTP pyrophosphatase DZIP1 548 237 385 279 DAZ interacting protein 1 DZIP1 834 469 618 547 DAZ interacting protein 1 EBPL 2851 955 903 946 emopamil binding protein-like ECH1 3334 1742 1350 1445 enoyl Coenzyme A hydratase 1, peroxisomal eukaryotic translation elongation factor 1 delta (guanine EEF1D 20067 12930 13381 12730 nucleotide exchange protein) EFEMP1 6840 1375 1053 1276 EGF-containing fibulin-like extracellular matrix protein 1 EFEMP1 30290 7545 5476 6472 EGF-containing fibulin-like extracellular matrix protein 1 EFHD1 657 0 0 0 EF hand domain containing 1 EFNA1 2281 749 625 760 ephrin-A1 EIF2S3 3935 2485 2417 2855 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa EIF4B 7045 4337 4079 4488 eukaryotic translation initiation factor 4B EIF4G3 1956 1094 1570 1386 eukaryotic translation initiation factor 4 gamma, 3 ELL2 6228 2646 2387 2429 elongation factor, RNA polymerase II, 2 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, ELOVL1 2508 1521 1770 1849 yeast)-like 1 EMILIN1 2045 624 924 923 elastin microfibril interfacer 1 EMP2 3917 2028 2208 2071 epithelial membrane protein 2 ENAH 3082 1009 1627 1338 enabled homolog (Drosophila) ENAH 734 257 313 282 enabled homolog (Drosophila) ENG 5663 1159 1455 1134 endoglin (Osler-Rendu-Weber syndrome 1) ENPP1 7845 2381 3068 2891 ectonucleotide pyrophosphatase/phosphodiesterase 1
244 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description ENPP2 7690 2009 1706 1870 ectonucleotide pyrophosphatase/phosphodiesterase 2 ENPP2 2046 672 546 626 ectonucleotide pyrophosphatase/phosphodiesterase 2 ENPP6 216 0 0 0 ectonucleotide pyrophosphatase/phosphodiesterase 6 EPB41L1 407 0 0 0 erythrocyte membrane protein band 4.1-like 1 EPHB4 361 0 0 0 EphB4 ERG 2530 412 418 442 v-ets erythroblastosis virus E26 oncogene like (avian) ESD 11880 8284 9377 9295 esterase D/formylglutathione hydrolase ESD 15255 11000 12810 12760 esterase D/formylglutathione hydrolase ETFB 2905 1537 1909 1768 electron-transfer-flavoprotein, beta polypeptide ETV1 1031 0 0 0 ets variant gene 1 EVL 645 0 408 365 Enah/Vasp-like EXOSC4 1922 1429 1613 1508 exosome component 4 EXTL2 3531 1585 1735 1782 exostoses (multiple)-like 2 FAM13C1 409 0 0 0 family with sequence similarity 13, member C1 FAM14A 3214 1800 2278 2307 family with sequence similarity 14, member A FAM20A 721 0 0 0 family with sequence similarity 20, member A FAM20C 20320 7520 8198 5960 family with sequence similarity 20, member C FAM20C 912 0 0 0 family with sequence similarity 20, member C FAM26B 853 430 304 361 family with sequence similarity 26, member B FAM26B 831 0 0 312 family with sequence similarity 26, member B FAM38B 729 0 0 0 family with sequence similarity 38, member B FANCF 500 0 371 399 Fanconi anemia, complementation group F FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 FARP1 2114 1431 1368 1546 (chondrocyte-derived) FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 FARP1 1658 0 0 0 (chondrocyte-derived) FBI4 219 0 0 0 FBI4 protein FBN1 7668 3617 3560 3612 fibrillin 1 (Marfan syndrome) FBXL18 457 212 251 290 F-box and leucine-rich repeat protein 18 FBXO16 225 0 243 0 F-box protein 16 FBXO9 6499 3246 4497 4265 F-box protein 9 FGD4 763 280 431 341 FGD1 family, member 4 FGF1 7589 649 674 645 fibroblast growth factor 1 (acidic) FGF1 3632 427 383 395 fibroblast growth factor 1 (acidic) FGF1 1091 259 249 232 fibroblast growth factor 1 (acidic) fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, FGFR2 4205 1321 1096 1176 Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, FGFR2 285 0 0 0 Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) FGG 25840 12230 8850 9355 fibrinogen, gamma polypeptide FHIT 372 0 201 0 fragile histidine triad gene FHL1 14870 4501 4193 4314 four and a half LIM domains 1 FHL1 1758 690 731 622 four and a half LIM domains 1 FHL2 7617 1962 1754 2056 four and a half LIM domains 2 FKBP7 1283 348 540 453 FK506 binding protein 7 FKSG32 1289 840 1221 1070 hypothetical protein FKSG32 FLJ00012 214 0 0 0 hypothetical protein FLJ00012 FLJ00133 380 0 0 0 FLJ00133 protein FLJ00133 1599 0 0 417 FLJ00133 protein FLJ10099 4575 2606 3252 3496 hypothetical protein FLJ10099 FLJ10312 435 0 0 0 hypothetical protein FLJ10312 FLJ10613 164 0 0 0 hypothetical protein FLJ10613 FLJ10916 777 415 459 346 hypothetical protein FLJ10916 FLJ10970 706 278 344 257 hypothetical protein FLJ10970 FLJ11175 752 290 350 250 hypothetical protein FLJ11175 FLJ11175 2136 857 1292 1143 hypothetical protein FLJ11175 FLJ12118 2307 787 649 963 hypothetical protein FLJ12118 FLJ12436 1277 820 767 878 hypothetical protein FLJ12436 FLJ12681 493 0 373 297 hypothetical protein FLJ12681 FLJ12681 786 406 590 528 hypothetical protein FLJ12681 FLJ14001 992 580 544 577 hypothetical protein FLJ14001 FLJ14054 247 0 0 0 hypothetical protein FLJ14054 FLJ14299 1217 0 0 0 hypothetical protein FLJ14299 FLJ14346 5874 4148 4243 3583 hypothetical protein FLJ14346 FLJ14834 613 351 316 257 hypothetical protein FLJ14834 FLJ20202 485 198 211 209 FLJ20202 protein FLJ20241 868 532 550 581 putative NFkB activating protein FLJ20308 220 0 0 265 hypothetical protein FLJ20308 FLJ20366 1976 718 917 923 hypothetical protein FLJ20366 FLJ20519 456 269 316 376 hypothetical protein FLJ20519 FLJ20533 357 0 245 330 hypothetical protein FLJ20533 FLJ20542 1217 863 1153 960 hypothetical protein FLJ20542 FLJ21127 964 602 712 631 hypothetical protein FLJ21127 FLJ21347 1618 778 641 650 hypothetical protein FLJ21347 FLJ21839 329 0 0 0 hypothetical protein FLJ21839 FLJ22729 214 0 0 0 hypothetical protein FLJ22729 FLJ23091 2854 995 1068 1000 putative NFkB activating protein 373 FLJ23091 1895 675 686 725 putative NFkB activating protein 373 FLJ23129 220 0 154 166 hypothetical protein FLJ23129 likely ortholog of mouse tumor necrosis-alpha-induced adipose- FLJ23153 5733 458 665 499 related protein FLJ23447 1702 0 0 0 hypothetical protein FLJ23447 FLJ25124 1900 652 570 517 hypothetical protein FLJ25124 FLJ36031 3854 1644 1673 1845 hypothetical protein FLJ36031 FLJ39155 3475 1325 1038 1289 hypothetical protein FLJ39155 FLN29 2028 1064 825 940 FLN29 gene product FLNB 624 0 0 0 filamin B, beta (actin binding protein 278) FLOT2 2258 1259 1124 1153 flotillin 2
245 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description FNBP2 334 0 0 310 formin binding protein 2 FOXA3 541 0 0 0 forkhead box A3 FOXC1 22240 8392 8403 8671 forkhead box C1 FOXO1A 1438 1097 1208 984 forkhead box O1A (rhabdomyosarcoma) FOXQ1 144 0 0 0 forkhead box Q1 FRAG1 928 426 578 416 FGF receptor activating protein 1 FRAG1 672 491 0 523 FGF receptor activating protein 1 FSCN1 726 0 0 0 fascin homolog 1, actin-bundling protein FTO 5014 3002 3277 3298 fatso FUCA2 6909 3885 4202 4325 fucosidase, alpha-L- 2, plasma FURIN 1381 926 941 882 furin (paired basic amino acid cleaving enzyme) FXYD5 14310 9707 10070 10320 FXYD domain containing ion transport regulator 5 FXYD5 8824 6035 6318 5907 FXYD domain containing ion transport regulator 5 FXYD6 6127 1821 1495 1633 FXYD domain containing ion transport regulator 6 FYB 176 0 0 0 FYN binding protein (FYB-120/130) FZD4 307 0 0 286 frizzled homolog 4 (Drosophila) FZD8 8677 1388 1138 1319 frizzled homolog 8 (Drosophila) FZD8 13055 2926 2602 2591 frizzled homolog 8 (Drosophila) FZD8 931 0 0 0 frizzled homolog 8 (Drosophila) GAB1 513 267 370 310 GRB2-associated binding protein 1 GABRA4 1409 281 368 355 gamma-aminobutyric acid (GABA) A receptor, alpha 4 GABRA4 772 0 0 0 gamma-aminobutyric acid (GABA) A receptor, alpha 4 GABRB1 420 176 162 144 gamma-aminobutyric acid (GABA) A receptor, beta 1 GADD45A 3853 1706 1125 1234 growth arrest and DNA-damage-inducible, alpha growth arrest and DNA-damage-inducible, gamma interacting GADD45GIP1 2062 1155 1452 1579 protein 1 GALE 2983 2029 1865 1890 galactose-4-epimerase, UDP- GALM 518 213 0 180 galactose mutarotase (aldose 1-epimerase) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- GALNT10 3719 981 1194 1154 acetylgalactosaminyltransferase 10 (GalNAc-T10) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- GALNT10 1147 396 420 399 acetylgalactosaminyltransferase 10 (GalNAc-T10) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- GALNT11 3389 1856 1775 1907 acetylgalactosaminyltransferase 11 (GalNAc-T11) UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- GALNT2 19370 9101 6545 8237 acetylgalactosaminyltransferase 2 (GalNAc-T2) GALT 787 449 368 447 galactose-1-phosphate uridylyltransferase GAS1 10673 523 547 621 growth arrest-specific 1 GATA3 314 0 0 0 GATA binding protein 3 GBGT1 979 0 0 0 globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 GCHFR 451 182 0 0 GTP cyclohydrolase I feedback regulator GDF10 434 0 0 0 growth differentiation factor 10 growth differentiation factor 5 (cartilage-derived morphogenetic GDF5 1415 0 0 0 protein-1) GHR 3045 943 1360 1045 growth hormone receptor GLB1 4211 2424 2484 2658 galactosidase, beta 1 GLCCI1 1163 347 406 361 glucocorticoid induced transcript 1 GLCCI1 1739 545 544 610 glucocorticoid induced transcript 1 GLI2 346 0 0 0 GLI-Kruppel family member GLI2 GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly GLI3 1104 729 649 612 syndrome) GLIPR1 12430 2707 3630 3051 GLI pathogenesis-related 1 (glioma) GLIPR1 5550 1270 1916 1695 GLI pathogenesis-related 1 (glioma) GLIPR1 13730 4169 4532 3795 GLI pathogenesis-related 1 (glioma) GLIS2 1483 767 881 863 Kruppel-like zinc finger protein GLIS2 GLRX 29160 10690 7839 8418 glutaredoxin (thioltransferase) GLRX 54788 33970 23680 26069 glutaredoxin (thioltransferase) GLUL 10710 6118 6449 6147 glutamate-ammonia ligase (glutamine synthase) GM2A 1291 489 482 567 GM2 ganglioside activator GM2A 673 205 264 249 GM2 ganglioside activator [BLAST] GMDS 5853 1386 1360 1354 GDP-mannose 4,6-dehydratase GMDS 4732 1279 1355 1303 GDP-mannose 4,6-dehydratase GMPR2 2179 1147 1214 1252 guanosine monophosphate reductase 2 GMPS 234 0 0 0 guanine monphosphate synthetase GOLPH2 11990 2548 3126 2983 golgi phosphoprotein 2 GP1BB 332 0 0 0 glycoprotein Ib (platelet), beta polypeptide GPAA1 4937 3068 3849 3722 GPAA1P anchor attachment protein 1 homolog (yeast) GPAA1 6159 3871 4363 4459 GPAA1P anchor attachment protein 1 homolog (yeast) GPM6B 1001 0 0 0 glycoprotein M6B GPM6B 276 0 0 105 glycoprotein M6B GPM6B 1020 0 0 0 glycoprotein M6B GPNMB 8367 2395 2282 2523 glycoprotein (transmembrane) nmb GPR125 94 0 0 0 G protein-coupled receptor 125 GPR88 18080 1486 1820 1641 G-protein coupled receptor 88 GPRC5C 2070 968 955 1123 G protein-coupled receptor, family C, group 5, member C GPS1 953 678 858 740 G protein pathway suppressor 1 GPSM1 2259 920 1106 1166 G-protein signalling modulator 1 (AGS3-like, C. elegans) GPSN2 3734 1680 2101 1990 glycoprotein, synaptic 2 GPX1 22559 12122 10790 11300 glutathione peroxidase 1 GREM1 2797 482 904 642 gremlin 1 homolog, cysteine knot superfamily (Xenopus laevis) GRHPR 2654 1487 1615 1822 glyoxylate reductase/hydroxypyruvate reductase GRHPR 3433 2114 2464 2259 glyoxylate reductase/hydroxypyruvate reductase GRHPR 2766 1870 1953 1954 glyoxylate reductase/hydroxypyruvate reductase GRN 4449 2299 2628 2114 granulin GRN 3896 2108 2255 1887 granulin GRN 2348 1274 1351 1262 granulin GRSP1 1776 273 431 328 GRP1-binding protein GRSP1 GSN 5578 2583 2148 2366 gelsolin (amyloidosis, Finnish type) GSTA4 7375 2819 3500 3002 glutathione S-transferase A4 GSTK1 2409 554 717 681 glutathione S-transferase kappa 1 GSTM4 444 0 0 0 glutathione S-transferase M4 GSTO2 1110 399 439 506 glutathione S-transferase omega 2
246 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description GSTT2 338 0 0 0 glutathione S-transferase theta 2 GTF3A 9074 4582 5865 5804 general transcription factor IIIA GYG 8487 3760 4015 4053 glycogenin H2AFJ 8154 4471 4551 4274 H2A histone family, member J H2AFJ 9788 5630 5386 5373 H2A histone family, member J H3F3A 44785 26900 25420 26253 H3 histone, family 3A H3F3A 44802 27680 27360 27180 H3 histone, family 3A H3F3A 37730 24660 24658 24084 H3 histone, family 3A H6PD 1877 1101 1061 1071 hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) HADH2 5219 2943 4296 3724 hydroxyacyl-Coenzyme A dehydrogenase, type II hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme HADHB 10459 6385 7344 7730 A thiolase/enoyl-Coenzyme A hydratase beta subunit HADHSC 1889 789 917 899 L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain HADHSC 1287 575 711 614 L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain HAL 1224 177 200 173 histidine ammonia-lyase HAPLN1 16202 2256 3256 2447 hyaluronan and proteoglycan link protein 1 HAPLN1 39178 12253 10510 9976 hyaluronan and proteoglycan link protein 1 HAPLN1 35452 13160 15997 11820 hyaluronan and proteoglycan link protein 1 HCFC1R1 2132 649 514 552 host cell factor C1 regulator 1 (XPO1 dependant) HDAC1 5855 3959 3778 3702 histone deacetylase 1 HDAC4 887 436 598 588 histone deacetylase 4 HDLBP 2037 1170 1623 1418 high density lipoprotein binding protein (vigilin) HFE 231 0 0 0 hemochromatosis HIBADH 2835 1973 1726 1987 3-hydroxyisobutyrate dehydrogenase HIC 10010 6460 5147 5333 I-mfa domain-containing protein HIRIP5 3997 2870 3031 3199 HIRA interacting protein 5 HIST3H2A 436 0 203 0 histone 3, H2a HLA-DMA 618 267 283 273 major histocompatibility complex, class II, DM alpha HMBS 1427 693 1036 880 hydroxymethylbilane synthase HMG20B 1351 764 1053 973 high-mobility group 20B HMGB3 1091 379 464 507 high-mobility group box 3 HN1 677 349 426 425 hematological and neurological expressed 1 HNLF 2598 729 865 896 putative NFkB activating protein HNLF hnRNPA3 2651 1181 1970 1860 heterogeneous nuclear ribonucleoprotein A3 hnRNPA3 4975 2717 3445 3423 heterogeneous nuclear ribonucleoprotein A3 HNRPA3 7037 3505 4911 4634 heterogeneous nuclear ribonucleoprotein A3 HOXA10 2756 1124 1205 1094 homeo box A10 HOXA13 236 0 0 0 homeo box A13 HRB2 8483 2351 2768 2235 HIV-1 rev binding protein 2 HRB2 8809 2903 2676 2379 HIV-1 rev binding protein 2 HRBL 1369 590 706 547 HIV-1 Rev binding protein-like HRMT1L1 2583 1762 1714 1787 HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae) HRSP12 1436 912 1096 1286 heat-responsive protein 12 HSCARG 1576 695 914 929 HSCARG protein HSD17B4 5536 3310 4976 5165 hydroxysteroid (17-beta) dehydrogenase 4 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid HSD3B7 595 0 0 0 delta-isomerase 7 HSPB1 3229 0 0 0 heat shock 27kDa protein 1 HSPB7 276 0 0 0 heat shock 27kDa protein family, member 7 (cardiovascular) HSPCB 28610 19555 22240 21620 heat shock 90kDa protein 1, beta HSU79266 656 0 0 0 protein predicted by clone 23627 HT036 943 421 511 635 hypothetical protein HT036 HT036 1436 751 871 689 hypothetical protein HT036 HYAL2 1145 668 979 883 hyaluronoglucosaminidase 2 inhibitor of DNA binding 3, dominant negative helix-loop-helix ID3 2850 380 549 562 protein IDH1 6018 1798 1687 1866 isocitrate dehydrogenase 1 (NADP+), soluble IDH1 8029 2448 2260 2761 isocitrate dehydrogenase 1 (NADP+), soluble IF 1190 438 322 395 I factor (complement) IF 342 0 0 0 I factor (complement) IFI16 3790 1289 1447 1430 interferon, gamma-inducible protein 16 IFI16 3517 1275 1381 1303 interferon, gamma-inducible protein 16 IFITM1 41437 3280 4328 3938 interferon induced transmembrane protein 1 (9-27) IFITM1 32620 2921 3158 2998 interferon induced transmembrane protein 1 (9-27) IFITM3 49907 7913 10070 7657 interferon induced transmembrane protein 3 (1-8U) IFITM3 61864 10650 12780 10540 interferon induced transmembrane protein 3 (1-8U) IL11RA 534 0 0 0 interleukin 11 receptor, alpha IL13RA1 6099 3558 4024 3528 interleukin 13 receptor, alpha 1 IMPA2 459 0 0 167 inositol(myo)-1(or 4)-monophosphatase 2 IMPDH2 10244 5562 4750 5823 IMP (inosine monophosphate) dehydrogenase 2 ISCU 11893 6901 7368 7132 iron-sulfur cluster assembly enzyme ISYNA1 550 0 0 0 myo-inositol 1-phosphate synthase A1 ITGA10 8008 2829 2501 2438 integrin, alpha 10 ITGA9 393 0 0 132 integrin, alpha 9 ITGB5 27545 15230 11780 12560 integrin, beta 5 ITM2C 6830 2545 2205 2379 integral membrane protein 2C JAG1 18146 6300 7071 6363 jagged 1 (Alagille syndrome) JAG1 11670 5154 6248 5161 jagged 1 (Alagille syndrome) JAG1 1962 880 1163 972 jagged 1 (Alagille syndrome) JAK2 3016 664 719 870 Janus kinase 2 (a protein tyrosine kinase) JAK2 1024 338 300 434 Janus kinase 2 (a protein tyrosine kinase) JTV1 527 0 586 575 JTV1 gene JWA 28315 10630 9516 10120 cytoskeleton related vitamin A responsive protein KAL1 2659 675 1176 914 Kallmann syndrome 1 sequence KBTBD4 636 0 0 0 kelch repeat and BTB (POZ) domain containing 4 KCNE3 307 0 0 154 potassium voltage-gated channel, Isk-related family, member 3 KCNJ15 471 0 0 0 potassium inwardly-rectifying channel, subfamily J, member 15 KCNJ15 1258 0 271 255 potassium inwardly-rectifying channel, subfamily J, member 15 KCNQ3 375 0 0 218 potassium voltage-gated channel, KQT-like subfamily, member 3 KHSRP 420 0 350 342 KH-type splicing regulatory protein (FUSE binding protein 2) KIAA0114 2098 1149 1207 1209 KIAA0114 gene product KIAA0141 986 393 519 461 KIAA0141 gene product
247 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description KIAA0182 823 0 0 626 KIAA0182 protein KIAA0367 7947 2440 2474 2555 KIAA0367 KIAA0367 1554 575 546 550 KIAA0367 KIAA0420 188 0 0 0 KIAA0420 gene product KIAA0494 5225 3750 4617 4610 KIAA0494 gene product KIAA0494 635 0 0 0 KIAA0494 gene product KIAA0513 717 382 0 355 KIAA0513 gene product KIAA0527 4671 2203 2144 2185 KIAA0527 protein KIAA0582 791 477 406 443 KIAA0582 KIAA0586 421 0 0 0 KIAA0586 KIAA0590 385 0 368 308 KIAA0590 gene product KIAA0602 1258 606 621 758 KIAA0602 protein KIAA0683 405 221 310 304 KIAA0683 gene product KIAA0759 520 307 416 396 KIAA0759 KIAA0789 825 0 0 0 KIAA0789 gene product KIAA0984 118 0 0 162 KIAA0984 protein KIAA1026 752 236 316 330 KIAA1026 protein KIAA1102 3251 1207 1273 1393 KIAA1102 protein KIAA1102 3876 1462 1840 1530 KIAA1102 protein KIAA1190 413 0 0 0 hypothetical protein KIAA1190 KIAA1196 759 392 353 366 KIAA1196 protein KIAA1279 3675 2247 2290 2414 KIAA1279 KIAA1755 1391 544 339 443 KIAA1755 protein KIAA1815 1369 335 436 396 KIAA1815 KIAA1856 1469 1005 947 1134 KIAA1856 protein KIAA1912 523 0 0 0 KIAA1912 protein KIAA1913 623 172 243 223 KIAA1913 KIAA1959 140 0 121 0 nm23-phosphorylated unknown substrate KIAA1959 701 261 295 290 nm23-phosphorylated unknown substrate KIAA1970 405 0 0 0 KIAA1970 protein KIF1C 465 0 0 552 kinesin family member 1C KLC2L 231 0 366 0 kinesin light chain 2-like LAMA4 2630 919 791 734 laminin, alpha 4 LAMB1 1087 285 294 269 laminin, beta 1 LANCL1 4003 2405 2153 2164 LanC lantibiotic synthetase component C-like 1 (bacterial) LAPTM4B 6351 3237 2795 3171 lysosomal associated protein transmembrane 4 beta LARS2 571 0 0 0 leucyl-tRNA synthetase 2, mitochondrial LBP 11100 2513 2445 2151 lipopolysaccharide binding protein LBP 11669 2668 1885 2119 lipopolysaccharide binding protein LDHB 19760 9621 9946 11395 lactate dehydrogenase B LDHB 27856 13690 16500 16770 lactate dehydrogenase B LOC114990 3684 1509 1871 1924 hypothetical protein BC013767 LOC116236 228 0 0 0 hypothetical protein LOC116236 LOC118430 361 0 0 0 small breast epithelial mucin LOC128344 1273 0 0 0 hypothetical protein LOC128344 LOC129642 313 0 0 0 hypothetical protein BC016005 LOC132321 155 0 123 0 hypothetical protein LOC132321 LOC134147 1783 322 0 286 hypothetical protein BC001573 LOC143458 6990 2650 2473 2640 hypothetical protein LOC143458 LOC144347 224 0 0 0 hypothetical protein LOC144347 LOC148418 141 0 0 0 dnaj-like protein LOC152573 667 0 0 0 hypothetical protein BC012029 LOC159090 1832 1088 2105 1805 similar to hypothetical protein MGC17347 LOC221091 2295 430 328 380 similar to hypothetical protein LOC284106 1461 685 720 674 hypothetical protein LOC284106 LOC285550 2359 1110 1134 1192 hypothetical protein LOC285550 LOC339834 196 0 137 0 hypothetical protein LOC339834 LOC340061 1768 546 523 583 hypothetical protein LOC340061 LOC374395 3824 2455 2367 2329 similar to RIKEN cDNA 1810059G22 LOC387758 3716 685 950 660 similar to RIKEN cDNA 1110018M03 LOC387758 21887 5471 4179 4660 similar to RIKEN cDNA 1110018M03 LOC389792 755 0 0 0 similar to RIKEN cDNA 2610524G09 LOC401494 898 261 258 302 similar to RIKEN 4933428I03 LOC83468 4956 1221 1182 1107 gycosyltransferase LOC83468 2944 0 0 0 gycosyltransferase LOC90378 261 0 0 0 atherin LOC90410 291 0 0 351 intraflagellar transport protein IFT20 LOC91137 1836 1153 1461 1463 hypothetical protein BC017169 LOH11CR2A 1197 393 289 307 loss of heterozygosity, 11, chromosomal region 2, gene A LOXL3 7155 3327 1962 1982 lysyl oxidase-like 3 LPHN1 342 0 0 0 latrophilin 1 LRFN3 401 195 271 199 leucine rich repeat and fibronectin type III domain containing 3 LRIG3 1188 495 669 510 leucine-rich repeats and immunoglobulin-like domains 3 low density lipoprotein-related protein 1 (alpha-2-macroglobulin LRP1 2640 1158 1014 937 receptor) LRP5 469 0 0 0 low density lipoprotein receptor-related protein 5 LRRC14 252 0 0 0 leucine rich repeat containing 14 LRRC2 130 0 0 0 leucine rich repeat containing 2 LRSAM1 246 0 241 0 leucine rich repeat and sterile alpha motif containing 1 LSM4 3322 1948 2381 2136 LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) LTB4DH 7441 3623 3726 3978 leukotriene B4 12-hydroxydehydrogenase LTB4R 206 0 0 0 leukotriene B4 receptor LTBP1 17770 9651 7570 6730 latent transforming growth factor beta binding protein 1 LTBP2 5199 2082 1697 1668 latent transforming growth factor beta binding protein 2 LTBP3 3399 1204 1095 1167 latent transforming growth factor beta binding protein 3 LTBP3 10630 5199 4065 3979 latent transforming growth factor beta binding protein 3 LTBR 1609 607 926 1071 lymphotoxin beta receptor (TNFR superfamily, member 3) LUC7A 553 0 445 0 cisplatin resistance-associated overexpressed protein LXN 2625 442 0 443 latexin LY6E 1104 277 415 426 lymphocyte antigen 6 complex, locus E LYNX1 1453 668 688 772 Ly-6 neurotoxin-like protein 1 LZTS1 426 0 0 194 leucine zipper, putative tumor suppressor 1
248 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description M11S1 245 129 150 183 membrane component, chromosome 11, surface marker 1 M11S1 8615 5727 6741 6657 membrane component, chromosome 11, surface marker 1 M6PRBP1 4603 1988 1827 1696 mannose-6-phosphate receptor binding protein 1 MAF 2989 344 408 344 v-maf musculoaponeurotic fibrosarcoma oncogene homolog v-maf musculoaponeurotic fibrosarcoma oncogene homolog MAF 1742 319 492 364 (avian) v-maf musculoaponeurotic fibrosarcoma oncogene homolog MAF 1038 234 260 257 (avian) MAGED1 19860 8265 12160 8779 melanoma antigen, family D, 1 MAGED2 3070 1620 1694 1584 melanoma antigen, family D, 2 MAN1C1 618 0 212 0 mannosidase, alpha, class 1C, member 1 MAN1C1 632 0 0 0 mannosidase, alpha, class 1C, member 1 MAN2A1 3752 2445 2580 2469 mannosidase, alpha, class 2A, member 1 MAN2A2 1433 993 1015 1013 mannosidase, alpha, class 2A, member 2 MAP1A 797 0 330 0 microtubule-associated protein 1A MAP3K12 352 0 0 0 mitogen-activated protein kinase kinase kinase 12 MCM3 1418 786 891 907 MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) MCM6 minichromosome maintenance deficient 6 (MIS5 MCM6 3430 1318 1420 1495 homolog, S. pombe) (S. cerevisiae) MDFI 636 0 315 0 MyoD family inhibitor MDS009 679 301 369 440 x 009 protein MADS box transcription enhancer factor 2, polypeptide C MEF2C 1749 664 1037 1021 (myocyte enhancer factor 2C) MGC10084 1608 1066 1495 1274 hypothetical protein MGC10084 MGC1203 317 0 0 0 hypothetical protein MGC1203 MGC12538 3737 1871 2132 2187 hypothetical protein MGC12538 MGC12981 2001 1301 1148 1266 hypothetical protein MGC12981 MGC14151 4732 1463 2222 1858 hypothetical protein MGC14151 MGC14151 5454 2173 2420 2428 hypothetical protein MGC14151 MGC15416 960 491 535 548 hypothetical protein MGC15416 MGC15416 1228 0 0 0 hypothetical protein MGC15416 MGC2747 4629 3253 3393 3332 hypothetical protein MGC2747 MGC29784 939 497 513 466 hypothetical protein MGC29784 MGC3047 3100 384 372 399 hypothetical protein MGC3047 MGC31963 1858 926 914 761 kidney predominant protein NCU-G1 MGC35366 309 0 0 0 hypothetical protein MGC35366 MGC35555 1071 253 162 281 hypothetical protein MGC35555 MGC40499 1064 463 469 464 hypothetical protein MGC40499 MGC4368 1500 757 795 790 hypothetical protein MGC4368 MGC45386 1551 1142 1133 1185 Similar to RIKEN cDNA 1110033O09 gene MGC45474 686 202 277 250 hypothetical protein MGC45474 MGC52022 895 0 0 0 Similar to RIKEN cDNA 1810038N08 gene MGC5576 4211 1951 1831 1886 hypothetical protein MGC5576 MGP 766 0 0 0 matrix Gla protein MGST2 723 0 0 0 microsomal glutathione S-transferase 2 MGST3 13980 9134 8343 7826 microsomal glutathione S-transferase 3 MINA 2648 1561 2188 1971 MYC induced nuclear antigen MMRN2 177 0 0 0 multimerin 2 MPP1 1159 0 0 0 membrane protein, palmitoylated 1, 55kDa MPPE1 1203 0 0 0 metallophosphoesterase 1 MPV17 2279 1177 1056 1268 MpV17 transgene, murine homolog, glomerulosclerosis MR-1 1379 567 721 636 myofibrillogenesis regulator 1 MRC2 270 0 0 0 mannose receptor, C type 2 MRGPRF 993 363 231 342 MAS-related GPR, member F MRPL4 937 595 656 678 mitochondrial ribosomal protein L4 MRPL40 6125 4197 4316 4488 mitochondrial ribosomal protein L40 MRPL41 3183 1397 2182 1852 mitochondrial ribosomal protein L41 MRPL41 1167 664 1105 954 mitochondrial ribosomal protein L41 MRPL55 1019 0 861 890 mitochondrial ribosomal protein L55 MRPS21 10390 5979 7995 7430 mitochondrial ribosomal protein S21 MRPS34 1451 749 703 866 mitochondrial ribosomal protein S34 MRTF-B 826 476 520 454 myocardin-related transcription factor B MRVLDC1 3166 1838 2060 2006 MARVEL (membrane-associating) domain containing 1 MSRB 5182 2790 2963 2872 methionine sulfoxide reductase B MST4 8270 4103 5284 5106 Mst3 and SOK1-related kinase methylenetetrahydrofolate dehydrogenase (NADP+ dependent), MTHFD1 2643 1185 1972 1475 methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase MTUS1 4165 1387 1584 1210 mitochondrial tumor suppressor 1 MTVR1 2782 866 1122 964 Mouse Mammary Turmor Virus Receptor homolog 1 MTVR1 2129 0 0 0 Mouse Mammary Turmor Virus Receptor homolog 1 MUC1 239 0 0 0 mucin 1, transmembrane MUTYH 1333 947 1045 1122 mutY homolog (E. coli) MVK 1306 752 919 739 mevalonate kinase (mevalonic aciduria) MVP 6351 2426 2864 2677 major vault protein MYLK 543 0 0 212 myosin, light polypeptide kinase MYO1D 5279 2430 2367 2421 myosin ID MYO6 396 0 0 0 myosin VI NAGLU 1642 881 931 966 N-acetylglucosaminidase, alpha- (Sanfilippo disease IIIB) NAP1L2 592 223 228 331 nucleosome assembly protein 1-like 2 NAP1L3 1266 359 520 512 nucleosome assembly protein 1-like 3 NBL1 2641 992 1038 1120 neuroblastoma, suppression of tumorigenicity 1 NDFIP1 4886 2860 2647 3314 Nedd4 family interacting protein 1 NDRG3 344 0 0 0 NDRG family member 3 NDUFB1 25163 17010 17281 16710 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, NDUFB10 9098 4227 5631 4744 22kDa NDUFB2 6023 3135 3967 3708 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, NDUFB7 1732 615 1023 988 18kDa NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa NDUFS7 2367 1752 2154 1832 (NADH-coenzyme Q reductase)
249 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description NEBL 12540 2885 2298 3028 nebulette NEBL 9889 3261 2634 2687 nebulette NEBL 541 0 0 0 nebulette NEGR1 1002 346 320 316 neuronal growth regulator 1 NEGR1 2316 863 915 804 neuronal growth regulator 1 NEIL1 364 0 0 0 nei endonuclease VIII-like 1 (E. coli) NEK1 97 0 0 0 NIMA (never in mitosis gene a)-related kinase 1 nuclear factor of activated T-cells, cytoplasmic, calcineurin- NFATC1 1034 556 458 487 dependent 1 NFIA 2081 517 676 468 nuclear factor I/A NFIA 851 239 328 361 nuclear factor I/A NFIA 1366 533 508 489 nuclear factor I/A NFIB 4566 1686 2086 1999 nuclear factor I/B NFIB 2475 974 1050 1043 nuclear factor I/B NFIB 1147 485 620 615 nuclear factor I/B NFIB 3700 1668 1651 1518 nuclear factor I/B NFIB 448 0 0 0 nuclear factor I/B NFIC 4675 1833 1750 1881 nuclear factor I/C (CCAAT-binding transcription factor) NGFRAP1 27690 6320 5803 6029 nerve growth factor receptor (TNFRSF16) associated protein 1 NIFIE14 10770 6796 8242 7958 seven transmembrane domain protein NINJ2 1141 0 478 594 ninjurin 2 NIPSNAP1 1841 0 0 0 nipsnap homolog 1 (C. elegans) NIT2 3138 1864 1825 1959 Nit protein 2 NLN 299 0 0 242 neurolysin (metallopeptidase M3 family) NME1 8810 4054 5536 6109 non-metastatic cells 1, protein (NM23A) expressed in NME2 17100 10300 11870 10640 non-metastatic cells 2, protein (NM23B) expressed in NME4 1489 405 469 515 non-metastatic cells 4, protein expressed in NNAT 272 0 0 0 neuronatin NNMT 42281 9841 13704 12200 nicotinamide N-methyltransferase NNMT 71365 21590 26507 25130 nicotinamide N-methyltransferase nucleolar protein family A, member 2 (H/ACA small nucleolar NOLA2 9831 4184 5233 5395 RNPs) nucleolar protein family A, member 2 (H/ACA small nucleolar NOLA2 545 0 0 0 RNPs) NOTCH3 423 0 0 0 Notch homolog 3 (Drosophila) NPC2 29083 11980 10010 11440 Niemann-Pick disease, type C2 natriuretic peptide receptor B/guanylate cyclase B NPR2 1016 567 694 653 (atrionatriuretic peptide receptor B) natriuretic peptide receptor B/guanylate cyclase B NPR2 1130 666 680 712 (atrionatriuretic peptide receptor B) NQO3A2 5396 2684 3224 3330 NAD(P)H:quinone oxidoreductase type 3, polypeptide A2 NRD1 264 0 333 323 nardilysin (N-arginine dibasic convertase) NRM 853 380 406 408 nurim (nuclear envelope membrane protein) NRP1 1532 123 235 289 neuropilin 1 NRP1 773 0 0 0 neuropilin 1 non-SMC (structural maintenance of chromosomes) element 1 NSE1 4783 2534 2471 2617 protein NTHL1 499 0 0 0 nth endonuclease III-like 1 (E. coli) NUCB1 6178 3855 3441 3449 nucleobindin 1 OACT1 486 211 259 0 O-acyltransferase (membrane bound) domain containing 1 OGN 1828 339 284 252 osteoglycin (osteoinductive factor, mimecan) OGN 4356 892 821 986 osteoglycin (osteoinductive factor, mimecan) OIP106 232 0 331 0 OGT(O-Glc-NAc transferase)-interacting protein 106 KDa OIP106 381 0 366 412 OGT(O-Glc-NAc transferase)-interacting protein 106 KDa OK/SW-cl.56 7059 2883 4453 4521 beta 5-tubulin OLFML2B 522 0 0 0 olfactomedin-like 2B OLFML3 428 0 0 0 olfactomedin-like 3 OMD 1011 0 0 0 osteomodulin OR2A20P 314 0 0 0 olfactory receptor, family 2, subfamily A, member 20 pseudogene OSBPL1A 1620 657 593 821 oxysterol binding protein-like 1A OSBPL7 314 0 0 0 oxysterol binding protein-like 7 OXCT1 2708 1245 1840 1560 3-oxoacid CoA transferase 1 PABPC1 13010 9338 11100 9616 poly(A) binding protein, cytoplasmic 1 PABPN1 225 0 0 0 poly(A) binding protein, nuclear 1 PACSIN3 408 0 0 0 protein kinase C and casein kinase substrate in neurons 3 platelet-activating factor acetylhydrolase, isoform Ib, gamma PAFAH1B3 697 0 0 0 subunit 29kDa PAK2 279 0 0 390 p21 (CDKN1A)-activated kinase 2 PALMD 10957 6430 6167 5962 palmdelphin PARG1 200 0 99 0 PTPL1-associated RhoGAP 1 PB1 4047 1989 2579 2179 polybromo 1 PBP 11020 5844 6463 5822 prostatic binding protein PBX1 1192 414 396 374 pre-B-cell leukemia transcription factor 1 PC 3500 1742 1553 1879 pyruvate carboxylase PCBP4 569 0 0 0 poly(rC) binding protein 4 PCDH18 383 0 167 183 protocadherin 18 PCDHB5 941 383 369 396 protocadherin beta 5 PCDHB6 984 376 476 376 protocadherin beta 6 PCDHGC3 9700 3952 3247 3162 protocadherin gamma subfamily C, 3 PCDHGC3 10222 6659 5081 5661 protocadherin gamma subfamily C, 3 PCOLCE 2611 909 0 1145 procollagen C-endopeptidase enhancer PCYOX1 1327 566 415 453 prenylcysteine oxidase 1 PCYT1B 167 0 0 0 phosphate cytidylyltransferase 1, choline, beta isoform PCYT2 784 0 0 0 phosphate cytidylyltransferase 2, ethanolamine PDE1A 130 0 0 0 phosphodiesterase 1A, calmodulin-dependent PDE3A 572 0 0 0 phosphodiesterase 3A, cGMP-inhibited PDE4DIP 2016 1291 1561 1403 phosphodiesterase 4D interacting protein (myomegalin) PDE7B 1807 0 0 0 phosphodiesterase 7B PDE7B 373 0 0 0 phosphodiesterase 7B PDGFD 3085 345 248 270 platelet derived growth factor D PDGFRA 23907 6505 6327 6765 platelet-derived growth factor receptor, alpha polypeptide PDK2 480 0 0 0 pyruvate dehydrogenase kinase, isoenzyme 2
250 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description PFKM 3054 1331 1290 1343 phosphofructokinase, muscle PHLDB1 863 0 0 0 pleckstrin homology-like domain, family B, member 1 PHYHD1 497 0 0 0 phytanoyl-CoA dioxygenase domain containing 1 PIGK 1126 410 401 376 phosphatidylinositol glycan, class K PIGM 1792 1203 1425 1359 phosphatidylinositol glycan, class M PITX1 528 0 0 0 paired-like homeodomain transcription factor 1 PKD1-like 776 0 0 864 polycystic kidney disease 1-like PKIB 94 0 0 0 protein kinase (cAMP-dependent, catalytic) inhibitor beta PLA2G2A 60002 22361 22532 23290 phospholipase A2, group IIA (platelets, synovial fluid) PLAC9 4840 2035 1998 1871 placenta-specific 9 PLCD1 1689 0 0 0 phospholipase C, delta 1 PLCE1 137 0 0 0 phospholipase C, epsilon 1 PLK2 21943 7636 9485 9896 polo-like kinase 2 (Drosophila) PLP2 17155 10910 9284 9984 proteolipid protein 2 (colonic epithelium-enriched) PLSCR1 3674 1655 1699 1636 phospholipid scramblase 1 PLSCR3 3271 1528 1689 1761 phospholipid scramblase 3 PLSCR3 3841 2002 2341 2221 phospholipid scramblase 3 PLSCR4 2377 857 842 959 phospholipid scramblase 4 PLXDC2 2498 948 1058 1067 plexin domain containing 2 PLXDC2 2987 1152 1106 1218 plexin domain containing 2 PLXDC2 6542 2536 2330 2552 plexin domain containing 2 PMPCA 1397 929 958 1048 peptidase (mitochondrial processing) alpha PMVK 2262 1141 1288 1259 phosphomevalonate kinase POLR1B 1214 656 851 1045 polymerase (RNA) I polypeptide B, 128kDa POLR2B 95 0 0 0 polymerase (RNA) II (DNA directed) polypeptide B, 140kDa POLR2I 3741 2260 2965 2616 polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa POLR2L 22030 11910 10750 10592 polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa POLR3H 955 0 0 0 polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) processing of precursor 1, ribonuclease P/MRP subunit (S. POP1 278 0 262 190 cerevisiae) processing of precursor 5, ribonuclease P/MRP subunit (S. POP5 4255 2184 2800 2413 cerevisiae) POSTN 3605 443 438 454 periostin, osteoblast specific factor PP 18950 8174 10490 9615 pyrophosphatase (inorganic) PP1201 7414 4931 4759 4278 PP1201 protein PP1665 1069 347 437 360 hypothetical protein PP1665 PP2135 2382 1109 1028 977 PP2135 protein PPHLN1 5630 2613 3242 2836 periphilin 1 PPP1R7 3372 1912 2154 2315 protein phosphatase 1, regulatory subunit 7 PPP1R7 4850 3395 3816 3715 protein phosphatase 1, regulatory subunit 7 PPP2R4 1372 720 531 543 protein phosphatase 2A, regulatory subunit B' (PR 53) PPP2R4 1758 1045 1017 902 protein phosphatase 2A, regulatory subunit B' (PR 53) palmitoyl-protein thioesterase 1 (ceroid-lipofuscinosis, neuronal PPT1 18214 9853 9061 9671 1, infantile) PRC1 343 168 249 277 protein regulator of cytokinesis 1 PRDX2 20933 9359 9892 9379 peroxiredoxin 2 PRDX3 1207 703 971 864 peroxiredoxin 3 PRDX5 11960 8985 9141 8696 peroxiredoxin 5 PRICKLE1 941 0 0 0 prickle-like 1 (Drosophila) PRKAR2B 10040 3990 4244 3503 protein kinase, cAMP-dependent, regulatory, type II, beta PRKCA 735 473 491 519 protein kinase C, alpha PROCR 3977 2429 2631 2486 protein C receptor, endothelial (EPCR) PRPSAP1 3155 1638 1782 1842 phosphoribosyl pyrophosphate synthetase-associated protein 1 PRRX1 14920 8121 8255 8776 paired related homeobox 1 PRSS11 34890 18985 14790 14750 protease, serine, 11 (IGF binding) PSEN2 539 0 0 0 presenilin 2 (Alzheimer disease 4) PSIP1 4876 2851 2666 2856 PC4 and SFRS1 interacting protein 1 PSIP1 2215 1588 1369 1482 PC4 and SFRS1 interacting protein 1 PSMD4 9174 5500 6204 6684 proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 PSTPIP1 626 0 0 0 proline-serine-threonine phosphatase interacting protein 1 PTGFRN 1359 568 564 556 prostaglandin F2 receptor negative regulator PTGIS 1252 0 0 0 prostaglandin I2 (prostacyclin) synthase prostaglandin-endoperoxide synthase 1 (prostaglandin G/H PTGS1 460 0 0 0 synthase and cyclooxygenase) PTMA 24590 10182 11170 11040 prothymosin, alpha (gene sequence 28) PTMA 18390 8675 11150 8991 prothymosin, alpha (gene sequence 28) PTMA 16681 8184 8177 8009 prothymosin, alpha (gene sequence 28) PTPRD 578 256 436 301 protein tyrosine phosphatase, receptor type, D PTX1 200 0 193 0 PTX1 protein PWWP1 351 0 401 0 PWWP domain containing 1 PYGB 6766 2856 1983 2279 phosphorylase, glycogen; brain QIL1 4611 2383 2764 2478 QIL1 protein RAB5B 1151 592 619 626 RAB5B, member RAS oncogene family RAB7L1 2276 836 1086 989 RAB7, member RAS oncogene family-like 1 RAB7L1 5018 2212 2450 2497 RAB7, member RAS oncogene family-like 1 RABL2B 838 529 659 696 RAB, member of RAS oncogene family-like 2B RAI2 615 381 466 361 retinoic acid induced 2 RANGNRF 1553 949 1229 1192 RAN guanine nucleotide release factor RAP140 1877 1117 1290 1210 retinoblastoma-associated protein 140 RAP140 254 0 357 0 retinoblastoma-associated protein 140 RARRES1 3829 504 453 547 retinoic acid receptor responder (tazarotene induced) 1 RARRES1 7541 1141 891 1041 retinoic acid receptor responder (tazarotene induced) 1 RARRES1 1503 0 0 0 retinoic acid receptor responder (tazarotene induced) 1 RBM9 3319 1848 1989 2079 RNA binding motif protein 9 RBMS2 717 334 436 446 RNA binding motif, single stranded interacting protein 2 RBMS2 855 469 440 550 RNA binding motif, single stranded interacting protein 2 RCL1 1875 334 458 596 RNA terminal phosphate cyclase-like 1 RCL1 2843 1041 1060 1192 RNA terminal phosphate cyclase-like 1 RDH10 1871 494 458 468 retinol dehydrogenase 10 (all-trans) REA 13875 9774 10570 10160 repressor of estrogen receptor activity RERG 5140 1511 1423 1448 RAS-like, estrogen-regulated, growth inhibitor RGMA 1199 365 475 417 RGM domain family, member A
251 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description RGN 361 0 0 0 regucalcin (senescence marker protein-30) RHOBTB3 4473 1400 1657 1620 Rho-related BTB domain containing 3 RHOBTB3 6394 2361 2662 2291 Rho-related BTB domain containing 3 RHOBTB3 11530 4497 4912 4281 Rho-related BTB domain containing 3 RHOD 1157 709 804 828 ras homolog gene family, member D RIPX 209 0 0 196 rap2 interacting protein x RNF130 5877 3607 3159 3412 ring finger protein 130 RNH 6906 2810 3931 3554 ribonuclease/angiogenin inhibitor RNPEP 3961 2554 2711 2844 arginyl aminopeptidase (aminopeptidase B) RORC 314 0 0 0 RAR-related orphan receptor C RPESP 977 225 250 190 RPE-spondin RPL10A 29730 13090 21630 23460 ribosomal protein L10a RPL13 45240 26960 23490 21100 ribosomal protein L13 RPL13A 22883 13462 10980 11320 ribosomal protein L13a RPL28 624 0 0 501 ribosomal protein L28 RPL29 3257 1910 2100 2136 ribosomal protein L29 RPL3 64396 32490 37649 36160 ribosomal protein L3 RPL3 72371 44801 47760 43970 ribosomal protein L3 RPL35A 502 293 345 368 ribosomal protein L35a RPL7A 43734 31996 32290 33870 ribosomal protein L7a RRBP1 10840 7058 7490 6974 ribosome binding protein 1 homolog 180kDa (dog) RRBP1 2225 1512 1881 1866 ribosome binding protein 1 homolog 180kDa (dog) RRBP1 1076 0 0 0 ribosome binding protein 1 homolog 180kDa (dog) RSU1 2676 1481 2024 1858 Ras suppressor protein 1 RTN3 2140 1517 1850 1542 reticulon 3 [BLAST] RTN4RL1 254 0 0 0 reticulon 4 receptor-like 1 S100A1 2827 1416 1390 1627 S100 calcium binding protein A1 S100A13 12840 6238 6508 6538 S100 calcium binding protein A13 S100B 3775 1270 1379 1187 S100 calcium binding protein, beta (neural) SASH1 3014 1325 1294 1186 SAM and SH3 domain containing 1 SASH1 2447 1109 1064 891 SAM and SH3 domain containing 1 SBLF 3043 582 731 688 stoned B-like factor SCARA3 4862 1489 1254 1428 scavenger receptor class A, member 3 SCARA3 1491 540 524 587 scavenger receptor class A, member 3 SCFD2 1669 602 962 797 sec1 family domain containing 2 SCGF 738 364 383 375 stem cell growth factor; lymphocyte secreted C-type lectin SCP2 7268 3767 4193 4063 sterol carrier protein 2 SCPEP1 3356 1733 1741 1976 serine carboxypeptidase 1 SCRG1 33781 16960 14790 14980 scrapie responsive protein 1 SCRN2 1070 557 520 546 secernin 2 SDBCAG84 11300 7645 7087 7173 serologically defined breast cancer antigen 84 SDC1 375 0 0 0 syndecan 1 syndecan 2 (heparan sulfate proteoglycan 1, cell surface- SDC2 6805 3556 2857 3457 associated, fibroglycan) syndecan 2 (heparan sulfate proteoglycan 1, cell surface- SDC2 14630 7881 5656 6153 associated, fibroglycan) SDCCAG33 1289 569 599 606 serologically defined colon cancer antigen 33 SEC61A2 759 503 618 551 Sec61 alpha 2 subunit (S. cerevisiae) SELENBP1 2010 289 462 423 selenium binding protein 1 SELL 181 0 0 122 selectin L (lymphocyte adhesion molecule 1) SELP 1046 0 0 0 selectin P (granule membrane protein 140kDa, antigen CD62) sema domain, immunoglobulin domain (Ig), short basic domain, SEMA3A 5948 1855 2162 1929 secreted, (semaphorin) 3A SEP_10 3007 1706 1251 1575 septin 10 SEP_6 314 0 255 214 septin 6 SEPN1 806 0 635 532 selenoprotein N, 1 SEPP1 8743 2157 1832 1810 selenoprotein P, plasma, 1 SEPW1 5182 2487 3144 2639 selenoprotein W, 1 SEPW1 11150 6069 5621 5733 selenoprotein W, 1 SESN3 130 0 0 138 sestrin 3 SFRS3 3055 2015 2065 1950 splicing factor, arginine/serine-rich 3 SGCD 630 0 0 0 sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) SGCD 387 0 0 0 sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) SGCD 395 0 0 0 sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) SGCD 615 0 0 0 sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) SGSH 799 295 0 0 N-sulfoglucosamine sulfohydrolase (sulfamidase) SGSH 3388 1576 1688 1714 N-sulfoglucosamine sulfohydrolase (sulfamidase) SH3BGRL 9008 4757 5968 5429 SH3 domain binding glutamic acid-rich protein like SH3BGRL2 261 0 0 0 SH3 domain binding glutamic acid-rich protein like 2 Shax3 962 0 523 462 Snf7 homologue associated with Alix 3 SHC1 15032 8579 9850 10810 SHC (Src homology 2 domain containing) transforming protein 1 SIGIRR 2014 817 708 766 single Ig IL-1R-related molecule sirtuin (silent mating type information regulation 2 homolog) 3 (S. SIRT3 411 0 0 0 cerevisiae) SIX1 7081 2602 2471 2779 sine oculis homeobox homolog 1 (Drosophila) solute carrier family 10 (sodium/bile acid cotransporter family), SLC10A3 1329 673 1004 870 member 3 solute carrier family 12 (sodium/potassium/chloride transporters), SLC12A2 1535 1169 1428 1127 member 2 solute carrier family 16 (monocarboxylic acid transporters), SLC16A10 291 0 235 0 member 10 solute carrier family 16 (monocarboxylic acid transporters), SLC16A2 517 0 0 0 member 2 (putative transporter) solute carrier family 16 (monocarboxylic acid transporters), SLC16A4 2094 856 1272 847 member 4 SLC22A18 958 366 445 510 solute carrier family 22 (organic cation transporter), member 18 solute carrier family 25 (mitochondrial carrier; citrate transporter), SLC25A1 1122 772 878 776 member 1 solute carrier family 25 (carnitine/acylcarnitine translocase), SLC25A20 1070 669 853 871 member 20 solute carrier family 25 (mitochondrial carrier; phosphate carrier), SLC25A23 345 0 0 0 member 23
252 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description SLC25A29 424 0 0 0 solute carrier family 25, member 29 SLC26A2 4499 2256 3386 3346 solute carrier family 26 (sulfate transporter), member 2 SLC26A4 2110 307 358 239 solute carrier family 26, member 4 SLC27A4 908 0 0 0 solute carrier family 27 (fatty acid transporter), member 4 SLC29A1 2026 475 371 386 solute carrier family 29 (nucleoside transporters), member 1 SLC29A1 1232 0 0 0 solute carrier family 29 (nucleoside transporters), member 1 solute carrier family 2 (facilitated glucose transporter), member SLC2A11 286 0 0 0 11 SLC35D2 253 0 454 368 solute carrier family 35, member D2 solute carrier family 37 (glycerol-6-phosphate transporter), SLC37A4 714 0 0 0 member 4 solute carrier family 7 (cationic amino acid transporter, y+ SLC7A8 1603 0 0 0 system), member 8 solute carrier family 7 (cationic amino acid transporter, y+ SLC7A8 560 0 0 0 system), member 8 solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 SLC9A3R1 2477 1164 966 1104 regulator 1 SMAD6 1479 435 390 423 SMAD, mothers against DPP homolog 6 (Drosophila) SWI/SNF related, matrix associated, actin dependent regulator of SMARCA1 4356 2080 2390 2500 chromatin, subfamily a, member 1 SWI/SNF related, matrix associated, actin dependent regulator of SMARCD3 447 0 0 0 chromatin, subfamily d, member 3 SWI/SNF related, matrix associated, actin dependent regulator of SMARCE1 5393 2592 3032 3192 chromatin, subfamily e, member 1 SWI/SNF related, matrix associated, actin dependent regulator of SMARCE1 470 241 252 264 chromatin, subfamily e, member 1 SMOC1 7116 2064 2496 2032 SPARC related modular calcium binding 1 SMP3 399 0 0 0 SMP3 mannosyltransferase SNAI1 451 0 0 0 snail homolog 1 (Drosophila) SNAPC4 530 0 0 0 small nuclear RNA activating complex, polypeptide 4, 190kDa SNRPD2 21800 12890 14640 14235 small nuclear ribonucleoprotein D2 polypeptide 16.5kDa syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, SNTB2 2335 880 782 808 basic component 2) syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, SNTB2 730 346 298 346 basic component 2) SNX15 4000 1898 2120 2210 sorting nexin 15 SNX5 5823 3896 3484 4232 sorting nexin 5 SORBS1 906 193 0 225 sorbin and SH3 domain containing 1 SORBS1 874 0 0 0 sorbin and SH3 domain containing 1 SOX4 2462 1378 1284 1220 SRY (sex determining region Y)-box 4 SOX8 567 0 355 292 SRY (sex determining region Y)-box 8 spastic paraplegia 7, paraplegin (pure and complicated SPG7 1735 1268 1101 1149 autosomal recessive) spastic paraplegia 7, paraplegin (pure and complicated SPG7 206 0 0 0 autosomal recessive) SPIN2 364 0 0 0 spindlin family, member 2 SPINT2 4109 1586 1885 1825 serine protease inhibitor, Kunitz type, 2 sparc/osteonectin, cwcv and kazal-like domains proteoglycan SPOCK 4258 2120 1590 1682 (testican) SPON1 1693 302 342 329 spondin 1, extracellular matrix protein SPON1 223 0 0 0 spondin 1, extracellular matrix protein SPON2 672 0 0 0 spondin 2, extracellular matrix protein SPPL2B 482 0 0 0 SPPL2b SPTAN1 2433 1715 1925 1785 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) SRI 895 461 504 594 sorcin SSB1 1558 551 483 554 SPRY domain-containing SOCS box protein SSB-1 SSB1 1196 516 390 493 SPRY domain-containing SOCS box protein SSB-1 SSBP4 1265 0 422 608 single stranded DNA binding protein 4 SSBP4 916 558 539 516 single stranded DNA binding protein 4 SSH3 582 0 0 0 slingshot homolog 3 (Drosophila) SSNA1 947 586 696 721 Sjogren's syndrome nuclear autoantigen 1 SSPN 2517 974 977 1005 sarcospan (Kras oncogene-associated gene) STAB1 371 0 0 0 stabilin 1 signal transducer and activator of transcription 3 (acute-phase STAT3 3914 2420 2254 2521 response factor) signal transducer and activator of transcription 3 (acute-phase STAT3 12686 7868 7459 7088 response factor) STAT5B 431 0 0 521 signal transducer and activator of transcription 5B STK17A 2073 1088 994 1098 serine/threonine kinase 17a (apoptosis-inducing) STK17A 588 325 0 324 serine/threonine kinase 17a (apoptosis-inducing) STMN3 906 0 0 0 stathmin-like 3 STOM 11360 3994 3188 3529 stomatin STOM 18380 9540 7768 7483 stomatin STOML2 3609 2510 2814 2920 stomatin (EPB72)-like 2 STX10 935 492 530 471 syntaxin 10 SUCLG1 4625 3491 3981 4133 succinate-CoA ligase, GDP-forming, alpha subunit sulfotransferase family, cytosolic, 1A, phenol-preferring, member SULT1A1 518 0 0 0 1 SUMF2 4304 2191 2470 2558 sulfatase modifying factor 2 SV2A 1131 573 550 712 synaptic vesicle glycoprotein 2A SYN2 447 0 0 0 synapsin II SYNGR2 1351 790 984 855 synaptogyrin 2 TAO1 3264 1544 1696 1753 thousand and one amino acid protein kinase TAZ 15300 8045 6473 6585 transcriptional co-activator with PDZ-binding motif (TAZ) TBC1D14 1396 881 871 851 TBC1 domain family, member 14 TBL3 818 501 691 655 transducin (beta)-like 3 TCEA3 3044 1237 935 1124 transcription elongation factor A (SII), 3 transcription factor 3 (E2A immunoglobulin enhancer binding TCF3 226 0 191 247 factors E12/E47) TCF4 7966 2804 2747 2542 transcription factor 4 TCF4 2207 875 1071 923 transcription factor 4 TCF4 1102 496 532 533 transcription factor 4 TCF4 373 0 0 0 transcription factor 4
253 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description TDO2 700 0 298 175 tryptophan 2,3-dioxygenase TEAD2 1459 679 943 797 TEA domain family member 2 TEAD4 988 375 406 363 TEA domain family member 4 TEAD4 1292 0 0 0 TEA domain family member 4 transforming growth factor, beta 1 (Camurati-Engelmann TGFB1 2090 1415 1599 1606 disease) TGFB1I4 32845 21532 23014 22810 transforming growth factor beta 1 induced transcript 4 TGFBR2 19410 6559 6174 6199 transforming growth factor, beta receptor II (70/80kDa) transglutaminase 2 (C polypeptide, protein-glutamine-gamma- TGM2 23770 8124 7078 7088 glutamyltransferase) THADA 1208 451 499 575 thyroid adenoma associated THADA 1785 777 979 970 thyroid adenoma associated THY1 395 0 0 0 Thy-1 cell surface antigen THY28 4946 2092 2184 2439 thymocyte protein thy28 THY28 3205 1706 1726 1862 thymocyte protein thy28 TIMP2 14683 6700 6183 5996 tissue inhibitor of metalloproteinase 2 TIMP2 30600 15600 14760 14717 tissue inhibitor of metalloproteinase 2 TIP120B 627 0 0 0 TBP-interacting protein TLE2 386 0 0 0 transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila) TLR5 496 0 0 148 toll-like receptor 5 TM4SF13 10160 3593 7241 5881 transmembrane 4 superfamily member 13 TM4SF6 7015 2970 3298 3226 transmembrane 4 superfamily member 6 TM4SF6 7443 3805 3692 3670 transmembrane 4 superfamily member 6 TM4SF7 7100 2756 2218 2455 transmembrane 4 superfamily member 7 TM4SF8 14546 8509 9062 8615 transmembrane 4 superfamily member 8 TM7SF3 4100 1782 1768 1910 transmembrane 7 superfamily member 3 TMEM14C 12034 6812 7915 7484 transmembrane protein 14C TMEM19 186 0 158 155 transmembrane protein 19 TMOD1 488 0 0 0 tropomodulin 1 TMOD1 421 0 0 0 tropomodulin 1 TNFRSF1A 4769 2964 2501 2547 tumor necrosis factor receptor superfamily, member 1A TNFSF13 2380 736 654 666 tumor necrosis factor (ligand) superfamily, member 13 TNFSF13 2067 666 609 748 tumor necrosis factor (ligand) superfamily, member 13 TNFSF13 1049 479 396 460 tumor necrosis factor (ligand) superfamily, member 13 TNFSF13 794 371 423 423 tumor necrosis factor (ligand) superfamily, member 13 TNFSF13B 309 0 0 0 tumor necrosis factor (ligand) superfamily, member 13b TNIK 1191 505 529 470 TRAF2 and NCK interacting kinase TOR3A 735 0 587 541 torsin family 3, member A TP53I3 423 0 0 0 tumor protein p53 inducible protein 3 TPD52L1 20180 3293 3692 3299 tumor protein D52-like 1 TPD52L1 4036 951 716 917 tumor protein D52-like 1 TPK1 350 155 275 284 thiamin pyrophosphokinase 1 TPM2 7302 1277 1277 1406 tropomyosin 2 (beta) serine/threonine kinase with Dbl- and pleckstrin homology TRAD 1017 0 0 0 domains TRAM2 8954 2549 2422 2464 translocation associated membrane protein 2 TRAM2 2130 746 901 733 translocation associated membrane protein 2 TRAP1 2353 1441 1858 1855 heat shock protein 75 TRAPPC1 3143 1990 2085 2176 trafficking protein particle complex 1 TRAPPC5 3161 1982 2480 2478 trafficking protein particle complex 5 TRD@ 1066 368 424 343 T cell receptor delta locus TRD@ 852 381 319 485 T cell receptor delta locus TRD@ 714 0 0 0 T cell receptor delta locus TREX2 608 253 442 395 three prime repair exonuclease 2 TRIB2 3452 1527 666 895 tribbles homolog 2 (Drosophila) TRIM28 3668 2788 3214 3115 tripartite motif-containing 28 TRIM34 337 0 0 0 tripartite motif-containing 34 TRIP6 3902 2415 2306 2409 thyroid hormone receptor interactor 6 TRO 559 0 0 0 trophinin TSAP6 4843 1665 1630 1658 dudulin 2 TSC2 1363 675 749 889 tuberous sclerosis 2 TTC11 10550 7283 7181 7654 tetratricopeptide repeat domain 11 TTYH2 236 0 0 0 tweety homolog 2 (Drosophila) TUBA1 2149 1117 1218 1288 tubulin, alpha 1 (testis specific) TUFM 7923 5259 5586 5929 Tu translation elongation factor, mitochondrial TUSC3 5976 4012 3852 3867 tumor suppressor candidate 3 twist homolog 1 (acrocephalosyndactyly 3; Saethre-Chotzen TWIST1 1634 828 944 962 syndrome) UHRF1 236 0 0 0 ubiquitin-like, containing PHD and RING finger domains, 1 UPF3A 507 355 454 413 UPF3 regulator of nonsense transcripts homolog A (yeast) UQCR 463 0 537 494 ubiquinol-cytochrome c reductase (6.4kD) subunit UROD 1894 954 1404 1418 uroporphyrinogen decarboxylase USF2 1497 0 0 0 upstream transcription factor 2, c-fos interacting USP30 650 475 414 385 ubiquitin specific protease 30 VPS13C 146 0 173 157 vacuolar protein sorting 13C (yeast) VPS28 6330 4451 5442 5006 vacuolar protein sorting 28 (yeast) WBSCR20A 2320 1656 1808 1826 Williams Beuren syndrome chromosome region 20A WBSCR22 5803 3368 3676 3544 Williams Beuren syndrome chromosome region 22 WDR34 1332 525 753 639 WD repeat domain 34 WHSC1 348 0 0 0 Wolf-Hirschhorn syndrome candidate 1 WISP1 1701 442 300 353 WNT1 inducible signaling pathway protein 1 WISP1 584 0 201 0 WNT1 inducible signaling pathway protein 1 XLKD1 342 0 0 0 extracellular link domain containing 1 ZAK 3342 1692 1884 1595 sterile alpha motif and leucine zipper containing kinase AZK ZAK 6378 3343 3417 3741 sterile alpha motif and leucine zipper containing kinase AZK ZBED1 1287 632 833 856 zinc finger, BED domain containing 1 ZCCHC5 317 0 0 0 zinc finger, CCHC domain containing 5 ZFP36L1 19972 9548 6576 7114 zinc finger protein 36, C3H type-like 1 ZFP36L2 12950 2178 2413 2526 zinc finger protein 36, C3H type-like 2 ZFP36L2 515 0 0 0 zinc finger protein 36, C3H type-like 2 ZFP36L2 1384 0 311 397 zinc finger protein 36, C3H type-like 2 ZNF10 164 0 0 0 zinc finger protein 10 (KOX 1)
254 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description zinc finger protein 145 (Kruppel-like, expressed in promyelocytic ZNF145 521 0 0 0 leukemia) ZNF146 170 0 178 191 zinc finger protein 146 ZNF238 3135 1996 2079 2115 zinc finger protein 238 ZNF30 267 0 0 193 zinc finger protein 30 (KOX 28) ZNF33A 223 0 107 157 zinc finger protein 33a (KOX 31) ZNF521 2614 783 660 821 zinc finger protein 521 ZNF521 2896 1097 1061 945 zinc finger protein 521 ZNF533 650 157 141 181 zinc finger protein 533 ZNF533 467 142 165 185 zinc finger protein 533 ZNF607 4561 3152 3259 3428 zinc finger protein 607 ZNF608 1019 473 373 500 zinc finger protein 608 ZNHIT1 3809 2348 2917 2892 zinc finger, HIT domain containing 1 229506_at 236 0 0 0 ubiquitin-like, containing PHD and RING finger domains, 1
Table XIII Genes, which were up-regulated with Byk191023 [30µM] and down-regulated by IL-1 alone in human OA chondrocytes. In the table are given: gene symbol (or Affymetrix identifier); relative expression values and description of the gene. Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description AMOTL1 0 0 0 159 angiomotin like 1 ARHGEF9 361 0 294 222 Cdc42 guanine nucleotide exchange factor (GEF) 9 ARNTL2 0 0 499 482 aryl hydrocarbon receptor nuclear translocator-like 2 ASPSCR1 529 0 563 608 alveolar soft part sarcoma chromosome region, candidate 1 ATF6 1096 0 930 1139 activating transcription factor 6 B1 578 0 603 575 parathyroid hormone-responsive B1 gene C19orf12 0 0 0 241 chromosome 19 open reading frame 12 C1orf21 257 0 0 196 chromosome 1 open reading frame 21 C20orf142 0 0 222 185 chromosome 20 open reading frame 142 C6orf162 0 0 430 407 chromosome 6 open reading frame 162 C6orf194 0 0 0 118 chromosome 6 open reading frame 194 CCT6B 495 0 0 416 chaperonin containing TCP1, subunit 6B (zeta 2) CNKSR1 0 0 182 146 connector enhancer of kinase suppressor of Ras 1 COG6 81 0 153 112 component of oligomeric golgi complex 6 COPS8 0 0 0 120 COP9 constitutive photomorphogenic homolog subunit 8 COPZ1 4247 2844 4271 4372 coatomer protein complex, subunit zeta 1 CXorf15 0 0 0 200 chromosome X open reading frame 15 DGKZ 0 0 0 503 diacylglycerol kinase, zeta 104kDa DKFZp762K222 189 0 148 164 hypothetical protein DKFZp762K222 DOK4 253 0 256 201 docking protein 4 FANCF 500 0 371 399 Fanconi anemia, complementation group F FGF18 0 0 0 415 fibroblast growth factor 18 FLJ10726 320 296 593 495 hypothetical protein FLJ10726 FLJ12681 493 0 373 297 hypothetical protein FLJ12681 FLJ20308 220 0 0 265 hypothetical protein FLJ20308 FLJ20533 357 0 245 330 hypothetical protein FLJ20533 FLJ21924 0 0 176 236 hypothetical protein FLJ21924 FLJ30313 0 0 0 372 hypothetical protein FLJ30313 FLJ31265 353 0 375 316 hypothetical protein FLJ31265 FLJ32954 983 385 647 637 hypothetical protein FLJ32954 GJB2 450 965 2406 2272 gap junction protein, beta 2, 26kDa (connexin 26) HECTD1 0 0 0 145 HECT domain containing 1 HOOK3 156 204 359 433 hook homolog 3 (Drosophila) HOOK3 0 0 0 253 hook homolog 3 (Drosophila) IFIH1 0 0 116 114 interferon induced with helicase C domain 1 JTV1 527 0 586 575 JTV1 gene KCNE3 307 0 0 154 potassium voltage-gated channel, Isk-related family, member 3 KIAA1229 0 0 107 144 KIAA1229 protein KIAA1609 316 0 0 269 KIAA1609 protein MASP2 160 0 161 221 mannan-binding lectin serine protease 2 MGC26979 100 0 0 139 hypothetical protein MGC26979 MGC33510 0 0 223 218 hypothetical protein MGC33510 MGC50559 103 0 0 80 hypothetical protein MGC50559 NDE1 358 0 611 561 nudE nuclear distribution gene E homolog 1 (A. nidulans) NDUFV3 289 268 428 465 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa NLN 299 0 0 242 neurolysin (metallopeptidase M3 family) NVL 541 0 0 485 nuclear VCP-like NY-SAR-41 0 0 0 167 sarcoma antigen NY-SAR-41 PIWIL2 0 0 192 333 piwi-like 2 (Drosophila) PKD1-like 776 0 0 864 polycystic kidney disease 1-like PLK3 0 1044 1817 1768 polo-like kinase 3 (Drosophila) PPP5C 0 0 0 548 protein phosphatase 5, catalytic subunit PSMC5 11920 8572 11230 11332 proteasome (prosome, macropain) 26S subunit, ATPase, 5 PTGER3 0 0 183 153 prostaglandin E receptor 3 (subtype EP3) PTPN7 133 0 0 152 protein tyrosine phosphatase, non-receptor type 7 RAB14 0 0 100 113 RAB14, member RAS oncogene family RAB22A 190 0 0 201 RAB22A, member RAS oncogene family RABL4 1451 1136 1686 1547 RAB, member of RAS oncogene family-like 4 RCHY1 0 0 161 215 ring finger and CHY zinc finger domain containing 1 RHOF 335 0 0 243 ras homolog gene family, member F (in filopodia) SESN3 130 0 0 138 sestrin 3 SET8 393 0 537 455 PR/SET domain containing protein 8 SLCO3A1 0 0 534 528 solute carrier organic anion transporter family, member 3A1 SOX8 567 0 355 292 SRY (sex determining region Y)-box 8 SPG6 0 0 137 129 spastic paraplegia 6 (autosomal dominant) SRPRB 1722 1680 2777 2490 signal recognition particle receptor, B subunit SSBP4 1265 0 422 608 single stranded DNA binding protein 4
255 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description TDO2 700 0 298 175 tryptophan 2,3-dioxygenase TEAD2 0 0 0 284 TEA domain family member 2 transient receptor potential cation channel, subfamily V, member TRPV3 0 0 0 188 3 UBE2H 0 0 194 166 ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) ZDHHC21 174 160 187 273 zinc finger, DHHC domain containing 21 ZNF311 118 0 141 153 zinc finger protein 311 210608_s_at 0 0 148 158 CDNA clone MGC:2062 IMAGE:3534501, complete cds 216067_at 0 0 82 111 CDNA FLJ11624 fis, clone HEMBA1004193 214744_s_at 431 0 247 301 CDNA FLJ11898 fis, clone HEMBA1007322 230986_at 121 0 151 171 CDNA FLJ30065 fis, clone ADRGL2000328 CDNA FLJ30424 fis, clone BRACE2008881, weakly similar to 1555967_at 518 0 681 588 ZINC FINGER PROTEIN 195 230849_at 134 0 0 202 CDNA FLJ42577 fis, clone BRACE3008298 231040_at 140 0 156 153 CDNA FLJ43172 fis, clone FCBBF3007242 227508_at 0 0 287 308 CDNA FLJ43285 fis, clone MESAN2000067 230139_at 0 0 0 328 CDNA FLJ43345 fis, clone NT2RI3008228 239792_at 177 0 140 151 Clone IMAGE:3995848, mRNA Hypothetical gene supported by AK024371; BC037920 231992_x_at 0 0 755 722 (LOC402534), mRNA 213929_at 101 0 0 86 MRNA; cDNA DKFZp586F1223 (from clone DKFZp586F1223) Transcribed sequence with strong similarity to protein sp:P00722 228773_at 241 0 0 191 (E. coli) BGAL_ECOLI Beta-galactosidase Transcribed sequence with weak similarity to protein 233264_at 199 0 108 119 prf:1510254A (H.sapiens) 1510254A L1 repetitive element ORF [Homo sapiens] Transcribed sequence with weak similarity to protein sp:P39188 241680_at 0 0 0 197 (H.sapiens) ALU1_HUMAN Alu subfamily J sequence contamination warning entry 230939_at 0 0 0 154 Transcribed sequences 240108_at 0 0 0 133 Transcribed sequences
Table XIV Genes, which were up-regulated with 1400W [10µM] and down-regulated by IL-1 alone in human OA chondrocytes. In the table are given: gene symbol (or Affymetrix identifier); relative expression values and description of the gene. Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description Homo sapiens cDNA FLJ10967 fis, clone PLACE1000798. 1555461_at 171 0 232 207 [BLAST] CDNA FLJ30424 fis, clone BRACE2008881, weakly similar to 1555967_at 518 0 681 588 ZINC FINGER PROTEIN 195 1557813_at 0 0 153 0 Full length insert cDNA clone YB34C04 1561010_a_at 0 0 164 134 Full length insert cDNA clone YY91C12 202546_at 1816 984 1339 1325 vesicle-associated membrane protein 8 (endobrevin) 211973_at 303 0 461 484 Clone 23872 mRNA sequence 213927_at 0 0 147 0 CDNA FLJ41436 fis, clone BRHIP2007741 214744_s_at 431 0 247 301 CDNA FLJ11898 fis, clone HEMBA1007322 214825_at 0 0 199 0 Similar to expressed sequence AW121567 (LOC387945), mRNA 216739_at 0 0 188 229 Sapiens cDNA: FLJ20874 fis, clone ADKA02818. Clone H10 anti-HLA-A2/A28 immunoglobulin light chain variable 217145_at 0 0 138 0 region mRNA, partial cds 217471_at 0 0 122 0 MRNA; cDNA DKFZp586B1324 (from clone DKFZp586B1324) Hypothetical gene supported by AK027125 (LOC402460), 226596_x_at 1685 1681 2187 2315 mRNA Transcribed sequence with weak similarity to protein sp:P39188 228812_at 345 1430 1893 1691 (H.sapiens) ALU1_HUMAN Alu subfamily J sequence contamination warning entry 230986_at 121 0 151 171 CDNA FLJ30065 fis, clone ADRGL2000328 231040_at 140 0 156 153 CDNA FLJ43172 fis, clone FCBBF3007242 232794_at 0 0 180 179 MRNA; cDNA DKFZp434L1626 (from clone DKFZp434L1626) 232991_at 0 0 192 0 CDNA FLJ11613 fis, clone HEMBA1004012 Transcribed sequence with weak similarity to protein 233264_at 199 0 108 119 prf:1510254A (H.sapiens) 1510254A L1 repetitive element ORF [Homo sapiens] Consensus includes gb:AJ302634 /DEF=Homo sapiens 6M1- 7P*01 pseudogene, cell line LG2 /FEA=CDS 234760_at 0 0 108 0 /DB_XREF=gi:12054482 /UG=Hs.307113 Homo sapiens 6M1- 7P*01 pseudogene, cell line LG2 235888_at 197 0 177 0 Transcribed sequences Transcribed sequence with weak similarity to protein 238507_at 180 0 173 189 ref:NP_055301.1 (H.sapiens) neuronal thread protein [Homo sapiens] 238826_x_at 246 0 285 0 Full length insert cDNA clone ZE12C10 238953_at 418 0 215 245 CDNA clone IMAGE:5206119, partial cds 239140_at 121 150 212 260 Transcribed sequences 239792_at 177 0 140 151 Clone IMAGE:3995848, mRNA Transcribed sequence with moderate similarity to protein 240008_at 0 0 123 0 sp:P39192 (H.sapiens) ALU5_HUMAN Alu subfamily SC sequence contamination warning entry 240066_at 0 0 116 0 Transcribed sequences 240370_at 0 0 108 130 Transcribed sequences 241804_at 0 0 114 0 Homo sapiens transcribed sequences 242305_at 157 0 160 205 CDNA FLJ42757 fis, clone BRAWH3001712 242973_at 0 0 112 0 Transcribed sequences ABHD2 1017 835 1245 1112 abhydrolase domain containing 2 AK7 227 213 299 249 adenylate kinase 7 AMD1 2526 1702 2923 2212 adenosylmethionine decarboxylase 1 ANAPC5 8174 5998 7986 7173 anaphase promoting complex subunit 5 AP4B1 172 0 156 164 adaptor-related protein complex 4, beta 1 subunit APEH 1219 741 1061 993 N-acylaminoacyl-peptide hydrolase
256 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description ARHGEF12 260 0 224 253 Rho guanine nucleotide exchange factor (GEF) 12 ARNTL2 0 0 499 482 aryl hydrocarbon receptor nuclear translocator-like 2 ARP3BETA 717 417 666 629 actin-related protein 3-beta ARS2 286 0 271 0 arsenate resistance protein ARS2 ATF6 1096 0 930 1139 activating transcription factor 6 ATF7IP 1058 563 935 847 activating transcription factor 7 interacting protein ATF7IP 1243 830 1269 1025 activating transcription factor 7 interacting protein ATR 622 523 736 754 ataxia telangiectasia and Rad3 related BAG1 3828 3317 4758 4156 BCL2-associated athanogene BBX 0 0 120 84 bobby sox homolog (Drosophila) C14orf10 263 0 224 230 chromosome 14 open reading frame 10 C14orf125 1275 1201 1960 1839 chromosome 14 open reading frame 125 C18orf37 249 234 458 318 chromosome 18 open reading frame 37 C20orf19 1937 1535 2303 1896 chromosome 20 open reading frame 19 C20orf31 1047 700 1331 1163 chromosome 20 open reading frame 31 C21orf106 148 0 178 0 chromosome 21 open reading frame 106 C21orf107 118 145 266 211 chromosome 21 open reading frame 107 CDC42BPA 468 296 466 481 CDC42 binding protein kinase alpha (DMPK-like) CDK2 1245 833 1328 1073 cyclin-dependent kinase 2 COPZ1 4247 2844 4271 4372 coatomer protein complex, subunit zeta 1 CYB561 1210 760 1477 1009 cytochrome b-561 DGKA 171 0 190 181 diacylglycerol kinase, alpha 80kDa DHDDS 1152 784 1157 905 dehydrodolichyl diphosphate synthase DKFZP564O0823 2517 4448 6895 5889 DKFZP564O0823 protein DNAJB9 2165 4303 6506 5039 DnaJ (Hsp40) homolog, subfamily B, member 9 DNAJB9 15870 22450 30848 26910 DnaJ (Hsp40) homolog, subfamily B, member 9 DOK4 253 0 256 201 docking protein 4 DSCR2 5778 3238 4506 3980 Down syndrome critical region gene 2 eukaryotic translation initiation factor 2B, subunit 3 gamma, EIF2B3 1642 1174 2148 1694 58kDa EKI1 751 1018 1477 1076 ethanolamine kinase ESRRBL1 2575 2134 3182 2837 estrogen-related receptor beta like 1 FAM34A 2761 2626 3558 3042 family with sequence similarity 34, member A FBXO16 225 0 243 0 F-box protein 16 FBXO9 6499 3246 4497 4265 F-box protein 9 FKBP14 2421 2866 5598 4376 FK506 binding protein 14, 22 kDa FLJ10292 505 551 1188 1058 hypothetical protein FLJ10292 FLJ10504 1851 1373 2572 3029 misato FLJ10747 2165 1331 2659 2115 hypothetical protein FLJ10747 FLJ21924 0 0 176 236 hypothetical protein FLJ21924 FLJ22028 4761 4139 5442 4516 hypothetical protein FLJ22028 FLJ23047 398 529 844 761 hypothetical protein FLJ23047 FLJ23129 220 0 154 166 hypothetical protein FLJ23129 FLJ31265 353 0 375 316 hypothetical protein FLJ31265 FLJ46041 156 0 152 205 FLJ46041 protein FNBP3 201 0 213 0 formin binding protein 3 GCSH 3317 2320 3382 2996 glycine cleavage system protein H (aminomethyl carrier) GJB2 450 965 2406 2272 gap junction protein, beta 2, 26kDa (connexin 26) GMPPB 3122 4066 7437 6310 GDP-mannose pyrophosphorylase B GRIM19 752 462 702 684 cell death-regulatory protein GRIM19 H17 630 0 561 669 hypothetical protein H17 HIPK3 0 0 134 0 homeodomain interacting protein kinase 3 hnRNPA3 2651 1181 1970 1860 heterogeneous nuclear ribonucleoprotein A3 HNRPAB 8843 6981 9977 9143 heterogeneous nuclear ribonucleoprotein A/B HSPA5 2469 1609 2508 2322 heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) HTATSF1 5262 4260 5949 5124 HIV TAT specific factor 1 INPP1 2824 3279 4519 4042 inositol polyphosphate-1-phosphatase potassium large conductance calcium-activated channel, KCNMB1 0 0 1138 917 subfamily M, beta member 1 KCTD1 0 0 112 0 potassium channel tetramerisation domain containing 1 KDR 0 0 121 0 kinase insert domain receptor (a type III receptor tyrosine kinase) KIAA1229 0 0 107 144 KIAA1229 protein KIAA1959 140 0 121 0 nm23-phosphorylated unknown substrate KIF1C 439 0 422 371 kinesin family member 1C KL 0 0 142 0 klotho LOC132321 155 0 123 0 hypothetical protein LOC132321 LOC159090 1832 1088 2105 1805 similar to hypothetical protein MGC17347 LOC200916 4193 2993 6743 5179 similar to ribosomal protein L22 LOC253982 0 0 314 370 hypothetical protein LOC253982 LOC339344 538 0 590 685 hypothetical protein LOC339344 LOC339834 196 0 137 0 hypothetical protein LOC339834 MASP2 160 0 161 221 mannan-binding lectin serine protease 2 mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N- MGAT4A 235 0 489 448 acetylglucosaminyltransferase, isoenzyme A MGC20235 359 326 619 505 hypothetical protein MGC20235 MLR1 0 0 244 282 transcription factor MLR1 NDE1 358 0 611 561 nudE nuclear distribution gene E homolog 1 (A. nidulans) NR4A2 3317 4852 12360 8363 nuclear receptor subfamily 4, group A, member 2 NUCB2 1055 0 1123 990 nucleobindin 2 OK/SW-cl.56 7059 2883 4453 4521 beta 5-tubulin OK/SW-cl.56 17240 13370 18670 17870 beta 5-tubulin PGAP1 0 0 158 0 GPI deacylase PHKA2 350 0 230 277 phosphorylase kinase, alpha 2 (liver) PIGL 304 0 299 402 phosphatidylinositol glycan, class L PIGQ 0 0 270 241 phosphatidylinositol glycan, class Q PLK3 0 1044 1817 1768 polo-like kinase 3 (Drosophila) PNAS-4 138 0 122 141 CGI-146 protein processing of precursor 1, ribonuclease P/MRP subunit (S. POP1 278 0 262 190 cerevisiae) PREB 2170 1947 2945 2671 prolactin regulatory element binding PTGER3 0 0 183 153 prostaglandin E receptor 3 (subtype EP3) PTX1 200 0 193 0 PTX1 protein
257 7. SUPPLEMENT
Gene symbol control IL-1 IL-1 1400W IL-1 191023 Gene description RAB27A 3417 2276 3556 2990 RAB27A, member RAS oncogene family RABL4 1451 1136 1686 1547 RAB, member of RAS oncogene family-like 4 RCP 0 0 247 233 Rab coupling protein RFP 1599 1255 1857 1790 ret finger protein Rif1 0 0 183 0 telomere-associated protein RIF1 homolog SCRN3 126 0 110 131 secernin 3 SDF2L1 2203 1713 3977 3432 stromal cell-derived factor 2-like 1 SEC23B 5088 6645 11830 8617 Sec23 homolog B (S. cerevisiae) SERP1 4304 4315 6546 5173 stress-associated endoplasmic reticulum protein 1 SERP1 6246 5856 8307 7037 stress-associated endoplasmic reticulum protein 1 SET8 393 0 537 455 PR/SET domain containing protein 8 sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta- SIAT7D 1291 822 1454 1236 galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6- sialyltransferase) sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta- SIAT7D 1536 577 1050 1007 galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6- sialyltransferase) SLC17A5 3974 2709 3571 3123 solute carrier family 17 (anion/sugar transporter), member 5 SLC26A2 4499 2256 3386 3346 solute carrier family 26 (sulfate transporter), member 2 SLC30A7 2176 1970 3093 2722 solute carrier family 30 (zinc transporter), member 7 SLCO3A1 0 0 534 528 solute carrier organic anion transporter family, member 3A1 SOCS2 2884 4037 7625 6050 suppressor of cytokine signaling 2 SPG6 0 0 137 129 spastic paraplegia 6 (autosomal dominant) SRPRB 1722 1680 2777 2490 signal recognition particle receptor, B subunit STCH 5327 8059 11520 9875 stress 70 protein chaperone, microsome-associated, 60kDa stress-induced-phosphoprotein 1 (Hsp70/Hsp90-organizing STIP1 2772 2310 3182 3210 protein) STX5A 798 785 1129 1059 syntaxin 5A STXBP4 0 0 200 0 syntaxin binding protein 4 SUGT1 5991 5389 7231 6341 SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) transcription factor 3 (E2A immunoglobulin enhancer binding TCF3 226 0 191 247 factors E12/E47) TCP10L 191 0 147 0 t-complex 10 (mouse)-like TDO2 700 0 298 175 tryptophan 2,3-dioxygenase TESK1 1227 968 1364 1307 testis-specific kinase 1 TM4SF13 10160 3593 7241 5881 transmembrane 4 superfamily member 13 TMEM18 0 0 279 303 transmembrane protein 18 TOR3A 735 0 587 541 torsin family 3, member A TRAM1 15994 15500 20150 17710 translocation associated membrane protein 1 TRIP11 0 0 123 0 thyroid hormone receptor interactor 11 TUBA2 0 0 655 619 tubulin, alpha 2 TUBG1 1356 1339 2112 2028 tubulin, gamma 1 UCHL3 3413 3375 4926 3946 ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) UTP14C 2754 2533 3335 2909 UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) VPS13C 146 0 173 157 vacuolar protein sorting 13C (yeast) WDHD1 0 0 97 0 WD repeat and HMG-box DNA binding protein 1 WFS1 1921 1475 2505 2348 Wolfram syndrome 1 (wolframin) WFS1 560 547 830 869 Wolfram syndrome 1 (wolframin) ZDHHC14 0 0 124 0 zinc finger, DHHC domain containing 14 ZDHHC18 0 0 144 0 zinc finger, DHHC domain containing 18 ZNF146 170 0 178 191 zinc finger protein 146 ZNF311 118 0 141 153 zinc finger protein 311 ZNF33A 223 0 107 157 zinc finger protein 33a (KOX 31) ZNRD1 2115 2088 2853 2209 zinc ribbon domain containing, 1
258