ARTICLE

Received 19 Aug 2013 | Accepted 11 Nov 2013 | Published 7 Jan 2014 DOI: 10.1038/ncomms3914 OPEN The pseudogene TUSC2P promotes TUSC2 function by binding multiple microRNAs

Zina Jeyapalan Rutnam1,2,*, William W. Du1,2,*, Weining Yang1, Xiangling Yang1,2 & Burton B. Yang1,2

Various non-coding regions of the genome, once presumed to be ‘junk’ DNA, have recently been found to be transcriptionally active. In particular, pseudogenes are now known to have important biological roles. Here we report that transcripts of the two tumour suppressor candidate-2 pseudogenes (TUSC2P), found on chromosomes X and Y, are homologous to the 30-UTR of their corresponding protein coding transcript, TUSC2. TUSC2P and the TUSC2 30-UTR share many common miRNA-binding sites, including miR-17, miR-93, miR-299-3p, miR-520a, miR-608 and miR-661. We find that ectopic expression of TUSC2P and the TUSC2 30-UTR inhibits cell proliferation, survival, migration, invasion and colony formation, and increases tumour cell death. By interacting with endogenous miRNAs, TUSC2P and TUSC2 30-UTR arrest the functions of these miRNAs, resulting in increased translation of TUSC2. The TUSC2P and TUSC2 30-UTR could thus be used as combinatorial miRNA inhibitors and might have clinical applications.

1 Sunnybrook Research Institute, Sunnybrook Health Sciences Centre, 2075 Bayview Avenue, Toronto, Ontario, Canada M4N 3M5. 2 Department of Laboratory Medicine and Pathobiology, University of Toronto, 1 King’s College Circle, Toronto, Ontario, Canada M5S 1A8. * These authors contributed equally to this work. Correspondence and requests for materials should be addressed to B.B.Y. (email: [email protected]).

NATURE COMMUNICATIONS | 5:2914 | DOI: 10.1038/ncomms3914 | www.nature.com/naturecommunications 1 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3914

ecently, there has been an increased interest surrounding miRNAs in common, which increase the metastasis and invasive the functions of non-coding RNA (ncRNA) transcripts. characteristics of MB231 CD44 30-UTR-overexpressing cells16. RThe term ncRNA is given to functional RNA molecules Here we continue the investigation of exogenous 30-UTR that are not translated to protein. Initially, non-translated regions overexpression with the TUSC2 30-UTR. of the genome were considered ‘junk DNA’ based on the fact that Tumour suppressor candidate-2 (TUSC2), also known as they did not code for proteins and were thus thought to serve Fus-1, is a novel tumour suppressor gene that functions as a no purpose. However, their importance has been revealed in ‘gatekeeper’ in the molecular pathogenesis of cancer. It was recent years. initially identified as part of a study analysing frequent deletions For example, ncRNAs can regulate microRNA (miRNA) in the short arm of chromosome 3p, which occurs in a wide activities. miRNAs are single-stranded RNAs of 18–24 nucleo- variety of human cancers, especially of the breast and lung17–19. tides in length and are generated from endogenous transcripts1,2. Owing to its recent discovery, very little is known about TUSC2. miRNAs can function as guide molecules in post-transcriptional However, it has been shown to function as a potent proapoptotic gene repression through partial binding to the 30-untranslated factor and has been identified to be involved in the release of region (UTR)3. By silencing mRNA targets, miRNAs have been cytochrome c from the inner membrane of the mitochondria20. shown to have central roles in physiological and pathological Our laboratory previously showed that miR-378 was able to conditions4–6. On the other hand, we have previously found that downregulate TUSC2 and Sufu translation. Overexpression of the expression of 30-UTRs can regulate the function of miR-378 resulted in increased cell survival, angiogenesis and endogenous miRNAs7–9. The 30-UTR has many functions; it tumour growth4. has been known to be involved in messenger RNA (mRNA) While analysing the sequence of the TUSC2 30-UTR, we nuclear transport, cellular localization, stability and translational identified a sequence with 89% homology to the TUSC2 30-UTR efficiency10,11. These functions are mediated by the presence of using the Basic Local Alignment Search Tool as a potential several regulatory sequences in the 30-UTR. These regulatory pseudogene of TUSC2 (TUSC2 pseudogene, or TUSC2P). In this sequences include the polyadenylation signal, which marks the study, we exogenously overexpressed TUSC2P and the TUSC2 site of cleavage of the mRNA transcript 30 nt downstream of the 30-UTR in breast carcinoma cell lines and found that ectopic signal; binding sites for AU-rich element binding proteins, which expression of TUSC2P and the TUSC2 30-UTR inhibited cancer can stabilize or destabilize the mRNA depending on the protein; cell activities by regulating miRNA functions. Therefore, TUSC2P and binding sites for miRNAs10,12. Interestingly, it has been and the TUSC2 30-UTR might be used as combinatorial miRNA reported that the 30-UTRs can be subject to alternative splicing13. inhibitors for potential clinical applications. This finding leads to the idea that splicing occurs in order for the 30-UTR to escape miRNA regulation under different biological circumstances. However, this idea needs to be further Results investigated. TUSC2P and TUSC2 30-UTR function as competing endo- Our laboratory has been investigating the role and function of genous RNAs. When analysing the sequence of the TUSC2 the 30-UTR in relation to miRNAs. It is our hypothesis that 30-UTR, we found that there was one pseudogene of TUSC2, overexpression of the 30-UTR could attract and bind endogenous named TUSC2P, expressed by chromosome Y, which shared 99% miRNAs. This would cause the liberation of endogenous 30- with a sequence found in chromosome X (Fig. 1a). The sequence UTRs, whose mRNAs would then be available for translation. expressed by the pseudogene TUSC2P from chromosome Y Subsequently, there would be an increase in the protein levels of shared 89% homology with the 30-UTR of TUSC2. Interestingly, these genes. We initially reported this in Lee et al.8, where we many miRNAs were found to have common binding sites for all found altered cell morphology and increased cell–cell adhesion three sequences, including miR-661, miR-299-3p, miR-93, miR- after the introduction of the exogenous 30-UTR of versican. This 17, miR-608 and miR-502 (Fig. 1a). In particular, the miRNA function was due to the ability of the 30-UTR of versican to binding sites were identical to the sequence found in chromo- antagonize miR-199a-3p functions. One activity of miR-199a-3p some X and the pseudogene in chromosome Y. Among these was to regulate the expression of two extracellular matrix miRNAs, some of them displayed more than one potential proteins, versican and fibronectin, which resulted in enhanced binding site. Notably, miR-608 displayed four potential binding cell–cell adhesion and organ adhesion. Furthermore, the versican sites in all three sequences. 30-UTR overexpression has been found to reduce the steady-state To examine whether or not the pseudogene was transcribed, expression of miR-199a-3p14. We expanded our research in this we performed reverse transcription–PCR and real-time PCR, field with the investigation of the 30-UTRs of nephronectin confirming that the pseudogene was transcribed into RNA in and CD44. We reported that the nephronectin 30-UTR directed different cells lines (Fig. 1b). Interestingly, results showed high the differentiation rates of MC3T3-E1 cells15. Because of levels of TUSC2P mRNA expression in normal cells, including binding of endogenous miR-378 and the subsequent increase in human white blood cells, human keratinocyte cell line (HaCaT) and GALNT7 expression, the 30-UTR of nephronectin supported human bronchial epithelial cell line (BEAS-2B). Conversely, there nodule formation and osteoblast differentiation, increasing was low expression in cancer cells, including human breast cancer nephronectin glycosylation and protein secretion. In Jeyapalan cell lines (MDA-MB231, MB468 and MT-1), a human glioblastoma et al.7, the CD44 30-UTR was introduced into the MT-1 human cell line (U87) and a mouse breast cancer cell line (4T1). breast cancer cell line. It was found that there was a decreased rate To study the effects of TUSC2P on regulating miRNA of cell proliferation and cell survival, whereas an increased functions, we cloned TUSC2P into the pcDNA3.1 vector amount of endothelial cell activities and angiogenesis was found. (Fig. 1c). The mouse and human mammary carcinoma cell lines, These phenotypic characteristics can be explained owing to the 4T1 and MB231, were stably transfected with the TUSC2 30-UTR involvement of three miRNAs (miR-216a, miR-330 and miR-608) and TUSC2P expression constructs. A control cell line was binding to both the CDC42 and CD44 30-UTRs. The introduction established with the stable transfection of an empty pcDNA3.1 of the exogenous 30-UTR of CD44 resulted in the increased vector. MDA-MB-231 and 4T1 cells were also stably transfected protein translation of CDC42 and CD44, both of which with the coding region of TUSC2 (TUSC2 coding). Expression of are important in cell cycle regulation. We have also reported TUSC2-UTR or TUSC2P was analysed by real-time PCR. The that the 30-UTRs of CD44, FN and Col1a1 have multiple RNA levels of TUSC2P and TUSC2-UTR in the TUSC2P- and

2 NATURE COMMUNICATIONS | 5:2914 | DOI: 10.1038/ncomms3914 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3914 ARTICLE

TUSC2 cDNA TUSC2 coding sequence

TUSC2 pseudogene on chromosome Y

TUSC2 pseudogene on chromosome X

1,000 -1 bp 293T BEAS2BHaCaTWBC 4T1 MCF-1MB468 MT-1 MB231 LnCapDu145 PC3 JHH HpG2 U87 800 200 TUSC2P 100 600 200 100 U6

400

200 Relative mRNA levels of TUSC2P 0 2 aT BC 4T1 T-1 ap PC3 U87 293T aC W CF-1 B468 M B231 LnC Du145 JHH-1 HpG BEAS2B H M M M

XhoI 16 BamHI Apal 20

CMV TUSC2P 15 12

10 8 NheI ApaI BamHI 5 4 ** ** CMV TUSC2-UTR 0 Relative mRNA levels

Rel ative mRNA levels 0 TUSC2P Control TUSC2 Control 3′-UTR

Figure 1 | Expression of the TUSC2P pseudogene. (a) Analysis of miRNA targeting the 30-UTR of TUSC2 and pseudogene TUSC2P on chromosome Y and chromosome X. (b) Expression of TUSC2P was analysed in different cancer and non-cancer cell lines by real-time PCR. The cancer cell lines had a decreased amount of TUSC2P mRNA compared with the non-cancer cell lines. The inset represents bands of reverse transcription–PCR of these cell lines; n ¼ 4, error bar, s.d. (c) TUSC2P and TUSC2 30-UTR were cloned and inserted into pcDNA3.1 plasmid, downstream of the cytomegalovirus promoter, producing the TUSC2P and TUSC2-UTR constructs. (d) Total RNA isolated from 4T1 cells stably transfected with TUSC2P, TUSC2-UTR and control vector were analysed by real-time PCR. The TUSC2P-transfected cells had a fourfold increase compared with the endogenous TUSC2P levels in the cells. The TUSC2-UTR-transfected cells had approximately a threefold increased expression of TUSC2 compared with the control cells; n ¼ 3, **Po0.01 analysed by t-test, error bar, s.d.

TUSC2-UTR-transfected cells were higher than those of Supplementary Fig. S1a). This confirmed that the TUSC2P and the control and TUSC2 coding, which displayed endogenous TUSC2-UTR were being expressed from the TUSC2P and levels of TUSC2P and TUSC2-UTR expression (Fig. 1d and TUSC2-UTR plasmids in our stably transfected cell lines.

NATURE COMMUNICATIONS | 5:2914 | DOI: 10.1038/ncomms3914 | www.nature.com/naturecommunications 3 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3914

30 80 ** **

24 60 cells) ** 4 ** 10 18 × 40 Control 12 20 6 + PI-stained cells Percentage of Annexin V Percentage of Annexin Cell number ( Cell number 0 0 Control TUSC2P TUSC2 Control TUSC2P TUSC2 3′-UTR 3′-UTR

140

120 60 m) left) μ 100 50

80 40 ** TUSC2-UTR 60 ** 30 ** TUSC2P ** 40 20 TUSC2 3′-UTR 10 20 Control

Cell migration (distance ( 0 0

Cell invasion (no. of cells per field) per of cells (no. Cell invasion Control TUSC2P TUSC2 0 h 20 h 3′-UTR

Control TUSC2P

TUSC2P

Control TUSC2-UTR

Figure 2 | TUSC2P and TUSC2 30-UTR can function as competing endogenous RNAs (ceRNAs). (a) The TUSC2P, TUSC2-UTR and control 4T1 cells were maintained in tissue culture dishes in serum-free conditions. Surviving cells were collected and counted after 8 days. The TUSC2P and TUSC2-UTR cells had a decreased rate of survival; n ¼ 3, **Po0.01 analysed by t-test, error bar, s.d. (b) The cells were cultured in serum-free conditions for 5 days, followed by apoptosis analysis. After being stained with Annexin V and PI, the cells were analysed by flow cytometry. The TUSC2P- and TUSC2- UTR-transfected cells had larger populations of apoptotic and necrotic cells (Annexin V positive, PI positive and Annexin V, PI positive) compared with the control cells; n ¼ 3, **Po0.01 by t-test, error bar, s.d. (c) Migration rates were monitored using scratch assay. It was found that the TUSC2P- and TUSC2-UTR-transfected 4T1 cells had a slower rate of migration compared with the control cells. **Po0.01 by t-test, error, s.d., n ¼ 10. (d) Cell invasion was examined using Matrigel-coated transwell chambers. When cells were placed in the chambers, the TUSC2P and TUSC2-UTR cells travelled slower through the Matrigel and membrane pores, and spread out on the underside of the membrane significantly less than the control cells; n ¼ 5, **Po0.01 by t-test, error bar, s.d. (e) Haematoxylin and eosin staining was performed in tumours formed by injecting TUSC2-UTR, TUSC2P and control 4T1 cells into mice. Evidence of invasive tissues could be seen in the control tumours. However, it was absent in the TUSC2P and TUSC2-UTR tumours. Scale bar, 50 mm. (f) TdT-mediated dUTP nick end labelling staining was performed to observe the apoptotic cells in the tumour sections. Tumours formed by the TUSC2P- and TUSC2-UTR-transfected cells displayed an increased amount of apoptotic cells than the control. Scale bar, 50 mm.

A series of functional assays were performed in 4T1 cells the TUSC2 coding sequence and a control vector. Expression of transfected with TUSC2-UTR, TUSC2P and control cells. Cells these constructs decreased cell proliferation (Supplementary Fig. transfected with TUSC2-UTR and TUSC2P displayed decreased S1b) and survival (Supplementary Fig. S1c) compared with the survival rates (Fig. 2a) but increased apoptosis (Fig. 2b) compared control. Consistent with this was the increased apoptosis when with the control. In cell migration assay, the TUSC2P- and the cells were cultured in serum-free medium (Supplementary TUSC2-UTR-transfected cells had reduced rates of migration Fig. S1d,e, upper panel) or treated with H2O2 (Supplementary Fig. compared with the control (Fig. 2c). When the cells were placed S1e, lower panel). on Matrigel-coated transwell chambers, the control cells invaded The tumorigenic potential of TUSC2P and TUSC2-UTR- through the Matrigel and membrane pores, spreading out on the transfected 4T1 cells was tested in BALB/c mice. Although there underside of the membrane significantly more than the TUSC2P was no significant difference in tumour size when tumours were and TUSC2-UTR cells (Fig. 2d). In addition, MB-231 cells were excised from the mice and subjected to haematoxylin and eosin transfected with TUSC2P, TUSC2-UTR, a construct expressing staining, the control tumours showed histological evidence of

4 NATURE COMMUNICATIONS | 5:2914 | DOI: 10.1038/ncomms3914 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3914 ARTICLE increased invasiveness. Mouse muscle tissue was surrounded by confirmed by luciferase assay. As indicated in the Supplementary tumour tissue, which was not present in the TUSC2-UTR and Fig. S3, we generated five luciferase constructs containing frag- TUSC2P tumours (Fig. 2e). Furthermore, the TUSC2-UTR and ments of TIMP2 30-UTR harbouring binding sites for miR-17, TUSC2P tumour sections exhibited more apoptotic cells than the miR-93, miR-299-3p, miR-520-3p and miR-608. Each construct control tumour sections when subject to TdT-mediated dUTP was subject to site-directed mutagenesis, abolishing the miRNA nick end labelling staining (Fig. 2f). binding activity. We also generated four luciferase constructs containing fragments of TIMP3 30-UTR harbouring binding sites for miR-17, miR-93, miR-299-3p and miR-661. The binding Targets of miRNAs interacting with TUSC2 and TUSC2P.To sites were mutated, resulting in four mutant constructs examine whether TUSC2P and TUSC2-UTR exerted their bio- (Supplementary Fig. S4). As there were many potential miRNA logical functions by modulating miRNAs that interacted with binding sites common in the 30-UTR of TUSC2 and the pseu- these two sequences, we analysed the potential targets of these dogene TUSC2P, we used TUSC2P to validate the effect of each miRNAs. By in silico analysis, we found that the 30-UTRs of tissue miRNA on binding to TUSC2P. Six miRNAs were tested by inhibitor of metalloproteinases-2 (TIMP2) and TIMP3 could also generating luciferase constructs and mutant constructs as shown bind many of these miRNAs (Fig. 3a). It is known that both (Supplementary Fig. S5). TIMP2 and TIMP3 are involved in cell migration, adhesion and Each luciferase construct was paired with the corresponding metastasis21–23. We hypothesized that overexpression of the mutant and a construct inserted with a non-related sequence non-coding transcripts, TUSC2P or TUSC2 30-UTR, was able to (Luc-G3R) serving as a control. Cells were co-transfected with the antagonize multiple miRNAs, thus relieving translational corresponding miRNA mimics and one of these constructs, inhibition of the mRNAs of TUSC2, TIMP2 and TIMP3 followed by luciferase activity analysis. We found that luciferase (Fig. 3a). Comparing the sequences of these miRNAs with activity was significantly repressed in the TUSC2P luciferase TUSC2-UTR (Fig. 3b), TUSC2P (Fig. 3c), TIMP2 and TIMP3 constructs when co-transfected with miR-299-3p (Fig. 5a), miR- (Fig. 3d) showed that these four mRNAs were highly homologous 661 (Fig. 5b), miR-17 (Fig. 5c), miR-93 (Fig. 5d), miR-520a in miRNA binding sites. (Fig. 5e) and miR-608 (Fig. 5f). Mutation of the binding site TIMP2 and TIMP3 are proteins that are critical for the reversed the repression significantly. We also found that luciferase inhibition of matrix metalloproteinases, a group of proteases activity was significantly repressed in the TIMP2 constructs when involved in the extracellular matrix remodelling of tissues24–26. co-transfected with miR-93 (Fig. 5g), miR-299-3p (Fig. 5h), miR- We hypothesized that an increase in TUSC2P and TUSC 30-UTR 17 (Fig. 5i), miR-608 (Fig. 5j) and miR-520a (Fig. 5k). Mutation levels should be followed by an increase in TUSC2, TIMP2 and of the binding sites reversed the repressive effect. Similarly, TIMP3 protein levels, as miRNAs would bind to the luciferase activity was repressed in TIMP3 constructs when the overexpressed TUSC2P and TUSC 30-UTR, freeing the cells were co-transfected with miR-93 (Fig. 5l), miR-299-3p endogenous mRNAs of TUSC2, TIMP2 and TIMP3. This was (Fig. 5m), miR-17 (Fig. 5n) and miR-661 (Fig. 5o), and the confirmed by western blotting using cell lysates from TUSC2P, inhibition was reversed when the binding sites were mutated. TUSC2-UTR and control cells. Indeed, we detected elevated The miRNAs used in this study were overexpressed in the expression of TUSC2, TIMP2 and TIMP3 in the TUSC2P and TUSC2 30-UTR 4T1 cells to observe the functions of these TUSC2-UTR cells but not in the control cells (Fig. 3e). Tumours individual miRNAs. This was also done to confirm the function created from mice injected with the TUSC2P-transfected 4T1 of these miRNAs in relation to the TUSC2 30-UTR. TUSC2 30- cells were analysed by western blotting. It was found that the UTR 4T1 cells transfected with miR-17, miR-93, miR-299-3p, TUSC2P tumours had higher TUSC2, TIMP2 and TIMP3 protein miR-520-3p, miR-608, miR-661 or a negative control oligo were expression levels, as compared with the control tumours (Fig. 3f). subject to western blot analysis. There was a repression of TUSC2 This increase was also seen by immunostaining of TUSC2P, levels by the overexpression of these miRNAs as compared with TUSC2-UTR and control tumours: both TUSC2-UTR and TUSC2P the control (Fig. 6a). This confirmed that the TUSC2 30-UTR was tumourshadahigheramountofTUSC2,TIMP2andTIMP3 a direct target of these six miRNAs. Furthermore, when the expression than the control tumours (Supplementary Fig. S2a). TUSC2P 4T1 cells were transfected with these miRNAs, there was We also performed these experiments in MDA-MB-231 cells a decrease in the levels of both TIMP2, targeted by miR-17, miR- stably transfected with TUSC2P, TUSC2-UTR and a control 93, miR-299-3p, miR-520-3p and miR-608, and TIMP3, targeted vector. Cells transfected with TUSC2P expressed higher levels of by miR-17, miR-93, miR-299-3p and miR-661 (Fig. 6b). TUSC2, TIMP2 and TIMP3 than the control cells (Supplemen- We examined phenotypic changes of the 4T1 cells transfected tary Fig. S2b). As expected, although transfection with the with these miRNAs. TUSC2P cells were transfected with the TUSC2-coding region increased TUSC2 expression, it did not miRNAs or a negative control oligo, followed by Annexin V increase TIMP2 and TIMP3 protein levels (Supplementary apoptosis assay. It was found that the miRNA-transfected cells Fig. S2c). had a decreased amount of cell apoptosis than the control cells Endogenous expression of TUSC2, TIMP2 and TIMP3 was (Fig. 6c). Migration assays showed that there was an increased analysed in a number of cancer and non-cancer cell lines. In rate of cell migration in the miRNA-transfected TUSC2P cells general, although we did not detect higher mRNA levels of compared with the control TUSC2P cells (Fig. 6d). The functions TUSC2 (Fig. 4a), TIMP2 (Fig. 4b) and TIMP3 (Fig. 4c) in of these miRNAs were further tested by transwell Matrigel cancerous cells, we detected lower levels of these proteins in the invasion assay. Relative to control cells, an increased migratory cancer cells than in the non-cancerous cell lines, Hek-293T, capacity was observed in cells that were transfected with miR-93, BEAS2B and HaCaT. We also examined the expression of miR-17, miR-299-3p and miR-661 (Fig. 6e). In addition, miR- TUSC2, TIMP2 and TIMP3 in human breast cancer specimens. 520-3p and miR-608 transfection also resulted in increased Although these proteins could be clearly detected in the ductal invasive capacity; however, the results were not as drastic as in structures of breast tissues, they were almost undetectable in miR-17-, miR-93-, miR-299-3p- and miR-661-transfected cells. tumour tissues (Fig. 4d). Collectively, these results demonstrated that all of miR-17, miR- 93, miR-299-3p, miR-520-3p, miR-608 and miR-661 were Validation of miRNA function. The binding of miRNAs to involved in migration and invasion. Notably, some miRNAs TUSC2P, the 30-UTRs of TUSC2, TIMP2 and TIMP3 was elicited a stronger phenotypic change than others. For example,

NATURE COMMUNICATIONS | 5:2914 | DOI: 10.1038/ncomms3914 | www.nature.com/naturecommunications 5 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3914

3′-UTR miR17 miR93 miR661 miR299-3p TUSC2 (NM_007275) TIMP3 3′ UGCGCGU CCGG UCU-- C U GGG U CCG U m i R 661 *:||*|*|||*|||****|||||||* 5′ CTGCCCCGGCAAGAAACTCCCAGGCT -58 3′-UTR 3′ UUCGCCAAAUGGUAGGGUGUAU miR299-3p miR17 miR93 miR299-3p miR608 miR520-3p :|||||**|*|*:||||||||* TIMP2 5′ GAGCGG—GTCGGTCCCACAGT -162 3′ GAUGGACG-----UGACAUUCGUGAAAC miR17 ***|||||*****:||***||||||||* 5′ AGCCCTGCTAGAGGCT-ACAGCACTTTA -376 miR661 miR299-3p miR17 miR93 miR608 miR520-3p 3′ GAUGGACG--UGCU--UGUCGUGAAA miR93 TUSC2P/ ***|||||**:*|:**|||||||||| TUSC2-UTR 5′ AGCCCTGCTAGAGGCTACAGCACTTT -375 3′ UGCCUCGACAGGG- UUGU ------GGUGGGGA miR608 ||****|**||||**|||*******|||||||| TUSC2 3′UTR/ TUSC2P 5′ ACCACCCCCTCCCTTACAGTAACCCCCACCCCT -938 CMV promoter 3′ UGUCAGGUUUCCC-UUCGUGAAA miR520a *|||||**|||||*|||||||** 5′ TCAGTC--AAGGGAAAGCACTAG -965

TUSC2 3′-UTR Control TUSC2P TUSC2 UTR TUSC2P kDa

TUSC2 19

β -Actin 47

Timp 2 21

TIMP2 (NM_003255) β-Actin TUSC2P (NC_000024.9) 3′ GAUGG-ACGUGACAUUCGUGAAAC miR17 *|:||**|||**|**|||||||*| 3′ UGCGCGUCCGGUC--UCU----GGGUCCGU miR661 5′ ATGCCAAGCA--GGCAGCACTTAG -334 24 ****||***||||**|||****|||||||* ′ Timp 3 ′ 3 GAUGGACGUGCUUGUCGUGAAAC miR93 5 TCCTGC—TCCAGCAAGAAACTCCCAGGCT -90 *|:||***:|*::||||||||*| ′ 5′ ATGCC- AAGCAGGCAGCACTTAG - 334 3 UGCGCGUCCGG------UCUCUGGGUCCGU miR661 β-Actin |*|:|:*|||:********:|||*|||||||* ′ ′ 3 UGUCAG----GUUUC-CCUUCGUGAAA miR520 5 AGGTGT-GGCTTCCATTAAGGAG-CCCAGGCT -124 |*:||:****||**|*|||||||:||* 3′ GAUGGACGUGCU----UGUCGUGAAAC miR93 5′ AAGGTTTCTGCATCGTGGAAGCATTTG -2005 ***|||||**||****||||||||||* 5′ AACCCTGCTAGAAGCTACAGCACTTTA -336 3′ UUCGCCAAAUGG-UAGGGUGUAU miR299-3p TUSC2P tumour Control tumour *|||*****||:***|||||||* 3′ GAUGGACG-----UGACAUUCGUGAAAC miR17 5′ CAGCACCTGACTCCCCCCACATC -561 1 212 ***|||||*****:||***||||||||* kDa ′ 5′ AACCCTGCTAGAAGCT-ACAGCACTTTA -335 3 UGCCUCGAC-AGGGUUG--UGGUGGGGA miR608 TUSC2 19 ′ *:||**|||**||||*|***|||||||* 3 UGUCAGG------UUUCCCUUCGUGAAA miR520a ′ **|**||******||*****|||||||| 5 TTGG-TCTGCACCCACCCCCCCACCCCC -740 ′ 5 CTAACCCTGCTAGAAGCTACAGCACTTT -335 TIMP3 (NM_000362) β-Actin 47 3′ UGCCUCGACAGGGUUGUGGUGGGGA miR608 3′ GAUGGACGUGACAUUCGUGAAAC miR17 ******||*||||***:|||||||| :|*|:||||***|*|||||||*| ′ 5 CCCCTACTCTCCC-CAGCCACCCCT -218 5′ TTTCTTGCAAATTTAGCACTTGG -123 Timp 2 21 3′ UGCCUCGACAGGGUUGUGGUGGGGA miR608 3′ GAUGGACGUGCUUGUCGUGAAAC miR93 **|**|:||*|||**|*|||||||* ***|:||||****:|||||||*| 5′ TAGTTGTTG-CCC-CC-CCACCCCC 654 5′ TTTCTTGCAAATTTAGCACTTGG -123 β-Actin 3'UGCCUCGACAGGGU-UGUGGUGGGGA miR608 ′ **||||**|**|:|**||||||||:* 3 UGCGCGUCCG--GUCUCUGGGUCCGU miR661 5'TGGGAG-GGAACTATTCACCACCCTG-812 **||*||**|***||**:|||||||* Timp 3 24 5′ TTGCACACACACAAG-TGCCCAGGCA -1865 3'UGCCUCGACAGGGUUGUGGUGGGGA miR608 ***|||:*|*||:***||||||||* 3′ UUCGCCAAAUGGUAGGGUGUAU miR299-3p β-Actin 5'TATGAGTAG-CCT---ACCACCCCC -870 *****|||**||*|||||||** 5′ CACAAGTT--CCCTCCCACAAG -2152

Figure 3 | Targeting of TUSC2 and TIMP2/3 by miRNAs. (a) We hypothesized that the TUSC2P/TUSC2-UTR would attract endogenous miR-17, miR-93, miR-299-3p, miR-520a, miR-608 and miR-661, thus freeing TUSC2, TIMP2 and TIMP3 mRNAs to be available for translation. (b) Computation analysis of the TUSC2 showed potential binding sites for miR-93, miR-299-3p, miR-520a, miR-17, miR-608 and miR-661. (c) Computation analysis of the TUSC2P showed potential binding sites for miR-93, miR-17, miR-520a, miR-608 and miR-661. (d) Computation analysis of TIMP2 30-UTR (upper) and TIMP3 (lower) 30-UTRs revealed binding sites for miR-17, miR-93, miR-299-3p, miR-608 and miR-661. (e) Protein lysates were prepared from TUSC2P-, TUSC2- UTR- and vector-transfected cells and subjected to western blot analysis probed with anti-TUSC2, anti-TIMP2 and anti-TIMP3 antibodies. There was elevated expression of TUSC2, TIMP2 and TIMP3 in the TUSC2P and TUSC2-UTR cells compared with the control cells. Detection of b-actin on the same membranes served as a loading control. (f) Protein lysates were prepared from TUSC2P and control tumours, and subject to western blot analysis and probed with anti-TUSC2, anti-TIMP2 and anti-TIMP3 antibodies. TUSC2, TIMP2 and TIMP3 were upregulated in the TUSC2P tumours.

miR-93 had a stronger effect on cell migration and invasion than but TUSC2P was expressed only in HaCaT cells (Fig. 7a). In both the other miRNAs. Our experiments directly confirmed the 4T1 and HaCaT, TUSC2P transfection only somewhat functions of TUSC2P and TUSC2 30-UTR in 4T1 cells. upregulated the expression levels of TUSC2P (Fig. 7b). The upregulation of TUSC2P was significant in 4T1 cells but not in Validation of TUSC2P effects. As 4T1 cells expressed unde- HaCaT cells, perhaps due to the high background levels of tectable levels of TUSC2P and HaCaT cells expressed very high TUSC2P (Fig. 7c). levels of TUSC2P, we analysed the copy number of both TUSC2P To examine the effects of TUSC2P, we tested whether the and TUSC2 using the method described27. In the vector- expression of TUSC2P affected levels of other mRNAs in tumours transfected cells, both 4T1 and HaCaT cells expressed TUSC2, formed by TUSC2P- or vector-transfected cells. Although TUSC2P

6 NATURE COMMUNICATIONS | 5:2914 | DOI: 10.1038/ncomms3914 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3914 ARTICLE

kDa 293T BEAS2B HaCaT 4T1 MCF-1 MB468 MT-1 MB231 LnCap Du145 PC3 JHH-1 HpG2 U87

19 TUSC2 protein 8 47 β-Actin 7

6

5

4

3

2

Relative mRNA levels of TUSC2 1

0 293T BEAS2B HaCaT WBC 4T1 MCF-1 MB468 MT-1 MB231 LnCap Du145 PC3 JHH-1 HpG2 U87

kDa 293T BEAS2B HaCaT 4T1 MCF-1 MB468 MT-1 MB231 LnCap Du145 PC3 JHH-1 HpG2 U87

10 21 TIMP2 protein 8 47 β-Actin 6

4

2

Relative mRNA levels of Timp2 0 293T BEAS2B HaCaT WBC 4T1 MCF-1 MB468 MT-1 MB231 LnCap Du145 PC3 JHH-1 HpG2 U87

kDa 293T BEAS2B HaCaT 4T1 MCF-1 MB468 MT-1 MB231 LnCap Du145 PC3 JHH-1 HpG2 U87

24 TIMP3 protein 10 47 β-Actin 8

6

4

2

Relative mRNA levels of Timp3 0 293T BEAS2B HaCaT WBC 4T1 MCF-1 MB468 MT-1 MB231 LnCap Du145 PC3 JHH-1 HpG2 U87

TUSC2, normal TIMP2, normal TIMP3, normal

TUSC2, tumour TIMP2, tumour TIMP3, tumour

Figure 4 | Expression of TUSC2 and TIMP2/3 in different cell lines and patient specimens. (a–c) Expression of TUSC2 (a), TIMP2 (b) and TIMP3 (c) were analysed by real-time PCR for mRNA levels and western blotting for protein levels (insets) in different cell lines as indicated; n ¼ 4, error bar, s.d. (d) Human breast cancer specimens were probed for expression of TUSC2, TIMP2 and TIMP3. Expression of these molecules was detected in the ductal structures (arrows), but not in the tumour tissues. Scale bar, 50 mm.

NATURE COMMUNICATIONS | 5:2914 | DOI: 10.1038/ncomms3914 | www.nature.com/naturecommunications 7 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3914

abcd120 120 120 miR-93 120 100 miR-661 100 100 miR-299-3p 100 miR-17 80 80 80 80 60 60 60 60 40 ** 40 40 ** 40 ** ** 20 20 20 20 Relative luciferase units (%) luciferase Relative Relative luciferase units (%) luciferase Relative Relative luciferase units (%) luciferase Relative Relative luciferase units (%) luciferase Relative 0 0 0 0

Luc- Luc- Luc- Luc- Luc-G3R Luc-G3R c2P-mut Luc-G3R Luc-G3R Luc-Tusc2P Tusc2P-mut Luc-Tusc2P Tus Luc-Tusc2P Tusc2P-mut Luc-Tusc2P Tusc2P-mut ef gh miR-93 120 100 100 miR-299-3p miR-520a 120 miR-608 100 100 80 80 80 80 ** 60 ** 60 60 60 ** 40 40 40 40 ** 20 20 20 20 Relative luciferase units (%) luciferase Relative Relative luciferase units (%) luciferase Relative Relative luciferase units (%) luciferase Relative 0 units (%) luciferase Relative 0 0 0

Luc- Luc- Luc- Luc- Luc-G3R Luc-G3R Luc-G3R Luc-G3R Luc-Timp2 Timp2-mut Luc-Timp2 Timp2-mut Luc-Tusc2P Tusc2P-mut Luc-Tusc2P Tusc2P-mut

120 ijmiR-17 kl120 100 miR-93 100 100 miR-608 miR-520a 100 80 80 80 80 ** 60 60 60 60

40 40 40 ** ** ** 40 20 20 20 20 Relative luciferase units (%) luciferase Relative Relative luciferase units (%) luciferase Relative Relative luciferase units (%) luciferase Relative Relative luciferase units (%) luciferase Relative 0 0 0 0

Luc- Luc- Luc- Luc- Luc-G3R Luc-G3R Luc-G3R Luc-G3R Luc-Timp2 Timp2-mut Luc-Timp2 Timp2-mut Luc-Timp2 Timp2-mut Luc-Timp2 Timp2-mut mn o 100 120 100 miR-299-3p miR-17 miR-661 100 80 80 80 60 ** 60 ** 60 40 ** 40 40

20 20 20 Relative luciferase units (%) luciferase Relative Relative luciferase units (%) luciferase Relative Relative luciferase units (%) luciferase Relative 0 0 0

Luc- Luc- Luc- Luc-G3R Luc-G3R Luc-G3R Luc-Timp3 Timp3-mut Luc-Timp3 Timp3-mut Luc-Timp3 Timp3-mut Figure 5 | Confirmation of TIMP2 and TIMP3 targeting. (a–f) Fragments of TUSC2P harbouring different target sites of miR-299-3p (a), miR-661 (b), miR-17 (c), miR-93 (d), miR-520a (e) and miR-608 (f) were cloned into the luciferase reporter vector pMir-Report. 4T1 cells were co-transfected with one of these miRNAs and the luciferase constructs or a mutant constructs, in which the miRNA target sites were mutated. A non-related fragment of complementary DNA was used as a positive control. Luciferase activity assays indicated that all six miRNAs repressed luciferase activities when it harboured the corresponding TUSC2P fragment, which was reversed when the potential miRNA target site was mutated; n ¼ 3, **Po0.01 (between wild type and mutants) by t-test, error bar, s.d. (g–k) The cells were co-transfected with luciferase reporter plasmids for TIMP2 with corresponding miRNAs or a control oligo. In the presence of the targeting UTR, luciferase activities were inhibited, which were significantly elevated when the target sites were mutated; n ¼ 3, **Po0.01 (between wild type and mutants) by t-test, error bar, s.d. (l–o) The TIMP3 30-UTR fragments containing the binding sites for miR- 17, miR-93, miR-299-3p and miR-661 were cloned into pMir-Report. Luciferase activity assays indicated that all four miRNAs repressed luciferase activities, which was reversed when the miRNA binding site was mutated; n ¼ 3, **Po0.01 (between wild type and mutants) by t-test, error bar, s.d. levels were increased in the TUSC2P tumours (Fig. 7d), there was cells transfected with TUSC2P expressed higher levels of TUSC2P little difference in levels of TUSC2 (Fig. 7e), TIMP2 (Fig. 7f) or than the control groups (Fig. 7h), but there was little difference TIMP3 (Fig. 7g). To corroborate these results, 4T1 and MB231 cells in the expression of TUSC2 (Fig. 7i), TIMP2 (Fig. 7j) and TIMP3 were transfected with TUSC2P or a control vector. It was found that (Fig. 7k).

8 NATURE COMMUNICATIONS | 5:2914 | DOI: 10.1038/ncomms3914 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3914 ARTICLE

n.c. miR-17 miR-93 miR-299-3pmiR-520a miR-608 miR-661kDa n.c. miR-17 miR-93 miR-299-3pmiR-520amiR-608kDa 21 TUSC2 19 Timp2

β-Actin 47 β-Actin 47

n.c. miR-93 n.c. miR-17 miR-93 miR-299-3pmiR-661kDa 104 104 Timp3 73.4 6.33 7.79 23.2 24 103 103 β-Actin 47 102 102 101 101 20.3 0.01 52.2 16.8 100 100 N.C. 100 101 102 103 104 100 101 102 103 104 140 miR-93 miR-299-3p 120

miR-299-3p miR-520a m) left) miR-520a 104 104 μ 0.12 1.58 1.27 8.96 100 miR-608 103 103 miR-661 80 102 102 miR-17 101 101 60 79 19.3 70.7 19 100 100 40 100 101 102 103 104 100 101 102 103 104 ** 20 Annexin 4 miR-608 4 miR-661 Cell migration (distance ( FL4-H: APC- 10 10 0 3.35 12.2 8.94 12.6 0 h 20 h 103 103 102 102 ** 101 101 80 ** 72.3 12.1 58.1 20.4 ** 100 100 100 101 102 103 104 100 101 102 103 104 60 miR-17 ** 104 29.7 0.19 103 40 ** 102 ** 101 20 67.8 2.3 100 0 1 2 3 4 10 10 10 10 10 0 Cell invasion (no. of cells per field) FL3-H:pi n.c.

miR-93 miR-661 miR-17 miR-520a miR-608 miR-299-3p

Figure 6 | Functional analysis of miRNAs targeting TUSC2. (a) Lysates of 4T1 cells transfected with miRNAs were analysed by western blotting. Expression of miR-17, miR-93, miR-299-3p, miR-520a, miR-608 and miR-661 decreased TUSC2 protein levels. b-Actin on the same membranes served as a loading control. (b) The cells transfected with different miRNAs were subject to western blot analysis for expression of TIMP2 and TIMP3. Both TIMP2 and TIMP3 levels decreased in cells transfected with miRNAs as compared with the control oligo. (c) Apoptosis was analysed in cells transfected with different miRNAs. Transfection with the miRNAs decreased apoptosis; n ¼ 3, **Po0.01. (d) The migration rate was measured for the miRNA-transfected 4T1 cells. There was an increased amount of cell migration in miRNA-transfected cells compared with control cells; n ¼ 10, **Po0.01 by t-test, error bar, s.d. (e) In cell invasion assays, the cells transfected with miR-17, miR-93, miR-299-3p, miR-520a, miR-608 and miR-661 showed drastically increased in the capacity of invasion through the membrane pores compared with the control cells; n ¼ 5, **Po0.01 by t-test.

We then tested the effects of TUSC2P on luciferase constructs endogenous TUSC2P and found that silencing endogenous harbouring the 30-UTRs of TUSC2, TIMP2 and TIMP3 in TUSC2P repressed luciferase activity when the constructs competition assays. It was found that luciferase activity was contained either TUSC2-UTR (Fig. 8f), TIMP2-UTR (Fig. 8g) increased in a dose-dependent manner when the constructs or TIMP3-UTR (Fig. 8h). contained the TUSC2-UTR (Fig. 7l), TIMP2-UTR (Fig. 7m) and In MB231 cells, siRNA-1 and siRNA-2 had strong interfering TIMP3-UTR (Fig. 7n) sequences. effects, whereas siRNA-3 only weakly decreased the expression of To confirm that the phenotypic changes were due to TUSC2P, TUSC2, TIMP2 and TIMP3 (Supplementary Fig. S6a). We also siRNA sequences were designed to target TUSC2P and to detected decreased cell apoptosis (Supplementary Fig. S6b), but suppress its function. HaCaT and MB231 cells were transfected enhanced cell migration (Supplementary Fig. S6c) and invasion with these siRNAs, using an unrelated sequence as a control. (Supplementary Fig. S6d) in the cells transfected with siRNAs. Thus, Western blot analysis was performed and the siRNA-treated the siRNAs that targeted TUSC2P were able to downregulate HaCaT were found to have decreased TUSC2, TIMP2 and TIMP3 TUSC2P functions, reversing the observed phenotype. These protein levels (Fig. 8a). siRNAs were found to decrease levels of TUSC2P (Supplementary The effects of siRNAs on cell phenotypes were then tested. Fig. S6e), but had little effect on the expression of TUSC2 siRNA treatment on TUSC2P cells increased survival compared (Supplementary Fig. S6f), TIMP2 (Supplementary Fig. S6g) and with the control (Fig. 8b). The siRNAs also enhanced migratory TIMP3 (Supplementary Fig. S6h). (Fig. 8c) and invasive capacity (Fig. 8d), while reducing cell To confirm that the observed transcriptional effects and apoptosis (Fig. 8e), compared with the control. To corroborate phenotype of TUSC2P cells were mediated through miRNAs, these results, we treated HaCaT cells with siRNAs targeting we treated HaCaT cells with an siRNA targeting Dicer1 to block

NATURE COMMUNICATIONS | 5:2914 | DOI: 10.1038/ncomms3914 | www.nature.com/naturecommunications 9 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3914

Vector-transfected cells TUSC2P-transfected cells 25 0.017 25 20 TUSC2 0.049 TUSC2 Vector 0.267 TUSC2P 20 TUSC2P 20 TUSC2P 15 15 15

10 0.002 10 2

5 5 Copy number per cell 1

Copy number per cell 0.006 0.001 Copy number s per cell 0 0 0 4T1 HaCaT 4T1 HaCaT 4T1 HaCaT

6 1.4 ** 1.6 1.4 5 1.2 1.2 4 1.2 1 1 3 0.8 0.8 0.8 0.6 0.6

2 of Timp2 of Timp3 of TUSC2 of TUSC2P 0.4 0.4

Relative levels 0.4 Relative levels Relative levels 1 Relative levels 0.2 0.2 0 0 0 0 Control TUSC2P Control TUSC2 Control Timp2 Control Timp3

25 Control ** TUSC2P 6 5 20 Control Control 4 Control 5 TUSC2P 4 TUSC2P TUSC2P 3 15 4 3 10 3 2 2 ** 2 5 1 1 1 Relative levels of Timp2 Relative levels of TUSC2P Relative levels of Timp3 0 Relative levels of TUSC2 0 0 0 4T1 MB-231 4T1 MB-231 4T1 MB-231 4T1 MB-231

120 120 Control Luc-Timp2-UTR 120 Control Luc-TUSC2-UTR Control Luc-Timp3-UTR

100 100 100 ** * * ** ** ** ** ** ** 80 80 ** 80 ** ** 60 60 60 **

40 40 40 Relative luciferase units (%) Relative luciferase units (%) Relative luciferase units (%) 20 20 20

0 0 0 0 10 50 100 300 500 0 10 50 100 300 500 0 10 50 100 300 500 Amount of pcDNA-TUSC2P (ng) Amount of pcDNA-TUSC2P (ng) Amount of pcDNA-TUSC2P (ng) Figure 7 | Expression of TUSC2P affects activities of TUSC2 and TIMP3. (a,b) Copy number of TUSC2 and TUSC2P was determined in vector- and TUSC2P-transfected cells. P-values are obtained by t-test and shown in the figure; n ¼ 3, error bar, s.d. (c) Copy number of TUSC2P was determined in vector- and TUSC2P-transfected cells. Expression of TUSC2P (d), TUSC2 (e), TIMP2 (f) and TIMP3 (g) was analysed in tumours formed by cells transfected with the control vector or TUSC2P. Although TUSC2P levels were promoted in the TUSC2P tumour, there was little difference in the expression of the others; n ¼ 3, **Po0.01 by t-test, error bar, s.d. Expression of TUSC2P (h), TUSC2 (i), TIMP2 (j) and TIMP3 (k) was analysed in 4T1 and MDA-MB- 231 cells transfected with the control vector or TUSC2P. TUSC2P transfection did not affect expression of TUSC2, TIMP2 and TIMP3; n ¼ 3, **Po0.01 by t-test, error bar, s.d. Luciferase constructs for the 30-UTRs of TUSC2 (l), TIMP2 (m) and TIMP3 (n) were co-transfected with TUSC2P in 4T1 cells. Increased amounts of TUSC2P promoted the activities of the luciferase constructs; n ¼ 3, *Po0.05, **Po0.01 by t-test, error bar, s.d. the miRNA biogenesis pathway. As expected, silencing Dicer1 the 30-UTRs of TUSC2 (Fig. 9c), TIMP2 (Fig. 9d) and TIMP3 decreased levels of the miRNAs tested (Fig. 9a). As a (Fig. 9e). However, in the presence of Dicer1 siRNA, the effects of consequence, silencing Dicer1 increased the expression of TUSC2P transfection were abolished and we confirmed silencing TUSC2, TIMP2 and TIMP3 (Fig. 9b). Luciferase assays showed of TUSC2P even in the presence of Dicer1 siRNA (Fig. 9f). that silencing TUSC2P decreased the effects of TUSC2P on The effects of all related transcripts were tested in cell promoting luciferase activity, when the construct contained migration assay. 4T1 cells were transfected with TUSC2P,

10 NATURE COMMUNICATIONS | 5:2914 | DOI: 10.1038/ncomms3914 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3914 ARTICLE

HaCaT cell survival in HaCaT cells transfected serum-free medium with TUSC2P siRNAs n.c. siRNA 1 siRNA 2 siRNA 3kDa 130 25 TUSC2 19 120

** m) left) 110

20 μ β-Actin 47 ** 100 cells) 4 ** 90 10 15 Timp2 21 × 80 70 Control β-Actin 10 siRNA1 ** 60 ** 5 50 siRNA2 Timp3 24 Cell survival ( ** 40 siRNA3 Cell migration (distance ( 0 0 β-Actin 0 h 48 h

Control siRNA1 siRNA2 siRNA3

104 104 22.4 Control 0.16 5.71 siRNA1 0.45 103 103 HaCaT cell invasion assays 102 102 6 ** 101 101 5 0 75.4 2.040 88.9 4.93

10 V apc annexin FL4-H: 10 FL4-H: apc annexin V apc annexin FL4-H: 100 101 102 103 104 100 101 102 103 104 4 ** ** FL3-H: pi FL3-H: pi

3 104 104 17.6 siRNA2 0.53 13.9 siRNA3 0.25 103 103 2 102 102 1 1 1 Cell invasion (no. of cells per field) 10 10 81.3 0.49 82.8 2.99 0 0 0 FL4-H: apc annexin V apc annexin FL4-H: 10 V apc annexin FL4-H: 10 ControlsiRNA1 siRNA2 siRNA3 100 101 102 103 104 100 101 102 103 104 FL3-H: pi FL3-H: pi

Control Luc-TUSC2-UTR 120 Control Luc-Timp2-UTR Control Luc-Timp3-UTR 120 120 100 100 ** ** 100 ** 80 ** 80 ** 80 ** * ** ** 60 60 60

40 40 40 Relative luciferase units (%) Relative luciferase units (%) 20 20 Relative luciferase units (%) 20

0 0 0 A2

Control siRNA1 siRNA2 siRNA3 Control siRNA1 siRNA2 siRNA3 Control siRNA1 siRN siRNA3 Figure 8 | Confirmation of TUSC2P effects by siRNA approach. (a) Lysates prepared from the siRNA-treated HaCaT cells were subject to western blot analysis. Levels of TUSC2, TIMP2 and TIMP3 decreased as a result of siRNA targeting TUSC2P. (b) Cell survival was analysed in cells transfected with siRNAs targeting TUSC2P or a control oligo. The TUSC2P siRNA-treated cells survived longer in serum-free medium than the control cells; n ¼ 5, Po0.01 by t-test, error bar, s.d. (c) In migration assay, the siRNA-treated cells migrated faster than the cells transfected with a control oligo; n ¼ 5, ** Po0.01 by t-test, error bar, s.d. (d) In invasion assay, there was an increased amount of the siRNA-treated cells that invaded through the Matrigel compared with the control; n ¼ 5, **Po0.01 by t-test, error bar, s.d. (e) Determination of cell apoptosis indicated that less siRNA-treated cells underwent apoptosis than the control cells; n ¼ 10. The luciferase constructs of TUSC2 (f), TIMP2 (g) and TIMP3 (h) were co-transfected with siRNA targeting endogenous TUSC2P in HaCaT cells. Silencing TUSC2P decreased luciferase activities; n ¼ 5, *Po0.05, **Po0.01 by t-test, error bar, s.d.

TUSC2, TIMP2, TIMP3 or a control vector. It was found that silencing of TUSC2, TIMP2 or TIMP3 significantly reversed the transfection with these expression constructs decreased cell effects of TUSC2P (Fig. 9i). migration as compared with the control (Fig. 9g). HaCaT cells The effects of TIMP2 and TIMP3 were further tested. 4T1 cells were also transfected with TUSC2P siRNA and rescued with stably transfected with TUSC2-UTR construct were treated with TUSC2, TIMP2 and TIMP3. Although silencing TUSC2P siRNAs targeting TIMP2 or TIMP3. After confirming silencing of enhanced cell migration, we found that expression of TUSC2, TIMP2 and TIMP3 (Supplementary Fig. S7a), cell migration was TIMP2 or TIMP3 significantly reversed the effects of TUSC2P monitored. Silencing TIMP2 and TIMP3 increased cell motility transfection (Fig. 9h). In another set of experiments, 4T1 cells (Supplementary Fig. S7b). It was found as well that siRNA- stably transfected with TUSC2P or a control vector were TIMP2 and siRNA-TIMP3 cells invaded through Matrigel-coated transfected with siRNAs targeting TUSC2, TIMP2 or TIMP3. transwell membranes faster than the TUSC2-transfected cells Although the expression of TUSC2P decreased cell migration, (Supplementary Fig. S7c). In cell attachment assay, it was found

NATURE COMMUNICATIONS | 5:2914 | DOI: 10.1038/ncomms3914 | www.nature.com/naturecommunications 11 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3914

bp Ctrl TUSC2P si-TUSC2P si-Dicer1 3,500 240 120 2,500 Dicer1 1,500 ** 292 GAPDH 100 500 kDa 80 Control 400 ** 19 TUSC2 ** Si-Dicer 60 300 47 β-Actin 200 40 21 Timp2 100 20

** Relative luciferase units (%) miRNA levels in HaCaT cells * ** β-Actin 0 ** 0 Timp3 24 miR-93 Control si-Dicer si-Dicer miR-608 miR-661 TUSC2P TUSC2P β TUSC2P TUSC2P miR-520a -Actin miR-17-5p luc-TUSC2 luc-TUSC2 luc-TUSC2 luc-TUSC2 si-TUSC2P si-TUSC2P miR-229-3p

4 ** 120 ** 120 90 ** 3 90 ** 60 2 60 P=0.63 units (%) units (%)

30 30 Relative mRNA 1 levels of TUSC2P Relative luciferase Relative luciferase 0 0 0 Control Control si-Dicer si-Dicer si-Dicer si-Dicer Control si-Dicer TUSC2P TUSC2P TUSC2P TUSC2P TUSC2P TUSC2P TUSC2P TUSC2P luc-Timp3 luc-Timp2 luc-Timp2 luc-Timp2 luc-Timp2 luc-Timp3 luc-Timp3 luc-Timp3 si-TUSC2P si-TUSC2P si-TUSC2P si-TUSC2P si-TUSC2P si-TUSC2P

140 4T1 cells 120 HaCaT cells 4T1 TUSC2P cells 140 120 100

m) left) 100 120 m) left) μ m) left) μ

μ ** 80 80 ** 100 ** 60 ** ** 60 ** * Control Control Control ** 80 * TUSC2P 40 TUSC2P si-TUSC2P ** TUSC2 40 si-TUSC2P+TUSC2 TUSC2P+si-TUSC2 Timp2 Cell migration (distance ( TUSC2P+si-Timp2 20 Cell migration (distance ( si-TUSC2P+Timp2 60 Timp3 Cell migration (distance ( si-TUSC2P+Timp3 ** TUSC2P+si-Timp3 20 0 0 0 0 h 48 h 0 h 24 h 0 h 24 h

Figure 9 | Confirmation of TUSC2P functions. (a) HaCaT cells were transfected with an siRNA targeting Dicer1 to block the miRNA biogenesis pathway. Silencing Dicer1 decreased levels of the miRNAs tested; n ¼ 4, *Po0.05, **Po0.01 by t-test, error bar, s.d. (b) HaCaT cells were treated with siRNA targeting Dicer1 or TUSC2P followed by reverse transcription–PCR for confirmation of Dicer knockdown and western blot analysis to analyse levels of TUSC2, TIMP2 and TIMP3. Silencing Dicer increased expression of TUSC2, TIMP2 and TIMP3. HaCaT cells were transfected with luciferase constructs of TUSC2 (c), TIMP2 (d) and TIMP3 (e) combined with TUSC2P, siRNA targeting TUSC2P, and/or siRNA targeting Dicer1 followed by luciferase assays. Although silencing TUSC2P decreased luciferase activities, silencing Dicer reversed the effects; n ¼ 4, **Po0.01 analysed by t-test, error bar, s.d. (f) HaCaT cells were transfected with TUSC2P siRNA combined with or without Dicer1 siRNA. TUSC2P was silenced even in the presence of Dicer1 siRNA; n ¼ 4, **Po0.01 analysed by t-test, error bar, s.d. (g) Transfection of 4T1 cells with TUSC2P, TUSC2, TIMP2 and TIMP3 decreased cell migration; n ¼ 4, **Po0.01 analysed by t-test, error bar, s.d. (h) Transfection of HaCaTcells with siRNA targeting endogenous TUSC2P increased cell migration. Combined transfection with TUSC2, TIMP2 or TIMP3 partially, but significantly, reversed the effect of TUSC2P on cell migration; n ¼ 4, **Po0.01 analysed by t-test, error bar, s.d. (i) Transfection of 4T1 cells with TUSC2P decreased cell migration, which could be partially, but significantly, reversed by transfection with siRNAs targeting TUSC2, TIMP2 or TIMP3; n ¼ 4, *Po0.05, **Po0.01 by t-test, error bar, s.d. that the siRNA-TIMP2 and siRNA-TIMP3 cells had a decreased showed decreased cell apoptosis compared with the control rate of attachment and spreading compared with the control cells (Supplementary Fig. S7e). (Supplementary Fig. S7d). Fluorescence-activated cell sorting In summary, our results show that the TUSC2P pseudogene analysis in the siRNA-TIMP2- and siRNA-TIMP3-treated cells can bind to and antagonize endogenous miRNAs, thereby

12 NATURE COMMUNICATIONS | 5:2914 | DOI: 10.1038/ncomms3914 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3914 ARTICLE modulating TUSC2, TIMP2 and TIMP3 (Supplementary Fig. S8a, transcription is lost during malignant transformation. Expression right side). In the absence of TUSC2P, canonical miRNA of TUSC2P in breast cancer cell lines isolated from females signalling mediated through RNA-induced silencing complex indicated that the sequence found in chromosome X, which can bind and inhibit the translation of TUSC2, TIMP2 shared 99% homology with the pseudogene TUSC2P expressed and TIMP3 mRNAs (Supplementary Fig. S8a, left side). The by chromosome Y, is actually another pseudogene and can be levels of miRNAs were unaffected by TUSC2P transfection transcribed. It is anticipated that one copy of these tentative (Supplementary Fig. S8b), whereas transfection with our six pseudogenes in chromosome X is inactive, whereas male can miRNAs of interest increased miRNA levels in the cells express two copied of TUSC2P pseudogenes. This would increase (Supplementary Fig. S8c). This confirmed effective processing the potential loss of TUSC2P in females, especially in a cancerous of the miRNA biogenesis pathway. Interestingly, transfection with state. Interestingly, we also detected low levels of TUSC2P miRNAs was found to weakly decrease TUSC2P levels expression in prostate cancer cell lines isolated from males. The (Supplementary Fig. S8d). The precise effect of this down- mechanisms by which expression of TUSC2P is decreased or regulation awaits further investigation. degradation of TUSC2P is increased await further investigation. The transfection of TUSC2P into 4T1 and MB231 cells elicited Discussion similar phenotypic changes as the TUSC2 30-UTR. Relative to In a variety of cancer cell lines, it has been reported that TUSC2 control and TUSC2 coding cells, TUSC2P and TUSC2 30-UTR mRNA transcripts were detected by northern blot analysis even transfection was found to relieve transcriptional inhibition on though there was no TUSC2 protein present28–30. This led us to endogenous TUSC2, TIMP2 and TIMP3, thereby increasing their believe that the TUSC2 protein was commonly downregulated by protein levels. Subsequent phenotypic changes were observed in alternative mechanisms. One such option was regulation by the TUSC2 30-UTR- and TUSC2P-transfected tumour cells in miRNAs. Previously, our lab showed that miR-378 was able to both 4T1 and MB231 cell lines. TUSC2P and TUSC2 30-UTR cells bind and inactivate TUSC2 mRNA transcripts4. Furthermore, Du had an increased percentage of apoptotic cells, showing increased et al.31 showed that miR-93, miR-98 and miR-197 were also cell death. This is correlated with the current knowledge of capable of binding to the TUSC2 30-UTR. Here we show that TUSC2, widely believed to be a tumour suppressor gene that is other miRNAs, miR-17, miR-299-3p, miR-520a, miR-608 and frequently inactivated during malignant transformation. Over- miR-661 were also able to bind to the TUSC2 30-UTR. expression of the TUSC2 30-UTR also resulted in alterations to In this study, we tried to simulate the naturally occurring the extracellular matrix. There was a decreased migratory and pseudogene phenomena, initially reported for PTENP1 (ref. 32) invasive capacity in the TUSC2P and TUSC2 30-UTR cells and later termed as the competing endogenous RNA model. compared with the control cells. The variations in these Pseudogenes have been discovered in equal abundance to extracellular matrix properties were a result of changes to TIMP2 functional genes and therefore represent a large component of and TIMP3 expression. We observed an increase in TIMP2 and the genome. The human genome has been estimated to have TIMP3 protein levels in both TUSC2P- and TUSC2 30-UTR- B20,000 putative pseudogenes33. Previously, pseudogenes were transfected 4T1 cells and tumours. The TUSC2P and 30-UTRs of classified as ‘junk DNA’ based on the fact that they did not code TUSC2, TIMP2 and TIMP3 contain multiple miRNA binding for proteins. However, it has been recently shown that certain sites in common. By luciferase assay, we confirmed that these pseudogenes have important roles in maintaining homeostasis, miRNA were indeed translational inhibitors of TUSC2, TIMP2 specifically as modulators of miRNAs. This was recently and TIMP3. described by Poliseno et al.32, where a phosphatase and tensin siRNA targeting TUSC2P were used to confirm the functions homologue (PTEN) pseudogene, PTENP1, was discovered to of TUSC2P. siRNAs were found to reverse the observed functions regulate PTEN cellular levels and suppress cell growth. of TUSC2P and these results confirmed that the phenotypic Furthermore, Chin et al.34 found that single-nucleotide changes in the cells were due to the exogenous expression of polymorphism variations located in miRNA binding sites of the TUSC2P. The mouse cell line 4T1 does not express transcript 30-UTR could affect miRNA target expression and function. The with significant homology to TUSC2P. The acquired functions in 30-UTR of KRAS contained a single-nucleotide polymorphism 4T1 cells transfected with TUSC2P were abolished by retransfec- correlated with an increased risk of non-small cell lung cancer34. tion with siRNAs targeting TUSC2P, confirming the observed This single-nucleotide change altered let-7 binding, which functions of TUSC2P. The functions of endogenous TUSC2P resulted in the overexpression of KRAS in lung cancer. A were also confirmed by siRNAs targeting TUSC2P in HaCaT cells muscle exclusive ncRNA, Linc-MD1, was found to increase the that expressed high level of endogenous TUSC2P. expression of MAML1 and MEF2C, stimulating muscle-specific Corroboration of TUSC2P regulating miRNA effect was gene expression by regulating miR-133 and miR-135 activities35. further confirmed by miRNA transfection. The miRNAs of Thus, these observations showed that certain pseudogenes interest were exogenously overexpressed by transfection into perform integral functions in maintaining homeostasis, TUSC2P-expressing 4T1 cells. This was done to test miRNA specifically as modulators of miRNAs. We have reported our function with the phenotypic changes in the TUSC2P 4T1 cells. findings in the overexpression of the 30-UTR of versican, CD44 miRNA overexpression reversed the observed phenotype of and nephronectin8,9,16. Recently, we also communicated our TUSC2P-transfected cells. There was an increase in cell survival, observations of the competing endogenous RNA functions of migration and invasion after the exogenous miRNAs were versican in liver cancer36. Here we continue our hypothesis transfected into the TUSC2P 4T1 cells and the HaCaT cells. describing the overexpression of the TUSC2 30-UTR and TUSC2P These experiments indicated that TUSC2P could regulate the in antagonizing multiple miRNAs that endogenously occur in the functions of miRNAs in a similar manner to the TUSC2 30-UTR. 4T1 and MB231 cells. The homology between the 30-UTR of Investigations into ncRNAs are important because of the TUSC2 and a potential pseudogene, TUSC2P, was compared. The complex interactions that these sequences have in comparison high degree of similarity (89%) between the two sequences with those induced by a single miRNA or gene. The pseudogene, confirmed that the same miRNA binding sites existed in the as well as the 30-UTR, can function as both a modulator of 30-UTRs of TUSC2 and TUSC2P. miRNA function and as a mediator of miRNA regulation. As Decreased transcription rates of TUSC2P in cancer cell lines multiple miRNAs can interact with a single ncRNA, these can be compared with normal cell lines inferred that TUSC2P important tools, either as buffers or as combinatorial regulators of

NATURE COMMUNICATIONS | 5:2914 | DOI: 10.1038/ncomms3914 | www.nature.com/naturecommunications 13 & 2014 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3914 miRNA. This concept lends itself to the further investigation of Tumour formation assay. Six-week-old female Balb-c strain nude mice (Jackson Laboratories) were subcutaneously injected with TUSC2-UTR or TUSC2P cells ncRNA as functional miRNA inhibitors. 5 The majority of breast-cancer-related deaths are due to (4T1) and control cells (1 Â 10 cells). Tumours were retrieved by the end of third week and fixed in 10% formalin, processed, embedded in paraffin and sectioned for metastatic disease. Thus, identifying new targets for metastatic immunohistochemistry39. The animal use protocol was approved by the Animal disease progression would greatly improve cancer mortality rates. Care Committee at Sunnybrook Research Institute. The 30-UTRs of TUSC2 and TUSC2P are candidate targets for tumour metastasis due to their ability to reduce cell survival and Immunohistochemistry. Immunohistochemistry was performed on the paraffin- also inhibit cell migration and invasion. Through its ability to embedded tissue sections. The tumour sections were processed for antigen bind multiple miRNAs that are shared in common with TIMP2 retrieval, blocked with 10% goat serum and incubated with primary antibodies and TIMP3, TUSC2P can decrease cell migration and invasion of against TUSC2, TIMP2 and TIMP3 in tris-buffered saline (TBS) containing 10% metastatic breast cancer cells. Thus, the 30-UTR of TUSC2 and goat serum overnight. The sections were then washed and labelled with biotiny- TUSC2P can have a diverse role in fine-tuning gene expression lated secondary antibody, followed by avidin-conjugated horseradish-conjugated peroxidase provided by the Vectastain ABC kit (Vector, PK-4000). The staining for the inhibition of cancer progression. Further analysis of this was developed according to the manufacturer’s instructions. The slides were sub- non-coding transcript should be investigated for application sequently stained with Mayer’s haematoxylin for counterstaining followed by slide towards developing cancer therapeutics. mounting.

Methods Western blotting. Western blotting was performed on cell and tissue lysates. Construct generation. The pcDNA3.1-TUSC2 30-UTR construct was created Briefly, cells were seeded onto a six-well plate at 2 Â 105 cells per well overnight. using the 30-UTR of TUSC2 previously made in the lab, which is also named as They were then transfected with 1 mg of TUSC2-UTR, TUSC2P or the control Fus-1 (ref. 4). The TUSC2 30-UTR fragment and the TUSC2P fragment were vector to create stable cell lines. In addition, the TUSC2-UTR and TUSC2P cells amplified and digested with restriction enzymes NheI and ApaI and inserted into were transfected with siRNA against TUSC2-UTR and TUSC2P, respectively, NdeI and ApaI opened pcDNA3.1 vector. The protein expression construct of the transfected with or different miRNA mimics. The control was a scramble RNA coding region of TUSC2 was generated previously in the lab4. provided in the kit. Proteins were extracted 48 h after transfection by lysing in 60 ml lysis buffer containing protease inhibitors (150 mM NaCl, 25 mM Tris-HCl, pH 8.0, 50 mM EDTA, 20% Triton X-100, 8 M Urea, and 1 Â protease inhibitor Cell survival assays. For survival assays, cells were seeded at the density of cocktail). 5 2 Â 10 cells per well in six-well plates in culture medium (2 ml) containing fetal Tissues were weighted and grinded in a quantity of lysis buffer according to bovine serum (FBS). After 24 h, cells were washed twice with PBS and then weight. All samples were subjected to SDS–PAGE and then transferred to incubated in serum-free medium. After 8 days, the cells were collected and the nitrocellulose membranes followed by incubating with antibodies against TUSC2 viable cells were counted after Trypan blue staining. (Abcam, Ab70182), TIMP2 (Abcam, Ab1828) or TIMP3 (Abcam, Ab58804) at a For Annexin V apoptosis assays, the cells were grown in low serum (1%) or dilution of 1:500 at 4 °C overnight. Appropriate secondary antibodies were used at serum-free medium for 5 days. The cells were separately washed twice with cold 1:2,000 dilutions to incubate with the membranes at room temperature for 2 h. PBS and stained with binding buffer containing fluorescein-labelled Annexin V After detection of the protein bands, the blots were stripped and reprobed with and with propidium iodide (PI; APC Annexin V Apoptosis Detection Kit I, BD mouse monoclonal antibody against b-actin (A5316, Sigma) to confirm equal Pharmingen) following manufacturer’s instructions. The cells that were positive for sample loading. After secondary antibody incubation, the blot was washed and apoptosis (APC annexin V positive, PI negative or APC annexin V positive, PI detected using ECL kit (Millipore) in autoradiography. Representative full-gel bots positive) were analysed by flow cytometry. are provided in the Supplementary Information (Supplementary Fig. S9).

Cell migration Cells (3 Â 105) were seeded in each well of a six-well plate. The cell . Luciferase activity assays. Luciferase activity assays were performed using a cultures were scratched using a 200-ml pipette tip. The cultures were washed with dual-luciferase reporter system developed by Promega (E1960). In brief, 4T1 cells PBS to remove cell debris and the culture media was replaced with serum-free were seeded onto 24-well tissue culture plates at a density of 3 Â 104 cells per well media. Cell migration was monitored and photographed. Distance travelled from in the medium containing 10% FBS for 24 h. The cells were co-transfected with the the initial scratch site was measured and the migration distance was quantified as luciferase reporter constructs, corresponding miRNA mimics and Renilla luciferase described37. construct by Lipofectamine 2000. The cells were then lysed using 100 ml of passive lysis buffer per well on a shaker for 30 min, and the lysates were centrifuged for Cell invasion. Cell transwell membrane inserts were placed in 24-well plates and supernatant collection. Twenty microlitres of the supernatants was then mixed with coated with 100 ml of Matrigel that had been diluted (1:10-fold). Cells (1 Â 103) 100 ml of LAR II and then firefly luciferase activities were measured using a were placed in serum-free media inside the inserts, while media supplemented with luminometer. For the internal control, 100 ml of Stop & Go reagent was added to 10% FBS was placed at the bottom of the inserts and in the wells of the plates. Cells the samples. Renilla luciferase activities were then measured in the same tube. were incubated at 37 °C and allowed to invade and migrate through the Matrigel Luciferase activities between different treatments were compared after normal- and the membrane pores in the inserts. After 20 h, the upper Matrigel layer and ization with Renilla luciferase activities. The miRNAs were used at a concentration of 100 nM. cells were removed, while the cells on the surface of the lower side of the membrane 0 were fixed and stained. Cells that migrated onto the lower surface were counted For the TUSC2 3 -UTR competition experiments, the same luciferase system from representative areas for quantification. was used. Cell were transfected with 10 mg of luciferase construct containing TIMP2 or TIMP3 30-UTR in each well. The cells were also transfected with TUSC2 30-UTR or the control vector at a concentration of 10 mg plasmid per well. RNA analysis. Expression of the TUSC2 30-UTR or TUSC2P was confirmed by real-time PCR. In brief, total RNA was extracted from cell cultures using the Statistical analysis. The results (mean values ±s.d.) of all experiments were mirVana miRNA Isolation Kit (Ambion) according to the manufacturer’s instruc- subject to statistical analysis by t-test. A P-value o0.05 was considered significant. tions. Real-time PCR was performed as previously described38. The primers for TUSC2 30-UTR were previously used in our lab38. The primers used as the real-time PCR controls were human-U6RNAf and human-U6RNAr. All primer sequences are References provided in the Supplementary Information (Supplementary Fig. S8e). 1. Chendrimada, T. P. et al. TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing. Nature 436, 740–744 (2005). siRNA assays. Three different siRNA sequences complementary to TUSC2P were 2. Hutvagner, G. & Zamore, P. D. A microRNA in a multiple-turnover RNAi used for knocking down TUSC2P: siRNA1: 50-GUGGUUCAGUCCUGUGAUA enzyme complex. Science 297, 2056–2060 (2002). TT-30 and 50-UAUCACAGGACUGAACCACTT-30; siRNA2: 50-GCUGUUGUUU 3. Ye, W. et al. The effect of central loops in miRNA:MRE duplexes on the GCUACUUAATT-30 and 50-UUAAGUAGCAAACAACAGCTT-30; siRNA3: efficiency of miRNA-mediated gene regulation. PLoS One 3, e1719 (2008). 50-GUGGAUGCUUGUGUCUAUATT-30 and 50-UAUAGACACAAGCAUCCAC 4. Lee, D. Y., Deng, Z., Wang, C. H. & Yang, B. B. MicroRNA-378 promotes cell TT-30. The TUSC2P 4T1 cells were seeded at the density of 2 Â 105 cells per well in survival, tumor growth, and angiogenesis by targeting SuFu and Fus-1 six-well plates in 2 ml culture medium containing 10% FBS. Cells were washed expression. Proc. Natl Acad. Sci. USA 104, 20350–20355 (2007). twice with serum-free medium 24 h after the inoculation, followed by transfection 5. Yang, X. et al. An anti-let-7 sponge decoys and decays endogenous let-7 with the three different siRNAs using Lipofectamine 2000 (Invitrogen). The cells functions. Cell Cycle 11, 3097–3108 (2012). were collected by exposure to trypsin 48 h after the transfection and then subjected 6. Shan, S. W. et al. MicroRNA MiR-17 retards tissue growth and represses to various assays. fibronectin expression. Nat. Cell Biol. 11, 1031–1038 (2009).

14 NATURE COMMUNICATIONS | 5:2914 | DOI: 10.1038/ncomms3914 | www.nature.com/naturecommunications & 2014 Macmillan Publishers Limited. All rights reserved. NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3914 ARTICLE

7. Jeyapalan, Z. et al. Expression of CD44 30-untranslated region regulates 29. Kondo, M. et al. Overexpression of candidate tumor suppressor gene endogenous microRNA functions in tumorigenesis and angiogenesis. Nucleic FUS1 isolated from the 3p21.3 homozygous deletion region leads to G1 Acids Res. 39, 3026–3041 (2011). arrest and growth inhibition of lung cancer cells. Oncogene 20, 6258–6262 8. Lee, D. Y. et al. A30-untranslated region (30UTR) induces organ adhesion by (2001). regulating miR-199a* functions. PLoS One 4, e4527 (2009). 30. Uno, F. et al. Myristoylation of the fus1 protein is required for tumor 9. Lee, S. C. et al. A non-coding transcript of nephronectin promotes osteoblast suppression in human lung cancer cells. Cancer Res. 64, 2969–2976 (2004). differentiation by modulating microRNA functions. FEBS Lett. 585, 2610–2616 31. Du, L. et al. miR-93, miR-98, and miR-197 regulate expression of tumor (2011). suppressor gene FUS1. Mol. Cancer Res. 7, 1234–1243 (2009). 10. Linsen, S. E. et al. Limitations and possibilities of small RNA digital gene 32. Poliseno, L. et al. A coding-independent function of gene and pseudogene expression profiling. Nat. Methods 6, 474–476 (2009). mRNAs regulates tumour biology. Nature 465, 1033–1038 (2010). 11. Gebauer, F. & Hentze, M. W. Molecular mechanisms of translational control. 33. Torrents, D., Suyama, M., Zdobnov, E. & Bork, P. A genome-wide survey of Nat. Rev. Mol. Cell Biol. 5, 827–835 (2004). human pseudogenes. Genome Res. 13, 2559–2567 (2003). 12. Mazumder, B., Seshadri, V. & Fox, P. L. Translational control by the 30-UTR: 34. Chin, L. J. et al. A SNP in a let-7 microRNA complementary site in the KRAS 30 the ends specify the means. Trends Biochem. Sci. 28, 91–98 (2003). untranslated region increases non-small cell lung cancer risk. Cancer Res. 68, 13. Nagasaki, H., Arita, M., Nishizawa, T., Suwa, M. & Gotoh, O. Species-specific 8535–8540 (2008). variation of alternative splicing and transcriptional initiation in six eukaryotes. 35. Cesana, M. et al. A long noncoding RNA controls muscle differentiation by Gene 364, 53–62 (2005). functioning as a competing endogenous RNA. Cell 147, 358–369 (2011). 14. Lee, D. Y. et al. Expression of versican 30-untranslated region modulates 36. Fang, L. et al. Versican 30-untranslated region (30-UTR) functions as a ceRNA endogenous microRNA functions. PLoS One 5, e13599 (2010). in inducing the development of hepatocellular carcinoma by regulating miRNA 15. Kahai, S. et al. MicroRNA miR-378 regulates nephronectin expression modulating activity. FASEB J. 27, 907–919 (2013). osteoblast differentiation by targeting GalNT-7. PLoS One 4, e7535 (2009). 37. Shan, S. W. et al. Mature miR-17-5p and passenger miR-17-3p induce 16. Rutnam, Z. J. & Yang, B. B. The non-coding 30 UTR of CD44 induces metastasis hepatocellular carcinoma by targeting PTEN, GalNT7 and vimentin in different by regulating extracellular matrix functions. J. Cell Sci. 125, 2075–2085 (2012). signal pathways. J. Cell Sci. 126, 1517–1530 (2013). 17. Ivanova, A. V. et al. Autoimmunity, spontaneous tumourigenesis, and IL-15 38. Wang, C. H. et al. MicroRNA miR-328 regulates zonation morphogenesis by insufficiency in mice with a targeted disruption of the tumour suppressor gene targeting CD44 expression. PLoS One 3, e2420 (2008). Fus1. J. Pathol. 211, 591–601 (2007). 39. Fang, L. et al. MicroRNA miR-93 promotes tumor growth and angiogenesis by 18. Yang, Q., Yoshimura, G., Mori, I., Sakurai, T. & Kakudo, K. Chromosome 3p targeting integrin-beta8. Oncogene 30, 806–821 (2011). and breast cancer. J. Hum. Genet. 47, 453–459 (2002). 19. Lerman, M. I. & Minna, J. D. The 630-kb lung cancer homozygous deletion Acknowledgements region on human chromosome 3p21.3: identification and evaluation of the resident candidate tumor suppressor genes. The International Lung Cancer We thank Zhaoqun Deng for technical assistance. This work was supported by grants Chromosome 3p21.3 Tumor Suppressor Gene Consortium. Cancer Res. 60, from Canadian Institutes of Health Research (MOP-102635, MOP-111171) to B.B.Y., 6116–6133 (2000). who is the recipient of a Career Investigator Award (CI 7418) from the Heart and Stroke 20. Ji, L. & Roth, J. A. Tumor suppressor FUS1 signaling pathway. J. Thorac. Oncol. Foundation of Ontario. 3, 327–330 (2008). 21. Zhang, X., Yan, G., Diao, Z., Sun, H. & Hu, Y. NUR77 inhibits the expression of Author contributions TIMP2 and increases the migration and invasion of HTR-8/SVneo cells Z.J.R. and W.W.D. performed reverse transcription–PCR, western blotting, luciferase induced by CYR61. Placenta 33, 561–567 (2012). activity and cell functional assays. Z.J.R., W.W.D. and W.Y. performed immunohisto- 22. Anania, M. C. et al. TIMP3 regulates migration, invasion and in vivo chemical staining. Z.J.R. and X.Y. performed tumour formation assays. W.W.D. and tumorigenicity of thyroid tumor cells. Oncogene 30, 3011–3023 (2011). Z.J.R. tested miRNA function and performed competition assays. B.B.Y. designed the 23. Musso, O. et al. In situ detection of matrix metalloproteinase-2 (MMP2) and project and analysed the results. Z.J.R., W.Y. and B.B.Y. wrote the paper. the metalloproteinase inhibitor TIMP2 transcripts in human primary hepatocellular carcinoma and in liver metastasis. J. Hepatol. 26, 593–605 (1997). 24. Ulbrich, S. E. et al. Bovine endometrial metallopeptidases MMP14 and MMP2 Additional information and the metallopeptidase inhibitor TIMP2 participate in maternal preparation Supplementary Information accompanies this paper at http://www.nature.com/ of pregnancy. Mol. Cell Endocrinol. 332, 48–57 (2011). naturecommunications 25. Basu, R. et al. Loss of Timp3 gene leads to abdominal aortic aneurysm Competing financial interests: The authors declare no competing financial interests. formation in response to angiotensin II. J. Biol. Chem. 287, 44083–44096 (2012). 26. Kassiri, Z. et al. Simultaneous transforming growth factor beta-tumor necrosis Reprints and permission information is available online at http://npg.nature.com/ factor activation and cross-talk cause aberrant remodeling response and reprintsandpermissions/ myocardial fibrosis in Timp3-deficient heart. J. Biol. Chem. 284, 29893–29904 (2009). How to cite this article: Rutnam, Z. J. et al. The pseudogene TUSC2P promotes TUSC2 27. Wagatsuma, A. et al. Determination of the exact copy numbers of particular function by binding multiple microRNAs. Nat. Commun. 5:2914 doi: 10.1038/ mRNAs in a single cell by quantitative real-time RT-PCR. J. Exp. Biol. 208, ncomms3914 (2014). 2389–2398 (2005). 28. Zabarovsky, E. R., Lerman, M. I. & Minna, J. D. Tumor suppressor genes on This work is licensed under a Creative Commons Attribution- chromosome 3p involved in the pathogenesis of lung and other cancers. NonCommercial-NoDerivs 3.0 Unported License. To view a copy of Oncogene 21, 6915–6935 (2002). this license, visit http://creativecommons.org/licenses/by-nc-nd/3.0/

NATURE COMMUNICATIONS | 5:2914 | DOI: 10.1038/ncomms3914 | www.nature.com/naturecommunications 15 & 2014 Macmillan Publishers Limited. All rights reserved.