Endonuclease G Initiates DNA Rearrangements at the MLL Breakpoint Cluster Upon Replication Stress

ORIGINAL ARTICLE Endonuclease G initiates DNA rearrangements at the MLL breakpoint cluster upon replication stress

B Gole1, C Baumann1, E Mian, CI Ireno and L Wiesmüller

MLL (myeloid/lymphoid or mixed-lineage leukemia) rearrangements are frequent in therapy-related and childhood acute leukemia, and are associated with poor prognosis. The majority of the rearrangements fall within a 7.3-kb MLL breakpoint cluster region (MLLbcr), particularly in a 0.4-kb hotspot at the intron11-exon12 boundary. The underlying mechanisms are poorly understood, though multiple pathways including early apoptotic signaling, accompanied by high-order DNA fragmentation, have been implicated. We introduced the MLLbcr hotspot in an EGFP-based recombination reporter system and demonstrated enhancement of both spontaneous and genotoxic treatment-induced DNA recombination by the MLLbcr in various human cell types. We identified Endonuclease G (EndoG), an apoptotic nuclease, as an essential factor for MLLbcr-specific DNA recombination after induction of replication stress. We provide evidence for replication stress-induced nuclear accumulation of EndoG, DNA binding by EndoG as well as cleavage of the chromosomal MLLbcr locus in a manner requiring EndoG. We demonstrate additional dependency of MLLbcr breakage on ATM signaling to histone H2B monoubiquitinase RNF20, involved in chromatin relaxation. Altogether our findings provide a novel mechanism underlying MLLbcr destabilization in the cells of origin of leukemogenesis, with replication stress-activated, EndoG-mediated cleavage at the MLLbcr, which may serve resolution of the stalled forks via recombination repair, however, also permits MLL rearrangements.

Oncogene (2015) 34, 3391–3401; doi:10.1038/onc.2014.268; published online 18 August 2014

INTRODUCTION homology-directed single-strand annealing was described as one 13 Rearrangements of the MLL gene (myeloid/lymphoid or mixed- important mechanism inducing MLL aberrations. lineage leukemia) are found in 6–35% of therapy-related acute We and others have previously shown that MLLbcr-specific 1,2 DNA cleavage can occur independently of the chromosomal leukemia and 80% of childhood acute lymphoblastoid 14,15 leukemia.3 These patients have a dismal prognosis with short context. In this work, we introduced a 399-bp segment 2–4 encompassing the MLLbcr hotspot for therapy-related latency after primary disease and poor survival. Particularly – rearrangements7 9 into an (enhanced green fluorescent protein) high, 2–12% lifelong risk of secondary leukemia has been EGFP-based cellular reporter system enabling us to monitor observed with treatments targeting topoisomeraseII and with 5 recombination as a function of cis-acting sequences and trans- alkylating agents. Over 95% of the MLL rearrangements fall within acting proteins in response to treatment.16 Our results elucidate a a 7.3-kb break-cluster region (bcr) ranging from the start of exon9 6 role of EndoG in MLLbcr breakage leading to recombinative to the end of intron11. MLL rearrangements in infants are rearrangements. frequently found at the 3´-end of that region, harboring a 0.4-kb hotspot for therapy-related breakage and rearrangements at the – intron11-exon12 boundary.6 8 RESULTS 4 Although 90% of MLL rearrangements have been attributed MLLbcr promotes recombination to topoisomeraseII-targeting agents,4 the underlying mechanisms are poorly understood. Various other cytotoxic compounds may To understand the genome destabilizing role of the MLLbcr hotspot for treatment-induced rearrangements, we inserted the also break MLL, suggesting that several DNA-cleaving mechanisms 15 – corresponding 399-bp fragment in both orientations (forward might be involved.7 10 Along the same line, downstream stress and reverse) as a spacer into an established EGFP (enhanced signaling rather than direct genotoxic effects were identified as fl 16 7,9 green uorescent protein)-based test system (Akyüz et al. , common denominator of MLL destabilizing compounds. In Supplementary Figure S1A). The resulting constructs (MLLbcr.fwd – particular, early apoptotic DNA fragmentation to large, 50 300 kb and MLLbcr.rev) were transiently introduced into WTK1 and TK6 DNA fragments, which some rare cells undergoing malignant human lymphoblastoid cells carrying mutated and wild-type p53, transformation may repair and survive, was suggested as a respectively, as well as in T47D human mammary carcinoma cells 10 possible cause for therapy-induced rearrangements. This which show the same MLLbcr cleavage patterns after genotoxic DNA fragmentation is executed by apoptotic nucleases—CAD treatments as lymphoblastoid cells.8 For comparison fragments (Caspase-activated Dnase), Endonuclease (EndoG), topoisomera- from the SV40 genome (SV40), a hygromycin-resistance cassette seII, DnaseII and Artemis.11,12 In the repair of the broken MLL, (HR3´), CDKN1A gene (p21) and the RARAbcr (RARαbcr) were

Gynecological Oncology, Department of Obstetrics and Gynecology, University of Ulm, Ulm, Germany. Correspondence: Dr B Gole or Professor L Wiesmüller, Gynecological Oncology, Department of Obstetrics and Gynecology, University of Ulm, Prittwitzstrasse 43, Ulm, Baden-Wuerttemberg 89075, Germany. E-mail: [email protected] or [email protected] 1These authors contributed equally to this work. Received 18 February 2014; revised 2 July 2014; accepted 14 July 2014; published online 18 August 2014 EndoG initiates DNA rearrangements at MLLbcr B Gole et al 3392

Figure 1. Spontaneous and induced recombination frequencies at the MLLbcr spacer. Recombination reporter constructs with MLLbcr spacer in both orientations (forward-fwd/reverse-rev) and control spacers SV40, HR3’, p21 and RARαbcr (fwd/rev) were transiently introduced into cells. (a) Spontaneous recombination frequencies (Recomb.freq.) for MLLbcr spacers were significantly higher than those for control spacers in WTK1, TK6 and T47D cells. Treatments of WTK1 (b) and T47D (c) cells with etoposide and camptothecin increased recombination frequencies for all spacers, while aphidicolin treatment resulted in MLLbcr-specific recombination induction. (d) Aphidicolin treatment increased MLLbcr-specific recombination in HeLa cells. Normalized mean values ± s.d. (n ⩾ 6) are presented (*Po0.05, **Po0.01, ***Po0.001, ****Po0.0001).

inserted in the reporter plasmid and analyzed in parallel. To dependent on this recombinase (Supplementary Figure S1B). exclude potential indirect effects related to differences in These data show that the MLLbcr hotspot is recombination transfection, cell proliferation or lethality, we determined transfec- stimulatory in comparison with other DNA sequences tion efficiencies for each sample and corrected recombination independently of DNA orientation, cell type and p53 status. frequencies individually. Most interestingly, aphidicolin treatment but not exposure In the three cell lines, we measured higher frequencies of to topoisomerase inhibitors resulted in MLLbcr-specific, spontaneous recombination at the MLLbcr spacer in both Rad51-dependent recombination induction. Since we aimed at orientations than at all the other spacers (Figure 1a). Treatment uncovering the mechanisms specific for MLLbcr instability we with the topoisomerase inhibitors etoposide and camptothecin focused on treatment with replication inhibitor aphidicolin. stimulated recombination with all the spacer constructs, whereas aphidicolin (replication inhibitor) treatment resulted in MLLbcr- Replication stress-induced recombination adjacent to the MLLbcr specific recombination stimulation in both lymphoblastoid and is caspase independent breast cancer cells (Figures 1b and c). Since recombination As expected, aphidicolin-treated T47D, WTK1 and HeLa cells frequencies for MLLbcr.fwd and MLLbcr.rev constructs did not accumulated in the G /S phase of the cell cycle, correspondingly fi 1 differ signi cantly, only the forward spacer MLLbcr.fwd was reducing the number of cells in G2/M (Figure 2a, Supplementary analyzed henceforth (termed as MLLbcr). Corresponding analysis Figure S2A). Concomitantly, the number of apoptotic/dying fi in HeLa cells con rmed aphidicolin-mediated enhancement of the (sub-G1) cells was slightly raised (Figure 2b, Supplementary MLLbcr-specific recombination also in these human cervical Figure S2B). Co-treatment of T47D cells with zVAD-fmk pan- carcinoma cells (Figure 1d). Silencing of Rad51 showed that caspase inhibitor decreased the number of sub-G1 cells without efficient aphidicolin-induced recombination of MLLbcr spacer is affecting the cell-cycle distribution. Induction of caspase-mediated

Figure 2. Cellular responses to aphidicolin treatment and caspase inhibition. (a) Aphidicolin treatment increased the G1-/S-phase fraction of T47D cells while significantly decreasing the number of cells in G2 (PI staining). Co-treatment with zVAD-fmk had no effect on the cell-cycle distribution. Aphidicolin treatment of T47D increased the percentage of sub-G1 cells (PI staining) (b) and early apoptotic cells (Annexin-V/PI double staining) (c), while treatment with zVAD-fmk decreased the same. (d) Aphidicolin treatment increased the percentage of T47D cells entering senescence (β-Gal staining) with and without zVAD-fmk co-treatment. (e) Treatment with zVAD-fmk slightly raised the recombination frequency of transiently introduced MLLbcr construct in T47D cells without aphidicolin treatment but not with treatment. Normalized mean values ± s.d. (n ⩾ 6) are presented (*Po0.05, **Po0.01, ***Po0.001). apoptosis by aphidicolin was verified by Annexin-propidium cells were not significantly altered by EndoG silencing iodide (PI) double staining in T47D (Figure 2c). A similar, but (Supplementary Figures S3A and B). statistically not significant trend was also observed in HeLa To validate our results in the chromosomal context, we (Supplementary Figure S2C). Aphidicolin treatment also increased generated HeLa/MLL cells with stably integrated MLLbcr construct. phosphorylation of Chk1, indicating active replication stress PCR characterization of the EGFP-sorted HeLa/MLL cells after signaling (Supplementary Figure S2D). Consistently, we observed aphidicolin treatment and comparison with the cells with no an increase in the appearance of senescent T47D and HeLa cells EGFP signal after treatment and non-treated cells suggests that (Figure 2d, Supplementary Figure S2E). Interestingly, stimulation of homologous recombination and not single-strand annealing is the MLLbcr-specific recombination was comparable in aphidicolin- and predominant pathway of MLLbcr-construct repair after aphidicolin- aphidicolin/zVAD-fmk-treated T47D and WTK1 cells (Figure 2e, induced damage (Supplementary Figure S3C). Also in HeLa/MLL Supplementary Figure S2F). Induction of replication stress by cells EndoG knockdown reduced recombination in both 5-fluorouracil in the presence of zVAD-fmk also resulted in MLLbcr- aphidicolin- and mock-treated cells (Figure 3e). Corresponding specific recombination stimulation in WTK1 cells (Supplementary results were obtained in K562/MLL leukemia cells with stably Figure S2G). Together, these results indicate that replication stress integrated MLLbcr construct (data not shown). An siRNA approach induces caspase-independent MLLbcr-specific recombination as to knockdown EndoG also resulted in decreased recombination of well as apoptosis and/or senescence. the MLLbcr construct after aphidicolin treatment both extra- (T47D cells) and intra-chromosomally (HeLa/MLL cells, Supplementary EndoG is required for MLLbcr rearrangements Figure S3D). Artemis nuclease was also reported to cleave MLLbcr after To test a potential role of apoptotic nucleases, we co-introduced induction of apoptosis,12 however we could not reliably detect the MLLbcr construct and shRNA targeting CAD, DnaseII and knockdown of this nuclease in the T47D cells (not shown). In EndoG into T47D cells (Figure 3a). Additionally, we employed 17 HeLa/MLL cells, the knockdown of Artemis resulted in loss of shRNA against DnaseI, for which MLLbcr is hypersensitive, and MLLbcr-induced recombination in aphidicolin-treated cells, though topoisomeraseI (TopI), which was previously proposed to target 8 no decrease in recombination as seen with EndoG knockdown the MLLbcr. Only EndoG downregulation resulted in decreased fi recombination in mock- and aphidicolin-treated cells (Figure 3b). was detected (Figure 3f). These ndings demonstrate that EndoG The other candidate nucleases either have no role or their is of major importance for replication stress-induced MLLbcr knockdown even augment the process. Treatment of T47D with rearrangements. zVAD-fmk after EndoG knockdown did not alter recombination frequencies (Figure 3c). In HeLa cells, EndoG knockdown again EndoG accumulates in the nucleus and cleaves MLLbcr after diminished MLLbcr-specific recombination, whereby recombina- aphidicolin treatment tion stimulation by aphidicolin was completely lost (Figure 3d). Quantitative immunofluorescence microscopy of HeLa cells Importantly, cell-cycle distribution and viability of T47D and HeLa revealed an increase in nuclear EndoG already within 4 h of

Figure 3. EndoG knockdown and MLLbcr-speciﬁc recombination. (a) Knockdown veriﬁcation. Western blotting was performed to verify knockdown of CAD (shCAD), DnaseII (DnaseII), EndoG (shEndoG) and Artemis (shArtemis), qRT-PCR for TopI (shTopI) and DnaseI (shDnaseI) as compared with controls (ctrl). (b) Knockdown of EndoG but not of CAD, TopI, DNaseI or DNaseII decreased the recombination frequency of transiently introduced MLLbcr construct in both mock- and aphidicolin-treated T47D cells. (c) Co-treatment with zVAD-fmk had no effect on recombination repression by EndoG knockdown in T47D cells. EndoG knockdown also decreased recombination frequencies both (d) for transiently introduced MLLbcr construct in mock- and aphidicolin-treated HeLa cells and (e) for stably integrated MLLbcr construct in mock- and aphidicolin-treated HeLa/MLL cells. (f) Knockdown of Artemis did not decrease the recombination frequency of stably integrated MLLbcr construct in mock- and aphidicolin-treated HeLa/MLL cells, but the recombination induction by the aphidicolin treatment was lost. Normalized mean values ± s.d. (n ⩾ 8) are presented (*Po0.05, **Po0.01, ***Po0.001).

aphidicolin treatment compared with controls (Figure 4a, the endogenous MLLbcr hotspot (Po0.01, n = 8) but not of control Supplementary Figure S4A). Western blot analysis demonstrated sequences after aphidicolin treatment, indicating MLLbcr-specific elevated EndoG protein levels at this and later time points after breakage (Figure 4e). EndoG knockdown increased MLLbcr-specific aphidicolin treatment in total HeLa cellular lysates (5.0-fold band intensities, suggesting protection from spontaneous and increase, P = 0.001, n = 19, representative Figure 4b) as well as in aphidicolin-induced breakage. After etoposide treatment, separate nuclear and cytoplasmic extracts (Figure 4c). Aphidicolin we similarly observed elevated EndoG protein levels and a had no effect on EndoG mRNA levels (data not shown). Consistent protective effect of EndoG knockdown on the MLLbcr integrity with a post-transcriptional mechanism, incubation with MG115 (Supplementary Figure S4B and C). Co-treatment of T47D cells proteasome inhibitor increased EndoG protein 4.3-fold without with aphidicolin and zVAD-fmk did not protect the MLLbcr, an additive effect after concomitant exposure to aphidicolin suggesting caspase-independent breakage (Supplementary (Figure 6e). Figure S4D). To discriminate between EndoG requirement for the primary To show whether EndoG binds genomic DNA under conditions MLLbcr breakage or the subsequent recombination step, I-SceI of MLLbcr rearrangements, chromatin immunoprecipitation was meganuclease, generating targeted breaks within the reporter performed in HeLa/MLL cells. PCR amplification of a sequence DNA, was introduced in T47D cells. Different from spontaneous or upstream of the MLLbcr-spacer (PCR-3, Supplementary Figure S3C) aphidicolin-induced MLLbcr-specific recombination, EndoG knock- showed that anti-EndoG antibody precipitated genomic down did not reduce I-SceI stimulated recombination (Figure 4d). DNA adjacent to the MLLbcr particularly after aphidicolin Genomic PCR analysis revealed 45% decreased amplification of treatment (Figure 4f). Together, these results suggest that

Figure 4. EndoG accumulation and cleavage of the chromosomal MLLbcr.(a) Compared with mock treatment aphidicolin increased the nuclear content of EndoG (red) in HeLa cells (automated quantification of and representative immunofluorescence microscopic images with DAPI stained, blue nuclei). (b) Western blots showing increased EndoG protein content in total cellular lysates of HeLa and (c) in nuclear as well as in cytoplasmic extracts after aphidicolin treatment. (d) EndoG knockdown (shEndoG) decreased the spontaneous, but not I-SceI-induced recombination frequency of transiently introduced MLLbcr construct in T47D cells. (e) Genomic PCR analysis showed that aphidicolin treatment reduced MLLbcr-specific amplification (band intensity), which was prevented by EndoG knockdown in T47D and HeLa cells. (f) Chromosome immunoprecipitation was performed on HeLa/MLL cells with stably integrated MLLbcr construct. PCR analysis of precipitated DNA showed that after aphidicolin treatment, anti-EndoG but not anti-53BP1 antibody precipitated more of the MLLbcr construct-fragment upstream of the MLLbcr spacer (PCR-3). Control DNA was not precipitated with these antibodies. Normalized mean values ± s.d. (n ⩾ 9) are presented (*Po0.05, **Po0.01, ***Po0.001). after aphidicolin treatment EndoG is stabilized, accumulates in both knockdown cell lines confirming a functional effect of the the nucleus, binds the MLLbcr-hotspot DNA and is required for stable ATM and ATR knockdown on cells (Figure 5b). its caspase-independent cleavage, but not its subsequent Genomic PCR indicated an increase in spontaneous MLLbcr recombination repair. breakage in HeLa/shATM and HeLa/shATR versus HeLa/NTsh cells (20–30%, Figure 5c) as well as more pronounced breakage ATM influences nuclear EndoG, MLLbcr breakage and following etoposide treatment (70–100%). After aphidicolin recombination treatment MLLbcr breakage was not altered in HeLa/shATM, We investigated a potential role of the critical DNA-damage but again more pronounced in HeLa/shATR cells. However, response components ATM and ATR18 in signaling upstream of ATR knockdown caused similar breakage of control genomic MLLbcr rearrangements using HeLa/shATM and HeLa/shATR loci (RARA, Figure 5c and MLLintr20, not shown) suggesting cells with stable knockdown of ATM and ATR compared with sequence-independent genome destabilization. Mimicking the HeLa/NTsh control cells (Figure 5a). Western blot analysis of H2AX breakage pattern, MLLbcr-specific reporter recombination was (a substrate of ATM and ATR pathway)19 after aphidicolin increased in HeLa/shATM (Figure 5d) without further treatment showed decreased phosphorylation (γH2AX signal) in stimulation by aphidicolin. In HeLa/shATR cells a general,

Figure 5. MLLbcr breakage, recombination and EndoG accumulation after ATM/ATR knockdown/inhibition. (a) Western blots verified knockdown of ATM and ATR in HeLa/shATM and HeLa/shATR cells compared with control (HeLa/NTsh) cells. (b) Western blots showing increased phosphorylation of γH2AX after aphidicolin treatment in HeLa/NTsh cells. This phosphorylation is decreased in HeLa/shATM and HeLa/shATR cells. (c) Genomic PCR showing differences in MLLbcr-specific amplification in mock-, aphidicolin- and etoposide-treated HeLa/ NTsh, HeLa/shATM and HeLa/shATR cells. (d) Comparison of recombination frequencies for transiently introduced MLLbcr-construct in mock- and aphidicolin-treated HeLa/NTsh, HeLa/shATM and HeLa/shATRcells. (e) Western blot showing EndoG protein contents in total lysates of HeLa/shATM and HeLa/shATR compared with HeLa/NTsh cells. (f) Nuclear EndoG levels in mock- and aphidicolin-treated HeLa/shATM and HeLa/shATR compared with HeLa/NTsh cells (automated quantification of immunofluorescence microscopic images). (g) Genomic PCR showing that co-treatment with KU55933 prevented the aphidicolin-induced decrease in MLLbcr-specific amplification in HeLa cells without an additional protective effect after EndoG knockdown. (h) Co-treatment with KU55933 increased the recombination frequency of transiently introduced MLLbcr construct in mock- and aphidicolin-treated HeLa cells. (i) In HeLa/MLL cells with stably integrated MLLbcr construct, loss of recombination induction by aphidicolin treatment was observed after KU55933 exposure. (j) In HeLa cells co-treatment with VE-821 had no effect on recombination of transiently introduced MLLbcr construct in mock- and aphidicolin-treated cells, while treatment with NU7441 increased the recombination frequency in mock-treated cells. Normalized mean values ± s.d. (n ⩾ 8) are presented (*Po0.05, **Po0.01, ***Po0.001).

Figure 6. RNF20 knockdown, MLLbcr breakage, recombination and EndoG accumulation. (a) RNF20 knockdown by siRNF20 as compared with control siRNA in HeLa cells was verified by qRT-PCR. (b) Genomic PCR showing that RNF20 silencing prevented the aphidicolin-induced decrease in the MLLbcr-specific amplification in HeLa cells. (c) Silencing of RNF20 decreased the recombination frequency of stably integrated MLLbcr construct in aphidicolin-treated HeLa/MLL cells leading to loss of recombination induction by aphidicolin. (d) Silencing of RNF20 decreased the recombination frequency of transiently introduced MLLbcr construct in aphidicolin-treated HeLa cells but the recombination induction by aphidicolin was not lost. (e) Western blot showing that EndoG protein in total lysates of HeLa cells was increased by aphidicolin, MG115 single treatment or co-treatment and RNF20 silencing with or without treatments. Normalized mean values ± s.d. (n = 9) are presented (*Po0.05, **Po0.01). non-significant trend toward higher recombination frequencies recombination neither in aphidicolin- nor in mock-treated HeLa was observed. cells (Figure 5j). Since ATR can compensate ATM deficiency and Western blot analysis demonstrated 2.1-fold EndoG protein shares central signaling components with ATM,19,20 we also accumulation in total cellular lysates of HeLa/shATM but not HeLa/ inhibited both kinases simultaneously by caffeine but obtained shATR cells (Po0.05, n = 11, Figure 5e). Immunofluorescence similar results as with ATM-specific inhibition (data not shown). microscopy demonstrated accumulation of EndoG protein in We also checked involvement of DNA-PK kinase implicated in HeLa/shATM nuclei without a further increase after aphidicolin non-homologous end-joining repair. Co-treatment with DNA-PK treatment (Figure 5f). ATR knockdown slightly raised nuclear inhibitor NU7441 had no effect on aphidicolin-induced recombi- EndoG levels in both mock- and aphidicolin-treated cells. nation of the transient MLLbcr construct in HeLa cells (Figure 5j). Altogether these experiments showed that ATM knockdown The increased recombination in mock-treated cells suggests that induced MLLbcr breakage, recombination and nuclear EndoG spontaneous breaks which might be repaired via NHEJ are accumulation similarly as after aphidicolin treatment. ATR knock- redirected to homology-directed repair after DNA-PK inhibition. down retained aphidicolin-inducible MLLbcr-specific recombination and nuclear EndoG accumulation but showed proneness to RNF20 knockdown protects the MLLbcr from breakage despite non-specific genomic DNA breakage. EndoG stabilization To more specifically address the role of the ATM kinase activity, we applied an ATM-specific pharmacological inhibitor (KU55933). Recently, it was reported that EndoG interacts with histone H2B, which is modified following DNA damage by RNF20 Different from ATM knockdown KU55933 treatment of HeLa 21–23 protected against aphidicolin-induced genomic MLLbcr breakage, monoubiquitinase. RNF20 silencing in HeLa and HeLa/MLL but had no additive effect after EndoG knockdown (Figure 5g). cells was accomplished by transfection of specific siRNAs Similar to ATM knockdown KU55933 treatment resulted in (Figure 6a, Supplementary Figure 5A). Genomic PCR revealed a increased MLLbcr-specific recombination. Interestingly, MLLbcr- RNF20 knockdown-mediated decrease in MLLbcr breakage after specific recombination was further stimulated by aphidicolin in aphidicolin treatment in HeLa cells (Figure 6b). RNF20 silencing the transient reporter assay in HeLa cells (Figure 5h) but not resulted in loss of the aphidicolin-mediated induction of with chromosomally integrated MLLbcr-construct in HeLa/MLL recombination of stably integrated (Figure 6c, Supplementary (Figure 5i), suggesting that the ATM kinase activity has a role Figure 5B), but not of the transiently introduced MLLbcr construct, in chromosomal MLLbcr rearrangements following aphidicolin though a 10% decrease in recombination was observed also in the treatment. latter (Figure 6d). Western blot analysis of total cellular lysates Application of an ATR-specific inhibitor (VE-821) on the other revealed a similar increase in EndoG protein after RNF20 knock- hand resulted in no significant differences in MLLbcr-specific down as found after MG115 or aphidicolin treatment (Figure 6e).

© 2015 Macmillan Publishers Limited Oncogene (2015) 3391 – 3401 EndoG initiates DNA rearrangements at MLLbcr B Gole et al 3398 Co-treatment with aphidicolin and MG115 and concomitant breakage was caspase independent, supporting the caspase- RNF20 knockdown had no additional effect. These results suggest independent role of EndoG. It is conceivable that the individual that even though RNF20 knockdown elevates the EndoG level contributions of caspase-independent EndoG and caspase- independently of aphidicolin treatment, it concomitantly reduces dependent nucleases in MLLbcr breakage vary not only between MLLbcr breakage and recombination in replication-stressed cells. treatments but also between cell types, as big differences in EndoG protein levels have been described across different tissue types.32 DISCUSSION EndoG was described as a mitochondrial protein, translocating With increasing numbers of patients and introduction of novel to the nucleus upon apoptotic stimuli and senescence-associated therapies, the total numbers of cancer survivors are increasing by cell death.29,33,34 We found elevated EndoG protein levels in and 3% annually,24 making secondary leukemia a potentially increas- outside HeLa nuclei after aphidicolin treatment at the time point ing problem. Understanding the causes and mechanisms of MLL of maximal MLLbcr cleavage. We detected some nuclear EndoG rearrangements is therefore essential to better predict and already without exogenous stress, as already reported for prevent them and to identify the targets for potentially protective S. cerevisiae30 and murine B cells.35 Similar to a preceding report treatments. The proposed mechanisms leading to therapy- involving HeLa cells exposed to oxidative stress36 we found EndoG induced MLL breakage and rearrangements involve either direct protein stabilization upon aphidicolin treatment. EndoG presence topoisomerase-mediated cleavage due to pharmacological in the nucleus before stress implies a function beyond the enzyme inhibition or apoptotic DNA fragmentation due to apoptotic program. EndoG was reported to participate in class- cytostatic treatment.5,7,10,25 Here, we newly describe an essential switch recombination during B-cell maturation.35 Of particular role of EndoG in replication stress-induced MLLbcr destabilization. relevance for our work, low-level fork stalling is detectable in We focused on mechanisms leading to therapy-induced MLL replicating cells even under physiological conditions.37 It may rearrangements by integrating a 0.4-kbp fragment from the explain basal nuclear EndoG levels, because our data indicate a MLLbcr hotspot for rearrangements at the intron11-exon12 role of basal EndoG in initiating spontaneous, that is, replication- boundary7–9 as a spacer sequence in the EGFP-based recombina- associated MLLbcr-specific recombination. tion test system.16 Independently of sequence orientation, cell Aphidicolin treatment causes replication fork stalling, known to type or p53 status, the MLLbcr spacer induced higher recombina- trigger ATR signaling for stabilization and resolution of the forks.18 tion frequencies compared with other sequences, which was in ATR knockdown by itself induces replication stress particularly at agreement with our previous findings utilizing a SV40-based test replication fragile sites involved in recurrent amplifications/ system.15 Recombination was stimulated by the topoisomeraseII- deletions.38 Consistent with exacerbated replication stress after inhibitor etoposide as previously reported,7,9,10,15 by the aphidicolin treatment plus ATR knockdown, we observed non- TopI-inhibitor camptothecin, by the DNA-polymerase inhibitor specific breakage of genomic loci, which did not translate into a aphidicolin and other cytostatic drugs (data not shown), support- recombination increase, possibly because of antagonistic DNA ing the notion that several mechanisms underlie MLLbcr substrate/product destruction. Application of ATR-specific inhibi- cleavage.8 Interestingly, recombination stimulation by aphidicolin tion suggested that ATR is not essential in the MLLbcr-specific was specific for the MLLbcr. Aphidicolin was previously shown to recombination after aphidicolin treatment. ATM kinase, predomi- 18 stall DNA replication in late-G1/early S-phase, causing accumula- nantly responding to double-strand breaks, can also become tion of DNA double-strand breaks, induction of homologous activated after replication stalling even in the absence of recombination and apoptosis.26,27 Here, we additionally noticed detectable breaks.39 Here, we noticed increased accumulation of aphidicolin-induced senescence induction and demonstrated that nuclear EndoG, spontaneous MLLbcr breakage and recombination aphidicolin-induced rearrangements at the MLLbcr are mediated after ATM knockdown. Since lack of functional ATM induces by homologous recombination. chronic oxidative stress,40 EndoG accumulation and downstream Previously, MLLbcr rearrangements were reported to be caspase effects on the MLLbcr could be an intrinsic property of ATM- dependent after apoptosis induction by anti-CD95 antibody in deficient cells. Notably, increased MLL translocation frequencies in TK6 cells25 and after etoposide treatment in mouse embryo ATM-deficient cells have been reported.41 ATM-specific inhibition fibroblasts.10 In contrast, our results in T47D cells imply caspase- gave similar results regarding the increase in MLLbcr-specific independent MLLbcr-specific recombination after aphidicolin recombination. We have previously reported that ATM-deficiency treatment despite a caspase-dependent increase in early apopto- de-represses low-fidelity homologous repair in HeLa and other cell sis. In agreement with lack of caspase dependency, knockdown of types.42 However, different from ATM knockdown, ATM kinase the caspase-dependent nucleases CAD,11 TopI28 and Artemis12 did inhibition protected against aphidicolin-induced cleavage. These not decrease MLLbcr recombination. Rather, like caspase inhibi- data suggested that aside from its general role in recombination tion, CAD and TopI knockdowns enhanced spontaneous recombi- regulation, ATM kinase activity promotes EndoG-mediated clea- nation, explainable by an antagonistic effect of caspase-mediated vage of the genomic MLLbcr during replication stress. Exacerbated DNA fragmentation on recombination by destruction of the DNA damage accumulation and stress signaling may have blurred DNA substrates and products. Knockdown of DnaseII, known to this aphidicolin-induced effect on MLLbcr-specific breakage in irreversibly degrade DNA into oligonucleotide fragments, ATM knockdown versus inhibitor-treated cells. enhanced recombination even more. These results are compatible ATM has already been implicated in chromatin relaxation with previous findings indicating that MLLbcr-specific recombina- following DNA damage.43 Specifically, ATM-mediated phosphor- tion occurs before caspase-dependent fragmentation of the DNA ylation of RNF20, a histone H2B monoubiquitinase,23 was into oligonucleotides.10,25 EndoG, the nuclease whose knockdown described to increase chromatin accessibility.44 This might apply abrogated MLLbcr-specific recombination, had been reported to to EndoG in particular as it was shown that H2B interaction with have a role in caspase-independent programmed cell death.29–31 Nuc1p, an EndoG homologue in S. cerevisiae, is necessary for the We show that EndoG binds DNA in the MLLbcr region and nuclease to cleave the DNA.30 Here, RNF20 was required for triggers recombination by cutting MLLbcr, which becomes aphidicolin-induced endogenous MLLbcr cleavage and recombi- obsolete after targeted substrate cleavage by I-SceI. Moreover, nation of the chromosomally integrated MLLbcr construct. Some we observed that EndoG knockdown prevented aphidicolin- and decrease in recombination after RN20 knockdown was observed to a lesser extent etoposide-induced breakage of the genomic also with extrachromosomal reporter. Since genomic loci such as MLLbcr. Though shown to be caspase dependent after apoptosis MLLbcr are prone to replication stalling, downstream signaling induction by anti-CD95 antibody,25 aphidicolin-induced MLLbcr affects both intra- and extrachromosomal recombination events

Oncogene (2015) 3391 – 3401 © 2015 Macmillan Publishers Limited EndoG initiates DNA rearrangements at MLLbcr B Gole et al 3399 on the MLLbcr construct. However, the particular contribution of chromatin components is smaller when the construct is extrachromosomal. Similarly as with ATM, RNF20 knockdown stabilized EndoG, which again might be an indirect consequence of RNF20 knockdown-induced stress signaling.45 Thus, EndoG accumulation in the absence of RNF20 was insufﬁcient for MLLbcr cleavage indicating a requirement for both EndoG and RNF20 as a prerequisite for MLLbcr rearrangements. Altogether, we describe here EndoG as a critical part of MLLbcr rearrangements, depicted by the following model (Figure 7). Cytostatic treatment stalls replication forks, particularly at the sites difﬁcult to bypass. The MLLbcr hotspot may be one of these sites, as it is predicted to form extensive hairpin structures (courtesy of Karen Vasquez, University of Texas, Austin, USA). Notably, the substrate’s secondary structure had previously been recognized as important for the recognition/catalysis mechanism of EndoG.32 Stalled forks result in EndoG stabilization and chromatin relaxation via ATM-RNF20 activation. EndoG cleaves the exposed MLLbcr, enabling recombination repair in an attempt to rescue the stalled fork. This replication stress-induced, EndoG-dependent pathway is caspase- and perhaps even apoptosis-independent. Our data therefore suggest that in the context of MLL rearrangements EndoG may not necessarily be part of apoptotic signaling but rather of a mechanism promoting resolution of stalled forks. Accidentally resulting rearrangements might involve the recently described FoSTeS (Fork Stalling Template Switch) mechanism, where the lagging strand of the stalled fork invades another fork and continues replication on the new locus.46 This could explain recently discovered MLLbcr-associated complex rearrangements in leukemia.6 In this context, it is of particular interest that hematopoietic stem cells, that is, the cells of origin of Figure 7. Model for the involvement of EndoG in MLLbcr rearrange- leukemia, accumulate DNA damage after serial transplantation- ments. Cytostatic treatment stalls DNA replication activating ATM to induced replication stress47 and that irradiation-induced compen- stabilize and resolve stalled forks and triggering apoptosis and senescence. ATM activation leads to RNF20 phosphorylation, H2B satory proliferation of these cells induces lymphoma formation in 48 monoubiquitination and chromatin relaxation, exposing the DNA to mice. Though more characterization of the pathways upstream repair proteins but also to nucleases. Simultaneously, replication of EndoG are still needed, our results open new strategies to stress induces EndoG accumulation via diminished proteasomal search for small molecules inhibiting EndoG with the aim to degradation. EndoG cleaves the exposed MLLbcr and breaks are mitigate secondary leukemia in cancer patients. repaired by recombination. However, this repair can be error-prone causing rearrangements at the MLLbcr locus.

MATERIALS AND METHODS The pSM2 empty vector, pSM2-EndoG (shEndoG, target sequence Cell culture 5′AAGAGCCGCGAGTCGTACGTGCT3′) and pSM2-Artemis (shArtemis, 5′GCACAGAGATGACAGTCAA3′) knockdown plasmids were purchased WTK1 and TK6 cells (provided by Eppendorf University Clinic, Hamburg, from Open Biosystems (Thermo Fisher, Waltham, MA, USA). The pSuper- Germany) were cultured in RPMI-1640 supplemented with 10% FBS and TopoI knockdown plasmid (shTopI) was previously described.49 The shCAD, 1% L-glutamine (all from PAA, Pasching, Austria). T47D cells (provided by shDnaseI and shDnaseII knockdown plasmids were constructed by University Clinic Ulm), HeLa cells (provided by Heinrich-Pette-Institute, annealing and ligation of corresponding oligonucleotides (all from Thermo Hamburg, Germany) and their derivates HeLa/shATM, HeLa/shATR, 49 Fisher) into BgIII/HindIII digested pSuper vector. The oligonucleotides HeLa/NTsh (all from Tebu-bio, Le-Perray-en-Yvelines, France) and used are listed in Supplementary Table T1. Corresponding empty vectors HeLa/MLL (this work) were cultured in DMEM supplemented with 10% μ were used as negative controls. FBS and 1% L-glutamine (all from PAA). Insulin (1 g/ml, Invitrogen, The pools of four siRNA, FlexiTube Gene-Solutions GS5888, GS56254 and Carlsbad, CA, USA) was included into the T47D medium. GS2021, were used to silence RAD51, RNF20 and ENDOG, respectively (all from Qiagen, Hilden, Germany). Hs_RNF20_3 and Hs_RNF20_5 FlexiTube Plasmids and siRNA siRNA (both from Qiagen) were also used to silence RNF20. The control The recombination plasmids pCMV-I-SceI, p5bPuroCMV-wtEGFP (wtEGFP), (non-silencing) siRNA 1022076 (Qiagen) was used as a negative control. pHR-EGFP/3’EGFP (HR3’), pHR-EGFP/3’EGFP-Rarα.fwd (RARαbcr.fwd) and pHR-EGFP/3’EGFP-Rarα.rev (RARαbcr.rev) were previously described.16,49 Establishment of cells with stably integrated MLLbcr constructs ’ The recombination plasmids pHR-EGFP/3 EGFP-SV40 (SV40), pHR-EGFP/ HeLa cells were stably transfected via lipofection (Fugene HD, Promega, ’ ’ 3 EGFP-MLLbcr.fwd (MLLbcr.fwd), pHR-EGFP/3 EGFP-MLLbcr.rev (MLLbcr.rev) Mannheim, Germany) with linearized HR-EGFP/3’EGFP-MLLbcr.fwd recom- ’ and pHR-EGFP/3 EGFP-p21 (p21) were constructed by SalI insertion of the bination vector carrying puromycin resistance cassette. Subsequently, corresponding genome fragments (see below) into the pHR-EGFP/3’EGFP μ fi 16 puromycin-resistant (0.25 g/ml, PAA) colonies were screened rst for I-SceI plasmid, in place of the hygromycin resistance cassette between the two and in the second round for aphidicolin-inducible cellular fluorescence by mutated EGFP variants (Supplementary Figure S1A). The genome flow cytometry (FACS Calibur, BD Biosciences, Heidelberg, Germany). fragments used were for SV40 plasmid a 413-bp fragment from the SimianVirus-40 genome (XcmI/BamHI fragment from pUC-SV40 vector),15 for MLLbcr.fwd and MLLbcr.rev plasmids the 399-bp fragment from the Transfection and treatments MLLbcr hotspot (ClaI fragment from pUC-SV40-Cla-MLL vector)15 in both Plasmids were transiently introduced into WTK1 and TK6 cells by orientations and for the p21 plasmid the 450-bp EcoRI/ScaI fragment electroporation (GenePulser Xcell, Bio-Rad, Hercules, CA, USA), into T47D encompassing the p53 recognition site in the p21 gene from vector pGL2- and HeLa cells by lipofection (Fugene HD). HiPerFect (Qiagen) was used for B-p21 (B. Vogelstein, Baltimore, MD, USA). siRNA transfection.

© 2015 Macmillan Publishers Limited Oncogene (2015) 3391 – 3401 EndoG initiates DNA rearrangements at MLLbcr B Gole et al 3400 After transfection cells were left to recover (6–48 h) before cytotoxic Cell cycle, apoptosis and senescence treatments with 10 μM aphidicolin, 50 μM etoposide, 300 nM camptothecin The cell-cycle distribution was determined by flow cytometry following PI or 100 μg/ml 5-fluorouracil (all from Sigma-Aldrich, Munich, Germany). staining of the fixed cells. Early apoptosis was determined using the Mock-treatment controls were performed in parallel. For caspase Annexin-V-FLUOS Staining Kit (Roche). Live, necrotic and apoptotic cells inhibition, cells were co-treated with 25 μM zVAD-fmk and for proteasome were differentiated by flow cytometry. Senescence was detected using the inhibition with 0.1 μM MG115 (both from Sigma-Aldrich). KU55933 (10 μM) β-Galactosidase Staining Kit (Cell Signaling). β-Galactosidase expressing was used for ATM-specific inhibition, 10 μM VE-821 for ATR-specific senescent (β-Gal, blue) cells was counted under an IX50 light microscope inhibition and 0.5 μM NU7441 for DNA-PK-specific inhibition (all from (Olympus, Tokyo, Japan). SelleckChem, Houston, TX, USA). Western blots for the phosphorylated proteins were performed after 2–4 h treatments, genomic DNA and Immunofluorescence staining fl – immuno uorescence analysis after 4 6 h treatments, all other analyses fi – The cells were xed in 3.7% formaldehyde, permeabilized (0.5% Triton), after 24 48 h treatments. washed in 0.05% Tween-20 and blocked with 5% goat serum. Cells were immunostained with anti-EndoG antibody 1/500 (ProSci). AlexaFluor555 Recombination analysis goat-anti-rabbit IgG 1/2.000 (A21428, Invitrogen) was used as secondary antibody. Nuclei were visualized by DAPI staining 1/30.000. Slides were Recombination frequencies were determined by FACS analysis to quantify mounted in Mowiol-Dabco 1:3, micrographs collected on a BX51 EGFP-positive cells as previously described.16,49 Experiments with wild-type epifluorescence microscope (Olympus) and analyzed using the Cell F 2.5 EGFP expression plasmid were performed in split samples each and the software (Soft Imaging System, Münster, Germany). resulting transfection efficiencies used to individually correct recombination frequencies. Statistics All experiments were repeated independently at least twice. Wilcoxon Western blot matched-pairs signed rank test with assumed two-tailed distribution and a Total cellular lysates and separate nuclear and cytoplasmic extracts 95% confidence interval was used to calculate the statistical significances 34,42 were prepared as previously described. Primary antibodies for of the differences observed (Prism 5.01 software, GraphPad, La Jolla, immunodetection were rabbit-anti-human Artemis, 1/300 (AB35649, CA, USA). Abcam, Cambridge, UK), mouse-anti-human ATM, 1/2.000 (AB2618, Abcam), rabbit-anti-human ATR, 1/2.000 (PC538, Merck Millipore, Darmstadt, Germany), rabbit-anti-human CAD, 1/1.000 (AB16926, CONFLICT OF INTEREST Chemicon, Billerica, MA, USA), rabbit-anti-human pChk1/Ser3435, 1/1.000 The authors declare no conflict of interest. (2348, CellSignalling, Danvers, MA, USA), rabbit-anti-human DnaseII, 1/5.000 (IMG-172, Imgenex, San Diego, CA, USA), rabbit-anti-human EndoG, 1/1.500 (3035, ProSci, Poway, CA, USA), mouse-anti-human γH2AX, ACKNOWLEDGEMENTS 1/2.000 (05-636, Merck Millipore) and rabbit-anti-human Rad51 1/1.000 We thank Daniela Waldraff, Regina Häfele, Rahel Wiehe (all Department of Obstetrics (SC8349, Santa Cruz, Dallas, TX, USA). Mouse-anti-human α-tubulin, 1/5.000 and Gynecology, University of Ulm, Germany) and Dré van der Merwe (Core facility (AB7291, Abcam) and goat-anti-human actin 1/2.000 (SC1616, Santa Cruz) FACS, Medical Faculty, University of Ulm, Germany) for their contributions to this served as loading controls. HRP-conjugated goat-anti-mouse (32430, work. This work was supported by the German Research Foundation (WI 3099/7-1, WI Thermo Fisher), goat-anti-rabbit (32460, Thermo Fisher), both 1/1.000 3099/7-2) and by the European/German Space Agency (ESA/DLR) and German and donkey-anti-goat 1/2.000 (705-035-147, Jackson ImmunoResearch, Ministry of Economy (BMWi), A0-10-IBER-2 funding 50WB1225. Newmarket, UK) were used as secondary antibodies. Western blot signals were visualized by Super Signal West Dura Extended Duration Substrate (Thermo Fisher), quantified using ImageJ 1.46 software (National Institutes REFERENCES of Health, Bethesda, MD, USA) and corrected with the values of the 1 Mosad E, Abdou M, Zaky AH. Rearrangement of the myeloid/lymphoid leukemia corresponding loading controls. Each immunoblotting experiment was gene in therapy-related myelodysplastic syndrome in patients previously treated performed at least twice and a representative image displayed. with agents targeting DNA topoisomerase II. Oncology 2012; 83: 128–134. 2 Abdulwahab A, Sykes J, Kamel-Reid S, Chang H, Brandwein JM. Therapy-related acute lymphoblastic leukemia is more frequent than previously recognized and qRT-PCR and genomic PCR has a poor prognosis. Cancer 2012; 118: 3962–3967. Total mRNA was isolated using the RNeasy Mini Kit, reverse-transcribed 3 Stam RW, den Boer ML, Pieters R. Towards targeted therapy for infant acute with QuantiTect Reverse Transcription Kit and qRT-PCR performed using lymphoblastic leukemia. Br J Haematol 2006; 132:539–551. QuantiTect SYBR Green PCR Kit (all from Qiagen) on a Viia7 RUO thermo 4 Shivakumar R, Tan W, Wilding GE, Wang ES, Wetzler M. Biologic features and cycler (Applied Biosystems, Foster City, CA, USA). Gene-specific mRNAs treatment outcome of secondary acute lymphoblastic leukemia--a review of were detected using Hs_ENDOG_1_SG, Hs_DNASE1_1_SG, Hs_TOP1_1_SG 101 cases. Ann Oncol 2008; 19:1634–1638. and Hs_RNF20_1_SG QuantiTect primer assays (all from Qiagen). 5 Ezoe S. Secondary leukemia associated with the anti-cancer agent, etoposide, 9 – Hs_GAPDH_2_SG (Qiagen) was used as an internal control. The differences a topoisomerase II inhibitor. Int J Environ Res Public Health 2012; :2444 2453. in target mRNA expression were calculated with the 2 − ΔΔCt method. 6 Meyer C, Hofmann J, Burmeister T, Gröger D, Park TS, Emerenciano M et al. The 27 – Genomic DNA was extracted using High pure PCR Template Preparation MLL recombinome of acute leukemias in 2013. Leukemia 2013; : 2165 2176. Kit (Roche, Basel, Switzerland). PCR was performed using Taq PCR Core Kit 7 Stanulla M, Wang J, Chervinsky DS, Thandla S, Aplan PD. DNA cleavage within the MLL breakpoint cluster region is a specific event which occurs as part of higher- (Qiagen) in the Flex Cycler thermocycler (Analytic, Jena, Germany). The order chromatin fragmentation during the initial stages of apoptosis. Mol Cell Biol primers used (all from Thermo Fisher) are listed in Supplementary Table T2. 1997; 17: 4070–4079. Each PCR experiment was performed at least twice and a representative 8 Mirault ME, Boucher P, Tremblay A. Nucleotide-resolution mapping of image displayed. topoisomerase-mediated and apoptotic DNA strand scissions at or near an MLL translocation hotspot. Am J Hum Genet 2006; 79: 779–791. Chromatin immunoprecipitation 9 Sim SP, Liu LF. Nucleolytic cleavage of the mixed lineage leukemia breakpoint cluster region during apoptosis. J Biol Chem 2001; 276: 31590–31595. ChIP-IT Express Enzymatic Magnetic Chromatin Immunoprecipitation Kit 10 Hars ES, Lyu YL, Lin CP, Liu LF. Role of apoptotic nuclease caspase-activated and Enzymatic Shearing Kit (Active Motif, La Hulpe, Belgium) were used. DNase in etoposide-induced treatment-related acute myelogenous leukemia. The sheared chromatin was immunoprecipitated using mouse anti-human Cancer Res 2006; 66: 8975–8979. EndoG antibody 1/1.000 (SC365359, Santa Cruz). Rabbit anti-human 53BP1 11 Samejima K, Earnshaw WC. Trashing the genome: the role of nucleases during antibody 1/1.000 (NB 100-304, Novus, Cambridge, UK) was used for control apoptosis. Nat Rev Mol Cell Biol 2005; 6:677–688. precipitation. PCR analysis of the precipitated DNA was performed as 12 Britton S, Frit P, Biard D, Salles B, Calsou P. ARTEMIS nuclease facilitates apoptotic described above. chromatin cleavage. Cancer Res 2009; 69: 8120–8126.

Oncogene (2015) 3391 – 3401 © 2015 Macmillan Publishers Limited EndoG initiates DNA rearrangements at MLLbcr B Gole et al 3401 13 Libura J, Ward M, Solecka J, Richardson C. Etoposide-initiated MLL rearrange- 32 Ruiz-Carrillo A, Renaud J. Endonuclease G: a (dG)n X (dC)n-specific DNase from ments detected at high frequency in human primitive hematopoietic stem cells higher eukaryotes. EMBO J 1987; 6: 401–407. with in vitro and in vivo long-term repopulating potential. Eur J Haematol 2008; 33 Diener T, Neuhaus M, Koziel R, Micutkova L, Jansen-Dürr P. Role of endonuclease 81: 185–195. G in senescence-associated cell death of human endothelial cells. Exp Gerontol 14 Stanulla M, Chhalliyil P, Wang J, Jani-Sait SN, Aplan PD. Mechanisms of MLL gene 2010; 45:638–644. rearrangement: site-specific DNA cleavage within the breakpoint cluster region is 34 Yang SH, Chien CM, Lu MC, Lin YH, Hu XW, Lin SR. Up-regulation of Bax independent of chromosomal context. Hum Mol Genet 2001; 10: 2481–2491. and endonuclease G, and down-modulation of Bcl-XL involved in cardiotoxin 15 Boehden GS, Restle A, Marschalek R, Stocking C, Wiesmüller L. Recombination III-induced apoptosis in K562 cells. Exp Mol Med 2006; 38: 435–444. at chromosomal sequences involved in leukaemogenic rearrangements is 35 Zan H, Zhang J, Al-Qahtani A, Pone EJ, White CA, Lee D et al. Endonuclease G differentially regulated by p53. Carcinogenesis 2004; 25: 1305–1313. plays a role in immunoglobulin class switch DNA recombination by introducing 16 Akyüz N, Boehden GS, Süsse S, Rimek A, Preuss U, Scheidtmann KH et al. DNA double-strand breaks in switch regions. Mol Immunol 2011; 48:610–622. substrate dependence of p53-mediated regulation of double-strand break repair. 36 Lee JS, Seo TW, Yi JH, Shin KS, Yoo SJ. CHIP has a protective role against oxidative Mol Cell Biol 2002; 22: 6306–6317. stress-induced cell death through specific regulation of Endonuclease G. Cell 17 Strissel PL, Strick R, Rowley JD, Zeleznik-Le NJ. An in vivo topoisomerase II Death Dis 2013; 4: e666. cleavage site and a DNase I hypersensitive site colocalize near exon 9 in the MLL 37 Ozeri-Galai E, Lebofsky R, Rahat A, Bester AC, Bensimon A, Kerem B. Failure of breakpoint cluster region. Blood 1998; 92: 3793–3803. origin activation in response to fork stalling leads to chromosomal instability at 18 Flynn RL, Zou L. ATR: a master conductor of cellular responses to DNA fragile sites. Mol Cell 2011; 43:122–131. replication stress. Trends Biochem Sci 2011; 36: 133–140. 38 Barlow JH, Faryabi RB, Callén E, Wong N, Malhowski A, Chen HT et al. Identification 19 Matsuoka S, Ballif BA, Smogorzewska A, McDonald ER 3rd, Hurov KE, Luo J et al. of early replicating fragile sites that contribute to genome instability. Cell 2013; ATM and ATR substrate analysis reveals extensive protein networks responsive to 152:620–632. DNA damage. Science 2007; 316: 1160–1166. 39 Bolderson E, Scorah J, Helleday T, Smythe C, Meuth M. ATM is required for the 20 Carrassa L, Broggini M, Erba E, Damia G. Chk1, but not Chk2, is involved in the cellular response to thymidine induced replication fork stress. Hum Mol Genet cellular response to DNA damaging agents: differential activity in cells expressing 2004; 13:2937–2945. or not p53. Cell Cycle 2004; 3: 1177–1181. 40 Ousset M, Bouquet F, Fallone F, Biard D, Dray C, Valet P et al. Loss of ATM 21 Vařecha M, Potěšilová M, Matula P, Kozubek M. Endonuclease G interacts with positively regulates the expression of hypoxia inducible factor 1 (HIF-1) through histone H2B and DNA topoisomerase II alpha during apoptosis. Mol Cell Biochem oxidative stress: Role in the physiopathology of the disease. Cell Cycle 2010; 9: 2012; 363: 301–307. 2814–2822. 22 Wu J, Huen MS, Lu LY, Ye L, Dou Y, Ljungman M et al. Histone ubiquitination 41 Sun J, Oma Y, Harata M, Kono K, Shima H, Kinomura A et al. ATM modulates the associates with BRCA1-dependent DNA damage response. Mol Cell Biol 2009; 29: loading of recombination proteins onto a chromosomal translocation breakpoint 849–860. hotspot. PLoS ONE 2010; 5: e13554. 23 Moyal L, Lerenthal Y, Gana-Weisz M, Mass G, So S, Wang SY et al. Requirement of 42 Volčič M, Karl S, Baumann B, Salles D, Daniel P, Fulda S et al. NF-κB regulates DNA ATM-dependent monoubiquitylation of histone H2B for timely repair of DNA double-strand break repair in conjunction with BRCA1-CtIP complexes. Nucleic double-strand breaks. Mol Cell 2011; 41: 529–542. Acids Res 2012; 40: 181–195. 24 Maddams J, Parkin DM, Darby SC. The cancer burden in the United Kingdom in 43 Grabarz A, Barascu A, Guirouilh-Barbat J, Lopez BS. Initiation of DNA double 2007 due to radiotherapy. Int J Cancer 2011; 129: 2885–2893. strand break repair: signaling and single-stranded resection dictate the 25 Betti CJ, Villalobos MJ, Diaz MO, Vaughan AT. Apoptotic stimuli initiate MLL-AF9 choice between homologous recombination, non-homologous end-joining and translocations that are transcribed in cells capable of division. Cancer Res 2003; alternative end-joining. Am J Cancer Res 2012; 2:249–268. 63: 1377–1381. 44 Fierz B, Chatterjee C, McGinty RK, Bar-Dagan M, Raleigh DP, Muir TW. Histone H2B 26 Saintigny Y, Delacôte F, Varès G, Petitot F, Lambert S, Averbeck D et al. ubiquitylation disrupts local and higher-order chromatin compaction. Nat Chem Characterization of homologous recombination induced by replication inhibition Biol 2011; 7:113–119. in mammalian cells. EMBO J 2001; 20: 3861–3870. 45 Chernikova SB, Razorenova OV, Higgins JP, Sishc BJ, Nicolau M, Dorth JA et al. 27 Ozeri-Galai E, Schwartz M, Rahat A, Kerem B. Interplay between ATM and ATR in Deficiency in mammalian histone H2B ubiquitin ligase Bre1 (Rnf20/Rnf40) the regulation of common fragile site stability. Oncogene 2008; 27: 2109–2117. leads to replication stress and chromosomal instability. Cancer Res 2012; 72: 28 Sordet O, Khan QA, Plo I, Pourquier P, Urasaki Y, Yoshida A et al. Apoptotic 2111–2119. topoisomerase I-DNA complexes induced by staurosporine-mediated oxygen 46 Zhang F, Carvalho CM, Lupski JR. Complex human chromosomal and genomic radicals. J Biol Chem 2004; 279: 50499–50504. rearrangements. Trends Genet 2009; 25: 298–307. 29 Li LY, Luo X, Wang X. Endonuclease G is an apoptotic DNase when released from 47 Milyavsky M, Gan OI, Trottier M, Komosa M, Tabach O, Notta F et al. A distinctive mitochondria. Nature 2001; 412:95–99. DNA damage response in human hematopoietic stem cells reveals an apoptosis- 30 Büttner S, Eisenberg T, Carmona-Gutierrez D, Ruli D, Knauer H, Ruckenstuhl C et al. independent role for p53 in self-renewal. Cell Stem Cell 2010; 7:186–197. Endonuclease G regulates budding yeast life and death. Mol Cell 2007; 25: 48 Labi V, Erlacher M, Krumschnabel G, Manzl C, Tzankov A, Pinon J et al. Apoptosis 233–246. of leukocytes triggered by acute DNA damage promotes lymphoma formation. 31 Tichy ED, Stephan ZA, Osterburg A, Noel G, Stambrook PJ. Mouse embryonic stem Genes Dev 2010; 24: 1602–1607. cells undergo charontosis, a novel programmed cell death pathway dependent 49 Baumann C, Boehden GS, Bürkle A, Wiesmüller L. Poly(ADP-RIBOSE) polymerase-1 upon cathepsins, p53, and EndoG, in response to etoposide treatment. Stem Cell (Parp-1) antagonizes topoisomerase I-dependent recombination stimulation by Res 2013; 10:428–441. P53. Nucleic Acids Res 2006; 34: 1036–1049.

Supplementary Information accompanies this paper on the Oncogene website (http://www.nature.com/onc)