Targeting Eif4a-Dependent Translation of KRAS Signaling Molecules a C Kamini Singh1, Jianan Lin2,3, Nicolas Lecomte4, Prathibha Mohan1, Askan Gokce4, Viraj R

Published OnlineFirst February 25, 2021; DOI: 10.1158/0008-5472.CAN-20-2929

CANCER RESEARCH | MOLECULAR CELL BIOLOGY

Targeting eIF4A-Dependent Translation of KRAS Signaling Molecules A C Kamini Singh1, Jianan Lin2,3, Nicolas Lecomte4, Prathibha Mohan1, Askan Gokce4, Viraj R. Sanghvi1,5, Man Jiang1, Olivera Grbovic-Huezo1, Antonija Burcul6, Stefan G. Stark6,7, Paul B. Romesser8, Qing Chang9, Jerry P. Melchor4, Rachel K. Beyer10, Mark Duggan11, Yoshiyuki Fukase11, Guangli Yang12, Ouathek Ouerfelli12, Agnes Viale13, Elisa de Stanchina9, Andrew W. Stamford11, Peter T. Meinke11, Gunnar Ratsch€ 6,7, Steven D. Leach14, Zhengqing Ouyang15, and Hans-Guido Wendel1

ABSTRACT ◥ Pancreatic adenocarcinoma (PDAC) epitomizes a deadly cancer MET, MYC, and YAP1. These findings contrast with a recent study driven by abnormal KRAS signaling. Here, we show that the eIF4A that relied on an older method, polysome fractionation, and impli- RNA helicase is required for translation of key KRAS signaling cated redox-related genes as eIF4A clients. Together, our findings molecules and that pharmacological inhibition of eIF4A has single- highlight the power of ribosome footprinting in conjunction with agent activity against murine and human PDAC models at safe dose deep RNA sequencing in accurately decoding translational control levels. EIF4A was uniquely required for the translation of mRNAs mechanisms and define the therapeutic mechanism of eIF4A inhi- with long and highly structured 50 untranslated regions, including bitors in PDAC. those with multiple G-quadruplex elements. Computational anal- yses identified these features in mRNAs encoding KRAS and key Significance: These findings document the coordinate, eIF4A- downstream molecules. Transcriptome-scale ribosome footprinting dependent translation of RAS-related oncogenic signaling mole- accurately identified eIF4A-dependent mRNAs in PDAC, including cules and demonstrate therapeutic efficacy of eIF4A blockade in critical KRAS signaling molecules such as PI3K, RALA, RAC2, pancreatic adenocarcinoma.

Introduction

1Cancer Biology and Genetics Program, Memorial Sloan-Kettering Cancer The translation of mRNAs into protein is tightly controlled at the Center, New York, New York. 2The Jackson Laboratory for Genomic Medicine, level of the multisubunit eIF4F initiation complex (1). The eIF4F 0 0 Farmington, Connecticut. 3Department of Biomedical Engineering, University of complex assembles on the 5 cap structure and scans the 5 UTR Connecticut, Storrs, Connecticut. 4David M. Rubenstein Center for Pancreatic (untranslated region) for a translation start site. EIF4A (DDX2) is Cancer Research, Memorial Sloan-Kettering Cancer Center, New York, New the RNA helicase component of the eIF4F translation initiation 5 York. Department of Molecular and Cellular Pharmacology, Sylvester complex and is especially required to initiate translation of mRNAs Comprehensive Cancer Center, Miller School of Medicine, University of Miami, 0 Miami, Florida. 6Computational Biology Department, Memorial Sloan-Kettering with long 5 UTRs that contain highly structured RNA sequences such – Cancer Center, New York, New York. 7Department of Computer Science, as multiple G-quadruplex (GQ) elements (2 4). To some extent this Biomedical Informatics, ETH, Zurich,€ Zurich,€ Switzerland. 8Department of insight enables the predictive identification of eIF4A-dependent Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, New mRNAs. Notably, the NRAS and KRAS genes have predicted GQ- 9 York. Molecular Pharmacology Program, Memorial Sloan-Kettering Cancer forming sequences in their 50UTRs, although the therapeutic impact of Center, New York, New York. 10Cancer Research Technology Program, Frederick 11 this prediction is not known (5, 6). Importantly, the natural compound National Laboratory for Cancer Research, Frederick, Maryland. Tri-Institutional fi Drug Development Initiative, Memorial Sloan-Kettering Cancer Center, New silvestrol binds eIF4A with nanomolar af nity and disables its – York, New York. 12The Organic Synthesis Core Facility, Memorial Sloan-Kettering RNA unwinding activity (7 10). Synthetic analogues of silvestrol Cancer Center, New York, New York. 13Integrated Genomics Operation, Center (e.g., CR-1–31B) have shown promise in models of leukemia and for Molecular Oncology, Memorial Sloan-Kettering Cancer Center, New York, lymphoma (2, 11, 12). In principle, cancers driven by a GQ-controlled 14 New York. Molecular Systems Biology and Surgery, Geisel School of Medicine, oncogene such as KRAS should be susceptible to eIF4A blockade. Dartmouth, Norris Cotton Cancer Center at Dartmouth-Hitchcock, Lebanon, Genomic studies have catalogued the genetic drivers of pancreatic New Hampshire. 15Department of Biostatistics and Epidemiology, School of Public Health and Health Sciences, University of Massachusetts, Amherst, adenocarcinoma (PDAC) and show nearly ubiquitous activation of Massachusetts. KRAS and loss of tumor-suppressor genes p53, p16/INK4A, and SMAD4 (13–17). Activation of mRNA translation is an important Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). biological consequence of KRAS activation. Accordingly, PDACs show increased levels of mRNA translation and mediated through activation Current address for A.W. Stamford: Bridge Medicines, 420 East 70th Street of MAPK, PI3K–AKT–mTOR signals, NRF2, and MYC (18–20). New York, NY 10021. mTORC1/S6K1 signaling activates translation initiation through Corresponding Author: Hans-Guido Wendel, Cancer Biology and Genetics phosphorylating eIF4B, cofactor for eIF4A helicase and enhance Program, Memorial Sloan Kettering Cancer Center, 1275 York Avenue, translation of MYC in pancreatic cancer (21, 22). There have been New York, NY 10065. Phone: 646-888-2526; Fax: 646-422-0197; E-mail: fi [email protected] signi cant advances in therapeutic development against PDAC (23). These include, inhibitors of G12C KRAS mutation (24–26), and Cancer Res 2021;81:2002–14 strategies to cotarget KRAS downstream signaling molecules like doi: 10.1158/0008-5472.CAN-20-2929 (e.g., MAPK, PI3K, mTOR, EGFR, c-RAF; refs. 27–30). Although we 2021 American Association for Cancer Research. have pharmacological inhibitors of the G12C KRAS mutation, this

AACRJournals.org | 2002

Targeting Translation of KRAS Pathway

speciﬁc mutation is present in only 3% of PDACs (24, 25). A recent study mRNA sequencing was done using featureCounts with the annota- reports effect of eIF4A inhibition on mouse PDAC (31). In this study, we tions of the protein coding genes of GRCh37 as input. Only reads explore exactly how eIF4A inhibition affects human PDACs and we aligned to the exonic regions of the protein coding genes were used for measure effects on global and speciﬁc mRNA translation programs. the downstream analysis.

Footprint profile analysis using Ribo-diff Materials and Methods We used Ribo-diff to analyze the translation efficiency (TE) based Cell culture and treatments on the ribosome footprinting and mRNA sequencing data. Genes with Pancreatic cancer cell lines were cultures as per specified by the at least 10 normalized read counts as the sum of RF and RNA ATCC. PANC1 and MiaPaca2 cells were purchased from the ATCC. sequencing data were used as input, which resulted in 10,861 genes PANC1 cells were cultured in DMEM supplemented with 10% FBS in total. Genes with significantly changed TE were defined by the q and penicillin–streptomycin (100 U/mL; 100 mg/mL; all Life Tech- value cutoff equal to 0.001. nologies). MiaPaca-2 cells were cultured in DMEM supplemented with 10% FBS, 2.5% horse serum penicillin–streptomycin (100 U/mL; Motif analysis and GQ prediction 100 mg/mL; all Life Technologies). All the cell lines used were regu- The longest transcript was selected to represent each corresponding Mycoplasma 0 larly tested for contamination using PCR. The IC50 data gene. The 5 UTR sequences of the transcripts were collected for pre- on the panel of cancer cell lines were done in collaboration with dicting motifs. Both the significant genes with increased or decreased TE Tri-Institutional Drug Initiative program at Memorial Sloan Kettering and the corresponding background gene sets were used to predict motifs Cancer Center (MSKCC, New York, NY). by DREME (33). The occurrences of the significant motifs (E < 0.05 and – P < 1 10 8 from DREME) were called using FIMO (33) with default Drugs, inhibitors, and plasmids parameters for strand-specificpredictionofallthe50UTR sequences. Silvestrol was purchased from ChemScene (CS-0543). []CR-1– We used RNAfold (version 2.1.6) to predict the GQ formation in the 31B and []CR-1–31B were synthesized in house at organic chemistry RNA secondary structure with the –g option. The number of different types core at MSKCC and Tri-Institutional Drug Development Initiative at of GQ (GG4, GGG4, and GGGG4) was then calculated by counting MSKCC, respectively. Each was suspended in DMSO for in vitro the number of consecutive “G”s using customized python scripts. experiments and 5.2% Tween 80 5.2% PEG 400 for in vivo experiments. Cycloheximide (C7698) was purchased from Sigma. pLEX-HA-birA- KRAS 50UTR reporter assays K-Ras(G12D)-IRES-Puro was a gift from Paul Khavari (Addgene, Full-length 50UTR of KRAS transcript variant b was cloned in plasmid #120562). MSCV-CMV-dsRed-IRES d1eGFP using Age I and Dra III restriction enzyme sites. This strategy replaced the IRES with the full-length 50UTR Ribosome footprinting of KRAS. For mutant version, we changed the GG pattern in the full- Human pancreatic cancer PANC1 cells were treated with DMSO or length 50UTR of KRAS that disrupted the RNA GQ structure. The []CR-1–31B (25 nmol/L; 45 minutes) followed by cycloheximide clones were validated by PCR sequencing using CMV forward primers treatment for 10 minutes. Total RNA and ribosome-protected frag- and the presence of full-length 50UTR of KRAS (wild-type and mutant, ments were isolated following published protocol (32). Deep sequenc- mentioned below) was confirmed downstream of CMV promoter. ing libraries were generated from these fragments and sequenced on Reporter plasmids were used for transient transfection in 293T cells. the HiSeq 2000 platform. Genome annotation was from the human Destabilized d1eGFP has a half-life of 1 hour and the translation activity genome sequence GRCh37 downloaded from Ensembl public data- driven by respective 50UTRs was measured by d1eGFP intensity using base: http://www.ensembl.org. flow cytometry. The 50UTR sequence for full-length wild-type and mutant version with restriction enzyme sites is provided below. Sequence alignment First, ribosome footprint (RF) reads were filtered on the basis AGE I KRAS 50UTR FOR of the quality score, which kept reads that have a minimum quality CCGGTGGCCGCACCACCACACCCAGCAGCGCGCGCCGCA- score of 25 for at least 75% of the nucleotides. Second, the linker GTACCCGCACCGAGCCTGCCACCGCCGCGCCCCGTGCTCCC- sequence (50-CTGTAGGCACCATCAAT-30) was trimmed from GGCCCCCGCCGTTGCACACTGACAGCGAGCGCACCGCAAC- the 30 end of the reads. Next, we filtered out the reads shorter than CGCTGGAACCACCACCACACCCAGAACCTCAGCACCTCCC- 15nt after the linker-trimming step. All these aforementioned steps AACTGCGGGCGCGCGGCCTGCTGAGAATGCACGTT were done by using FASTX-Toolkit (http://hannonlab.cshl.edu/ 0 fastx_toolkit/index.html). To remove ribosomal RNA, the footprint DRAIII KRAS 5 UTR REV reads were then aligned to the ribosome RNA sequences of GRCh37 GTGCATTCTCAGCAGGCCGCGCGCCCGCAGTTGGGAGGT- downloaded from UCSC Table Browser (https://genome.ucsc.edu/ GCTGAGGTTCTGGGTGTGGTGGTGGTTCCAGCGGTTGCGG- cgi-bin/hgTables). After removing the reads aligned to the ribosome TGCGCTCGCTGTCAGTGTGCAACGGCGGGGGCCGGGAGCA- RNAs, RF reads were mapped to the human genome sequence CGGGGCGCGGCGGTGGCAGGCTCGGTGCGGGTACTGCGGC- GRCh37 downloaded from Ensembl public database: http://www. GCGCGCTGCTGGGTGTGGTGGTGCGGCCA ensembl.org using HISAT2 with default parameters. We only used 0 the uniquely aligned reads for further analysis. AGE I KRAS 5 UTR Mutant FOR Total mRNA-sequencing reads were aligned to the GRCh37 refer- CCGGTGGCCGCGGCGGCGGAGGCAGCAGCGGCGGCGGC- ence using HISAT2. Similarly, as RF reads alignment, we performed AGTGGCGGCGGCGAAGGTGGCGGCGGCTCGGCCAGTACT- the splice alignment for the paired-end mRNA-seq datasets with the CCCGGCCCCCGCCATTTCGGACTGGGAGCGAGCGCGGCGC- default parameters. We only kept the uniquely aligned reads for the AGGCACTGAAGGCGGCGGCGGGGCCAGAGGCTCAGCGGCT- downstream analysis. The alignment quantification for both RF and CCCAGGTGCGGGAGAGAGGC CTGCTGAAACACGTT

AACRJournals.org Cancer Res; 81(8) April 15, 2021 2003

Singh et al.

DRAIII KRAS 50UTR Mutant REV the sucrose gradient was studied by RT-qPCR analysis of the RNA GTGTTTCAGCAGGCCTCTCTCCCGCACCTGGGAGCCGCT- in each of the 12 gradient fractions. GAGCCTCTGGCCCCGCCGCCGCCTTCAGTGCCTGCGCCGC- GCTCGCTCCCAGTCCGAAATGGCGGGGGCCGGGAGTACTG- In vitro eIF4A duplex unwinding assay GCCGAGCCGCCGCCACCTTCGCCGCCGCCACTGCCGCCGCC- To evaluate the eIF4A activity, we have used a fluorescent duplex GCTGCTGCCTCCGCCGCCGCGGCCA unwinding assay as reported in refs. 35 and 36. Briefly, we designed Restriction enzyme sites are shown as underlined. oligo containing 12-mer CGG4 (GQ) motif and (AG)7 repeats labeled CMV Forward Primer-CGCAAATGGGCGGTAGGCGTG with Cy3 on the positive strand and with BHQ (Black Hole Quencher) on the negative strand. We purified human eIF4A1, eIF4H isoform 2, CRISPR–cas9-mediated deletion of KRAS 50UTR and eIF4GD using previously reported study (37). Purified proteins To delete the RNA GQs from KRAS 50UTR, we designed sgRNAs eIF4A and eIF4GD proteins are stored at 80C in storage buffer targeting the genomic regions on KRAS. Each sgRNA was cloned into (20 mmol/L Hepes, pH 7.5, 200 mmol/L KCl, 1 mmol/L DTT) the lenti-CRISPRv2 (Addgene, cat no. 52961) using BsmB I restriction supplemented with 10% glycerol. To maintain stability, purified eIF4H enzyme site. PANC1 cells were cotransfected with sgRNA containing is stored at 80C in storage buffer supplemented with 20% glycerol as plasmids and then selected with puromycin (2 mg/mL) for 24 hours. reported in refs. 35 and 36. We performed the duplex unwinding Selected colonies were expanded for 2 weeks. The deletion was exactly as reported in Ozes and colleagues (35) using eIF4A1 confirmed using PCR primers spanning the KRAS 50UTR region in (10 mmol/L), eIF4H isoform 2 (10 mmol/L), eIF4GD (5 mmol/L) with genomic DNA. The sequence of sgRNA and PCR primers is provided 12 mer (CGG) and (AG)7 repeat oligos (50 nmol/L) in the presence of below. eIF4A inhibitor []CR-1–31B at (50 and 100 mmol/L). Oligo sequences are provided below. sg-1 KRAS-50UTR-50sg1-F: CACCGCTAGGCGGCGGCCGCGGCGG 1. 12 mer (CGG)-Cy3 REV- 50-Cy3-CGGCGGCGGCGG-30 KRAS-50UTR-5sg10-R: AAACCCGCCGCGGCCGCCGCCTAGC 2. 12 mer (CGG)-BHQ FOR-50-GCCGCCGCCGCC-BHQ-30 3. 12 mer (CGG)-Competitor DNA-50-GCCGCCGCCGCC-30 sg-2 4. (AG)7 repeat-Cy3 REV-50-Cy3-AGAGAGAGAGAG-30 KRAS-50UTR-30sg1-F: CACCGCCAGAGGCTCAGCGGCTCCC 5. (AG)7 repeat-BHQ FOR-50-CUCUCUCUCUCU-BHQ-30 KRAS-50UTR-30sg1-R: AAACGGGAGCCGCTGAGCCTCTGGC 6. (AG)7 repeat-Competitor DNA-50-CTCTCTCTCTCT-30

sg-3 Human pancreatic cancer cell line xenografts and PDXs KRAS-50UTR-30sg2-F: CACCGCTCAGCGGCTCCCAGGTGC Human pancreatic cancer MiaPaca-2 cells expressing stable GFP- KRAS-50UTR-30sg2-R: AAACGCACCTGGGAGCCGCTGAGC Luciferase reporter were injected in subcutaneous flank in J:Nu mice (5 million cells per flank). IVIS imaging was performed weekly to monitor PCR primers the tumor growth. When tumors were between 80 and 100 mm3, KRAS 50UTR F2: GACCGCCTCCAGCCTCA Silvestrol (0.5 m/kg) or []CR-1–31B (0.5 mg/kg) or []CR-1–31B KRAS 50UTR R2: AAGAAGAATCGAGCGCGGAA (0.5 mg/kg) was injected in mice intraperitoneally twice a week until the control mice developed fully grown tumors. P values were calcu- Immunoblots lated using two-way repeated measures ANOVA. PDX tumors were Lysates were made using TNN lysis buffer (50 mmol/L Tris-Cl, established by the antitumor facility at MSK under an approved 250 mmol/L NaCl, 5 mmol/L EDTA, 0.5% NP-40 supplemented with Institutional Review Board protocol and were transplanted subcuta- protease inhibitor). 60 mg of protein was loaded onto SDS-PAGE gels neously in nude mice. Once tumors reached 80–100 mm3, the mice were then transferred onto Immobilon-FL Transfer Membranes (Millipore randomized into treatment groups as above. J:nu mice were purchased IPFL00010). The antibodies used were KRAS2B (Proteintech), MYC from The Jackson Laboratory. All animal experiments were performed (Cell Signaling Technology), HRAS (Abcam), ERK (BD Pharmingen), in accordance with regulations from Memorial Sloan-Kettering Cancer p-ERK (p42/44), MET, YAP1, XPO1, DDX6, PARP1, RALBP1, Center’s Institutional Animal Care and Use Committee. PI3KCA, RAC1/2, b-tubulin, GAPDH (Cell Signaling Technology), and b-actin (Sigma A5316). Quantification of Western blot images Orthotopic implantation studies was done by using ImageJ software. The PDA cell line KPC4662 used for orthotopic implantation was obtained from the RH Vonderhide group and previously described (38) Annexin V staining assay and stably transfected with GFP-Luciferase reporter. C57BL/6 mice Human pancreatic cancer cell lines PANC1, were used for annexin were obtained from The Charles River Laboratories. For orthotopic V staining using kit (Invitrogen) and following the manufacturer’s implantation of PDEC, we followed previously described procedure instruction. Annexin V staining was detected by FACS analysis. with some modifications (39). In brief, mice were anesthetized using isoflurane and then the pancreas was exposed through an abdominal Polysome profiling incision (laparotomy). PDAC (2 105 cells/mouse) was suspended in We performed polysome profiling to evaluate the effect of Matrigel (Corning) diluted 1:1 with cold PBS (total volume of 25 mL) []CR-1–31B on global translation and translation of KRAS4B and injected into the tail region of the pancreas using a Hamilton transcript. Briefly, we used polysome lysate from PANC1 cells Microliter Syringe. A successful injection was verified by the appearance treated with DMSO or []CR-1–31B (50 nmol/L) for 1 and 4 hours of a fluid bubble without intraperitoneal leakage. The abdominal wall in duplicates and performed polysome fractionation using a pub- was closed with absorbable Vicryl RAPIDE sutures (Ethicon) and the lished protocol from Panda and colleagues (34). The relative skin was closed with wound clips (Roboz). Mice with luciferase imaging distribution of the percentage of mRNA of KRAS and B2M over diagnosed tumors of volume 50 to 150 mm3 were enrolled and block

2004 Cancer Res; 81(8) April 15, 2021 CANCER RESEARCH

Targeting Translation of KRAS Pathway

randomized into treatment groups. Tumors were visualized and recon- were plated into Matrigel-coated well and precultured for 4 days. structed for quantifying tumor volume using the integrated Vevo 2100 Organoids were then exposed to the drug over a 7-concentration range Workstation software package. The Institutional Animal Care and Use (from mmol/L to sub-nmol/L) or vehicle control for 6 days. Cell Committee at MSKCC approved all animal care and procedures. viability was assessed at day 10 using the Cell Titer-Glo 3D assay (Promega). In vivo therapy dosing For the in vivo application in KPC mouse model of PDAC (PdxCre; Clonogenic survival assay KrasG12D, TP53fl/fl), []CR-1–31B was diluted in 5.2% PEG400 Cells were seeded in 6-well plates (20 103 cells per well) and (Sigma-Aldrich), 5.2% Tween 80 (Sigma-Aldrich), 2% DMSO (Sigma- allowed to adhere overnight in regular growth media. DMSO or Aldrich), and administered intraperitoneally at 0.5 mg/kg, twice a []CR-1–31B (10 nmol/L) was added and refreshed every 3 days week, from d28 to d83. For the in vivo application in PDA cell line until the end of the experiment (14 days). For each independent KPC4662-derived orthotopic tumors in pancreas of C57/Bl mice, experiment, the DMSO or []CR-1–31B–treated cells were fixed in 4% []CR31B was diluted in 5.2% PEG400 (Sigma-Aldrich), 5.2% formaldehyde for 15 minutes at room temperature and subsequently Tween 80 (Sigma-Aldrich), 2% DMSO (Sigma-Aldrich). Vehicle or stained with 0.1% crystal violet and digitalized on an image scanner. All []CR-1–31B was administered at 0.5 mg/kg dose via intraperitoneal experiments were performed at least three times in triplicates and injection on Monday–Wednesday–Friday (3 days a week). For the representative results are shown. in vivo application in MiaPaca-2 cell line–derived xenografts nude mice, silvestrol was diluted in 5.2% PEG400 (Sigma-Aldrich), 5.2% Histology and IHC analysis Tween 80 (Sigma-Aldrich), 2% DMSO (Sigma-Aldrich). Vehicle or Tissue specimens were fixed in 4% buffered paraformaldehyde, silvestrol was administered at 0.5 mg/kg dose via intraperitoneal dehydrated, and embedded in paraffin wax. Formalin-fixed paraffin- injection on Monday–Wednesday–Friday (3 days a week). For the embedded sections of 3 mm were stained with hematoxylin and eosin, in vivo application in human PDAC-derived tumors in nude mice, TUNEL, and Ki-67. Immunohistochemical analysis was done on five []CR-1–31B was diluted in 10% Captisol (Sigma-Aldrich) in sterile samples in each vehicle and drug-treated group by counting number of water. Vehicle or []CR-1–31B was administered at 0.5 mg/kg dose positive tumor cells at 10 high-power field (400) and for Ki-67 via intravenous injection on Monday–Thursday (e.g., twice a week). staining one hot spot area at 400 was selected for each case. Toxicity in all the in vivo treatment experiments was monitored by weight loss and daily clinical observation until the end of the exper- Real-time PCR assay iment. 24 hours after the last test article administration, 4–5 mice in Total RNA was extracted using AllPrep DNA/RNA/Protein Mini each group were sacrificed and clinical chemistry, hematology and Kit (Qiagen 80004). cDNA was made using SuperScript III First- fi – DDC tissue-speci c histopathology were done at autopsy. Strand (Invitrogen 18080 400). Analysis was performed by t. Applied Biosystems TaqMan GeneExpression Assays: Human KRAS Patient-derived ex vivo PDAC organoid culture, treatment, and Hs00364284_g1, Myc Hs00153408_m1, MET Hs01565584_m1, YAP1 read out Hs00902712_g1, XPO1 Hs00185645_m1, DDX6 Hs00898915_m1, The study was conducted under Memorial Sloan-Kettering Cancer and B2M Hs00187842_m1. Center Institutional Review Board approval (MSKCC IRB 15–149 or 06–107) and all patients provided written informed consent before Statistical analysis tissue acquisition. Tissue resections and biopsies from patients with All the results were analyzed with two-tailed t tests unless specified. pancreatic cancer were processed according to protocols previously The significance of motif enrichments was from DREME program described by Boj and colleagues (40, 41), slightly modified to ensure based on the Fisher exact test. The hypergeometric test was performed maximum viable cell recovery and organoid formation efficiency. to test for the significance in the enrichment of the gene overlap in the Briefly, resected tissue or biopsy were minced in less than 1-mm3 Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway. pieces and digested in organoid medium containing collagenase II (2.5 mg/mL) and Rho kinase inhibitor Y-27632 10.5 mmol/L (Selleck Online content Chemicals). Tissue digestion was performed up to 4 hours at 37C. Red Additional Methods, Supplementary display items and source data blood cells were removed by specific lysis with ACK buffer (Gibco). are available in the online version of the article; references unique to After 3 successive wash in PBS and organoid medium, dissociated cells these sections appear only in the online article. were seeded in growth factor reduced Matrigel (BD Biosciences) and The ribosome footprinting and total mRNA sequencing raw and cultured in WNT-driven expansion medium containing: DMEM-F12 processed data were deposited in the NCBI Gene Expression Omnibus Advanced (Gibco), Hepes 10 mmol/L (Gibco), antibiotics 500mg/mL database GSE120159 accession number available at following link. (To (Gibco), Glutamax 2 mmol/L (Gibco), A83–01 0.5 mmol/L (Tocris), review GEO accession GSE120159: Go to https://www.ncbi.nlm.nih. human EGF 50 ng/mL (Peprotech), human FGF10 100 ng/mL (Pepro- gov/geo/query/acc.cgi?acc¼GSE120159 Enter token yhkpamwsn- tech), human Noggin 100 ng/mL (Peprotech), human Gastrin I pinfkt into the box). 10 nmol/L (Sigma), N-acetylcysteine 1.25 mmol/L (Sigma), Nicotin- amide 10 nmol/L (Sigma), B-27 supplement 1X (Gibco), Wnt3A conditioned media 50% (v/v, from Hans Clevers, Hubrecht Institute, Results the Netherlands), R-spondin1 conditioned media 10% (v/v, from The KRAS protein is encoded by two variant transcripts (a and b) Calvin Kuo, Stanford University, Stanford, CA). Organoid lines were and two pseudogenes that do not encode a protein (Supplementary considered established when sustained epithelial proliferation was Fig. S1A). 50UTR sequence of human and mouse KRAS transcripts is maintained over 5 passages (about 3- to 5-week culture). identical as shown by ClustalX alignment (Supplementary Fig. S1A Evaluation of PDAC organoids sensitivity to []CR-1–31B was and S1B). The KRAS4B 50UTR is 192 bp long and computational performed in 384-well plate format. Briefly 2,000 single organoid cells prediction using M-Fold indicates the presence of three highly

AACRJournals.org Cancer Res; 81(8) April 15, 2021 2005

Singh et al.

AB′ ′ Figure 1. The translation of KRAS mRNA depends on the eIF4A helicase. A and B, The 50UTRs of KRAS transcript variants “a” and “b” harbor three highly structured regions (red boxes; subsequent panels refer to variant “b” and KRAS2B). C, Diagram of the KRAS 50UTR translation reporter assay where wild-type (structured) or mutant (unstructured, same length and GC content, sequence in methods) control d1eGFP expression in 293T cells. D, Quantiﬁcation of d1eGFP translation from wild-type or mutant KRAS 50UTR in response to []CR-1–31B (50 nmol/L; 24 hours) or solvent (DMSO). E–H, KRAS, p-ERK, ERK b CD′ protein levels and -actin in PANC1 and Mia- – (%) Paca-2 cells following [ ]CR-1 31B treat- Wild-type ment at indicated doses and time points. I, Schematic diagram showing CRISPR–Cas9 sgRNA pairs used to generate the two deletion mutants of the endogenous KRAS 50UTR in PANC1 cells. J, In parental PANC1 cells, the KRAS protein decreases upon []CR-1–31B treatment (50 nmol/L; top). In cells with 50UTR deletions corresponding to sgRNA ′ pairs sg1-sg2 and sg1-sg3, the KRAS is not affected by []CR-1–31B. MYC protein is equally affected in the parental and KRAS EF 50UTR-deleted PANC1 cells. b-Actin was used as loading control.

IJ ′

′ ′

′

′ ′

structured and potentially GQ-forming regions in the 50UTR of both destabilized eGFP (d1eGFP, T1/2 ¼ 1 hour) is expressed from a KRAS transcripts that are reminiscent of eIF4A-dependent mRNAs CMV promoter and its translation controlled by the KRAS4B 50UTR (Fig. 1A and B; refs. 2, 3, 5, 6). The transcription start site (TSS) can or a mutant 50UTR where predicted GQ structures are disrupted vary within different cell types and tissue (32). We have compared the without changing 50UTR length or GC content (Fig. 1C). []CR-1– TSS in various PDAC cell lines (RNA-seq data reported in GSE dataset 31B is a synthetic analogue of silvestrol synthesized by the J. Porco’s GSE160434) and observed that KRAS variant b (KRAS4B) is the most group at University of Boston and shows nanomolar eIF4A expressed transcript across the nine PDAC cell lines, suggesting that inhibition (2, 11, 12, 31, 42–44). We measured the basal expression the TSS for KRAS is very much stable in these PDAC cell lines. We of d1eGFP driven by KRAS4B 50UTR or a mutant 50UTR in built a KRAS4B 50UTR translation reporter assay to test the eIF4A 293T cells (Supplementary Fig. S1C). Next, we conﬁrmed the half- requirement using the eIF4A inhibitor []CR-1–31B (11). Brieﬂy, life of d1eGFP by adding a pan translation inhibitor cycloheximide.

2006 Cancer Res; 81(8) April 15, 2021 CANCER RESEARCH

Targeting Translation of KRAS Pathway

Both KRAS4B 50UTR or a mutant 50UTR-driven d1eGFP expression tantly, eIF4A dependence of KRAS translation depends on an intact, was reduced to 50% following 1 hour treatment with cycloheximide endogenous KRAS 50UTR. For example, using two pairs of CRISPR (Supplementary Fig. S1D and S1E). In 293T cells, transiently expres- guideRNAs (sgRNAs) we induce KRAS 50UTR deletions sg1–sg2 and sing the KRAS4B 50UTR reporter constructs treatment with []CR-1– sg1–sg3, respectively, that abrogate []CR-1–31B sensitivity and 31B (50 nmol/L) reduces translation of the d1eGFP reporter controlled eIF4A-dependent KRAS translation in PANC1 cells (Fig. 1I and J; by the wild-type KRAS 50UTR by 70% and has little effect on Supplementary Fig. S1H and S1I). Deletion of KRAS 50UTR did not the mutant 50UTR (P < 0.001; Fig. 1D; Supplementary Fig. S1F). affect the protein expression of KRAS, phospho-ERK levels and Consistently, treatment of KRAS mutant PDAC cell lines (PANC1, in mRNA of KRAS in the PANC1 cells (Supplementary Fig. S1J and MiaPaca-2) with different doses of []CR-1–31B (1–50 nmol/L, S1K). Hence, GQ elements in the KRAS 50UTR confer dependence on 72 hours) reduces the KRAS protein levels consistent with reported eIF4A in translation reporter assays and in human PDAC cells. KRAS protein half-life (Fig. 1E–H; ref. 45). EIF4A inhibition resulted Nanomolar concentrations (2–10 nmol/L) of []CR-1–31B inhibit in slight reduction of phospho-ERK levels at 72 hours of []CR-1–31B cell growth in KRAS mutant PDAC and other cancer cell lines – (1 50 nmol/L) treatment (Fig. 1E and F). KRAS mRNA expression indicated by IC50 analysis, PARP1 cleavage, and block colony forma- was not affected by []CR-1–31B (Supplementary Fig. S1G). Impor- tion in human PDAC cell lines (PANC1, MiaPaca-2; Fig. 2A and B;

A BC

′ ′ ′

D E

Figure 2.

Activity of the eIF4A inhibitor []CR-1–31B against PDAC cells and organoids. A, IC50 analysis for []CR-1–31B in a panel of human PDAC cell lines. B and C, Long-term (14 d) colony formation assay from MiaPaca-2 and PANC1 cells with different deletions of KRAS 50UTR in []CR-1–31B (0–10 nmol/L) or DMSO. D, Primary murine PDAC (mKPC1/2) and normal pancreatic duct cell (mNormal1/2) organoids derived from the KPC (Pdx1-Cre; Krasþ/LSL-G12D; Trp53þ/LSL-R172H) mouse model exposed to []CR-1–31B at indicated doses; P value for comparison of PDAC and normal pancreatic organoids. E, Six primary human PDAC organoids exposed to indicated concentrations of []CR-1–31B and assessed for viability. F, Representative images corresponding to human PDAC organoids in E treated as indicated.

AACRJournals.org Cancer Res; 81(8) April 15, 2021 2007

Singh et al.

Supplementary Fig. S2A and S2B). Primary fibroblast lines showed drivers of PDAC, such as MYC, MET, YAP, TGFb1/2, PI3K, and – at least approximately 1,000-fold higher IC50 for [ ]CR-1 31B other proteins involved in RAS signaling (Fig. 3B). KRAS TE was (Supplementary Fig. S2A). Importantly, CRISPR–cas9-engineered reduced by 35% at q ¼ 0.5 whereas MYC TE decreased by 40% at q < KRAS 50UTR deletions (sg1–sg2 and sg1–sg3) are largely (>80% 0.001 (Supplementary Table S2). colonies at 4 and 6 nmol/L []CR-1–31B) able to rescue colony These findings differ from results reported in a recent polysome formation by PANC1 cells under continued []CR-1–31B expo- fractionation study on PDAC cells treated with the same inhibitor (31). sure, indicating that KRAS is a significant target of the drug’saction For example, we do not see the reported changes in the translation of (Fig. 2C). Deletion of KRAS 50UTR in PANC1 cells increased the redox and central carbon metabolism genes (31). A review of the – IC50 for [ ]CR-1 31B to approximately 10 nmol/L compared with published dataset (Supplementary Table S2 in ref. 31) shows that the approximately 6 nmol/L in Cas9-expressing PANC1 control cells polysome fractionation experiment identified exactly two genes (Lag3 (Supplementary Fig. S2C and S2D). Next, overexpression of HA- and Tmcc2!) whose translation was significantly (q < 0.05) reduced BirA-K-RAS4B (G12D) in PANC1 cells rescued the cell death upon eIF4A inhibition. Other genes implicated in the study as eIF4A induced by []CR-1–31B. We observed only 30% inhibition in cell targets are shown with significance values as high as q ¼ 0.25 and in proliferation at the highest dose of []CR-1–31B (10 mmol/L) some instances q ¼ 0.45 are chosen on the basis of the manual analysis. in PANC1 cells with ectopic expression of KRAS4B (G12D; Most likely this reflects poor inter-sample reproducibility of manual or Supplementary Fig. S2E). Although the []CR-1–31B treatment instrumental separation of heavy and light polysome fractions using inhibited the endogenous KRAS4B protein, it did not affect the this older methodology. ectopic expression of HA-BirA-KRAS4B(G12D) as determined by We confirmed the effects on protein levels for KRAS and several the Western blot analysis (Supplementary Fig. S2F). []CR-1–31B targets across identified with as highly significant cell lines (PANC1, treatment also equally inhibited the MYC protein levels similar to MiaPaca-2), organoids, in PDACs arising in vivo (PdxCre; KrasG12D, the wild-type PANC1 cells (Supplementary Fig. S2F). We observed TP53fl/fl; Fig. 3C–F; ref. 47). []CR-1–31B did not affect the mRNA higher levels of total ERK in PANC1 cells with ectopic expression levels of these targets in PANC1 cells (Supplementary Fig. S3I). We of KRAS4B (G12D) compared with wild-type PANC1 cells but the also validated the effect of []CR-1–31B on global and KRAS trans- p-ERK levels were equally affected by the []CR-1–31B treatment lation by polysome profiling. We observed a significant increase of (Supplementary Fig. S2F). total mRNA in the light molecular weight (LMW; P < 0.05) and Organoid culture more closely models the three-dimensional corresponding reduction in the heavy molecular weight (HMW) tissue organization of tumors that may also affect drug action (40). polysome fraction following []CR-1–31B treatment (50 nmol/L for 1 Here, []CR-1–31B effectively blocked organoid formation from and 4 hours) in PANC1 cells (Supplementary Fig. S3J). KRAS murine KRAS/p53 PDACs (Fig. 2D) and similarly inhibited the mRNA was highly and significantly reduced in the HMW polysome – P < 0.05 growth of primary human PDAC organoids ([ ]CR-1 31B IC50s: fraction ( ) whereas B2M mRNA showed slight reduction in the 0.4–22 nmol/L; 72 hours; Fig. 2E and F). Hence, the silvestrol HMW polysome fraction following []CR-1–31B treatment, indicat- analogue []CR-1–31B kills PDAC cells and the effects are reduced ing that []CR-1–31B selectively target KRAS translation (Supple- upon disruption of the KRAS 50UTR. mentary Fig. S3K and S3L). Next, we evaluated the effect of []CR-1– We performed ribosome footprinting (ribosome profiling) and 31B on the kinetics of KRAS protein degradation. Using cycloheximide deep sequencing (32) in the presence and absence of the eIF4A treatment (1 ng/mL), we observed approximately 40% degradation of inhibitor []CR-1–31B to identify eIF4A-dependent translation. KRAS protein between 4 and 24 hours in PANC1 cells whereas []CR- Briefly, we normalized ribosome-protected RNA fragments (RF 1–31B treatment (50 nmol/L) reduced KRAS protein expression to reads) to the total RNA abundance to isolate changes in TE. We similar extent (40%–50%) in 4–24 hours as observed and quantified by performed ribosome footprinting on three control (DMSO) and Western blotting analysis (Supplementary Fig. S3M and S3N). Both three []CR-1–31B (25 nmol/L)-treated PANC1 samples (Fig. 3A). cycloheximide (1 ng/mL) and []CR-1–31B (50 nmol/L) combined We chose an early time point (45 min) to minimize secondary and showed no significant difference on KRAS protein degradation sug- knockon effects. Read mapping to ribosomal RNAs, noncoding gesting that []CR-1–31B do not affect the half-life of KRAS protein in RNAs, library linkers, and incomplete alignments were removed PANC1 cells (Supplementary Fig. S3M and S3N). An unbiased gene from the analysis (Supplementary Fig. S3A–S3F). Most of the ontology analysis of eIF4A-dependent genes (TE down) further sup- remaining reads range from 25 to 35 nucleotides in length and ported the enrichment (P <1.18E09) of RAS/MAPK pathway genes, map to protein coding genes (Supplementary Fig. S3A–S3F). The including KRAS, RALA, RALBP1, MEK1/2, RAC2, and MYC (Fig. 3G total number of RF reads mapped to exons was 4.1 million in control and H). Together, these findings reveal coordinate translational down- and3.5millionin[]CR-1–31B–treated samples. This corresponds modulation of key KRAS–MAPK–MYC signaling proteins following to 19,821 protein coding genes. Quality control analysis of replicates eIF4A inhibition. showed significant correlations among the replicates with a Pearson Next, we explored these significant and confirmed eIF4A targets for coefficient >0.97 (Supplementary Fig. S3G and S3H). We used the common molecular features. We compared the []CR-1–31B sensi- RiboDiff statistical framework to isolate the effect on mRNA trans- tive (TE down) group of mRNAs with annotated 50UTRs (n ¼ 591), the lation (46). With a very stringent statistical cutoff at q < 0.001 (FDR []CR-1–31B independent (TE up; n ¼ 431) to each other and a <1%), we identified 614 mRNAs whose translation was significantly background list of 623 equally expressed and annotated mRNAs that repressed (TE down: n ¼ 614; q < 0.001), and we also detected a set showed no significant change in their translation (Supplementary of mRNAs showing a relative increase in ribosome occupancy (TE Table S3A–S3C). We noticed that []CR-1–31B–sensitive mRNAs up: n ¼ 456; q < 0.001; Fig. 3B; Supplementary Table S1A and S1B; had significantly longer 50UTRs (TE down vs. Bkg P ¼ 4.0e13; TE Complete dataset at GEO# GSE120159). A full list of genes differ- down vs. TE up P ¼ 3.2e24; Supplementary Fig. S4A). Next, we entially affected on TE by eIF4A inhibitor []CR-1–31B in PANC1 applied the MEME (Motif-Based sequence analysis tool; ref. 48) search cells is provided in Supplementary Table S2. Importantly, we notice tool to investigate sequence elements that were either over- or under- that eIF4A-dependent (TE down) mRNAs included key oncogenic represented in any of the three groups. Comparing the TE down group

2008 Cancer Res; 81(8) April 15, 2021 CANCER RESEARCH

Targeting Translation of KRAS Pathway

A B

FGH

Figure 3. Ribosome profiling identifies the eIF4A-dependent mRNAs in PDAC cells. A, Schematic of the ribosome profiling on PANC1 cells treated with DMSO or []CR-1–31B (25 nmol/L; 45 minutes). Comparison of ribosome-protected sequences and total mRNA isolates the translational efficiency for each mRNA (TE). B, Frequency distribution of the change translation efficiency (TE) in untreated and []CR-1–31B–treated PANC1 cells. Using the indicated statistical cutoffs, we identify mRNAs with decreased (TE down, red) and increased (TE up, blue) and unchanged translation (background, gray); three biological replicates; the most significantly affected genes are indicated on each side. C–F, Immunoblot on lysates for PANC1 (C), MiaPaca-2 (D), KPC-4622 (E), and human PDAC organoid (F) treated with CR-1–31B and probed for the indicated proteins. b-Tubulin and GAPDH were used as loading control; mRNA levels of PANC1 in Supplementary Fig. S3I. G, GSEA KEGG pathway analysis of eIF4A-dependent (TE down) genes. H, Key proteins in the KRAS and MAPK pathways are sensitive to eIF4A inhibition in PDAC cells (marked with black star).

with TE up and background lists, we identify one significantly over- GQ-forming sequences whereas the 9-mer motif (CCGCCGCCG) represented 12-mer sequence (CGGCGGCGGCGG) and two 9-mer did not coincide with the GQ sequences (Fig. 4B). 36% of the TE motifs (CGGCGGCGG and CCGCCGCCG; P ¼ 3.8e10; P ¼ down transcripts contains GQ sequences their 50UTR in whereas 1.6e14; and P ¼ 1.1e8, respectively; Fig. 4A; Supplementary only 19% and 23% of the TE Up and background genes harbor GQ Table S4). We observed no significant enrichment or depletion of sequences, respectively (Fig. 4C). Consistently, we found that sequences/motifs in the coding or 30UTR sequences. We also per- 50UTR GQ sequence elements were highly significantly (P < formed a separate search for differentially represented structural 0.0001) associated with changes in TE across the transcriptome elements using RNAfold program. This search identified an enrich- upon eIF4A inhibition (Fig. 4D). A swimmer plot illustrates how ment of predicted RNA GQ structures (sequence: GGX4) in the thenumberofGQelementsper50UTR corresponds to the degree of 50UTRs of eIF4A-dependent (TE down) genes compared with the translational repression []CR-1–31B treatment, indicating a dos- background genes (P ¼ 8.4e7) and TE up genes (P ¼ 3.8e9); other age effect (Fig. 4E). We also mapped the relative position and potentially GQ forming sequences (GGGX4 and GGGGX4), TOP number of GQ sequence elements in the 50UTR of key oncogenes motif, IRES, uORFs, pyrimidine-rich translation element, and putative using QGRS mapper and a stringent cutoff (QGRS score >20); for fi eIF4A-binding sites [GAAG (AG)3 repeats] were too infrequent to example, the algorithm identi es three GQ sequence elements in the detect changes in their representation between groups (Supplementary KRAS 50UTR, four in MYC, five in RALBP1, four in PI3K, four in Fig. S4B and S4C). Next, the 12-mer sequence (CGGCGGCGGCGG) HRAS, and seven in YAP1 (Fig. 4F). Again, our findings are in stark and the 9-mer motif (CGGCGGCGG) significantly overlapped with contrast with Chan and colleagues (31) that report effects on short

AACRJournals.org Cancer Res; 81(8) April 15, 2021 2009

Singh et al.

A Bits Bits Bits

BCF′

D E 1,015]

4,000]

GH I

′ ′ ′

Figure 4. CR-1–31B impairs the translation of RNA G-quadruplex containing mRNAs in PDAC. A, An unbiased search for signiﬁcantly enriched sequences (TE down vs.

background and TE up; search across the entire coding sequence) identifies a 12-mer (CGG)4 and two 9-mer (CGG)3 and (CCG)3 sequences as significantly enriched motifs that correspond to GQ forming sequences (significance for GQ motifs: p12mer ¼ 3.8e10, p9mer ¼ 1.6e14,andp9mer ¼ 1.1e8). B, Analysis showing overlap

between 12-mer (CGG)4 and two 9-mer (CGG)3 and (CCG)3 sequences with predicted GQ structure forming sequences in the TE down group of transcripts. C, The percentage of transcripts containing predicted GQ structure forming motifs in TE down, TE up, and background. D, Frequency distribution analysis across the TE range shows that transcripts with 50UTR GQ motifs are more sensitive to []CR-1–31B–mediated inhibition compared with the transcripts without 50UTR GQ sequences. E, Swimmer plot shows a reduction (fold change) in TE upon []CR-1–31B treatment corresponds to the number of 50UTR GQ sequences, suggesting a dosage effect. F, Diagram of the 50UTRs of key eIF4A-dependent mRNAs, indicating the presence of GQ sequences (red stars). G, Schematic of an eIF4A duplex unwinding assay that accounts for the sequence-speciﬁc unwinding activity of eIF4A using a Cy3/BHQ-labeled RNA duplex probe. H, eIF4A duplex unwinding assay using 12-mer (CGG)4 oligomers in RNA GQ folding conditions with DMSO or []CR-1–31B at the indicated doses and time points. I, eIF4A duplex unwinding assay with

oligomers encoding the putative eIF4A-binding site (AG)7 with DMSO or []CR-1–31B at the indicated doses and time points.

and unstructured 50UTRs, instead we find that long and highly such that unwinding results in an increased Cy3 signal (Fig. 4G). structured 50UTRs are highly enriched among eIF4A-dependent ATP addition results in activation of 12-mer CGG4 (GQ) motif mRNAs. unwinding that is blocked by the eIF4A inhibitor []CR-1–31B We directly tested unwinding by the eIF4A helicase in the presence (pvehicle vs. []CR-1–31B ¼ 0.0001; Fig. 4H). On the other hand, – fi – and absence of the inhibitor ([ ]CR-1 31B) in a sequence-speci c [ ]CR-1 31B led to increased unwinding of the (AG)7 sequence manner. Briefly, we used an in vitro duplex unwinding assay using the (pvehicle vs. []CR-1–31B < 0.001), potentially consistent with reports of purified initiation factors (eIF4A, eIF4H, eIF4G and ATP) to rocaglamide increasing eIF4A’saffinity ubiquitous and AG-rich measure resolution of the 12-mer CGG4 (GQ) motif, and we used sequences (Fig. 4I; refs. 7, 49). Hence, []CR-1–31B inhibits the fi a ubiquitous (AG)7 that has been proposed as preferred eIF4A-binding eIF4A helicase activity in a sequence-speci c manner on 12-mer sequence (35), as a control. The assay uses duplex probes labeled with CGG4 (GQ) sequence motif that are also highlighted in our ribosome Cy3 on the positive strand and with BHQ on the negative strand profiling data.

2010 Cancer Res; 81(8) April 15, 2021 CANCER RESEARCH

Targeting Translation of KRAS Pathway

ABC

DEF

GHI

JKLM

Figure 5. In vivo safety and efficacy of eIF4A inhibitors in PDAC models. A, Genetically engineered mouse model of PDAC. Kaplan–Meier survival analysis comparing overall survival of KPC (PdxCre;KrasG12D, TP53fl/fl) mouse treated with []CR-1–31B (0.5 mg/kg twice a week intraperitoneally; n ¼ 5) or vehicle (n ¼ 7) starting at 4 to 5 weeks of age and followed for disease progression and death. B–D, Orthotopically engrafted KPC mouse PDAC cells (KPC-4662) in the pancreas of immune- competent C57/B6 animals and treated with []CR-1–31B (0.5 mg/kg, i.p, twice a week, d1-d42) or vehicle. B, Luciferase imaging. C, Representative hematoxylin and eosin (H&E) and Ki-67 stains on KPC tumors following []CR-1–31B treatment (d42). D, Animal weights following []CR-1–31B (0.5 mg/kg, i.p, twice a week, d1-d42) or vehicle treatment. E, KRAS, p-ERK, ERK protein levels and b-actin in orthotopically engrafted KPC tumors treated with []CR-1–31B (0.5 mg/kg, i.p, twice a week, d1-d42) or vehicle at day 42. F, ImageJ quantification of KRAS, MYC, PI3K, and YAP1 protein levels normalized to b-actin (as in E). G–L, Human PDAC PDX implanted subcutaneously in NSG mice and treated with []CR-1–31B (0.5 mg/kg twice a week intravenously) or vehicle after tumors formed (80 mm3) from day 22 until day 54; G, Tumor volume curve. P value compares []CR-1–31B and vehicle-treated cohorts (n ¼ 5 per group). H, Kaplan–Meier survival analysis comparing overall survival of mice harboring tumor volume >2,000 mm3 in vehicle-treated (n ¼ 10) and []CR-1–31B–treated animals (n ¼ 13). I, Tumor histology (hematoxylin and eosin and Ki-67 stains) on PDX tumors harvested after last treatment. J, Immunoblot on PDX lysates probed for KRAS, MYC, p-ERK, and ERK 24 hours after last treatment (vehicle or []CR-1–31B). K and L, ImageJ quantification of KRAS and MYC protein levels normalized to b-actin. p-ERK was normalized to total ERK (as in J). M, Animal weights indicate tolerability of []CR-1–31B treatment (as in G).

AACRJournals.org Cancer Res; 81(8) April 15, 2021 2011

Singh et al.

Chan and colleagues report activity of an eIF4A inhibitor against in []CR-1–31B-treated MiaPaca-2 bearing animals (0.5 mg/kg, i.p., mouse PDAC (31) and we are pleased to confirm and expand the twice a week, n ¼ 5/8, P < 0.0012; Supplementary Fig. S5Q). therapeutic benefitinthesameKPCmodelandalsoinhuman PDAC tumors. Briefly, in murine KPC tumors we observe an increase in median overall survival from 49 days (control) to 69 days Discussion upon treatment with []CR-1–31B (0.5 mg/kg, i.p., twice a week, Our findings provide new insight into the therapeutic utility and the d28–d83 n ¼ 7/5, P < 0.02 log-rank Mantel-Cox test; Fig. 5A). mechanism of eIF4A inhibitor treatment. Using ribosome footprinting In orthotopically engrafted KPC tumors engineered to express on human PDAC cells, we find that genes with long- and highly luciferase, responses were more varied and []CR-1–31B (0.5 mg/kg, structured 50UTRs depend on eIF4A for their translation. These i.p., twice a week, d10–d42) induced responses in 3 out of 5 animals, include important KRAS signaling molecules such as RALA, RALGDS, whereas control animals uniformly succumbed to PDAC (n ¼ 5, RAF, RAC, PI3K, RALBP1, and MYC, whereas KRAS itself falls just pvehicle vs. CR-1–31B < 0.01; Fig. 5B; Supplementary Fig. S5A and S5B). outside our stringent statistical criteria and is still affected in protein Histology showed a cytostatic effect with loss of proliferation (Ki-67 studies. Consistent with our previous findings in T-cell leukemia, we positive; Fig. 5C; Supplementary Fig. S5C), animal weights, blood, notice that many eIF4A-dependent mRNAs harbor sequence elements and platelet counts were unchanged, indicating tolerability in mice that are predicted to fold into secondary, noncovalent GQ struc- (Fig. 5D; Supplementary Fig. S5D–S5F). Expression of KRAS, tures (2). Inserting GQ sequences confers eIF4A dependence in MYC, PI3K, and YAP1 was significantly reduced in orthotopically translation reporter and helicase assays. Conversely, removing them engrafted KPC tumors treated with []CR-1–31B (0.5 mg/kg, i.p., from the endogenous KRAS gene reduces the eIF4A requirement. twice a week, d10–d42) compared with vehicle-treated tumors as However, it is not clear to what extent these sequences exist in a stably observed by Western blotting and quantification (P < 0.05; Fig. 5E folded state in cells. For example, one RNA sequencing-based method and F). suggested that GQ elements are largely unstructured in cells (50), We further find that the eIF4A inhibitor has single-agent activity another method (rG4-seq) indicates that they are structured, and a against human PDACs. Specifically, we purified the active [] enan- third, antibody-based method, also detects abundant GQ structures in tiomer of CR-1–31B. We treated a primary, patient-derived PDX cells (51, 52). Our study does not directly address this question, model of PDAC transplanted into the flanks of five nude mice although consistent and unbiased identification of GQ sequences in 3 once tumors had reached a volume of approximately 80 mm (dosing eIF4A-dependent RNAs and functional evidence consistently support schedule: []CR-1–31B, 0.5 mg/kg, i.v., twice a week from d22–d54). a role for GQ elements in eIF4A dependence. By contrast, ubiquitous We observed a significant delay in human PDX growth during the AG-rich sequences that act as accessible sites for eIF4A binding (49) do treatment period, although tumors resumed growth when treatment not confer eIF4A dependence and may act to sequester eIF4A. was stopped, potentially indicating the need for combination therapies Ribosome profiling has emerged as the experimental standard to (pvehicle vs. []CR-1–31B < 0.03, n ¼ 5; Fig. 5G). When tumors in either precisely map and measure ribosome occupancy across the transcrip- 3 group reached a size of approximately 2,000 mm animals were tome and provides a surrogate measure for mRNA translation into euthanized and we considered this as an endpoint for a survival protein (53). The previous polysome fractionation method relied on analysis. Notably, []CR-1–31B treatment of tumor-bearing animals manual separation of heavy and light polysome fractions from sucrose significantly increased the median overall survival from 49 days to gradients and suffered low reproducibility. Highlighting these differ- 62 days (0.5 mg/kg i.v., twice a week, n ¼ 10 in vehicle group, n ¼ 13 in ences, our findings differ strongly from a recent polysome study on treated group, Kaplan–Meier analysis: P < 0.0001 Log-rank Mantel- PDAC cells treated with the same eIF4A inhibitor–treated PDAC Cox test; Fig. 5H). Histology showed a striking reduction of prolif- cells (31). The other study by Chan and colleagues ruled out MYC and erating (Ki-67 positive) adenocarcinoma cells (indicated by arrows) KRAS, and instead implicated a number of redox enzymes and central surrounded by tumor stroma (Fig. 5I). We confirmed significant loss carbon metabolism genes, however, using conventional statistical of KRAS, MYC, and phospho-ERK (P < 0.05) whereas total ERK cutoffs (q < 0.05), none of named genes showed a significant difference remained unchanged as shown by immunoblots on lysates of in vivo in the Chan and colleagues study as well as in our study (31). Relying on treated tumors collected from controls or 24 hours after the last these data, the study reports preferential eIF4A effects on genes with []CR-1–31B dosing (Fig. 5J). ImageJ quantification is shown where short and unstructured 50UTRs that contradicts much prior work on the KRAS, MYC protein expression is normalized to b-actin (Fig. 5K). this helicase (54, 55). On the other hand, we happily agree that eIF4A p-ERK is normalized to total ERK (Fig. 5K). As with the racemic inhibition has promising single-agent activity against PDAC in vitro mixture, we found []CR-1–31B was well tolerated without evidence and in vivo (31). A prior study on a different rocaglamide (Infinity’s of drug-related mortality or weight loss (Fig. 5L). Compound 76) showed toxicity and low efficacy and these effects may To enhance reproducibility of these important results, we also tested be specific to that inhibitor (56). Our findings show in vivo efficacy at the natural compound silvestrol and the analogue []CR-1–31B in tolerable dose levels for the CR-1–31B compound in mouse and more widely available PDAC xenograft models. For example, silvestrol human models of PDAC and indicate a therapeutic window in treating (0.5 mg/kg, i.p., twice a week, from d10–d63) caused tumor growth this deadly cancer with this new and exciting class of drugs. arrest in MiaPaca-2 xenografts in nude mice by luciferase imaging, and ex vivo tumor weights and volumes (n ¼ 5, P < 0.05; Supplementary Authors’ Disclosures Fig. S5G–S5I). TUNEL stains (24 hours after last dosing) indicated tumor cell apoptosis in silvestrol-treated tumors (Supplementary P.B. Romesser reports grants and personal fees from EMD Serono, as well as fi Fig. S5J and K). Silvestrol was well tolerated without weight loss or personal fees and non- nancial support from Elekta outside the submitted work. fi Y. Fukase reports a patent for WO2019161345A1 issued. G. Yang reports grants from signi cant changes in blood counts (24 hours after last dosing; NCI during the conduct of the study, as well as reports intellectual property rights in – – Supplementary Fig. S5L S5O). [ ]CR-1 31B showed similar tumor Memorial Sloan Kettering Cancer Center and Angiogenex. O. Ouerfelli reports growth delay in this model (Supplementary Fig. S5P), and endpoint intellectual property rights in Jazz Pharmaceutical, MSKCC, Johnson & Johnson, analysis (tumor >2,000 mm3) indicates a significant survival advantage and Y-mAbs Therapeutics, as well as reports ownership, intellectual property rights,

2012 Cancer Res; 81(8) April 15, 2021 CANCER RESEARCH

Targeting Translation of KRAS Pathway

and provision of services in Angiogenex. S.D. Leach reports membership of the Goodwin and the Commonwealth Foundation for Cancer Research; the Center for scientiﬁc advisory board of NYBO Therapeutics and is a co-founder of Episteme Experimental Therapeutics at MSKCC; the Starr Cancer Consortium; the Geoffrey Prognostics. Z. Ouyang reports grants from NIH during the conduct of the study. No Beene Cancer Research Center; David Rubenstein Center for Pancreatic Cancer; disclosures were reported by the other authors. Druckenmiller Center for Lung Cancer Research; a Leukemia and Lymphoma Society (LLS) SPORE grant; and the MSKCC Core Grant (P30 CA008748). H.G. Wendel is a Authors’ Contributions scholar of the Leukemia Lymphoma Society. K. Singh is supported by the Pancreatic Cancer Action Network. G. R€atsch is supported by MSK Core funding. S.D. Leach is K. Singh: Conceptualization, resources, data curation, formal analysis, investigation, supported by NIH grant R01CA204228. E. de Stanchina is supported by NIH U54 visualization, methodology, writing–original draft. J. Lin: Data curation, software, OD020355-01. P.B. Romesser is supported by a K12 CA184746, G. R€atsch is investigation, methodology. N. Lecomte: Investigation, methodology. P. Mohan: supported by the core funding of ETH Zurich.€ Z. Ouyang is supported by NIH Validation, methodology. A. Gokce: Formal analysis. V.R. Sanghvi: Methodology. R35 GM124998. We acknowledge the use of the Integrated Genomics Operation Core M. Jiang: Validation, methodology. O. Grbovic-Huezo: Investigation, methodology. (funded by CCSG, P30 CA08748, Cycle for Survival, Marie-Josee and Henry R. Kravis A. Burcul: Data curation, software, formal analysis. S.G. Stark: Data curation, Center for Molecular Oncology, the Mouse Pharmacology and Organic Synthesis software, formal analysis. P.B. Romesser: Methodology. Q. Chang: Methodology. cores funded by the NCI CCSG, P30 CA08748. We thank G. Sukenick, J. McCauley J.P. Melchor: Writing–review and editing. R.K. Beyer: Investigation, methodology. S. Kargman (Tri-I-TDI), T. Tammela (MSK) for assistance with various part of the M. Duggan: Investigation. Y. Fukase: Methodology. G. Yang: Methodology. study. We thank Dr. Christopher S. Fraser for sharing the human eIF4AI (406 amino O. Ouerfelli: Methodology. A. Viale: Methodology. E. de Stanchina: Investigation, acids), eIF4H isoform 2 (228 amino acids), and eIF4GD (amino acids 682–1166 from methodology. A.W. Stamford: Investigation, methodology. P.T. Meinke: Investi- eIF4GI) expression plasmids. gation, methodology. G. R€atsch: Resources, data curation, supervision. S.D. Leach: Resources, supervision, methodology. Z. Ouyang: Data curation, software, formal analysis, supervision. H.-G. Wendel: Conceptualization, resources, supervision, The costs of publication of this article were defrayed in part by the payment of page writing–original draft. charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Acknowledgments H.G. Wendel is supported by NIH/NCI grants R01CA183876-03, R01 CA207217- 04, R01CA190384-05, P50 CA217694-02, P50 CA192937-04. H.G. Wendel is also Received August 30, 2020; revised December 1, 2020; accepted February 22, 2021; supported by Lymphoma Research Foundation; William H. Goodwin and Alice published ﬁrst February 25, 2021.

References 1. Parsyan A, Svitkin Y, Shahbazian D, Gkogkas C, Lasko P, Merrick WC, et al. 14. Biankin AV, Waddell N, Kassahn KS, Gingras MC, Muthuswamy LB, Johns AL, mRNA helicases: the tacticians of translational control. Nat Rev Mol Cell Biol et al. Pancreatic cancer genomes reveal aberrations in axon guidance pathway 2011;12:235–45. genes. Nature 2012;491:399–405. 2. Wolfe AL, Singh K, Zhong Y, Drewe P, Rajasekhar VK, Sanghvi VR, et al. RNA 15. Waddell N, Pajic M, Patch AM, Chang DK, Kassahn KS, Bailey P, et al. Whole G-quadruplexes cause eIF4A-dependent oncogene translation in cancer. Nature genomes redefine the mutational landscape of pancreatic cancer. Nature 2015; 2014;513:65–70. 518:495–501. 3. Rubio CA, Weisburd B, Holderfield M, Arias C, Fang E, DeRisi JL, et al. 16. Bardeesy N, Morgan J, Sinha M, Signoretti S, Srivastava S, Loda M, et al. Obligate Transcriptome-wide characterization of the eIF4A signature highlights plasticity roles for p16(Ink4a) and p19(Arf)-p53 in the suppression of murine pancreatic in translation regulation. Genome Biol 2014;15:476. neoplasia. Mol Cell Biol 2002;22:635–43. 4. Linder P, Jankowsky E. From unwinding to clamping—the DEAD box RNA 17. Ying H, Dey P, Yao W, Kimmelman AC, Draetta GF, Maitra A, et al. Genetics and helicase family. Nat Rev Mol Cell Biol 2011;12:505–16. biology of pancreatic ductal adenocarcinoma. Genes Dev 2016;30:355–85. 5. Kumari S, Bugaut A, Huppert JL, Balasubramanian S. An RNA G-quadruplex in 18. Castellano E, Downward J. RAS interaction with PI3K: more than just another the 50 UTR of the NRAS proto-oncogene modulates translation. Nat Chem Biol effector pathway. Genes Cancer 2011;2:261–74. 2007;3:218–21. 19. Chio IIC, Jafarnejad SM, Ponz-Sarvise M, Park Y, Rivera K, Palm W, et al. NRF2 6. Miglietta G, Cogoi S, Marinello J, Capranico G, Tikhomirov AS, Shchekotikhin promotes tumor maintenance by modulating mRNA translation in pancreatic A, et al. RNA G-quadruplexes in kirsten Ras (KRAS) oncogene as targets for cancer. Cell 2016;166:963–76. small molecules inhibiting translation. J Med Chem 2017;60:9448–61. 20. Fujita-Sato S, Galeas J, Truitt M, Pitt C, Urisman A, Bandyopadhyay S, et al. 7. Bordeleau ME, Robert F, Gerard B, Lindqvist L, Chen SM, Wendel HG, et al. Enhanced MET translation and signaling sustains K-Ras–driven prolifera- Therapeutic suppression of translation initiation modulates chemosensitivity in tion under anchorage-independent growth conditions. Cancer Res 2015;75: a mouse lymphoma model. J Clin Invest 2008;118:2651–60. 2851–62. 8. Chu J, Galicia-Vazquez G, Cencic R, Mills JR, Katigbak A, Porco JA Jr, et al. 21. Csibi A, Lee G, Yoon SO, Tong H, Ilter D, Elia I, et al. The mTORC1/S6K1 CRISPR-mediated drug-target validation reveals selective pharmacological inhi- pathway regulates glutamine metabolism through the eIF4B-dependent control bition of the RNA helicase, eIF4A. Cell Rep 2016;15:2340–7. of c-Myc translation. Curr Biol 2014;24:2274–80. 9. Sadlish H, Galicia-Vazquez G, Paris CG, Aust T, Bhullar B, Chang L, et al. 22. Holz MK, Ballif BA, Gygi SP, Blenis J. mTOR and S6K1 mediate assembly of the Evidence for a functionally relevant rocaglamide binding site on the eIF4A-RNA translation preinitiation complex through dynamic protein interchange and complex. ACS Chem Biol 2013;8:1519–27. ordered phosphorylation events. Cell 2005;123:569–80. 10. Iwasaki S, Iwasaki W, Takahashi M, Sakamoto A, Watanabe C, Shichino Y, et al. 23. Makohon-Moore A, Iacobuzio-Donahue CA. Pancreatic cancer biology and The translation inhibitor rocaglamide targets a bimolecular cavity between genetics from an evolutionary perspective. Nat Rev Cancer 2016;16:553–65. eIF4A and polypurine RNA. Mol Cell 2019;73:738–48. 24. Ostrem JM, Peters U, Sos ML, Wells JA, Shokat KM. K-Ras(G12C) inhibitors 11. Rodrigo CM, Cencic R, Roche SP, Pelletier J, Porco JA Jr. Synthesis of allosterically control GTP affinity and effector interactions. Nature 2013;503: rocaglamide hydroxamates and related compounds as eukaryotic transla- 548–51. tion inhibitors: synthetic and biological studies. J Med Chem 2012;55: 25. Waters AM, Der CJ. KRAS: the critical driver and therapeutic target for 558–62. pancreatic cancer. Cold Spring Harb Perspect Med 2018;8:a031435. 12. Cencic R, Carrier M, Galicia-Vazquez G, Bordeleau ME, Sukarieh R, 26. Janes MR, Zhang J, Li LS, Hansen R, Peters U, Guo X, et al. Targeting KRAS Bourdeau A, et al. Antitumor activity and mechanism of action of the mutant cancers with a covalent G12C-specific inhibitor. Cell 2018;172:578–89. cyclopenta[b]benzofuran, silvestrol. PLoS ONE 2009;4:e5223. 27. Samatar AA, Poulikakos PI. Targeting RAS–ERK signalling in cancer: promises 13. Cancer Genome Atlas Research Network, Cancer Genome Atlas Research and challenges. Nat Rev Drug Discov 2014;13:928–42. Network. Integrated genomic characterization of pancreatic ductal adenocar- 28. Blasco MT, Navas C, Martin-Serrano G, Grana-Castro O, Lechuga CG, cinoma. Cancer Cell 2017;32:185–203. Martin-Diaz L, et al. Complete regression of advanced pancreatic ductal

AACRJournals.org Cancer Res; 81(8) April 15, 2021 2013

Singh et al.

adenocarcinomas upon combined inhibition of EGFR and C-RAF. 43. Gerard B, Sangji S, O’Leary DJ, Porco JA Jr. Enantioselective photocycloaddition Cancer Cell 2019;35:573–87. mediated by chiral Bronsted acids: asymmetric synthesis of the rocaglamides. 29. Kinsey CG, Camolotto SA, Boespflug AM, Guillen KP, Foth M, Truong A, et al. J Am Chem Soc 2006;128:7754–5. Protective autophagy elicited by RAF!MEK!ERK inhibition suggests a treat- 44. Gerard B, Cencic R, Pelletier J, Porco JA Jr. Enantioselective synthesis of the ment strategy for RAS-driven cancers. Nat Med 2019;25:620–7. complex rocaglate (-)-silvestrol. Angew Chem Int Ed Engl 2007;46:7831–4. 30. Bryant KL, Stalnecker CA, Zeitouni D, Klomp JE, Peng S, Tikunov AP, et al. 45. Shukla S, Allam US, Ahsan A, Chen G, Krishnamurthy PM, Marsh K, et al. KRAS Combination of ERK and autophagy inhibition as a treatment approach for protein stability is regulated through SMURF2: UBCH5 complex-mediated beta- pancreatic cancer. Nat Med 2019;25:628–40. TrCP1 degradation. Neoplasia 2014;16:115–28. 31. Chan K, Robert F, Oertlin C, Kapeller-Libermann D, Avizonis D, Gutierrez J, 46. Zhong Y, Karaletsos T, Drewe P, Sreedharan VT, Kuo D, Singh K, et al. RiboDiff: et al. eIF4A supports an oncogenic translation program in pancreatic ductal detecting changes of mRNA translation efficiency from ribosome footprints. adenocarcinoma. Nat Commun 2019;10:5151. Bioinformatics 2017;33:139–41. 32. Ingolia NT, Brar GA, Rouskin S, McGeachy AM, Weissman JS. The ribosome 47.BardeesyN,AguirreAJ,ChuGC,ChengKH,LopezLV,HezelAF,etal. profiling strategy for monitoring translation in vivo by deep sequencing of Both p16(Ink4a) and the p19(Arf)-p53 pathway constrain progression of ribosome-protected mRNA fragments. Nat Protoc 2012;7:1534–50. pancreatic adenocarcinoma in the mouse. Proc Natl Acad Sci U S A 2006;103: 33. Grant CE, Bailey TL, Noble WS. FIMO: scanning for occurrences of a given 5947–52. motif. Bioinformatics 2011;27:1017–8. 48. Bailey TL, Boden M, Buske FA, Frith M, Grant CE, Clementi L, et al. MEME 34. Panda AC, Martindale JL, Gorospe M. Polysome fractionation to analyze mRNA SUITE: tools for motif discovery and searching. Nucleic Acids Res 2009;37: distribution profiles. Bio Protoc 2017;7:e2126. W202–8. 35. Ozes AR, Feoktistova K, Avanzino BC, Baldwin EP, Fraser CS. Real-time 49. Iwasaki S, Floor SN, Ingolia NT. Rocaglates convert DEAD-box protein eIF4A fluorescence assays to monitor duplex unwinding and ATPase activities of into a sequence-selective translational repressor. Nature 2016;534:558–61. helicases. Nat Protoc 2014;9:1645–61. 50. Guo JU, Bartel DP. RNA G-quadruplexes are globally unfolded in eukaryotic 36. Ozes AR, Feoktistova K, Avanzino BC, Fraser CS. Duplex unwinding and cells and depleted in bacteria. Science 2016;353:aaf5371. ATPase activities of the DEAD-box helicase eIF4A are coupled by eIF4G and 51. Kwok CK, Marsico G, Sahakyan AB, Chambers VS, Balasubramanian S. rG4-seq eIF4B. J Mol Biol 2011;412:674–87. reveals widespread formation of G-quadruplex structures in the human tran- 37. Fraser CS, Berry KE, Hershey JW, Doudna JA. eIF3j is located in the decoding scriptome. Nat Methods 2016;13:841–4. center of the human 40S ribosomal subunit. Mol Cell 2007;26:811–9. 52. Kwok CK, Marsico G, Balasubramanian S. Detecting RNA G-Quadruplexes 38. Winograd R, Byrne KT, Evans RA, Odorizzi PM, Meyer AR, Bajor DL, et al. (rG4s) in the transcriptome. Cold Spring Harb Perspect Biol 2018;10: Induction of T-cell immunity overcomes complete resistance to PD-1 and a032284. CTLA-4 blockade and improves survival in pancreatic carcinoma. 53. Ingolia NT, Ghaemmaghami S, Newman JR, Weissman JS. Genome-wide Cancer Immunol Res 2015;3:399–411. analysis in vivo of translation with nucleotide resolution using ribosome 39. Pylayeva-Gupta Y, Lee KE, Hajdu CH, Miller G, Bar-Sagi D. Oncogenic Kras- profiling. Science 2009;324:218–23. induced GM-CSF production promotes the development of pancreatic neopla- 54. Pelletier J, Graff J, Ruggero D, Sonenberg N. Targeting the eIF4F translation sia. Cancer Cell 2012;21:836–47. initiation complex: a critical nexus for cancer development. Cancer Res 2015;75: 40. Boj SF, Hwang CI, Baker LA, Chio II, Engle DD, Corbo V, et al. Organoid models 250–63. of human and mouse ductal pancreatic cancer. Cell 2015;160:324–38. 55. Sen ND, Zhou F, Harris MS, Ingolia NT, Hinnebusch AG. eIF4B stimulates 41. Gao D, Vela I, Sboner A, Iaquinta PJ, Karthaus WR, Gopalan A, et al. Organoid translation of long mRNAs with structured 50 UTRs and low closed-loop cultures derived from patients with advanced prostate cancer. Cell 2014;159: potential but weak dependence on eIF4G. Proc Natl Acad Sci U S A 2016; 176–87. 113:10464–72. 42. Gerard B, Jones Ii G, Porco JA Jr. A biomimetic approach to the rocaglamides 56. Liu T, Nair SJ, Lescarbeau A, Belani J, Peluso S, Conley J, et al. Synthetic silvestrol employing photogeneration of oxidopyryliums derived from 3-hydroxyflavones. analogues as potent and selective protein synthesis inhibitors. J Med Chem 2012; J Am Chem Soc 2004;126:13620–1. 55:8859–78.

2014 Cancer Res; 81(8) April 15, 2021 CANCER RESEARCH

Targeting eIF4A-Dependent Translation of KRAS Signaling Molecules

Kamini Singh, Jianan Lin, Nicolas Lecomte, et al.

Cancer Res 2021;81:2002-2014. Published OnlineFirst February 25, 2021.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-20-2929

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2021/02/24/0008-5472.CAN-20-2929.DC1

Cited articles This article cites 56 articles, 11 of which you can access for free at: http://cancerres.aacrjournals.org/content/81/8/2002.full#ref-list-1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/81/8/2002. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.