ADHERENT AND NON-ADHERENT MACROPHAGES IN CELL SURVIVAL AND DEATH
Dissertation
Presented in Partial Fulfillment of the Requirements for the Degree Doctor of
Philosophy in the Graduate School of The Ohio State University
By
KRITHIKA SELVARAJAN, M.S.
Integrated Biomedical Science Graduate Program
The Ohio State University
2009
Dissertation Committee:
DR. SAMPATH PARTHASARATHY, Advisor
DR. NICANOR MOLDOVAN
DR. NARASIMHAM PARINANDI
DR. SUSHEELA TRIDANDAPANI
ABSTRACT
Macrophages are often referred to as professional phagocytes due to their
ability to scavenge a wide array of substances including pathogens, cellular
debris, apoptotic cells, non physiological molecules such as asbestos, silica etc.
Their ability to engulf modified lipoproteins leads to the formation of lipid-laden
foam cells in atherosclerosis. On the other hand macrophages are also recognized
as growth promoters and antigen presenting cells. Most tissue macrophages are
adherent cells except for those found in the peritoneal cavity. Resident or elicited
peritoneal macrophages are non-adherent or weakly adherent cells whose function has not been clearly elucidated. Adherence is a key feature of
macrophage differentiation and it is essential to determine whether it is a
contributing or a determining factor of the role of macrophages. There is also a
controversy as to the role of the scavenger receptors in the adhesion process
itself.
The focus of this study has been to understand the nature and function of
non-adherent and adherent macrophages particularly in regard to interaction
with apoptotic cells. We hypothesized that adherent macrophages function as
scavengers of late apoptotic cells and thus prevent inflammation. On the other
hand, non-adherent macrophages may have a growth-promoting role and could
revive early apoptotic cells which can be considered to be in a state of sickness. ii In most of these studies mouse peritoneal macrophages which are non- adherent in situ were used after being maintained a few hours in culture. In the current study, we analyzed non-adherent and adherent macrophages for changes in receptor expression, growth factor production and function. Our results indicate that adherent macrophages have increased expression of scavenger receptors which are not only involved in the uptake of apoptotic cells, but also play an essential role in adherence. Candidate receptors for phosphatidylserine
(PS) and integrin subunits were also upregulated in adherent macrophages.
Analysis of growth factors that are known to be secreted by macrophages revealed that the type of growth factor produced could be cell-type specific. It was interesting to note that, MFG-E8 which is a milk fat globule epidermal growth factor as well an opsosin of apoptotic cells was enhanced in non-adherent cells.
Thus non-adherent cells that have low scavenger receptor expression combined with increased generation of MFG-E8 could act as revivers of early apoptotic cells. Scavenger receptor function was also enhanced in the adherent population as observed by an increase in the uptake of ligands such as DiI labeled acetylated
LDL (DiI-AcLDL) and PS liposomes. Using 1 µm fluorescent beads, we were also able to demonstrate that adherent cells were more efficient in phagocytosis as compared to non-adherent cells.
We next investigated whether early apoptotic cells had the ability to recruit monocytes/macrophages, which would be necessary for the macrophages to exert their growth promoting function. So we induced apoptosis in human umbilical vein endothelial cells (HUVECs) by serum deprivation. We observed that 4 h of
iii growth factor withdrawal yielded a relatively early apoptotic population, as
evidenced by PS exposure and caspase activation but absence of DNA
fragmentation. We analyzed the mRNA levels of monocyte chemotactic protein-1
(MCP-1), a potential chemoattractant for monocytes and an early response gene.
MCP-1 was strongly induced in early apoptotic cells. The induction was enhanced
in late apoptotic cells that were obtained by 48 h of serum deprivation. Another
potential chemoattractant that we analyzed was lysophosphatidylcholine (LPC).
Although this lipid has been reported to be a chemotactic factor produced by
apoptotic cells, we did not observe any differences in LPC levels between control
and early apoptotic cells. To determine whether apoptosis induced by serum
deprivation can be reversed by growth factors, we incubated early apoptotic
endothelial cells in the presence of 20% serum and observed them over a period
of 1 wk. The apoptotic cells which exhibited PS externalization following serum
deprivation failed to show features of early apoptosis even at day 1 in the
presence of growth factors. There was a slow but steady increase in cell number
and cells remained viable as observed by the trypan blue viability assay. In the
presence of mouse peritoneal lavage fluid that contained the MFG-E8 protein,
revival of early apoptotic HUVECs was observed; however sustained revival and
growth was not seen.
In conclusion, the results of the study showed that (i) adherent
macrophages are better equipped for scavenger function and (ii) apoptotic
process might itself be involved in the chemotactic recruitment of monocytes.
More importantly, the studies suggest that very early stages of apoptosis might be
iv handled differently by mononuclear cells as opposed to cells at the verge of death.
Taken together, these results bring in to light a new and exciting concept pertaining to macrophage function and their behavior towards apoptotic cells.
v ACKNOWLEDGEMENTS
At the outset, I would like to express my deep gratitude and respect to my
mentor, Dr.Sampath Parthasarathy, for his invaluable guidance and support
throughout my graduate training. I thank him for providing an ideal niche to
learn and develop professionally. His passion for science and plethora of
scientific achievements has been a true inspiration and his role as my mentor will
continue throughout my career as I truly value his input and advice.
I would like to thank my committee members, Dr.Nicanor Moldovan,
Dr.Narasimham Parinandi and Dr.Susheela Tridandapani for always being
approachable and encouraging. I thank them for their time, critical feedback and
suggestions. A great deal of knowledge and insight has been gained from the
discussions with them.
Dr.Allan Yates, Dr.Virginia Sanders and the entire IBGP team have been
extremely helpful and supportive. Both the Division of Cardiothoracic Surgery at
Ohio State University Medical Center and Department of Pathology at Louisiana
State University Health Sciences Center have taught me a lot about
cardiovascular diseases. I have enjoyed interacting with physicians, surgeons and
other researchers. I am grateful to the American Heart Association for
recognizing the novelty of my dissertation project and for granting me the predoctoral fellowship.
vi I thank every current and former member of the laboratory for helping me and for contributing towards my research. I have had the opportunity to work with wonderful colleagues who have influenced my life in their own way. The time spent in the laboratory has been enjoyable and memorable.
Special thanks to Jigar for his helpful suggestions and advice. His efforts of ensuring that I meet with my deadlines have pushed me to work hard and be focused. He has imparted clarity at times of doubt and confusion and has made tough times manageable.
Finally, this journey could not have been possible without the love and support of my grandmother, my parents, my sister and the rest of my family and friends.
vii
VITA
1999-2002………………………………………..……..B.Sc. Zoology, Stella Maris College University of Madras, India
2002-2004...... M.Sc. Biomedial Genetics Institute of Basic Medical Science University of Madras, India
2005-2006…………………………………….………..Graduate Research Assistant Department of Pathology Louisiana State University Health Sciences Center
2006–Present…………………………………………..Graduate Research Associate; Integrated Biomedical Science Graduate Program; Department of Cardiothoracic Surgery The Ohio State University
PUBLICATIONS
Research Publications
1. Mahdi Garelnabi, Krithika Selvarajan, Dmitry Litvinov, Nalini Santanam, Sampath Parthasarathy, Dietary oxidized linoleic acid lowers triglycerides via APOA5/APOClll dependent mechanisms, Atherosclerosis. 199(2): 304–309, 2008
2. Priscilla Jaichander, Krithika Selvarajan, Mahdi Garelnabi and SampathParthasarathy, Induction of paraoxonase 1 and apolipoprotein A1 gene expression by aspirin. J. Lipid Res. 49: 2142-2148, 2008
viii 3. Sampath Parthasarathy; Dmitry Litvinov; Krithika Selvarajan; Mahdi Garelnabi, Lipid peroxidation and decomposition-Conflicting roles in plaque vulnerability and stability). Biochim Biophys Acta. 1781(5):221-31, 2008
4. Dmitry Litvinov, Krithika Selvarajan, Mahdi Garelnabi, Larissa Brophy, Sampath Parthasarathy. Anti-atherosclerotic actions of azelaic acid, an end product of linoleic acid peroxidation, in mice. Accepted for publication in Atherosclerosis. 2009
5. Sampath Parthasarathy, Dmitry Litvinov, Krithika Selvarajan, Oxidation hypothesis of atherosclerosis did not go far enough to include the oxidation of lipid peroxide-derived aldehydes. Could antioxidants cause the accumulation of toxic aldehydes? Free Radic. Biol. Med. 2009 In Press
FIELD OF STUDY
Major Field of Study: Integrated Biomedical Science Area of Emphasis: Biochemical and Molecular Basis of Disease
ix
TABLE OF CONTENTS
Page
ABSTRACT...... ii
ACKNOWLEDGEMENTS...... vi
VITA...... viii
LIST OF TABLES………………………………………………………………………xiii
LIST OF SCHEMES……………………………………………………………………xiv
LIST OF FIGURES………………………………………………………………………xv
LIST OF ABBREVIATIONS………………………………………………………..xvii
CHAPTERS
1. Introduction……………………………………………………………………….1
1.1. Origin of monocytes…………………………………………………………………………4 1.2. Origin of macrophages……………………………………………………………………..6 1.3. Macrophage polarization………………………………………………………………….8 1.4. Functions of macrophages………………………………………………………………..9 1.4.1. Scavenger function…………………………………………………………………9 1.4.2. Lipoprotein uptake…………………………………………………………………9 1.4.3. Role of macrophages in cell death…………………………………………..11 1.4.4. Immune function……………………………………………………………...... 13 1.4.5. Tumor immunity and tumor progression………………………………..13 1.4.6. Wound healing, tissue repair and remodeling…………………………14 1.5. Scavenger receptors………………………………………………………………………….14 1.5.1. Classes of scavenger receptors………………………………………………...15 1.5.1.1. Class A……………………………………………………………………15 1.5.1.2. Class B……………………………………………………………………16 1.5.1.3. Class D……………………………………………………………………17 1.5.1.4. Class E………………………………………………………………...... 17 x 1.5.1.5. Class F……………………………………………………………………18 1.5.1.6. Class G…………………………………………………………………..18 1.5.1.7. Other recent members……………………………………………..18 1.5.2. Scavenger receptors and cell adhesion…………………………………. 19 1.6. Apoptosis……………………………………………………………………………………….20 1.6.1. Morphological features of apoptotic cells………………………………20 1.6.1.1. Blebbing of plasma membrane………………………………….21 1.6.1.2. Exposure of phosphatidylserine………………………………..21 1.6.1.3. Oxidized PS……………………………………………………………23 1.6.1.4. Mitochondrial changes…………………………………………….23 1.6.1.5. Nuclear changes……………………………………………………..24 1.6.2. Chemoattraction of monocytes by apoptotic cells………………….24 1.6.3. Agents that promote apoptosis…………………………………………….25 1.6.4. Agents that inhibit apoptosis………………………………………………26 1.6.5. Major apoptotic pathways……………………………………………………27 1.6.5.1. Death receptor pathway…………………………………………27 1.6.5.2. Mitochondrial pathway…………………………………………27 1.6.5.3. Caspase-independent apoptosis…………………………….28 1.6.5.4. Granzyme B pathway……………………………………………29 1.6.5.5. ER and apoptosis………………………………………………...29 1.6.6. Apoptosis in diseases………………………………………………………….30 1.6.7. Commonly used methods for studying apoptosis……………………31 1.6.7.1. Annexin V staining………………………………………………..31 1.6.7.2. DNA fragmentation assay………………………………………31 1.6.7.3. Caspase assays………………………………………………………32 1.6.7.4. Detection of mitochondrial membrane potential……..32 1.6.7.5. Membrane permeability assays……………………………..33 1.6.7.6. In vivo detection of apoptosis………………………………..33
1.7. Hypothesis and Objectives (Scope of the current study)………………………34
2. Materials and Methods………………………………………………………36
2.1. Materials………………………………………………………………………………………..36 2.2. Antibodies………………………………………………………………………………………36 2.3. Isolation and culture of mouse peritoneal macrophages……………………..36 2.4. Human monocyte-derived macrophage culture………………………………….37 2.5. Culture of HUVECs…………………………………………………………………………38 2.6. Preparation of DiI-AcLDL………………………………………………………………..38 2.7. Quantitative real time PCR………………………………………………………………38 2.8. Western blot analysis………………………………………………………………………40 2.9. Macrophage functional assays…………………………………………………………..41
xi 2.10. Annexin V-FITC staining for PS exposure………………………………………..41 2.11. Caspase 3/7 activity……………………………………………………………………….42 2.12. DNA fragmentation analysis…………………………………………………………..42 2.13. Column purification of apoptotic cells……………………………………………..43
3. Macrophage adherence is important for their scavenger function……………………………………………………………………………44
3.1 Results…………………………………………………………………………………………….44
3.1.1. Increased expression of scavenger receptors in adherent macrophages………………………………………………………………..44 3.1.2. Increased gene expression of candidate PS receptors in adherent macrophages………………………………………………….48 3.1.3. Differential integrin gene expression in mouse peritoneal macrophages………………………………………………………………..48 3.1.4. Growth factors expressed by non-adherent and adherent macrophages……………………………………………………………….50 3.1.5. Enhanced scavenger receptor activity in adherent macrophages. ………………………………………………………………53 3.1.6. Adherent macrophages have increased phagocytic ability…….56
3.2. Discussion………………………………………………………………………………………57
4. Early apoptotic HUVECs produce MCP-1 to recruit monocytes/macrophages - potential role in revival………………62
4.1. Results……………………………………………………………………………………………62
4.1.1. MCP1 gene expression in early and late apoptotic HUVECs…….62 4.1.2. MCP1 gene expression in isolated apoptotic HUVECs…………….66 4.1.3. Analysis of generation of lysophosphatidylcholine in HUVECs…………………………………………………………………………68 4.1.4. Growth of early apoptotic HUVECs in the presence of serum….69
4.2. Discussion………………………………………………………………………………………74
Conclusions…………………………………………………………………………………………….78
BIBLIOGRAPHY…………………………………………………………………………………….80
xii LIST OF TABLES
Table Page
Table 1. Monocyte heterogeneity in mammals as determined by the presence of characteristic surface antigens…………………………….6
Table 2. Specialized macrophages characteristic of their tissue-specific localization…………………………………………………………7
Table 3. M1 vs M2 macrophages…………………………………………………………….8
Table 4. Inducers of apoptosis………………………………………………………………25
Table 5. Primer sequences for quantitative real time PCR……………………….39
xiii LIST OF SCHEMES
Scheme Page
Scheme 1 Various functions of a macrophage…………………………………..2
Scheme 2 Non-adherent peritoneal macrophages as an intermediate phenotype between monocytes and tissue macrophages…………………………………………………………3
Scheme 3 Origin of monocytes from myeloid progenitor cells……………4
Scheme 4 Macrophages in apoptotic cell recognition……………………….11
Scheme 5 Macrophages as scavengers or revivers of apoptotic cells….35
Scheme 6 Potential role of integrins and MFG-E8 in determining the function of non-adherent and adherent macrophages in apoptosis………………………………………………………………….60
Scheme 7 Non adherent and adherent macrophages in atherosclerosis………………………………………………………………61
Scheme 8 Proposed scheme of monocyte recruitment by apoptotic endothelial cells in atherosclerosis…………………..76
xiv LIST OF FIGURES
Figure Page
Figure 1. Phosphatidylserine………………………………………………………………….21
Figure 2. Increased scavenger receptor expression in mouse peritoneal macrophages………………………………………………………….46
Figure 3. Scavenger receptor expression in human monocyte-derived macrophages……………………………………………….47
Figure 4. Gene expression of candidate PS receptors in non-adherent and adherent mouse peritoneal macrophages………48
Figure 5. Integrin gene expression in mouse peritoneal macrophages……….49
Figure 6. Growth factor expression in mouse peritoneal macrophages……….51
Figure 7. MFG-E8 expression in human monocyte-derived macrophages….52
Figure 8. Increased uptake of DiI-AcLDL by adherent macrophages.………..53
Figure 9. Increased PS liposome uptake by adherent macrophages.………….54
Figure 10. Increased phagocytosis of 1 μm fluorescent latex beads by adherent mouse peritoneal macrophages………………………………….56
Figure 11. Characterization of apoptosis in HUVECs induced by serum deprivation ± TNFα………………………………………………………………..64
Figure 12. Induction of MCP-1 in apoptotic HUVECs………………………………..66
Figure 13. Annexin V-FITC staining of column isolated HUVECs……………….67
xv
Figure Page
Figure 14. MCP-1 gene expression in column isolated HUVECs….………………68
Figure 15. Detection of LPC in HUVECs by thin layer chromatography..……..69
Figure 16. Growth of early apoptotic HUVECs in the presence of medium with 20% serum………………………………………………………………………71
Figure 17. Growth of labeled apoptotic HUVECs in the presence of regular growth medium………………………………………………………………………72
Figure 18. Early apoptotic HUVECs incubated in the presence of peritoneal lavage fluid……………………………………………………………..73
xvi ABBREVIATIONS
ABCA1 ATP-binding cassette transporter, subfamily A, member 1 AcLDL Acetylated low density lipoprotein AIDS Acquired immuno deficiency syndrome AIF Apoptosis inducing factor Apaf Apoptotic protease activating factor Apoe-/- Apo E knockout mice APT Aminophospholipid translocase ATP Adenosine tri phosphate Bak Bcl-2 homologous antagonist/killer Bax Bcl-2-associated X protein Bcl 2 B-cell CLL/lymphoma 2 bFGF Basic fibroblast growth factor Bid BH3 interacting domain death agonist CD Cluster of differentiation Cd36-/- CD36 knockout mice CHO-K1 Chinese hamster ovary cells CL-P1 Cleavage and polyadenylation factor 1 CMXRos Chloromethyl-X-rosamine c-myc v-myc myelocytomatosis viral oncogene homolog (avian) CRD Carbohydrate recognition domain CSF-1 Colony stimulating factor-1 CXCL16 Chemokine (C-X-C motif) ligand 16 DEVD Asp-Glu-Val-Asp DIABLO Direct IAP-binding protein with low pI DiI 1,1’-dioctadecyl-3,3,3’,3’tetramethylindicarbo- cyanine perchlorate DiIAcLDL DiI labeled acetylated low density lipoprotein DISC Death-inducing signaling complex DNA Deoxyribonucleic acid E1A Adenoviral oncogene EGF Epidermal growth factor Endo G Endonuclease G ER stress Endoplasmic reticulum stress FACS Fluorescence activated cell sorting xvii FADD Fas associated death domain FEEL fasciclin, EGF-like, laminin-type EGF-like, and link domain-containing scavenger receptor FGF Fibroblast growth factor FITC Fluorescein isothiocyanate G6PD Glucose 6-phosphate dehydrogenase GM-CSF Granulocyte–macrophage colony-stimulating factor HDL High density lipoprotein HEK293 Human Embryonic Kidney 293 cells Hsp Heat shock protein HUVECs Human umbilical vein endothelial cells IAPs Inhibitors of apoptosis proteins ICAM Intracellular adhesion molecule IFN Interferon IGF Insulin-like growth factor IL10 Interleukin-10 IL13 Interleukin-13 IL1ß Interleukin-1ß IL2 Interleukin-2 IL4 Interleukin-4 iPLA2 Calcium-independent phospholipase A2 LDL Low density lipoprotein LIMK LIM kinase LIMP Lysosomal integral membrane protein LOX-1 Lectin-like oxidized low density lipoprotein receptor-1 LPC Lysophosphatidylcholine LPS Lipopolysaccharide MAPK Mitogen activated protein kinase MARCO Macrophage receptor with collagenous structure MCP-1 Monocyte chemotactic protein-1 M-CSF Macrophage colony-stimulating factor Mertk2 Mer receptor tyrosine kinase MHC-I Major histocompatability-I MHC-II Major histocompatability-II mlDL Maleated low density lipoprotein MMP Matrix metalloproteases MOMP Mitochondrial outer membrane permeabilization NADPH Nicotinamide adenine dinucleotide phosphate NGF Nerve growth factor oxLDL Oxidized low density lipoprotein
xviii PAK2 p-21 activated protein kinase-2 p53 Tumor suppressor gene PARP Poly-ADP-ribose-polymerase PC Phosphatidylcholine PDGF Platelet-derived growth factor PET Positron emission tomography PI Propidium iodide PLS Phospholipid scramblase PMA Phorbol myristyl acetate PS Phosphatidylserine ROCK Rho associated kinase ROS Reactive oxygen species SCARA Scavenger receptor A Smac Second mitochondrion-derived activator of caspases SMCs Smooth muscle cells SPECT Single photon emission computed tomography SR Scavenger receptor SREC SRs expressed by endothelial cells SR-PSOX Scavenger receptor that binds with phospatidylserine and oxidized lipoprotein TAM Tumor-associated macrophages TdT Terminal deoxynucleotidyl transferase TGF-β Transforming growth factor-β TNF Tumor necrosis factor TNF-α Tumor necrosis factor-α TRAF-2 Tumor necrosis factor-receptor-associated factor 2 TSP-1 Thrombospondin 1 TUNEL Terminal deoxynucleotidyl transferase dUTP nick end labeling VEGF Vascular endothelial growth factor β-VLDL Very low density lipoprotein
xix
CHAPTER 1
INTRODUCTION
During the past three decades, macrophages have emerged as a key player in the pathology of many chronic diseases. Central among their actions are their scavenger and inflammatory functions. Their abilities to scavenge foreign materials including bacteria, cell debris, and senescent cells took the backstage when it was realized in the late seventies that damaged lipoproteins could serve as macrophage ‘food’ and could be the underlying cause of arterial blockage or atherosclerosis. These studies spawned a new era in the study of macrophage biology and the study of receptors that are involved in their adherence to matrix components as well as those responsible for their scavenger function. Currently these functions appear to be indistinguishable as there is confusion as to the requirement of the scavenger receptors themselves for cellular adhesion. There is also a growing body of evidence suggesting that many of these receptors also are involved in cellular signaling upon ligand binding. Paradoxically, the cells that are so intimately involved in phagocytosis can also promote growth! In addition to many inflammatory cytokines that posses or induce growth factors, macrophages produce many different growth promoting activities including specific growth promoting activities for vascular endothelial cells (VEGF). One
1 can’t help wondering whether removal, repair, and rejuvenation occur concurrently and are integral part of the macrophage-mediated defense system.
Yet another process that macrophages are intimately involved with is the antigen processing and presentation for antibody production to prevent additional or new threat (Scheme 1).
Scheme 1: Various functions of a macrophage
While the presence of different types of macrophages with different phenotypes have been recognized recently, there is a big void of studies on yet another macrophage phenotype, the “peritoneal macrophages” (Scheme 2).
2
Scheme 2: Non-adherent peritoneal macrophages as an intermediate phenotype between monocytes and tissue macrophages
These are cells that abound the peritoneal cavity of most rodents and yet are a
few in number in the normal human peritoneal cavity. In rodents, their numbers
can be increased by the intraperitoneal administration of irritants such as
thioglycollate, carraghennan, chalk powder etc. In humans, pathological
conditions, such as endometriosis in women, are accompanied by an increase in these cells. In fact, their presence in women with endometriosis was what prompted our laboratory to undertake the proposed studies. Our laboratory proposed the hypothesis that peritoneal macrophages might be involved in the revival and growth of retrograde menstruation derived partially apoptotic endometrial cells in the peritoneal cavity accounting for the implantation and growth of endometrial cell. A key feature of these peritoneal cells is that they are non-adherent in situ and could be easily lavaged by saline washing. They are known to produce lipid and peptide inflammatory products and yet appear to lack the scavenger functions that are the hallmarks of these cells. It is the latter property that is one of the major focuses of the current proposed studies.
3 1.1. Origin of monocytes
Monocytes are the precursors for macrophages. Monocytes originate in the
bone marrow from myeloid progenitor cells (Scheme 3) and enter the
bloodstream where they remain in circulation for several days. Peripheral blood
is composed of 3-8% monocytes and their half-life in humans is reported to be about 3 days (1).
Scheme 3: Origin of monocytes from
myeloid progenitor cells
In the absence of inflammatory stimuli, they exit from circulation in a
random manner. Once they migrate to tissues they develop into resident
macrophages. Increase in number of tissue macrophages is achieved by entry of
blood monocytes responding to various signals that arise during infection and
4 inflammation (2). Chemotaxis is a phenomenon by which cells move towards a
concentration gradient of a ‘chemotactic factor’. Many molecules generated
during infection or injuries are recognized by the surface receptors of monocytes
and macrophages and triggers chemotactic response. Such substances include
monocyte chemotactic protein-1 (MCP-1) (3), complement C5a (4),
lysophosphatidylcholine (LPC) (5), platelet-derived growth factor (PDGF) (6), N-
formylated peptides produced by bacteria (7), leukotriene B4 and other
eicosanoids (8-11), collagen and elastin fragments (12, 13), thrombin (14), platelet
factor 4 (15), and several neutrophil proteins and peptides including cathepsin G,
azurophils and defensins (16, 17). Most chemotactic agents act via receptor-
dependent mechanisms. In general most chemotactic factors for monocytes are
also chemotactic factors for lymphocytes which may suggest that these cells might act in unison.
Primary functions of monocytes include
• Host defense
• Tissue remodeling and repair
• Precursors to tissue macrophages and dendritic cells
A characteristic feature of these blood cells is their heterogeneous nature.
They exhibit differences in size, granularity and nuclear morphology (18). In
addition, different subsets have been identified based on the expression of
specific surface antigenic markers which in turn dictates their function. Two
major subsets have been characterized in humans, mice, rats and pigs as shown in Table 1 (19). 5
Table 1: Monocyte heterogeneity in mammals as determined by the presence
of characteristic surface antigens
Species Non-inflammatory monocytes Inflammatory monocytes Human CD14+CD16+ CD14hiCD16- Mice Ly-6Clo Ly-6Chi Rats CD43hi CD43low Pigs CD163+ CD163-
1.2. Origin of macrophages
Monocytes and macrophages form the mononuclear phagocytic system.
Through a process of differentiation monocytes become macrophages in
peripheral tissues (20-22). This occurs to renew the macrophage population and
when inflammatory processes ensue. In vitro, agents like phorbol myristyl
acetate (PMA), macrophage colony-stimulating factor (M-CSF) and granulocyte–
macrophage colony-stimulating factor (GM-CSF) are routinely used to induce
differentiation of monocytes to macrophages (23, 24). Typically monocytes are
kept in culture for a week in the presence of autologous serum (or AB serum) to allow for adherence and differentiation to macrophages. Differentiation of a monocyte into a tissue macrophage involves a number of changes that have been demonstrated using in vitro and in vivo systems: the cell enlarges five-ten fold with an increase in protein content; its intracellular organelles increase in both number and complexity; it acquires increased phagocytic ability, produces higher levels of hydrolytic enzymes and begins to secrete a variety of soluble factors (25).
Besides increase in cellular oxidative stress (26), in vitro analysis of monocyte 6 differentiation showed that macrophages get depleted of antioxidants such as vitamin E and there is an increase in n-3 long chain polyunsaturated fatty acids
(27).
These mononuclear phagocytes are widely distributed throughout the body and are found in a variety of locations. While “macrophage” is a more general term, these cells have specialized names depending on the tissue of localization as seen in Table 2.
Table 2: Specialized macrophages characteristic of their tissue-specific
localization
Name Location
Kupffer cells Liver
Microglia Central Nervous System
Osteoclast Bone
Histiocytes Connective tissue
Dust cells/Alveolar macrophages Lungs
White pulp/Red pulp/Marginal- Spleen
zone/Metallophilic macrophage
Epitheliod cells Granuloma
Macrophages are also found in the serous cavities such as the peritoneum.
Although the exact lifespan of tissue macrophages in unknown, it is thought that resident macrophages live longer than macrophages that respond to inflammation.
7 1.3. Macrophage polarization
Based on the cues received from their microenvironment, macrophages
get activated and develop into either M1 or M2 phenotypes (28-30). This
phenomenon was initially observed in vitro and later demonstrated in vivo. Thus by altering the cytokine environment, different macrophage phenotypes can be obtained from the same monocyte population. M1 are classically activated macrophages while M2 are alternatively activated. M2 population is heterogeneous as it can further be subdivided into M2a, M2b and M2c. Table 3 lists the characteristic features of M1 and M2 polarization.
Table 3: M1 vs M2 macrophages
Feature M1 M2
Activation pathway Classical Alternate Activating molecules IFN, LPS, TNF, GM-CSF M2a: IL4, IL13 M2b: IL1β, LPS M2c: IL-10, TGFβ, Glucocorticoids Inflammatory Pro-inflammatory Anti-inflammatory response (Secrete IL-1β, IL-6, IL- (Production of pro-inflammatory 12, IL-15, IL-18, TNFα cytokines is suppressed) etc) T cell response Support Th1 response Support Th2 effector functions Function (s) Endocytosis Scavengers of debris, promote angiogenesis, tissue remodeling and repair Arginine metabolism High levels of iNOS High levels of arginase
8 1.4. Functions of macrophages
1.4.1 Scavenger function
Macrophages are professional phagocytes that are capable of ingesting a wide variety of substances. The ligands can be physiological including microbes, lipoproteins, apoptotic cells and cellular debris or non physiological such as asbestos and silica (31). As a result they help maintain homeostasis and provide defense against invading pathogens. Macrophages respond to chemotactic stimuli and efficiently perform their function at the target site (32). Recognition and internalization of ligands is achieved by the expression of innumerous cell surface receptors. Many phagocytic receptors can also mediate adhesion of macrophages which is an important step for their scavenger function. Following uptake of the target molecule, macrophages digest the components via the endosome-lysosome pathway.
1.4.2. Lipoprotein uptake
Macrophages express receptors for cholesterol-containing lipoproteins such as low density lipoprotein (LDL) and very low density lipoprotein (β-VLDL)
(33, 34). Another family of receptors called scavenger receptors (SRs) were identified based on their ability to bind modified LDL namely acetylated LDL
(AcLDL) (35).
But today, not only have the classes of scavenger receptors have expanded, but so have the ligands that bind to them. This includes other modified forms of
LDL such as oxidized LDL (oxLDL), maleylated LDL (mlDL), various enzyme
9 digested LDL (phospholipase C or sphingomyelinase treated LDL), apoptotic cells, pathogen components and anionic phospholipids (36). The term “scavenger
receptor” was coined by Goldstein and Brown in 1979 to emphasize that the
uptake of modified lipoprotein was not through the classical LDL receptor.
Macrophage foam cell formation is facilitated by the scavenger receptors as they
do not respond (in contrast to the LDL receptor) to any feedback inhibition due
to cholesterol accumulation.
The scavenger receptors expressed by macrophages include:
• Class A (SRAI, SRAII, SRAIII, MARCO, SRCL)
• Class B (CD36, SR-BI)
• Class D (CD68)
• Class E (LOX1)
• Class F (SREC-I, SREC-II)
• Class G (SR-PSOX/CXCL16)
These receptors will be discussed in detail later. Although the classification is
based on structural characteristics, members within each class can vary based on
ligand specificity, tissue expression and additional structural features (37, 38). In
addition, the IgG receptor FcγRII-B2, integrins such as αVβ3 and αVβV as well as
TLR-4 have also been shown to bind to oxLDL (39) and contribute to foam cell
formation. Downstream signaling events following binding of modified
lipoproteins to SRs have not been clearly elucidated. It was demonstrated that
during foam cell formation, binding of oxLDL to CD36 activated members of
MAP kinases, JNK1 and JNK2 (40). Binding of oxLDL to LOX-1 resulted in an 10 increased production of reactive oxygen species (ROS) and activation of NF-κB in bovine aortic endothelial cells (41). The contribution of specific scavenger pathway to any specific functionality or pathological process has not been determined.
1.4.3. Role of macrophages in cell death
Scheme 4: Macrophages in apoptotic cell recognition
While a great deal is known about the behavior of macrophages towards
apoptotic cells, very little information is available on necrotic cell clearance.
Apoptotic cell clearance elicits an anti-inflammatory response; necrotic cells
induce a pro-inflammatory response.
Macrophages are responsible for the rapid engulfment of apoptotic cells
before they can undergo secondary necrosis and release their cellular contents in
11 to the surrounding tissues. This helps in maintenance of tissue structure and
function by ensuring effective waste disposal and suppression of inflammation
(42). Peter Henson and co-workers coined the term ‘efferocytosis’ (Greek: effero-
to bury) to describe the process of clearance of apoptotic cells by professional and
non professional phagocytes (43).
Numerous macrophage receptors have been identified in the recognition
of “eat me” signals displayed by apoptotic cells. Some receptors come in to direct
contact with the “eat me signal”, while others first bind to an opsonin which in
turn recognize the apoptotic cell. Though a plethora of receptors, apoptotic
signals and pathways may seem redundant, it probably ensures the timely and
efficient removal of dead cells by the scavengers. The scavenger receptors
involved in the apoptotic cell recognition and clearance include SR-A, CD36,
CD68, LOX-1. Besides these, a wide variety of other receptors such as integrin
receptors (αvβ3 and αvβ5), CD14, PS receptor, ATP-binding cassette transporter
(ABCA1) and Mer receptor tyrosine kinase (Mertk2) also facilitate the recognition of apoptotic cell surface molecules (44, 45).
Macrophages can also induce cell death in certain instances. For example,
mesangial cells were shown to undergo apoptosis when co-cultured in the
presence of macrophages (46). Macrophages also induce apoptosis of endothelial
cell in the vitreous during eye development (47).
12 1.4.4. Immune function
The scavenger cells play an active role in both innate and adaptive
immunity. Once they encounter a pathogen, macrophages either directly binds to
the micro-organism by adsorption or following opsonization. The microbes may
activate the complement cascade which produces complement fragments for
opsonization. Complement fragments may also be derived from macrophages.
Receptors such as Fc receptors (CD16, CD64), complement receptors (CD35,
CD18), mannose-fucose receptors and scavenger receptors are involved in the
recognition of ligands, which is followed by internalization and destruction of the
pathogen (48-52). Many of the receptors involved in recognition of pathogen
associated molecular patterns are commonly referred to as ‘pattern recognition
receptors’. In many cases macrophages produce potent mediators such as
reactive oxygen intermediates (eg: hydrogen peroxide, superoxide) and
arachidonic acid metabolites (eg: prostaglandin E2, thromboxane, prostacyclin)
which possess microbicidal activities. Cytokines like TNFα, IL-1, IL6, M-CSF GM-
CSF etc are secreted to mediate an immune response (53-57).
As antigen presenting cells, macrophages efficiently process the targets and present the antigens as a complex with MHC Class II/ Class I molecules to
CD4 or CD8 T cells respectively (58).
1.4.5. Tumor immunity and tumor progresssion
The tumor-associated macrophages (TAMs) are considered a double-
edged sword as they can promote both tumor progression as well as regression.
13 Interaction between TAMs and cancer cells can cause phagocytosis and lysis of
tumors. TAMs can lyse tumor cells in an antibody dependent and independent
fashion. They can also inhibit the cell division of cancer cells by production of
TNFα, IL-1, prostaglandins etc (59, 60).
TAMs can cause progression of tumors by inducing angiogenesis, tumor
cell migration/invasion and by inducing growth of the tumors. Production of
factors such as VEGF, FGF-2, TNF-α, MMPs and a variety of
cytokines/chemokines facilitate the diverse roles played by TAMs (58-63, 30).
1.4.6. Wound healing, tissue repair and remodeling
Macrophages are actively recruited to the site of injury where they become
the source of growth factors (PDGF, TGFβ, EGF), proteases (collagenase,
elastase), extracellular matrix molecules and chemoattractants to orchestrate the
wound healing and tissue repair (64, 65).
1.5. Scavenger receptors
Scavenger receptors (SRs) are a family of membrane proteins that were
first identified in macrophages due to their ability to bind and internalize
modified lipoproteins that resulted in cholesterol accumulation and foam cell
formation. Since its discovery, a wealth of information has come in to light about the SRs. As their name indicates, they bind and scavenge an array of molecules that has further contributed to the diversity and functionality of these receptors.
Today about 6 classes of SRs have been identified based on structure.
14 1.5.1. Classes of scavenger receptors
1.5.1.1. Class A
In 1990, Kodama et al cloned the first macrophage scavenger receptor which was named SR-A (66). Currently, members of class A are SR-AI, SR-AII,
SR-AIII, macrophage receptor with collagenous structure (MARCO) and SR with
C-type lectin (SRCL).
Structurally, SR-A receptors consists of six domains which includes
• N-terminal cytoplasmic domain (domain I)
• Transmembrane spanning region (domain II)
• Spacer region (domain III)
• A-α helical coiled coil motif involved in trimerization (domain IV)
• Collagenous domain that mediates ligand binding (domain V) and
• C-terminal cysteine-rich motif that is isoform specific (domain VI).
SR-AI, II and III are formed by alternate splicing mechanism. SR-AII lacks domain VI while SR-AIII has a truncated C-terminal region. MARCO is characterized by the absence of domain IV and SRCL has a unique C-terminal calcium-dependent C-type carbohydrate recognition domain (CRD) (67). While macrophages have a high constitutive expression of SRs, a low level of expression is found in aortic endothelial cells and vascular smooth muscle cells. In vitro,
SMC SR expression was found to be upregulated using agents like phorbol ester, growth factors like PDGF and TGFβ1 (68).
SR-A ligands are polyanionic that includes a wide variety of molecules such as modified LDL (acetylated, oxidized), oxidized HDL, gram negative and gram 15 positive bacteria, lipopolysaccharide, fucoidin, dextran sulfate,
polyribonucleotides such as polyinosinic acid and polyguanylic acid, apoptotic cells etc.
Multifunctional SR-A are widely recognized for their involvement in
atherogenesis, macrophage adhesion and phagocytosis of apoptotic cells. SR-A
also belong to the class of pattern recognition receptors thus participating in
innate immune response (69, 70).
1.5.1.2 Class B
CD36, SR-BI and lysosomal integral membrane protein II (LIMPII) are
members of the class B scavenger receptor family. The N- and C-terminal form
the transmembrane region and the receptor traverses the membrane twice which
forms an extracellular loop that is extensively glycosylated.
Due to the relevance of CD36 to the proposed project, it will be more extensively
discussed than other class B members.
CD36 was identified as the platelet integral membrane glycoprotein
(glycoprotein IV) receptor that could bind to thrombospondin and Plasmodium
falciparum-parasitized erythrocytes. Today, some of the best known ligands for this SR include oxidized LDL, collagen I and IV, anionic phospholipids, long-
chain fatty acids, apoptotic cells, sickle cell erythrocytes, advanced glycation end
products, β-amyloid as well as native lipoproteins (LDL, HDL, VLDL). Several
cells including monocytes/macrophages, dendritic cells, adipocytes,
16 microvascular endothelium, skeletal muscle and erythroid precursors express
CD36 (71). Thus it has a more widespread distribution than SR-A.
Proatherogenic role of CD36 have been confirmed through several in vivo
studies in Apoe-/- mice. A marked reduction in atherosclerotic lesion was seen in
Apoe-/- Cd36-/- mice (72). CD36 has also been shown to play a proinflammatory
role in Alzheimer disease (73). When β-amyloid fibrils bind to CD36,
inflammatory signaling cascade is initiated that result in neuronal degeneration.
Uptake of apoptotic cells is mediated through the cooperative binding of CD36
and αvβ3 to TSP-1 that acts as a bridging molecule between the phagocytes and cells undergoing apoptosis.
1.5.1.3. Class D
CD68 and its murine homolog, macrosialin, are heavily glycosylated SRs
found in the endosomes of macrophages. In vitro, these receptors bind to OxLDL
(74). CD68 has also been suggested to be a potential receptor for recognition and
uptake of apoptotic cells.
1.5.1.4. Class E
Lectin-like oxidized low density lipoprotein receptor-1 (LOX-1) consists of
a short intracellular domain, a transmembrane-spanning region, and an
extracellular C-type lectin domain. The N-linked glycosylation is thought to
facilitate binding of LOX1 to OxLDL (75). The receptor functions as a homodimer
whose extracellular domain can be cleaved to generate a soluble form. Although
17 originally discovered in bovine aortic endothelial cells, LOX1 is also expressed by macrophages and smooth muscle cells. Other ligands for LOX1 include apoptotic cells, activated platelets, bacteria and advanced glycation end products (76).
1.5.1.5. Class F
This class primarily includes SRs expressed by endothelial cells (SREC-I and SREC-II). Structural characteristics include five epidermal growth factor– like domains, a transmembrane domain and a long intracellular C terminus.
SREC-I accounts for only 6% of macrophage AcLDL degradation (77).
1.5.1.6. Class G
SR-PSOX/CXCL16 is known to bind to oxLDL and bacteria. It is expressed by macrophages, endothelium and smooth muscle cells (78).
1.5.1.7. Other recent members
Some new members that have been added to the list of SRs include fasciclin epidermal growth factor (EGF)-like, laminin-type EGF-like, and link domain-containing scavenger receptor (FEEL1, FEEL2), SCARA5, CD163 and
CL-P1 (79). This expanding class of membrane proteins warrants more investigation in to their nature and functioning in the biological system.
18 1.5.2. Scavenger receptors and cell adhesion
Several investigations have shown that scavenger receptor expression confers an adherent phenotype to cells. Gordon et al demonstrated that calcium- independent adhesion of RAW 264.7 cells was blocked using 2F8 antibody that is specific for SR-A (80). Peritoneal macrophages from SR-A null mice were less adherent and maintained a more round phenotype in culture (81). Freshly isolated peripheral monocytes were shown to have very low SR-A expression which increases when monocytes are maintained in culture for a week and allowed to differentiate in to macrophages (82). Other weakly adherent cells such as HEK293 bound well to plastic when transfected with SR-A receptors (83).
The collagenous domain of class A SRs mediate binding of these proteins to
extra-cellular matrix components such as collagen type IV and denatured
collagen type I and III. Proteoglycans of the extra-cellular matrix such as biglycan
and decorin are also ligands for SR-A (84). It is suggested that class A-mediated
adhesion involves activation of the Gi/o dependent signaling pathway, actin
polymerization and formation of focal adhesion complexes (85, 86). Other SRs
like LOX1 were also shown to participate in cell adhesion. CHO-K1 cells that were
stably transfected with LOX1 bound to fibronectin efficiently (87).
Thus the multifunctional nature of SRs is obvious. In my studies, I further
investigate the properties of adherent and non-adherent macrophages pertaining to SR expression, adherence and function.
19 1.6. Apoptosis
Apoptosis is an active and regulated form of cell death that plays an essential role
in the development of multi-cellular organisms and in maintaining tissue
homeostasis. The term was coined by Kerr, Wyllie and Currie in 1972 which in
Greek refers to the falling of leaves or flower petals (88). The roundworm,
Caenorhabditis elegans, served as an important model in which most of the
exciting discoveries were made. In 2002, Sydney Brenner, John Sulston and
Robert Horvitz were awarded the Nobel Prize in Medicine for their discoveries of
genetic regulation of apoptosis.
Apoptosis or programmed cell death is a common phenomenon that is
observed from embryogenesis throughout various life processes. The
physiological significance of apoptosis is evident from events such as
disappearance of inter-digital membrane during development, breakdown of
endometrial lining during menstruation, turnover of intestinal lining etc. It is
also a well conserved process from nematodes to humans. Due to its role in
normal physiology and in several pathological conditions, extensive research has
been carried out to understand this phenomenon.
1.6.1. Morphological features of apoptotic cells
When a cell undergoes apoptosis it exhibits certain signature features that distinguish this form of cell death from all others. These include cell shrinkage, chromatin and nuclear condensation, blebbing of plasma membrane, DNA
20 fragmentation and fragmentation of cell into apoptotic bodies. If the cell is not
taken up by phagocytes, it undergoes secondary necrosis.
1.6.1.1. Blebbing of plasma membrane
One of the distinctive features of apoptosis is the blebbing of plasma
membrane. This is thought to result due to weakening of the cytoskeleton as
many cytoskeletal proteins such as actin, myosin, spectrins, α-actinin, gelsolin
and filamin are substrates for caspases (89). At the same time, it has also been
shown that caspases activate Rho-associated kinase (ROCK I and ROCK II) which
in turn generates actin-myosin force through the phosphorylation of myosin light
chain (90-92). This results in cell contraction and membrane blebbing. Other
kinases such as stress activated protein kinase p38, p21–activated protein kinase-
2 (PAK2) or LIM-kinases 1 and 2 (LIMK1 and LIMK2) that are involved in
regulating expression of actin and actin-associated proteins and their dynamics
can also affect membrane blebbing (93-95).
1.6.1.2. Exposure of phosphatidylserine
Figure 1. Phosphatidylserine
21 Healthy cells exhibit membrane phospholipid asymmetry with the
aminophospholipids (PS and PE) present on the inner leaflet and the choline
containing phospholipids (PC and sphingomyelin) present on the outer leaflet.
Physiological relevance of this asymmetric distribution is multifold. Many cytoplasmic proteins such as annexin, spectrin and protein kinase C localize to
the cytoplasmic side of the membrane by interacting with PS (96-98). Studies
using erythrocyte membranes have shown that interaction between skeletal
proteins and aminophospholipids helps in maintaining the mechanical stability
of plasma membrane (99). This asymmetry is maintained by aminophospholipd
translocase (APT) or ‘flippase’ and ATP-independent phospholipid scramblase
(PLS). While APT is involved in transporting PS and PE to the inner leaflet, PLS
is associated with the bidirectional movement of all phospholipids (100, 101).
With the initiation of apoptosis, PS is exclusively transported from the
inner leaflet to the outer leaflet due to activation of PLS and inhibition of APT
(102). Externalization of PS is considered an early event in the apoptotic process
as it precedes DNA fragmentation and cell lysis (if not phagocytosed). Presence of
PS on the outer surface is a very important recognition signal or “eat me signal”
for macrophages to efficiently engulf apoptotic cells (103).
Besides PS, other molecules that are potential ligands include oxLDL,
ICAM3, annexin-1, calreticulin, mannose or fucose (104, 105).
22 1.6.1.3 Oxidized PS
Studies have shown that PS gets oxidized which promotes its
externalization and oxidized PS (OxPS) is the ligand that is recognized by
macrophage receptors. Kagan et al demonstrated that cytochrome c released
from the mitochondria is capable of causing oxidation of phosphatidsylserine
(PS) (106). Using HL-60 cells they also showed the involvement of NADPH-
oxidase in the oxidation and externalization of PS (107). Oxidized phospholipids
are believed to undergo spontaneous flip-flop (108). This could explain the
translocation of PS from the inner leaflet of the plasma membrane to the outer
leaflet. Other studies have shown that inhibition of APT due to oxidation and
activation of PLS is involved in the translocation of PS. Oxidation of APT itself
may lead to inhibition of the enzyme or APT may not be able to recognize
oxidized PS. On the other hand scramblases that facilitate bidirectional
movement of phospholipids are activated by increased levels of intracellular
calcium ions (109).
1.6.1.4. Mitochondrial changes
The organelle which is known as the power house of the cell also harbors
numerous pro-apoptotic molecules which get released in to the cytoplasm following apoptotic trigger. During apoptosis, mitochondria lose their membrane potential (110); various pro-apoptotic molecules (Bid, Bax, and Bak) cause mitochondrial outer membrane permeabilization (MOMP) as they form channels
23 to allow the release of mitochondrial molecules that participate in downstream apoptotic events (111, 112).
1.6.1.5. Nuclear changes
Massive chromatin condensation takes place with the disassembly of nuclear lamina as a result of proteolysis of lamins A, B and C by caspases (113).
The nuclear pores redistribute and DNA is fragmented in to 200-300bp fragments that can be seen as a distinct DNA-ladder on agarose gel electrophoresis (114, 115). Microtubules are thought to assist in dispersing nuclear fragments into plasma membrane blebs.
1.6.2. Chemoattraction of monocytes by apoptotic cells
In vitro trans well migration assays have shown that apoptotic cells produce increased levels of chemoattractants such as LPC and thrombospondin which can recruit macrophages (116). S19 ribosomal protein dimer and split human tyrosyl-tRNA synthetase have also been described as “find me signals”
(117, 118). The events that take place from the release of a chemotactic factor to the activation of a macrophage are largely unknown. It appears that iPLA2
((Ca2+-independent phospholipase-A2) that is produced by caspase-3 mediated action cleaves membrane phosphatidylcholine to generate LPC which may act alone or in concert with other factors to function as a chemoattractant. The effects of LPC could be receptor mediated or independent of a specific receptor
24 wherein LPC may incorporate in to the plasma membrane and interact with signaling molecules.
1.6.3. Agents that promote apoptosis
Till date, numerous agents have been known to induce apoptosis. They could broadly be classified as physiological, damage-related or therapy associated as seen in table. This surely is not a comprehensive list as new agents are being discovered everyday.
Table 4: Inducers of apoptosis
Type of inducer Agents
Physiological TNF family (TNF and Fas/CD95-L), TGF-β, Withdrawal of growth
factors, Modified lipoproteins (oxLDL), Neurotransmitters
(glutamate, dopamine), Glucocorticoids, Calcium influx, Loss of
matrix attachment
Damage-related Heat shock, Viral infection, Bacterial toxins, Oncogenes (c-myc,
E1A), Tumor suppressor genes (p53), Free radicals
Therapy-associated Chemotherapeutic drugs (cisplatin, etoposide, cycloheximide,
bleomycin, adriamycin, hydroxyurea etc), Radiation (gamma, UV)
25 1.6.4. Agents that inhibit apoptosis
In every cell there are a set of molecules with anti apoptotic activity. The
best characterized of these include Inhibitors of Apoptosis Proteins (IAPs) that
are caspase inhibitors and members of the Bcl family such as Bcl-2, Bcl-xL etc
(119, 120). In cancer cells, increased gene expression of IAP called survivin
renders them resistant to apoptosis (121). Pro-survival Bcl molecules sequester
Bax and Bak that are pro-apoptotic, thus maintaining mitochondrial integrity
(122). They also act on lysosomes, ER and cytosol to prevent apoptosis. Apart
from the intracellular inhibitors, many diverse molecules in the extracellular
milieu act to prevent programmed cell death.
It has been shown that apoptosis is inhibited in the presence of growth
factors. Several growth factors such as vascular endothelial growth factor (VEGF)
(123), platelet-derived growth factor (PDGF) (124), epidermal growth factor
(EGF) (125), nerve growth factor (NGF) (126), insulin-like growth factor 1 (IGF-1)
(127) and basic fibroblast growth factor (bFGF) (128) protect cells from apoptosis. These growth factors act through various intracellular signaling pathways to exert their action. Recently it was reported that embryonic stem cell
conditioned medium inhibited apoptosis of H9c2 cardiac myoblast cells (129).
Anoikis is the form of programmed cell death that is induced by
detachment of cells from extracellular matrix. Coagulation factors VIIa and Xa inhibit apoptosis induced by detachment and serum deprivation (130). Hsp 70
has been shown to prevent the formation of a functional apoptosome in a cell-
free system (131). While bacteria like Shigella and Legionella induce apoptosis in
26 the host’s cells, Chlamydia has been observed to inhibit host cell apoptosis (132).
Thus innumerous agents exist that can be pro- or anti-apoptotic or both.
1.6.5. Major apoptotic pathways
There are two principal apoptotic pathways namely the death receptor
pathway (extrinsic pathway) and the mitochondrial pathway (intrinsic pathway).
Although the two pathways operate independently, certain degree of crosstalk
does exist between them (133-135).
1.6.5.1. Death receptor pathway
When ligands such as Fas or Tumor Necrosis Factor (TNF) bind to their
receptors, it causes oligomerization of the receptors. This is followed by recruitment of adaptor molecule Fas-Associated Death Domain (FADD) which in turn recruits procaspase 8 to form the death-inducing signaling complex (DISC).
Procaspase 8 gets autoactivated and is released from DISC to act on one of the executioner caspases, namely caspase 3. Caspase 8 also truncates Bid to tBid which translocates to the mitochondria to form channels for the the release of
proapoptotic molecules. tBid binds to cardiolipin which is a mitochondria-
specific protein.
1.6.5.2. Mitochondrial pathway
In response to apoptotic stimuli such as withdrawal of growth factors,
DNA damage or application of chemotherapeutic agents etc, there is disruption of
27 mitochondrial transmembrane potential. Proapoptotic members such as Bax,
Bad, Bid associate with mitochondrial membrane and modify its permeability.
Some of the other changes associated with the mitochondria are increased
production of ROS, potassium channel activation and calcium ion uptake. As a
result of increased membrane permeability a number of factors are released from
the organelle, one of which is cytochrome c. Together with ATP, cytochrome c
forms a complex with Apaf-1(Apoptotic Protease Activating Factor) and
procaspase-9. This complex is called the apoptosome. Procaspase-9 is then
released in an active form to activate caspase 3. The death receptor pathway and
the mitochondrial pathway converge at the level of caspase 3 activation. In
addition, crosstalk occurs when caspase 8-mediated cleavage of Bid causes it to
translocate to the mitochondrion and release cytochrome c. Smac (the Second
mitochondrion-derived activator of caspases), DIABLO (Direct IAP-binding
protein with low pI) and HtrA2/Omi are a group of proteins that are released
from the mitochondrion and bind to inhibitors of apoptosis proteins (IAP) thus
activating caspases.
1.6.5.3. Caspase-independent apoptosis
Studies in the recent years have unveiled other pathways of programmed
cell death that are caspase-independent. Apoptosis-Inducing Factor (AIF) and endonuclease G (Endo G) are nucleases that are released from the mitochondria upon induction of apoptosis which can enter the nucleus to cause DNA fragmentation (136).
28 1.6.5.4. Granzyme B pathway
Yet another mechanism of programmed cell death is that mediated by granzymes such as granzyme b that are serine proteases present in the granules of cytotoxic T lymphocytes. The granules also contain a protein called perforin which oligomerizes in the membrane of the target cell to allow the entry of granzymes. Once inside the target, granzyme b can cleave Bid, caspase 3 and 9 to cause apoptosis (137-139). Granzyme b is abundant in advanced atherosclerotic lesions and transplant vascular disease as studied in human and animal tissues
(140, 141). Hence granzyme mediated apoptosis is thought to be involved in the pathogenesis of these disease conditions.
1.6.5.5. ER and apoptosis
In cases of severe stress, the endoplasmic reticulum activates its resident caspase namely pro-caspase 12 (142). The activating factors include m-calpain, increase in calcium reserve and formation of a complex with endoribonuclease
Ire1α and tumor necrosis factor-receptor-associated factor 2 (TRAF-2) (143, 144).
In vitro compounds such as thapsigargin, brefildin A and tunicamycin have been used to induce ER stress and thus activation of pro-caspase 12. Upon activation, caspase 12 acts on other effector caspases to execute apoptosis.
29 1.6.6. Apoptosis in diseases
The phenomenon of apoptosis can be either exaggerated or inhibited in
diseased states. For long it was thought that neoplasia was due to increased cell
proliferation. But today, inhibition of apoptosis is associated with the pathology
of cancer. Viruses contain many anti-apoptotic proteins that cause the host cell to
evade apoptosis. Murine models and humans with systemic lupus erythematosis
exhibit mutations in genes like lpr (that encodes Fas) which causes lymphocytes
to become resistant to cell death. Diseases associated with increased apoptosis
include AIDS, neurodegenerative diseases like Alzheimer’s and Parkinson’s,
hematological conditions such as G6PD deficiency, aplastic anemia etc (145-147).
Cardiovascular diseases including atherosclerosis, myocardial infarction and
ischemia are all associated with increased apoptosis. Apoptosis of all major cell
types have been observed in atherosclerotic arteries. This includes endothelial
cells, smooth muscle cells (SMCs), lymphocytes and macrophages. But the
specific role of apoptosis in atherosclerosis has still not been determined.
The apoptotic process can be initiated as well as inhibited in the presence
of various growth factors. The benefits or harmful effects of initiation versus inhibition are relative to the physiological or pathological condition in question.
While the process was thought to be irreversible, recent studies have provided some insights that apoptotic cells could be revived under appropriate conditions.
We further investigate this concept in the current study.
30 1.6.7. Commonly used methods for studying apoptosis
1.6.7.1. Annexin V staining
Annexins are proteins that bind to phospholipids and have high affinity for
PS. Flipping of PS to the outer leaflet of the membrane during apoptosis allows annexin V conjugated with a fluorochrome (like Fluorescein isothiocyanate or
FITC) to bind to PS (148, 149). Such binding can be detected by fluorescence microscopy or flow cytometry. In order to distinguish between apoptosis and necrosis, cells are usually stained with annexin V-FITC and propidium iodide (PI) that stains DNA. Apoptotic cells will stain positive for annexin V FITC only while necrotic cells will stain for PI. Late apoptotic cells stain for both annexin V-FITC and PI.
1.6.7.2. DNA fragmentation assay i) DNA fragmentation is a late event in the apoptotic pathway. Activation of endonucleases by caspases leads to breakdown of chromatin DNA in to fragments of 200-300 bp. To detect this, DNA is isolated from cells and analyzed by agarose gel electrophoresis. ii) TdT-mediated dUTP nick end labeling (TUNEL) assay
In 1992, Ben-Sasson and colleagues developed the TUNEL assay to detect DNA fragmentation (150). Terminal deoxynucleotidyl transferase (TdT) recognizes the
3’-hydroxyl ends of the DNA and catalyzes the addition of dUTPs that are labeled with markers like biotin or fluorescein. The signals can be detected in situ or by
FACS.
31 1.6.7.3. Caspase assays
Caspases are cysteine proteases that require the presence of an essential cysteine in their active site and cleave after aspartic acid residues in the substrate.
Since caspases have sequence specificity, one way of analyzing the presence of active caspases is to add caspase substrates linked to a fluorescent tag such as
DEVD-tag. When cleaved by caspases the tag is released and emits fluorescent signals. This fluorescence can be quantitated using a fluorometer.
Since caspases are present as zymogens and need to be cleaved to get activated, immunoblot is used to identify intact or cleaved products of the enzymes. Alternatively substrates of caspases like Poly-ADP-Ribose-Polymerase
(PARP), a 113 kD protein can also be identified by western blot analysis. The proteases cleave PARP to fragments of approximately 89 kD and 24 kD. Anti-
PARP antibodies can recognize intact PARP as well as the 89 kD band.
1.6.7.4. Detection of mitochondrial membrane potential
Mitochondria lose their membrane potential during apoptosis.
MitoTracker Red CMXRos is a fluorescent dye that can permeate live cells and stains mitochondria with active membrane potential due to its thiol-reactive chloromethyl group. Thus apoptotic cells do not stain with it.
32 1.6.7.5. Membrane permeability assays i) Trypan blue exclusion cell viability assay
Trypan blue is a dye which can get into dead cells as the membrane becomes permeable and cannot enter live cells as the membranes are intact. ii) Propidium iodide and Hoechst stain
PI (red) and Hoechst (blue) are DNA staining dyes. While PI is incapable of penetrating intact and live cells, Hoechst can enter live cells.
1.6.7.6. In vivo detection of apoptosis
While most of the above mentioned techniques are applied for in vitro detection of apoptosis, advances have been made for minimally invasive in vivo detection. Cell permeant fluorescent dyes are available that can be injected in to animals where they bind to activated caspases. The tissues can then be examined using fluorescence microscopy. Various radiolabeled annexin V agents for PET
(Positron Emission Tomography) and SPECT (Single Photon Emission Computed
Tomography) have been used to image tissues and organs undergoing programmed cell death in patients (151, 152).
33 1.7. Hypothesis and Objectives (Scope of the current study)
Macrophages are a heterogeneous group of cells. While their role as
scavengers has been extensively studied, their involvement in promoting growth
of other cells has not been clearly elucidated. Adherence is synonymous with
their state of differentiation and function. While tissue macrophages are
adherent, the peritoneal macrophages are present in a non-adherent or a weakly
adherent state. Thus it is key to understand whether adherence contributes to the
functional heterogeneity in these cells.
In this study, we propose to study the seemingly contradictory behavior of
macrophages and suggest a dual role for them in the apoptotic process, one as a
reviver and promoter of growth and the other as a scavenger. Many have
categorized the events of apoptosis as “early” or “late”. Cells entering apoptotic death may signal the recruitment of monocytes. The macrophages that are derived from monocytes might secrete growth promoting activity and repair cells in very early stages of apoptosis that do not have prominent intracellular damage.
Many studies have documented that cells resist apoptosis in the presence of
growth factors. When the apoptotic process continues and when cells enter the
late apoptotic stage that involve extensive intracellular damage, the scavenger
cells may be involved in their uptake (Scheme 5).
34
Scheme 5: Macrophages as scavengers or revivers of apoptotic cells
35 CHAPTER 2
MATERIALS AND METHODS
2.1. Materials
Dichlorodimethylsilane, 1,1’-dioctadecyl-3,3,3’,3’tetramethylindicarbo-
cyanine perchlorate (DiI), TNFα and Ficoll-Hypaque solution were purchased from Sigma-Aldrich Chemical Co, Saint Louis, MO. TRIzol™ and primers were obtained from Invitrogen, Carlsbad, CA. 0.5 μm and 1 μm fluoresbrite latex beads were purchased from Polysciences, Inc., Warrington, PA. PS liposomes were generously provided by Andrew Moiseev.
2.2. Antibodies
Anti-mouse SR-AI, anti mouse CD36, anti-mouse MFG-E8, anti human
SR-AI, anti human MFG-E8 and rabbit anti goat IgG were obtained from R and D
Systems (Minneapolis, MN). Anti human CD36 and goat anti mouse IgM were purchased from santa cruz biotechnology (Santa Cruz, California). Anti b-actin was obtained from Sigma, St Louis, MO.
2.3. Isolation and culture of mouse peritoneal macrophages
Eight-week old C57bl/6J mice were purchased from Jackson Laboratory,
Bar Harbor, ME. Macrophages from the peritoneal cavity were isolated by
36 peritoneal lavage using 3 ml of cold saline and obtained by centrifugation. Cells were cultured in RPMI 1640 (Invitrogen, Carlsbad, CA) containing 10% fetal bovine serum (Sigma, St Louis, MO) at 37°C in a 5% CO2 incubator. Cultures were maintained overnight in siliconized and non siliconized 60 mm glass petri dishes to yield non adherent and adherent cells respectively (153). Macrophages were used for experiments immediately.
2.4. Human monocyte-derived macrophage culture
Monocytes were isolated from 120 ml of human peripheral blood collected in to EDTA tubes. 30 ml of blood was allowed to clot in tubes without anticoagulant and serum was collected by centrifugation. The EDTA tubes were centrifuged at 2400 rpm for 25 min at 4°C; plasma was removed and the mononuclear cells were obtained from the buffy coat by Ficoll-Hypaque density gradient centrifugation. Cells were washed at least three times to remove platelets and resuspended in RPMI 1640. The mononuclear cells were plated in 6o mm petri dishes and incubated at 37°C for 2 h. Non-adherent cells were removed by washing with phosphate buffered saline and adherent cells were detached and replated in siliconized and non siliconized glass petri dishes. Cells were cultured for an additional 7 d to produce monocyte-derived macrophages. The culture medium consisted of RPMI 1640 with human serum (20%), penicillin (100
U/ml)/streptomycin (100 μg/ml), 1% glutamine and 1% sodium pyruvate.
37 2.5. Culture of HUVECS
Human Umbilical Vein Endothelial Cells (HUVECs) were purchased from
Lonza Inc., Allendale and maintained in M199 medium with fetal bovine serum
(20%), endothelial growth supplement (50 μg/ml), penicillin (100 U/ml), streptomycin (100 μg/ml), L -glutamine (100 mg/l), heparin (30 U/ml) and fungizone/amphotericin B (2.5 μg/ml) at 37°C in 5% CO2. Cells were used between passages 5-10 for experiments.
2.6. Preparation of DiI-AcLDL
Blood was collected from healthy donors and LDL (d = 1.019-1.063) was
isolated from the plasma by ultracentifugation (154). LDL was dialyzed overnight
against phosphate buffered saline and protein concentration was determined
using Biorad DC Protein Assay (Biorad, Hercules, CA). It was then labeled with
DiI as described by Pitas et al (155). This involved incubating 1 mg of LDL with 2
ml of lipoprotein-deficient serum and 50 μl of DiI in dimethyl sulfoxide (3 mg/ml
stock) at 37°C for 15 h. The DiI-labeled LDL was reisolated by ultracentrifugation and acetylated using acetic anhydride. DiI-AcLDL was dialyzed overnight and filter sterilized using 0.2 μm syringe filter. It was stored at 4°C and used within 2
wk of preparation.
2.7. Quantitative real time PCR
Total RNA was isolated from macrophages using TRIzol™ reagent
according to manufacturer’s instructions. RNA quantity and quality was assessed
38 by using the NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham,
MA). 1 μg of RNA was reverse transcribed using the SuperScriptTM III First-
Strand Synthesis system (Invitrogen, Carlsbad, CA). Quantitative real time PCR was performed using iQTM5 iCycler Multicolor Real-Time PCR Detection System
(Biorad, Hercules, CA) with SYBR Green (Invitrogen, Carlsbad, CA) as detection dye. The mRNA levels of target genes were normalized to that of GAPDH.
Table 5: Primers sequences for quantitative real time PCR
Mouse primers
Target Forward primer Reverse primer
GAPDH ACCCAGAAGACTGTGGATGG CACATTGGGGGTAGGAACAC
SR-AI AAAGGTGATCGGGGACAAA TTGCCCCAATATGATCAGG
CD36 TGCTGGAGCTGTTATTGGTG TGGGTTTTGCACATCAAAGA
CD68 TAGCCCAAGGAACAGAGGAA TGGCAGGGTTATGAGTGACA
CD14 TCAGGAACTCTGGCTTTGCT TGGCTTTTACCCACTGAACC
CD44 TGGATCCGAATTAGCTGGAC AGCTTTTTCTTCTGCCCACA
Integrin alpha V ATCCGACGAGCACTGTTTCT AAATGGTGATGGGAGTGAGC
Integrin beta 3 ACGTCCTCCAGCTCATTGTT AAGCTCACCGTGTCT CCAAT
Integrin beta 5 ACGGCATCCTTTGAAGTGTC GTTCCATTCCCACTGCATCT
PDGF CAAGACCAGGACGGTCATTT ACTTTGGCCACCTTGACACT
FGF-2 CAACCGGTACCTTGCTATGAA CCGTTTTGGATCCGAGTTTA
TGF-b TGAGTGGCTGTCTTTTGACG GGTTCATGTCATGGATGGTG
MFG-E8 TGA TGC CAA ATG TCT GGT G CAA GCC CAT GAA ACC CAT A
39 Human primers
Target Forward primer Reverse primer
GAPDH AGTCAACGGATTTGGTCGTA GGAACATGTAAACCATGTAGTTGAG
SR-AI CCT CGT GTT TGC AGT TCT CA CCA TGT TGC TCA TGT GTT CC
CD36 AGA TGC AGC CTC ATT TCC AC TGG GTT TTC AAC TGG AGA GG
MFG-E8 GCC CTG GAT ATC TGT TCC AA GCT CGA CAC ATT TCG TCT CA
2.8. Western blot analysis
Whole cell lysates from mouse peritoneal macrophages and human monocyte derived macrophages were solubilized in 1% SDS buffer. Concentration of protein was determined using Biorad DC Protein Assay (Biorad, Hercules, CA).
15 μg of sample was fractionated on a 10% SDS polyacrylamide gel and transferred to a 0.2 μm nitrocellulose membrane for immunoblotting.
Membranes were blocked with 5% milk in TBST followed by incubation with primary antibody (1:2000) overnight at 4°C. Anti mouse and anti human antibodies were used for SR-A1, CD36 and MFG-E8. Membranes were washed three times with TBST for 10 min each followed by incubation with HRP- conjugated secondary antibody (1:5000) for 1 h at room temperature. Protein bands were visualized using ECL (Thermo Scientific, Rockford, IL) according to manufacturer’s instructions.
40 2.9. Macrophage functional assays
SR activity was determined after maintaining the adherent and non adherent mouse peritoneal macrophages in culture for 4 h. The cells were incubated with 50 ug/ml of DiI-AcLDL at 37°C overnight. At the end of incubation uptake of DiI-AcLDL was observed by fluorescence microscopy.
Subsequently, cells were lysed with 3% SDS and intensity of fluorescence was measured using a fluorescence plate reader (Victor V, Perkin Elmer) with emission and excitation wavelengths set at 520 and 580 nm, respectively.
As a mimic to apoptotic cell uptake, macrophages were incubated with PS containing liposomes. The liposomes were added at a concentration of 300 μM and cells were incubated overnight. Subsequently cells were processed as mentioned above.
For phagocytosis assay, adherent and non-adherent mouse peritoneal macrophages were incubated with 1 μm fluorescent latex beads. The beads were diluted in phosphate buffered saline and cells were incubated overnight at 37°C in 5% Co2.
2.10. Annexin V-FITC staining for PS exposure
Following induction of apoptosisin HUVECs, cells were stained with
Annexin V-FITC and propidium iodide (PI) (Sigma, St. Louis, MO, USA) according to supplier’s protocol. Briefly, cells were washed twice with phosphate buffered saline and resuspended in binding buffer. They were then incubated with Annexin V-FITC (5 μl) and PI (10 μl) in the dark for 15 min at room
41 temperature. Following this, cells were washed with binding buffer and resuspended in fresh binding buffer. Cell suspension was spotted on a glass slide and coverslip was added and observed using OLYMPUS IX51 fluorescence microscope.
2.11. Caspase 3/7 activity
To assay for caspase3/7 activation, cells were seeded in a 96 well plate at a density of 104 cells/well. After overnight incubation, cells were serum deprived for 4 h to induce apoptosis. The caspase substrate was directly added to the wells for 30 min. Caspase activity was then measured using a fluorescence plate reader
(Victor V, Perkin Elmer) with excitation at 380 nm and emission at 460 nm.
2.12. DNA fragmentation analysis
HUVECs were induced to undergo apoptosis. DNA was extracted using apoptotic DNA ladder detection kit from BioVision, Mountain View, CA according to manufacturer’s instructions. Entire genomic DNA was subjected to electrophoresis through a 1.8 % agarose gel. Gel was stained with ethidium bromide and DNA bands were visualized using UVP Biospectrum AC imaging system.
42 2.13. Column purification of apoptotic cells
The method uses the ability of Annexin V to bind to acidic lipids present at the surface of apoptotic cells. After subjecting the cells to apoptosis, cells were mildly trypsinized and were tagged with biotinylated Annexin V. The cell mixture
(cells that were unaffected by apoptosis, cells that have undergone varying stages of apoptosis, and necrotic cells) was passed through a column of streptavidin- conjugated magnetic beads. Non-apoptotic and necrotic cells that don’t carry PS at the surface are removed followed by subsequent elution of bound cells. An apoptotic cell isolation kit (BioVision, Mountain View, CA) was used according to manufacturer’s instructions. Isolated cell fractions were immediately used for experiments. Cells were verified for the ability (or inability) to bind to fluorescent labeled Annexin V.
43 CHAPTER 3
MACROPHAGE ADHERENCE IS IMPORTANT FOR THEIR SCAVENGER
FUNCTION
3.1 RESULTS
3.1.1. Increased expression of scavenger receptors in adherent
macrophages
While most tissue macrophages are adherent cells, the peritoneal
macrophages are non-adherent and pose an anomaly: they are noted to express
SR-AI activity upon culturing on tissue culture dishes (as opposed to monocytes
that take several days to express SR-AI) and thus are suggested to be
“differentiated” but not adherent macrophages. They are often used within a few hours after isolation as macrophages. Innumerous studied have documented their use as scavenger macrophages that take up modified lipoproteins and develop foam cells. As mentioned earlier, macrophages serve many functions.
Notable among these are their ability to scavenge macromolecules (including modified lipoproteins, apoptotic cells, senescent red blood cells, pathogens etc.), promote growth by the secretion of a variety of growth factors, process and
44 present antigens for antibody production, produce inflammatory mediators, and others. It is important to understand which of these functions might depend on their adherence status. For example, if scavenger function is dependent on their adherent status, one might conclude that, a) role of these cells in the peritoneal cavity might not include their scavenger function (or they may be deficient in this function due to the “disease” state), or the peritoneal milieu might not be conducive to their adherence.
Presence of SRs has been associated with the property of adherence in many cell types. To determine whether macrophages need to be adherent to function effectively, we first analyzed the gene expression of SR-AI, CD36 and
CD68 in non-adherent and adherent mouse peritoneal macrophages. Freshly collected macrophages were further cultured in siliconized and non siliconized glass petri dishes to obtain non-adherent and adherent cells respectively.
Glassware that is siliconized has been used for culturing adherent cells in suspension. This method is nontoxic and has been reported to have no biochemical or morphological effects on cells. In addition, in many preliminary experiments, freshly lavaged peritoneal cells were also used. Literature evidence indicates that over 85% of the non-elicited peritoneal cells are macrophages in nature. In our studies such cells were used without further purification. Cells were cultured as adherent or non-adherent cells and RNA was isolated after culturing for 24 h. RT-PCR was performed using appropriate primers and conditions. Expression of target genes was calculated using standard methods. As shown in Figure 2, we observed increased gene expression of SR-AI, CD36 and
45 CD68 in adherent cells as compared to non- adherent cells with SR-AI and CD36
reaching significant fold induction.
We also isolated proteins from the cells and performed Western blot
analysis using specific commercially available antibodies. Protein levels of SR-A1
and CD36 was analyzed in both adherent and non-adherent cell populations.
Increased SR-A1 and CD36 protein expression was seen in the adherent cells. In
contrast to SR-A1 which showed detectable protein in the non-adherent cells,
CD36 was nearly absent in the non-adherent cells. These results validate data f
rom gene expression analysis.
Figure 2: Increased scavenger receptor expression in mouse peritoneal macrophages. A) Quantitative real time PCR in non adherent and adherent cells for SR-AI, CD36 and CD68. Open bars represent non-adherent macrophages and black bars represent adherent macrophages. Values are expressed as mean±SD. Statistically significant differences between non-adherent and adherent cells are marked as * (p<0.05) or ** (p<0.01). B) Western blot analysis for SR-AI and CD36. Total cellular protein was isolated from non adherent (NAdh) and adherent (Adh) cells and a fraction was run on 10% SDS-polyacrylamide gel.
We performed similar analysis in human monocyte-derived macrophages.
Our focus of SRs included SR-AI and CD36. Freshly isolated monocytes have no
46 or scarce SR levels. Upon differentiation into macrophages, there is evident increase in SR expression. Peripheral blood monocytes were isolated by Ficoll- gradient centrifugation followed by adherence to serum coated dishes and detachment method and was cultured into macrophages using autologous serum.
So human monocytes were plated in siliconized and non siliconized condition to maintain a non-adherent and adherent phenotype respectively and cells were cultured for 7 d to allow for differentiation in to macrophages. The macrophages were then harvested for gene expression studies and Western blot analysis. As observed in mouse peritoneal macrophages, adherent human monocyte-derived macrophages had increased SR-A1 and CD36 mRNA levels as compared to non- adherent cells (Figure 3).
A) B)
Figure 3: Scavenger receptor expression in human monocyte-derived macrophages. A) Quantitative real time PCR in non-adherent and adherent cells for SR-AI and CD36. Open bars represent non-adherent macrophages and black bars represent adherent macrophages. Values are expressed as mean±SD. Statistically significant differences between non-adherent and adherent cells are marked as * (p<0.05) or ** (p<0.01). B) Western blot analysis for SR-AI and CD36. Total cellular protein was isolated from non-adherent (NAdh) and adherent (Adh) cells and a fraction was run on 10% SDS-polyacrylamide gel.
47 3.1.2. Increased gene expression of candidate PS receptors in
adherent macrophages
In the event of apoptosis, SRs are known to play a role in recognition of PS and facilitate engulfment of apoptotic cells. Besides these, CD14 and CD44 have
also been identified as candidate receptors for PS. To determine whether the
expression level of these receptors varied based on adherence, we performed
quantitative real time PCR analysis of non-adherent and adherent mouse
peritoneal macrophages using primers for CD14 and CD44. We observed that the
mRNA levels of both receptors were enhanced in the adherent population with
CD14 showing significant elevated expression (Figure 4).
Figure 4: Gene expression of candidate PS receptors in non- adherent and adherent mouse peritoneal macrophages. RNA was reverse transcribed and quantitative real time PCR analysis was performed using CD14 and CD44 primers. mRNA levels were standardized to GAPDH. Statistically significant differences between non-adherent and adherent cells are marked as * (p<0.05).
3.1.3. Differential integrin gene expression in mouse peritoneal
macrophages
Integrins are another class of cell surface receptors that mediate cell-cell
and cell-matrix interaction. Their role in cell adhesion is well recognized. αVβ3
and αVβ5 heterodimers have been implicated to be involved in the uptake of
48 apoptotic cells by macrophages. In addition, recent studies also indicate that they
may be involved in the uptake of oxidized LDL (156). The expressions of specific
integrins have been documented to be influenced by M-CSF and GM-CSF.
We analyzed the expression of these receptors in non-adherent and
adherent mouse peritoneal macrophages (Figure 5). Adherent macrophages
showed increased expression of αV and β5 forms while β3 gene expression was
significantly higher in the non-adherent cells.
Figure 5: Integrin gene expression in mouse peritoneal macrophages. mRNA levels of alpha V (A), beta 3 (B) and beta 5 (C) integrins were analyzed in non-adherent and adherent mouse macrophages by quantitative real time PCR. Values are expressed as mean± SD. Statistically significant differences between non adherent and adherent cells are marked as * (p<0.05).
49 3.1.4. Growth factors expressed by non-adherent and adherent
macrophages.
As mentioned earlier, macrophages also synthesize and secrete a number
of growth factors. In addition, proteins that are suggested to be involved in the uptake of apoptotic cells (e.g. MFG-E8) are known to have growth-promoting activities. One of our underlying hypotheses is that these activities might be significant in non-adherent macrophages and could be involved in the revival of dying cells at early point of nutrient/serum deprivation. Considering monocyte chemoattraction is an early event and MCP-1 has been recognized as an early response gene, we have postulated that newly arriving and non-adherent macrophages might actually contribute to cell revival and rejuvenation.
To determine whether non-adherent macrophages have an increased
propensity for promoting growth we analyzed the gene expression of growth
factors that are known to be produced by macrophages. RNA was isolated, reverse-transcribed and quantitative real time PCR was performed using mouse
primers for PDGF, FGF-2, TGF-β and MFG-E8 as described in Materials and
Methods. Although FGF-2 and TGF-β showed no significant difference, PDGF
mRNA levels were more abundant in adherent cells. At the same time, MFG-E8
gene expression showed a significant (p <0.01) increase in the non-adherent
population. To determine whether the increase in MFG-E8 in non-adherent
macrophages is reflected at the protein level, Western blot analysis was
performed using anti-mouse MFG-E8.
50 As seen in Figure 6(E), non-adherent macrophages had increased MFG-E8 protein expression as compared to adherent macrophages. This suggests that the growth factor produced can be macrophage-type specific and may also depend on other cues received from the environment.
E)
Figure 6: Growth factor expression in mouse peritoneal macrophages. RNA was extracted from mouse macrophages cultured in non-adherent and adherent condition. Quantitative real time PCR analysis was performed for PGDF (A), FGF-2 (B), TGF-β (C) and MFG-E8 (D) using mouse primers. Statistically significant differences between non-adherent and adherent cells are marked as * (p<0.05) or ** (p<0.01). E) MFG-E8 protein levels were determined in non-adherent (NAdh) and adherent (Adh) cells. A fraction of cellular protein was run on a 10% SDS-PAGE and membrane was immunoblotted using anti mouse MFG-E8 and corresponding secondary antibody. Membrane was developed using ECL solution.
51 MFG-E8 mRNA and protein expression was investigated in human
monocyte-derived macrophages. As seen with mouse macrophages, non- adherent cells had increased MFG-E8 mRNA as compared to adherent cells. But on the contrary, the protein expression was found to be more in adherent cells.
MFG-E8 is a secreted glycoprotein as most growth factors. As monocytes were kept in culture for 7 d to allow them to differentiate into macrophages, it is possible that the protein was secreted in to the medium by non-adherent cells.
MFG-E8 is also known to mediate the uptake of apoptotic cells by macrophages by binding to PS on apoptotic cells and αVβ3/αVβ5 integrins on macrophages.
Decreased levels of αV integrin subunit in non-adherent macrophages could promote these cells to act more as growth promoters than scavengers.
A) B)
Figure 7: MFG-E8 expression in human monocyte-derived macrophages. Monocytes were maintained in culture for 7 d in the presence of autologous serum to allow differentiation in to macrophages. Cells were maintained in siliconized and non- siliconized glass petri dishes to yield non-adherent and adherent macrophages respectively. A) RNA was isolated and MFG-E8 gene expression was analyzed by quantitative real time PCR. Statistically significant differences between non-adherent and adherent cells are marked as * (p<0.01). B) Protein level of MFG-E8 was determined in non-adherent (NAdh) and adherent (Adh) cells using western blot analysis.
52 3.1.5. Enhanced scavenger receptor activity in adherent macrophages
To determine whether adherent and non-adherent macrophages differed in scavenger receptor activity, they were incubated with various ligands including
DiI-AcLDL and PS liposomes (a mimic of apoptotic cells). Following incubation,
cells were observed using fluorescence microscopy and intensity of fluorescence
was quantified subsequently. We observed that adherent cells had ingested more
of the ligands as compared to non-adherent cells. The quantification confirmed a
higher uptake of DiI-AcLDL and PS liposomes by the adherent population.
Figure 8: Increased uptake of DiI-AcLDL by adherent macrophages. Non- adherent and adherent cells were incubated with DiI-AcLDL for 24 h. Cells were examined by fluorescence microscopy (A) and intensity of fluorescence was quantified (B) using excitation and emission wavelengths of 520 nm and 580 nm respectively.
53
Figure 9: Increased PS liposome uptake by adherent macrophages. Non- adherent and adherent mouse peritoneal macrophages were incubated with PS liposomes (0% and 6%) for 24 h. The PE component of the liposome was labeled with rhodamine as shown in the table (A). Cells were observed by fluorescence microscopy (B) followed by measurement of intensity of fluorescence (C).
54
Figure 9:
A)
55 3.1.6. Adherent macrophages have increased phagocytic ability
Macrophages are known as professional phagocytes as they have the ability to scavenge a variety of ligands. To test their phagocytic ability in vitro, we incubated non-adherent and adherent mouse peritoneal macrophages with 1 µm fluorescent latex beads. Particles of this size are engulfed by macrophages through phagocytosis. As seen in Figure 10, adherent macrophages exhibited enhanced phagocytosis as compared to non-adherent cells.
Figure 10: Increased phagocytosis of 1 μm fluorescent latex beads by adherent mouse peritoneal macrophages. Non-adherent and adherent cells were incubated for 24 h and uptake of beads was observed using fluorescence microscopy (A). Quantification of intensity of fluorescence is shown in (B).
56 3.2. Discussion
As discussed earlier, there are different types of scavenger receptors
present in various cell types. For example the Type I scavenger receptor
(represented by the classical acetyl LDL receptor) has been noted in endothelial
cells, macrophages, smooth muscle cells and fibroblasts although some of these
cell types might require “activation” by platelet derived products. While the
functions(s) of the presence of scavenger receptor proteins are unknown in most
other cell types, its presence in macrophages has been assumed to play a major
role in atherosclerosis. SR-AI is virtually absent in monocytes and is induced
during the differentiation of these cells into macrophages. This process is
assumed to be synonymous with their adherence.
However, the peritoneal macrophages seem to pose an anomaly as they are present in a non adherent or weakly adherent state. These cells are abundant in rodent peritoneal cavity and have been extensively used for the study of macrophages. Many investigators use foreign irritants (thioglycollate,
carragheenan, chalk powder etc) to increase the number of these cells in the
peritoneal cavity. The lavaged cells are plated on tissue culture dishes and are
often used as macrophages in as little as 2 h after plating. In contrast to rodents,
normal humans do not have great many peritoneal macrophages and acquire
them only under disease conditions. Subjects with endometriosis (in which the
cells from the uterine endometrium grow in the peritoneal cavity) and those with
peritoneal malignancy who have increased ascites fluid have been noted to have
57 increased peritoneal macrophages. The presence of growth-promoting
environment or inflammation associated with the increased presence of
macrophages in the peritoneal cavity prompted us to ask the question, “why are
these macrophages non-adherent and what functions(s) do they serve in the
peritoneal cavity?”
The heterogeneous nature of macrophages and their precursors has
expanded our knowledge about these cells and their function. We wanted to
investigate whether adherence status of macrophages distinguish between their
scavenger function and potential growth-promoting activity. Scavenger receptor
expression and function was analyzed in non-adherent and adherent mouse
peritoneal macrophages. Siliconization of glass dishes which is used to prevent
adherence of cells and thus maintain a non-adherent phenotype is not 100%
effective, as there were cells that adhered even in siliconized plates. Additionally, it is extremely difficult to siliconize plastic cell culture dishes. SR-AI and CD36 are representative of the family of SRs and have been widely studied. Using real time quantitative PCR it was observed that the mRNA levels of both SR-AI and
CD36 were significantly higher in adherent macrophages as compared to non- adherent cells. CD68 scavenger receptor which is also a macrophage marker showed a higher fold expression in adherent macrophages. Besides scavenger receptors, we also studied gene expression of CD14 and CD44 that have been identified as candidate receptors for phosphatidylserine. CD14 which was the first identified pattern recognition receptor showed a significant fold induction (p<
0.05) in adherent cells. On the other hand, CD44 expression was only marginally
58 higher in the adherent macrophages. We also wanted to see whether non- adherent and adherent macrophage population differed in growth factor levels.
Of all the growth factors analyzed, MFG-E8 was significantly higher (p<0.01) in non-adherent macrophages. While PDGF mRNA levels were more in adherent cells, FGF-2 and TGF-β levels were comparable in both macrophage populations.
Although MFG-E8 is known as a tethering molecule that facilitates the uptake of apoptotic cells, it could be possible that non-adherent macrophages may be producing this protein to mediate revival and growth of early apoptotic cells. It has been recognized as a growth factor and is vital for the maintenance of intestinal epithelial cells (157). Similar gene expression studies were performed using human monocyte-derived macrophages. As seen with mouse peritoneal macrophages, adherent human macrophages had increased mRNA levels of SR-
AI and CD36. A significant difference was also observed in MFG-E8 gene expression with non-adherent cells expressing more of this protein. We also analyzed protein levels of SR-AI, CD36 and MFG-E8 in the macrophage populations. Western blot analysis validated the gene expression data except for
MFG-E8 levels in human macrophages where increased protein expression was seen in adherent cells.
Although we observed differences in mRNA and protein levels of the scavenger receptors, we wanted to determine whether adherent and non- adherent macrophages differed in function. We incubated the cells with scavenger receptor ligands such as AcLDL labeled with DiI (DiI-AcLDL) and PS containing liposomes. While AcLDL is a specific ligand for class A SRs, uptake of
59 PS liposomes can be mediated through various SRs. The PS liposomes are
considered a mimic of apoptotic cells as PS that translocates to the outer
membrane of apoptotic cells is recognized by scavenger receptors. Adherent cells
showed increased uptake of DiI-AcLDL as compared to non-adherent cells. When
we used PS containing liposomes as ligands, adherent and non-adherent
macrophages showed a comparable level of uptake of 0% PS. But in case of
liposomes containing 6% PS, adherent cells showed more uptake. Using 1 μm
fluorescent latex beads we studied the phagocytic ability of macrophages. As seen
with other ligands, adherent cells exhibited increased phagocytosis than their
non-adherent counterparts. These results indicate that adherent and non- adherent macrophages clearly differ in scavenger receptor expression and function. The expression of scavenger receptors is important for adherence and
enables the cells to bind to their ligands. Although non-adherent cells may have
very low scavenger function they could promote growth of cells by producing
growth factors like MFG-E8 as depicted in the following scheme.
Scheme 6: Potential role of integrins and MFG-E8 in determining the function of non-adherent and adherent macrophages in apoptosis
60 Macrophages abound in many tissues and are recruited into tissue space depending on cellular injury. It may play different roles at different sites. In the context of atherosclerosis, the following scenario could be visualized: Both growth and proliferation of cells (smooth muscle cell proliferation, collateral
Scheme 7: Non-adherent and adherent macrophages in atherosclerosis
formation and neo vascularization) as well as apoptosis of all cell types have been observed during atherosclerosis. However, frank denudation of the endothelium is rarely observed unless there is a plaque rupture. Thus, the intimal macrophages could be visualized to play a major role in keeping the endothelial cells “under check” providing sufficient growth stimulus. At the same time, they could serve the vital function of clearing any apoptotic or damaged ECs and paving way for repair and reendothelialization.
61 CHAPTER 4
EARLY APOPTOTIC HUMAN UMBILICAL VEIN ENDOTHELIAL CELLS PRODUCE MCP-1 TO RECRUIT MONOCYTES/MACROPHAGES - POTENTIAL ROLE IN REVIVAL
4.1. RESULTS
4.1.1. MCP1 gene expression in early and late apoptotic HUVECs
Cells undergoing apoptosis are engulfed by phagocytes before their
contents are released in to the surrounding environment. Chemoattractants are
essential for the recruitment of phagocytes to the site of action where the effective
and timely uptake of the apoptotic cells prevents inflammation and maintenance
of steady state. On the other hand we propose that the cells in the early stages of
apoptosis, when they are just “sick” may recruit macrophages to bring about revival and growth. Appearance of PS on the surface of apoptotic cells is considered an early event and we propose that it is unlikely that a ligand for macrophage death receptor would be physiologically meaningful even before the cell is “dead.” We suggest that “sick” cells would generate chemotactic signal for revival and maintenance.
We wanted to determine whether the induction of apoptosis results in an
increased expression of MCP-1 using human endothelial cells. Apoptosis was
induced in HUVECs using serum deprivation alone or serum deprivation along 62 with 1 ng/mL TNFα. Cells were incubated for 4 h following which they were
stained with annexin V-FITC to assess PS exposure. Annexin V-FITC positive
cells were observed in both serum deprived condition and those treated with
TNFα. Significant activation of caspases 3 and 7 which are key enzymes that are responsible for the execution of various events in apoptotic cells was observed.
Assessment of the condition of DNA revealed that it was intact in serum-deprived
cells. But in the presence of TNFα, we observed a distinct DNA ladder pattern.
63
Figure 11: Characterization of apoptosis in HUVECs induced by serum deprivation ± TNFα: A) Annexin V-FITC staining was performed in control and experimental cells to assess PS exposure. Annexin V-FITC positive cells were observed in both serum deprived condition and in the presence of 1 ng/mL TNFα. Basal level of apoptosis was seen in control condition. B) DNA fragmentation assay in HUVECs. Lane a: 1 kb plus DNA ladder marker; b: control; c: no serum; d: no serum + TNFα. A distinct ladder pattern is seen in lane d. C) Caspase 3/7 activation assay was performed as outlined in Materials and Methods. Readings were taken using Perkin Elmer fluorescence plate reader. Significant activation was seen both in serum deprived cells and in the presence of TNFα. Statistically significant differences between conditions are marked as * (p<0.05) or ** (p<0.01).
64 Figure 11:
A)
B) C
65
To analyze mRNA levels of MCP-1, RNA was isolated, reverse transcribed and quantitative real time PCR was performed using GAPDH as reference gene.
Significant differences were seen between the conditions with MCP-1 being strongly expressed in cells exposed to serum deprivation and TNFα while serum deprivation alone did not induce MCP-1.
Figure 12: Induction of MCP-1 in apoptotic HUVECs. Apoptosis was induced in human umbilical vein endothelial cells using serum deprivation alone or serum deprivation along with 1 ng/mL TNFα. Following 4 h of incubation cells were harvested for RNA isolation. 1 μg RNA was reverse transcribed and real time quantitative PCR was performed using human GAPDH and MCP-1 primers. Statistically significant difference between conditions are marked as * (p<0.05).
4.1.2. MCP1 gene expression in isolated apoptotic HUVECs
As the cells analyzed previously were a mixture of healthy and apoptotic cells, we wanted to determine MCP-1 mRNA levels in a pure apoptotic population. Based on our observations that serum deprivation alone yielded a relatively early apoptotic population, this condition was used to trigger apoptosis in the subsequent experiments. Following induction of apoptosis, cells were collected and incubated with annexin V conjugated with biotin. This was followed
66 by addition of streptavidin conjugated magnetic beads. Cells were passed through
a magnetic column to isolate healthy and apoptotic cells.
Annexin V-FITC staining was performed to confirm apoptosis. As seen in figure
13 over 95% of cells in the apoptotic fraction gave a strong signal for PS exposure.
Figure 13: Annexin V-FITC staining of column isolated HUVECs. Cells were cultured in T-75 flasks and apoptosis was induced by serum deprivation for 4 h. Apoptotic and healthy cells were separated as described in Materials and Methods. Annexin V-FITC staining was performed in both fractions to assess PS exposure. >95% of cells in the apoptotic fraction were annexin V-FITC positive with basal level seen in the healthy population.
MCP-1 gene expression was analyzed in isolated fractions. Following
separation of healthy and apoptotic HUVECs, RNA was extracted, reverse-
transcribed and real time quantitative PCR was repeated. A significant induction
of MCP-1 gene was seen in the isolated apoptotic cells at 4 hours of serum
deprivation. We also wanted to determine if the chemokine was induced at a 67 relatively late stage of apoptosis. So cells that were serum deprived for 48 h were isolated through the magnetic column and mRNA levels of MCP-1 were analyzed.
Strong induction of the chemokine was observed as seen in figure 14 (B) and the fold expression was higher than that seen at 4 h of serum deprivation.
A) B)
Figure 14: MCP-1 gene expression in column isolated apoptotic HUVECs. Apoptosis was induced by serum deprivation for 4 h and 48 h. Apoptotic cells were isolated by passing through a magnetic column following incubation with annexin-V biotin and streptavidin-magnetic beads. RNA was isolated and real time quantitative PCR was performed to determine expression of MCP-1 gene. In both 4 h (A) and 48 h (B) of serum deprivation, cells showed significant expression of the chemokine. Statistically significant difference between conditions are marked as * (p<0.05)
4.1.3. Analysis of generation of LPC in HUVECs
As LPC has been reported to be a chemoattractant produced by apoptotic cells, we wanted to determine whether HUVECs produced this lipid chemoattractant when they undergo apoptosis due to growth factor withdrawal. Lipids were extracted from control and apoptotic endothelial cells and a thin layer
68 chromatography was performed to detect LPC. As observed from figure 15, there
was no difference in the levels of LPC between control and serum-deprived cells.
Figure 15: Detection of LPC in HUVECs by thin layer chromatography. Lipids were extracted from control and serum-deprived endothelial cells. A TLC was set up with appropriate positive controls. PC and LPC bands are marked in the Figure.
4.1.4. Growth of early apoptotic HUVECs in the presence of serum
With the early apoptotic cells producing significant levels of MCP1, we
wanted to investigate whether these cells have the ability to be revived in the
presence of medium with growth factors. Hence column isolated early apoptotic
HUVECs were plated in the presence of 20% serum and the cells were observed
at d 1, 3 and 5. An annexin V-FITC staining was performed to assess level of apoptosis. No noticeable annexin V-FITC staining was observed in both healthy and apoptotic cells even at d 1 (Figure 16A).
A trypan blue viability assay revealed negligible level of dead cells. Cell
count indicated an obvious increase in cell number in the healthy fraction. In case
69 of the apoptotic cells, although the increase in the number of cells was not at a
comparable level to that seen in healthy cells, we still observed an increase from d
1 to 5 (Figure 16B).
In order to follow the growth of apoptotic cells in a more efficient way, we
pre-labeled the HUVECs with 0.5 μm fluorescent beads. Uptake of the beads by
HUVECs was very efficient as seen in figure 17(A). Following this, cells were
serum deprived, isolated through the column and replated in the presence of
serum as described earlier. We observed that the apoptotic cells had the ability to
recover when the necessary growth factors were present in the medium (Figure
17).
Having demonstrated that non-adherent macrophages produce increased levels of MFG-E8 mRNA, we detected the presence of the protein in the mouse
peritoneal lavage fluid by Western blot analysis as shown in Figure 18A. When
early apoptotic endothelial cells were incubated in the presence of the peritoneal
lavage fluid, revival of cells was observed at 24 h. However at 72 h, continued
revival and growth of cells was not seen (Figure 18B).
70 A)
B)
Figure 16: Growth of early apoptotic HUVECs in the presence of medium with 20% serum. Cells that were isolated through the column were plated in normal growth medium containing 20% serum.Annexin V-FITC staining was done at day 1, 3 and 5 to asses apoptosis (A). A cell viability assay and cell count was also performed to determine growth (B).
71 A)
B)
C)
Figure 17: Growth of labeled apoptotic HUVECs in the presence of regular growth medium. Cells were pre-labeled with 1 μm fluorescent latex beads. Efficient uptake and retention by cells is shown at 10X and 20X magnifications (A). The labeled cells were induced to undergo apoptosis by serum deprivation and passed through a magnetic column to separate apoptotic cells from the healthy population. The column isolated cells were observed (B) and number of cells were counted (C) at d 1, 3 and 5 to assess growth.
72
A)
MFG-E8
B)
Figure 18: Early apoptotic HUVECs incubated in the presence of peritoneal lavage fluid. A) Presence of MFG-E8 protein in mouse peritoneal lavage fluid was detected by Western blot analysis. The peritoneal lavage fluid was concentrated by lyophilization and reconstituted in sterile water. The fluid was dialyzed and sterile filtered. 15 μg of protein was fractionated on a 10% SDS-PAGE and immunoblotted using anti-mouse MFG-E8 antibody. Membrane was developed using ECL solution. B) Early apoptotic HUVECs were incubated ± mouse peritoneal lavage fluid concentrate and cells were observed for 72 h.
73 4.2. Discussion
One of the puzzling questions that we encountered when considering the
link between apoptosis and macrophages was the need to chemoattract
monocytes. If the appearance of PS at the cell surface represents one of the
earliest changes during apoptosis, there must be an induction of chemoattractant
production if this lipid is indeed a molecule that is recognized by the
macrophages. There are several options: (i) Generation of known peptide
chemotactic factors (E.g. MCP-1, RANTES-Regulated on Activation, Normal T-
cell Expressed and Secreted etc), (ii) generation of non-peptide lipid chemotactic
factors (e.g. LPC), and (iii) others including PS or its oxidized form itself. It is
extremely unlikely that the whole apoptotic cell serves as chemotactic stimulus as
it would defy the definition of chemotactic factors. Besides, the agent has to be
secreted to the extracellular milieu and should be capable of establishing a
concentration gradient.
MCP-1 is a potent chemoattractant for monocytes and other cells of the
immune system. It is highly relevant to oxidative stress and is an early response gene. It is often induced within minutes after a cellular event (e.g. viral infection).
In atherosclerotic lesions presence of this chemokine have been detected using anti-MCP-1 antibody and various cell types including macrophages, endothelial cells and vascular smooth muscle cells were shown to have increased mRNA expression. The presence of apoptotic cells in atherosclerotic arteries contributes
to plaque vulnerability and rupture. We wanted to determine whether apoptotic
endothelial cells produce MCP-1 to facilitate recruitment of
74 monocytes/macrophages. Endothelial cells were used as the model system as
they form a barrier between the lumen of the blood vessel and the rest of the
vessel wall and circulating monocytes and sub-endothelial macrophages come
into immediate contact with the endothelium. Apoptosis was induced using
either serum deprivation alone or serum deprivation along with TNFα. Induction
of apoptosis was confirmed using annexin V FITC staining, caspase assay and
DNA fragmentation assay. Although annexin positive cells and increased caspase
activation was observed in both serum deprivation and with TNFα, DNA
laddering was seen only when cells were exposed to TNFα. Thus compared to
TNFα, 4 h of growth factor withdrawal alone yielded a relatively early apoptotic
population where we observed events such as translocation of PS to the outer
membrane and caspase activation but no DNA fragmentation.
The population of cells analyzed was not a pure apoptotic fraction but a mixture of both healthy or non apoptotic cells and apoptotic cells. Hence the results that we observed may not be a true representation of the events taking place in an apoptotic cell. To address this issue, apoptosis was induced in
HUVECs by serum deprivation for 4 h. Cells were incubated with biotin
conjugated annexin-V followed by incubation with streptavidin bound magnetic
beads. The apoptotic cells were isolated by passing through a magnetic column
followed by annexin V-FITC staining. >95% of cells stained positive for PS which
indicated a good separation of apoptotic fraction from healthy cells. MCP1 gene
expression was repeated with the column isolated cells. A isolated apoptotic cells
75 exhibited increased MCP-1 gene expression at 4 h of serum deprivation. At 48 h of serum deprivation there was a stronger induction of MCP-1.
We are aware that this is not the only chemokine that may be involved in the recruitment of monocytes/macrophages. RANTES and LPC could be other possible chemoattractants produced by cells undergoing apoptosis under the given conditions. In fact, a recent study suggests that LPC might be a chemotactic factor generated by apoptotic cells; however, our results suggest little or no difference in the content of this lipid in control and serum-deprived cells. It is possible that the type of apoptotic trigger determines the apoptotic pathway to be activated that causes differences in factors produced by apoptotic cells.
Scheme 8: Proposed scheme of monocyte recruitment by apoptotic endothelial cells in atherosclerosis
76 With early apoptotic cells producing increased levels of MCP-1, we
investigated the possibility of the ability of such cells to be revived in the presence
of growth factors. When column isolated early apoptotic HUVECs were cultured
in the presence of serum, they did not stain for annexin V-FITC and exhibited
growth over a 5 day period as recorded by increase in cell number and trypan
blue viability assay. In the presence of mouse peritoneal lavage fluid that was
shown to contain MFG-E8, early apoptotic HUVECs showed signs of revival at 24
h. However continued revival and growth of cells was not observed probably due
to lack of sufficient amount of growth factors and nutrients. Thus an “early
apoptotic cell” can be viewed as a cell in a state of sickness. If serum deprivation
is the trigger of apoptosis, cells could be revived in a growth factor rich
environment. Macrophages that have the ability to produce a wide variety of growth promoting molecules could have the potential to repair and revive cells in early stages of apoptosis.
77
CONCLUSIONS
The study was undertaken in response to our puzzlement, “why do cells
that are in very early stages of apoptotic death and are not yet dead generate a
molecule at the surface that are recognized by macrophage death receptors?” Our
conclusions based on the preliminary studies conducted suggest that the
apoptotic cells might not only “signal” for their
clearance but might actually setup an early
“SOS" "Save Our Ship” signal when they are
just “sick” and not yet dead. Interestingly, the
“savior” and the “scavenger” are both
macrophages. It is well known that
macrophages perform several functions; years back, Daniel Steinberg, a pioneer
in cardiovascular research asked the question, “Are macrophages good or bad
guys?” The answer might depend on a number of factors. We have identified in
this study that:
1. The adherence status of macrophages might determine their ability to scavenge.
2. The target cell status might determine their revivability.
3. Many cell surface proteins might contribute to their scavenger functions.
78 4. What is believed to be a dead cell recognition molecule (MFG-E8), might actually be a growth promoter specific for sick cells.
The study raises a number of further questions which can’t be answered easily:
1. Why are there so many scavenger receptors on macrophages? Do they act collectively and synergistically or each one has a specific function?
2. How does adherence lead to the expression of the cell surface receptors? Or the cell surface receptors lead to adherence?
3. Why are peritoneal cells non-adherent? Are they “different” species of macrophages? Or are there factors in the peritoneal milieu that prevent them from adherence? Are there other tissue macrophages that are non-adherent?
4. Why do macrophages secrete growth factors? Do they represent otherwise hidden functions of these cells?
5. Should we promote growth or scavenging activities? What role these play in diseases such as cancer and atherosclerosis? By promoting or preventing them would we affect the disease process? Would they alter the course of immune function and inflammation?
6. Many pharmacological agents (e.g. retinoic acid, dexamethasone) affect monocyte differentiation. How do they relate to macrophage functions?
Hopefully these questions will be answered in future so that these extraordinary cells could be better understood and their capacities would be utilized for the prevention and treatment of human diseases.
79 BIBLIOGRAPHY
1. Whitelaw DM, Bell M. The intravascular lifespan of monocytes. Blood. 1966; 28: 455-464.
2. Leder LD. The origin of blood monocytes and macrophages. Ann. Hematol. 1967; 16(2): 86-98.
3. Rollins BJ, Walz A, Baggiolini M. Recombinant human MCP-1/je induces chemotaxis, calcium flux, and the respiratory burst in human monocytes. Blood. 1991; 78(4): 1112-1116.
4. Marder SR, Chenoweth DE, Goldstein IM, Perez HD. Chemotactic responses of human peripheral blood monocytes to the complement- derived peptides C5a and C5a des Arg. J Immunol. 1985; 134(5):3325-31.
5. Quinn MT, Parthasarathy S, Steinberg D. Lysophosphatidylcholine: a chemotactic factor for human monocytes and its potential role in atherogenesis. Proc Natl Acad Sci U S A. 1988; 85(8):2805-2809.
6. Deuel TF, Senior RM, Huang JS, Griffin GL. Chemotaxis of monocytes and neutrophils to platelet-derived growth factor. J. Clin. Invest. 1982; 69(4): 1046-1049.
7. Pike MC, Fischer DG, Koren HS, Snyderman R. Development of specific receptors for n-formylated chemotactic peptides in a human monocyte cell line stimulated with lymphokines. J Exp Med. 1980; 152: 31-40.
8. Smith MJH, Ford-Hutchinson AW, Bray MA. Leukotriene b: a potential mediator of inflammation. J. Pharm. Pharmacol 1980; 32: 517-518.
9. Aiello RJ, Bourassa P-A, Lindsey S, Weng W, Freeman A, Showell HJ. Leukotriene B4 receptor antagonism reduces monocytic foam cells in mice. Arterioscler Thromb Vasc Biol. 2002; 22:443–449.
80 10. Sozzani S, Zhou D, Locati M, Bernasconi S, Luini W, Mantovani A, O'Flaherty JT. Stimulating properties of 5-oxo-eicosanoids for human monocytes: synergism with monocyte chemotactic protein-1 and -3. J Immunol. 1996; 157(10): 4664-71.
11. Goetzl, E.J. Mediators of immediate hypersensitivity derived from arachidonic acid. N. Engl. J. Med. 1980; 303 (14): 822-825.
12. Postlethwaite AE, Kang AH. Collagen-and collagen peptide-induced chemotaxis of human blood monocytes. J Exp Med. 1976; 143:1299-1307.
13. Hunninghake GW, Davidson JM, Rennard S, Szapiel S, Gadek JE, RG Crystal RG. Elastin fragments attract macrophage precursors to diseased sites in pulmonary emphysema. Science. 1981; 212 (4497): 925-927.
14. Bar-Shavit R, Kahn A, Fenton JW, Wilner GD. Chemotactic response of monocytes to thrombin. J Cell Biol. 1983; 96: 282-285.
15. Deuel TF, Senior RM, Chang D, Griffin GL, Heinrikson RL, Kaiser ET. Platelet factor 4 is chemotactic for neutrophils and monocytes. Proc Natl Acad Sci U S A. 1981; 78(7): 4584–4587.
16. Chertov O, Ueda H, Xu LL, Tani K, Murphy WJ, Wang JM, Howard OM, Sayers TJ, Oppenheim JJ. Identification of human neutrophil-derived cathepsin G and azurocidin/CAP37 as chemoattractants for mononuclear cells and neutrophils. J Exp Med. 1997; 186(5): 739-47.
17. Territo MC, Ganz T, Selsted ME, Lehrer R. Monocyte-chemotactic activity of defensins from human neutrophils. J Clin Invest. 1989; 84(6):2017-20.
18. Grage-Griebenow E, Flad HD, Ernst M. Heterogeneity of human peripheral blood monocyte subsets. J Leukoc Biol. 2001; 69(1):11-20.
19. Gordon S, Taylor PR. Monocyte and macrophage heterogeneity. Nat Rev Immunol. 2005; 5(12):953-64.
20. Metcalf D. The molecular control of cell division, differentiation commitment and maturation in haemopoietic cells. Nature. 1989; 339:27– 30.
21. Mosser DM and Edwards JP Exploring the full spectrum of macrophage activation. Immunology. 2008;8:958-969.
22. Adams DO, Hamilton TA. The cell biology of macrophage activation. Ann. Rev. lmmunol. 1984; 2:283-318.
81 23. Musson RA. Human monocyte maturation/differentiation during in vitro culture. Surv. immunol. Res. 1983; 2: 246-251.
24. Guidez F, Li AC, Horvai A, Welch JS, Glass CK. Differential utilization of Ras signaling pathways by macrophage colony-stimulating factor (CSF) and granulocyte-macrophage CSF receptors during macrophage differentiation. Mol Cell Biol. 1998; 18(7): 3851–3861.
25. Zuckerman SH, Ackerman SK, Douglas SD. Long-term human peripheral blood monocyte cultures: establishment, metabolism and morphology of primary human monocyte-macrophage cell cultures. Immunology. 1979; 38: 401-411.
26. Fuhrman B, Partoush A, Volkova N, Aviram M. Ox-LDL induces monocyte-to-macrophage differentiation in vivo: Possible role for the macrophage colony stimulating factor receptor (M-CSF-R). Atherosclerosis. 2008; 196: 598–607.
27. Visioli F, Marangoni F, Moi D, Rise P, Galli C. In vitro differentiation of human monocytes to macrophages results in depletion of antioxidants and increase in n 3 fatty acids levels. FEBS Letters. 2000; 471: 75-77.
28. Martinez FO, Gordon S, Locati M, Mantovani A. Transcriptional profiling of the human monocyte-to-macrophage differentiation and polarization: new molecules and patterns of gene expression. J Immunol. 2006; 177: 7303–7311.
29. Mantovani A, Sica A and Locati1 M. New vistas on macrophage differentiation and activation. Eur. J. Immunol. 2007; 37: 14–16.
30. Mantovani A, Sozzani S, Locati M, Allavena P and Sica A. Macrophage polarization:tumor-associated macrophages as a paradigm for polarized M2 mononuclear phagocytes. Trends Immunol. 2002; 23(11):549-555.
31. Aderem A, Underhill DM. Mechnaisms of phagocytosis in macrophages Annu. Rev. Immunol. 1999; 17:593-623.
32. Jones GE. Cellular signaling in macrophage migration and chemotaxis. J Leukoc Biol. 2000; 68: 593-602.
33. Brown MS, Goldstein JL. Lipoprotein metabolism in the macrophage: implications for cholesterol deposition in Atherosclerosis. Ann. Review Biochem. 1983; 52:223-261.
82 34. Goldstein JL, Ho YK, Brown MS, Innerarity TL, Mahley RW. Cholesteryl ester accumulation in macrophages resulting from receptor-mediated uptake and degradationof hypercholesterolemic canine β-very low density lipoproteins J. Biol Chem. 1980; 255: 1839-48.
35. Brown MS, Goldstein JL, Krieger M, Ho YK, Anderson RG. Reversible accumulation of cholesteryl esters in macrophages incubated with acetylated lipoproteins. J Cell Biol. 1979; 82:597– 613.
36. Platt N, Gordon S. Is the class A macrophage scavenger receptor (SR-A) multifunctional? – The mouse's tale. J Clin Invest. 2001; 108(5):649-54. 37. Greaves DR and Gordon S. The macrophage scavenger receptor at 30 years of age: current knowledge and future challenges. J Lipid Res 2009; S282-S286.
38. Moore KJ and Freeman MW. Scavenger receptors in atherosclerosis: Beyond lipid uptake Arterioscler. Thromb. Vasc. Biol. 2006; 26: 1702- 1711.
39. Stanton LW, White RT, Bryant CM, Protter AA, Endemann G. A macrophage Fc receptor for IgG is also a receptor for oxidized low density lipoprotein. J Biol Chem. 1992; 267 (31): 22446-22451.
40. Rahaman SO, Lennon DJ, Febbraio M, Podrez EA, Hazen SL, Silverstein RL. A CD36-dependent signaling cascade is necessary for macrophage foam cell formation Cell Metab. 2006; 4(3): 211–221.
41. Cominacini L, Pasini AF, Garbin U, Davoli A, Tosetti ML, Campagnola M, Rigoni A, Pastorino AM, Cascio VL, Sawamura T. Oxidized low density lipoprotein (ox-LDL) binding to ox-LDL receptor-1 in endothelial cells induces the activation of NF-kB through an increased production of intracellular reactive oxygen species. J Biol Chem. 2000; 275 (17): 12633- 12638.
42. Fadok VA, Bratton Dl, Konowal A, Freed PW, Westcott JY, Henson PM. Macrophages that have ingested apoptotic cells in vitro inhibit pro- inflammatory cytokine production through autocrine/paracrine mechanisms involving TGFb, PGE2, and PAF J. Clin. Invest. 1998; 101:890–898.
43. Erwig LP, Henson PM. Clearance of apoptotic cells by phagocytes. Cell Death Differ. 2008;15(2):243-50.
83 44. Fadok VA, Bratton DL, Henson PM. Phagocyte receptors for apoptotic cells: recognition, uptake, and consequences J. Clin. Invest.2001; 108: 957–962.
45. Ravichandran KS, Lorenz U. Engulfment of apoptotic cells: signals for a good meal. Immunology 2007; 7:964-974.
46. Duffield JS, Ware CF, Ryffel B, Savill J. Suppression by apoptotic cells defines tumor necrosis factor-mediated induction of glomerular mesangial cell apoptosis by activated macrophages. Am J Pathol. 2001; 159(4):1397- 404.
47. Diez-Roux G, Lang RA. Macrophages induce apoptosis in normal cells in vivo. Development 1997; 124: 3633-3638.
48. Gordon S. The macrophage: Past, present and future Eur. J. Immunol. 2007; 37: S9–17.
49. Indik ZK, Park JG, Hunter S, Schreiber AD. The molecular dissection of Fc gamma receptor mediated phagocytosis. Blood. 1995; 86:4389–99.
50. Campagne ML, Wiesmann C, Brown EJ. Macrophage complement receptors and pathogen clearance Cell Microbiol. 2007; 9(9): 95–2102.
51. Stahl PD, Ezekowitz RA. The mannose receptor is a pattern recognition receptor involved in host defense. Curr. Opin. Immunol. 1998; 10:50–55.
52. Platt N, Haworth R, Darley L, Gordon S. The many roles of the class A macrophage scavenger receptor. Int. Rev. Cytol. 2002; 212:1–40.
53. Sasada M, Johnston RB. Macrophage microbicidal activity correlation between phagocytosis-associated oxidative metabolism and the killing of candida by macrophages J Exp Med. 1980; 152: 85-98.
54. Rouzer CA, Scott WA, Hamill AL, Liu FT, Katz DH, Cohn ZA. Secretion of leukotriene c and other arachidonic acid metabolites by macrophages challenged with immunoglobulin e immune complexes J Exp Med. 1982; 156: 1077-1086.
55. Cui W, Morrison DC, Silverstein R. Differential tumor necrosis factor alpha expression and release from peritoneal mouse macrophages in vitro in response to proliferating gram-positive versus gram-negative bacteria Infect Immun. 2000; 68(8): 4422-9.
84 56. Foss DL, Zilliox MJ, Murtaugh MP. Differential regulation of macrophage interleukin-1 (IL-1), IL-12, and CD80-CD86 by two bacterial toxins. Infect Immun. 1999; 67(10): 5275–5281.
57. Medzhitov R. Recognition of microorganisms and activation of the immune response. Nature 2007; 449 (18): 819-826.
58. Underhill DM, Bassetti M, Rudensky A, Aderem A. Dynamic interactions of macrophages with T cells during antigen presentation. J. Exp. Med. 1999; 190(12): 1909–1914.
59. Wilson KM, Siegal G, Lord EM. Tumor necrosis factor-mediated cytotoxicity by tumor-associated macrophages. Cell Immunol. 1989; 123(1):158-65.
60. Chattopadhyay U, Bhattacharyya S, Chakrabarty NG. Tumor associated macrophage mediated lysis of autologous tumor cells. Neoplasma. 1986; 33(2):157-65.
61. Shih J, Yuan A, Chen JJW, Yang PC. Tumor-associated macrophage: Its role in cancer invasion and metastasis. J Cancer Mol. 2006; 2(3): 101-106.
62. Pollard JW. Tumour-educated macrophages promote tumour progression and metastasis. Nat Rev Cancer 2004; 4: 71–78.
63. Crowther M, Brown NJ, Bishop ET, Lewis CE. Microenvironmental influence on macrophage regulation of angiogenesis in wounds and malignant tumors. J Leukoc Biol. 2001; 70: 478-490.
64. Mutsaers SE, Bishop JE, McGrouther G, Laurent GJ. Introductory overview mechanisms of tissue repair: from wound healing to fibrosis Int. J.Biochem. Cell Biol. 1997; 29:5-17.
65. Leibovich SJ, Ross R. The role of the macrophage in wound repair A study with hydrocortisone and antimacrophage serum. Am J Pathol. 1975; 78:75-92.
66. Kodama T, Freeman M, Rohrer L, Zabrecky J, Matsudaira P, Krieger M. Type I macrophage scavenger receptor contains alpha-helical and collagen-like coiled coils. Nature. 1990; 343:531–535.
85 67. Matsumoto A, Naito M, Itakura H, Ikemoto S, Asaoka H, Hayakawa I, Kanamori H, Aburatani H, Takaku F, Suzuki H, Kobari Y, Miyai T, Takahashi K, Cohen EH, Wydro R, Housman DE, Kodama T. Human macrophage scavenger receptors: primary structure, expression, and localization in atherosclerotic lesions. Proc. Natl. Acad. Sci. USA. 1990; 87: 9133–9137.
68. Li H, Freeman MW, Libby P. Regulation of smooth muscle cell scavenger receptor expression in vivo by atherogenic diets and in vitro by cytokines J. Clin. Invest.1995; 95:122-133.
69. Nick Platt N, Gordon S. Is the class A macrophage scavenger receptor (SR- A) multifunctional? — The mouse’s tale. J. Clin. Invest. 2001; 108:649– 654.
70. Gough PJ, Greaves DR, Suzuki H, Hakkinen T, Hiltunen MO, Turunen M, Herttuala SY, Kodama T, Gordon S. Analysis of macrophage scavenger receptor (SR-A) expression in human aortic atherosclerotic lesions. Arterioscler. Thromb. Vasc. Biol. 1999; 19:461-471.
71. Huh HY, Pearce SF, Yesner LM, JL Schindler JL, Silverstein RL. Regulated expression of CD36 during monocyte-to-macrophage differentiation: potential role of CD36 in foam cell formation. Blood. 1996; 87: 2020- 2028.
72. Rahaman SO, Lennon DJ, Febbraio M, Podrez EA, Hazen SL, Silverstein RL. A CD36-dependent signaling cascade is necessary for macrophage foam cell formation. Cell Metab. 2006; 4(3): 211–221.
73. Febbraio M, Hajjar DP, Silverstein RL CD36: a class B scavenger receptor involved in angiogenesis, atherosclerosis, inflammation, and lipid metabolism J. Clin. Invest. 2001; 108:785–791.
74. de Beer MC, Zhao Z, Webb NR, van der Westhuyzen DR, de Villiers WJ. Lack of a direct role for macrosialin in oxidized LDL metabolism. J Lipid Res. 2003; 44:674–685.
75. Sawamura T, Kume N, Aoyama T, Moriwaki H, Hoshikawa H, Aiba Y, Tanaka T, Miwa S, Katsura Y, Kita T, Masaki T. An endothelial receptor for oxidized low-density lipoprotein. Nature. 1997; 386:73–77.
76. Mehta JL, Chen J, Hermonat PL, Romeo F, Novelli G. Lectin-like, oxidized low-density lipoprotein receptor-1 (LOX-1): a critical player in the development of atherosclerosis and related disorders. Cardiovasc Res. 2006; 69:36–45.
86
77. Tamura Y, Osuga J, Adachi H, Tozawa R, Takanezawa Y, Ohashi K, Yahagi N, Sekiya M, Okazaki H, Tomita S, Iizuka Y, Koizumi H, Inaba T, Yagyu H, Kamada N, Suzuki H, Shimano H, Kadowaki T, Tsujimoto M, Arai H, Yamada N, Ishibashi S. Scavenger receptor expressed by endothelial cells I (SREC-I) mediates the uptake of acetylated low density lipoproteins by macrophages stimulated with lipopolysaccharide. J. Biol. Chem. 2004; 279: 30938–30944.
78. Shimaoka T, Kume N, Minami M, Hayashida K, Kataoka H, Kita T, Yonehara S. Molecular cloning of a novel scavenger receptor for oxidized low density lipoprotein, SR-PSOX, on macrophages. J. Biol. Chem. 2000; 275: 40663–40666.
79. Greaves DR, Gordon S. Thematic review series: The immune system and atherogenesis recent insights into the biology of macrophage scavenger receptors. J Lipid Res. 2005; 46:11-20.
80. Fraser I, Hughes D, Gordon S. Divalent cation-independent macrophage adhesion inhibited by monoclonal antibody to murine scavenger receptor. Nature. 1993; 364: 343-346.
81. Kodama T, Doi T, Suzuki H, Takahashi K, Wada Y, Gordon S. Collagenous macrophage scavenger receptors. Curr. Opin. Lipidol. 1996; 7: 287-291.
82. Geng Y, Kodama T, Hansson GK. Differential expression of scavenger receptor isoforms during monocyte- macrophage differentiation and foam cell formation. Arterioscler. Thromb. Vasc. Biol. 1994;14: 98-806
83. Kosswig N, Rice S, Daugherty A, Post SR. Class A scavenger receptor- mediated adhesion and internalization require distinct cytoplasmic domains. J Biol Chem. 2003; Vol. 278(36): 34219–34225.
84. Santiago-Garcia J, Kodama T, Pitas RE. The class A scavenger receptor binds to proteoglycans and mediates adhesion of macrophages to the extracellular matrix. J Biol Chem. 2003; 278(9): 6942–6946.
85. Post SR, Gass C, Rice S, Nikolic D, Crump H and Post GR. Class A scavenger receptors mediate cell adhesion via activation of G i/o and formation of focal adhesion complexes. J Lipid Res. 2002; 43:1829-1836.
86. Nikolic DM, Gong MC, Turk J, Post SR. Class A scavenger receptor- mediated macrophage adhesion requires coupling of iPLA2 and 12/15 lipoxygenase to RAC and CDC42 activation. J Biol Chem. 2007; 282(46): 33405–33411.
87 87. Shimaokaa T, Kumeb N, Minamib M, Hayashidab K, Sawamurac T, Kitab T, Yoneharaa S. Lectin-like oxidized low density lipoprotein receptor-1 (LOX-1) supports cell adhesion to fibronectin. FEBS Letters. 2001; 504: 65-68.
88. Kerr JF, Wyllie AH, Currie AR. Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer. 1972; 26(4):239-57.
89. Earnshaw WC, martins LM, Kaufmann SH. Mammalian caspases: Structure, activation, substrates, and functions during apoptosis. Annu. Rev. Biochem. 1999; 68:383–424.
90. Coleman ML, Sahai EA, Yeo M, Bosch M, Dewar A, Olson MF. Membrane blebbing during apoptosis resulted from caspase-mediated activation of ROCK I. Nat Cell Biol. 2001; 3:339-345.
91. Song Y, Hoang BQ, Chang DD. ROCK-II-induced membrane blebbing and chromatin condensation require actin cytoskeleton. Exp Cell Res 2002; 278:45–52.
92. Mills JC, Stone NL, Erhardt J, Pittman RN. Apoptotic membrane blebbing is regulated by myosin light chain phosphorylation. J Cell Biol. 1998; 140:627–36.
93. van Gorp RM, Heeneman S, Broers JL, Bronnenberg NM, van Dam- Mieras MC, Heemskerk JW. Glutathione oxidation in calcium- and p38 MAPK-dependent membrane blebbing of endothelial cells. Biochim Biophys Acta. 2002; 1591: 129–38.
94. Rudel T, Bokoch GM. Membrane and morphological changes in apoptotic cells regulated by caspase-mediated activation of PAK2. Science. 1997; 276: 1571–1574.
95. Tomiyoshi G, Horita Y, Nishita M, Ohashi K, Mizuno K. Caspase-mediated cleavage and activation of LIM-kinase 1 and its role in apoptotic membrane blebbing. Genes Cells. 2004; 9:591–600.
96. Palfrey HC, Wasrrm A. Protein kinase C in the human erythrocyte. Translocation to the plasma membrane and phosphorylation of bands 4.1 and 4.9 and other membrane proteins. J Biol Chem. 1985; 260: 16021– 16029.
88 97. MacDonald RI. Temperature and ionic effects on the interaction of erythroid spectrin with phosphatidylserine membranes. Biochemistry. 1993; 32 (27): 6957–6964.
98. Meers P, Mealy, T. Calcium-dependent annexin V binding to phospholipids: Stoichiometry, specificity, and the role of negative charge. Biochemistry. 1993; 32(43): 11711–11721.
99. Manno S, Takakuwa Y and Mohandas N. Identification of a functional role for lipid asymmetry in biological membranes: Phosphatidylserine-skeletal protein interactions modulate membrane stability Proc Natl Acad Sci U S A. 2002; 99(4 ):1943–1948.
100. Bevers EM, Tilly RH, Senden JM, Comfurius P, Zwaal RF. Exposure of endogenous phosphatidylserine at the outer surface of stimulated platelets is reversed by restoration of aminophospholipid translocase activity. Biochemistry. 1989; 28(6):2382-7.
101. Williamson P, Bevers EM, Smeets EF, Comfurius P, Schlegel RA, Zwaal RFA. Continuous analysis of the mechanism of activated transbilayer lipid movement in platelets. Biochemistry. 1995; 34: 0448-10455.
102. Bret V, Robert AS and Patrick W. Mechanisms of phosphatidylserine exposure, a phagocyte recognition signal, on apoptotic T lymphocytes. J. Exp. Med. 1995; 182: 1597-1601.
103. Martin SJ, Reutelingsperger CEM, McGahon AJ, Rader JA, van Schie RCAA, LaFace DM, Green DR. Early redistribution of plasma membrane phosphatidylserine is a general feature of apoptosis regardless of the initiating stimulus: Inhibition by overexpression of Bcl-2 and Abl. J. Exp. Med. 1995;182:1545-1556.
104. Gardai SJ, Bratton DL, Ogden CA and Henson PH. Recognition ligands on apoptotic cells: a perspective. Journal of Leukoc Biol. 2006; 79:896-903.
105. Taylor RC, Cullen SP, Martin SJ. Apoptosis: controlled demolition at the cellular level. Nat. Rev. Mol. Cell Biol. 2008; 9: 231-241.
106. Kagan VE, Fabisiak JP, Shvedova AA, Tyurina YY, Tyurin VA, Schor NF, Kawai K. Oxidative signaling pathway for externalization of plasma membrane phosphatidylserine during apoptosis. FEBS Letters. 2007; 477:1-7.
89 107. Arroyo A, Modrianský M, Serinkan FB, Bello RI, Tatsuya Matsura T, Jiang J, Tyurin VA, Tyurina YY, Fadeel B, Kagan VE. NADPH oxidase- dependent oxidation and externalization of phosphatidylserine during apoptosis in DMSO-differentiated HL-60 cells: Role in phagocytic clearance. J Biol Chem. 2009.
108. Barsukov LI, Victorov AV, Vasilenko IA, Evstigneeva RP, Bergelson LD. Investigation of the inside-outside distribution, intermembrane exchange and transbilayer movement of phospholipids in sonicated vesicles by shift reagent NMR. Biochim Biophys Acta. 1980; 598(1):153-68.
109. Williamson P, Christie A, Kohlin T, Schlegel RA, Comfurius P, Harmsma M, Zwaal RFA, Bevers EM. Phospholipid scramblase activation pathways in lymphocytes. Biochemistry. 2001; 40: 8065-8072.
110. Finucane DM, Waterhouse NJ, Amarante-Mendes GP, Cotter TG, Green DR. Collapse of the inner mitochondrial transmembrane potential is not required for apoptosis of HL60 cells. Exp Cell Res. 1999; 251: 166-174.
111. Mayer B, and Oberbauer R. Mitochondrial regulation of apoptosis. News Physiol Sci. 2003; 18: 89-94.
112. Korsmeyer SJ, Wei MC, Saito M, Weiler S, Oh KJ, and Schlesinger PH. Pro-apoptotic cascade activates BID, which oligomerizes BAK or BAX into pores that result in the release of cytochrome c. Cell Death Differ. 2000; 7: 1166-1173.
113. Oberhammer FA, Hochemer K, Froschl G, Tiefenbacher R, Pavelka M. Chromatin condensation during apoptosis is accompanied by degradation of lamin A + B, without enhanced activation of cdc2 kinase. J Cell Biol. 1994; 126: 827-837.
114. Oberhammer F, Wilson JW, Dive C, Morris ID, Hickman JA, Wakeling AE, Walker PR, Sikorska M. Apoptotic death in epithelial cells: cleavage of DNA to 300 and/or 50 kb fragments prior to or in the absence of internucleosomal fragmentation. EMBO J. 1993; 12:3679-3684.
115. Earnshaw WC. Nuclear changes in apoptosis. Current Opinion in Cell Biology. 1995; 7:337-343.
116. Lauber K, Bohn E, Krober SM, Xiao Y, Blumenthal SG, Lindemann RK, Marini P, Wiedig C, Zobywalski A, Baksh S, Xu Y, Autenrieth IB, Schulze- Osthoff K, Belka C, Stuhler G, Wesselborg S. Apoptotic cells induce migration of phagocytes via caspase-3-mediated release of a lipid attraction signal. Cell. 2003; 113: 717–730.
90
117. Horino K. et al. A monocyte chemotactic factor, S19 ribosomal protein dimer, in phagocytic clearance of apoptotic cells. Lab. Invest. 1998; 78: 603–617.
118. Wakasugi K, Schimmel P. Two distinct cytokines released from a human aminoacyl-tRNA synthetase. Science. 1999; 284: 147–151.
119. Schimmer AD. Inhibitor of apoptosis proteins: Translating basic knowledge into clinical practice. Cancer Res. 2004; 64: 7183–7190.
120. Hu Y, Benedict MA, Wu D, Inohara N, Nunez G. Bcl-XL interacts with Apaf-1 and inhibits Apaf-1-dependent caspase-9 activation. Proc. Natl Acad. Sci. USA. 1998; 95: 4386–4391.
121. Ambrosini G, Adida C, Altieri DC. A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med 1997; 3:917–21.
122. Adams JM, Cory S. The Bcl-2 protein family: arbiters of cell survival. Science. 1998; 281: 1322–1326.
123. Li Y, Zhang F, Nagai N, Tang Z, Zhang S, Scotney P, Lennartsson J, Zhu C, Qu Y,Fang C, Hua J, Matsuo O, Fong GH, Ding H, Cao Y, Becker KG, Nash A, Heldin CH, Li X. VEGF-B inhibits apoptosis via VEGFR-1-mediated suppression of the expression of BH3-only protein genes in mice and rats. J Clin Invest. 2008; 118(3):913-23.
124. Romashkova JA, Makarov SS. NF-kB is a target of AKT in anti-apoptotic PDGF signaling. Nature. 1999; 401: 86-90.
125. Stoll SW, Benedict M, Mitra R, Hiniker A, Elder JT, Nunez G. EGF receptor signaling inhibits keratinocyte apoptosis: evidence for mediation by Bcl-XL. Oncogene. 1998; 16: 1493-1499.
126. Torcia M, De Chiara G, Nencioni L, Ammendola S, Labardi D, Lucibello M, Rosini P, Marlier LN, Bonini P, Dello Sbarba P, Palamara AT, Zambrano N, Russo T, Garaci E, Cozzolino F. Nerve growth factor inhibits apoptosis in memory B lymphocytes via inactivation of p38 MAPK, prevention of Bcl-2 phosphorylation, and cytochrome c release. J Biol Chem. 2001; 276(42):39027-36.
127. Parrizas M, Saltiel AR, LeRoith D. Insulin-like Growth Factor 1 inhibits apoptosis using the phosphatidylinositol 3’-kinase and mitogen-activated protein kinase pathways. J Biol Chem. 1997; 272(1):154–161.
91 128. Miho Y, Kouroku Y, Fujita E, Mukasa T, Urase K, Kasahara T, Isoai A, Momoi MY, Momoi T. bFGF inhibits the activation of caspase-3 and apoptosis of P19 embryonal carcinoma cells during neuronal differentiation. Cell Death Differ. 1999; 6(5):463-70.
129. Singla DK, Reetu D. Singla DR and McDonald DE. Factors released from embryonic stem cells inhibit apoptosis in H9c2 cells through P1- 3kinase/Akt but not ERK pathway Am J Physiol Heart Circ Physiol. 2007; 293(3): H1590–H1595.
130. Versteeg HH, Spek A, Richel DJ, Peppelenbosch MP. Coagulation factors VIIa and Xa inhibit apoptosis and anoikis. Oncogene. 2004; 23, 410–417.
131. Beere HM, Wolf BB, Cain K, Mosser DD, Mahboubi A, Kuwana T, Tailor P, Morimoto RI, Cohen GM, Green DR. Heat-shock protein 70 inhibits apoptosis by preventing recruitment of procaspase-9 to the Apaf-1 apoptosome. Nat Cell Biol. 2000; 2(8):469-75.
132. Fischer SF and Vier J, Kirschnek S, Klos A, Hess S, Ying S, Hacker G. Chlamydia inhibit host cell apoptosis by degradation of proapoptotic BH3-only proteins. J Exp Med. 2004; 200(7): 905–916.
133. Hengartner MO. The biochemistry of apoptosis. Nature. 2000; 407: 770- 776.
134. Schultz DR, Harrington WJ. Apoptosis: Programmed cell death at a molecular level. Semin Arthritis Rheum. 2003; 32(6):345-369.
135. Wallach D, Varfolomeev EE, Malinin NL, Goltsev YV, Kovalenko AV, Boldin MP.Tumor necrosis factor receptor and Fas signaling mechanisms. Annu Rev Immunol 1999;17:331-67.
136. Zanna C, Ghelli A, Porcelli AM, Martinuzzi A, Carelli V, Rugolo M. Caspase-independent death of Leber's hereditary optic neuropathy cybrids is driven by energetic failure and mediated by AIF and endonuclease G. Apoptosis. 2005; 10(5):997-1007.
137. Waterhouse NJ, Sedelies KA, Browne KA, Wowk ME, Newbold A, Sutton VR, Clarke CJP, Oliaro J, Lindemann RK, Bird PI, Johnstone RW, Trapani JA. A central role for Bid in granzyme B-induced apoptosis. J Biol Chem. 2005; 280(6): 4476–4482.
92 138. Goping IS, Barry M, Liston P, Sawchuk T, Constantinescu G, Michalak KM, Shostak I, Roberts DL, Hunter AM, Korneluk R, Bleackley RC. Granzyme B-induced apoptosis requires both direct caspase activation and relief of caspase inhibition. Immunity, 2003; 18:355–365.
139. Froelich CJ, Metkar SS, Raja SM. Granzyme B-mediated apoptosis – the elephant and the blind men? Cell Death Diff. 2004; 11:369–37.
140. Choy JC, McDonald PC, Suarez AC, Hung VV, Wilson JE, McManus BM, Granville DJ. Granzyme B in atherosclerosis and transplant vascular disease: association with cell death and atherosclerotic disease severity. Mod Pathol 2003; 16(5):460–470.
141. Choy JC, Cruz RP, Kerjner A, Geisbrecht J, Sawchuk T, Fraser SA, Hudig D, Bleackley RC, Jirik FR, McManus BM, Granville DJ. Granzyme B induces endothelial cell apoptosis and contributes to the development of transplant vascular disease. Am J Transplant 2005; 5: 494–499.
142. Nakagawa T, Zhu H, Morishima N, Li E, Xu J, Yankner BA, Yuan J. Caspase-12 mediates endoplasmic-reticulum-specific apoptosis and cytotoxicity by amyloid-beta. Nature. 2000; 403(6765):98-103.
143. Tan Y, Dourdin N, Wu C, De Veyra T, Elce JS, Greer PA. Ubiquitous calpains promote caspase-12 and JNK activation during endoplasmic reticulum stress-induced apoptosis. J Biol Chem. 2006;281(23):16016-24.
144. Orrenius S, Zhivotovsky B, Nicotera P. Regulation of cell death: the calcium-apoptosis link. Nat Rev Mol Cell Biol. 2003; 4(7):552-65.
145. MacFarlane M, Williams AC. Apoptosis and disease: a life or death decision. EMBO reports. 2004; 5 (7): 674-678
146. Fadeel B, Orrenius S, Zhivotovsky B. The potential role of apoptosis in human disease. Med Principles Pract. 2000; 9:151–163
147. Chamond RR, Anon JC, Aguilar y F CM, Pasadas G. Apoptosis and disease. Alergol Immunol Clin. 1999; 14(6): 367-374.
148. Engeland MV, Luc J.W. Nieland LJW Ramaekers FCS, Schutte B, Reutelingsperger CPM. Annexin V-affinity assay: A review on an apoptosis detection system based on phosphatidylserine exposure. Cytometry. 1998; 31:1–9.
93 149. Vermes IM, Haanen C, Steffens-Nakken H and Reutelingsperger C. A novel assay for apoptosis Flow cytometric detection of phosphatidylserine early apoptotic cells using fluorescein labeled expression on Annexin V. J Immunol Methods.1995; 184: 39-51.
150. Gavrieli Y, Sherman Y, Ben-Sasson SA. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J Cell Biol. 1992; 119(3):493-501.
151. Blankenberg FG, Katsikis PD, Tait JF, Davis RE, Naumovski L, Ohtsuki K, Kopiwoda S, Abrams MJ, Darkes M, Robbins RC, Maecker HT, Strauss HW. In vivo detection and imaging of phosphatidylserine expression during programmed cell death. Proc Natl Acad Sci USA. 1998; 95(11):6349-54.
152. Blankenberg FG. In vivo detection of apoptosis. J Nucl Med. 2008; 49 Suppl 2:81S-95S.
153. Noteboom WD, Will PC. Siliconizing glassware to be used for suspension cell culture. J Tissue Cult Methods. 1982; 7(1): 9-11.
154. Chung BH, Wilkinson T, Geer JC, Segrest JP. Preparative and quantitative isolation of plasma lipoproteins: rapid, single discontinuous density gradient ultracentrifugation in a vertical rotor. J Lipid Res. 1980; 21: 284- 291.
155. Pitas RE, Innerarity TL, Weinstein JN, RW Mahley RW. Acetoacetylated lipoproteins used to distinguish fibroblasts from macrophages in vitro by fluorescence microscopy. Arterioscler. Thromb. Vasc. Biol. 1981; 1:177- 185.
156. Antonov AS, Kolodgie FD, Munn DH, Gerrity RG. Regulation of macrophage foam cell formation by alphaVbeta3 integrin: potential role in human atherosclerosis. Am J Pathol. 2004;165(1):247-58.
157. Bu HF, Zuo XL, Wang X, Ensslin MA, Koti V, Hsueh W, Raymond AS, Shur BD, Tan XD. Milk fat globule-EGF factor 8/lactadherin plays a crucial role in maintenance and repair of murine intestinal epithelium. J Clin Invest. 2007;117(12):3673-83.
94