African Journal of Microbiology Research

Volume 8 Number 7, 19 February, 2014

ISSN 1996-0808

ABOUT AJMR

The African Journal of Microbiology Research (AJMR) (ISSN 1996-0808) is published Weekly (one volume per year) by Academic Journals.

African Journal of Microbiology Research (AJMR) provides rapid publication (weekly) of articles in all areas of Microbiology such as: Environmental Microbiology, Clinical Microbiology, Immunology, Virology, Bacteriology, Phycology, Mycology and Parasitology, Protozoology, Microbial Ecology, Probiotics and Prebiotics, Molecular Microbiology, Biotechnology, Food Microbiology, Industrial Microbiology, Cell Physiology, Environmental Biotechnology, Genetics, Enzymology, Molecular and Cellular Biology, Plant Pathology, Entomology, Biomedical Sciences, Botany and Plant Sciences, Soil and Environmental Sciences, Zoology, Endocrinology, Toxicology. The Journal welcomes the submission of manuscripts that meet the general criteria of significance and scientific excellence. Papers will be published shortly after acceptance. All articles are peer-reviewed.

Submission of Manuscript

Please read the Instructions for Authors before submitting your manuscript. The manuscript files should be given the last name of the first author

Click here to Submit manuscripts online

If you have any difficulty using the online submission system, kindly submit via this email [email protected].

With questions or concerns, please contact the Editorial Office at [email protected].

Editors

Prof. Dr. Stefan Schmidt, Dr. Thaddeus Ezeji Applied and Environmental Microbiology Assistant Professor School of Biochemistry, Genetics and Microbiology Fermentation and Biotechnology Unit University of KwaZulu-Natal Department of Animal Sciences Private Bag X01 The Ohio State University Scottsville, Pietermaritzburg 3209 1680 Madison Avenue South Africa. USA.

Prof. Fukai Bao Department of Microbiology and Immunology Associate Editors Kunming Medical University Kunming 650031, Dr. Mamadou Gueye China MIRCEN/ Laboratoire commun de microbiologie IRD-ISRA-UCAD, BP 1386, Dr. Jianfeng Wu DAKAR, Senegal. Dept. of Environmental Health Sciences, School of Public Health, Dr. Caroline Mary Knox University of Michigan Department of Biochemistry, Microbiology and USA Biotechnology Rhodes University Dr. Ahmet Yilmaz Coban Grahamstown 6140 OMU Medical School, South Africa. Department of Medical Microbiology, Samsun, Dr. Hesham Elsayed Mostafa Turkey Genetic Engineering and Biotechnology Research Institute (GEBRI) Dr. Seyed Davar Siadat Mubarak City For Scientific Research, Pasteur Institute of Iran, Research Area, New Borg El-Arab City, Pasteur Square, Pasteur Avenue, Post Code 21934, Alexandria, Egypt. Tehran, Iran. Dr. Wael Abbas El-Naggar Head of Microbiology Department, Dr. J. Stefan Rokem Faculty of Pharmacy, The Hebrew University of Jerusalem Mansoura University, Department of Microbiology and Molecular Genetics, Mansoura 35516, Egypt. P.O.B. 12272, IL-91120 Jerusalem, Israel Dr. Abdel Nasser A. El-Moghazy Microbiology, Molecular Biology, Genetics Engineering Prof. Long-Liu Lin and Biotechnology National Chiayi University Dept of Microbiology and Immunology 300 Syuefu Road, Faculty of Pharmacy Chiayi, Al-Azhar University Taiwan Nasr city, Cairo, Egypt N. John Tonukari, Ph.D Department of Biochemistry Delta State University PMB 1 Abraka, Nigeria

Editorial Board

Dr. Haoyu Mao Dr. Barakat S.M. Mahmoud Department of Molecular Genetics and Microbiology Food Safety/Microbiology College of Medicine Experimental Seafood Processing Laboratory Costal Research and Extension Center University of Florida Mississippi State University Florida, Gainesville 3411 Frederic Street USA. Pascagoula, MS 39567 Dr. Rachna Chandra USA Environmental Impact Assessment Division

Environmental Sciences Prof. Mohamed Mahrous Amer Poultry Disease (Viral Diseases of poultry) Sálim Ali Center for Ornithology and Natural History Faculty of Veterinary Medicine, (SACON), Department of Poultry Diseases Anaikatty (PO), Coimbatore-641108, India Cairo university Giza, Egypt Dr. Yongxu Sun Department of Medicinal Chemistry and

Biomacromolecules Dr. Xiaohui Zhou Molecular Microbiology, Industrial Microbiology, Qiqihar Medical University, Qiqihar 161006 Environmental Microbiology, Pathogenesis, Antibiotic Heilongjiang Province resistance, Microbial Ecology P.R. China Washington State University Bustad Hall 402 Department of Veterinary Dr. Ramesh Chand Kasana Institute of Himalayan Bioresource Technology Microbiology and Pathology, Pullman, Palampur, Distt. Kangra (HP), USA India Dr. R. Balaji Raja Department of Biotechnology, Dr. S. Meena Kumari School of Bioengineering, Department of Biosciences SRM University, Faculty of Science University of Mauritius Chennai Reduit India

Dr. Aly E Abo-Amer Dr. T. Ramesh Division of Microbiology, Botany Department, Faculty Assistant Professor of Science, Sohag University. Marine Microbiology Egypt. CAS in Marine Biology Faculty of Marine Sciences

Annamalai University

Parangipettai - 608 502

Cuddalore Dist. Tamilnadu, India

Dr. Pagano Marcela Claudia Post doctoral fellowship at Department of Biology, Federal University of Ceará - UFC,

Brazil.

Dr. EL-Sayed E. Habib Dr. Mohd Fuat ABD Razak Associate Professor, Institute for Medical Research Dept. of Microbiology, Malaysia Faculty of Pharmacy, Mansoura University, Dr. Davide Pacifico Egypt. Istituto di Virologia Vegetale – CNR Italy Dr. Pongsak Rattanachaikunsopon Department of Biological Science, Prof. Dr. Akrum Hamdy Faculty of Science, Faculty of Agriculture, Minia University, Egypt Ubon Ratchathani University, Egypt Warin Chamrap, Ubon Ratchathani 34190, Thailand Dr. Ntobeko A. B. Ntusi Cardiac Clinic, Department of Medicine, Dr. Gokul Shankar Sabesan University of Cape Town and Microbiology Unit, Faculty of Medicine, Department of Cardiovascular Medicine, AIMST University University of Oxford Jalan Bedong, Semeling 08100, South Africa and Kedah, United Kingdom Malaysia Prof. N. S. Alzoreky Dr. Kwang Young Song Food Science & Nutrition Department, Department of Biological Engineering, College of Agricultural Sciences & Food, School of Biological and Chemical Engineering, King Faisal University, Yanbian Universityof Science and Technology, Saudi Arabia Yanji, China. Dr. Chen Ding College of Material Science and Engineering, Dr. Kamel Belhamel Hunan University, Faculty of Technology, China University of Bejaia Algeria Dr Svetlana Nikolid Faculty of Technology and Metallurgy, Dr. Sladjana Jevremovic University of Belgrade, Institute for Biological Research Serbia Sinisa Stankovic, Belgrade, Dr. Sivakumar Swaminathan Serbia Department of Agronomy, College of Agriculture and Life Sciences, Dr. Tamer Edirne Iowa State University, Dept. of Family Medicine, Univ. of Pamukkale Ames, Iowa 50011 Turkey USA

Dr. R. Balaji Raja M.Tech (Ph.D) Dr. Alfredo J. Anceno Assistant Professor, School of Environment, Resources and Development Department of Biotechnology, (SERD), School of Bioengineering, Asian Institute of Technology, SRM University, Thailand Chennai. India Dr. Iqbal Ahmad Aligarh Muslim University, Dr. Minglei Wang Aligrah University of Illinois at Urbana-Champaign,USA India

Dr. Josephine Nketsia-Tabiri Prof. Dong Zhichun Ghana Atomic Energy Commission Professor, Department of Animal Sciences and Ghana Veterinary Medicine, Yunnan Agriculture University, Dr. Juliane Elisa Welke China UFRGS – Universidade Federal do Rio Grande do Sul Dr. Mehdi Azami Brazil Parasitology & Mycology Dept, Baghaeei Lab., Dr. Mohammad Nazrul Islam Shams Abadi St. NIMR; IPH-Bangalore & NIUM Isfahan Bangladesh Iran

Dr. Okonko, Iheanyi Omezuruike Dr. Anderson de Souza Sant’Ana Department of Virology, University of São Paulo. Faculty of Basic Medical Sciences, Brazil. College of Medicine, University of Ibadan, Dr. Juliane Elisa Welke University College Hospital, UFRGS – Universidade Federal do Rio Grande do Sul Ibadan, Brazil Nigeria Dr. Paul Shapshak Dr. Giuliana Noratto USF Health, Texas A&M University Depts. Medicine (Div. Infect. Disease & Internat Med) USA and Psychiatry & Beh Med. USA Dr. Phanikanth Venkata Turlapati Washington State University Dr. Jorge Reinheimer USA Universidad Nacional del Litoral (Santa Fe) Argentina Dr. Khaleel I. Z. Jawasreh National Centre for Agricultural Research and Dr. Qin Liu Extension, NCARE East China University of Science Jordan and Technology China Dr. Babak Mostafazadeh, MD Shaheed Beheshty University of Medical Sciences Dr. Xiao-Qing Hu Iran State Key Lab of Food Science and Technology Jiangnan University Dr. S. Meena Kumari P. R. China Department of Biosciences Faculty of Science Prof. Branislava Kocic University of Mauritius Specaialist of Microbiology and Parasitology Reduit University of Nis, School of Medicine Institute Mauritius for Public Health Nis, Bul. Z. Djindjica 50, 18000 Nis Serbia Dr. S. Anju Department of Biotechnology, Dr. Rafel Socias SRM University, Chennai-603203 CITA de Aragón, India Spain

Dr. Mustafa Maroufpor Iran

Prof. Kamal I. Mohamed Prof. Isidro A. T. Savillo State University of New York at Oswego ISCOF USA Philippines

Dr. Adriano Cruz Dr. How-Yee Lai Faculty of Food Engineering-FEA Taylor’s University College University of Campinas (UNICAMP) Malaysia Brazil Dr. Nidheesh Dadheech Dr. Mike Agenbag (Michael Hermanus Albertus) MS. University of Baroda, Vadodara, Gujarat, India. Manager Municipal Health Services, India Joe Gqabi District Municipality South Africa Dr. Omitoyin Siyanbola Bowen University, Dr. D. V. L. Sarada Iwo Department of Biotechnology, Nigeria SRM University, Chennai-603203 India. Dr. Franco Mutinelli Istituto Zooprofilattico Sperimentale delle Venezie Dr. Samuel K Ameyaw Italy Civista Medical Center United States of America Dr. Chanpen Chanchao Department of Biology, Prof. Huaizhi Wang Faculty of Science, Institute of Hepatopancreatobiliary Chulalongkorn University Surgery of PLA Southwest Hospital, Thailand Third Military Medical University Chongqing400038 Dr. Tsuyoshi Kasama P. R. China Division of Rheumatology, Showa University Prof. Bakhiet AO Japan College of Veterinary Medicine, Sudan University of Science and Technology Dr. Kuender D. Yang, MD. Sudan Chang Gung Memorial Hospital Taiwan Dr. Saba F. Hussain Community, Orthodontics and Peadiatric Dentistry Dr. Liane Raluca Stan Department University Politehnica of Bucharest, Faculty of Dentistry Department of Organic Chemistry “C.Nenitzescu” Universiti Teknologi MARA Romania 40450 Shah Alam, Selangor Malaysia Dr. Muhamed Osman Senior Lecturer of Pathology & Consultant Prof. Dr. Zohair I.F.Rahemo Immunopathologist State Key Lab of Food Science and Technology Department of Pathology, Jiangnan University Faculty of Medicine, P. R. China Universiti Teknologi MARA, 40450 Shah Alam, Selangor Dr. Afework Kassu Malaysia University of Gondar Ethiopia Dr. Mohammad Feizabadi Tehran University of medical Sciences Iran

Prof. Ahmed H Mitwalli Dr. Adibe Maxwell Ogochukwu State Key Lab of Food Science and Technology Department of Clinical Pharmacy and Pharmacy Jiangnan University Management, P. R. China University of Nigeria, Nsukka. Dr. Mazyar Yazdani Nigeria Department of Biology, University of Oslo, Dr. William M. Shafer Blindern, Emory University School of Medicine Oslo, USA Norway Dr. Michelle Bull Dr. Ms. Jemimah Gesare Onsare CSIRO Food and Nutritional Sciences Ministry of Higher, Education Australia Science and Technology Kenya Prof. Dr. Márcio Garcia Ribeiro (DVM, PhD) School of Veterinary Medicine and Animal Science- Dr. Babak Khalili Hadad UNESP, Department of Biological Sciences, Dept. Veterinary Hygiene and Public Health, Roudehen Branch, State of Sao Paulo Islamic Azad University, Brazil Roudehen Iran Prof. Dr. Sheila Nathan National University of Malaysia (UKM) Dr. Ehsan Sari Malaysia Department of Plan Pathology, Iranian Research Institute of Plant Protection, Prof. Ebiamadon Andi Brisibe Tehran, University of Calabar, Iran. Calabar, Nigeria Dr. Snjezana Zidovec Lepej University Hospital for Infectious Diseases Dr. Julie Wang Zagreb, Burnet Institute Croatia Australia

Dr. Dilshad Ahmad Dr. Jean-Marc Chobert King Saud University INRA- BIA, FIPL Saudi Arabia France

Dr. Adriano Gomes da Cruz Dr. Zhilong Yang, PhD University of Campinas (UNICAMP) Laboratory of Viral Diseases Brazil National Institute of Allergy and Infectious Diseases, National Institutes of Health Dr. Hsin-Mei Ku Agronomy Dept. NCHU 250 Kuo Dr. Dele Raheem Kuang Rd, Taichung, University of Helsinki Taiwan Finland

Dr. Fereshteh Naderi Dr. Li Sun Physical chemist, PLA Centre for the treatment of infectious diseases, Islamic Azad University, Tangdu Hospital, Shahre Ghods Branch Fourth Military Medical University Iran China

Dr. Biljana Miljkovic-Selimovic Dr. Pradeep Parihar School of Medicine, Lovely Professional University, Phagwara, Punjab. University in Nis, India Serbia; Referent laboratory for Campylobacter and Helicobacter, Dr. William H Roldán Center for Microbiology, Department of Medical Microbiology, Institute for Public Health, Nis Faculty of Medicine, Serbia Peru

Dr. Xinan Jiao Dr. Kanzaki, L I B Yangzhou University Laboratory of Bioprospection. University of Brasilia China Brazil

Dr. Endang Sri Lestari, MD. Prof. Philippe Dorchies Department of Clinical Microbiology, Laboratory of Bioprospection. University of Brasilia Medical Faculty, Brazil Diponegoro University/Dr. Kariadi Teaching Hospital, Semarang Dr. C. Ganesh Kumar Indonesia Indian Institute of Chemical Technology, Hyderabad Dr. Hojin Shin India Pusan National University Hospital South Korea Dr. Farid Che Ghazali Universiti Sains Malaysia (USM) Dr. Yi Wang Malaysia Center for Vector Biology, 180 Jones Avenue Rutgers University, New Brunswick, NJ 08901-8536 Dr. Samira Bouhdid USA Abdelmalek Essaadi University, Tetouan, Dr. Heping Zhang Morocco The Key Laboratory of Dairy Biotechnology and Engineering, Dr. Zainab Z. Ismail Ministry of Education, Department of Environmental Engineering, University Inner Mongolia Agricultural University. of Baghdad. China Iraq

Prof. Natasha Potgieter Dr. Ary Fernandes Junior University of Venda Universidade Estadual Paulista (UNESP) South Africa Brasil

Dr. Alemzadeh Dr. Papaevangelou Vassiliki Sharif University Athens University Medical School Iran Greece

Dr. Sonia Arriaga Dr. Fangyou Yu Instituto Potosino de Investigación Científicay The first Affiliated Hospital of Wenzhou Medical Tecnológica/División de Ciencias Ambientales College Mexico China

Dr. Armando Gonzalez-Sanchez Dr. Galba Maria de Campos Takaki Universidad Autonoma Metropolitana Cuajimalpa Catholic University of Pernambuco Mexico Brazil

Dr. Kwabena Ofori-Kwakye Dr. Hans-Jürg Monstein Department of Pharmaceutics, Clinical Microbiology, Molecular Biology Laboratory, Kwame Nkrumah University of Science & Technology, University Hospital, Faculty of Health Sciences, S-581 KUMASI 85 Linköping Ghana Sweden

Prof. Dr. Liesel Brenda Gende Dr. Ajith, T. A Arthropods Laboratory, School of Natural and Exact Associate Professor Biochemistry, Amala Institute of Sciences, National University of Mar del Plata Medical Sciences, Amala Nagar, Thrissur, Kerala-680 Buenos Aires, 555 Argentina. India

Dr. Adeshina Gbonjubola Dr. Feng-Chia Hsieh Ahmadu Bello University, Biopesticides Division, Taiwan Agricultural Chemicals Zaria. and Toxic Substances Research Institute, Council of Nigeria Agriculture Taiwan Prof. Dr. Stylianos Chatzipanagiotou University of Athens – Medical School Prof. Dra. Suzan Pantaroto de Vasconcellos Greec Universidade Federal de São Paulo Rua Prof. Artur Riedel, 275 Jd. Eldorado, Diadema, SP Dr. Dongqing BAI CEP 09972-270 Department of Fishery Science, Brasil Tianjin Agricultural College, Tianjin 300384 Dr. Maria Leonor Ribeiro Casimiro Lopes Assad P. R. China Universidade Federal de São Carlos - Centro de Ciências Agrárias - CCA/UFSCar Dr. Dingqiang Lu Departamento de Recursos Naturais e Proteção Nanjing University of Technology Ambiental P.R. China Rodovia Anhanguera, km 174 - SP-330 Araras - São Paulo Dr. L. B. Sukla Brasil Scientist –G & Head, Biominerals Department, IMMT, Bhubaneswar Dr. Pierangeli G. Vital India Institute of Biology, College of Science, University of the Philippines Dr. Hakan Parlakpinar Philippines MD. Inonu University, Medical Faculty, Department of Pharmacology, Malatya Prof. Roland Ndip Turkey University of Fort Hare, Alice South Africa Dr Pak-Lam Yu Massey University Dr. Shawn Carraher New Zealand University of Fort Hare, Alice South Africa Dr Percy Chimwamurombe University of Namibia Dr. José Eduardo Marques Pessanha Namibia Observatório de Saúde Urbana de Belo Horizonte/Faculdade de Medicina da Universidade Dr. Euclésio Simionatto Federal de Minas Gerais State University of Mato Grosso do Sul-UEMS Brasil Brazil

Dr. Yuanshu Qian Dr. N Saleem Basha Department of Pharmacology, Shantou University M. Pharm (Pharmaceutical Biotechnology) Medical College Eritrea (North East Africa) China Prof. Dr. João Lúcio de Azevedo Dr. Helen Treichel Dept. Genetics-University of São Paulo-Faculty of URI-Campus de Erechim Agriculture- Piracicaba, 13400-970 Brazil Brasil

Dr. Xiao-Qing Hu Dr. Julia Inés Fariña State Key Lab of Food Science and Technology PROIMI-CONICET Jiangnan University Argentina P. R. China Dr. Yutaka Ito Dr. Olli H. Tuovinen Kyoto University Ohio State University, Columbus, Ohio Japan USA Dr. Cheruiyot K. Ronald Prof. Stoyan Groudev Biomedical Laboratory Technologist University of Mining and Geology “Saint Ivan Rilski” Kenya Sofia Bulgaria Prof. Dr. Ata Akcil S. D. University Dr. G. Thirumurugan Turkey Research lab, GIET School of Pharmacy, NH-5, Chaitanya nagar, Rajahmundry-533294. Dr. Adhar Manna India The University of South Dakota USA Dr. Charu Gomber Thapar University Dr. Cícero Flávio Soares Aragão India Federal University of Rio Grande do Norte Brazil Dr. Jan Kuever Bremen Institute for Materials Testing, Dr. Gunnar Dahlen Department of Microbiology, Institute of odontology, Sahlgrenska Academy at Paul-Feller-Str. 1, 28199 Bremen University of Gothenburg Germany Sweden

Dr. Nicola S. Flanagan Dr. Pankaj Kumar Mishra Universidad Javeriana, Cali Vivekananda Institute of Hill Agriculture, (I.C.A.R.), Colombia ALMORA-263601, Uttarakhand India Dr. André Luiz C. M. de A. Santiago Universidade Federal Rural de Pernambuco Dr. Benjamas W. Thanomsub Brazil Srinakharinwirot University Thailand Dr. Dhruva Kumar Jha Microbial Ecology Laboratory, Dr. Maria José Borrego Department of Botany, National Institute of Health – Department of Infectious Gauhati University, Diseases Guwahati 781 014, Assam Portugal India

Dr. Catherine Carrillo Dr. Tang Ming Health Canada, Bureau of Microbial Hazards College of Forestry, Northwest A&F University, Canada Yangling China Dr. Marcotty Tanguy Institute of Tropical Medicine Dr. Olga Gortzi Belgium Department of Food Technology, T.E.I. of Larissa Greece Dr. Han-Bo Zhang Laboratory of Conservation and Utilization for Bio- Dr. Mark Tarnopolsky resources Mcmaster University Key Laboratory for Microbial Resources of the Canada Ministry of Education, Yunnan University, Kunming 650091. Dr. Sami A. Zabin School of Life Science, Al Baha University Yunnan University, Kunming, Saudi Arabia Yunnan Province 650091. China Dr. Julia W. Pridgeon Aquatic Animal Health Research Unit, USDA, ARS Dr. Ali Mohammed Somily USA King Saud University Saudi Arabia Dr. Lim Yau Yan Monash University Sunway Campus Dr. Nicole Wolter Malaysia National Institute for Communicable Diseases and University of the Witwatersrand, Prof. Rosemeire C. L. R. Pietro Johannesburg Faculdade de Ciências Farmacêuticas de Araraquara, South Africa Univ Estadual Paulista, UNESP Brazil Dr. Marco Antonio Nogueira Universidade Estadual de Londrina Dr. Nazime Mercan Dogan CCB/Depto. De microbiologia PAU Faculty of Arts and Science, Denizli Laboratório de Microbiologia Ambiental Turkey Caixa Postal 6001 86051-980 Londrina. Dr Ian Edwin Cock Brazil Biomolecular and Physical Sciences Griffith University Dr. Bruno Pavoni Australia Department of Environmental Sciences University of Venice Prof. N K Dubey Italy Banaras Hindu University India Dr. Shih-Chieh Lee Da-Yeh University Dr. S. Hemalatha Taiwan Department of Pharmaceutics, Institute of Technology, Dr. Satoru Shimizu Banaras Hindu University, Varanasi. 221005 Horonobe Research Institute for the Subsurface India Environment, Northern Advancement Center for Science & Dr. J. Santos Garcia A. Technology Universidad A. de Nuevo Leon Japan Mexico India

Dr. Somboon Tanasupawat Dr. Mick Bosilevac Department of Biochemistry and Microbiology, US Meat Animal Research Center Faculty of Pharmaceutical Sciences, USA Chulalongkorn University, Bangkok 10330 Dr. Nora Lía Padola Thailand Imunoquímica y Biotecnología- Fac Cs Vet-UNCPBA Argentina Dr. Vivekananda Mandal Post Graduate Department of Botany, Dr. Maria Madalena Vieira-Pinto Darjeeling Government College, Universidade de Trás-os-Montes e Alto Douro Darjeeling – 734101. Portugal India Dr. Stefano Morandi Dr. Shihua Wang CNR-Istituto di Scienze delle Produzioni Alimentari College of Life Sciences, (ISPA), Sez. Milano Fujian Agriculture and Forestry University Italy China Dr Line Thorsen Dr. Victor Manuel Fernandes Galhano Copenhagen University, Faculty of Life Sciences CITAB-Centre for Research and Technology of Agro- Denmark Environment and Biological Sciences, Integrative Biology and Quality Research Group, Dr. Ana Lucia Falavigna-Guilherme University of Trás-os-Montes and Alto Douro, Universidade Estadual de Maringá Apartado 1013, 5001-801 Vila Real Brazil Portugal Dr. Baoqiang Liao Dr. Maria Cristina Maldonado Dept. of Chem. Eng., Lakehead University, 955 Oliver Instituto de Biotecnologia. Universidad Nacional de Road, Thunder Bay, Ontario Tucuman Canada Argentina Dr. Ouyang Jinping Dr. Alex Soltermann Patho-Physiology department, Institute for Surgical Pathology, Faculty of Medicine of Wuhan University University Hospital Zürich China Switzerland Dr. John Sorensen Dr. Dagmara Sirova University of Manitoba Department of Ecosystem Biology, Faculty Of Science, Canada University of South Bohemia, Branisovska 37, Ceske Budejovice, 37001 Dr. Andrew Williams Czech Republic University of Oxford United Kingdom Dr. E. O Igbinosa Department of Microbiology, Dr. Chi-Chiang Yang Ambrose Alli University, Chung Shan Medical University Ekpoma, Edo State, Taiwan, R.O.C. Nigeria. Dr. Quanming Zou Dr. Hodaka Suzuki Department of Clinical Microbiology and Immunology, National Institute of Health Sciences College of Medical Laboratory, Japan Third Military Medical University China

Prof. Ashok Kumar Dr. Guanghua Wang School of Biotechnology, Northeast Institute of Geography and Agroecology, Banaras Hindu University, Varanasi Chinese Academy of Sciences India China

Dr. Chung-Ming Chen Dr. Renata Vadkertiova Department of Pediatrics, Taipei Medical University Institute of Chemistry, Slovak Academy of Science Hospital, Taipei Slovakia Taiwan Dr. Charles Hocart Dr. Jennifer Furin The Australian National University Harvard Medical School Australia USA Dr. Guoqiang Zhu Dr. Julia W. Pridgeon University of Yangzhou College of Veterinary Medicine Aquatic Animal Health Research Unit, USDA, ARS China USA Dr. Guilherme Augusto Marietto Gonçalves Dr Alireza Seidavi São Paulo State University Islamic Azad University, Rasht Branch Brazil Iran Dr. Mohammad Ali Faramarzi Dr. Thore Rohwerder Tehran University of Medical Sciences Helmholtz Centre for Environmental Research UFZ Iran Germany Dr. Suppasil Maneerat Dr. Daniela Billi Department of Industrial Biotechnology, Faculty of University of Rome Tor Vergat Agro-Industry, Prince of Songkla University, Hat Yai Italy 90112 Thailand Dr. Ivana Karabegovic Faculty of Technology, Leskovac, University of Nis Dr. Francisco Javier Las heras Vazquez Serbia Almeria University Spain Dr. Flaviana Andrade Faria IBILCE/UNESP Dr. Cheng-Hsun Chiu Brazil Chang Gung memorial Hospital, Chang Gung University Prof. Margareth Linde Athayde Taiwan Federal University of Santa Maria Brazil Dr. Ajay Singh DDU Gorakhpur University, Gorakhpur-273009 (U.P.) Dr. Guadalupe Virginia Nevarez Moorillon India Universidad Autonoma de Chihuahua Mexico Dr. Karabo Shale Central University of Technology, Free State Dr. Tatiana de Sousa Fiuza South Africa Federal University of Goias Brazil Dr. Lourdes Zélia Zanoni Department of Pediatrics, School of Medicine, Federal Dr. Indrani B. Das Sarma University of Mato Grosso do Sul, Campo Grande, Jhulelal Institute of Technology, Nagpur Mato Grosso do Sul India Brazil

Dr. Tulin Askun Dr. Hongxiong Guo Balikesir University STD and HIV/AIDS Control and Prevention, Turkey Jiangsu provincial CDC, China Dr. Marija Stankovic Institute of Molecular Genetics and Genetic Dr. Konstantina Tsaousi Engineering Life and Health Sciences, Republic of Serbia School of Biomedical Sciences, University of Ulster Dr. Scott Weese University of Guelph Dr. Bhavnaben Gowan Gordhan Dept of Pathobiology, Ontario Veterinary College, DST/NRF Centre of Excellence for Biomedical TB University of Guelph, Research Guelph, Ontario, N1G2W1, University of the Witwatersrand and National Health Canada Laboratory Service P.O. Box 1038, Johannesburg 2000, Dr. Sabiha Essack South Africa School of Health Sciences South African Committee of Health Sciences Dr. Ernest Kuchar University of KwaZulu-Natal Pediatric Infectious Diseases, Private Bag X54001 Wroclaw Medical University, Durban 4000 Wroclaw Teaching Hospital, South Africa Poland

Dr. Hare Krishna Dr. Hongxiong Guo Central Institute for Arid Horticulture, STD and HIV/AIDS Control and Prevention, Beechwal, Bikaner-334 006, Rajasthan, Jiangsu provincial CDC, India China

Dr. Anna Mensuali Dr. Mar Rodriguez Jovita Dept. of Life Science, Food Hygiene and Safety, Faculty of Veterinary Scuola Superiore Science. Sant’Anna University of Extremadura, Spain Dr. Ghada Sameh Hafez Hassan Pharmaceutical Chemistry Department, Dr. Jes Gitz Holler Faculty of Pharmacy, Mansoura University, Hospital Pharmacy, Egypt Aalesund. Central Norway Pharmaceutical Trust Professor Brochs gt. 6. 7030 Trondheim, Dr. Kátia Flávia Fernandes Norway Biochemistry and Molecular Biology Universidade Federal de Goiás Prof. Chengxiang FANG Brasil College of Life Sciences, Wuhan University Dr. Abdel-Hady El-Gilany Wuhan 430072, P.R.China Public Health & Community Medicine Faculty of Medicine, Dr. Anchalee Tungtrongchitr Mansoura University Siriraj Dust Mite Center for Services and Research Egypt Department of Parasitology, Faculty of Medicine Siriraj Hospital, Mahidol University 2 Prannok Road, Bangkok Noi, Bangkok, 10700, Thailand

Instructions for Author

Electronic submission of manuscripts is strongly Regular articles encouraged, provided that the text, tables, and figures are included in a single Microsoft Word file (preferably in Arial All portions of the manuscript must be typed double- font). spaced and all pages numbered starting from the title page. The cover letter should include the corresponding author's full address and telephone/fax numbers and should be in The Title should be a brief phrase describing the contents an e-mail message sent to the Editor, with the file, whose of the paper. The Title Page should include the authors' name should begin with the first author's surname, as an full names and affiliations, the name of the corresponding attachment. author along with phone, fax and E-mail information. Present addresses of authors should appear as a footnote. Article Types Three types of manuscripts may be submitted: The Abstract should be informative and completely self- explanatory, briefly present the topic, state the scope of Regular articles: These should describe new and carefully the experiments, indicate significant data, and point out confirmed findings, and experimental procedures should major findings and conclusions. The Abstract should be be given in sufficient detail for others to verify the work. 100 to 200 words in length.. Complete sentences, active The length of a full paper should be the minimum required verbs, and the third person should be used, and the to describe and interpret the work clearly. abstract should be written in the past tense. Standard Short Communications: A Short Communication is suitable nomenclature should be used and abbreviations should for recording the results of complete small investigations be avoided. No literature should be cited. or giving details of new models or hypotheses, innovative Following the abstract, about 3 to 10 key words that will methods, techniques or apparatus. The style of main provide indexing references should be listed. sections need not conform to that of full-length papers. Short communications are 2 to 4 printed pages (about 6 to A list of non-standard Abbreviations should be added. In 12 manuscript pages) in length. general, non-standard abbreviations should be used only when the full term is very long and used often. Each Reviews: Submissions of reviews and perspectives covering abbreviation should be spelled out and introduced in topics of current interest are welcome and encouraged. parentheses the first time it is used in the text. Only Reviews should be concise and no longer than 4-6 printed recommended SI units should be used. Authors should pages (about 12 to 18 manuscript pages). Reviews are also use the solidus presentation (mg/ml). Standard peer-reviewed. abbreviations (such as ATP and DNA) need not be defined.

Review Process The Introduction should provide a clear statement of the problem, the relevant literature on the subject, and the All manuscripts are reviewed by an editor and members of proposed approach or solution. It should be the Editorial Board or qualified outside reviewers. Authors understandable to colleagues from a broad range of cannot nominate reviewers. Only reviewers randomly scientific disciplines. selected from our database with specialization in the subject area will be contacted to evaluate the manuscripts. Materials and methods should be complete enough to The process will be blind review. allow experiments to be reproduced. However, only truly Decisions will be made as rapidly as possible, and the new procedures should be described in detail; previously Journal strives to return reviewers’ comments to authors as published procedures should be cited, and important fast as possible. The editorial board will re-review modifications of published procedures should be manuscripts that are accepted pending revision. It is the mentioned briefly. Capitalize trade names and include the goal of the AJMR to publish manuscripts within weeks manufacturer's name and address. Subheadings should be after submission. used. Methods in general use need not be described in detail.

Results should be presented with clarity and precision. 1987a,b; Tijani, 1993,1995), (Kumasi et al., 2001) The results should be written in the past tense when References should be listed at the end of the paper in describing findings in the authors' experiments. alphabetical order. Articles in preparation or articles Previously published findings should be written in the submitted for publication, unpublished observations, present tense. Results should be explained, but largely personal communications, etc. should not be included without referring to the literature. Discussion, in the reference list but should only be mentioned in speculation and detailed interpretation of data should the article text (e.g., A. Kingori, University of Nairobi, not be included in the Results but should be put into the Kenya, personal communication). Journal names are Discussion section. abbreviated according to Chemical Abstracts. Authors are fully responsible for the accuracy of the references. The Discussion should interpret the findings in view of the results obtained in this and in past studies on this Examples: topic. State the conclusions in a few sentences at the end of the paper. The Results and Discussion sections can Chikere CB, Omoni VT and Chikere BO (2008). include subheadings, and when appropriate, both Distribution of potential nosocomial pathogens in a sections can be combined. hospital environment. Afr. J. Biotechnol. 7: 3535-3539.

The Acknowledgments of people, grants, funds, etc Moran GJ, Amii RN, Abrahamian FM, Talan DA (2005). should be brief. Methicillinresistant Staphylococcus aureus in community-acquired skin infections. Emerg. Infect. Dis. Tables should be kept to a minimum and be designed to 11: 928-930. be as simple as possible. Tables are to be typed double- spaced throughout, including headings and footnotes. Pitout JDD, Church DL, Gregson DB, Chow BL, Each table should be on a separate page, numbered McCracken M, Mulvey M, Laupland KB (2007). consecutively in Arabic numerals and supplied with a Molecular epidemiology of CTXM-producing heading and a legend. Tables should be self-explanatory Escherichia coli in the Calgary Health Region: without reference to the text. The details of the methods emergence of CTX-M-15-producing isolates. used in the experiments should preferably be described Antimicrob. Agents Chemother. 51: 1281-1286. in the legend instead of in the text. The same data should not be presented in both table and graph form or Pelczar JR, Harley JP, Klein DA (1993). Microbiology: repeated in the text. Concepts and Applications. McGraw-Hill Inc., New York, pp. 591-603. Figure legends should be typed in numerical order on a separate sheet. Graphics should be prepared using applications capable of generating high resolution GIF, Short Communications TIFF, JPEG or Powerpoint before pasting in the Microsoft Word manuscript file. Tables should be prepared in Short Communications are limited to a maximum of Microsoft Word. Use Arabic numerals to designate two figures and one table. They should present a figures and upper case letters for their parts (Figure 1). complete study that is more limited in scope than is Begin each legend with a title and include sufficient found in full-length papers. The items of manuscript description so that the figure is understandable without preparation listed above apply to Short reading the text of the manuscript. Information given in Communications with the following differences: (1) legends should not be repeated in the text. Abstracts are limited to 100 words; (2) instead of a separate Materials and Methods section, experimental References: In the text, a reference identified by means procedures may be incorporated into Figure Legends of an author‘s name should be followed by the date of and Table footnotes; (3) Results and Discussion should the reference in parentheses. When there are more than be combined into a single section. two authors, only the first author‘s name should be Proofs and Reprints: Electronic proofs will be sent (e- mentioned, followed by ’et al‘. In the event that an mail attachment) to the corresponding author as a PDF author cited has had two or more works published during file. Page proofs are considered to be the final version the same year, the reference, both in the text and in the of the manuscript. With the exception of typographical reference list, should be identified by a lower case letter or minor clerical errors, no changes will be made in the like ’a‘ and ’b‘ after the date to distinguish the works. manuscript at the proof stage.

Examples:

Abayomi (2000), Agindotan et al. (2003), (Kelebeni, 1983), (Usman and Smith, 1992), (Chege, 1998;

Fees and Charges: Authors are required to pay a $550 handling fee. Publication of an article in the African Journal of Microbiology Research is not contingent upon the author's ability to pay the charges. Neither is acceptance to pay the handling fee a guarantee that the paper will be accepted for publication. Authors may still request (in advance) that the editorial office waive some of the handling fee under special circumstances

Copyright: © 2014, Academic Journals. All rights Reserved. In accessing this journal, you agree that you will access the contents for your own personal use but not for any commercial use. Any use and or copies of this Journal in whole or in part must include the customary bibliographic citation, including author attribution, date and article title.

Submission of a manuscript implies: that the work described has not been published before (except in the form of an abstract or as part of a published lecture, or thesis) that it is not under consideration for publication elsewhere; that if and when the manuscript is accepted for publication, the authors agree to automatic transfer of the copyright to the publisher.

Disclaimer of Warranties

In no event shall Academic Journals be liable for any special, incidental, indirect, or consequential damages of any kind arising out of or in connection with the use of the articles or other material derived from the AJMR, whether or not advised of the possibility of damage, and on any theory of liability. This publication is provided "as is" without warranty of any kind, either expressed or implied, including, but not limited to, the implied warranties of merchantability, fitness for a particular purpose, or non-infringement. Descriptions of, or references to, products or publications does not imply endorsement of that product or publication. While every effort is made by Academic Journals to see that no inaccurate or misleading data, opinion or statements appear in this publication, they wish to make it clear that the data and opinions appearing in the articles and advertisements herein are the responsibility of the contributor or advertiser concerned. Academic Journals makes no warranty of any kind, either express or implied, regarding the quality, accuracy, availability, or validity of the data or information in this publication or of any other publication to which it may be linked.

African Journal of Microbiology Research International Journal of Medicine and Medical Sciences

Table of Content: Volume 8 Number 8, February 19, 2014

ARTICLES

Morphological and molecular characterization of pathogenic isolates of Fusarium spp. obtained from gladiolus corms and their sensitivity to Jatropha curcas L. oil Liliana Córdova Albores, Silvia Bautista Baños, Jorge Martínez Herrera, Laura Barrera Necha, Mónica Hernández López and Andrés Cruz Hernández

Screening phosphate solubilizing actinobacteria isolated from the rhizosphere of wild plants from the Eastern Cordillera of the Colombian Andes Luis Daniel Prada Salcedo, Carolina Prieto and Marcela Franco Correa

Establishment of EvaGreen qPCR for detecting bovine rotavirus based on VP7 gene Wei Suocheng, Che Tuanjie, Wang Jingming, Li Yukong, Zhang Taojie, Song Changjun and Tian Fengling

Nutritional requirements for the production of antimicrobial metabolites from Streptomyces Mariadhas Valan Arasu, Thankappan Sarasam Rejiniemon, Naif Abdullah Al-Dhabi, Veeramuthu Duraipandiyan, Savarimuthu Ignacimuthu, Paul Agastian, Sun-Ju Kim, V. Aldous J. Huxley, Kyung Dong Lee, Ki Choon Choi

Incidence of Aspergillus contamination of groundnut (Arachis hypogaea L.) in Eastern Ethiopia Abdi Mohammed and Alemayehu Chala

Microencapsulation, survival and adherence studies of indigenous probiotics Ammara Hassan, M. Nawaz Ch and Barbara Rasco

Screening novel diagnostic marker of Mycobacterium tuberculosis Xin Pan, Siliang Zeng, Jialin Cai, Bin Zhang, Boju Pan, Zhonglei Pan, Ying Wu, Ying Wang, Yi Zhou, Wei Fang, Min Chen, Wanqing Liao, XiuZhen Yu, Min Tao, Jun Zhang and Wei Song

An outbreak of ringworm caused by Trichophyton verrucosum in a group of calves in Vom, Nigeria Dalis, J. S., Kazeem, H. M., Kwaga, J. K. P. and Kwanashie, C. N.

African Journal of Microbiology Research

Table of Content: Volume 8 Number 8, February 19, 2014

Characteristics of nodule bacteria from Mimosa spp grown in soils of the Brazilian semiarid region Ana Dolores Santiago de Freitas, Wardsson Lustrino Borges, Monaliza Mirella de Morais Andrade, Everardo Valadares de Sá Barretto Sampaio, Carolina Etienne de Rosália e Silva Santos, Samuel Ribeiro Passos, Gustavo Ribeiro Xavier, Bruno Mello Mulato and Maria do Carmo Catanho Pereira de Lyra

Microbiological assessment of dentists’ hands in clinical performance Márcia Rosental da Costa CARMO, Jorge Kleber CHAVASCO, Solange de Oliveira Braga FRANZOLIN, Luiz Alberto BEIJO, Júlia Rosental de SOUZA CRUZ and Paulo Henrique WECKWERTH

Evaluation of marine macro alga, Ulva fasciata against bio-luminescent causing Vibrio harveyi during Penaeus monodon larviculture Krishnamoorthy Sivakumar, Sudalayandi Kannappan, Masilamani Dineshkumar and Prasanna Kumar Patil

Characterization and determination of antibiotic susceptibility pattern of bacteria isolated from some fomites in a teaching hospital in northern Nigeria Aminu Maryam, Usman-Sani Hadiza and Usman M. Aminu

Prevalence of different enterococcal species isolated from blood and their susceptibility to antimicrobial drugs in Vojvodina, Serbia, 2011-2013 Mihajlović-Ukropina Mira, Medić Deana, Jelesić Zora, Gusman Vera, Milosavljević Biljana and Radosavljević Biljana

Prevalence of anti-Anaplasma phagocytophilum antibodies among dogs from Monterrey, Mexico J. A. Salinas-Meléndez, R. Villavicencio-Pedraza, B. V. Tamez-Hernández, J. J. Hernández-Escareño, R. Avalos-Ramírez, J. J. Zarate-Ramos, F. J. Picón-Rubio and V. M. Riojas-Valdés

Novel simple diagnostic methods compared to advanced ones for the diganosis of Chlamydia trachomatis, Ureaplasma urealyticum and Mycoplasmas hominis in patients with complicated urinary tract infections Hala Badawi, Aisha Abu Aitta, Maisa Omar, Ahmed Ismail, Hanem Mohamed, Manal El Said, Doaa Gamal, Samah Saad El Dine and Mohamed Ali Saber

Full Length Research Paper

Morphological and molecular characterization of pathogenic isolates of Fusarium spp. obtained from gladiolus corms and their sensitivity to Jatropha curcas L. oil

Liliana Córdova Albores1, Silvia Bautista Baños1, Jorge Martínez Herrera1, Laura Barrera Necha1, Mónica Hernández López1 and Andrés Cruz Hernández2

1Instituto Politécnico Nacional-Centro de Desarrollo de Productos Bióticos. Carr. Yautepec-Jojutla km. 6, San Isidro, CEPROBI 8, Yautepec, Morelos, C. P. 62731, México. 2Universidad Autónoma de Querétaro. Laboratorio de Microbiología, Facultad de Ciencias Naturales-Biología. Av. de las Ciencias s/n, Juriquilla, Querétaro, Delegación Santa Rosa Jauregui. C.P. 76230. México.

Accepted 30 January, 2014

The State of Morelos is the third biggest gladiolus producer in Mexico. However, this ornamental is affected by the disease named corm rot or fusarium yellows, characterized by leaf yellowing, epinasty and wilting, and caused by fungi of the genus Fusarium. The first objective was to corroborate the pathogenicity of the 45 isolates obtained. The second objective was to identify and characterize morphologically and molecularly by polymerase chain reaction-internal transcribed spacer (PCR-ITS), the highly pathogenic isolates and comparatively analyze the fungal species involved with the reference strain Fusarium oxysporum f. sp. gladioli (Fog). The third objective was to quantify the phorbol esters in Jatropha curcas oil and evaluate their antifungal potential on mycelial growth and conidial germination of different Fusarium species. Eleven isolates were highly significant pathogenic (P < 0.001). Three fungal species were identified in basal stems and damaged corms taken from field plants, namely F. oxysporum, Fusarium solani and Fusarium proliferatum. Molecular analyzes corroborated the species identified and their sequences were deposited in the National Center for Biotechnology Information (NCBI) gene bank. The percentage of oil obtained was 61.5 %; the phorbol ester content in the oil was 1.52 mg g-1 of 12,13-phorbol myristate. All species identified and the reference strain was sensitive to the 5 mg mL-1 oil concentration.

Key words: Corm rot, Fusarium, molecular analysis, phorbol esters, Fusarium development.

INTRODUCTION

The gladiolus is one of the main crops in the State of among the most important plant pathogens worldwide. Morelos, which ranks as Mexico’s third biggest producer Fusarium species are widely distributed in soil and of this flowering plant. Corm rot is caused by Fusarium organic substrates and are abundant in cultivated soils in spp. and results in losses of 60-80% during storage temperate and tropical regions (Booth, 1985). Some (SAGARPA, 2006). Members of the genus Fusarium are species of this genus produce mycotoxins in stored food

*Corresponding author. E-mail: [email protected]. Tel: 52 7353942020. Albores et al. 725

and cause disease in animals and humans (Ortoneda et obtained and evaluate their response to J. curcas seed al., 2003). Like many soil-borne fungi, the genus oil. Fusarium is amply endowed with means of survival, one of its mechanisms being the ability to rapidly change both MATERIALS AND METHODS its host and its morphology and behavior (Booth, 1985; Alves-Santos et al., 1999; Katan and Di Primo, 1999; Sampled material Ortoneda et al., 2003). Differentiation of Fusarium spp. is based on physiological and morphological characteristics, Corms and plants (yellowing of leaves and corms with basal rot) of such as the size and shape of macroconidia, presence or five varieties (‘White foam’, ‘Red ewe’, ‘White ewe’, ‘Yellow’ and absence of microconidia and chlamydospores, and ‘Sancerri’) were collected in the field in seven producing municipalities in the State of Morelos. A total of 34 plants showing colony morphology. Subtle differences in a single feature symptoms of corm rot were collected from August to October 2011 can delineate species. Characterization by molecular from commercial fields in Cuautla, Yautepec, Ayala, Tlanepantla, techniques using polymerase chain reaction (PCR) to Temixco, Yecapixtla and Totolapan. amplify the internal transcribed sequences (ITS) allows identifying organisms that cannot be distinguished Isolation of fungi morphologically, and they can also help to understand the mechanisms of pathogenic variation and therefore, to Soil and roots were removed from gladiolus corms by washing with develop effective management strategies (Flores-Olivas running water and then corms were immersed in an acaricide et al., 1997; Alves-Santos et al., 1999; Baayen, 2000; solution (AK®20) at a concentration of 15 ml l-1 for 5 min and left to Haan et al., 2000). Management by synthetic fungicides dry. They were disinfected with a sodium hypochlorite solution at leads to resistance, environmental pollution, elimination 5% for 3 min, rinsed with sterile distilled water and placed in humid chambers for 24 h to promote fungal growth. From mycelium of beneficial entomofauna and operator poisoning. developed in the corms, isolates were made on Potato Dextrose Consequently, there are a large number of reports on the Agar (PDA) medium and incubated at room temperature for 7 days. development of alternatives such as the use of essential Monosporic cultures were established as described by Leslie and oils (Pauli and Knobloch, 1987; Pintore et al., 2002; Summerell (2006). Barrera-Necha and García-Barrera, 2008; Barrera-Necha et al., 2009; Tripathi et al., 2009); however, there are few reports on the use of vegetable oils. Jatropha curcas Pathogenicity tests belongs to the family Euforbiaceae. In Mexico, the latex Forty-five isolates showed differences in the color of the colonies of this plant is used to treat mouth infections and and initially they were selected as different species. Healthy corms digestive problems caused by certain fungi, and to make of the variety ‘White foam’, pre-peeled and pre-treated with a ® -1 biodiesel, which gives it considerable economic contact fungicide (Captan 2 g L ), were planted in sterile soil importance (Martínez-Herrera, 2006). The seeds contain (121°C, 15 lb pressure for 3 h) under greenhouse conditions. Once the approximately 1-cm stem emerged, 5 mL of the isolated spore chemical compounds, among which tannins, saponins solution of each isolate to examine were added at a concentration and phorbol esters stand out for their possible biological of 1 × 106 spores ml-1. The reference strain used was Fusarium activity. J. curcas oil has insecticidal activity (Wink et al., oxysporum f. sp. gladioli (Fog) already molecularly identified 1997), and it has also been tested as an antimicrobial (Garduño-Pizaña et al., 2010) and it was treated in the same way agent to treat infections, including sexually transmitted without inoculation. Plants were assessed three weeks after ones, in humans (Aiyelaagbe et al. 2007). Based on this, inoculation. To statistically assess pathogenicity, a damage scale was studies have focused on fungal development in in vitro developed based on the corm rot symptoms observed in the plants, tests demonstrating that mycelial growth of several fungi, assigning it numerical values: no symptoms (plant and corm) (1); including Alternaria alternata, Aspergillus flavus, A. epinasty/stunting (2); yellowing (3); plant did not emerge with root fumigans, A. niger and Fusarium chladmydosporum, is development (4); plant did not emerge (5) (Mendoza, 1977). inhibited when grown on seed oil and crude seed extracts at concentrations of 100 and 500 µl (Srivastava et al., Data analysis 2012). In an attempt to evaluate the fungicidal effect of different plant organs of J. curcas, it was found that A completely randomized design with 5 replicates for each isolate seeds followed by the fruit pulp and the whole fruit had and a control treatment (reference strain, labeled as Fog) were significant inhibition of the mycelia of the fungus used. Analysis of variance of repeated means and a multiple Colletrotrichum gloeosporioides isolated from papaya comparison against the control were performed with the Holm-Sidak method (P < 0.05) using the Sigma Stat 3.5 statistical package fruits (Rahman et al., 2011). Therefore, it is necessary to designed by STATCON© Witzenhausen, Germany. carry out studies to evaluate the use of different antifungal compounds to control fungal diseases such as phorbol esters contain in seed oil. The aims of this study Morphological characterization were to verify the pathogenicity of the isolates obtained For taxonomic identification of the isolates, the classification from gladiolus corms in the State of Morelos, to morpho- methodology of Nelson et al. (1983) and Leslie and Summerell logically and molecularly characterize Fusarium isolates (2006) was used. These authors suggest taking as references the 726 Afr. J. Microbiol. Res.

colony colors on PDA, and the length of the phialides, 52’ 17” North; 92° 27’ 04” West, at 26 masl. 3) Ejido la Victoria, chlamydospores, microconidia and macroconidia. The length of the municipality of Mazatán, Chiapas, 14° 49’ 16” North; 92° 29’ 56” structures was measured using ImageTool© software for Windows West, at 10 masl. Location altitudes were taken with a GPS lll Version 3.0 Alpha 4 designed by the Center for Health Sciences, (Garmin, GPS lll Plus model, Ronsey, UK). University of Texas. Morphological observations and measurements were made with a compound microscope at 40x. Oil extraction

Molecular characterization The extraction of the seed oil was performed according to the Soxhlet method (NMX-F-089-S-1978), with petroleum ether and DNA extraction from 12 monosporic isolates was performed by the hexane and 8-h reflux time. About 2 to 5 g of ground J. curcas method described by Doyle and Doyle (1990), with modifications. seeds were weighed and placed in the extraction thimble. After The quality of the DNA obtained was verified by electrophoresis on extraction, the solvent was gently evaporated from the flask and the 1 % agarose gel stained with ethidium bromide (0.1 µg µl-1) and excess petroleum ether or hexane was removed using a BÜCHI ® observed in a gel documentation system (G Box®; Syngene, model 114 rotary evaporator (BÜCHI Labortechnik AG, Switzer- England). DNA concentration was calculated by measuring the land) at 60°C. The calculations to determine the percentage of oil optical density at 260 nm with the following formula: obtained was performed using the formula:

[DNA] = Oil (%) = (P-p/M) × 100 [DNA] =

Where: P = mass in grams of the flask with the oil; p = mass in grams of the flask; M = mass in grams of the sample. PCR for ITS primers Phorbol esters were quantified using the high performance liquid chromatography (HPLC) method described by Martínez-Herrera The ITS regions were amplified with the primers ITS1 (2006). Specifically, 20 ml of methanol were added to a 2 g sample, (TCCGTAGGTGAACCTGCGG), ITS2 which was sonicated for 2 min. The sample was centrifuged at 3600 (TCCTCCGCTTATTGATATGC) and ITS5 rpm for 10 min and the supernatant was evaporated almost to dry- (GGAAGTAAAAGTCGTAACAAGG) (White et al., 1990; Haan et ness in a rotary evaporator (the extraction was repeated 3 times). al., 2000; Abd-Elsalam et al., 2003; Moreno-Velázquez et al., 2005; The standard used was 12,13-phorbol myristate (Sigma Aldrich®), Teixeira et al., 2005; González-Pérez et al., 2009), as well as the which showed a retention time of 25 min. The results were -1 specific primers for the genus Fusarium reported by Adb-Elsalam et expressed as mg g of sample equivalent to 12,13-phorbol myristate. al. (2003): ITS-Fu-Fwd (CGCACGATTACCACTAACGA) and ITS- This analysis was performed in the food laboratory of the Institute of Fu-Rev (CAACTCCCAAACCCCTGTGA). The primers were synthe- Animal Production in the Tropics and Subtropics at the University of sized by the Sigma Aldrich® Company. Each PCR reaction was Hohenheim in Stuttgart, Germany. carried out in a final volume of 25 μl; 5.5 μl of nuclease-free water were mixed with 2.0 μl of DNA of the fungus problem, 2.5 μl of each ® ITS and 12.5 μl of Taq 2X Master Mix (BioLabsInc, New England). Mycelial growth ® The amplification reaction was carried out in a Perkin Elmer ther- mocycler (GeneAmp PCR System 2400) with the following pro- Only the 11 isolates mentioned above and the reference strain gram: initial denaturation at 95°C for 5 min; 35 cycles of dena- (Fog) were used to evaluate this parameter. A 5-mm disc of the turation, alignment and extension at 95°C for 1 min and 72°C for 2 pathogen was placed on 60 × 15 mm Petri dishes containing PDA, min. respectively, and a final extension at 72°C for 10 min. The Tween 20® and the oil at different concentrations (2.5, 5 and 10 mg amplified fragments were verified by electrophoresis in 1% agarose -1 -1 -1 ml ), as well as 4 controls: PDA, petroleum ether (10 mg ml ), gel stained with ethidium bromide (0.1 μg μl ). The gel was run at Tween 20® (10 mg ml-1) and Captan® (2 g L-1). They were incubated 85 V for 40 min and observed in a gel documentation system (G ® at 25°C in the dark. Diameter growth was measured daily for 5 days Box ; Syngene, England). with a Vernier caliper until the control treatments reached the edge of the Petri dish. The experimental design was completely randomized and consisted of 7 treatments with 6 replicates. Analysis of Sequencing variance (ANOVA) and Tukey’s comparison of means test (P < 0.05) were performed using the Sigma Stat 3.5 software program © The amplified PCR products were purified using the DNA Clean & designed by STATCON Witzenhausen, Germany. ConcentratorTM-5 Kit (Zymo Research, USA) and analyzed at the Sequencing Laboratory of the Institute of Biotechnology, belonging Spore germination to the University National Autonomous of México, in Cuernavaca, Morelos. The sequences were aligned and compared with sequences in the National Center for Biotechnology Information (NCBI) Ten milliliters of sterile distilled water were added to Petri dishes database using the Basic Local Alignment Search Tool (BLAST) containing the growth of each isolate, then the surface was scraped (Zhang et al., 2000). with a bent metal rod and the filtrate was passed through cotton gauze. Of this suspension, 20 µl were placed on PDA discs of 10 mm in diameter and incubated for 6 to 10 h at room temperature (26°C). Later, a few drops of lactophenol methylene blue were Collection of J. curcas seeds added and the number of germinated spores was determined by photo analysis with Image Tool© software for Windows version 2.01 Seeds were collected from J. curcas plants being used as a living Alpha 4, developed by the Center for Health Sciences at the fence in the following locations: 1) Segunda Sección de la University of Texas. Germination was evaluated on nine PDA discs. Cebadilla, municipality of Tapachula, Chiapas, 14° 50’ 48” North; Mean percentage germination and standard deviations were 92° 17’ 00” West, at 109 masl. 2) Villa de Mazatán, Chiapas, 14° calculated. Albores et al. 727

1 2 3 4 5 6 7 8

Figure 1. Preliminary classification of isolates according to coloring on PDA medium.

RESULTS in isolates T9, T11, T12, T20, T24, T30, T32, T34, T35, T39 and T40, which were collected from the munici- Number of isolates palities of Yautepec and Cuautla (Figure 2). Isolates that showed highly significant differences in the pathogenicity Their morphological aspect, identified as belonging to the capacity were used for morphological and molecular genus Fusarium, obtained a total of 45 isolates. The characterization and J. curcas oil sensitivity testing. isolates showed different apparent morphological characteristics, mainly in the color of the culture medium. Nelson et al. (1983) performed a morphological characterization Morphological characterization using the coloration on PDA as indicating that each species has a specific color. Based on the coloring obtained, Some of the typical structures of the 11 isolates and the a preliminary classification was conducted, obtaining a reference strain (Fog) are summarized in Table 1. total of eight groups as shown in Figure 1.

Pathogenicity tests Molecular characterization

Statistical analysis showed that when compared with the The DNA had a yield of 220 to 670 µg g-1 of mycelium, reference strain Fog (T25), isolates T1, T15, T20, T36 the band of the PCR products containing the primers and T44 were significantly different (P < 0.01), whereas ITS2-ITS5 was 500 base pairs (bp) and the PCR product highly significant differences (P < 0.001) were observed for the primers ITS-Fu-Fwd and ITS-Fu-Rev was from 728 Afr. J. Microbiol. Res.

Figure 2. Comparison of means against the reference strain Fog (T25) of the pathogenic capacity of isolates of Fusarium spp. Significant difference *P < 0.01; **P < 0.001.

410 to 429 bp (Figure 3). For the multiple alignments, the Spore germination total amplified portion of the 12-nucleotide sequences is shown in Table 2, which corresponds to the complete Treatment susceptibility depended on the isolate, as no sequence of both regions (ITS2 and ITS5). In Genbank, trend was observed for any specific treatment (Table 4). the sequence of F. oxysporum f. sp gladioli and isolates Isolate T9 presented the lowest germination rate with J. T30, T35 and T39 showed a similarity index of 99% with curcas oil at concentrations of 2.5 and 10 mg ml-1 with a F. oxysporum. Another five isolates showed a similarity percentage germination of 14.40 and 14.43%, respec- index of 99% with F. proliferatum. Isolates T20 and T34 tively, as compared to 98.44% for the PDA treatment. showed no similarity to other sequences (Table 2). Isolate T24 also showed a low germination rate, which was 12.62 and 17.28% for the concentrations of 2.5 and 5 mg ml-1, respectively. Isolate T24 was the most sus- Oil extraction ceptible to the treatment with the fungicide Captan®, presenting a germination of 33.79% while the PDA treatment The oil percentage obtained for both solvents was 61.5%. had 99.77% germination. Phorbol esters in the kernel meal and the oil extracted with petroleum ether were 0.94 and 1.52 mg g-1, respectively, while the oil extracted with hexane was 0.24 and DISCUSSION 0.67 mg g-1, respectively. The highly pathogenic isolates were characterized morphologically, identifying at least 2 species: F. oxysporum and Mycelium growth Fusarium solani, which had different morphological features, both gross and microscopic, and which were asso- Comparison of means of mycelial growth on the last day ciated with the afore mentioned species. González-Pérez of each treatment indicated that the eleven Fusarium et al. (2009) reported that these species caused rot in isolates and the reference strain (Fog) were more gladiolus in San Martin Texmelucan, Puebla. They also sensitive to the concentration of 5 mg ml-1. Isolates T9, reported that these species differed in terms of colony T11, T20, T32, T34, T35 and T40 were also sensitive to color and morphological characteristics, coinciding with the concentration of 2.5 mg ml-1. For isolate T9, it was the results obtained in this work for descriptions of observed that the concentration of 5 mg ml-1 showed less macro- and micro-conidia, phialides and chlamydospores. mycelial growth than the fungicide Captan®, while for the For their part, Montiel-Gonzalez et al. (2005) described isolate T11 incubated at the same concentration (5 mg the morphological characteristics of F. oxysporum, F. -1 ® ml ) and the control with Tween 20 there were no solani, Fusarium lateritium, Fusarium reticulatum, Fusarium significant differences. The isolate most susceptible to equiseti, Fusarium verticillioides, Fusarium culmorum, the fungicide Captan® was the reference strain (Fog) Fusarium crookwellense, Fusarium proliferatum and (Table 3). Fusarium sporotrichioides present in bean roots in five Albores et al. 729

Table 1. Morphological characteristics of isolates of the genus Fusarium collected in gladiolus-growing areas of the state of Morelos.

Color Macroconidia Isolate Microconidia Chlamydospore Species Anverse Reverse Apical Basal Size (m) # septa Oval with one septa Fog* White Violet Hooked Distinctly notched 50.50-67.49 3 No F. oxysporum Oval

Oval with one septa T9 White Orange Blunt Barely notched 48.72-64.51 3-4 No F. solani Reniform

Oval Single and paired T11 White Brown Hooked Distinctly notched 69.63-73.19 3-4 F. oxysporum Oval with one septa verrucose

White and Oval with one septa T12 Brown Blunt Barely notched 55.37-82.54 3-4 No F. solani orange Oval

Oval T20 White Cream Papillate Barely notched 56.35-67.68 3-4 Single verrucose F. solani Oval with one septa

Oval Single verrucose Pyriform T24 Cream Cream Papillate Barely notched 54.77-87.51 3-4 Paired smooth- F. solani Globose walled Oval with one septa Single and paired T30 White Cream Obovoid with a truncate base NO NO NO NO Fusarium spp. verrucose

Oval Single verrucose T32 White Cream Obovoid with a truncate base Blunt Foot shaped 57.31-69.52 3 Paired smooth- F. oxysporum Oval with one septa walled

Oval Single verrucose Fusarium spp. T34 White Cream NO NO NO NO Obovoid with a truncate base Paired

Oval T35 White Violet NO NO NO NO Single smooth Fusarium spp. Oval with one septa

White and Globose oval Chains 2,3 and 4 T39 Cream NO NO NO NO Fusarium spp. orange Oval with one septa verrucose

Globose T40 Cream Yellow Oval NO NO NO NO Single verrucose Fusarium spp. Obovoid with a truncate base

*Reference strain. 730 Afr. J. Microbiol. Res.

Figure 3. 1% agarose gel electrophoresis of the PCR products of the regions ITS-Fu-Fwd and ITS-Fu-Rev of the isolates of Fusarium spp. Line: M) Molecular marker 100 bp (BioLabsInc, New England), 1) Fog, 2) T9, 3) T11, 4) T12, 5) T20, 6) T24, 7) T30, 8) T32, 9) T34, 10) T35, 11) T39, 12) T40.

Table 2. Morphological and molecular characterization of highly pathogenic isolates from gladiolus corms.

Color Species Isolate Morphological Molecular Molecular Similarity percentage Anverse Reverse Accession number NCBI characterization characterization size (bp) (%) Fusarium Fusarium FOG* White Violet 537 99 GU724514.1 oxysporum oxysporum

T9 White Orange Fusarium solani Fusarium solani 538 99 EU982942.1

Fusarium Fusarium T11 White Brown 553 99 EU839366.1 oxysporum proliferatum

T12 White Brown Fusarium solani Fusarium solani 539 86 EU625405.1 T20 White Cream Fusarium solani No identified 435 T24 Cream Cream Fusarium solani Fusarium solani 456 78 GU355660.1

Fusarium T30 White Cream Fusarium spp 526 99 GU445378.1 oxysporum

Fusarium T32 White Cream Fusarium solani 541 99 FJ460589.1 oxysporum

T34 White Cream Fusarium spp No identified 433

Fusarium T35 White Violet Fusarium spp 516 99 GU724514.1 oxysporum

Fusarium T39 White Cream Fusarium spp 515 99 GU724514.1 oxysporum

T40 Cream Yellow Fusarium spp Fusarium solani 557 99 EU625405.1

states of central Mexico. The descriptions made for the due to the indiscriminate use of fungicides in the region. species isolated in this study also agreed with those Alternatively, these unidentified isolates could be species reported by these authors. Molecular taxonomic results not yet reported. The percentage of J. curcas seed oil by PCR: ITS confirm the morphological identification of reported by Martínez-Herrera et al. (2010) coincides with ten isolates, which corresponded to F. oxysporum, F. the values obtained in this research in seeds from the solani and F. proliferatum. The two isolates that showed state of Chiapas, with a value of 60.4%. The same author no similarity when aligning them using BLAST could be reports phorbol ester values of 2.03 mg g-1 in oil and 0.16 Fusarium species, where genetic variation has occurred mg g-1 in kernel meal. The differences in phorbol ester Albores et al. 731

Table 3. Effect of J. curcas oil on mycelial growth of isolates of Fusarium spp.

Isolate Treatment Fog* T9 T11 T12 T20 T24 T30 T32 T34 T35 T39 T40 PDA 4.08a (0.82) 4.51a (0.82) 4.95a (1.01) 4.19a (0.87) 4.76a (0.96) 3.70a (0.79) 4.26a (0.84) 4.68a (0.96) 4.16a (0.88) 4.91a (0.99) 4.23a (0.90) 4.80a (0.99) Tween®20 3.45a (0.61) 3.10bc (0.53) 2.86c (0.47) 3.55bc (0.5) 2.91d (0.48) 2.61bc (0.46) 3.56ab (0.89) 3.0bc (0.56) 3.56abc (0.70) 3.30bc (0.59) 2.95b (0.54) 3.76b (0.75) Captan® 0.78b (0.08) 1.31d (0.17) 1.43d (0.20) 1.43d (0.19) 1.50e (0.21) 1.08d (0.13) 1.23d (0.19) 0.90 e (0.09) 0.98e (0.09) 1.41e (0.23) 1.66d (0.26) 1.33d (0.20) Petroleum ether 3.91a (0.75) 3.0bc (0.56) 3.93b (0.76) 3.11bc (0.6) 3.78bc (0.74) 3.03ab (0.53) 3.96ab (0.81) 3.66b (0.72) 3.31bcd (0.66) 3.91ab (0.79) 3.51ab (0.74) 3.63b (0.70) Oil 2.5 mg mL-1 3.61a (0.72) 2.78c (0.54) 2.81c (0.47) 3.23bc (0.6) 3.55cd (0.70) 3.33ab (0.68) 3.60ab (0.68) 2.23cd (0.40) 2.76cd (0.52) 2.8cd (0.49) 3.55ab( 0.70) 3.51b (0.67) Oil 5 mg mL-1 1.28b (0.17) 1.26d (0.15) 1.83d (0.28) 1.92d (0.28) 2.06e (0.34) 1.95cd (0.28) 2.61c (0.45) 1.23de (0.14) 2.56d (0.46) 1.98de (0.41) 2.48c (0.42) 2.33c (0.42) Oil 10 mg mL-1 3.39a (0.72) 3.70ab (0.77) 3.11bc (0.61) 3.67ab( 0.6) 4.50ab (0.92) 3.05ab (0.61) 3.38bc (0.68) 3.35b (0.66) 3.78ab (0.79) 3.58bc (0.73) 3.68ab (0.76) 3.55b (0.76)

*Reference strain. Means followed by different letters in each column are significantly different by Tukey test at (α 0.05). Values in parenthesis indicate growth rate (mm day-1).

Table 4. Effect of J. curcas oil on percentage conidial germination of isolates of Fusarium spp.

Treatment Isolate J. curcas oil (mg ml-1) PDA Tween® 20 Captan® Petroleum ether 2.5 5 10 Fog* 97.92 ± 3.77 97.56 ± 5.20 96.26 ± 5.15 96.05 ± 4.68 61.34 ± 18.52 90.06 ± 14.62 39.87 ± 20.86 T9 98.44 ± 1.66 68.44 ± 14.27 65.35 ± 28.05 36.44 ± 25.43 14.40 ± 9.45 44.64 ± 30.46 14.43 ± 11.44 T11 97.55 ± 3.95 95.55 ± 3.12 83.33 ± 17.37 97.11 ± 2.84 96.00 ± 3.00 96.24 ± 4.69 98.22 ± 2.90 T12 99.55 ± 0.88 44.44 ± 22.70 83.33 ± 35.35 97.17 ± 5.65 44.44 ± 22.75 90.74 ± 18.84 97.77 ± 6.66 T20 99.55 ± 0.88 93.96 ± 6.04 41.95 ± 15.71 42.15 ± 10.42 91.55 ± 7.46 52.41 ± 19.90 98.66 ± 1.73 T24 99.77 ± 0.66 86.00 ± 12.84 33.79 ± 21.46 34.25 ± 11.09 12.62 ± 15.46 17.28 ± 6.03 82.66 ± 30.53 T30 97.55 ± 3.97 92.22 ± 7.03 92.07 ± 4.77 90.00 ± 7.28 89.33 ± 5.19 91.85 ± 7.78 55.37 ± 26.10 T32 99.55 ± 0.88 44.44 ± 22.70 83.33 ± 35.35 97.17 ± 5.65 44.44 ± 22.75 90.74 ± 18.84 97.77 ± 6.66 T34 99.77 ± 0.66 97.77 ± 2.10 91.66 ± 17.67 91.31 ± 8.52 89.13 ± 7.54 64.53 ± 33.37 89.58 ± 6.40 T35 100.0 ± 0.00 98.44 ± 2.51 100.00 ± 0.00 100.00 ± 0.00 98.22 ± 3.93 97.22 ± 4.39 91.15 ± 11.99 T39 99.22 ± 1.16 92.06 ± 7.67 99.77 ± 0.66 96.92 ± 4.89 96.33 ± 4.03 60.81 ± 15.04 94.41 ± 5.29 T40 99.77 ± 0.66 98.20 ± 2.18 89.94 ± 12.53 98.97 ± 2.06 91.00 ± 16.78 70.17 ± 20.16 90.54 ± 12.54

*Reference strain. Means and SD.

content for each solvent, obtained in this study, applying a higher temperature to obtain the oil rates between 0.140 and 0.462 mm day-1 were could be because the two solvents have a diffe- with the solvents used, the phorbol esters are de- obtained, when compared with 0.820 to 1.018 mm rent boiling point (68.85 for hexane and 60°C for graded. The greatest effect on mycelial growth for day-1 for the PDA control. Some authors reported petroleum ether) and because the phorbol esters the isolates evaluated was with the J. curcas oil that the effect on the mycelial growth of the com- -1 in the oil are thermolabile, which means that by treatment at the concentration of 5 mg ml . Growth pounds present in the essential oils may be due to 732 Afr. J. Microbiol. Res.

two factors: the first involves inhibition of extracellular Barrera-Necha L, Garduño-Pizaña C, García-Barrera LJ (2009) In vitro enzyme synthesis, and the second the alteration of the antifungal activity of essential oils and their compounds on mycelia growth of Fusarium oxysporum f.sp. gladioli (Massey) Snyder and cell wall structure (Tripathi et al., 2009). Siva et al. (2008) Hansen. Plant Pathol. J. 8:17-21. evaluated the antifungal effect of aqueous, acetone and Booth C (1985) The genus Fusarium. Ed. Commonweath Mycological ethanol extracts of 20 medicinal plants against F. Institute. p. 237. oxysporum f. sp. melongenae. J. curcas was one of the Donlaporn S, Suntornsuk W (2010) Antifungal Activities of Ethanolic Extract from Jatropha curcas Seed Cake. J. Microbiol. Biotechnol. plants evaluated and showed inhibition percentages of 20:319-324. 100% for all extracts used. Donlaporn and Suntornsuk Doyle JJ, Doyle JL (1990). A rapid total DNA preparation procedure for (2010) evaluated the antifungal activity of ethanol ex- fresh plant tissue. Focus 12:13-15. tracts of J. curcas seeds and the importance of phorbol Flores-Olivas A, Martínez-Soriano JP, Martínez-Espinoza AD (1997) Use of technology new in detection and genetic analysis of esters present in the extracts on F. oxysporum, F. phytopathogens. Phytopathology 32:96-111. semitectum, Colletotrichum capsici, C. gloeosporioides, Garduño-Pizaña C, Barrera-Necha LL, Ríos-Gómez MY (2010). Pythium aphanidermatum, Lasiodiplodia theobromae and Evaluation of the fungicidal activity of leaves powders and extracts of Curvularia lunata, using concentrations of 0 to 10,000 mg fifteen Mexican plants against Fusarium oxysporum f. sp. gladioli -1 -1 (Massey) Snyder & Hansen. Plant Pathol. J. 9:79-87. L . Concentrations from 6,000 mg L showed 100% González-Pérez E, Yañez-Morales MJ, Ortega-Escobar H, Velázquez- inhibition of mycelial growth for all tested pathogens. Mendoza J (2009) Comparative Analysis among Pathogenic Fungal These authors are the first to report that phorbol esters Species that Cause Gladiolus (Gladiolus grandiflorus Hort.) Corm Rot are responsible for the fungicidal activity of the extracts, in Mexico. Mex. J. Phytopathol. 27:45-52. Haan LAM, Numansen A, Roebroeck EJA, van Doorn J. (2000) PCR as they note that by removing these compounds from the detection of Fusarium oxysporum f.sp. gladioli race 1, causal agent of extracts there were no significant differences as com- Gladiolus yellows disease, from infected corms. Plant Pathol. 49:89- pared to the control. As for the germination of conidia, the 100. three concentrations used in this study were effective for Katan T, Di Primo P (1999). Current status of vegetative compatibility groups in Fusarium oxysporum: Supplement (1999). Phytoparasitica only two isolates (T9 and T24) with germination between 27:1-5. 12.62 and 17.28%. Ogbebor and Adekunle (2008) assessed Leslie J, Summerell BA (2006). The Fusarium laboratory manual. Ed. the germination of Drechslera heveae conidia on PDA Blackwell publishing. p. 388. with J. curcas extracts, attaining a 20% germination rate Martínez-Herrera J (2006) Genetic and nutritional diversity of piñón (Jatropha curcas L.) in México. PhD dissertation, Instituto Politécnico with the 100% concentration. The three species identified Nacional, México. showed symptoms of the disease in the plant, such as Martínez-Herrera J, Martínez-Ayala AL, Makkar H, Francis H, Becker K leaf yellowing, epinasty and some-times late flowering in (2010) Agroclimatic conditions, Chemical and Nutritional the field. It is suggested that in different parts of Morelos, Characterization of Differents provenances of Jatropha curcas L. from Mexico. Eur. J. Sci. Res. 39:396-407. corm rot in gladiolus is caused by three fungal species, Mendoza-Zamora C (1997). Certificación de estudios de efectividad which showed morphological, molecular and pathogenic biológica de plaguicidas. Ed. Cecilio Mendoza Zamora-Universidad differences, plus different sensitivity to J. curcas oil. All Autonóma de Chapingo. Texcoco, Mexico. 279 p. three species were capable of causing the disease. The Montiel-González L, González-Flores F, Sánchez-García BM, Guzmán- Rivera S, Gámez-Vázquez FP, Acosta-Gallegos JA, Rodríguez- results of this research demonstrate the antifungal poten- Guerra R, Simpson-Williamson J, Cabral-Enciso M, Mendoza-Elos M. tial of J. curcas oil to control fungi that cause diseases in (2005). Species of Fusarium occurring on bean (Phaseolus vulgaris ornamental plants. L.) roots affected with rots in five states of Central México. Mex. J. Phytopathol. 23:1-7. Moreno-Velázquez M, Yáñez-Morales MJ, Rojas-Martínez RI, Zavaleta- ACKNOWLEDGEMENTS Mejía E, Trinidad-Santos A, Arellano-Vazquez JL (2005). Diversity of fungi of amaranthus (Amaranthus hypochondriacus L.) seed and their This work was funded by the Secretary of Postgraduate molecular characterization. Mex. J. Phytopathol. 23:111-118. and Research (Projects 20090234 and 20100783) and by Nelson P E, Toussoun T A, Marasas WFO (1983) Fusarium species: an the Commissions of Operation and Support to Academic illustration manual for identification. University Park, Pennsylvania State University Press, Pensylvania, USA. p. 193. Activities from the National Polytechnic Institute. Ogbebor ON, Adekunle AT (2008). Inhibition of Drechslera heveae

(Petch) M. B. Ellis, causal organism of Bird’s eye spot disease of REFERENCES rubber (Hevea brasiliensis Muell Arg.) using plant extracts. Afr. J. Gen. Agric. 4:19-26. Abd-Elsalam AK, Aly IN, Abdel-Satar MA, Khalil MS, Verreet JA (2003) Ortoneda M, Guarro J, Madrid M, Caracuel Z, Roncero MI, Mayayo E, PCR identification of Fusarium genus based on nuclear ribosomal- Di Pietro A. (2003). Fusarium oxysporum as a Multihost Model for the DNA sequence data. Afr. J. Biotechnol. 2:82-85. Genetic Dissection of Fungal Virulence in Plants and Mammals. Aiyelaagbe OO, Adeniyi BA, Fatunsin OF, Arimah BD (2007) In Vitro Infect. Immun. 72:1760–1766. antimicrobial activity and phytochemical analisis of Jatropha curcas Pauli A, Knobloch K (1987) Inhibitory effects of essential oil components roots. Int. J. Pharmacol. 3:106-110. on growth of food-contamining fungi. Z. Leb.-Unt. und-For. 185:10- Alves-Santos FM, Benito EP, Elsava AP, Díaz-Mínguez JM. (1999) 13. Genetic diversity of Fusarium oxysporum strains from common bean Pintore G, Chessa M, Boatto GP, Cerri G, Usai M, Trillini B (2002) fields in Spain. Appl. Environ. Microbiol. 65:3335-3340. Essential oil Hypericum perforatum L. var. angustifolium DC growing Baayen RP (2000). Diagnosis and detection of host-specific forms of wild in Sardinia (Italy). J. Essential Oil Res. 17:533-535. Fusarium oxysporum. EPPO Bull. 30:489-491. Rahman M, Ahmad SH, Mohamed MTM, Rahman MZA (2011). Extrac- Barrera-Necha L, García-Barrera L (2008) Antifungal activity of tion of Jatropha curcas fruits for antifungal activity against essential oils and their compounds on growth of Fusarium sp. anthracnose (Colletotrichum gloeosporioides) of papaya. Afr. J. isolated from papaya (Carica papaya). Rev. UDO Agric. 8:33-41. Biotechnol. 10:9796-9799. Albores et al. 733

SAGARPA (2006). Manual Técnico fitosanitario del cultivo de gladiolo. White TJ, Bruns T, Lee S, Taylor J (1990). Amplification and direct Ed. Comité Estatal de Sanidad Vegetal del Estado de Morelos. p. 13. sequencing of fungal ribosomal RNA genes for phylogenetics. Siva N, Ganesan S, Banumathy N, Muthuchelia (2008). Antifungal Chapter 38. PCR protocols: A guide to methods and applications. Ed. Effect of Leaf Extract of Some Medicinal Plants Against Fusarium Academic Press Inc, pp. 315-323. oxysporum Causing Wilt Disease of Solanum melogena L. Ethnobot. Wink M, Koshmieder C, Saverwein M, Sporer F (1997). Phorbol esters Leaflets 12:156-163. of Jatropha curcas. In G.M. Gübitz, M. Mittelbach, & M. Trabi (Eds.), Srivastava S, Kumar R, Sinha A. (2012). Antifungal Activity of Oil Biofuels and Industrial products from Jatropha curcas Austria, Dbv- Against Some Seed-borne Fungi. Plant Pathol. J. 11:120-123. Verlag Univ. pp.160-166. Teixeira M, Figueira G, Sartoratto A, Garcia V, Delarmelina C (2005). Zhang Z, Schwartz S, Wagner L, Miller W (2000) A greedy algorithm for Anti-Candida activity of Brazilian medicinal plants. J. aligning DNA sequences. J. Comput. Biol. 7:203-14. Ethnopharmacol. 97:305-311 Tripathi A, Sharma N, Sharma V (2009). In vitro efficacy of Hyptis suaveolens L. (Poit.) essential oil on growth and morphogenesis of Fusarium oxysporum f.sp. gladioli (Massey) Snyder & Hansen. World J. Microbiol. Biotechnol. 25:503-512.

Full Length Research Paper

Screening phosphate solubilizing actinobacteria isolated from the rhizosphere of wild plants from the Eastern Cordillera of the Colombian Andes

Luis Daniel Prada Salcedo1*, Carolina Prieto2 and Marcela Franco Correa3

1Luis Daniel Prada Salcedo: Unidad de investigaciones agropecuarias. Facultad de Ciencias. Pontificia Universidad Javeriana, Department of Microbiology Carrera 7ª 43-82 Edificio Félix Restrepo, S. J. 3° Piso Bogotá - Colombia. 2Centro de investigación de la caña de azucar, Cenicaña. Cali - Colombia. 3Marcela Franco Correa: Grupo de Biotecnología ambiental e industrial. Facultad de Ciencias. Pontificia Universidad Javeriana, Department of Microbiology Carrera 7ª 43-82 Edificio Félix Restrepo, S. J. 3° Piso Bogotá - Colombia.

Accepted 20 January, 2014

Colombia is a tropical country with high diversity and an agricultural economy, yet their soils are characterized by low pHs and poor phosphorus concentrations. Soil supplementation with chemical fertilizers containing soluble phosphorus is a costly and contaminating practice and for this reason, the aim of this study was to isolate actinobacteria that are able to release soluble phosphate from wild plants of the Eastern Cordillera of Colombia and select strains with high phosphorus solubilizing activity. To screen the isolates of actinobacteria, we used two qualitative assays to determine the efficiency of solubilization by measuring the halo of hydrolysis in a Pikovskaya’s agar plate (PVK). A second assay was performed on broth with National Botanical Research Institute's phosphate growth (NBRIP) medium containing bromophenol blue (BPB). Finally, the released soluble phosphate by actinobacteria was quantified using insoluble Ca3(PO4)2 or AlPO4 as sole sources of P. Only five of the tested strains were the best solubilizing strains in the two qualitative assays. The strains T1C, T1H, T3A, T3C, P3E, F1A, F2A and V2B solubilized significantly more phosphorus than the other strains, which was shown for the quantitative assay. Strains T1C, T3A, T3C and F1A are candidates for future studies and to evaluate other plant growth promoting activities.

Key words: Screening, phosphate solubilizing, actinobacteria, Colombia.

INTRODUCTION

Colombia is one of the five countries in the world with the physicochemical (sorption-desorption) and biological largest diversity of genes, species, and ecosystems. The (immobilization-mineralization) processes. Phosphate Colombian Andes are located in one of the world bio- anions can be immobilized by precipitation with cations diversity hotspots and the savannahs of the Llanos are such as Ca2+, Mg2+, Fe3+ and Al3+ providing a high phos- listed as one of the world eco-regions with rare, rich and phorus fixation capacity to soils (Oliveira et al., 2009; biologically important habitats (Myers et al., 2000; Herzog Khan et al., 2009). In Colombia’s agricultural tradition, to et al., 2011). Soils within these areas are characterized prepare soils by adding manure, chemical fertilizers or by low pHs and low phosphorus concentrations (Rao et organic amendments, any of them is supplemented with al., 2004; Fassbender and Bornemisza, 1994; Malagon et phosphate in order to compensate the phosphorus defi- al., 2003). Soil phosphorus dynamics is characterized by ciency is a common practice (León, 1991; Guimaraeset

*Corresponding author. E-mail: [email protected]. Tel: 5701 3208320 ext: 4150 – 4069. Fax: 3208320 ext. 4047. Salcedo et al. 735

et al., 2001). Soil supplementation with chemical (Figure 1). These habitats included the rhizospheres of wild plants fertilizers containing soluble phosphorus is thus a costly growing in natural protected areas and forests; samples were taken and conta-minating practice, not only because of their from forest species associated with Vallea, Weinmannia, Vaccinium, Drimys, Rosmarinus, plus samples from legumes grasses (Rye way of use but because of the highly polluting mode in Grass or Bromus) and clovers (Trifolium repens and Trifoliumpratense). which they are industrially produced, requiring the use of Soil pH, total P, available P, and organic matter were characterized sulphuric acid at high temperatures. Furthermore, wrong (Table 1). The samples were taken at a depth of 15-30 cm and fertilizer applications can cause problems of eutrophica- were placed in polyethylene bags, closed tightly and stored in a tion and erosion (Whitelaw, 2000; Vassilev et al., 2006). refrigerator at 4°C. Actinobacteria were isolated by dilution plate method using oat-meal agar. These media were supplemented with Many studies have been done on phosphate solubilizing nistatin (0.1 % V/V). Plates were incubated at 26°C, and monitored micro-organisms (PSM) as an alternative in the pre- daily. Subcultures led to purified bacterial colonies that’s howed an vention of environmental and agricultural issues men- actinobacteria-like appearance. Gram staining indicated that they tioned above (Rodriguez and Fraga, 1999; Krishnaraj and were Gram positive mycelia sporulating bacteria. A classical appro- Goldstein, 2001; Kumar et al,. 2010; Bhattacharyya and ximation was used for the characterization like aerial mass colour, Jha, 2012). reverse side pigments, melanoid pigments, soluble pigments. We did determination of micro morpho-logical characteristics of the There are reports on studies with microorganisms spore-bearing hyphae, the number of spores at the end of mature capable of solubilizing phosphate, especially bacteria and hyphae and the spore chain Morphology. The strains were stored in some fungi, which have experimentally demonstrated 20% sterile glycerol at -20°C. their capacity to improve phosphorus availability to plants in laboratory, greenhouse and field experiments (Rudresh et al., 2005; Deubel et al., 2005; Pandey et al., 2008; Screening of phosphate-solubilizing actinobacteria

Hamdali et al., 2012). To a lesser extent, actinobacteria The solid plate assay was done to measure the halo zone formed have been reported as microorganisms with the capacity surrounding the bacteria after being inoculated on agar and to release phosphorus into the soil (Mba, 1994, 1997; incubated for 72 h at 26°C on PVK growth medium containing 5 g of

Hamdali et al., 2008, El-Tarabily et al., 2006). Actinobacteria tricalcium phosphate as sole phosphorus source and pH 7.2 (Pikovskaya 1948). Halo-forming colonies were recorded as posi- have special interest because these filamentous sporulating bacteria are able to thrive in extremely different soils, tive. The solubilization index was calculated as the ratio between the total diameter (colony + halo) and the colony diameter (Kumar play important ecological roles in soil nutrient cycling and and Narula, 1999). A second assay was performed on broth with are recently being regarded as plant growth promoting NBRIP medium containing BPB following the protocol of Mehta and rhizobacteria (Jiang et al., 2005; Pathom-Aree et al., Nautiyal (2001). In brief, 5 ml of NBRIP-BPB medium in a 30-ml test 2006; Franco-Correa et al., 2010). The selection of PSM tube was inoculated with the actinobacterial strain (50 ml inoculum with approximately 3 X 107cfu/ml), and the isolates were grown for is carried out by rapid qualitative methods. The most com- 4 days at 26°C with continuous agitation at 120 rpm. At the end of mon method is to determine the efficiency of solubili- the incubation period, the final OD-600 values were subtracted from zation by measuring the halo of hydrolysis in a Pikovskaya’s the initial values. The medium pH was measured by immersing a agar plate (1948), but results are not always consistent glass electrode into the culture broth. and in some cases this method is insufficient to detect all the PSM (Nautiyal 1999; Mehta and Nautiyal, 2001; Rashid et al., 2004). Mehta and Nautiyal (2001) deve- Release soluble phosphate loped a system that includes a broth - the National Botanical Research Institute's phosphate growth medium (NBRIP) Solubilization of P by Actinobacteria was quantified using insoluble 5 g/L of Ca3(PO4)2 or 1 g/L of AlPO4 as sole sources of P in the medium and a qualitative assay in liquid medium, which NBRIP broth medium. In each autoclaved flask, 2 ml of bacterial is more accurate and reliable in the selection of PSM and suspension (approximately 3 X 107cfu/ml) were transferred to 100 therefore makes the screening process more quick, effi- ml Erlenmeyer flask containing 20 ml of NBRIP broth medium. The cient and with low cost (Khan et al., 2009). actinobacteria cultures were placed on a rotary shaker at 120 rpm The aim of this study was to isolate actinobacteria able for 4 days and pH was measured after incubation with a pH meter. to release soluble phosphate from wild plants of the Suspensions were centrifuged to remove bacterial cells and other insoluble materials. The resulting supernatants were passed through Eastern Cordillera of Colombia and to select strains with a 0.45 μm filter and the inorganic phosphate content of the culture high phosphorus solubilizing activity with the purpose of filtrate was determined by the molybdenum blue method (Murphy suggesting those microorganisms as potential bioferti- and Riley, 1962). The available phosphorous was determined using lizers and hence help to use less chemical fertilizers in a spectrophotometer at 880 nm and calibrated with a standard agricultural practices. KH2PO4 curve.

MATERIALS AND METHODS Statistical analysis

Soil samples and isolation of Actinobacteria All of the experiments were performed with four replicates. The data were analyzed with a One Way Analysis of Variance (ANOVA) and Soil samples were collected from various localities from the Eastern a Duncan’s multiple range test to determine any significant differen- Cordillera between 2010 and 2011. Diverse habitats at different ces between groups at p < 0.05. All the statistical analyses were altitudes were selected for the isolation of actinobacteria strains performed using the SPSS 11.0 for Windows® software. 736 Afr. J. Microbiol. Res.

Figure 1. Map of Colombia with coordinates, altitude, humidity and temperature of the localities sampled.

Table 1. Characteristics of the soil from the different regions in Colombia.

Region Soil pH Total P (mg/kg) Available P (mg/kg) Organic matter % Tota* 5.06 ± 0.3 360 ± 283.6 118.4 ± 126.5 13 ± 16.9 Paipa* 5.52 ± 1.0 614 ± 311.1 8 ± 2.6 5.96 ± 5.3 Mani* 4.8 ± 0.5 407.2 ± 408.6 17.04 ± 31.3 2.2 ± 1.3 Fusagasuga* 5.1 ± 1.4 2830.6 ± 1554.0 55.52 ± 56.8 13.52 ± 13.5 La vega* 4.06 ± 0.6 1504.4 ± 417.7 86.52 ± 171.4 4.6 ± 0.6 Villleta* 5.9 ± 1.6 949.25 ± 880.8 8.725 ± 7.6 2.95 ± 1.7 Andina 5.5 ± 0.2 922 ± 1143 83 ± 83 8 ± 3.2 Caribe 6 ± 1.1 1343 ± 1143 101 ± 123 9 ± 1.8 Pacific 4.5 ± 2.1 315 ± 456 37 ± 28 8.5 ± 5.5 Orinoquia 7 ± 2.4 541 ± 626 116 ± 84 2.8 ± 4.5 Amazonica 5 ± 0.8 815 ± 717 43 ± 86 3 ± 4.6

*Data of this work. 30 soil cores from random location. Values are Average ±standard deviation.

RESULTS localities at the highest elevations: 56% of the isolates belong to Tota and Paipa, 40% to the towns of Soil samples and isolation of Actinobacteria Fusagasuga, La Vega and Villeta; and the remaining 4% of the isolates were from Mani, a locality at a lower ele- We isolated 57 strains of actinobacteria from six different vation that is located on tropical plains. The use of oat- sampling areas from October 2010 to July 2011. Soil meal agar allowed the recovery of large numbers of characterization showed pH ranges from 4.0 to 5.9, total actinobacteria that showed growth and sporulation results P from 360 to 2830 mg/kg, available P from 8.7 to 118.4 after 7 days of culture. Preliminary morphological charac- mg/kg, and organic matter from 2.95 to 13.52% (Table 1). terization of the isolates showed typical structures, like Figure 2 shows a greater abundance of actinobacteria in aerial and substrate mycelium, conidia chains, some Salcedo et al. 737

Figure 2. Efficiency of solubilization of the isolates. A clear zone around a growing colony indicate phosphate solubilization and was measured as phosphate solubilazation index.

mycelium with coccoid elements, and spore chain mor- obtained with the test, the pH present in the culture phologies namely Rectiflexibiles, Retinaculiaperti and medium was low for the majority of the strains selected. Spirales. In addition, other characteristics as melanoid The best solubilizing strains with low pH are from the pigments, reverse side pigments and soluble pigments town of Tota, which was the sampling zone with highest were observed. Macroscopically, all have a dry appearance elevation and lowest temperature in addition to a rela- granular, powdery or velvety, characteristic of the actino- tively low moisture percentage. In this area, a large num- bacteria. Additionally, there were several colors: white ber of actinobacteria were isolated from five samples (T1B, T3B, P2R, L4C and M2A), heavy or light gray (T3A, collected in the surroundings of the lake, near an area T3C, T3D, L3A, P3E, F2A), beige (F1A, F2C), blue-green known as Playa Blanca where the few remnants of wild (V1B) and pink (V2B and V1E), and diffusible pigment forests are influenced by agriculture and tourism. The production (F1A, F2C). Finally, we recognized the smell town Fusagasuga has strains with high activity but not a of wet soil, representative characteristic of this group of decrease in pH; this locality has a lower humidity and microorganisms for the production of geosmina. Some higher temperatures. genera of actinobacteria were identified as Streptomyces, Nocardia and Actinomadura, among unidentified isolates. Release soluble phosphate

Screening of phosphate-solubilizing actinobacteria The results of the two qualitative assessments are not totally consistent. Seven of the tested strains F1A, F1B, Figures 2 and 3 show which isolates belong to strains F1C, F4C, T1A, T1D and T3A were the best solubilizing with the best phosphorus solubilizing capacity as well as strains in both the solid and liquid evaluation media. We two control strains deposited at the Pontificia Universidad made a quantitative assessment to find which of the Javeriana: Streptomyces sp. MCR26 labelled as negative strains has the highest solubilizing capacity and which of control and Streptomyces sp. MCR24 as positive control. the two methods is more reliable. Figure 4 shows that the These control strains were characterized as Plant growth- strains T1C, T1H, T3A, T3C,P3E, F1A, F2A and V2B are promoting rhizobacteria (PGPR) (Franco-Correa et al., as good as Streptomyces sp. MCR24 for Ca3(PO4)2 and 2010). The plate assay revealed that strains with the that these strains solubilized significantly more phos- highest values of phosphorus solubilization are F2A, F1A, phorus than the other strains. Strains T1H, T1C, T3A, F1B, F1C, F4C, T3F, T1A, T1D, and T3A. These strains T3C and F1A are present only in the selection obtained have the same activity as that of the control strain with the methodology reported by Mehta and Nautiyal Streptomyces sp. MCR24. On the other hand, the liquid (2001) suggesting that this test can choose more strains evaluation exhibited that isolates with higher solubilizing with true solubilizing ability and for this reason, it is more capacity are those that produce changes greater than 1.5 reliable. These strains also lowered pH at around 4 or optical density units at 600 nm, which were F1A, F1B, less with exception of F1A. This result is supported by the F1C, F2D, F4B, F4D, M2A, M4B, T1B, T1C, T1D, T1G, change in coloration in the medium caused by the pre- T1H, T3A, T3B and T3C. In addition to the activity results sence of BPB pH indicator,which turns from purple to 738 Afr. J. Microbiol. Res.

3.0 6.5

2.5 6.0

2.0 5.5

standard deviation standard

- /

1.5 5.0 the medium

1.0 4.5

activity in activity

shift at 600 nm+ 600 at shift

0.5 4.0 pH density

0.0 3.5

Optical Optical

Figure 3. Change in optical density at 600 nm. The dotted line indicates the cut-off for the selection of microorganisms with high tricalcium phosphate solubilizing capacity.

600.00

) 4

500.00

(PO 3

Ca 2

400.00

300.00

200.00

100.00

0.00

0.00 5.00 10.00 15.00 20.00 25.00 ALPO 4

-1 Figure 4. Released soluble phosphate. Activity with Ca3(PO4)2 5g·L source is shown in Y and activity with -1 AlPO4 1g·L source is shown in X.

Salcedo et al. 739

green, a fact related to the secretion of organic acids by (Leyval and Barthelin, 1989; Louw and Webley, 1959; actinobacteria. No tests were made with aluminum phos- Gupta et al., 1994; Mehta and Nautiyal, 2001; Liu et al., 2011). phate because Mehta and Nautiyal (2001) evaluation In our work, the advantage of the liquid assay metho- methodology was designed for tricalcium phosphate. We dology was observed with strains Tota, Fusagasuga, La observed that only in the quantitative assessment strains Vega and Villeta, which showed a major shift in the T1J and T3A can solubilize phosphorus significantly from NBRIP-BPB broth decolorization and a high release of AlPO4. In addition, the control strain Streptomyces sp. soluble phosphorus in the quantitative assessment. MRC24 had a very low activity with this source of Figures 2, 3 and 4 show these strains are not equally dis- phosphorus. tributed in all the six sampled localities; on the contrary, they are found mostly in the locality of Tota. This locality 2 DISCUSSION is a lake of 56.2 km surrounded by crop fields of onions, potatoes, beans, peas and carrots, and a few small high Soil samples and isolation of Actinobacteria Andean forests. The constantly chemically fertilized crops are affecting forests and causing eutrophication in water The abundance of the isolates in the locality of Tota can bodies. The soil analysis of the Tota locality showed a be explained by the environmental conditions of this area, 13% of organic matter, a cation-exchange capacity of 6 such as an average temperature of 18°C, sandy soils cmol/kg, a pH around 5 or less, and a total phosphorus with low water content, and pH of 5.0 to 7.2; characteris- concentration of 360 mg/kg with only 118 mg/kg available tics that facilitate growth and colonization of actino- phosphorus. These results suggest that only 33% of bacteria. On the other hand, the towns of Mani and La phosphorus applied to the soil may be taken up by plants, Vega have clay soils with low organic matter content, low on the other hand the remaining 67% is not used and can oxygen tension and pH below 5.0 (Table 1). These soil cause environmental problems. The latter phosphorus characteristics can decrease the abundance of actino- parameters reveal excessive chemical fertilization. Pro- bacteria (Goodfellow and Williams, 1983; Alexander bably, excess phosphorus is adsorbed or precipitated 1977; El-Tarabily and Sivasithamparam, 2006). Actino- and organic matter is removed as the crop itself, so bacteria occurs in a wide range of environments, but soil microorganisms are forced to use mainly inorganic forms is the most common ecological niche because the role of of phosphorus. these microorganisms is to recycles oil nutrients. Isolates reflect abundant numbers and variety of morphologies in Release soluble phosphate each of the localities sampled, but due to the isolation methodology used, the predominant genus was Perez et al. (2007) propose that isolates causing a shift of Streptomyces spp. (Xu et al., 1996; Ghodhbane-Gtari et > 1.5 units be selected for further studies. In order to al., 2010). Actinobacteria isolates show that fertile soils confirm the usefulness of this cut-off point proposed by with high concentrations of nitrogen and carbon are not Perez et al. (2007) and therefore to select the best strains, always necessary to isolate these microorganisms. Although we implemented the quantitative assay measuring the growth of these microorganisms is optimum with pH close release of soluble phosphorus in the NBRIP broth (Baig to neutrality; our findings show that they can be isolated et al., 2010). Figure 4 shows that strains T1C, T1H, T3C, from sandy soils with low pH and high aluminum concen- P3E, and V2B have a significantly higher activity to other trations; results that are consistent with those of Shirokikh isolates, a result that was not observed in the plate assay et al. (2002) and Norovsuren et al. (2007). possibly because one or more acids involved in the process did not diffuse into the agar so that there was no

Screening of phosphate-solubilizing actinobacteria presence of a solubilization halo. The evaluation in NBRIP-BPB broth revealed that isolates decolorizing the In order to perform the screening for an adequate broth more than 1.5 units were also more efficient in the selection of phosphorus solubilizing actinobacteria from quantitative assay. Also, the assay by Mehta and Nautiyal Colombian native soils, the isolates were subjected to the (2001) contribute to reduce costs and efforts in the search traditional test used by PVK and the test reported by of microorganisms with biofertilizing potential. Studies Mehta and Nautiyal (2001). Although both qualitative based on physiology of actinobacteria in Colombia are tests use different measurement units, there is a slight scarce, especially those focused on agriculture (Joaquín correlation pattern between them. Figure 2 shows high et al., 2006; Cardona et al., 2009; Franco-Correa et al., bars for the locality of Tota and locality of Fusagasuga, 2010); in addition, there has been little research on bio- respectively. These results are similar to those in Figure fertilizer-based clean technologies as a valuable input for 3, where the highest strain bars belong to the same agricultural development (Burbano and Silva, 2010). localities with the greatest activity strains shown in Figure Developing native biofertilizers contributes to the mana- 2. The two methodologies are used, but the assay by gement of tropical soils with high absorption and fixation Mehta and Nautiyal (2001) is currently more reported, of phosphorus due to their high cation concentrations, because it reveals strains with good phosphorus-solubi- usually low pH and clay texture, characteristics that have lizing capacity which is not detected in the plate assay traditionally been amended with an increased use of che- 740 Afr. J. Microbiol. Res.

mical fertilizers resulting in a negative impact on render these strains good candidates for the production ecosystems. Strains T1C, T1H, T3A, T3C, P3E, F1A, of new bio-fertilizers with the ability of colonizing crop F2A and V2B have phosphorus solubilizing capacities rhizospheres in tropical soils. between 396 and 520 μg/ml with tricalcium phosphate; Strains T1C, T3A, T3C and F1A are candidates for these results are good when compared with other bac- future studies. These strains have similar activity to the teria from similar soils reported as phosphorus solubili- positive control strain Streptomyces sp. MCR24, which zers,s uch as Bacillus spp., and Azotobacter spp (Narula was previously characterized by Franco-Correa et al. et al., 2000; Chatli et al., 2008; Saharan and Nehra, (2010) who reported a broad variety PGPR activities 2011). Using similar soil isolates, Perez and co-workers besides phosphorus solubilizing capacity. Prior studies reported an activity with tricalcium phosphate as high as have reported that strain swith good phosphorus solubi- 97 μg/ml by Burkholderia and with iron phosphate of 42 lizing capacity have also a variety of mechanisms to pro- μg/ml by Serratia. Regarding actinobacteria, El-Tarabily mote plant growth like the strain Streptomyces sp. (2008) reported that Micromonospora has an activity of MCR24. For this reason, further studies with these strains 218 μg/ml with phosphate rock and Gupta (2010) repor- designed to evaluate other plant growth promoting active- ted that Streptomyces has an activity of 46 μg/ml with ties, like nitrogen fixation, degradation of complex carbo- tricalcium phosphate. The values obtained are similar to hydrates, synergistic activities, antagonisms and produc- the results of Chen et al. (2006) that evaluated this acti- tion of plant growth promoting hormones, can make an vity in actinobacteria belonging to the genera Rhodococcus important contribution to agriculture. sp. and Arthrobacter sp. which had 186 and 519 activities

μg/ml, respectively. Those activities reported show that ACKNOWLEDGEMENTS our isolates have a great potential and an acceptable activity. This study was partially supported by the Internal Finan- Differences in the reported values by other authors may cial (Vicerrectoria Academica - Pontificia Universidad be due to the measurement techniques employed or to Javeriana - Colombia). The authors would like to thank the source of phosphorus evaluated. Occasionally, the the Dra. Sandra Constantino Chuaire for her contribution measurements with rock phosphate may overestimate on the translation of this paper. the values of in vitro solubilization because this source of phosphorus is composed of several insoluble as well as REFERENCES soluble forms of phosphorus (Zapata and Roy, 2007). One of the most valuable achievements of our research Alexander M (1977). Introduction to soil Microbiology.2nd edn. John is having isolated an actinobacteria with the ability to wiley and sons. ISBN0-85226-013X. New York Baig KA, M, Zahir ZA, solubilize both tricalcium phosphate and aluminum phos- Cheema MA (2010).Comparative efficacy of qualitative and quantitative methods for rock phosphate solubilization with phosphate phate; the latter is a source difficult to solubilize because solubilizing rhizobacteria. Soil Environ. 29:82-86. aluminum phosphate is rapidly absorbed in acid soils. Its Baig KS, Arshad M, Zahir ZA, Cheema MA (2010). Comparative fixation rate per unit area is twice the rate in neutral or efficacy of qualitative and quantitative methods for rock phosphate calcareous soils. Aluminum is also the leading cause of solubilization with phosphate solubilizing rhizobacteria. Soil Environ. 29(1):82-86. phosphorus precipitation in acid soils (Olsen and Watanabe, Bhattacharyya PN, Jha DK (2012). Plant growth-promoting rhizo- 1957; Holford, 1983). The source of phosphorus in the bacteria (PGPR): emergence in agriculture. World J. Microbiol. AlPO4 test had a concentration of 1 g/L in NBRIP broth Biotechnol. 28:1327-1350. because this compound is highly toxic to many micro- Burbano H, Silva F (2010). Ciencia del suelo: principios básicos. Sociedad Colombiana de la Ciencia del suelo., Bogotá, D.C., organisms. The greatest in vitro resistance to aluminum Colombia. 594. Cardona G, Peña. by actinobacteria reported in the scientific literature is of 5 Cardona G, Venegas CP, Ruiz-Garcia M (2009). Comunidades de g/L AlPO4 (Sayed et al., 2000); therefore, several authors hongos actinomicetos en tres tipos de vegetación de la Amazonia have been working with lower concentrations (Illmer, colombiana: abundancia, morfotipos y el gen 16s ADNr. Rev. Biol. Trop. 57:1119-1139. 1995; Prijambada et al., 2009). In addition, it is known Chatli A, Beri V, Sidhu B (2008). Isolation and characterisation of that AlPO4 toxicity varies by the complexity of the soils phosphate solubilizing microorganisms from the cold desert habitat of and that actinobacteria have good resistance to alumi- Salix alba Linn. in trans Himalayan region of Himachal Pradesh. num thus their soil colonization is facilitated in presence Indian J. Microbiol. 48:267-273. Chen YP, Rekha PD, Arun AB, Shen FT, Lai WA, Young CC (2006). of this element (Shirokikh et al., 2002; Rueda et al., Phosphate solubilizing bacteria from subtropical soil and their 2009). Strains with improved phos-phorus solubilizing tricalcium phosphate solubilizing abilities. Appl. Soil Ecol. 34:33-41. activity lowered the pH probably due to the production of Deubel A, Merbach W, Varma A, Buscot F (2005). Influence of organic acids, which is one of the phosphorus releasing Microorganisms on Phosphorus Bioavailability in Soils Microorganisms in Soils: Roles in Genesis and Functions. In. Springer Berlin mechanisms reported in scientific literature (Khan et al., Heidelberg, pp. 177-191. 2009; Saharan and Nehra 2011). Soils with these charac- El-Tarabily KA, Nassar AH, Sivasithamparam K (2008).Promotion of teristics predominate in the Colombian tropics, hence growth of bean (Phaseolus vulgaris L.) in a calcareous soil by a strain T3A is important because it can release phospho- phosphate-solubilizing, rhizosphere-competent isolate of Micromonospora endolithica. Appl. Soil Ecol. 39:161-171. rus from different sources. All the facts mentioned above, El-Tarabily KA, Sivasithamparam K (2006). Non-streptomycete actino- Salcedo et al. 741

mycetes as biocontrol agents of soil-borne fungal plant pathogens and Fe mobilization fromminerals and plant growth. Plant Soil and as plant growth promoters.Soil Biol. Biochem. 38:1505-1520. 117:103-110. Fassbender H, Bornemisza E (1994). Química de suelos, con énfasis Liu H, Wu X-Q, Ren J-H, Ye J-R (2011). Isolation and Identification of en suelos de América Latina, San José, Costa Rica. Colección de Phosphobacteria inPoplar Rhizosphere from Different Regions of libros y materiales educativos/ IICA n 81. 420. China. Pedosphere 21:90-97. Franco-Correa M, Quintana A, Duque C, Suarez C, Rodriguez MX, Louw HA, Webley DM (1959).A study of soil bacteria dissolving certain Barea J-M (2010).Evaluation of actinomycete strains for key traits mineral phosphatefertilizers and related compounds.J. Appl. related with plant growth promotion and mycorrhiza helping activities. Microbiol. 22:227-233. Appl. Soil Ecol. 45:209-217. Malagon DC (2003). Ensayo sobre tipología de suelos colombianos. Ghodhbane-Gtari F, Essoussi I, Chattaoui M, Chouaia B, Jaouani A, Énfasis en génesis yensayos ambientales Revista de la Academia Daffonchio D, Boudabous A, Gtari M (2010). Isolation and Colombiana de Ciencias Exactas, Físicas y Naturales 27: 319 - 341. characterization of non-Frankia actinobacteria from root nodules of Mba C (1994). Field studies on two rock phosphate solubilizing Alnus glutinosa, Casuarina glauca and Elaeagnus angustifolia. actinomycete isolates asbiofertilizer sources. Environ. Manage. Symbiosis 50:51-57. 18:263-269. Goodfellow M, Williams S (1983).Ecology of Actinomycetes. Annu. Rev. Mba C (1997). Rock phosphate solubilizing Streptosporangium isolates Microbiol. 37:189-216. from casts oftropical earthworms. Soil Biol. Biochem. 29:381-385. Guimaraes ES, Rao Y, Amezquita MC, Amezquita E (2001). Sistemas Mehta S, Nautiyal CS (2001). An Efficient Method for Qualitative agropastoriles en sabanas tropicales de América Latina.CIAT: Cali, Screening of Phosphate-Solubilizing Bacteria. Curr. Microbiol. 43:51- Colombia and EMBRAPA: Brasilia, Brasil p. 328. 56. Gupta N, Sahoo D, Basak U (2010). Evaluation of in vitro solubilization Murphy J, Riley JP (1962).A modified single solution method for the potential of phosphate solubilising Streptomyces isolated from determination ofphosphate in natural waters. Anal. Chim. Acta. phyllosphere of Heritiera fomes (mangrove). Afr. J. Microbiol. Res. 27:31-36. 4:136-142. Myers N, Mittermeier RA, Mittermeier CG, da Fonseca GA, Kent J Gupta R, Singal R, Shankar A, Kuhad RC, Saxena RK(1994).A (2000).Biodiversityhotspots for conservation priorities. Nature 403: modified plate assay for screening phosphate solubilizing 853-858. microorganisms. J. Gen. Appl. Microbiol. 40:255-260. Narula N, Kumar V, Behl RK, Deubel A, Gransee A, Merbach W Hamdali H, Bouizgarne B, Hafidi M, Lebrihi A, Virolle MJ, Ouhdouch Y (2000).Effect of PsolubilizingAzotobacter chroococcum on N, P, K (2008). Screening for rock phosphate solubilizing Actinomycetes from uptake in P-responsive wheatgenotypes grown under greenhouse Moroccan phosphate mines. Appl. Soil Ecol. 38:12-19. conditions.J. Plant Nutr. Soil Sci. 163:393-398. Hamdali H, Moursalou K, Tchangbedji G, Ouhdouch Y, Hafidi M (2012). Nautiyal CS (1999).An efficient microbiological growth medium for Isolation and characterization of rock phosphate solubilizing screening phosphatesolubilizing microorganisms.FEMS Microbiol. actinobacteria from a Togolese phosphate mine. Afr. J. Lett.170:265-270. Biotechnol.11: 312-320. Norovsuren Z, Zenova G, Mosina L (2007). Actinomycetes in the Herzog SK, Martinez R, Jørgensen PM, Tiesse H (2011). Climate rhizosphere of semidesertsoils of Mongolia.Eurasian Soil Sci. 40:415- change and biodiversity in the tropical Andes. Inter-American Institute 418. for Global Change Research (IAI) and Scientific Committee on Oliveira CA, Alves VMC, Marriel IE, Gomes EA, Scotti MR, Carneiro Problems of the Environment (SCOPE), 348 pp. ISBN: 978-85- NP, Guimarães CT, Schaffert RE, Sá NMH (2009). Phosphate solu- 99875-05-6. bilizing microorganisms isolated from rhizosphereof maize cultivated Holford I (1983). Differences in the efficiency of various soil phosphate in an oxisol of the Brazilian Cerrado Biome. Soil Biol. Biochem. tests for white clover between very acidic and more alkaline soils. 41:1782-1787. Austr. J. Soil Res. 21:173-182. Olsen S, Watanabe F (1957). A method to determine a phosphorus Illmer P, Barbato A, Schinner F (1995). Solubilization of hardly-soluble absorption maximum ofsoils as measured by the Langmuir isotherm. AlPO4 with P solubilizing microorganisms.Soil Biol. Biochem. 27:265- Soil Sci. Soc. Am. J. 21:144-149. 270. Pandey A, Das N, Kumar B, Rinu K, Trivedi P (2008). Phosphate Jiang Y, Li WJ, Xu P, Tang SK, Xu LH (2005). Study on diversity of solubilization byPenicillium spp. isolated from soil samples of Indian Actinomycetes saltand alkaline environments. WeiShengWuXueBae. Himalayan region. World J. Microbiol. Biotechnol. 24:97-102. 46(2):191-195. Pathom-aree W, Stach J, Ward A, Horikoshi K, Bull A, Goodfellow M Joaquín L, Benavides L, Gladys M, Quintero O, Ostos O (2006). (2006). Diversity ofactinomycetes isolated from Challenger Deep Aislamiento eidentificación de diez cepas bacterianas desnitrificantes sediment (10,898 m) from the Mariana Trench. Extremophiles. a partir de un suelo agrícolacontaminado con abonos nitrogenados 10:181-189. proveniente de una finca productora decebolla en la Laguna de Tota, Pérez E, Sulbarán M, Ball MM, Yarzábal LA (2007).Isolation and Boyacá, Colombia nova - publicación científica.4(6):50-54. characterization of mineral phosphate-solubilizing bacterianaturally Khan A, Ajgam S, Naqvi SM, Rasheed M (2009). Phosphorus colonizing a limonitic crust in the south-eastern Venezuelan region. solubilizing bacteria:occurrence, mechanisms and their role in crop Soil Biol. Biochem. 39(11):2905-2914. production. J. Agric. Biol. Sci. 1:48-58. Pikovskaya R (1948). Mobilization of phosphorus in soil in connection Krishnaraj PU, Goldstein AH (2001). Cloning of a Serratia marcescens with vital activity ofsome microbial species. Microbiol. 17: 362-370. DNA fragment thatinduces quinoprotein glucose dehydrogenase- Prijambada I, Widada J, Kabirun S, Widianto D (2009). Secretion of mediated gluconic acid production inEscherichia coli in the presence organic acids by phosphate solubilizing bacteria isolated from Oxisols of stationary phase Serratia marcescens. FEMS Microbiol. Lett. J. Tanah Trop.14(3):245-251. 205:215-220. Rao IM, Barrios E, Amézquita E, Friesen DK (2004).Soil phosphorus Kumar A, Bhargava P, Rai L (2010). Isolation and molecular character- dynamics, acquisition and cycling in crop-pasture fallow systems in rization of phosphatesolubilizing Enterobacter and Exiguobacterium low fertility tropical soils: A review from Latin America CentroInter- species from paddy fields of EasternUttar Pradesh. Afr. J. Biotechnol. nacional de Agricultura Tropical (CIAT), Canberra. Modelling nutrient 4:820-829. management in tropical cropping systems. ACIAR proceedings. pp. Kumar V, Narula N (1999).Solubilization of inorganic phosphates and 126-134. growth emergenceof wheat as affected by Azotobacter chroococcum Rashid M, Khalil S, Ayub N, Alam S, Latif F (2004).Organic acids mutants.Biol. Fert. Soils 28:301-305. production andphosphate solubilization by phosphate solubilizing León LA (1991). La experiencia La experiencia del centro internacional microorganisms (PSM) under invitro conditions. Pakistan J. Biol. Sci. para el desarrollode fertilizantes en el uso de rocas fosfóricas en 7:187-196. América Latina. Rev. Fac. Agron. 17:49-66. Rodriguez H, Fraga R (1999). Phosphate solubilizing bacteria and their Leyval C, Berthelin J (1989). Interactions betweenLaccarialaccata, role in plant growth promotion. Biotech. Adv.17:319-339. Agrobacteriumradiobacterand beech roots: Influence on P, K, Mg, Rudresh DL, Shivaprakash MK, Prasad RD (2005).Effect of combined 742 Afr. J. Microbiol. Res.

application ofRhizobium, phosphate solubilizing bacterium and Shirokikh IG, Zenova GM, Zvyagintsev DG (2002). Actinomycetes in the Trichoderma spp. on growth, nutrient uptake and yield of chickpea Rhizosphere of Barley Grown on Acid Soddy Podzolic Soil. Microbiol. (Cicer aritenium L.). Appl. Soil Ecol. 28:139-146. 71:455-459. Rueda C, Aikawa M, Prada LD, Franco-Correa M, Martinez MA, Padilla Vassilev N, Vassileva M, Nikolaeva I (2006). Simultaneous P- G (2009). Evaluación de la presencia del gen mer A implicado en la solubilizing and biocontrolactivity of microorganisms: potentials and detoxificacion demercurio a partir de actinomicetos nativos del future trends. Appl. Microbiol. Biotechnol. 71:137-144. humedal de La Conejera. Revista Colombiana de Biotecnología Whitelaw M (2000). Growth promotion of plants inoculated with 11:105-113. phosphate-solubilizingfungi. Adv. Agron. 69:99-151. Saharan B, Nehra V (2011). Plant Growth Promoting Rhizobacteria: A Xu L, Li Q, Jiang C (1996). Diversity of soil actinomycetes in Yunnan, Critical Review. Life Sci. Med. Res. 2011:LSMR-21. china. Appl. Environ. Microbiol. 62:244-248. Sayed W, Mohaowad S, Abd El-Karim M (2000). Effect of Al, Co, and Zapata F, Roy R (2007).Utilización de rocas fosfóricas para agricultura Pb ions on growthof Frankia spp. in a mineral medium. Folia sostenible. Boletin FAO No 13, Roma. 156. Microbiol. 45:153-156.

Full Length Research Paper

Establishment of EvaGreen qPCR for detecting bovine rotavirus based on VP7 gene

Wei Suocheng1*, Che Tuanjie2, Wang Jingming3, Li Yukong3, Zhang Taojie1, Song Changjun1 and Tian Fengling1

1Life Science and Engineering College, Northwest University for Nationalities, Lanzhou 730030, China. 2Lanzhou Baiyuan Company for Gene Technology, Lanzhou 730000, China. 3Lanzhou Veterinary Research Institute of Chinese Academy of Agricultural Sciences, Lanzhou 730030, China. 4Agriculture Bureau of Yuzhong County, Lanzhou 730100, China.

Accepted 20 January, 2014

The aim of the present study was to establish a method of EvaGreen real time fluorescence quantitative polymerase chain reaction (qPCR) for detecting quickly bovine rotavirus (BRV) in fecal samples from calves with diarrhea. The specific primers were designed and synthesized according to BRV VP7 gene in Genbank. VP7 gene was cloned into the pMD18-T vector. The bovine viral diarrhea virus, bovine coronavirus, porcine epidemic diarrhea virus, bovine mycobacterium tuberculosis and negative control were detected with qPCR. Plasmids in five 10-fold gradients were detected using qPCR. The results show that a EvaGreen qPCR was established in the present study. Only BRV displayed amplification curve; cross-reactivity between BRV and the other viruses or bacteria was not observed. The amplification curve of pMD18-T vector plasmid (diluted in 10-1 to 103 gradient) was typical S shape. The detection limit of qPCR was 8.0 copies/μL, namely 100 plasmid concentrations. The coefficients of variation in both intra-assay and inter-assay was less than 2%. The established EvaGreen qPCR had a high specificity, sensitivity and reproducibility. It can be applied to clinical diagnosis and epidemiological surveys of BRV.

Key words: Rotavirus, VP7 gene, evagreen, real-time quantitative PCR, bovine.

INTRODUCTION

Neonatal calf diarrhea is a common disease affecting the countries (Abe et al., 2009). Even in developed countries, newborn calf worldwide, threatening the cattle production rotavirus remains an important cause of morbidity. along with significant morbidity and mortality and inducing Rotaviruses possess 11 segments of double-stranded severe economic losses (Wei, 2011). Group A rotaviruses ribonucleic acid (dsRNA) and two outer capsid proteins: (RVA) are known to be important viral diarrheal agents in VP4 (encoded by gene segment 4) and VP7 (encoded by infants and young animals, including calves. gene segment 7, 8 or 9 depending on the strain), both of The numbers of the rotavirus-associated mortality are which are independently responsible for virus neutrali- estimated to be 453,000 in 2008 (Tate, 2012; 2013). The zation (Estes, 2001). RVA strains are antigenically hetero- numbers of deaths is particularly high in developing geneous, and are classified in multiple G and P types de-

*Corresponding author. E-mail: [email protected]. Tel: +0086-931-2937773.

744 Afr. J. Microbiol. Res.

fined by VP7 and VP4 outer capsid proteins (Papp et al., more sensitive for the detection and quantification of 2013). The neutralization specificity related to VP7 is rotavirus (Mackay et al., 2002; Kang et al., 2004; Pang et referred to as the G serotype (for glycoprotein), and that al., 2004). EvaGreen (EG) is a novel DNA-binding dye. It associated with VP4 is referred to as the P serotype (for has been reported to be used for DNA quantification, DNA protease-sensitive protein) (Anthony et al. 1999). conformation detection quantitative PCR (Ihrig et al., 2006). Currently, group A rotavirus has been classified into at Currently, very little research of Evagreen Real-time least 15 G serotypes (G1-G15) and 21 P genotypes Quantitative PCR (qPCR) is performed for detection of (P1-P24) (Ram, 2004). With regard to bovine, at least BRV (Ihrig et al., 2006). Currently, very little research of nine G serotypes (G1-4, 6-8, 10, 11) and three P Evagreen Real-time Quantitative PCR (qPCR) has been genotypes have been found so far (Santos and Hoshino, performed for detection of bovine rotavirus (BRV) (Gouvea 2005; Papp et al., 2013). Feray et al. (2010) reported G6 et al., 1990; Mohan et al., 2006). It has not been applied in was the predominant G-type, detected in 40/53 samples detecting bovine rotavirus in China. The aim of the pre- (75.4%), while P[11] was the predominant P-type, detected sent study was to establish EvaGreen Real-time Quanti- in 52/53 samples (98.1%). The most common VP7/VP4 tative PCR (qPCR) for detecting BRV VP7 gene in fecal combinations were G6P[11] (60.3%) and G10P[11] samples. (24.5%). A similar finding was reported by Swiatek et al. (2010). Our study found that G6 and G10 serotypes were 29 (54.7%) and 8 (15.1%) in positive samples for VP7. MATERIALS AND METHODS

The main combinations of BRV G serotype and P Fecal samples genotype were G6P[5] (28.3%) (Wei et al., 2013). VP7 and VP4 proteins elicit the production of neutralizing Fecal samples were collected from 62 calves with diarrhea that were antibodies, define the antigenic specificities, referred to as one to thirty days old and located on dairy farms in Lanzhou (26 G type and P type, respectively, and are the major samples), Qingyang cities (19 samples) and Gannan autonomous antigens neutralizing immune responses during rotavirus prefecture (17 samples) of Gansu province of China, from Novem- ber 2010 to April 2011. TRIzol (a nucleic acid extraction reagent; infections (Aminu et al., 2010). Rotavirus VP7 gene is Invitrogen, Beijing, China) was added to the collection tube in highly conservative at both ends of open reading frame advance. All fecal specimens were stored at -20°C until further use. (ORF), such it is feasible to detect rotavirus serotypes A 10% suspension of each fecal sample was prepared in phosphate utilizing the rotavirus specific primers. VP7 has been shown buffered saline (PBS), pH 7.2 and centrifuged at 4,000 g for 15 min to be involved in the early interactions with cell-surface at 4°C. The supernatants of 62 fecal samples were subjected to molecules, during the rotavirus entry process (Lopez and ELISA for detecting the presence of RV with commercially rotavirus detection kits (Lanzhou Institute of Biological Products Company, Arias, 2006; Martha et al., 2012). Moreover, PCR can be Lanzhou, China) and following the protocol of the manufacture used to detect rotavirus VP7 not only stool specimens instructions. The results were interpreted by using the OD values also cerebrospinal fluids and sera (Hiroshi et al., 1994). obtained at 450 nm with ELISA reader (BioTec, Dresden, Germany). Currently many methods (including polymerase chain All positive samples from ELISA were used for the subsequent experiments. Fecal supernatants were stored at 4°C. reaction, PCR) are available for detecting rotavirus, especially VP6 antigen (Luan et al., 2006; Gutierrez-Aguirre et al., 2008; Zhu et al., 2011; Fan et al., 2011). Unfortunately, PCR Primers designs and synthesis assays require sophisticated equipment, which is costly to maintain, and must be performed in specialized labora- For qPCR, based on the deposited genome sequences of BRV VP7 tories (Xie et al., 2012). So far, little information regarding in GenBank (accession number No. GQ433985), specific primers were designed using Primer Premier 5.0 software according to the real-time quantitative PCR (qPCR) utilized to detect RV highly conserved regions: Forward: VP7 antigen has been known. The real-time quantitative 5’-GTATGGTATTGAATATACCAC-3’ (nts 51-71 of GQ433985). PCR (qPCR) methods are not only fast and accurate, and Reverse: 5’-GATCCTGTTGGCCATCC-3’ (nts 376-392 of also can test against different target sequences. Its speci- GQ433985). The length of predicting product is 342 bp. The concen- ficity is very high (Okada and Matsumoto, 2002; Santos and trations of primers (100, 200, 300 and 500 nM) were evaluated. The formation of primer-dimers was assessed by melting curve analysis. Hoshino, 2005). Quantitative PCR (qPCR), also known as Thus, only those concentrations of primers that showed real-time PCR, has become a powerful tool for the ampli- dimer-free reactions were used for the final analysis. Primers were fication, identification and quantification of nucleic acids. synthesized from Takara Bio, Dalian, China. Its ability to quantitatively and specifically detect genes has been invaluable for both research and diagnostic Cell cultures applications (Schweitzer and Kingsmore, 2001). The qPCR using a simple DNA dye is a popular choice among The neonatal calf diarrhea virus (NCDV) strain (AV-51, purchased academic laboratories for PCR experiments (Bustin, from Chinese Veterinary Drugs Supervisor Institute, Beijing, China) 2002). Compared to conventional reverse transcript PCR and ELISA positive fecal samples were inoculated to single layer (RT-PCR), qPCR has been shown to be more rapid and MA-104 cells as described previously (Wei et al., 2010). The cells

Suocheng et al. 745

were cultured for 3-4 days at 37°C. The process ended when the (PEDV) and bovine mycobacterium tuberculosis (provided by cytopathogenic effect (CPE) was higher than 90%. Then, the cells Lanzhou Veterinary Research Institute, Chinese Academy of were frozen and thawed 2 to 3 times. The viral supernatant was agricultural sciences, Lanzhou, China), respectively. RNA was collected for RNA extraction or stored at -80°C until processed. reverse transcribed. RNA templates were amplified with the established qPCR. Meanwhile, the negative control was detected. Meanwhile, the negative control was set. RNA extraction and cDNA synthesis

According to the manufacturer’s instructions, total RNA was extrac- Sensitivity tests ted from the viral supernatants of the neonatal calf diarrhea virus (NCDV) strain (AV-51) and fecal samples using the TRIzol RNA The plasmids were diluted on the serial 10-fold dilutions (103, 102, extraction kit (Invitrogen, Beijing, China). 101, 100 and 10-1 gradients) and detected with the established qPCR Briefly, PCR was performed in a 25 μL volumes that included 15.5 to evaluate the sensitivity of qPCR. μL diethylpyrocarbonate (DEPC) water, 0.5 μL (10 mM) deoxyribo- nucleotide triphosphate (dNTPs), 2.5 μL 10×PCR buffer, 0.5 μL Tag enzyme. 0.5 μL BRVF primer, 0.5 μL BRVR and 5 μL cDNA. The Stability PCR products were electrophoresed on 1.5% agarose gel (Amresco, USA) containing 1×Gel Red (BIOTIUM, Hayward, CA, U.S.A.) and For the intra-assay variability, the plasmids in 5 dilution gradients subsequently analyzed with the software CS Analyzer Ver 3.0 (10-4, 10-3, 10-2 and 10-1) were detected using qPCR. The test was (ATTO, Tokyo, Japan). repeated thrice. The copy numbers, mean, standard deviation and The cDNA was synthesized from the NCDV strain and extracted variation coefficient (CV) were calculated from the standard curve viral RNA by reverse transcription reaction and used for PCR for each dilution gradients. amplification of the VP7 gene. The expected amplicons were 342 bp For inter-assay variability, the plasmids in 5 dilution gradients sizes. were detected with the qPCR for three times every three days. The

copy numbers, average, standard deviation and variation coefficient Preparation of plasmid standard template were also calculated as the methods mentioned above.

The amplified VP7 cDNA fragments were cloned into pMD18-T Fecal sample detection vectors. Then, pMD18-T vectors were sequenced and validated. The positive plasmids were quantitatively measured using the To evaluate the diagnostic efficacy of qPCR assay, cDNAs of 62 optimized reaction conditions to establish a standard curve with the fecal samples were detected using the established qPCR. The logarithm values of template starting copy number as the horizontal findings were compared with that of ELISA method to verify the axis and Ct values as the vertical axis. The positive plasmids were coincidence rate of two methods. used as standards (pMD-VP7), which were serially diluted 10-fold -1 0 1 2 3 gradient to 4.0×10 , 4.0×10 , 4.0×10 , 4.0×10 and 4.0×10 (copies/μL). RESULTS

EvaGreen Real-time Quantitative PCR (qPCR) Screening of fecal samples by ELISA The qPCR was performed in a 50 μL reaction systems, which consisted of 25 μL EvaGreen qPCR Master Mix (Chaoshi The screening of 10% suspension of 62 fecal samples biotechnology company, Shanghai, China), 1 μL BRVF Primer (10 indicated that 12 fecal samples were positive for BRV, μM), 1 μL BRVR primers (10 μM), 5 μL cDNA and 18 μL deionized with a prevalence rate of 19.36%. water. The experiment Detector was set to SYBR, and the Quencher was set to None. The conditions for qPCR were as follows: initial denaturation at 95°C for 15 min followed by 40 cycles of 94°C for 15 Amplification of BRV VP7 gene s, 55°C for 30 s and 72°C for 40 s, and a final extension at 72°C for 10 min. The qPCR was done in ABI quantitative PCR instrument As shown in Figure 1, a predicted 342 bp band was found (ABI PRISM 7300 type, Applied Biosystems incorporation, USA). in agarose gel electrophoresis. The result testified they are group A BRV.

Establishment of the standard curve for qPCR Dynamics curve and the standard curve of qPCR The 10-fold diluted plasmid standards (4.0×10-1, 4.0×100, 4.0×101, 2 3 4.0×10 and 4.0×10 copies/μL) were detected quantitatively using The reaction conditions of qPCR were optimized. The qPCR assay. Such the standard curve had been established with the logarithmic values of the starting copies as the horizontal axis (X) optimum reaction conditions were as follows: initial and Ct values as the vertical axis (Y). denaturation for 15 min at 95°C, denaturation for 15 s at 95°C, annealing for 30 s at 55°C, elongation for 40 sat 72°C, by 40 cycles, and a final elongation of 10 min at 72°C. Specificity tests The dynamics curve of qPCR was acquired (Figure 2). The recombinant plasmids (pMD-VP7) in five 10-fold To examine the analytical sensitivity, the RNA was extracted from -1 3 the viral supernatants of BRV stools, bovine viral diarrhea virus gradients from 4.0×10 to 4.0×10 were detected using (BVDV), bovine coronavirus (BCV), porcine epidemic diarrhea virus the optimized qPCR reactions, respectively. Ct values were

746 Afr. J. Microbiol. Res.

had an excellent specificity. It can be applied to detect diarrhea sample clinically.

Sensitivity test results

The plasmids in five dilution gradients were detected with the established qPCR (Figure 5). The amplification curve of pMD-VP7 plasmid (diluted in 10-1～103 gradient) was typical S shape with an excellent appearance. Ct values were 28.55, 24.42, 2.067, 17.42 and 14.48, respectively. The corresponding copy numbers were 1.80×10-3, 4.11×102, 6.21×101, 8.03×100 and 9.68×10-1, respectively. Therefore, the detection limit of -0 qPCR was 8.0 copies/μL, namely 10 plasmid concentration.

Stability test results Figure 1. Amplification of BRV in agarose gel

electrophoresis. The predicted 342 bp band was As shown in Table 1, the variation coefficients (CV) of found. 1: blank control; 2 and 3: extracted total RNA from fecal samples; 4: marker. intra-assay reproducibility and inter-assay reproducibility were 1.0-1.1 and 1.7-2.0, respectively, which demonstrated the qPCR assay was stable and reliable.

Detection results of fecal samples

Detection results of fecal samples showed that 10 (all of which were positive for ELISA) out of 62 fecal samples were found positive for BRV by qPCR. The coincidence rate of qPCR and ELISA was 83.3%. qPCR had a higher sensitivity and specificity.

DISCUSSION Figure 2. The dynamics curve of qPCR. Real-time PCR can be carried out using either probes or DNA dyes (Higuchi et al., 1993; Wilhelm and Pingoud, 2003; Anne, 2011). SYBR Green exhibits a very strong 28.55, 24.42, 20.67, 17.42 and 14.48 respectively. Such, fluorescent signal, but it has been shown to inhibit the the standard curve was established (Figure 3). The slope, PCR reaction and has a narrow dynamic range and lower intercept and correlation coefficient (R2) of the standard reproducibility than other detection chemistries (Gudnason curve were -3.574, 31.77 and 0.997 respectively, et al., 2007). EvaGreen is another DNA dye which is less indicating a strong linear relationship. Gene amplification inhibitory to PCR than SYBR Green and is marketed as efficiency (E) equalled to (1.91-1) x100%=91%. Such, the an alternative. EvaGreen dye performed better than regression equation was expressed as Y=-3.574 LogX SYBR Green in general, and high reaction efficiencies +31.77. It can be calculated that Ct value equated to can be achieved using the dye. In cases where template 31.77-3.574X. sequence tends to vary, dye-based detection helps prevent false negatives that might result from base pair Specificity test results mismatches in a sequence-specific probe binding region (Anderson et al., 2003; Papin et al., 2004). It has recently As can be seen from Figure 4, the optimized rotavirus been used for quantitative real-time PCR (qPCR), qPCR assay was tested against other viruses and post-PCR DNA melt curve analysis and several other bacteria, which included BCoV, PEDV and MB, in order to applications (Mao et al., 2007). So far, it has not been demonstrate the specificity of the assay. The results show reported that qPCR is utilized to detect bovine rotavirus in only BRV displayed amplification curve, the cross- China. The present study was to develop a higher reactivity between BRV and other viruses or bacteria was specificity and sensitivity method for detecting BRV VP7 not observed. It indicated the established qPCR assay gene in fecal samples using EvaGreen dye.

Suocheng et al. 747

Figure 3. The standard curve of qPCR. The slope, intercept and correlation coefficient (R2) of the standard curve were -3.574, 31.77 and 0.997 respectively, indicating a strong linear relationship.

Figure 4. Specificity of qPCR assay. BRV displayed amplification curve, the cross-reactions between bovine rotavirus and other viruses: BVDV, bovine viral diarrhea virus; BcoV, bovine coronavirus; PEDVPEDV, porcine epidemic diarrhea virus or bacteria bovine; MB, mycobacterium tuberculosis and negative control were not observed, indicating a high specificity for qPCR assay.

Figure 5. Sensitivity of qPCR assay. M, 100bp DNA Marker; 1-2, padding and negativie control; 3-7, the 10-fold serial plasmid dilutions (103, 102, 101, 100 and 10-1 gradients).

748 Afr. J. Microbiol. Res.

Table 1. Intra-assay and Inter-assay reproducibility test of qRT-PCR.

Dilution gradient of n Intra-assay reproducibility Inter-assay reproducibility Standard plasmid* X  SD CV(%) CV(%) 10-1 3 15.1±0.6 1.0 16.3±0.7 1.7 10-2 3 18.4±0.7 1.0 19.4±0.9 2.0 10-3 3 21.5±0.6 1.1 21.1±0.9 1.9 10-4 3 26.1±0.7 1.0 26.0±0.9 2.0

Note: * Copy /μL

In the present research, a 342 bp VP7 gene of BRV was 73(9): 7574-7581. amplified from fecal samples with RT-PCR. qPCR has Bustin SA (2002). Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J. Mol. Endocrinol. been developed for determining BRV VP7 gene. The 0 29(1): 23-39. quantities of RNA in qPCR ranged between 8.03×10 and Estes MK (2001). Rotaviruses and their replication. In Fields virology 1.80×10-3 copies per reaction. The established qPCR was Knipe DM, Howley PM eds). Lippincott-Roven Publishers, high specificity, sensitivity and stability. However, because Philadelphia, 1747-1785. Fan Q, Xie ZX, Lie JB, Peng YS, Deng XW, Xie ZQ, Xie LJ, Peng Y of inadequate conditions and detection of small samples, (2011). Detection of bovine rotavirus by TaqMan based Real-time the specificity of the experimental methods and result reverse transcription polymerase chain reaction assay. China Anim. repetition need to be improved in the future. In addition, Husbandry Vet. Med. 38:105–108. BRV Kit has not been developed (Luan et al., 2006; Wei Feray A, Aykut O, Tuba CO, Mehmet OT, Elvin C, Vito M, Ibrahim B (2010). Distribution of G (VP7) and P (VP4) genotypes of group A et al., 2010). The human ELISA Kit was used in this study. bovine rotaviruses from Turkish calves with diarrhea, 1997–2008. Vet. The coincidence rate of qPCR and ELISA in our findings Microbiol. 141:231–237. needs to be investigated further. Gouvea V, Glass RI, Woods P, Taniguchi K, Clarke HF, Forrester B, It is concluded that the qPCR using EvaGreen dye is a Fang ZY (1990). Polymerase chain reaction amplification and typing of rotavirus nucleic acid from stool specimens. J. Clin. Microbiol. rapid, sensitive and stable method for the detection of 28:276-282. BRV VP7 gene. The qPCR has a low risk of contamination Gudnason H, Dufva M, Bang DD, Wolff A (2007). Comparison of multiple and is less time and manpower consuming than con- dyes for real-time PCR: effects of dye concentration and sequence ventional RT-PCR. It could be used for clinical diagnosis composition on DNA amplification and melting temperature. Nucleic Acids Res. 35(19): e127 and epidemiological survey of bovine rotavirus. Gutierrez-Aguirre I, Steyer A, Boben J, Gruden K, Poljsak-Prijatelj M, Ravnikar M (2008). Sensitive detection of multiple rotavirus genotypes with a single reverse transcriptionreal-time quantitative PCR assay. J. ACKNOWLEDGEMENTS Clin. Microbiol. 46:2547–2554. Higuchi R, Fockler C, Dollinger G, Watson R (1993). Kinetic PCR The work was supported by the science and technology analysis: real-time monitoring of DNA amplification reactions. Bio. program project in Gansu province of China in 2007 Technol. 11:1026-1030. Hiroshi U, Keqin X, Shuichi N, Shigeru M, Toshiaki A (1994). Detection (Grant No: 0708NKCA079 and the research and and Sequencing of Rotavirus VP7 Gene from Human Materials application project of agricultural biotechnology in Gansu (Stools, Sera, Cerebrospinal Fluids, and Throat Swabs) by Reverse province (Grant No: GNSW-2010-10). Transcription and PCR. J. Clin. Microbiol. 32(12): 2893-2897. Ihrig J, Lill R, Muhlenhoff U (2006). Application of the DNA-specific dye EvaGreen for the routine quantification of DNA in microplates. Anal. REFERENCES Biochem. 359(2):265-267. Kang G, Iturriza-Gomara M, Wheeler JG, Crystal P, Monica B, Ramani S, Abe M, Ito N, Morikaw S, Takasu M, Murase T, Kawashima T, Kawai Y, Primrose B, Moses PD, Gallimore CI, Brown DW, Gray J (2004). Kohara J, Sugiyama M (2009) Molecular epidemiology of rotaviruses Quantitation of group A rotavirus by real-time among healthy calves in of a novel bovine rotavirus bearing new P reverse-transcription-polymerase chain reaction: correlation with and G genotypes. Virus Res. 144: 250-257 clinical severity in children in South India. J. Med. Virol. 73, 118-122. Aminu M, Page N A, Ahmad AA, Umoh JU, Dewar J, Steele AD (2010). Lopez S, Arias CF. (2006) Early steps in rotavirus cell entry. Curr Top Diversity of Rotavirus VP7 and VP4 Genotypes in Northwestern Microbiol Immunol 309:39–66. Nigeria. JID. 202 (Suppl 1): S198-S204. Luan J, Yang S, Zang W, Gao Y, Zhong J, Zhao H (2006). Rapid Anderson TP, Werno AM, Beynon KA, Murdoch DR (2003). Failure to detection of bovine rotavirus with semi2nested RT2PCR assay. genotype herpes simplex virus by real-time PCR assay and melting Chinese J. Zoonoses. 22(7): 671-674. curve analysis due to sequence variation within probe binding sites. J. Mackay IM, Arden KE, Nitsche A (2002). Real-time PCR in virology. Clin. Microbiol. 41(5): 2135-2137. Nucleic Acids Res. 30: 1292-1305. Anne CE (2011). SYTO dyes and EvaGreen outperform SYBR Green in Mao F, Leung WY, Xin X (2007). Characterization of EvaGreen and the real-time PCR. BMC Res. Notes. 4: 263-271. implication of its physicochemical properties for qPCR applications. Anthony HC, Choi MB, Monica MM (1999). Antibody-Independent BMC Biotechnol. 7:76-82. Protection against Rotavirus Infection of Mice Stimulated by Martha NC, Fanny G, Orlando A, Carlos AG (2012). Rotavirus VP4 and Intranasal Immunization with Chimeric VP4 or VP6 Protein. J. Virol. VP7-Derived Synthetic Peptides as Potential Substrates of Protein

Suocheng et al. 749

Disulfide Isomerase Lead to Inhibition of Rotavirus Infection. Int. J. Tate JE, Steele AD, Bines JE, Zuber PL, Parashar UD (2012). Research Pept. Res. Ther. 18:373–382 priorities regarding rotavirus vaccine and intussusception: a meeting Mohan S, Manoharan P, Pachaikani R (2006). Genotyping of rotavirus of summary. Vaccine. 30 (Suppl 1):A179-84.doi: neonatal calves by nested-multiplex PCR in India. Veterinarski Arhiv. 10.1097/INF.0b013e31828d639c. 76 (6): 497-505. Tate JE, Haynes A, Payne DC, Cortese MM, Lopman BA, Patel MM, Okada N, Matsumoto Y (2002). Bovine rotavirus G and P types and Parashar UD (2013). Trends in national rotavirus activity before and sequence analysis of the VP7 gene of two G8 bovine rotaviruses from after introduction of rotavirus vaccine into the national immunization Japan. Vet Microbiol. 84: 297-305. program in the United States, 2000 to 2012. Pediatr Infect Dis J. Pang XL, Lee B, Boroumand N, Leblanc B, Preiksaitis JK, Yu ICC (2004). 32(7):741-4. Increased detection of rotavirus using a real time reverse transcription Wei Suocheng, FENG Ruofei, GONG Zhuandi, TIAN Fengling (2010). polymerase chain reaction (RT-PCR) assay in stool specimens Researches of Isolation and Cell Cultivation of Bovine Rotavirus in fromchildren with diarrhea. J. Med. Virol. 72: 496-501. Vero and MA-104 Cells. J. Northwest University for Nationalities. Papin JF, Vahrson W, Dittmer D (2004). SYBR Green-based real-time 31(4):71-75. quantitative PCR assay for detection of West Nile virus circumvents Wei S, Gong Z, Che T, Ayimu G, Tian F (2013). Genotyping of calves false-negative results due to strain variability. J. Clin. Microbiol. rotavirus in China by reverse transcription polymerase chain reaction. 42(4):1511-1518. J. Virol. Methods 189(1):36– 40 Papp H, László B, Jakab F, Ganesh B, De Grazia S, Matthijnssens Wei Z, Jianbao D, Takeshi H, Yoshitaka G, Masuo S (2011). Rapid and J, Ciarlet M, Martella V, Bányai K (2013). Review of group A rotavirus Sensitive Detection of Bovine Coronavirus and Group A Bovine strains reported in swine and cattle. Vet. Microbiol. 165(3-4):190-199. Rotavirus from Fecal Samples by Using One-Step Duplex RT-PCR Ram IG (2004). Pathogenesis of intestinal and system in rotavirus Assay. J. Vet. Med. Sci. 73(4): 531-534. infection. J. Virol. 78:10213-10220. Xie Z, Fan Q, Liu J, Pang Y, Deng X, Xie Z, Xie L, Khan MI (2012). Santos N, Hoshino Y (2005). Global distribution of rotavirus serotypes/ Reverse transcription loop-mediated isothermal amplification assay genotypes and its implication for the development and implementation for rapid detection of Bovine Rotavirus. BMC Vet. Res. 8:133-137. of an effective rotavirus vaccine. Rev. Med. Virol. 15: 29-56. Zhu W, Dong J, Haga T, Goto Y, Sueyoshi M (2011). Rapid and Schweitzer B, Kingsmore S (2001). Combining nucleic acid amplification sensitive detection of bovine coronavirus and group a bovine rotavirus and detection. Curr. Opin. Biotechnol. 12(1):21-27. from fecal samples by using one-step duplex RT-PCR assay. J. Vet. Swiatek DL, Palomboc EA, Leed A, Coventryd MJ, Britza ML, Kirkwooda Med. Sci. 73:531–534. CD (2010). Detection and analysis of bovine rotavirus strains circulating in Australian calves during 2004 and 2005. Vet. Microbiol. 140: 56–62.

Full Length Research Paper

Nutritional requirements for the production of antimicrobial metabolites from Streptomyces

Mariadhas Valan Arasu1,2*, Thankappan Sarasam Rejiniemon3, Naif Abdullah Al-Dhabi4, Veeramuthu Duraipandiyan1,4, Savarimuthu Ignacimuthu1, Paul Agastian1,5, Sun-Ju Kim6, V. Aldous J. Huxley3, Kyung Dong Lee7, Ki Choon Choi2*

1Division of Microbiology, Entomology Research Institute, Loyola College, Chennai, India. 2Grassland and forage division, National Institute of Animal Science, RDA, Seonghwan-Eup, Cheonan-Si, Chungnam, 330-801, Republic of Korea. 3Department of Zoology, Thiru Vika Government Arts College, Thiruvarur - 610 003, Tamil Nadu, India. 4Department of Botany and Microbiology, Addiriyah Chair for Environmental Studies, College of Science, King Saud University, Riyadh, Saudi Arabia. 5Department of Plant Biology and Biotechnology, Loyola College, Chennai, India. 6Department of Bio-environmental Chemistry, Chungnam National University, 99 Daehak-Ro, Yuseong-Gu, Daejeon 305-764, Republic of Korea. 7Department of Oriental Medicine Materials, Dongsin University, Naju, Korea.

Accepted 13 January, 2014

The objective of this study was to optimize the nutritional and cultural conditions of Streptomyces strain ERI-1, ERI-3 and ERI-26 for the production of antimicrobial metabolites under shake-flask conditions. Effect of eight fermentation medium, different temperature, pH, incubation time, different carbon and nitrogen sources and different concentration of sodium chloride on production of antimicrobial metabolites were studied. Antimicrobial activity of the fermentation medium was evaluated by cup plate method by measuring the zone of inhibition. Nutritional and cultural conditions for the production of antimicrobial metabolites by Streptomyces strain ERI-1, ERI-3 and ERI-26 under shake-flask conditions have been optimized. Modified nutrient medium was found to be good base for fermentation. Glucose and ammonium nitrate were identified as best carbon and nitrogen sources, respectively for growth and production of more antimicrobial compounds. Similarly, initial production medium pH of 7.0, incubation temperature of 30°C and incubation time of 96 h was found to be optimal. Optimization of medium and cultural conditions resulted in better antibacterial and antifungal activity. The zone of inhibition of ERI-26 against Aspergillus niger was 25 and 20 mm for Curvularia lunata, respectively. It is clear that novel Stretomyces strains ERI-1, ERI-3 and ERI-26 produced extra cellular antimicrobial metabolites effective against pathogenic bacteria and fungi, moreover the medium and cultural conditions for better antimicrobial metabolites production have been optimized.

Key words: Streptomyces, antimicrobial activity, nutritional requirements, cultural conditions, optimized media.

INTRODUCTION

Streptomycetes are potent producers of secondary al., 2000). Secondary metabolites produced by them metabolites. Among 10000 known antibiotics, 45-55% is have a broad spectrum of biological activities such as produced by Streptomycetes (Demain, 2006; Lazzarini et antibacterial (streptomycin, tetracycline, chloramphenicol),

*Corresponding author. E-mail: [email protected]. Arasu et al. 751

antifungal (nystatin), antiviral (tunicamycin), antiparasitic mL fermentation broth medium and incubated on a rotary shaker at (avermectin), immunosuppressive (rapamycin), antican- 200 rpm, 30°C for 24 h. After that 10% of inoculum was transferred cer (actinomycin, mitomycin C, anthracyclines), enzyme to production medium containing 100 mL of fermentation medium in 500 mL Erlenmeyer flask. Different culture conditions like tempera- inhibitors (clavulanic acid) and diabetogenic (bafilomycin, tures (20, 25, 30, 37 and 45°C), pH (6.0, 6.5, 7.0, 7.5, 8.0 and 8.5) streptozotocin). and incubation time (24, 48, 72, 96, 120 and 144 h) were studied to Secondary metabolite production in microbes is strongly standardize the antibiotic production. Effect of different carbon influenced by nutritional factors and growth conditions. A source and nitrogen source for growth and antimicrobial compound common strategy, widely applied in industrial screening production in fermentation medium were evaluated. Different concentrations of sugar for production of antimicrobial compound and programs, consists of the application of several growth growth were also studied. Influence of different concentrations of conditions (including variables such as production media, sodium chloride in production medium was studied. incubation time and other factors) to different strains which has been studied (Vilella et al., 2000). There is strong evidence that this approach improves the chances Antibacterial assay of finding the desired metabolites (Lauren and Yit-Heng, Test organism 2011; Arasu et al., 2013). Considering that any screening program of microbial natural products can handle a limi- The following test organisms were used for antibacterial studies: ted number of fermentations, applying many growth Staphylococcus aureus (ATCC 25923), Staphylococcus epidermidis conditions to each strain may critically restrict the number (MTCC 3615), Bacillus subtilis (MTCC 441), Enterococcus faecalis (ATCC 29212), Escherichia coli (ATCC 25922), Pseudomonas of strains and therefore the diversity of biosynthetic path- aeruginosa (ATCC 27853), Klebsiella pneumoniae (ATCC 15380), ways included in the screening. As a compromise bet- Proteus vulgaris (MTCC 1771), Erwinia sp. MTCC (2760), ween these two requirements, a number of conditions are Xanthomonas sp., Vibrio fischeri (MTCC 1738) and Salmonella usually applied to each strain (Wildmans, 1997). Further- typhi (MTCC 733). All cultures were obtained from Department of more, without prior knowledge about the preferred growth Microbiology, Christian Medical College, Vellore, Tamil Nadu, India. Each bacterial strain was inoculated in 3 mL of Mueller Hinton broth conditions for a given microorganism, random assign- and incubated at 37°C for 24 h. After incubation period the culture ment of media to strains may generate an inefficient was diluted. redundancy of metabolites or extracts lacking relevant levels of secondary metabolites. The production of secon- Fungal strains dary metabolites is affected by the availability of nutrients The following fungi were used for experiments: Trichophyton (Valanarasu et al., 2010). In fermentation experiments, rubrum (MTCC 296), Trichophyton rubrum (57/01), Trichophyton the production of antibiotics is increased by the presence mentagrophytes (66/01), Trichophyton simii (110/02), of a non preferred carbon source, or by other nutrients Epidermophyton floccosum (73/01), Scopulariopsis sp. (101/01) (Mohd et al., 2012). The source and availability of nitro- Aspergillus niger (MTCC 1344), Botyritis cinerea, Curvularia lunata gen can also influence the production of secondary meta- (46/01) and Candida albicans (MTCC 227). bolites (Arasu et al., 2008; Arasu et al., 2009).

In our screening programme for isolation and identi- Preparation of fungal spore fication of actinomycetes from Westen Ghats of Tamil Nadu for antimicrobial metabolite production, we isolated The filamentous fungi were grown on Sabouraud dextrose sgar 367 actinomycetes from different parts of the forest soil (SDA) slants at 28°C for 10 days and the spores were collected using sterile doubled distilled water and homogenized. Yeast was samples. Actinomycetes recovered from Kanyakumari grown on Sabouraud dextrose broth at 28°C for 48 h. showed significant activity against most of the tested bacteria and fungi (Arasu et al., 2013). Among the different actinomycetes; ERI-1, ERI-3 and ERI-26 isolates from the Cup plate method Western Ghats region of Kanyakumari District revealed Antibacterial assays significant activity against all the tested bacteria and fungi. This study focused on optimizing nutrition and cultural Antibacterial activities were assayed by the agar diffusion method conditions of Streptomyces strain ERI-1, ERI-3 and ERI- by Arasu et al. (2013). Petri plates were prepared with 20 mL of sterile Mueller Hinton Agar (MHA) (Hi-media, Mumbai). The test cul- 26 for the production of antimicrobial metabolites under 8 the shake-flask condition. tures (100 µL) of suspension containing 10 CFU/mL bacteria) were swabbed on the top of the solidified media and allowed to dry for 10 min. 5 mm diameter well was made using sterile cork borer and MATERIALS AND METHODS filled with 0.05 mL of supernatant of ERI-1, ERI-3 and ERI-26. The plates were left for 30 min at room temperature for supernatant Fermentation medium diffusion. Negative control was prepared using the respective fermentation medium. The plates were incubated for 24 h at 37°C. A Fermentations were carried out using eight different antimicrobial zone of inhibition was recorded in millimeters and the experiment compound production medium; GEN medium (M-1), Streptomyces was repeated twice. medium (M-2), Micromonospora medium (M-3), nutrient glucose medium (M-4), Bennett medium (M-5), starch with a mineral salt Antifungal assays solution medium (M-6), complex medium (M-7) and starch casein medium (M-8). A loopful of a selected strain was inoculated into 50 Antifungal assay was done by agar diffusion method. Petri plates 752 Afr. J. Microbiol. Res.

Table 1. Effect of production of antimicrobial metabolites on different media.

Inhibition zones in mm Fermentation medium B.s S.a S.e E.f E.c P.a K.p X.sp. E.sp. S.t V.f P.v C.a ERI-1 Medium -1 12 10 10 14 10 10 9 9 12 10 10 13 10 Medium – 2 10 12 12 12 10 10 ------Medium – 3 12 10 23 10 11 10 10 ------Medium – 4 14 12 14 15 14 11 10 10 12 10 10 10 14 Medium – 5 10 12 15 ------10 Medium – 6 12 13 10 12 10 10 10 12 12 11 10 - - Medium – 7 10 14 ------Medium – 8 12 12 10 10 10 10 12 11 12 10 9 9 12

ERI-3 Medium - 1 10 12 13 10 10 10 9 9 10 - - - - Medium – 2 12 11 12 10 11 10 11 10 10 - - - - Medium – 3 10 9 11 10 ------10 Medium – 4 10 10 9 9 9 12 ------Medium – 5 15 12 10 ------10 Medium – 6 11 10 11 11 10 10 12 10 10 - - - - Medium – 7 11 ------Medium – 8 12 14 14 10 12 11 10 12 15 10 12 10 12

ERI-26 Medium – 1 9 9 11 10 ------10 Medium – 2 11 13 14 10 11 9 9 10 - - - - - Medium – 3 10 11 12 10 ------Medium – 4 12 14 14 12 15 10 11 12 12 10 14 10 10 Medium – 5 11 12 12 10 ------10 Medium – 6 11 10 10 ------Medium – 7 10 ------Medium – 8 9 11 10 10 9 ------10

-: No activity, ERI: Entomology Research Institute. B.s- B. subtilis; S.a- S. aureus; S.e-S. epidermidis; E.f- E. faecalis; E.c- E. coli; P.a- P. aeruginosa; K.p- K. pneumoniae; X.sp- Xanthomonas sp.; E.sp- Erwinia; S.t- S. typhi; V.f- V. fischeri; P.v- P. vulgaris. Results were analyzed in triplicates.

were prepared with 20 mL of sterile SDA (Hi-media, Mumbai). The pound(s) from three actinomycetes strains ERI-1, ERI-3 test cultures (50µL of fungal spore suspension) were swabbed on and ERI-26. All the twelve tested bacteria and yeast the top of the solidified media and allowed to dry for 10 min. Five growth was inhibited by strain ERI-1 grown in M-1 and M- mm diameter well was made using sterile cork borer and filled with 0.05 mL of supernatant of ERI-1, ERI-3 and ERI-26. The plates 8 medium. M-2 did not show any activity against K. were left for 30 min at room temperature for supernatant diffusion. pneumoniae, Xanthomonas sp., Erwinia, S. typhi, V. Negative control was prepared using the respective fermentation fischeri, P. vulgaris and C. albicans, whereas M-5 exhi- medium. The plates were incubated for 24-48 h at 28°C. A zone of bited activity against only B. subtilis, S. aureus and S. inhibition was recorded in millimeters and the experiment was epidermidis (Table 1). ERI-3 cultivated in M-3, M-5 and repeated twice. M-8 inhibited the growth of all the tested bacteria; how-

ever M-4 was ideal for ERI-26

RESULTS Effect of pH on the production of antimicrobial Selection of fermentation medium compounds

Eight different fermentation media named as M-1 to M-8 Optimum pH for the production of antimicrobial com- were used as the base to determine the optimal nutri- pounds was recorded by diameter of zone of inhibition tional conditions for the production of antimicrobial com- (Table 2). At pH 7.0, ERI-1, ERI-3 and ERI-26 exhibited Arasu et al. 753

Table 2. Effect of pH of the medium on the growth and production of antimicrobial metabolites.

Inhibition zones in mm pH Strain B.s S.a S.e E.f E.c P.a K.p X.sp E.sp S.t V.f P.v C.a ERI-1 ------

DCW 1.5g/L 6.0 ERI-3 ------DCW 0.98 g/L ERI-26 ------DCW 1.23 g/L ERI-1 12 9 11 10 12 ------10 DCW 1.74 g/L 6.5 ERI-3 9 10 10 11 9 9 9 ------DCW 1.32g/L ERI-26 10 11 12 10 10 9 7 ------DCW 1.47 g/L ERI-1 15 15 14 14 14 11 10 10 12 12 12 10 12 DCW 2.47 g/L 7.0 ERI-3 12 9 9 11 10 9 9 9 11 - - - - DCW 2.21 g/L ERI-26 13 13 16 16 13 10 11 12 12 11 13 10 12 DCW 2.73 g/L ERI-1 9 10 10 9 9 10 9 10 12 10 9 9 9 DCW 2.4 g/L ERI-3 12 13 15 10 11 11 10 12 14 10 12 10 11 7.5 DCW 2.75 g/L ERI-26 9 10 9 9 10 8 8 12 13 14 - - 10 DCW 2.43 g/L ERI-1 13 14 10 12 12 14 12 ------DCW 1.41 g/L 8.0 ERI-3 9 10 11 9 9 9 ------12 DCW 1.28 g/L ERI-26 ------DCW 0.79 g/L ERI-1 ------DCW 0.42 g/L ERI-3 ------8.5 DCW 0.61 g/L ERI-26 ------DCW 0.72 g/L

-; No activity, ERI- Entomology Research Institute, DCW- dry cell weight. B.s - B. subtilis; S.a – S. aureus ;S.e - S. epidermidis; E.f - E. faecalis; E.c - E. coli; P.a- P. aeruginosa; K.p - K. pneumoniae; X.sp - Xanthomonas sp.; E.sp- Erwinia;S.t - S. typhi; V.f - V. fischeri;P.v - P. vulgaris. Results were analyzed in triplicates.

good growth and antimicrobial activity against tested Optimizing the incubation time and temperature for bacteria. Cell growth in terms of biomass was noted in production of antimicrobial compounds strain ERI-3 as 0.98, 1.32, 2.21, 2.43, 0.79 and 0.72 g/L for pH 6.0, 6.5, 7.0, 7.5, 8.0 and 8.5, respectively. ERI-1, ERI- 3 and ERI- 26 showed maximum antimicro- 754 Afr. J. Microbiol. Res.

Table 3. Effect of incubation time on growth and production of antimicrobial metabolites.

Inhibition zones in mm Time Strain B.s S.a S.e E.f E.c P.a K.p X.sp E.sp S.t V.f P.v C.a ERI-1 9 9 10 ------DCW 1.27 (g/L) ERI-3 ------24 DCW 0.7 (g/L) ERI-26 ------DCW 0.86 (g/L) ERI-1 10 12 10 9 11 12 13 11 12 10 12 12 10 DCW 2.8 ERI-3 9 10 12 9 10 11 10 10 12 11 10 10 10 48 DCW 2.46 (g/L) ERI-26 10 9 11 12 9 10 11 9 11 10 10 10 9 DCW 2.1 (g/L) ERI-1 9 10 11 10 11 12 12 10 12 11 11 10 10 DCW 3.21 (g/L) ERI-3 12 11 12 10 11 13 10 9 12 10 12 10 10 72 DCW 4.01 (g/L) ERI-26 10 12 11 12 13 10 11 12 12 10 13 10 10 DCW 3.9 (g/L) ERI-1 9 10 9 9 10 9 10 10 9 10 9 10 10 DCW 3.02 (g/L) ERI-3 12 10 11 11 10 11 9 10 10 9 11 10 10 96 DCW 3.79 (g/L) ERI-26 10 9 11 10 10 9 11 12 9 10 10 10 9 DCW 4.0 (g/L)

-; No activity, ERI- Entomology Research Institute, DCW- dry cell weight; B.s - B. subtilis; S.a- S. aureus; S.e- S. epidermidis; E.f - E. faecalis; E.c - E. coli; P.a- P. aeruginosa; K.p - K. pneumoniae; X.sp - Xanthomonas sp.; E.sp- Erwinia; S.t- S. typhi; V.f - V. fischeri; P.v - P. vulgaris. Results were analyzed in triplicates.

bial activity after 24 h. At 48 and 72 h, it exhibited maxi- Effect of glucose concentration on growth and mum cell growth as well as antibacterial activity (Tables 3 antimicrobial activity and 4). ERI-1, ERI-3 and ERI-26 did not exhibit activity at 20 and 45°C. It was not suitable for growth also. 30°C Different concentration of glucose on growth and antibac- was found to be optimum temperature for antimicrobial terial activity was studied (Table 6). For ERI-1, ERI-3 and metabolite production (Table 4). ERI-26, the concentration of glucose from 6 to 12 g/L enhanced the cell growth and the antimicrobial compound production. Effect of different carbon sources on growth and antimicrobial activity Effect of different nitrogen source on growth and Effect of different carbon source on growth and antimicro- antimicrobial activity bial activity was analyzed. Optimization of antibacterial compound production was carried out in batch culture. The results of nitrogen source utilization are shown in Strains were able to grow in all the tested carbon sources Table 7. The higher growth and antibacterial activity were (Table 5). However, ERI-1 and ERI-3 exhibited maximum observed in ammonium nitrate as nitrogen source follo- antimicrobial activity in medium supplemented with glu- wed by sodium nitrate and potassium nitrate in case of cose as a sole carbon source followed by starch and fruc- ERI-1 and ERI-26. ERI-3 exhibited maximum growth and tose. ERI-26 was able to utilize glucose for better growth antibacterial activity by using sodium nitrate followed by and revealed maximum antibacterial activity. ammonium nitrate. Arasu et al. 755

Table 4. Effect of incubation temperature on growth and production of antimicrobial metabolites.

Inhibition zones in mm Temperature Strain B.s S.a S.e E.f E.c P. a K.p X.sp E.sp S.t V.f P.v C.a ERI-1 ------20°C ERI-3 ------ERI-26 ------ERI-1 10 11 11 14 10 12 10 11 10 10 10 11 10 30°C ERI-3 11 9 11 13 10 13 11 12 10 10 10 10 12 ERI-26 9 11 12 10 9 10 10 10 11 11 11 10 11 ERI-1 10 10 9 11 9 11 10 9 9 - - - 9 37°C ERI-3 9 10 10 9 9 - - 9 9 9 10 11 10 ERI-26 9 11 10 9 9 9 10 10 10 10 10 9 9 ERI-1 10 11 ------45°C ERI-3 ------ERI-26 ------

-: No activity, ERI- Entomology Research Institute. B.s- B. subtilis; S.a- S. aureus; S.e- S. epidermidis; E.f- E. faecalis; E.c- E. coli; P.a- P. aeruginosa; K.p- K. pneumoniae; X.sp- Xanthomonas sp.; E.sp- Erwinia; S.t- S. typhi; V.f- V. fischeri; P.v- P. vulgaris.Results were analyzed in triplicates.

Table 5. Effect of different carbon sources on growth and antimicrobial activity against S. epidermidis.

ERI-1 ERI-3 ERI-26 Carbon Dry cell weight Antimicrobial activity Dry cell weight Antimicrobial activity Dry cell weight Antimicrobial activity source (g/L) (mm) (g/L) (mm) (g/L) (mm) Glucose 2.9 23 3.1 20 3 23 Starch 1.7 20 1.5 18 1.7 17 Sucrose 1.8 17 1.7 15 2 16 Starch 1.5 20 1.4 15 1.8 16 Maltose 2.7 18 2.9 17 2.5 18 Fructose 2.8 20 2.7 19 2.9 19 Mannitol 0.8 15 0.4 15 0.5 16 Mannose 1.7 15 1.5 15 1.8 15 Xylose 0.6 0 0.7 13 0.4 - Glycerol 2.4 18 2.7 16 2.9 16

Results were analyzed in triplicates.

Table 6. Effect of different glucose concentration on growth and antimicrobial activity (against S. epidermidis).

Glucose ERI-1 ERI-3 ERI-26 concentration Dry cell Antimicrobial activity Dry cell Antimicrobial activity Dry cell Antimicrobial activity (g/L) weight (g/L) (mm) weight (g/L) (mm) weight (g/L) (mm) 2 0.72 - 0.45 - 0.91 12 4 1.25 - 0.93 - 1.43 12 6 2.37 14 1.73 16 2.30 15 8 3.11 17 2.54 17 3.10 17 10 3.73 17 3.1 19 3.80 20 12 3.68 22 3.04 19 3.90 22 14 3.24 22 2.73 18 2.40 22 16 2.43 20 2.64 18 2.34 22 18 1.40 20 1.56 14 2.10 18 20 0.91 18 1.24 14 2.03 18

Results were analyzed in triplicates. 756 Afr. J. Microbiol. Res.

Table 7. Effect of different nitrogen sources on growth and antimicrobial activity (against S. epidermidis).

ERI-1 ERI-3 ERI-26 Nitrogen source Dry cell Antimicrobial Dry cell Antimicrobial activity Dry cell Antimicrobial activity weight (g/L) activity (mm) weight (g/L) (mm) weight (g/L) (mm) Ammonium nitrate 2.78 21 2.42 17 2.40 17 Ammonium sulphate 0.87 14 1.27 15 1.70 15 Ammonium citrate 1.04 15 0.73 12 0.64 - Sodium nitrate 2.45 20 2.75 22 1.92 15 Potassium nitrate 2.40 19 2.35 17 2.29 15

Results were analyzed in triplicates.

Table 8. Effect sodium chloride concentration on growth and antimicrobial activity (against S. epidermidis).

Sodium chloride ERI-1 ERI-3 ERI-26 concentration Dry cell weight Antimicrobial Dry cell Antimicrobial Dry cell Antimicrobial (g/L) (g/L) activity (mm) weight (g/L) activity (mm) weight (g/L) activity (mm) 4 1.85 17 1.93 18 1.93 18 8 3.21 18 2.84 18 3.71 21 12 4.68 23 3.64 24 3.53 22 16 3.43 20 2.94 20 2.14 22 20 1.91 18 1.54 19 1.33 21

Results were analyzed in triplicates.

Effect of sodium chloride on growth and antimicrobial Effect of fermentation media on antifungal activity activity Fermentation media were also checked against fungal Effect of different concentration of sodium chloride on pathogens. It was observed that strain ERI-26 greatly growth and antibacterial activity was studied. Increase in suppressed the growth of all the chosen fungal strains as concentration of sodium chloride in the medium influen- compared to strain ERI-1 and ERI-3 (Table 9). Among all ced the growth and antimicrobial compound production the fungi, A. niger and C. lunata showed significant inhibi- (Table 8). A concentration of 12 g/L was good for growth tion. as well as antimicrobial activity for the strains. There was a decline in growth and antimicrobial activity after 20 g/L. DISCUSSION

Cultivation of different complex media signalized the abi- Optimized media on antimicrobial activity lity for secondary metabolite production and the influence of inoculum stage conditions. Arasu et al. (2008) reported Optimized media showed good activity as compared to that antagonistic properties are largely influenced by the normal fermentation media. Secondary metabolites from quality of the medium. Eight different fermentation media strain ERI-1 showed good antimicrobial activity in opti- were used for the selection of best antimicrobial meta- mized media (M-4 media containing 12 g/L glucose, 1.2 bolite production. Medium-4 (modified nutrient glucose g/L ammonium nitrate, 12 g/L sodium chloride, pH 7.0, agar media) was chosen as the best base for the pro- temperature 30°C and incubation time 72 h). It was 1.5 duction and antimicrobial metabolite production for ERI-1 times more than the normal media (Table 9). ERI-3 culti- and ERI-26. ERI-3 cultured in M-8 was the best source vated in M-8 media containing 12 g/L glucose, 1.2 g/L for antimicrobial metabolite production. Our results indi- sodium nitrate, 12 g/L sodium chloride, pH 7.5, tempe- cated that MNGA was the good base for antimicrobial rature 30°C and incubation time 72 h revealed good pro- metabolite production; however Augustine et al. (2005) duction of antimicrobial metabolite in the broth. M-4 reported that starch casein medium was found to be good media components with 12 g/L of glucose, 1.2 g/L ammo- base for antifungal metabolite production. nium nitrate, 12 g/L sodium chloride, pH 7.0, temperature Optimizations of fermentation conditions are necessary 30°C and incubation time 72 h influenced ERI-26 for to improve secondary metabolite formation. Dissolved better production of antimicrobial metabolites. oxygen tension was identified to influence the productivity Arasu et al. 757

Table 9. Antimicrobial activity of optimized fermentation medium.

Antibacterial activity (Inhibition zones in mm) Anfungal activity (Inhibition zones in mm) Strain B.s S.a S.e E.f E.c P.a K.p X.sp E.sp S.t V.f P.v T.m E.f T.s C.l A.n B.c T.r 296 T.r 57 Scro C.a ERI-1 22 18 18 19 15 16 23 18 15 15 15 10 ------ERI-3 22 20 21 12 11 10 12 15 10 12 10 13 ------ERI-26 21 23 20 15 13 12 10 11 11 11 10 11 15 15 10 20 25 10 15 18 10 18

- ; No activity, ERI- Entomology Research Institute. B.s- B. subtilis; S.a- S. aureus ; S.e- S. epidermidis; E.f- E. faecalis; E.c - E. coli; P.a- P. aeruginosa; K.p - K. pneumoniae; X.sp - Xanthomonas sp.; E.sp- Erwinia; S.t- S. typhi; V.f- V. fischeri; P.v- P. Vulgaris; T.m- T. mentographytes; E.f- Epidermophyton floccosum; T.s- T. simii; C.l- Curvularia lunata; A.n- Aspergillus niger; B.c- Botrytis cinerea; T.r- Trichophyton rubrum; Scro- Scropulariopsis sp.; C.a- Candida albicans. Results were analyzed in triplicates. Among the fungus, only Candida albicans was used in the initial antimicrobial screening such as effect of different medium, different temperature, different pH and different incubation time, respectively.

of several processes concerning bioactive com- They influence the growth, as well as the potassium nitrate. Strains cultivated at 30°C were pound (Ya-Jie et al., 2009). Possibility to enlarge antimicrobial metabolite production of the optimum for good growth and antimicrobial meta- secondary metabolite formation with high oxygen actinomycetes strains. Nadia et al. (2004) repor- bolite production. The results also indicated an levels is a strong dependency of oxygen with the ted that leucine was the best nitrogen source for incubation time of 96 h as optimal. Cruz et al. enzymatic reactions of product formation. Kim et antimicrobial activity, while maximum antimicrobial (1999) reported that the production of antibiotic by al. (2000) reported a 7-fold enhancement of activity was introduced by using the carbon sour- S. griseocarneus was increased by glucose. kasugamycin production by pH shock in batch ces, citrate and acetate. Our results indicated that Gupte and Kulkarni reported that three indepen- culture of Streptomyces kasugaensis. It is well more antimicrobial activity was found when the dent variables, namely concentration of carbon known that environmental signals, including pH carbon source is glucose in combination with the source (glucose), nitrogen source (soybean meal) shock, can stimulate and promote the biosynthe- nitrogen source ammonium nitrate. The effects of and temperature of incubation, were found to be sis of secondary metabolites. Kim et al. (2007) nitrogen sources on streptolydigin production and the most important for the production of antimicro- reported that when the pH was maintained at 5, distribution of secondary metabolites from bial metabolites (Gupte and Kulkarni, 2000). In production of geldanamycin was increased from Streptomyces lydicus were investigated in shake general, Streptomyces sp. grew best in media 414 to 768 mg/L. Nadia et al. (2004) studied the flask level (Liangzhi et al., 2007). When soybean containing carbon and nitrogen sources, including effects of temperature, pH, incubation period, meal was used as the source of nitrogen, three chitin, starch, glycerol, arginin, asparagine, casein some media and different nitrogen and carbon analogues of streptolydigin were detected. Among and nitrate (Locci, 1989). sources for the production of antimicrobial meta- the nitrogen sources glutamic acid was most Results of the present work indicated that the bolite production. Temperature of 35°C and pH 8 favorable for the formation of streptolydigin selected actinomycetes possess antibacterial and were the best for growth and antimicrobial agent (Liangzhi et al., 2007). antifungal properties in liquid broth. This explains production and 14 to 15 days of incubation was ERI-1, ERI-3 and ERI-26 were able to grow in all that the antimicrobial metabolites are extra cellular found to be the best for maximum growth and the tested carbon sources. However maximum in nature. Conditions such as pH, temperature and antimicrobial activity, respectively, in the medium growth and antimicrobial activity was obtained in incubation period were optimized. Best me-dium BG-11. medium supplemented with glucose followed by for growth and antimicrobial metabolite production We found that medium with glucose and fruc- fructose. Fermentation medium supplemented were selected on the basis of antimicrobial activity. tose showed maximum antimicrobial metabolite with glucose enhanced the growth and antimicro- Modified nutrient medium with glucose as a car- production and cell growth. Ammonium nitrate and bial metabolite synthesis. The highest activity was bon source was found to be good base for fer- sodium nitrate were found to be the best nitrogen obtained in media containing ammonium nitrate as mentation. Best nitrogen source was selected source for the antimicrobial metabolite production. a nitrogen source, followed by sodium nitrate and based on the growth and antimicrobial activity. From 758 Afr. J. Microbiol. Res.

the present investigations, it was clear that ERI-1, ERI-3 Kim CJ, Chang YK, Chun GT (2000). Enhancement of kasugamycin and ERI-26 were found to produce extra cellular antimic- production by pH shock in batch cultures of Streptomyces robial metabolites. kasugaensis. Biotech. Prog. 16:548-552. Kim YJ, Song JY, Moon MH, Smith CP, Hong SK, Chang YK (2007). pH shock induces overexpression of regulatory and biosynthetic genes for actinorhodin production in Streptomyces coelicolor ACKNOWLEDGEMENTS A3(2). Appl. Microbiol. Biotechnol. 76:1119-1130. Lauren BP, Yi T, Yit-Heng C (2011). Metabolic engineering for the We thank "Cooperative Research Program for Agriculture production of natural products. Annu. Rev. Chem. Biomol. 2:211- 236. Science and Technology Development (Project No. Lazzarini A, Cavaletti L, Toppo G, Marinelli F (2000). Rare genera of PJ008502)" Rural Development Administration, Republic actinomycetes as potential producers of new antibiotics. Antonie of Korea. The authors extend gratitude to The Director, van Leeuwenhoek 78:399-405. Entomology Research Institute, Loyola College, Chennai. Liangzhi LI, Bin Q, Yingjin Y (2007). Nitrogen sources affect strep- Authors are thankful to Addiriyah Chair for Environmental tolydigin production and related secondary metabolites distribu- Studies, Department of Botany and Microbiology, College tion of Streptomyces lydicus. Chin. J. Chem. Eng. 15:403-410. Locci R (1989). Streptomyces and related genera. In: Stanley T. of Science, King Saud University, Saudi Arabia for finan- Williams, M. Elizabeth. Sharpe, and John Holt, editors. Bergey’s cial assistance. manual of systematic bacteriology. Baltimore: Williams Co. Mohd HI, Hawa ZEJ (2012). Primary, secondary metabolites, H2O2, malondialdehyde and photosynthetic responses of Orthosiphon REFERENCES stimaneus Benth. to different irradiance levels. Molecules 17:1159-1176. Arasu MV, Al-Dhabi NA, Saritha V, Duraipandiyan V, Muthukumar Nadia HN, Abdel FM, Khaleafa SHZ (2004). Factors affecting anti- C, Kim SJ (2013). Antifeedant, larvicidal and growth inhibitory microbial activity of Synechococcus leopoliensis. Microbiol. Res. bioactivities of novel polyketide metabolite isolated from 159:395-402. Streptomyces sp. AP-123 against Helicoverpa armigera and Valanarasu M, Kannan P, Ezhilvendan S, Ganesan G, Ignacimuthu Spodoptera litura BMC Microbiol. 13:105. S, Agastian P (2010). Antifungal and antifeedant activities of Arasu MV, DuraipandiyanV, Agastian P, Ignacimuthu S (2008). extracellular product of Streptomyces spp. ERI-04 isolated from Antimicrobial activity of Streptomyces spp. ERI-26 recovered Western Ghats of Tamil Nadu. J. Med. Mycol. 20:290-297 from Western Ghats of Tamil Nadu. J. Med. Mycol. 18:147-153. Vilella D, Sánchez M, Platas G, Salazar O, Genilloud O, Royo I, Arasu MV, Duraipandiyan V, Agastian P, Ignacimuthu S (2009). In Cascales C, Martín I, Díez T, Silverman KC, Lingham RB, Singh vitro antimicrobial activity of Streptomyces spp. ERI-3 isolated SB, Jayasuriya H, Peláez F (2000). Inhibitors of farnesylation of from Western Ghats rock soil (India). J. Med. Mycol. 19: 22-28. ras from a natural products screening program. J. Ind. Microbiol. Arasu MV, Ignacimuthu S, Agastian P (2012). Actinomycetes from Biotechnol. 25:315-327. Western Ghats of Tamil Nadu with its antimicrobial properties. Wildmans H (1997). Potential of tropical microfungi within the Asian Pac. J. Trop. Med. S830-S837. pharmaceutical industry. In: Hyde KD, editor. Biodiversity of Augustine SK, Bhavsar OSP, Kapadnis BP (2005). Production of a tropical microfungi. Hong Kong: Hong Kong University Press; pp. growth dependent metabolite active against dermatophytes by 29-46. Streptomyces rochei AK 39. Ind. J. Med. Res. 121:164-170. Ya-Jie T, Wei Z, Jian-Jiang Z (2009). Performance analyses of a Cruz R, Arias ME, Soliveri J (1999). Nutritional requirements for the pH-shift and DOT-shift integrated fed-batch fermentation process production of pyrazoloisoquinolinone antibiotics by Streptomyces for the production of ganoderic acid and Ganoderma polysaccha- griseocarneus NCIMB 40447. Appl. Microbiol. Biotechnol. rides by medicinal mushroom Ganoderma lucidum. Bioresour 53:115-119. Technol 100: 1852–1859. Demain AL (2006). From natural products discovery to commerciali- zation: a success story. J. Ind. Microbiol. Biotechnol. 33:486-495. Gupte MD, Kulkarni PR (2002). A study of antifungal antibiotic production by Streptomyces chattanoogensis MTCC 3423 using full factorial design. Lett. Appl. Microbiol. 35:220-226.

Full Length Research Paper

Incidence of Aspergillus contamination of groundnut (Arachis hypogaea L.) in Eastern Ethiopia

Abdi Mohammed1 and Alemayehu Chala2*

1Bule Hora University, P. O. Box 144, Bule Hora, Ethiopia. 2Hawassa University, P. O. Box 05, Hawassa, Ethiopia.

Accepted 23 January, 2014

The production of groundnut is constrained by several factors, among which is Aspergillus spp. In addition to causing quantitative losses, Aspergillus spp. produce highly toxic and carcinogenic chemical substances known as aflatoxins. This study was conducted with the objectives to (i) identify Aspergillus species associated with groundnuts, (ii) determine the frequency of seed contamination, and (iii) survey agro-ecological conditions related to groundnut contamination by Aspergillus spp. About 270 groundnut samples were collected from farmers’ storage, fields and local markets of three districts that is, Babile, Darolabu and Gursum of Eastern Ethiopia for mycological analysis in the year 2010. Results of the mycological analysis suggested heavy infestation of groundnut samples by various molds including Aspergillus niger, Aspergillus flavus, Aspergillus ochraceus, Aspergillus parasiticus and Pencillium species. At the district level, the incidence of infected groundnut kernels ranged from 50 to 80%. Within the district kernel infection varied between 36.3 and 100%. The common Aspergillus symptoms (yellowing or chlorotic leaves, wilting, drying and brown or black mass covered by yellow or greenish spores) were also observed in groundnut fields. The current results were consistent with our earlier report of heavy aflatoxin contamination of groundnut from the same places, suggesting the urgent need to apply control measures against toxigenic fungi and associated mycotoxins.

Key words: Aspergillus spp., groundnut, Penicillium spp., Ethiopia.

INTRODUCTION

Groundnut (Arachis hypogaea L.) is an important food nic microorganisms like Aspergillus species. Aspergillus and feed crop, which also serve as component of crop spp. are facultative parasites. They invade host plant rotation in many countries (Pande et al., 2003; tissues directly or attack tissues that have been predis- Upadhyaya et al., 2006). Groundnuts are also significant posed by environmental stresses such as dry weather or source of cash in developing countries that contribute damages caused by insects, nematodes, natural crac- significantly to food security and alleviate poverty (Smart king, and harvest equipment (Pettit and Taber, 1968). et al., 1990). Developing countries account for 97% of the They are distributed worldwide, mainly in countries with world’s groundnut area and 94% of the total production tropical climates that have extreme ranges of rainfall, (FAOSTAT, 2010). However, groundnut yield in this part temperature and humidity (Pettit and Taber, 1968). Many of the world and particularly in Africa is lower than the strains of this fungus are capable of producing aflatoxins world average due to prevailing abiotic, biotic and socio- that render the seed unacceptable due to high toxicity for economic factors (Pande et al., 2003; Upadhyaya et al., human or animal consumption (Reddy et al., 1996). 2006; Caliskan et al., 2008). Aflatoxins are highly toxic metabolites associated with In warm climates grains are easily infected with toxige- Reye’s syndrome, Kwashiorkor and acute hepatitis

*Corresponding author E-mail: [email protected]. Tel: +251 912 163096. Fax: +251 46 2206517. 760 Afr. J. Microbiol. Res.

(Wild and Hall, 1999; Wild and Turner, 2002). then stored at 4°C in vials containing 2.5 ml of sterile distilled water The Eastern lowland areas of Ethiopia have conside- for further use. rable potential for increased oil crop production including groundnut. Particularly areas such as Babile, Darolabu Species identification and Gursum are the major producers of groundnuts for local and commercial consumption (Getnet and Nugussie, Isolates were identified to a species level based on morphological 1991; Chala et al., 2012). Nevertheless, the area may (phenotypic) features as described by Cotty (1994), Egel et al. also be very conducive for toxigenic fungi like Aspergillus (1994), Kurtzman et al. (1997), and Okuda et al. (2000). For this purpose: Isolates representing each pure culture were grown on spp. owing to its warm and dry climate. Moreover, far- Czapek Dox Agar (CZDA) and PDA at 25°C for 5-7 days. Fungal mers’ practices of production and handling of groundnut colonies that grew rapidly and produced colors of white, yellow, at pre- and pos-harvest stages may provide favorable yellow-brown, brown to black or shades of green, mostly consisting conditions for outbreaks of fungi and their mycotoxins. As of a dense felt of erect conidiophores were broadly classified as Chala et al. (2012) reported, groundnut from East Ethio- Aspergillus spp. while those that produce blue spores were considered as Pencillium spp. (Okuda et al., 2000). Isolates with pia is heavily contaminated by aflatoxins at levels much dark green colonies and rough conidia were considered A. more than international standards, and this might be parasiticus (Klich, 2002). The major distinction currently separating associated with infection of the crop with Apsergillus spp., A. niger from the other species of Aspergillus is the production of mainly A. falvus and A. parasiticus that are known produ- carbon black or very dark brown spores from biseriate phialides cers of aflatoxins. However, up to date information on the (Raper and Fennell, 1965). Those that showed brown colony with prevalence of fungi, and studies on environmental factors orange and cream reverse sides were considered A. sojae and A. oryzae, respectively (Cotty, 1994). Those, which produce conidia and farmers’ practices that promote fungal contamination, with smooth surface on CZDA and colonies typical of A. flavus were which could be basis for the reduction of mycotoxins are recorded as A. flavus. limited under Ethiopian conditions. On the other hand, such studies are of paramount importance to give valid Data analysis recommendations for safe consumption and marketing of groundnut. The objectives of this study were to: i) identify Data on frequencies of kernel infection by Aspergillus and Aspergillus species associated with groundnut in East Penicillium species for samples collected from different locations of Ethiopia, ii) determine the frequency of seed contamina- the districts were subjected to analysis of variance (ANOVA) using the SAS computer package, version 9.11 (SAS, 2003). LSD test at tion, and iii) survey agro-ecological conditions related to the 0.05 probability level was used for mean comparison. contamination of groundnut by Aspergillus spp.

RESULTS AND DISCUSSION MATERIALS AND METHODS

Surveys of groundnut and sample collection Identification of Aspergillus species associated with groundnut Groundnut samples were collected from three districts (Babile, Darolabu and Gursum) of Eastern Ethiopia in the year 2010. The Four different Aspergillus spp. were found to be asso- samples were collected in three groups that is, from farmers’ stores, ciated with groundnut samples collected from Eastern fields and from local markets of selected locations of the three dis- Ethiopia (Figure 1). The first species isolated from the tricts. Geographic description of survey locations are given in Table 1. In each district, five locations were chosen based on the ground- collected samples was A. niger. The major distinction nut productions potential. Six samples were collected from each currently separating A. niger from the other species of location and hence 30 samples were collected per district making Aspergillus is the production of carbon black or dark the total number of samples collected from all over the three dis- brown spores of biseriate phialides (Raper and Fennell, tricts 270 (3 districts × 5 locations per district × 6 samples per 1965). The current study also confirmed the production of location × 3 sample groups per district). Data were also gathered on planting and harvesting dates of the crop, the variety, soil type, black or brown-black or black conidia by this species previous crop, and types of cultural practices. The common (Figure 1). methods of storage structures, drying materials and grain moistures A. flavus was the second species identified in this were observed. study. Colonies of this fungus were characterized by yellow to dark, yellowish-green pigments, consisting of a

Fungal isolation, species identification dense felt of conidiophores or mature vesicles bearing phialides over their entire surface (Gourama and Bullerman, Fungal isolation 1995). In general, A. flavus was known as a velvety,

yellow to green or the old colony was brown mould with a Fifty groundnut seeds per sample were surface sterilized with 10% Chlorox solution for 1 min, followed by immersion in sterile distilled goldish to red-brown on the reverse. The conidiophores water for 1 min. Surface sterilized seeds were then placed on were variable in length; walls of A. flavus conidia were freshly prepared potato dextrose agar (PDA) plates (five seeds per smooth to finely roughened or moderately roughened, plate) and incubated for three days at 25°C. Pure cultures of pitted and spiny. These observations were consistent different out growing fungi were obtained by transferring fungal colonies to new PDA plates using sterile toothpicks, and incubating with the findings of Gourama and Bullerman (1995), who the plates for 5-7 days at 25°C. Pure cultures of each isolate were reported A. flavus colonies as being initially Mohammed and Chala 761

Table 1. Geographic description of locations included in the survey.

District Location Latitude Longitudes Altitude (m) Ausharif 09011’933” 042013’080” 1733 Shekabdi 09012”890” 042013’65” 1437 Babile Shekusman 09012’89” 042013’105” 1784 Ifa 09017’762” 042017’161” 1500 Bishan Babile 09015’872” 042018’049” 1500

Sakina 08035’023” 040020’388” 2100 Gadulo 08026’078” 040015’732” 1400 Darolabu Odalaku 08035’067” 040019’842” 1760 Sororo 08035’036” 040019844” 1608 Haroadi 08034’954” 040020’280” 1788

Audal 09037’297” 042043’951” 1792 Ilalam 09037’268” 042043’758” 1838 Gursum Kassa oromiya 09037’282” 042043’610” 1650 Oda oromiya 09037’273” 042043’633” 1732 Harobate 09037’298” 042043’832” 1550

colored sclerotia, and salmon-pink mycelial turf on the reverse side of CZDA. Colonies of this species also produced near white to light yellow pigment and were dull yellow to dark yellow or sometimes brown on the reverse. A. parasiticus was the fourth species isolated from groundnut samples tested in the current study. Colonies A. niger A. niger A. flavus representing this species produced dark green and rough conidia on CZDA at 25 and 37°C after 5-7 days of incubation. Similar study by Peterson et al. (2001) distinguished A. parasiticus from A. bombycis by its typically dark green color on CZDA. Groundnut plants infected by Aspergillus spp. showed typical symptoms of infection as shown in (Figure 2).

A. ochraceus A. ochraceus A. parasiticus These include yellowing of leaves or chlorosis and premature death and dropping of leaves, wilting, drying Figure 1. Aspergillus spp. isolated from groundnut samples. single plant and patching or drying of localized areas within the fields. Underground grains were rotten and

distorted, and the plants were pulled out of the ground easily. On some dried plants, brown or black mass covered by yellow or greenish spores were observed in infected fields. A study by Subrahmanyam and Ravindranath (1988) stated the presence of shriveled and dried grains covered by yellow or green spores, when

Figure 2. Symptoms of Aspergillus infection on groundnut. groundnut plants are infected by A. flavus (Aflaroot or yellow mold). The same study reported highly stunted seedlings; reduced leaf size with pale to light green; yellow, turning to yellow-green or olive green with age crown rot or collar rot, with germinating seeds covered and appearing dark green with smooth shape and some with masses of black conidia; and rapid drying of plants having radial wrinkles. due to infection of groundnut by Aspergillus spp.

The third species identified in the current work, A. ochraceoroseus, produced yellow-gold conidia (Bartoli Frequency of kernel contamination and Maggi, 1978). The A. ochraceus was characterized particularly by its pale yellow conidial heads, orange-red Proportion of kernel contamination by Aspergillus spp. conidiophores with coarsely roughened walls, light varied from 50% at Babile market to about 80% at farmers’ 762 Afr. J. Microbiol. Res.

Figure 3. Proportion of groundnut kernels infected with Aspergillus spp. in East Ethiopia (N= 150 seeds/samples).

fields in Gursum district and storage houses in the district nut samples, A. niger and A. flavus were the most preva- of Darolabu (Figure 3). Groundnut samples collected lent mycotoxigenic fungi across the storage, field and from storage houses in the districts of Gursum and market samples in East Ethiopia. These two species Babile, and farmers’ fields at Babile had the second hig- were isolated at a rate of 21-48% (A. flavus) and 35-66% hest kernel contamination (70%). (A. niger). On the other hand, A. ochraceus accounted for When samples were analyzed at the location level 0-14%, while A. parasiticus was associated with 2-21% of (within district), kernel contamination varied significantly kernel infection. Pencillium spp. were also isolated from (p<0.05) from 36% at Bishan Babile market (Babile 6-13% of samples analyzed (data not shown). In another district) to 100% in farmers’ fields of Harobate (Gursum experiment, Eshetu (2010) reported the most frequent district) (Table 2). Samples from stores in Bishan Babile occurrence of Aspergillus spp. (A. flavus, A. niger and and Shekabdi kebeles (Babile district), stores in Sororo other Aspergilli) in wet shelled one year stored peanut location of Darolabu district, farmers’ field in Kasa Oromiya sample from Gursum district of Hararghe region in East of Gursum district were infected at a proportion of 93%. Ethiopia. In addition, groundnut samples collected from farmers’ In this study; A. flavus and A. niger were isolated at fields in Ausharif and Shekabdi location of Babile district, higher frequencies from samples collected from farmers’ stores of Sakina and Odalaku (Darolabu district), and fields and stores than markets while A. parasiticus was stores of Audal and Harobate in Gursum district were consistently isolated at higher frequencies from market found to be contaminated at a rate of 90%. On the other samples. In contrast to these, isolation frequency of A. hand, samples from markets at Shekusman location ochraceus was not consistently high or low in any of the (Babile district), Sororo of Darolabu district and Oda sample collection sites (fields, markets and stores) Oromiya (Gursum district) had only 43% kernel infection. across the survey districts. The current results were con- Generally, the current results suggest heavy contamina- sistent with Chala et al. (2012), who detected 5-11,900 tion of groundnut kernels with Aspergillus spp. Groundnut µg/kg total aflatoxin from same samples suggesting samples collected from markets had the lowest level of heavy groundnut contamination by Aspergillus spp. and Aspergillus infection compared to samples from farmers’ associated aflatoxins in the region. Aspergillus flavus and fields and stores across the survey districts and locations. aflatoxins contamination was also prevalent in stored This may suggest possible sorting of kernels by farmers groundnuts in Ghana (Awuah and Kpodo, 1996). Abdela to avoid those with visible symptoms of infection (2009) also reported contamination of groundnut samples (discoloration) before bringing the samples to the local from Sudan by A. niger and A. flavus, which were isola- markets. The results were in agreement with the study by ted at frequencies of 29-60% for A. niger and 4-52% for Pitt and Hocking (2009) in which Aspergillus spp. were A. flavus. Fusarium oxysporum, A. niger, R. bataticola more prevalent in the field and stored foods than in the and S. rolfisii were the predominant species of fungi markets. associated with diseased plants indicating the involve- The frequency of Aspergillus isolated from the ground- ment of these fungi in pre- and post- emergence death of nut samples analyzed in the current study is presented in groundnut plants in Babile district (Tefera and Tana, Table 3. Of the several species isolated from the ground- 2002). Mohammed and Chala 763

Table 2. Proportion of groundnut seeds infected by Aspergillus spp. in different districts of East Ethiopia.

Percent kernel infection District Location Store Field Market Ausharif 50c 90a 53.3bc Shekusman 70b 63b 43.3cd Shekabdi 93.3a 90a 70a Babile Ifa 66.7b 63b 56b Bishan babile 93.3a 70b 36.3cd LSD (0.05) 12 11 21.8 CV (%) 14 13 20

Sakina 90a 70b 56.7ab Gadulo 73.3b 53.3b 66.7a Odalaku 90a 56.7b 66.7a Darolabu Sororo 93a 53.3b 43c Haroadi 66.7b 76a 46.7bc LSD (0.05) 12 11 11 CV (%) 12 15 17

Audal 90a 73.3b 56.7c Ilalam 56.7c 70b 66ab Kasa Oromiya 63.3b 93.3a 65bc Gursum Oda Oromiya 73.3b 66.7b 43.3cd Harobate 90a 100a 46.7cd LSD (0.05) 13.4 11 7 CV (%) 15 11 12

Means in a column followed by the same letter are not significantly different according to LCD at p<0.05.

Table 3. Frequency of Aspergillus species isolated from groundnut seeds collected from three districts in East Ethiopia.

Percent kernel contamination District Fungal specie Store Field Market A. flavus 20.5 29 26.25 A. niger 66 47.8 38.75 Babile A. parasiticus 3.6 14 21.25 A. ochraceus 9.8 9.7 13.75

A. flavus 31 32.6 33.7 A. niger 56 53.6 41 Darolabu A. parasiticus 4 2.1 10.8 A. ochraceus 9 10.5 8.7

A. flavus 48.2 41 34.5 A. niger 34.82 40.5 39 Gursum A. parasiticus 4.46 10.74 14.3 A. ochraceus 9.82 7.43 0

Description of local groundnut varieties around Gursum districts are different from that of Darolabu selected areas districts. Their naming was based on the morphology standing from the ground and leaf shape, size, color and

Description of groundnut varieties in around Babile and seed size. Around Babile and Gursum districts, the common

764 Afr. J. Microbiol. Res.

local groundnut varieties were “Oldhale”, “Sartu”, and after optimum maturations due to lack of labor, which “Jawsi” (Data from Agricultural and Rural Develop-ment further increases Aspergillus infection. Drought stress Bureaus of the distritcs). Another similar study re-ported during late stages of pod development favors inva-sion of that predominant groundnut local variety (Oldhale) was groundnut by A. flavus and subsequent aflatoxin conta- commonly produced by farmers around Babile district mination. End of season drought was very critical as it (Tefera and Tana, 2002). The shape and leaf size of affects grain filling and pod formation in groundnut (Hill et these three varieties were different from each other. Two al., 1984). groundnut varieties that is, “Basuqa”and “Qacine” are found to grow commonly around Darolabu district. They Drying method of groundnut around the study areas are identified based on the plant morphology and seed size. The “Basuqa” variety has larger seeds and leaves Groundnut crops harvested in the survey districts are than “Qacine”. It gives higer yield than “Qacine”. But it is usually sun dried on materials such as matting. Curing of more susceptible to diseases and drought as revealed by groundnut was done for few days in the farms before the Agricultural and Rural Development Bureau of the drying and removing of the seed from the hulms, to re- district. move some moisture content from the kernels. In cases, where the moisture content of threshed unshelled and shelled pods was too high, the pods were sometimes Factors associated with Aspergillus spp. bagged and every day the bags were brought out from contamination of groundnuts in the study areas the stores and left in the open. Although such practices

Cultural practices may help reduce Aspergillus invasion, it would have been made more effective had it been coupled with fumigation Across the study areas, the groundnut shell is removed with burning cow dung fumes and sun drying for one day and left in farms, on the roads or water furrows then as suggested by Gehewande et al. (1986). irrigation water takes it to the farms and gardens. Such a scenario generally favors over seasoning of plant patho- Traditional groundnut storage system gens including Aspergillus for subsequent contamination of the next crops. Besides, groundnut in the survey dis- Storage structures commonly found in the survey districts tricts is cultivated either as a sole crop or intercropped are made from mud and animal dung. In mud house with different crops like sorghum (Sorghum bicolor), maize there was no improved aerations in some stores and in (Zea mays), haricot bean (Phaseolus vulgaris), and under some rain could percolate from the top and from the the shade of chat (Khata edulis), coffee (Coffea arabica) sides. Groundnuts in such houses are usually stored in and mango (Mangifera indica) trees. Although intercrop- sacks from the previous years, and this may also ping is generally known to decrease disease pressure in increase the contamination of groundnuts by Aspergillus agricultural fields, the companion crops in groundnut and aflatoxins. Dickens et al. (1973) associated moisture fields may not be very effective against Aspergillus spp. condensation on roofs, improper application of insecticide Mechanical damages caused during pulling and digging sprays or leaking hoses and application equipment, out groundnuts may also have predisposed kernels to conveyance of water from flooded elevator dump pits into infection by Aspergillus and associated aflatoxins. Seeds warehouse, and storage of peanuts on concrete floors in split pods are frequently invaded by A. flavus and that are damp or have no vapor barriers with increased A. subsequently become contaminated with aflatoxin as flavus growth. According to Bankole and Adebanjo suggested by (Graham, 1982). Shriveled kernels contain (2003), traditional storage structures used for on farm higher amounts of aflatoxin as a result of higher A. flavus storage include containers made of plant materials infection (Hill et al., 1984). Other factors, which may aid (woods, bamboo, and thratch). the contamination of groundnut with Aspergillus and then aflatoxins might be exchanging of equipment or plowing Conclusion materials and groundnut seeds between households. Results of the current survey revealed heavy contamina- Time of planting and harvesting of groundnuts tion of groundnuts by Aspegillus spp. Infection of kernels were higher in farmers’ store and farmers’ fields than Rain fall is usually unpredictable at the time of planting markets with incidence of kernel infection at district level and harvesting around the study areas. The planting time ranging from 36% at Babile market to 100% at Gursum of groundnut around the study areas usually lasts from field. A. niger and A. flavus were the most dominant spe- the beginning of April to the end of May, and the har- cies infecting groundnuts in East Ethiopia. vesting time is from the end of September to the first half In combination with our earlier report on aflatoxin of November according to the field conditions and availa- contamination of groundnut from East Ethiopia, the cur- bility of labor. However, pods may overstay in the field rent results should serve as a wakeup call to create aware-

Mohammed and Chala 765

ness on toxicogenic fungi and associated mycotoixns in Dickens JW, Satterwhite JB, Sneed RE (1973). Aflatoxin-contaminated the country. As aflatoxins are associated with health peanuts produced on North Carolina farms in 1968. J Am. Peanut Res. Edu. Assoc. 5: 48-58. risks, reducing their level in food stuff to a level accepted Egel DS, Cotty PJ, Elias S (1994). Relationship among isolates of by international standard is paramount importance to Aspergillus sect. flavi that vary in aflatoxin production. ensure the safety of these food stuff to consumers Phytopathology. 84: 906-912. thereby facilitate trade both within and between countries. Eshetu L (2010). Aflatoxin content of peanut (Arachis hypogaea L.) in relation to shelling and storage practice of Ethiopian farmers. M.Sc. Five local groundnut varieties are found to grow in the Thesis. Addis Ababa University, Ethiopia. survey districts. These are “Sartu”, “Oldhale”, “Jawsi”, FAOSTAT (2010). Groundnut world production. “Basuka” and “Qacine”. Although these varieties vary in http://www.faostat.fao.org. terms of morphological features and disease resistance, Gehewande MP, Nagaraj G, Jhala R (1986). Aflatoxin production and detoxification in groundnut. Proceedings of the national seminar on their resistance to Aspergillus and aflatoxins under dif- plant protection in field crops. 29-31 January 1986. Central plant fering environmental conditions is not established beyond protection training institute. Hydrabd. India. pp. 15-26. ambiguity. Thus future work should also focus in testing Getnet A, Nugussie A (1991). Production and research on oil seeds in varieties for Aspergillus resistance under different envi- Ethiopia. Proceedings of the first national oil seeds workshop in Ethiopia, 3-5 December. Institute of Agricultural Research. Addis ronmental conditions and management practices. Ababa, Ethiopia. p.312. This study has identified some important factors that Gourama H, Bullerman LB (1995). A. flavus and A. parasiticus: may contribute for aflatoxin contamination of groundnuts Aflatoxigenic fungi of concern in food and feeds. J. Food Prot. 58: both pre- and post-harvest. These include: weather con- 1395-1404. Graham J (1982). Aflatoxin in peanuts: Occurrence and control. ditions, seed and equipment sharing, planting time; har- Queens. Agri. J. 108: 119-122. vesting time and methods; curing, drying and storage Hill RA, Wilson DM, Burg WR, Shotwell OL (1984). Viable fungi in corn practices. The roles of additional factors that contribute to dust. App. Environ. Microbiol. 47: 84-87. aflatoxin contamination down in the value chain need Klich MA (2002). Identification of common Aspergillus species. Cen- traalbureau voor Shimmelcultures. Utrecht. The Netherlands. p.116. further investigation. In addition, the role of none che- Kurtzman CP, Horn BW, Hesseltine CW (1997). Aspergillus nomius, a mical seeds treatments especially essential oils and that new aflatoxin-production species related to A. flavus and A. tamari. of biological control agents in reducing groundnut Ant. Van Lee. 53: 147-158. contamination should be studied to come up with a more Okuda T, Klich MA, Seifert KA, Ando K (2000). Integration of modern taxonomic methods for Penicillium and Aspergillus Classification. In: effective and sustainable management strategy. Farmers’ Samson RA, Pitt JI Editors. Hardwood Academic Publishers: association and extension agents should also be encou- Reading, UK. pp 83-100. raged in creating awareness about aflatoxins and mana- Pande N, Saxena J, Pandey H (2003). Natural occurrence of gement techniques. mycotoxins in some cereals. Mycoses. 33:126-128. Peterson SW, Ito Y, Horn BW, Goto T (2001). Aspergillus bombycis, a

new aflatoxigenic species and genetic variation in its sibling species, ACKNOWLEDGEMENT A. nomius. Mycologia. 93: 689-703. Pettit RE, Taber RA (1968). Factors influencing aflatoxin accumulation

in peanut kernels and the associated mycoflora. Appl. Microbiol. 16: We are grateful to the Drylands Coordination Group 1230-1234. (DCG), Norway, for financial assistance. We also thank Pitt JI, Hocking AD (2009). Fungi and food spoilage (3rd ed). Springer. Drs. Dereje Gorfu, Ferdu Azerefegne and Yibrah Beyene pp. 520. for their valuable comments. Raper KB, Fennell DI (1965). The genus Aspergillus. Williams and Wilkins. Baltimore, Maryland. pp.686. Reddy LJ, Nigam SN, Moss JP, Singh AK, Subrahmanyam P, McDonald D, Reddy AGS (1996). Registration of ICGV86699 peanut REFERENCES germplasm line with multiple disease and insect resistance. Crop Science 36: 821. Abdella MH (2009). Mycoflora of groundnut kernels from Sudan. Trans. SAS Institute Inc (2003). SAS/STATA guide for personal computers Br. Mycol. Soci. 63: 353-359. version 9.1 edition. Carry: SAS Institute. Awuah RT, Kpodo KA (1996). High incidence of A. flavus and aflatoxins Smart MG, Shotwell OL, Caldwell RW (1990). Pathogenesis in in stored groundnuts in Ghana and the use of microbial assay to Aspergillus ear rot of maize: aflatoxin B1 levels in grains around assess the inhibitory effects of plant extracts on aflatoxin synthesis. wound inoculation sites. Phytopatology. 80: 1283-1286. Mycopathologia 134: 109-114. Subrahmanyam P, Ravindranath V (1988). Fungal and nematode Bankole SA, Adebanjo OO (2003). Occurrence of aflatoxins and diseases. In: Reddy PS Editor: Groundnut. Indian Council of fumonisins in preharvest maize from south-western Nigeria. Food Agricultural Research. New Delhi. India. pp. 453-523. Add. Cont. 21: 251- 255. Tefera T, Tana T (2002). Agronomic performance of sorghum and Bartoli A, Maggi O (1978). Four new species of Aspergillus from Ivory groundnut cultivars in sole and intercrop cultivation under semiarid Coast soil. Trans. Br. Mycol. Soci. 71: 383-394. conditions. J Agron. and Crop Sci. 188: 212-218. Caliskan S, Arslan M, Arioglu H (2008). Effects of sowing date and Upadhyaya HD, Reddy LJ, Gowda CLL, Singh S (2006). Identification of growth duration on growth and yield of groundnut in a Mediterranean- diverse groundnut germplasm: Sources of early maturity in a core type environment in Turkey. Field Cro. Res. 105: 131-140. collection. Field Cro. Res. 97: 261-271. Chala A, Mohammed A, Ayalew A, Skinnes H (2012). Natural Wild CP, Hall AJ (1999). Hepatitis B virus and liver cancer: Unanswered occurrence of aflatoxins in groundnut (Arachis hypogaea L.) from questions. Can. Surv. 33: 35-54. eastern Ethiopia. Food Control. In press. Wild CP, Turner PC (2002). The toxicology of aflatoxins as basis for Cotty PJ (1994). Comparison of four groups for the isolation of A. flavus public health decisions. Mutagenesis. 17: 471-481. group fungi. Mycopathologia. 125: 157-162.

Full Length Research Paper

Microencapsulation, survival and adherence studies of indigenous probiotics

Ammara Hassan1*, M. Nawaz Ch2 and Barbara Rasco3

1Food and Biotechnology Research Centre, Pakistan Council of Scientific and Industrial Research, Lahore. Pakistan. 2CEES, University of the Punjab, Lahore. Pakistan. 3School of food Sciences, Washington State University, USA.

Accepted 23 January, 2014

The aim of the study was to evaluate the adherence potential of indigenous probiotic bacteria and to improve the gastrointestinal survival of these cultures by adopting the double microencapsulation technique. The mean with standard deviation of triplicate experiments for the cell surface hydrophobicity, aggregation, and Cell adhesion evaluation of indigenous probiotics revealed that there was no significant difference in the hydrophobicity of both solvents (n- hexadecane and Xylene). A mixed trend was observed in the estimation for hydrophobicity; the indigenous Lactobacillus acidophilus was found with highest cell surface hydrophobicity (56.3%) and the lowest was found in Lactobacillus reuteri (28.1%). The Ca-alginate and prebiotics amalgum was used in double treatment and compared with control (free) and single encapsulated (Ca-alginate) cells in the stimulated gastric juice (SGJ) and stimulated intestinal juice (SIJ). The one-way analysis of variance (ANOVA) results show that the double microencapsulation technique has significant effects (P< 0.05) on the survival of bacterial cells during 6 weeks storage. A negligible reduction was found on day 42 in case of double microencapsulated cells as compared to significant adverse effects on the free cell. The loss was higher in single microencapsulated Lactobacillus plantarum and Lactobacillus paracasei and zero loss for Lactobacillus delbrueckii subsp. Bulgaricus. While a slight revival was observed in the free and single encapsulated bacteria in SIJ. Thus, combination of Ca-alginate and prebiotics significantly improves the viability and stress response of probiotics in the harsh GI conditions.

Key words: Surface-hydrophobicity, aggregation, adhesion, double- microencapsulation, stimulated gastric Juice, stimulated intestinal juice, prebiotics, probiotics.

INTRODUCTION

Foods are no longer considered by consumers only in products led Ilya Metchnikoff towards Nobel Prize in 1908 terms of taste and immediate nutritional needs, but also (Vasiljevic and Shah, 2008). Probiotics are live micro- in terms of their ability to provide specific health benefits organisms that benefit the health of the host, if consumed beyond their basic nutritional value. Currently, the largest in adequate amount (Liaskovskii and Podgorskii, 2005). segment of the functional food market is provided by the Mostly probiotic bacteria are incorporated in dairy foods targeted towards improving the balance and activity products like milk, ice cream and yoghurt. The lactic acid of the intestinal microflora (Saarela et al., 2002). The producing probiotics keep the gut at a low pH, maintains nutritional effects due to the presence of probiotics in the the gut microflora and helps preserve the dairy products.

*Corresponding author. E-mail: [email protected]. Hassan et al. 767

They also combat the growth of harmful pathogens that adhesion on the gut lining is considered as an important cause foodborne illnesses (that is, diarrhea). The probio- requirement for delivering health based benefits and the tics prevent the attachment of these pathogens by com- estimation of surface hydrophobicity is the best technique peting for similar binding sites on the gut epithelium to determine this adherence and colonization potential (Parvez et al., 2006). But to deliver the health benefits, (Kaushik et al., 2009). the probiotic bacteria need to be viable in the gut. The In this study, two materials of particular interest used as International Dairy Foundation (IDF) has recommended a capsules were the Ca-alginate and prebiotics amalgum minimum number of 107 CFU per gram of the product (containing galactooligosaccharides (GOS), manno- consumed (Homayouni et al., 2008). However, the loss of oligosaccharide (MOS), and fructooligosaccharides viability can happen prior to consumption, during process- (FOS)). Alginate is a natural polysaccharide of β-D- sing procedures such as oxygen stress, freezing and mannuronic acid (M) and α-L-guluronic acid (G), usually drying or due to the harsh conditions in gastrointestinal extracted from algae/seaweed and is currently the most (GI) tract such as high pH, bile salt and gastric acid widely used and studied material of microencapsulation secretion (Chávarri et al., 2010). (Chen and Walker, 2005). while Prebiotics are a group of Therefore, providing a physical barrier to the probiotic carbohydrates made up of functional oligosaccharides living cells to resist adverse environmental conditions is which are non-digestible food substances that favour the therefore an approach currently receiving considerable growth of other bacteria (Liaskovskii and Podgorskii, interest (Kailasapathy, 2009). 2005). The microencapsulation techniques have resulted in The main objective of this research was to evaluate the greatly enhanced viability of these microorganisms in adherence potential and survival of indigenous probiotic food products as well as in the gastrointestinal tract. In bacteria in gastrointestinal (GI) environment after micro- this process, active agents are entrapped within a carrier encapsulation. material. It is a useful tool to improve living cells into foods, to protect (Favaro-Trindade and Grosso, 2002; Liserre et al., 2007; Shima et al., 2009; Thantsha et al., MATERIALS AND METHODS 2009) and to extend their storage life and to convert them into a powder form for convenient use (O'riordan et al., In vitro adherence studies of indigenous probiotic strains 2001; Lian et al., 2003; Oliveira et al., 2007). In addition, microencapsulation can promote controlled release and Cell surface hydrophobicity optimize delivery to the site of action, thereby potentiating the efficacy of the respective probiotic strain. This pro- To determine the probiotics adhesion to hydrocarbons the method cess can also prevent these microorganisms from multi- of Rosenberg et al. (Rosenberg et al. 1980) and absorbance was plying in food that would otherwise change their sensory taken at 600 nm and surface hydrophobicity (%) was calculated in characteristics. replicates as percent decrease (ΔAbs×100) in the absorbance of The investigations has revealed that the probiotic cell suspension (A Initial) and after phase separations (A final) as follows:

Cell aggregation was kept at 35°C for 2 h after that 1.0 ml of the top suspension was

taken to measure the absorbance (A final), and broth was used as The freshly grown probiotic bacterial cells in MRS broth at 35°C for reference (Del Re et al., 2000; Tomás et al., 2005). The estimation 24 h were harvested (1) and the cell pellet washed with PBS and was performed in replicate. To calculate cellular autoaggregation resuspended in PBS. An absorbance of ~0.5 at 600 nm (A initial) was index, the difference in percentage between the initial and final taken. Then the suspension was centrifuged and the pellet was absorbance was recorded as follows: resuspended in equal volume of removed broth (in 1). The mixture

Caco-2 Cells Adhesion Assay Preparation of cell suspension for microencapsulation

Adhesion of probiotic isolates was estimated using method of All the previously Isolated Probiotic cultures (Hassan and Jacobsen et al. (Jacobsen et al., 1999). with Caco-2 cells (105) and Chaudhry, 2013) were prepared, from frozen stocks stored at the estimation was performed in replicate. −80°C, by transfering into MRS broth, then cultures were incubated, 768 Afr. J. Microbiol. Res.

Figure 1. Overview of adopted microencapsulation technique.

in anaerobic conditions, at 35°C for 18 h. After incubation, media 2008) by adding to 36 mL of the pancreatin- bile mixture (containing were centrifuged for 10 min at 4°C, and cells were washed with 1 mg/mL pancreatin and 4.5 g/mL of bile salts in phosphate buffer) , sterile 0.1% (w/v) pepton water. and pH was adjusted to 7.4. The mixture was then incubated for 4 h at 35°C.

Microencapsulation Statistical analysis For microencapsulation, firstly the cells were coated with Ca- alginate by the emulsion method of Ortakci (Ortakci et al., 2012) The data observed in in vitro adherence studies as well as the and stored in pepton-saline solution at 4°C until use. Later, the logarithmic reductions in free (control), single encapsulated and alginate -encapsulated probiotic cells were coated with the mixture double encapsulated bacterial cells as a consequence of acidic of prebiotics, containing FOS, MOS, GOS and free cells were used (SGJ-A and SGJ-B) and bile (SIJ) juices were analyzed by one-way as control. The overall adopted technique for microencapsulation is ANOVA using SPSS 17 version. Significance was declared at P ≤ shown in Figure 1. 0.05.

Survival evaluation in simulated gastric juice (SGJ) RESULTS AND DSCUSSION

To investigate the effect of pH, same as that of Gastric juice, on the In vitro adherence studies of potential indigenous survival of indigenous encapsulated probiotic bacteria, the cells probiotic strains were treated (for 120 min ) with sterile stimulated Gastric Juice -A (SGJ -A) as followed by Mainville et al. (Mainville et al., 2005) containing 2.0 g/kg of NaCl and 0.3 g/kg of pepsin in M HCl (~pH Cell surface hydrophobicity 1.4) and sterile stimulated Gastric Juice- B (SGJ -B) containing 0.9 M H3PO4 (pH 2.0) instead of HCl. The investigations has revealed that the probiotic cell adhesion on the gut lining is considered as an important requirement for delivering health based benefits and the Survival evaluation in simulated intestinal juice (SIJ) estimation of surface hydrophobicity is the best technique After treatment in SGJ for 60 min, the mixture was converted to to determine this adherence and colonization potential simulated intestinal juice (Huang and Adams 2004; Annan et al. (Kaushik et al., 2009). Therefore, the indigenous probiotic Hassan et al. 769

Table 1. Cell surface hydrophobicity, aggregation, and cell adhesion evaluation of selected indigenous probiotic Isolates.

Hydrophobicity (%) Isolate Aggregation (%) Adhesion ratio (%) n- hexadecane Xylene L. acidophilus 56.3 ± 0.10 56.1 ± 0.04 36.1 ± 0.13 7.2 ± 0.10 L. lactis 49.1 ± 0.06 49.3 ± 0.08 34.9 ± 0.14 8.3 ± 0.09 L. casei 52.7 ± 0.21 52.3 ± 0.01 31.7 ± 0.09 7 ± 0.12 L. rhamnosus 47.3 ± 0.14 47.3 ± 0.09 41.3 ± 0.98 8.1 ± 016 L. brevis 43.1 ± 0.12 43.5 ± 0.03 32.6 ± 0.01 8.5 ± 0.32 L. lactis (b) 37.5 ± 0.19 37.6 ± 0.13 40.9 ± 0.12 7.9 ± 0.63 L. rhamnosus (b) 39.1 ± 0.24 39.1 ± 0.17 51.9 ± 0.07 7.4 ± 0.42 L. acidophilus(b) 34.9 ± 0.14 34.1 ± 0.74 37.9 ± 0.07 7.1 ± 0.31 L. brevis (b) 33.4 ± 0.14 33.6 ± 0.79 56.1 ± 0.03 6.9 ± 0.17 L. casei (b) 36.7 ± 0.18 36.2 ± 0.18 48.0 ± 0.04 8.6 ± 0.78 B. bifidus 29.1 ± 0.21 29 ± 0.06 49.2 ± 0.08 8.2 ± 0.91 B. infantis 39.7 ± 0.17 39.1 ± 0.08 32.9 ± 0.06 7.9 ± 0.19 B. longum 51.3 ± 0.78 51.6 ± 0.07 32.5 ± 0.02 8.1 ± 0.17 B. dentum 46.7 ± 0.98 46.7 ± 0.17 33.3 ± 0.07 7.6 ± 0.63 B. brevis 31.5 ± 0.15 31.3 ± 0.04 31.8 ± 0.03 7.3 ± 0.71 B. adoles 38.4 ± 0.18 38.1 ± 0.09 40.7 ± 0.07 7.1 ± 0.44 L. plantum 36.6 ± 0.24 36.1 ± 0.13 49.6 ± 0.05 7.2 ± 0.19 L. reteri 28.1 ± 0.27 28.6 ± 0.19 31.9 ± 0.03 6.1 ± 0.13 L. gasseri 35.5 ± 0.17 35.5 ± 0.19 35.1 ± 0.10 6.9 ± 0.22 L. fermentum 39.6 ± 0.12 39.6 ± 0.27 31.7 ± 0.09 7.5 ± 0.26

isolates were also analysed for the adherence studies in persistence of probiotic bacteria in the host GI tract this study. The mean with standard deviation of triplicate (Boekhorst et al., 2006b) (Boekhorst et al., 2006a). It has experiments are presented in Table 1. It has been found also been investigated that after adherence in the gut that there was no significant difference in the hydro- lining, the probiotic bacteria got the ability of aggregation phobicity of both solvents used. All the recorded readings and colonization for health promoting benefits. found in line with Kaushik et al. (Kaushik et al., 2009). In Vandevoorde et al. (1992) has also reported that the the present estimation, the hydrophobicity was found with cellular aggregation not only facilitates the colonization mixed trend, the indigenous Lactobacillus acidophilus but also provide a protection to the host by formatio of was found with highest cell surface hydrophobicity biofilm (Vandevoorde et al., 1992) and this biofilm (56.3%) and lowest was found in Lactobacillus reuteri formation is important for functioning of probiotics (Ocaña (28.1%). Previous research has revealed that some and Nader-Macias, 2001; Kos et al., 2003; Cesena et al., lactobacillus strains show low cell surface hydrophobicity 2001). In the present study, the mean and standard to 2-5% (Schillinger et al., 2005; Rijnaarts et al., 1993) deviation of percentages of triplicate experiment for cell but neither of the isolated strain showed such a low aggregation of all indigenous isolates were recorded and hydophobicity percentage. Kaushik et al. (2009) has presented in Table 1. The highest percentage was clamied that hydrophobicity plays a vital role in the observed in L. rhamnosus (51.9%) followed by L. brevis cellular interaction. This great difference in the hydo- with the percentage of 56.1 while the least was found in phobicity percentage could be due to the difference in the two isolates L.casei and L.fermentus with the similar cell surface protein expression that may be due to the value of 31.7%. The cell aggregation study was also variation in environmental conditions(Tomás et al., 2005; concluded by Kaushik et al (Kaushik et al., 2009) but they Ramiah et al., 2007). did not find such a high potential of self-aggregation in their indigenous strain of Lactobacillus plantarum.

Cell auto-aggregation Cell adhesion assay The reports have highlighted the presence of four mucus- binding proteins genome in Lactobacillus plantarum The mean and standard deviation of cell adhesion assay inclding the longest gene, ORF lp_1643 containing six of selected indigenous isolates are given in Table 1, the repeats. These proteins helps in the adherence and the highest percentage was observed by L. casei (8.6%) 770 Afr. J. Microbiol. Res.

Table 2. Probiotic bacterial count for Free, Single and Double Encapsulated bacteria during storage.

Control Single-encapsulated Double-encapsulated Time (day) (Mean CFU × 108/g) ±SD (Mean CFU × 108/g) ±SD (Mean CFU × 108/g) ±SD 0 2.45 ± 0.20 2.98 ± 0.21 3.16 ± 0.18 7 2.52 ± 0.14 2.92 ± 0.18 3.32 ± 0.09 14 2.68 ± 0.19 3.12 ± 0.23 3.41 ± 0.17 21 2.74 ± 0.27 3.29 ± 0.40 3.68 ± 0.23 28 2.63 ± 0.23 3.36 ± 0.23 3.73 ± 0.71 35 1.91 ± 0.20 3.29 ± 0.16 3.84 ± 0.20 42 0.71 ± 0.19 3.14 ± 0.14 3.83 ± 0.20

followed by isolate L. brevis with the percentage of 8.5% combination of Ca-alginate and prebiotics significantly while the least was found in isolates Lactobacillus lactis improves the viability of probiotic cells in the harsh gastro- with the value of 6.1%. The results of cell surface hydro- intestinal conditions. phobicity, cell auto-aggregation and cell adhesion assay These microencapsulated indigenous probiotic cutlures for the selected indigenous probiotic isolates suggests can be used in food technology and production as it provides that these isolates have specific interaction and coloni- a solution to the low viability of probiotics incorporated in zation potential in the gut that is also indicated by good local dairy products. Ideally these cultures, since have adhesion ratio while using Caco-2 cell lines, as matches adherence potential, can maintain the level of the bene- the conclusions of Kaushik on lactobacillus strains ficial probiotic bacteria at the minimum standard amount (Kaushik et al., 2009). required (Akhiar and Aqilah, 2010). This study showed significant effects on the survival of free cultures in both SGJ-A and SGJ-B while the loss was higher in single microencapsulated L. plantarum and Microencapsulation and survival studies of Lactobacillus paracasei while negligible loss was indigenous probiotic strains observed for double- microencapsulated cells. The zero loss was found in the mean probiotic count (cfu/g) of Lactobacillus delbrueckii subsp. Bulgaricus and L. The mean and standard deviation experiments conducted paracasei. While a slight revival was observed in the free in triplicate for the free, single (Ca- alginate) and double and single encapsulated bacteria in SIJ probably (Ca- alginate and prebiotics amagum) microencapsula- because of resuscitation of some injured cells because of tion are shown in Table 2 and count was performed on acidic conditions. The adherence studies reveal that seven day interval for the period of six weeks. The rate of there is significant potential of health benefits of the reduction of probiotic bacterial count (CFU/g) was calcu- isolated indigenous probiotic cultures and the lated by the following formula;

All the individual cultures of Lactobacillus and Bifidobac- The present investigation also endorsed the results of terium as well as the mixed culture of both showed simi- Yeo and Liong that a significant increase in the count for lar response as that was investigated by Sultana et al. L. acidophillus FTDC 8033 and Lactobacillus sp. FTDC (2000), Kailasapathy et al. (2002), Vivek et al. (2013) and 2113 in soy milk when supplemented with prebiotic (FOS) Chen et al. (2005), and proved the potential of microen- upto 7- log CFU/ml (Yeo and Liong, 2010). According to capsulation for protecting the indigenous probiotic bacte- Ding and Shah, probiotic bacteria encapsulated in algi- rial cells. The adopted double encapsulation technique nate, xanthan gum, and carrageenan gum survived better has presented a significant effect (P< 0.05) on the survi- (P < 0.05) than free probiotic bacteria, in acidic environ- val of probiotic indigenous cells during storage of six ment (Ding and Shah, 2009), which also justifies the sig- weeks. In the case of free cells, which were used as a nificance of present study. In fact, it has been investiga- control, the reduction in the mean count was observed on ted that prebiotics (fructooligosaccharides, iso-maltooligo- day 28, single encapsulated on day 35 while the double saccharides and lactulose) is an emerging alternative that encapsulated bacterial cells was decreased from 3.84 × can further enhance probiotic activity and they enhance 8 8 10 on day 35 to 3.83 × 10 on day 42. the growth of probiotics by providing carbon and nitrogen Hassan et al. 771

Figure 2. Mean loss in Lactobacillus count (Log 10 cfu/g) for free (control), Single encapsulated and Double Encapsulated bacteria in SGJ- A. Lactobacillus lactis AH-1 Lactobacillus reuteri AH-2 , Lactobacillus acidophilus AH-3, Lactobacillus rhamnosus AH-4 Lactobacillus casei AH-5, Lactobacillus plantarum AH-6 and Lactobacillus brevis AH-7.

sources which can increase their colonization of the gut count for uncoated free bacterial cells while the coated (Annan et al., 2008). bacterial cells, either single or double microencapsulated, However, the symbiotic effects of probiotics and prebio- had a negligible reduction. tics are strain-dependent. As Yeo Siok had reported dif- In the case of single microencapsulated probiotics, the ferent growth behaviours for six different strains of loss was high L. plantarum AH-6 and Lactobacillus brevis lactobacilli and bifidobacteria when supplemented with AH-7 that is, 2.29 × 102 and 3.24 × 102, respectively. The five different prebiotics. Lactobacillus spp. FTDC 2113 bacterial loss was negligible in the case of double- micro- grew significantly when supplemented with FOS but did encapsulated bacterial cells. The zero loss was found in not grow with pectin (Yeo and Liong, 2010). In the pre- the mean microbiological count (cfu/g) of L. reuteri AH-2 sent study the mixture of encapsulated bacteria has and L. reuteri AH-7 after the incubation of 2 h in SGJ-A. showed higher growth in the presence of prebiotics. The The results of bifidobacterium cultures are shown in survival of double microencapsulated probiotics not only Figure 4 for SGJ-A. proves the statement of Rabanel et al. that both the algi- This rapid reduction in count of free bacterial cells, nate and prebiotics are compatible with probiotics (Rabanel when incubated for 120 min in stimulated Gastric Juice -A et al., 2009) but also justifies the claim of Chen Kun-Nan (SGJ-A), was the function of low pH (1.4) and acidic con- et al. (2005) that the Survival rate of the co-encapsulated ditions, which is similar to the pH of the human stomach active probiotics increases 1000 times higher than for before ingestion of food. the main reason of rapid loss alginates alone. was that no protection was provided to free cells in such a harsh acidic environment. The technique of double microencapsulation, both with Ca- alginate and prebiotics Simulated gastric Juice (FOS and IMO) showed amazing results in the case of L. reuteri AH-2 and Lactobacillus brevis AH-7 as compared The stimulated Gastric Juice (SGJ-A) has shown a signi- to the negligible loss of bacterial count was observed in ficant reduction on the free probiotic cell (Figure 2). Initial the case of other probiotic isolates. It proves the potential mean count for free cells was 2.45 × 108 cfu/g which had in technique of double microencapsulation. Under the lost 1.09 × 103, 1.04 × 104, 2.01 × 102, 2.74 × 101, 2.56 × double microencapsulated probiotic cells, the survival of 102, 1.76×101 and 1.99 × 102 for L. lactis AH-1, L. reuteri bacteria was significantly greater than free and single- AH-2, L. acidophilus AH-3, Lactobacillus rhamnosus AH- microencapsulated bacterial cells. This supports the notion 4, Lactobacillus casei AH-5, L. plantarum AH-6, and that it is prime to test the probiotics in the proper physio- Lactobacillus brevis AH-7, respectively. logical conditions as bacterial survival is greatly influen- The results of the survival evaluation of free cells, ced by variations in pH (Mainville et al., 2005; Pitino et Single encapsulated and double encapsulated probiotics al., 2010). This agrees with the findings of Sharp (Sharp in stimulated Gastric Juice B, shown in Figure 3. The et al., 2008) who observed a 3.8-log reduction after results indicated that the pH 2.0 resulted in great loss in two hours of incubation in SGJ. 772 Afr. J. Microbiol. Res.

Figure 3. Mean loss in Lactobacillus count (Log 10 cfu/g) for free (control), Single encapsulated and Double Encapsulated bacteria in SGJ-B. L. lactis AH-1, Lactobacillus reuteri AH-2, Lactobacillus acidophilus AH-3 , Lactobacillus rhamnosus AH-4 , Lactobacillus casei AH-5 , Lactobacillus plantarum AH-6 , and Lactobacillus brevis AH-7.

Figure 4. Mean loss in bifidobacterium and two lactobacillus strains count (Log 10 cfu/g) for free (control), Single encapsulated and Double Encapsulated bacteria in stimulated Gastric Juice B (120 min incubation).

Again the great loss of free probiotic cells was found in H3PO4 (SGJ-B) was useful to provide a buffering effect the SGJ-B as compared to single and double - micro- when the bacteria were present in a uncoated form espe- encapsulation. The in vitro test of gastric survival using cially. The results of SGJ-B for the bifidobacterium isolates Hassan et al. 773

Figure 5. Mean loss in bifidobacterium and two lactobacillus strains count (Log 10 cfu/g) for free (control), Single encapsulated and Double Encapsulated bacteria in stimulated Gastric Juice B (120 min incubation).

Figure 6. Mean loss in Lactobacillus isolates (Log 10 cfu/g) for free (control), Single encapsulated and Double Encapsulated bacteria in SIJ. L. lactis AH-1, Lactobacillus reuteri AH-2, Lactobacillus acidophilus AH-3, Lactobacillus rhamnosus AH-4, Lactobacillus casei AH-5, Lactobacillus plantarum AH-6 and Lactobacillus brevis AH-7 .

are shown in Figure 5. tion of bile-pancreatin mixture. The acids of the SGJ-A and SGJ-B both were unable to provide any significant protective effect for the control and single micro-encap- Simulated intestinal juice (SIJ) sulated probiotics. A slight increase may be the resuscitation of some cells that were sublethally injured during The Mean loss in probiotic count (Log 10 cfu/g) for the 160 min of incubation of SGJ, while the zero loss was control, single encapsulated and double encapsulated found in the case of double microencapsulated bacterial probiotics in stimulated Intestinal Juice (pH 7.4) are cells. shown in Figure 6. A slight recovery of free and single Bifidobacterium breve and Bifidobacterium longum encapsulated bacterial strains was found after the addi- were encapsulated by Picot and Lacroix, who found 774 Afr. J. Microbiol. Res.

Figure 7. Mean loss in bifidobacterium and two lactobacillus strains count Log 10 cfu/g) for free (control), Single encapsulated and Double Encapsulated bacteria in SIJ.

results similar to the present study. They reported that Bifidobacterium adolescentis 15703T during exposure to this approach is potentially useful for delivery of viable simulated gastro-intestinal conditions. Food Res. Int. 41(2):184-193. Boekhorst J, Helmer Q, Kleerebezem M, Siezen RJ (2006a). Compa- probiotics to the gastrointestinal tract of humans (Picot rative analysis of proteins with a mucus-binding domain found and Lacroix 2004). After incubation in simulated gastric exclusively in lactic acid bacteria. Microbiol. 152(1):273-280 (1 h) and intestinal juices (pH 7.4, 4 h), the number of Boekhorst J, Wels M, Kleerebezem M, Siezen RJ (2006b). The pre- probiotic B. adolescentis the surviving cells was found dicted secretome of Lactobacillus plantarum WCFS1 sheds light on interactions with its environment. Microbiol. 152(11):3175-3183 high (Annan et al. 2008) showing similarity with the pre- Cesena C, Morelli L, Alander M, Siljander T, Tuomola E, Salminen S, sent study. The results of SIJ for the bifidobacterium and Mattila-Sandholm T, Vilpponen-Salmela T, Von Wright A (2001). two lactobacillus isolates are shown in Figure 7. Lactobacillus crispatus and its Nonaggregating Mutant in Human This study showed significantly adverse effects on the Colonization Trials. J. Dairy Sci. 84(5):1001-1010 Chávarri M, Marañón I, Ares R, Ibáñez FC, Marzo F, Villarán MdC survival of free cultures in both SGJ-A and SGJ-B while (2010). Microencapsulation of a probiotic and prebiotic in alginate- the loss was higher in single microencapsulated L. chitosan capsules improves survival in simulated gastro-intestinal plantarum AH-6 and Lactobacillus brevis AH-7 while conditions. Int. J. Food Microbiol. 142(1):185-189 negligible for double- microencapsulated cells. The zero Chen CC, Walker WA (2005). Probiotics and prebiotics: role in clinical disease states. Adv. Pediatr. 52:77-113 loss was found in the mean microbiological count (cfu/g) Chen KN, Chen MJ, Liu JR, Lin CW, Chiu HY (2005). Optimization of of L. reuteriAH-2 and Lactobacillus brevis AH-7. While a incorporated prebiotics as coating materials for probiotic slight revival was observed in the free and single encap- microencapsulation. J. Food Sci. 70(5):M260-M266 sulated bacteria in SIJ probably because of resuscitation Del Re B, Sgorbati B, Miglioli M, Palenzona D (2000). Adhesion, autoaggregation and hydrophobicity of 13 strains of Bifidobacterium of some injured cells because of acidic conditions. The longum. Lett. Appl. Microbiol. 31(6):438-442. findings reveal that the combination of Ca-alginate and Favaro-Trindade C, Grosso C (2002) Microencapsulation of L. prebiotics significantly improve the viability of bacterial acidophilus (La-05) and B. lactis (Bb-12) and evaluation of their cells in the harsh gastrointestinal conditions and may be survival at the pH values of the stomach and in bile. J. Microencaps 19(4):485-494. of use for the food and/or pharmaceutical industries. In Hassan A, Chaudhry MN (2013) Culture-dependent and culture- the nutshell, the results of survival studies reveals that independent techniques to identify lactic acid bacteria in fermented incurporation of ca- alginate and prebiotic amalgum has products. Afr. J. Microbiol. Res. 7(30):3983-3987 improved viability of probiotics. Homayouni AA, Ehsani A, Yarmand M, Razavi MSH (2008). Effect of microencapsulation and resistant starch on the probiotic survival and sensory properties of symbiotic ice cream. Food Chem. 111:50-55. Huang Y, Adams MC (2004). In vitro assessment of the upper REFERENCES gastrointestinal tolerance of potential probiotic dairy propionibacteria. Int. J. Food Microbiol. 91(3):253-260. Akhiar M, Aqilah NS (2010). Enhancement of probiotics survival by Jacobsen CN, Nielsen VR, Hayford A, Møller P, Michaelsen K, microencapsulation with alginate and prebiotics. MMG 445 Basic Paerregaard A, Sandström B, Tvede M, Jakobsen M (1999). Biotechnol. eJ. 6 (1) Screening of probiotic activities of forty-seven strains of Lactobacillus Annan N, Borza A, Hansen LT (2008). Encapsulation in alginate-coated spp. by in vitro techniques and evaluation of the colonization ability of gelatin microspheres improves survival of the probiotic five selected strains in humans. Appl. Environ. Microbiol. 65(11): Hassan et al. 775

4949-4956. Rijnaarts HH, Norde W, Bouwer EJ, Lyklema J, Zehnder AJ (1993). Kailasapathy K (2002). Microencapsulation of probiotic bacteria: Bacterial adhesion under static and dynamic conditions. Appl. technology and potential applications. Curr. Issues Intestinal Environ. Microbiol. 59(10):3255-3265. Microbiol. 3(2):39-48. Rosenberg M, Gutnick D, Rosenberg E (1980). Adherence of bacteria Kailasapathy K (2009). Encapsulation technologies for functional foods to hydrocarbons: a simple method for measuring cell‐surface and nutraceutical product development. CAB Reviews: Perspectives hydrophobicity. FEMS Microbiol. Lett. 9(1):29-33. in agriculture, veterinary science, nutrition and natural resources Saarela M, Lähteenmäki L, Crittenden R, Salminen S, Mattila-Sandholm 4(033):1-19. T (2002). Gut bacteria and health foods - the European perspective. Kaushik JK, Kumar A, Duary RK, Mohanty AK, Grover S, Batish VK Int. J. Food Microbiol. 78(1):99-117. (2009). Functional and probiotic attributes of an indigenous isolate of Schillinger U, Guigas C, Heinrich Holzapfel W (2005). In vitro Lactobacillus plantarum. PloS one 4(12):e8099. adherence and other properties of lactobacilli used in probiotic Kos B, Šušković J, Vuković S, Šimpraga M, Frece J, Matošić S (2003). yoghurt-like products. Int. Dairy J. 15(12):1289-1297. Adhesion and aggregation ability of probiotic strain Lactobacillus Sharp M, McMahon DJ, Broadbent J (2008). Comparative Evaluation of acidophilus M92. J. Appl. Microbiol. 94(6):981-987. Yogurt and Low‐Fat Cheddar Cheese as Delivery Media for Probiotic Lian W-C, Hsiao H-C, Chou C-C (2003). Viability of microencapsulated Lactobacillus casei. J. Food Sci. 73(7):M375-M377. bifidobacteria in simulated gastric juice and bile solution. Int. J. Food Shima M, Matsuo T, Yamashita M, Adachi S (2009). Protection of Microbiol. 86(3):293-301. Lactobacillus acidophilus from bile salts in a model intestinal juice Liaskovskii TM, Podgorskii VS (2005). [Assessment of probiotics by incorporation into the inner-water phase of a W/O/W emulsion. according to the international organizations (FAO/WHO)]. Microbiol. Food Hydrocolloids 23(2):281-285. J. 67(6):104-112. Sultana K, Godward G, Reynolds N, Arumugaswamy R, Peiris P, Liserre AM, Ré MI, Franco BD (2007). Microencapsulation of Kailasapathy K (2000). Encapsulation of probiotic bacteria with Bifidobacterium animalis subsp. lactis in modified alginate-chitosan alginate-starch and evaluation of survival in simulated gastrointestinal beads and evaluation of survival in simulated gastrointestinal conditions and in yoghurt. Int. J. Food Microbiol. 62(1):47-55. conditions. Food Biotechnol. 21(1):1-16. Thantsha MS, Cloete TE, Moolman FS, Labuschagne PW (2009). Mainville I, Arcand Y, Farnworth E (2005). A dynamic model that Supercritical carbon dioxide interpolymer complexes improve survival simulates the human upper gastrointestinal tract for the study of of B. longum Bb-46 in simulated gastrointestinal fluids. probiotics. Int. J. Food Microbiol. 99(3):287-296. Int. J. Food Microbiol. 12(1):88-92. O'riordan K, Andrews D, Buckle K, Conway P (2001). Evaluation of Tomás J, Wiese B, Nader‐Macías M (2005). Effects of culture microencapsulation of a Bifidobacterium strain with starch as an conditions on the growth and auto‐aggregation ability of vaginal approach to prolonging viability during storage. J. Appl. Microbiol. Lactobacillus johnsonii CRL 1294. J. Appl. Microbiol. 99(6):1383- 91(6):1059-1066. 1391. Ocaña VS, Nader-Macias ME (2001). Vaginal lactobacilli: self-and co- Vandevoorde L, Christiaens H, Verstraete W (1992). Prevalence of aggregating ability. Br J Biomed Sci 59 (4):183-190 coaggregation reactions among chicken lactobacilli. J. Appl. Oliveira A, Moretti T, Boschini C, Baliero J, Freitas L, Freitas O, Favaro- Microbiol. 72(3):214-219. Trindade C (2007). Microencapsulation of B. lactis (BI 01) and L. Vasiljevic T, Shah NP (2008). Probiotics - from Metchnikoff to acidophilus (LAC 4) by complex coacervation followed by spouted- bioactives. Int. Dairy J. 18(7):714-728. bed drying. Drying Technol. 25(10):1687-1693. Vivek K (2013). Use of encapsulated probiotics in dairy based foods. Ortakci F, Broadbent J, McManus W, McMahon D (2012). Survival of Int. J. Food Agric. Vet. Sci. 3(1):188-199 microencapsulated probiotic Lactobacillus paracasei LBC-1e Yeo SK, Liong MT (2010). Effect of prebiotics on viability and growth during manufacture of Mozzarella cheese and simulated gastric characteristics of probiotics in soymilk. J. Sci. Food Agric. 90(2):267- digestion. J. Dairy Sci. pp. 6274-6281. 275. doi:10.1002/jsfa.3808 Parvez S, Malik K, Ah Kang S, Kim HY (2006). Probiotics and their fermented food products are beneficial for health. J. Appl. Microbiol. 100(6):1171-1185. Picot A, Lacroix C (2004). Encapsulation of bifidobacteria in whey protein-based microcapsules and survival in simulated gastrointestinal conditions and in yoghurt. Int. Dairy J. 14(6):505-515. Pitino I, Randazzo CL, Mandalari G, Lo Curto A, Faulks RM, Le Marc Y, Bisignano C, Caggia C, Wickham MSJ (2010). Survival of Lactobacillus rhamnosus strains in the upper gastrointestinal tract. Food Microbiol. 27(8):1121-1127. Rabanel JM, Banquy X, Zouaoui H, Mokhtar M, Hildgen P (2009). Progress technology in microencapsulation methods for cell therapy. Biotechnol. Prog. 25(4):946-963. Ramiah K, Van Reenen C, Dicks L (2007). Expression of the mucus adhesion genes Mub and MapA, adhesion-like factor EF-Tu and bacteriocin gene plaA of Lactobacillus plantarum 423, monitored with real-time PCR. Int. J. Food Microbiol. 116(3):405-409.

Full Length Research paper

Screening novel diagnostic marker of Mycobacterium tuberculosis

Xin Pan1,2*, Siliang Zeng1, Jialin Cai2, Bin Zhang3*, Boju Pan2, Zhonglei Pan2, Ying Wu2, Ying Wang4, Yi Zhou1, Wei Fang2, Min Chen2, Wanqing Liao2, XiuZhen Yu1, Min Tao1, Jun Zhang1 and Wei Song1

1Shanghai Junwei Fine Medical Club，58 Bao Tou Road, Shanghai 200433, China. 2Second Military Medical University，800 Xiang Yin Road, Shanghai, 200433, China. 3Qingpu Branch of Zhongshan Hospital, Fudan University, 1158 Gong Yuan Dong Road, Shanghai 201700, China. 4Shanghai Jiao Tong University School of Medicine, 280 Chongqing South Road, Shanghai, 200025, China.

Accepted 23 January, 2014

The aim of present study was to screen and evaluate the serodiagnostic value of the purified fusion antigens of Mycobacterium tuberculosis (Mtb) by enzyme-linked immunosorbent assay (ELISA). A group of vector system which was constructed by cloning Rv1908c, Rv0733, Rv0899, Rv1411c and Rv3914 gene of Mtb into the prokaryotic expression plasmid pET-32b was transformed into E. coli for induction and expression fusion antigens to determine their potentiality in diagnostic application. Following purification with the His-select nickel magnetic agarose beads, the expressed fusion proteins showed purity via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot technique. The ELISA plates were coated with these fusion antigens. Through ELISA, the antigen binding with specific IgG levels between active TB patients and healthy controls was compared. The purity and the size of the expressed fusion antigens were confirmed by the Western blot. The ELISA results indicated that IgG levels against Rv1411c-6His, Rv3914-6His and Rv2031c-6His were significantly higher in serum of active TB patients than in that of healthy controls. More interesting, the AUC value of Rv3914-6His (0.7867) was higher than that of Rv2031c-6His (0.754) which was widely used in clinic. The results implied that Rv3914-6His might be a useful candidate antigen in the diagnosis of Mtb infection, especially for active pulmonary TB diagnosis. Its role in serodiagnosis of extra-pulmonary TB is still needed to be validated.

Key words: Mycobacterium tuberculosis, expression and purification, antigen, serodiagnosis, tuberculosis.

INTRODUCTION

Tuberculosis (TB) is a chronic infectious disease mainly liver, spleen, kidney, spine, bone and skin which named caused by Mycobacterium tuberculosis (Mtb). The extrapulmonary TB (EPTB) (Ireton et al., 2010). TB is bacteria typically attack the lung parenchyma which currently the second-largest killer infectious agent after named pulmonary TB (PTB) by the clinical manifestations human immunodeficiency virus (HIV). According to the (Walzl et al., 2011). Mtb also can attack other part of the World Health Organization (WHO) statistics, China has body such as lymph nodes, the central nervous system, the world's second largest tuberculosis epidemic

*Corresponding authors. E-mail: [email protected] and [email protected].

Pan et al. 777

(Wang et al., 2007). Therefore, it is very important to bacteria in intracellular nucleotide metabolism. Rv0899 develop new convenient, fast, high sensitivity and gene name is ompA，antigen name is outer membrane specificity diagnosis methods to control the prevalence protein A, molecular mass is about 33.54 kDa, it may and spread of tuberculosis． protect the integrity of the bacterium. Rv1411c gene Although currently bacteriological culture is still consi- name is lprG, antigen name is conserved lipoprotein, dered as the gold standard in clinical laboratory confirma- molecular mass is about 24.55 kDa, the function is still tion of TB disease, the laboratory may need more time (4- unknown. Rv3914 gene name is trxC, antigen name is 6 weeks), and the rates of false-positive cultures are too thioredoxin, molecular mass is about 12.54 kDa, Thiore- high, which are not suitable for clinical application doxin participates in various redox reactions. Enzyme- (Kashyap et al., 2010). The newly developed GeneXpert linked immunosorbent assay (ELISA) plates were coated MTB/RIF assay is a novel nucleic acid amplification with prokaryotic expression and purification of the five diagnostic technique for the diagnosis of tuberculosis and antigens, respectively. An indirect ELISA was established rapid detection of rifampicin (RIF) resistance in clinical for rapid comparison serum IgG responses to the five specimens (Steingart et al., 2013). But this assay antigens respectively between patients with active tuber- determined the presence or absence of Mtb or rifampicin culosis (TB group) and healthy physical examinees with resistance, the activity of TB bacillus cannot be deter- non-tuberculosis (control group). Anti-Rv3914 IgG may mined. The QuantiFERON®-TB gold in-tube or T-Spot TB become a potential important new serum marker for test is an indirect test for measuring the release of active tuberculosis diagnosis. interferon-gamma (INF-γ) from the patient's viable T lymphocytes stimulated by a few Mtb-specific antigens MATERIALS AND METHODS (early secreted antigenic target-6 and culture filtrate protein-10) (Rose et al., 2012) . INF-γ release assays Plasmids and antigens have excellent sensitivity and specificity with minimizing subjective interpretation and operator bias. However, the The recombinant prokaryotic expressive plasmids pET-32b-Rv0733, assays require expensive instrument, reagents and well pET-32b-Rv1411c, pET-32b-Rv1908c, pET-32b-Rv0899, pET-32b- trained operators. These requirements restrict their use in Rv3914 and Rv2031c-6His fusion antigen were kept in our laboratory. China. Serodiagnosis has a long history and is characterized by convenient specimens, low costs, and commonly used in clinical laboratories to test numerous TB Main Reagents and instruments serum samples in a short time (Steingart et al., 2011). Mouse monoclonal to 6×His tag antibody was purchased from The antibody response to the 88 kDa, 65 kDa Hsp, 45 Abcam, USA. Prestained protein molecular weight marker was kDa, 38 kDa lipoprotein (He et al., 2011), 16 kDa HSP purchased from Fermentas, Canada. IRDye 800CW goat anti- (Senol et al., 2009), ESAT-6, CFP-10, and mouse IgG (H+L) was purchased from Licor Biosciences, USA. lipoarabinomannan (LAM) (Ben Selma et al., 2010) Plasmid preparation kit and DNA gel extraction kit were purchased antigens of Mtb was extensively studied by diagnostic from Axygen, USA. Isopropyl-β-D-thiogalactopyranoside (IPTG) and companies and used in the commercial serological tests His-select nickel magnetic agarose beads were purchased from Sigma, USA. Alkaline phosphatase (AP)-affinipure goat anti-human of TB infection (Flores et al., 2011). However, currently IgG (H+L) was purchased from Jackson ImmunoResearch, USA. available commercial serodiagnostic tests provided incon- BL21 (DE3) PLySs competent cells was purchased from Takara, sistent and imprecise findings, the WHO issued a policy Japan. Amicon ultra-2 centrifugal filter unit with ultracel-3 mem- statement against the use of commercial serological tests brane was purchased from Millipore, USA. Odyssey infrared ima- for the diagnosis of active PTB (WHO, 2011). Therefore, ging system was purchased from Licor Biosciences, USA. ELISA accurate, rapid and inexpensive antibody-based tests for plate reader was purchased from Corning Incorporated, USA.

TB diagnosis are needed urgently (Flores et al., 2011). The Mtb immunoproteome analyses revealed sera from Prokaryotic expression and purification of His-Mtb fusion TB mainly recognized membrane associated and extra- antigens cellular proteins of the bacterial (Kunnath-Velayudhan et al., 2010). In the study, the successful cloned genes of Escherichia coli (E.coli) BL21 (DE3) PLySs was transformed with the recombinant plasmid pET-32b-Rv0733, pET-32b-Rv1411c, pET- Mycobacterium tuberculosis envelope proteins Rv1908c, 32b-Rv1908c, pET-32b-Rv0899, pET-32b-Rv3914 and pET-32b- Rv0733, Rv0899, Rv1411c and Rv3914 were selected for Rv2031c, respectively. Positive colonies were confirmed by DNA expression and purification and screening serodiagnosis sequencing and performed to verify antigen expression. antigens. Rv1908c gene name is KatG, antigen name is Two hundred (200) mL medium LB containing 50 μg/mL ampicillin catalase-peroxidase- peroxynitritase T, molecular mass is was inoculated and incubated at 37°C with 200 rpm shaking to the about 80.57 kDa, it may play a role in the intracellular optical density (OD) value approximately 0.4～0.6 at 600 nm. IPTG was added to a final concentration of 0.1 mmol/L for inducing survival of mycobacteria within macrophages. Rv0733 expression. Shaking incubation was continued at 30°C for 6 h. gene name is adk, antigen name is adenylate kinase, Bacterial cells were precipitated by centrifugation (7000 g for 3 min molecular mass is about 20.09 kDa, it is essential for the at 4°C) and resuspended in 20 mL lysis buffer containing 50 mmol/L

778 Afr. J. Microbiol. Res.

NaH2PO4，300 mmol/L NaCl and 10mmol/L imidazole pH 8.0. The 1% gelatin in PBST for an hour at 37°C and followed by three mixture was sonicated and centrifuged (8000 g for 30 min at 4°C). washings. Subsequently, 100 μL of diluted serum samples (1:100 in The supernatant containing recombinant Mtb antigens named crude blocking buffer) was added. Following an incubation period of 1 h at extracts were filtered through a 0.45 μm prefilter. His-select nickel 37°C, the wells were again washed and filled with 100 μL of a magnetic agarose beads were uniformly suspended and added 1 1:2000 dilution of alkaline phosphatase-conjugated goat anti-human mL to the filtrate protein. The mixture gently shaked overnight at immunoglobulin G. After incubation for 1 hr at 37°C, the plates were 4°C and the affinity gel washed with plenty of wash buffer again washed with PBST. The wells were filled with 100 μL of containing 50 mmol/L NaH2PO4, 300 mmol/L NaCl and 20 mmol/L substrate solution (1 mg/mL p-nitrophenylphosphate in 10% dietha- imidazole pH 8.0. The sample was centrifuged and the supernatant nolamine buffer containing 0.5 mM MgCl2, pH 9.8). After 30 min containing unbinding contaminating proteins was removed. The His- incubation at room temperature in darkness, the reaction was stop- Tag-C-terminal protein was eluted from the beads with elution buffer ped by adding 50 μL /well of 2 M Na2CO3. The optical density (OD) (50 mmol/L NaH2PO4, 300 mmol/L NaCl, 300 mmol/L imidazole, pH of each well was measured at a wavelength of 405 nm in ELISA 8.0). Eluted fractions were transferred to Amicon Ultra-2 centrifugal plate reader. Immunogenic properties of the purified antigens identi- filter unit with ultracel-3 membrane and centrifuged to remove the fication were done in ten-fold serial dilutions of serum samples. imidazole and other small molecules. The ultrafiltered samples were sterilized through 0.22 μm filter. The purified proteins were stored in Statistical analysis 40% glycerin at -80°C.

Data were presented as means and standard errors (mean ± SD). The cut-off value for the optical density (OD) of an ELISA was SDS-PAGE and Western blotting determined by the mean value of healthy controls plus 3SD. Comparisons between two groups were performed with GraphPad The protein concentration of the crude extracts and the purified Prism 5 statistical analysis software using the Mann Whitney test, protein was measured respectively using the Bradford method. An and the level P < 0.05 was considered statistically significant. equal amount of total protein content was loaded on each lane and separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by staining at 37°C using RESULTS Coomassie brilliant blue R-250. Rv3914 was used as a given example for assessing the purity effect before and after purification. Prokaryotic expression, purification and For Western blot analysis, five purified antigens were separated identification of five recombinant antigens of by 12% SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membranes by semi-dry apparatus and nonspecific binding Mycobacterium tuberculosis was blocked with PBS containing 3% bovine serum albumin (BSA). The blots were probed with anti-6-His antibodies diluted 1:1000, Single colonies of BL21 (DE3) PlySs bacteria and the immune complexes were visualized using goat anti-mouse transformed respectively by pET-32b-Rv0733, pET-32b- IgG（H+L）IRDye 800 conjugate secondary antibody, according to Rv 1411c, pET-32b-Rv1908c, pET-32b-Rv0899 and pET- the manufacturer’s instructions. Blots were digitally photographed 32b-Rv3914 were picked up from cultured plates and using the Odyssey infrared imaging system. confirmed by DNA sequencing analysis. Recombinant antigens expressed as COOH-terminally polyhistidine- tagged fusion proteins were induced with IPTG and Human serum collection purified using His-select nickel magnetic agarose beads. The research proposal was approved by the ethics committee of SDS-PAGE gels for Rv3914-6His given representative Shanghai Junwei Fine Medical Club, China and all participants at sample visualization the level of purity required was Shanghai pulmonary hospital, China provided written informed stained with Coomassie brilliant blue R-250. Taking the consents. Thirty-four serum samples were collected from patients molecular weight of the 6×His tag (0.84kDa) and that of with confirmed diagnosis active pulmonary tuberculosis and thirty- Rv3914 antigen (12.54 kDa) into account, the size of the five serum samples were obtained from healthy physical examinees. The patients had clinical symptoms，radiological signs of TB, purified protein showed an expected size of protein band acid-fast stain test of sputum smear, as well as positive culture for of 13.38 kDa (Figure 1). Mycobacterium tuberculosis. Serum samples as healthy controls Based on the Western blot assay, all of the five purified were obtained from healthy physical examinees with no apparent native fusion proteins could be recognized by His signs of any disease and tuberculosis diagnoses ruled out. monocolonal antibodies and the expected bands were present respectively (Figure 2). These fusion proteins were Rv0899-6His (34.38 kDa), Rv0733-6His (20.93 Detection the relative antibody in serum by indirect enzyme- kDa), Rv1908c-6His (81.41 kDa), Rv1411c-6His (25.39 linked immunosorbent assay kDa) and Rv3914-6His (13.38 kDa), respectively.

Flat-bottom 96-well Costar plates were coated with 100 μL/well of each purified antigen at a concentration of 1μg/mL in carbonate Reactivities evaluation of recombinant antigens to buffer (15mM Na2CO3, 35mM NaHCO3, pH9.6). The positive control was Rv2031c (16 kDa HSP) -6His antigen, the negative control was human serum specimens serum of healthy physical examinees and blank control was phosphate-buffered saline (PBS). After overnight incubation at 4°C, A total of 34 serum samples were collected from 34 patients these antigen-coated wells were washed 3 times with PBS, with a confirmed diagnosis of pulmonary tuberculosis at containing 0.05% Tween 20 (PBST), blocked with blocking buffer of Shanghai pulmonary hospital between 2009 and 2010.

Pan et al. 779

serum specimens were interpreted based on the ELISA assays. For ELISA the positive control antigen Rv2031c- 6His (Figure 3) and the representative antigens Rv3914- 6His (Figure 4) were used. Rv2031c, the 16 kDa heat shock protein (HSP), one of the three well known diagnostic antigen (Senol et al., 2009), was shown to be specific and sensitive for detecting antibodies against M. tuberculosis. The antigens were coated onto 96-well microplates. A total of 7 human sera were used in this assay, of which 6 serum specimens were from active TB patients, whereas 1 was from healthy individual. Ten-fold serial dilutions of the sera were examined, all reactions were run three times. The results revealed that the purified native Rv3914-6His antigen showed substantial reactivity to active-TB specimens. The OD value of active-TB specimens was significantly increased (0.88-fold for Rv2031c-6His, t=-15.433, P=0.0001; 0.72-fold for Rv3914-6His, t =-8.513, P=0.0004) in microwell plate

coated with the antigens at the concentration of 1μg/mL Figure 1. Expression and purification as compared with the concentration of 0.1 μg/mL. The of Rv3914-6His fusion protein detected recombinant antigens concentration of 1 μg/mL for ELISA with SDS-PAGE studies was selected as working coated concentration in 1:Protein marker; 2:Lysates of pET- the following studies. 32b-Rv3914/BL21(DE3) PlySs with IPTG induction; 3: Purified native Rv3914-6His fusion protein. ELISA screening of purified recombinant antigens for TB diagnosis

After confirming the reactivity of purified fusion antigen, a total of 69 human serum samples were assayed by ELISA using the five recombinant antigens, respectively. The Rv2031c-6His (16 kDa antigen) fusion protein was included in the assay system as a positive control for specificity and sensitivity. Each assay was repeated three times. These sera consisted of 34 samples from active TB patients, and 35 samples from healthy physical examinees. The profiles of IgG antibodies against of these purified fusion Mtb antigens were estimated by indirect ELISA in these human serum samples collected (Figure 5). The ELISA with Rv3914-6His, Rv1411c-6His and Rv2031c-6His fusion antigens were useful to discriminate

positive and negative TB, a statistically significant dif- Figure 2. The identification of five kinds of Mtb fusion ference in IgG level were found between healthy controls antigens by two-color infrared fluorescence and TB patients (PRv3914c-6His=0.0001, PRv1411c-6His=0.0043 1:Protein marker; 2: Purified Rv0899c-6His fusion and PRv2031c-6His=0.0004, respectively). There was no protein; 3: Purified Rv0733-6His fusion protein; 4: significant difference in the levels of anti-Mycobacterium ； Purified Rv1908c-6His fusion protein 5: Purified tuberculosis antibody IgG from those of serum specimens Rv1411c-6His fusion protein; 6: Purified Rv3914-6His fusion protein. from healthy controls and from active TB individuals by ELISA with Rv0899-6His, Rv0733-6His and Rv1908c-6His fusion antigens (PRv0899-6His=0.1398, PRv0733-6His=0.3060 and PRv1908c-6His = 0.0691, respectively). The clinical and laboratory characteristics of the TB pa- Receiver operating characteristic (ROC) curves is a tients and healthy controls were summarized in Table 1. graph of sensitivity on the y-axis against 100-specificity Serum samples as control group were obtained from on the x-axis. It is an excellent way to evaluate the healthy individuals (n=35) with tuberculosis diagnoses clinical diagnostic value of given biomarker. ROC curves ruled out. were plotted using GraphPad Prism 5. The areas under The reactivities of recombinant antigens to human serum the summary ROC curve (AUC) of Rv3914-6His,

780 Afr. J. Microbiol. Res.

Table 1. Clinical and experimental parameters of research cohort.

Clinical and laboratory characteristic Active tuberculosis patients (n=34) Healthy controls (n=35) Age (years ±SD) 45.4 ± 18.6 42.8 ± 16.2 Sex (male/female) 12/22 24/11 Duration of symptoms (months ±SD) 19.18 ± 2.61 － Treatment (months ±SD) 2.45 ± 0.12 － Smear positive 20 － Sputum culture positive 25 － Purified protein derivative (PPD) positive 16 － Cavity positive 13 －

Concentration of Rv2031c-6His antigen (μg/mL)

Figure 3. Detection of serum IgG against with Rv2031c-6His fusion protein by indirect ELISA. TB: tuberculosis patients; HC: protein by indirect ELISA. TB: tuberculosis patients；HC: Figure 5. Detection of serum IgG against with Mtb healthy physical examinees. antigen-6His fusion protein by indirect ELISA. TB: tuber-

culosis patients (n=34)；HC: healthy physical examinees (n=35).

Rv1411c-6His and Rv2031c-6His ROC were 0.7867, 0.5867 and 0.754, respectively (Figure 6). An AUC of 0.75 or greater is generally considered a good biomarker. Antibody response to the 16 kDa heat shock protein in active TB has been used in assist diagnosis of infectious Mtb (Senol et al., 2009). It was suggested that Rv3914 recombinant protein could be potentially used for the diagnosis of tuberculosis and as a candidate antigen.

DISCUSSION

In recent years，due to movement of population, pro- Concentration of Rv3914-6His antigen (μg/mL) blems of multi-drug resistant TB and TB-HIV co-infection,

Figure 4. Detection of serum IgG against with Rv3914-6His tuberculosis continues to be one of major public health fusion protein by indirect ELISA. TB: tuberculosis patients; burden in China．Rapid and effective diagnosis of infec- HC: protein by indirect ELISA. tious cases is crucial to facilitate earlier treatment initiation

Pan et al. 781

TB: tuberculosis patients (n=34)；HC: healthy physical examinees (n=35) 150 Rv1411c-6His 150 Rv2031c-6His 150 Rv3914-6His

100 100 100

50 50 50

Sensitivity%

Sensitivity% Sensitivity%

0 0 0 0 20 40 60 80 100 0 20 40 60 80 100 0 20 40 60 80 100 100% - Specificity% 100% - Specificity% 100% - Specificity%

Figure 6. ROC curves of Mtb 6His fusion antigens in the diagnosis of TB.

and reducing disease transmission and preventing emer- plates, respectively. It has been reported previously that gence of resistant strains (Kaushik et al., 2012). mutations in the three antigens’ gene lead to reduce The aim of this study was to screen a specific diagnos- virulence and may cause reduced survival of Mtb in host tic marker from five envelope protein of Mtb which identi- tissues (Pym et al., 2002; Raynaud et al., 2002; fied by proteomic studies (de Souza et al., 2011; Forrellad Bellinzoni et al., 2006). These antigens might really begin et al., 2013). The envelop antigens，such as Rv1908c their work when Mtb were engulfed by macrophages. (Escalante et al., 2013), Rv0899 (Marassi (2011) and Therefore, these antigens might be helpful for screening Rv3914 (Akif et al., 2008), may play essential roles in the intracellular antibodies of Mtb. intracellular growth and survival of Mtb within the host. The expression and purification system of five fusion Authors’ contributions proteins was successfully established and recombinant fusion proteins with high purity and high yield was XP designed the research and wrote the paper; XP, SLZ, obtained. The recombinant antigen’s native conformation JLC, BZ, BJP, ZLP, YW, YW, YZ, WF, MC, WQL, XZY, with antibody binding activity may be lost due to prokar- MT, JZ, WS performed research. yotic expression system, so the ELISA plates were coated with gradient dilution antigens, and the collected ACKNOWLEDGMENT serums (dilution, 1:100) were used as primary antibodies. The result showed the representative Rv3914-6His anti- This work was supported by National Key Basic Research gen retained antibody-binding activity. The purified fusion Program of China Grants (Contract No. 2013CB531601) antigens were potentially used as coated antigens in and National Natural Science Foundation of China Grants ELISA assays. (Contract No. 30972633). Serum specimens (including 34 cases of active TB patients and 35 healthy physical examinees) were tested REFERENCES for the presence of IgG antibodies against these five antigens of Mtb using a quantitative ELISA. The results of Akif M, Khare G, Tyagi AK, Mande SC, Sardesai AA (2008). Functional ELISA test showed good sensitivity for purified Rv3914- studies of multiple thioredoxins from Mycobacterium tuberculosis. J. Bacteriol. 190(21):7087-7095. 6His and Rv1411c-6His antigen. The levels of antibodies Bellinzoni M, Haouz A, Graña M, Munier-Lehmann H, Shepard W, Alzari against the two antigens were significantly higher in TB PM (2006). The crystal structure of Mycobacterium tuberculosis 2+ patients than in healthy individuals (PRv3914c-6His = 0.0001, adenylate kinase in complex with two molecules of ADP and Mg P = 0.0043), respectively. Rv3914 could be supports an associative mechanism for phosphoryl transfer. Protein Rv1411c-6His Sci. 15(6):1489-1493. selected as an adjunct for TB serodiagnostic assay Ben Selma W, Harizi H, Marzouk M, Ben Kahla I, Ben Lazreg F, Ferjeni according to the ROC analysis, the AUC value for A, Harrabi I, Abdelghani A, Ben Said M, Boukadida J (2010). Rapid Rv3914-6His is 0.7867 and similar to the value for detection of immunoglobulin G against Mycobacterium tuberculosis Rv2031c (AUC =0.754 ). It would be of interest antigens by two commercial ELISA kits. Int. J. Tuberc. Lung. Dis. Rv2031c-6His 14(7):841-846. to further study how the Rv3914 and Rv2031c antigens de Souza GA, Leversen NA, Malen H, Wiker HG (2011). Bacterial perform in combination. proteins with cleaved or uncleaved signal peptides of the general There were no statistically significant differences bet- secretory pathway. J. Proteomics 75(2):502-510. ween the optical density values obtained with sera from Escalante P, McKean-Cowdin R, Ramaswamy SV, Williams-Bouyer N, Teeter LD, Jones BE, Graviss EA (2013). Can mycobacterial katG TB patients and healthy controls with Rv1908c-6His, genetic changes in isoniazid-resistant tuberculosis influence human Rv0899-6His or Rv0733-6His antigens-coated ELISA disease features? Int. J. Tuberc. Lung Dis. 17(5):644-651.

782 Afr. J. Microbiol. Res.

Flores LL, Steingart KR, Dendukuri N, Schiller I, Minion J, Pai M, Raynaud C, Papavinasasundaram KG, Speight RA, Springer B, Sander Ramsay A, Henry M, Laal S (2011). Systematic review and meta- P, Bottger EC, Colston MJ, Draper P (2002). The functions of analysis of antigen detection tests for the diagnosis of tuberculosis. OmpATb, a pore-forming protein of Mycobacterium tuberculosis. Mol. Clin. Vaccine Immunol. 8(10):1616-1627. Microbiol. 46(1):191-201. Forrellad MA, Klepp LI, Gioffré A, Sabio y García J, Morbidoni HR, de la Rose MV, Kimaro G, Nissen TN, Kroidl I, Hoelscher M, Bygbjerg IC, Paz Santangelo M, Cataldi AA, Bigi F (2013). Virulence factors of the Mfinanga SG, Ravn P (2012). QuantiFERON®-TB gold in-tube Mycobacterium tuberculosis complex. Virulence 4(1):3-66. performance for diagnosing active tuberculosis in children and adults He XY, Li J, Hao J, Chen HB, Zhao YZ, Huang XY, He K, Xiao L, Ye LP, in a high burden setting. PLoS. One.7(7):e37851. Qu YM, Ge LH (2011). Assessment of five antigens from Senol G, Ecevit C, Oztürk A (2009). Humoral immune response against Mycobacterium tuberculosis for serodiagnosis of tuberculosis. Clin. 38- and 16-kDa mycobacterial antigens in childhood tuberculosis. Vaccine Immunol.18(4):565-570. Pediatr. Pulmonol.44(9):839-844. Ireton GC, Greenwald R, Liang H, Esfandiari J, Lyashchenko KP, Reed Steingart KR, Flores LL, Dendukuri N, Schiller I, Laal S, Ramsay A, SG (2010). Identification of Mycobacterium tuberculosis antigens of Hopewell PC, Pai M (2011). Commercial serological tests for the high serodiagnostic value. Clin. Vaccine Immunol. 17(10):1539-1547. diagnosis of active pulmonary and extrapulmonary tuberculosis: an Kashyap RS, Ramteke SS, Gaherwar HM, Deshpande PS, Purohit HJ, updated systematic review and meta-analysis. PLoS. Med. 8(8): Taori GM, Daginawala H (2010). Evaluation of BioFM liquid medium e1001062. for culture of cerebrospinal fluid in tuberculous meningitis to identify Steingart KR, Sohn H, Schiller I, Kloda LA, Boehme CC, Pai M, Mycobacterium tuberculosis. Indian. J. Med. Microbiol. 28(4):366- Dendukuri N (2013). Xpert® MTB/RIF assay for pulmonary tubercu- 369. losis and rifampicin resistance in adults. Cochrane. Database. Syst. Kaushik A, Singh UB, Porwal C, Venugopal SJ, Mohan A, Krishnan A, Rev.1:CD009593. Goyal V, Banavaliker JN (2012). Diagnostic potential of 16 kDa Walzl G, Ronacher K, Hanekom W, Scriba TJ, Zumla A (2011). Immuno- (HspX, α-crystalline) antigen for serodiagnosis of tuberculosis. Indian. logical biomarkers of tuberculosis. Nat. Rev. Immunol. 11(5):343-354. J. Med. Res. 135(5):771-777. Wang L, Liu J, Chin DP (2007). Progress in tuberculosis control and the Kunnath-Velayudhan S, Salamon H, Wang HY, Davidow AL, Molina DM, evolving public-health system in China. Lancet. 369(9562):691-696. Huynh VT, Cirillo DM, Michel G, Talbot EA, Perkins MD, Felgner PL, World Health Organization (WHO) (2011). Policy statement: commercial Liang XW, Gennaro ML (2010). Dynamic antibody responses to the serodiagnostic tests for diagnosis of tuberculosis. Mycobacterium tuberculosis proteome. Proc. Natl. Acad. Sci. U. S. A. WHO/HTM/TB/2011.5.WHO, Geneva, Switzerland. 107(33):14703-14708. http://whqlibdoc.who.int/publications/2011/9789241502054_eng.pdf. Marassi FM (2011). Mycobacterium tuberculosis Rv0899 defines a Accessed 29 July 2011. family of membrane proteins widespread in nitrogen-fixing bacteria. Proteins.79(10):2946-2955. Pym AS, Saint-Joanis B, Saint-Joanis B, Cole ST (2002). Effect of katG mutations on the virulence of Mycobacterium tuberculosis and the implication for transmission in humans. Infect. Immun. 70(9):4955- 4960.

Full Length Research Paper

An outbreak of ringworm caused by Trichophyton verrucosum in a group of calves in Vom, Nigeria

Dalis, J. S.1*, Kazeem, H. M.2, Kwaga, J. K. P.3 and Kwanashie, C. N.2

1Bacterial Research Division, National Veterinary Research Institute, Vom, Plateau State, Nigeria. 2Department of Microbiology, Faculty of Veterinary Medicine, Ahmadu Bello University, Zaria, Kaduna State, Nigeria. 3Department of Veterinary Public Health and Preventive Medicine, Ahmadu Bello University, Zaria, Kaduna State, Nigeria.

Accepted 5 February, 2014

An outbreak of ringworm in young calves is reported from Vom in Nigeria. Twelve out of fourteen calves were observed to have skin lesions consistent with dermatophytosis. Lesions were seen mostly around the eyes and neck. Skin scrapings were collected from the affected areas and processed for mycology. Trichophyton verrucosum was isolated from all the affected calves. This study has shown that T. verrucosum can be a problem to watch for in calves in this particular environment, both as a zoonosis and economic importance as a result of damage to hides and skin. The need to study the prevalence of the disease among the cattle population in the state and country with a view to instituting preventive and control measures was emphasized.

Key words: Dermatophytosis, outbreak, calves, Nigeria.

INTRODUCTION

Ringworm (dermatophytosis) is an infection of the climates, and particularly in countries or areas having hot superficial, keratinized structures of the skin and hair of and humid climatic conditions (Radostits et al., 1997). man and animals. The disease is caused by a group of The typical lesion in cattle is a heavy, grayish-white keratinophilic filamentous fungi called dermatophytes in crust that is raised perceptibly above the skin, affecting the Genera Trichophyton, Microsporum and young calves’ more than adult cattle (Cam et al., 2007; Epidermophyton (Gudding and Lund, 1995). Akbarmehr, 2011). Dermatophytosis had been consi- Animals are infected by contact with arthrospores dered the most common zoonosis worldwide, affecting (asexual spores formed in the hyphae of the parasitic more children than adults (Achterman and White, 2012). stage) or conidia (sexual or asexual spores formed in the Studies on human skin infections revealed that dermato- “free living” environmental stage). Transmission between phytosis and other superficial fungal infections constitute hosts usually occurs by direct contact with a symptomatic a major public health problem in Nigeria (Adeleke et al., or asymptomatic host (Murray et al., 2005). It had been 2008). reported that housing animals in close proximity to each Whereas the literature is replete with information on other for long periods in the presence of infected debris human dermatophytoses (Ameh and Okolo, 2004; was responsible for the high incidence of the disease in Adeleke et al., 2008; Nweze, 2010), very little informa- winter (Al-Ani et al., 2002). However, the disease tion on animal ringworm have been documented in appears to be more common in tropical than temperate Nigeria. While there are some information on dermato-

*Corresponding author. E-mail: [email protected]. 784 Afr. J. Microbiol. Res.

phytosis of goats (Chineme et al., 1980) and pet animals elements (ectothrix spores and endothrix hyphae) by (Adekeye et al., 1989), to our knowledge, no studies on direct microscopic examination. The fungus grew slowly ringworm infection in cattle have been published from this on Dermarsel agar producing white, cottony, heaped and country. slightly folded colonies with some submerge growth and This paper focuses on the outbreak of ringworm in a yellow reverse pigment (Figure 2). Microscopic examina- group of calves in Vom, Nigeria. tion of isolates stained with lactophenol cotton blue revealed septate hyphae with numerous clavate microconidia borne laterally from the hyphae (Figure 3b), and MATERIALS AND METHODS many clamydospores arranged in chains (chains of pearls) characteristic of T. verrucosum (Figure 3b) Twelve out of fourteen (85.7%) calves aged between four and eight months were observed to have skin lesions consistent with dermatophytosis. The calves were kept indoors and in close contact with each other. They were fed concentrate and hay and allowed to DISCUSSION suckle from their dams in the morning during milking. The dams and other adult cattle in the herd were physically examined for the T. verrucosum was found to be responsible for the presence of skin lesions. Skin samples were collected from infected ringworm seen on 12 of the 14 calves in this study. Our animals by first disinfecting the affected area by cleaning it with cotton wool soaked in 70% ethyl alcohol. Skin scrapings were report is significant as it suggests that dermatophytosis collected by scraping the margin of the lesions using sterile scalpel could be a major problem in cattle farms especially in blade into sterile Petri dishes. Hair pullouts and crusts were also young animals. This report agrees with previous findings collected from the margin of the lesions as described by Robert and (Cam et al., 2007; Shams-Gahfarokhi et al., 2009), that Pihet (2008). Each sample was divided into two parts. One part was young animals are particularly susceptible to infection by used for direct microscopic examination while the second part was ringworm fungi. This could be as a result of the poorly used for fungal isolation by culture. developed immune system and the high pH of the skin in young animals (Radostits et al., 1997). Direct microscopic examination The diagnosis of ringworm in this study was based on clinical signs, demonstration of fungal elements in sam- A portion of each sample was placed on a clean glass slide ples by direct microscopic examination and the isolation containing a drop of 10% potassium hydroxide solution and covered of causative agent by culture. T. verrucosum had been with a cover slip. The slides were gently heated over a flame from a Bunsen burner and examined for the presence of arthrospores and implicated in ringworm of cattle (Swai and Sanka, 2012; hyphae under a light microscope. Cam et al., 2007). The main clinical signs observed among the affected calves were circular, circumscribed, grayish-white, thick crusty lesions perceptibly raised Fungal isolation and identification above the skin. The lesions were most frequently found

Each sample was inoculated onto Dermasel agar (OXOID) con- on the head and neck especially around the eyes and taining: Mycological peptone, 10.0 g/L; glucose, 20.0g/L; agar, face. These observations were in agreement with other 14.5g/L; cyclohexamide, 0.4g/L and chloramphenicol, 0.05g/L, pH reports (Cam et al., 2007; Akbarmehr, 2011). The reason 6.9, incubated at 37°C for 2-4 weeks and examined for fungal for the occurrence of more lesions around the eyes and growth. face in young animals is not well understood. However, Identification of fungal isolates was carried out by both the habit of licking and grooming by calves could pre- macroscopic and microscopic examination which included growth rate, general topography, surface and reverse pigmentation. dispose this part of the animal to infection. Microscopic identification of positive fungal cultures was carried out Our results showed that all the samples examined by using the method described by Murray et al. (2005). Briefly, a drop direct microscopy were positive for fungi. Other resear- of lactophenol cotton blue stain was placed on a clean glass slide. chers found out that direct microscopic examination could A portion of mycelium was transferred into the lactophenol cotton provide a positive diagnosis in 60-71% of samples from blue stain and teased with a 22 gauge nichrome needle to separate which dermatophytes were isolated (Sparkes et al., 1993; the filaments. Cover slip was placed on the preparation and examined under low and high power magnification using a much Al-Ani et al., 2002). In this study, the dermatophyte was reduced light for identification. isolated in pure culture suggesting that dermasel agar is a suitable selective medium for the isolation of pathogenic fungi. RESULTS Colonies of T. verrucosum in this report were slow growing, white, cottony, heaped and slightly folded with The skin of affected calves showed circular, circum- some submerged growth and yellow reverse pigment. scribed, grayish-white, thick, hairless, crusty raised This observation is consistent with the findings of Forbes lesions (Figure 1). The lesions were mostly seen on the et al. (2002). In our investigation, microscopic examina- head, face, around the eyes, neck and dewlap. No visible tion revealed septated hyphae and microconidia that skin lesions were observed on the dams or other animals were attached laterally to the hyphae. There were nume- in the herd. All the 12 samples were positive for fungal rous chlamydospores mostly in chains (chains of pearls). Dalis et al. 785

Figure 1. Ringworm lesions in a 4 month-old calf. Note thick, crusty, grayish-white lesions around the eye, face, ear and neck (arrow).

This agrees with the report of Shams-Gahfarokhi et al. downgrading of hides and skin and decrease in meat and (2009) who observed chains of chlamydospores as pre- milk production (Gudding and Lund, 1995). In a survey of dominant microscopic feature of the fungus in slide bovine dermatophytoses in major dairy farms of Mashhad culture. Adult cattle had been reported to be less suscep- City, Eastern Iran, T. verrucosum was the predominant tible to the ringworm (Cam et al., 2007) and some of the dermatophyte isolated (Shams-Gahfarokhi et al., 2009). dams could perhaps be carrying the infection without A large scale outbreak of the disease involving a dairy showing clinical sign and might be a source of infection herd has recently been reported in Arusha region, for the calves. The soil, infected installations and even Tanzania (Swai and Sanka, 2012). Several other out- the house were the animals were kept could be other breaks of ringworm affecting cattle herds and especially sources through which the animal could acquire infection young calves had been documented in Australia since T. verrucosum is known to persist in the environ- (Maslem, 2000), China (Ming and Ti, 2006) and Italy ment for 5-7 years and had been isolated from the soil (Papini et al., 2009). (Gudding and Lund, 1995; Mahmoudabadi and Zarrin, The major problem with T. verrucosum infection in 2008; Singh and Kushwaha, 2010). We do not know the cattle farms is that, once the disease is introduced into a actual source of infection for these animals because nei- farm, it spreads rapidly among susceptible animals. The ther neither the healthy dams nor any of these materials organism is difficult to eradicate from the environment were sampled and investigated in this study. because of the peculiarity in composition of its spores.

The warm and humid climate of our environment could Treatment of cattle ringworm is expensive and cumbersome have favored the growth and development of fungal especially on a herd level (Gudding and Lund, 1995). spores thereby predisposing the animals to infection and This concern has prompted the need for effective prophy- hence the outbreak in this highly susceptible population. laxis against the disease as hygienic and other preven- Cattle ringworm causes high economic losses espe- tive measures were often inadequate (Rybnikar, 1992). cially in the livestock and leather industries due to Vaccination against bovine dermatophytosis had been 786 Afr. J. Microbiol. Res.

Figure 2. Colonial morphology of T. verrucosum. Note: white, cottony, heaped and folded colony.

a b

Figure 3. Microscopic morphology of T. verrucosum showing microconidia borne laterally from the hyphae (a) and clamydoconidia in chains referred to as “chains of pearls” (b).

considered the most effective way of controlling the 2012). infection (Rybnikar, 1992). Immunization of calves with Ringworm is enzootic in Nigeria. However, the national live T. verrucosum was found to protect 90% of the vac- prevalence of the disease in the cattle population in this cinated animals against T. verrucosum infection (Mikaili country is yet to be determined. et al., 2012). A nationwide immunization program carried This study has revealed that T. verrucosum could be an out in Norway where all cattle including none infected important health problem in calves in this particular envi- animals of all ages followed by vaccination of all calves ronment, both as a zoonosis and economic importance and purchased animals reduced the prevalence of ring- as a result of esthetic and damage to hides and skin. worm from 70% in the year the program started to 0% There is need to study and understand the disease among eight years later (Gudding and Lund, 1995; Mikaili et al., the cattle population in this country with a view to Instituting Dalis et al. 787

prevention and control measures. Papini R, Nardoni S, Fanelli A, Mancianti F (2009). High infection rate of Trichophyton verrucosum in calves from Central Italy. Zoonoses Pub. Hlth. 56(2): 59-64. Radostits OM, Blood DC, Gay CC (1997). Veterinary Medicine, 8th Ed, ACKNOWLEDGEMENT Bailliere Tindall, London,pp. 381-39. Robert R, Pihet M (2008). Conventional methods for the diagnosis of We thank the Executive Director, National Veterinary dermatophytosis. Mycopath. 166: 295-306. Rybnikar A (1992). Cross-immunity in calves after vaccination against Research Institute, Vom, Nigeria for permission to publish trichophytosis. Acta Vet. Brno. 61:189-194. this work Shams-Gahfarokhi M, Mosleh TF, Ranjbar BS, Razzaghi AM (2009). An epidemiological survey on cattle ringworm in major dairy farms of Mashad city, Eastern Iran. I. J, M. 1(3): 31-36 Singh I, Kushwaha RKS (2010). Dermatophyte and related keratinophlic REFERENCES fungi in soil of Parks and Agricultural Fields of Uttar Pradesh, India.

Indian J. Dermatol. 53(3):306-308. Achterman RR, White TC (2012). Dermatophyte virulence factors: Sparkes AH, Gruffy TJ, Shaw SE, Wright AI, Stokes CR (1993). identifying and analyzing genes that may contribute to chronic or Epidemiological and diagnostic features of canine and feline acute infections. Int. J. Microbiol. 2012. pp. 1-8 dermatophytosis in the United Kingdom from 1956 to 1991. Vet. Rec. Adekeye J, Ado P, Kwanashie CN, Adeyanju J, Abdullahi S (1989). 133: 57-61. Prevalence of animal dermatophytes in Zaria. Zariya Veterinarian, Swai ES, Sanka PN (2012). Bovine dermatophytosis caused by 4(1):84-86. Trichophyton verrucosum: a case report. Vet. World 5(5):297-300 Adeleke SI, Usman B, Ihesiulor G (2008). Dermatophytosis among itinerant Quranic scholars in Kano (Northwest) Nigeria. Nig. Med. Pract. 53(3):33-35. Akbarmehr J (2011). The prevalence of cattle ringworm in native dairy farms of Sarab city (East Azarbayjan Province) in Iran. Afr. J. Microbiol. Res. 5(11): 1268-1271. Al-Ani FK, Younes FA, Al-Rawashdeh OF (2002). Ringworm Infection in Cattle and Horses in Jordan. Acta. Vet. Brno. 71: 55-60. Ameh IG, Okolo RU (2004). Dermatophytosis among school children: domestic animals as predisposing factor in Sokoto, Nigeria. Pak. J. Biol. Sci. 7(7):1109-1112. Cam Y, Gümüssoy KS, Kibar M, Apaydin N, Atalay Ö (2007). Efficacy of ethylenediamine dihydriodise for the treatment of ringworm in young cattle. Vet. Rec. 160: 408-410. Chineme CN, Adekeye JO, Bida SA (1980). Trichophyton verrucosum in young goats. Bull. Anim. Hlth. Prod. 29: 75-78. Forbes BA, Sahm DF Weissfeld AS (2002). Laboratory Methods in Basic Mycology. In Bailey and Scott’s Diagnostic Microbiology 11th edition, Mosby Inc, 11830 West line Industrial Drive St. Louis, Missouri 63146, U S A. Gudding R, Lund A (1995). Immunoprophylaxis of bovine dermatophytosis. Can. Vet. J. 36:302-306 Mahmoudabadi AZ, Zarrin M (2008). Isolation of dermatophytes and related kerationophilic fungi from the two Public Parks in Ahvaz. Jundishapur J. Microbiol. 1(1):20-23. Maslen MM (2000). Human cases of cattle ringworm due to Trichophyton verrucosum in Victoria, Australia. Australian J. Dermatol. 42: 1-4. Mikaili A, Chalabi M, Ghashghaie A, Mostafaie A (2012). Immunization against bovine dermatophytosis with live Trichophyton verrucosum. Afr. J. Microbiol. Res. 6 (23):4950-4953. Ming PX, Ti YL, Bulmer GS (2006). Outbreak of Trichophyton verrucosum in China transmitted from cows to humans. Mycopath. 161: 225-228. Murray PR, Rosenthal KS, Pfaller MA (2005). Superficial and cutaneous mycosis. In: Medical Microbiology, 5th edition. Philadelphia, USA, pp. 745-751. Nweze EI (2010). Dermatophytosis among children of Fulani/Hausa herdsmen living in Southeastern Nigeria. Rev. Iberoam. Micol. 27(4):191-194.

Full Length Research Paper

Characteristics of nodule bacteria from Mimosa spp grown in soils of the Brazilian semiarid region

Ana Dolores Santiago de Freitas1*, Wardsson Lustrino Borges2, Monaliza Mirella de Morais Andrade1, Everardo Valadares de Sá Barretto Sampaio3,Carolina Etienne de Rosália e Silva Santos1, Samuel Ribeiro Passos4, Gustavo Ribeiro Xavier4, Bruno Mello Mulato4 and Maria do Carmo Catanho Pereira de Lyra5

1Universidade Federal Rural de Pernambuco (UFRPE), Recife-PE, Brazil. 2Embrapa Amapá, Macapá-AP, Brazil. 3Universidade Federal de Pernambuco (UFPE), Recife-PE, Brazil. 4Embrapa Agrobiologia, Seropédica-RJ, Brazil. 5Instituto Agronômico de Pernambuco (IPA), Recife-PE, Brazil.

Accepted 13 January, 2014

The Brazilian Northeastern dry forest (Caatinga) is one of the diversification centers of Mimosa species. We determined the characteristics of native rhizobia isolates from nodules of Mimosa tenuiflora and Mimosa paraibana grown in pots with soils collected under Caatinga vegetation and compared the restriction ribosomal DNA profiles of the isolates with those of 16 reference strains. All plants formed abundant indeterminate nodules and all nodule isolates formed fast growing colonies. No colony altered the medium to an alkaline reaction and most of them produced low or medium amounts of extracellular polysaccharides. White and creamy colonies predominated among the isolates but orange and green colonies were present. Differences among the isolates from the Mimosa species tested are indicated by the greater phenotypic diversity of those obtained from M. tenuiflora. The analysis of the 16S rDNA gene suggests that the isolates from M. tenuiflora and M. paraibana are closely related and closer to - rhizobia than to α-rhizobia. However, the similarity with all the tested -rhizobia reference strains was relatively low suggesting that the isolates may belong to different bacteria species.

Key words: Biological nitrogen fixation, diversity, rhizobia, wild tree legumes.

INTRODUCTION

Legume species belonging to the genus Mimosa have diverse habitats, including lowland tropical rainforest, received considerable attention in recent years because savanna, tropical and subtropical dry forest and thorn of their potential to fix large proportions of their nitrogen scrub, mid-elevation subtropical forest, desert, grassland, from the atmosphere (Freitas et al., 2010) and because and wetland (Simon et al., 2011). of their preferential association with -rhizobia (Chen et One of the diversification centers of Mimosa is the al., 2005; Barrett and Parker, 2006; Bontemps et al., Brazilian Northeastern dry forest (Simon et al., 2011), 2010; Elliott et al., 2009; Reis Jr et al., 2010; Liu et al., locally called Caatinga. The Caatinga represents the 2012). Mimosa is one of the richest Leguminosae genera, largest and most isolated of the South American dry with over 500 species, mostly neotropical, occupying forests. It covers more than 850,000 km2 (Albuquerque et

*Corresponding author. E-mail: [email protected]. Tel: 55-81-32692660, 55-81-33206237. Fax: 55-81-33206200. de Freitas et al. 789

al., 2012), from 02°50’S at its northern limits, to 17°20’S (2003), Souza (2010) and Pereira et al. (2003), respectively. with a variety of different types of vegetation (Queiroz Number of species and tree heights and stem diameters are higher in the agreste zone than in the sertão zone and in this last zone 2006). Caatinga occurs under a prevailing semi-arid higher in Serra Talhada than in Santa Terezinha, probably reflec- climate, with a high evapotranspiration potential (1500 to -1 ting higher water availability. 2000 mm year ) and a low precipitation (300 - 1000 mm Soil subsamples were analyzed for some chemical and physical -1 year ) that is usually concentrated within 3 to 5 months characteristics (Table 2), following the methodology described by (Queiroz 2006). The region is rich in legume species, with Embrapa (1997). The samples were dried, passed through a 6 mm more than 293 speies in 77 genera, many of them ende- mesh sieve and portions of 1 kg were placed in pots maintained under greenhouse conditions. Seeds of two Mimosa species mic ones (Queiroz et al., 2009). Few of these species (Mimosa tenuiflora (Willd.) Poir. and Mimosa paraibana Barneby) were studied in relation to their potential to fix nitrogen were collected from a single mother tree in Remígio caatinga. The and to their microsymbionts (Freitas et al., 2010; Teixeira seeds were surface disinfected in etanol (70% v/v - 3 min) and et al., 2010). sodium hypochlorite (1 % v/v - 3 min), rinsed five times with sterile Mimosa paraibana Barneby and Mimosa tenuiflora distilled water, rolled onto YMA plates to test for surface sterility and (Willd.) Poir. are leguminous tree species with great then were sown in the pots. Each legume species was sown in triplicate for each soil sample. The pots received 100 ml of nutrient nitrogen fixation capacity mean contributions of biological solution without nitrogen (Hoagland and Arnon, 1939) every week fixation for plant nitrogen reaching up to 50% in Caatinga until harvest, 120 days after seed germination. At harvest the root (Freitas et al., 2010). M. tenuiflora is a species of wide nodules were separated, dehydrated in silica gel and stored. distribution, occupying dry areas of Brazil to Mexico, Honduras and El Savador (Queiroz et al., 2009). This species is the main pioneer species in areas of caatinga Isolation and phenotypic characterization of rhizobia with few years of regeneration (Souza et al., 2012). Its Rhizobia were isolated from the nodules in yeast mannitol agar preferred symbionts are apparently β-proteobacteria, -1 medium (YMA, pH 6.8) (Vincent, 1970) with 25 mg kg (w/v) of belonging to the genus Burkholderia (Bontemps et al., Congo red. The typical rhizobia colonies were purified and stored at 2010; Reis Jr et al., 2010). Moreover, M. paraiba is a -20°C, in microtubes with 1 ml YM medium(YMA without agar) plus species endemic to Northeast Brazil (Queiroz et al., 15% sterilized glycerol. Isolates colonies in YMA with 25 mg kg-1 2009) and there is no studies on bacteria capable of (w/v) bromethymol blue as pH indicator (Fred and Waksman, 1958) forming symbiotic nodules on their roots. were observed for the following characteristics: growth period, pH Research on Mimosa rhizobia have been conducted in alteration of growth medium, colony morphology (shape, size, border, transparency, surface) and amount of extracellular poly- several regions of Brazil (Chen et al., 2005; Barrett and saccharides (EPS) (Xavier et al., 1998). These characteristics were Parker, 2006; Elliott et al., 2009; Liu et al., 2012). converted to binary data employed in a cluster analysis using the Isolation of rhizobia populations from Caatinga soils has UPGMA (Unweighted Pair Group Method Using Arithmetic Ave- been relatively rare (Bontemps et al., 2010; Reis Jr et al., rages) algorithmand the Jaccard similarity index. 2010; Teixeira et al., 2010), mainly considering the diver- The results of the cluster analysis were used to calculate richness (Taxa S and Margalef), diversity (Shannon H), dominance sity of environmental conditions in the region, that can (Simpson 1-D) and uniformity (Equitability J) indices for the soils affect the structure of rhizobia populations (Mishra et al., and species, where each morphological group, at 60% of the 2012). Moreover, most of this research centered on ge- similarity (Jesus et al., 2005), was considered as one operational netic characteristics and only Teixeira et al. (2010) des- taxonomic unit. The Past (palaeontological statistics) program was cribed cultural characteristics of the rhizobia. Therefore, used to perform cluster analysis and diversity indices calculation the diversity of bacteria able to nodulate Mimosa species (Hammer et al., 2001). in the region is little known.

Considering this scarcity of information, we charac- Restriction analysis (ARDRA) and reference strains terized Caatinga native rhizobia associated to two Mimosa species in relation to their cultural traits and DNA isolation, 16S rDNA gene amplification and restriction analysis compared the restriction profiles of their amplified ribo- of ribosomal DNA (ARDRA) using HinfI, MspI and DdeI endo- somal DNA (16S rDNA-ARDRA) with those of 16 nucleases were prepared according to Teixeira et al. (2010). reference strains. Twenty eight new strains were randomly selected (19 from M. paraibana and 9 from M. tenuiflora) and compared with 16 strains from Embrapa Agrobiologia bacterial diazotrophic collection: BR 7801 (Mesorhizobium loti), BR 527 (Sinorhizobium terangae), BR MATERIALS AND METHODS 7606 (Rhizobium leguminosarum bv trifoli), BR 2811 (Bradyrhizobium elkani), BR 114 (Bradyrhizobium japonicum), BR Soil sampling and Mimosa spp. cultivation 5401 (Azospirilum doberaneae), BR5410 (Azorhizobium caulinodans), BR 2006 (Methylobacterium nodulans), BR 3407 Composite soil samples from the 0 to 20 cm superficial layer were (Burkholderia sabiae), BR 3437 (Burkholderia nodosa), BR 3454 collected in areas of preserved Caatinga vegetation in three (Burkholderia mimosarum), BR 3467 (Burkholderia mimosarum), municipalities, with different climate conditions (Table 1): 1) Santa BR 3471 (Cupriavidus taiwanensis), BR 3486 (Burkholderia Terezinha, in the sertão zone of Paraíba state; 2) Remígio, in the phymatum), BR 3487 (Burkholderia tuberum) and BR 3498 agreste zone of this same state; and 3) Serra Talhada, in the sertão (Burkholderia caribensis). The restriction fragment profiles were zone of Pernambuco state. The composition and structure of the used to perform a cluster analysis using the Jaccard index, the vegetation in the three areas were described by Ferraz et al. UPMGA algorithm and the GelCompar II (Applied Maths) program. 790 Afr. J. Microbiol. Res.

Table 1. General characteristics of preserved Caatinga areas in three municipalities, in the States of Paraíba (PB) and Pernambuco (PE), Brazil.

Municipality (state) Characteristic Santa Teresinha (PB) Remígio (PB) Serra Talhada (PE) Coordinates 07º03'S and 37º29'W 6°52’S and 35°47’W 07º59'S and 38º18'W Altitude (m) 380 596 500 Annual rainfall (mm) 824 700 768 Months with water deficit 9 - 10 4 - 5 6 - 7 Average temperature (◦C) 26 22 24

Table 2. Soil characteristics of preserved Caatinga areas in three municipalities, in the States of Paraíba (PB) and Pernambuco (PE), Brazil.

Municipality (state) Soil characteristic Santa Teresinha (PB) Remígio (PB) Serra Talhada (PE) Classification Litholic Neosol Regolithic Neosol Luvisol pH (water) 8.8 4.4 6.8 P (mg dm-3) 7.3 8.4 4.9 N (%) 0.07 0.08 0.10 C (%) 0.73 0.96 1.09 Sand (g kg-1) 623 725 651 Silt (g kg-1) 224 122 227 Clay (g kg-1) 153 153 122

(A) (B)

Figure 1. Shape of nodules found in Mimosa paraibana (A) and M. tenuiflora (B) roots from plants grown in soils collected under mature Caatinga vegetation.

RESULTS very fast, in less than 24 h, and formed circular colonies in the YMA medium. Mimosa spp. nodulation

All harvested plants, cultivated in all three soils, had Phenotypic characteristics of rhizobia isolates nodules of indeterminate growth with dark red interior and sizes up to 3 cm in diameter (Figure 1). Sixty one isolates No isolate changed the medium pH to an alkaline reac- were obtained from the nodules of M. paraibana and 62 tion. Most of the isolates obtained from M. tenuiflora from the nodules of M. tenuiflora. All isolates developed changed the medium pH to an acid reaction: 96% when de Freitas et al. 791

Acid Neutral A

100 90 80 70

(%) 60 50 40 Isolates 30 20 10 0 MT MP MT MP MT MP Santa Teresinha Remígio Serra Talhada

B 100 None Low Moderate Copious 90 80 70 60 50 40 Isolates(%) 30 20 10 0 MT MP MT MP MT MP

Santa Teresinha Remígio Serra Talhada

Figure 2. pH change (A) and amount of extracellular polysaccharides (EPS) production (B) in YMA medium of bacterial nodule isolates from Mimosa tenuiflora (MT) and M. paraibana (MP) grown in soils collected under mature Caatinga vegetation.

when grown in the soil from Santa Terezinha, 75% in the from M. tenuiflora, the highest proportion (30 to 40% in soil from Remígio and 68% in the soil from Serra Talhada the three soils) produced colonies with moderate (Figure 2). Most of the isolates from M. paraibana grown amounts of extracellular polysaccharides (EPS), 26% in the soil from Serra Talhada (62%) also changed the pH were dry colonies and only in the colonies originating to an acid reaction but the proportions were lower in the from the Santa Terezinha soil the proportion of high EPS soils from Santa Terezinha (48%) and Remígio (35%). producers (46%) surpassed the proportion of moderate Most of the colonies had a cream color (74% of those producers (Figure 2). Among the isolates from M. from M. tenuiflora and 67% from M. paraibana) but there paraibana most (30 to 95%) produced low amounts of were also white, orange and green colonies. At 48 h in EPS, except in the Santa Terezinha soil where the YMA, the most common diameters of colonies from M. proportion of colonies with copious amounts of EPS was tenuiflora were punctiform (29%), 3 mm (19%) and 4 mm also high (48%). (16%) while those from M. paraibana were 2 mm (31%), The isolates from M. tenuiflora were classified into 19 punctiform (23%) and 1 mm (21%). Among the isolates phenotypic groups and those of M. paraibana into 16 792 Afr. J. Microbiol. Res.

Figure 3. Phenotipic similarity dendrogram among M. tenuiflora (A) and M. paraibana (B) nodule isolates froms oils of preserved Caatinga. The letters MT and MP indicates the isolates from M. Tenuiflora and M. Paraibana respectively. The letters M P, R and S indicates isolates native from soils of Santa Terezinha, Remígio and Serra Talhada (municipalities in the States of Paraíba (PB) and Pernambuco (PE), Brazil.), respectively.

groups (Figure 3). Eight groups from each plant species Santa Terezinha, 23 of them clustering into four groups were composed of a single isolate which can be con- exclusive of isolates from the soil of this area (Figure 3B). sidered to belong to different or rare types. The isolates On the other hand, the isolates from M. tenuiflora had no from M. paraibana had a tendency to group according to clear tendency to group according to the soil. the soil, mainly the isolates originating from the soil of Richness, diversity and equitability were higher among de Freitas et al. 793

Figure 4. Taxa S, Margalef, Shannon H, Simpson 1-D and Equitability J indices for bacterial nodule isolates from Mimosa tenuiflora (MT) and M. paraibana (MP) grown in soils collected under Mature Caatinga vegetation.

the isolates from M. tenuiflora than from M. paraibana native populations of bacteria able to colonize the roots of (Figure 4). For the first species, the order of isolate both plant species. Ample populations of nodulating diversity for the soils was Santa Terezinha, Remígio and bacteria are common in the soils of the regions where the Serra Talhada while for the second species it was the legume species are native. On the other hand, nodulation inverse order. frequently fails when a legume species is planted outside its original region (Bala et al., 2003; Souza et al., 2007). M. tenuiflora has a large distribution in tropical dry Restriction analysis (ARDRA) cluster forests, from Brazil to Mexico (Queiroz et al., 2009) and naturally occurs in the three Caatinga fragments where Four large groups (Figure 5) were formed in the cluster the soils were collected (Ferraz et al., 2003; Pereira et analysis based on the restriction analysis of ribosomal al., 2003; Souza, 2010). M. paraibana has a more DNA (ARDRA). One group was composed of 26 out of 28 restricted distribution, being endemic to the Caatinga, of the new isolates, both from M. paraibana (17 out of 19 and spontaneously occurs only in the Caatinga fragment total new isolates) and from M. tenuiflora (9 new of Remígio (Pereira et al., 2003). In spite of that, it also isolates). The second group was somewhat related to the nodulated when planted in the soil of the two other areas. first group and was composed mostly of strains typical of There is no information on the natural occurrence of -rhizobia genera. The third group was composed of rhizobia populations able to form symbiosis with the strains of the type typical of α-rhizobia genera. The fourth several Mimosa species growing in soils of the Brazilian group included only two isolates from M. paraibana semiarid, but the spontaneous nodulation of M. paraibana (MPS5 and MPS10) and had a low similarity with both the indicates that this occurrence may be quite general. -rhizobia and the α-rhizobia groups. Two pairs of These species may also be very promiscuous, nodulating isolates (MPS 19 and MTP 16-2; MPS 17 and MPS 12) with a large spectrum of microsymbionts, as observed for and one groups of five isolates (MPS1, MPS6, MPS7, M. pudica (Bontemps et al., 2010). MPS8 and MPS9) from M. paraibana had 100% The nodules of M. tenuiflora and M. paraibana were similarity. indeterminate, as has been described for those of other Mimosoideae legumes. Indeterminate nodules, with a wide range of size, formats and ramifications are usually DISCUSSION attributed to species of Mimosoideae (Sprent et al., 2007), without influence of the microsymbionts (Lammel Mimosa spp. nodulation et al., 2007).However, some of the nodules grew more than usually reported (Patreze and Cordeiro, 2004), The spontaneous nodulation of M. paraibana and M. reaching more than 20 mm in their longest axis (Figure tenuiflora indicates the presence, in the three soils, of 1). M. paraibana is one of the endemic species of 794 Afr. J. Microbiol. Res.

Figure 5. Genetic similarity dendrogram among 28 bacterial nodule isolates from Mimosa tenuiflora (MT) and M. paraibana (MP) grown in soils collected under mature Caatinga vegetation and 16 α- and -reference rhizobia strains based on PCR-ARDRA of the 16S rDNA gene. de Freitas et al. 795

caatinga that only recently was identified as capable of type of colony. Therefore, the bacteria associated with M. fixing nitrogen (Freitas et al., 2010) and the description of paraibana and M. tenuiflora seem to differ, from a certain its nodules is being reported for the first time. extent, from those described in native rhizobia collections obtained from soils of the region using cowpea as a trap culture. Mishra et al. (2012) demonstrated that different Phenotypic characteristics of rhizobia isolates legume species can form associations with different rhizobia populations, in spite of being cultivated in the The growing interest on microsymbionts associated to same soils. The wide phylogenetic distance from cowpea Mimosa spp. has resulted in a large number of articles on and Mimosa species, belonging to two distinct legume the subject (Chen et al., 2005; Barrett and Parker, 2006; subfamilies (Papilionoidea and Mimosoidea), may explain Bontemps et al., 2010; Elliott et al., 2009; Reis Jr et al., part of the difference in their microsymbionts. 2010; Liu et al., 2012). However, few of these articles Differences among the isolates from the two Mimosa describe the characteristics of the culture colonies formed species tested are indicated by the greater phenotypic by these symbionts. Recently, Teixeira et al. (2010) diversity of those obtained from M. tenuiflora (Figure 4). observed that all the isolates obtained from nodules of M. This species may establish symbiosis with a larger array tenuiflora grown in a soil from a Caatinga area (Petrolina, of rhizobia species, and this could be explained by its Pernambuco State, Brazil) had a rapid development and larger spatial distribution which may determine different acidified the medium and that most of them produced a patterns of co-evolution with the microsymbionts. large quantity of EPS. Fast-growing acid-producing rhizobia are the most common symbionts of several African and Asian wild tree legumes (Wolde-Meskel et al., 2004; Analysis of the 16S rDNA gene

Shetta et al., 2011). The isolates obtained from M. The analysis of the 16S rDNA gene suggests that the paraibana and M. tenuiflora cultivated in the soils from isolates from M. tenuiflora and M. paraibana are closely Serra Talhada, Santa Terezinha and Remígio also had related, independently from the soil of cultivation, clus- rapid development but, contrasting with the African tering in the first group of the dendrogram (Figure 5). All isolates, some of them did not modify the YMA culture isolates show the same phenotypic characteristics of medium (51% of the M. paraibana isolates and 19% of mucus production, acid or neutral reaction and homo- the M. tenuiflora isolates). Large production of EPS was geneous and circular colonies. Other characteristics such only observed in 17 isolates (20% of all the M. paraibana as differences in color of colonies and amount of mucus isolates and 8% of the M. tenuiflora isolates). Rapid generated clustering on phenotypic dendrograms that growth is a common characteristic of native isolates from cannot be observed in the genetic analysis. They were the Brazilian semiarid region obtained from nodules of also closer related to -rhizobia than to α-rhizobia, corro- several species (Teixeira et al., 2010; Medeiros et al., borating previous reports of prevalence of this group 2009). Usually, isolates of rapid development do not form among species of the Mimosoideae subfamily (Chen et dry colonies (Teixeira et al., 2010) but this was the case al., 2005; Reis Jr et al., 2010). However, the similarity with in 16% of the isolates from M. tenuiflora and 6% of the all the tested -rhizobia reference strains was relatively isolates from M. paraibana (Figure 2).  low. White, creamy or translucent colonies are commonly Two isolates (MPS5 and MPS10) are clustered apart formed by bacteria associated with wild tree legumes these two groups. According to their position they could such as Acacia spp. (Wolde-Meskel et al., 2004), Millettia be alpha that were not well resolved by the analysis, or pinatta (Rasul et al., 2012) and Mimosa tenuiflora another class of proteobacteria. (Teixeira et al., 2010). White and creamy colonies also predominated among the isolates from M. tenuiflora and M. paraibana but orange and green colonies were also Conclusion present. Considering that descriptions of colonies formed by rhizobia associated to Mimosa spp. are scarce (Chen The results demonstrate that the bacteria populations et al., 2005; Bontemps et al., 2010; Reis Jr et al., 2010; from the nodules of Mimosa spp. species native from the Teixeira et al., 2010), it is difficult to evaluate the soils of the semiarid Brazilian region have cultural cha- frequency of these phenotypes. racteristics different from those obtained from the same Medeiros et al. (2009) reported that punctiform colonies soils but using other legume species as trap plants. In are commonly formed by isolates from nodules of Vigna spite of fast growth, the isolates can form from dry colo- unguiculata cultivated in soils from Caatinga areas. nies to colonies with large production of EPS. The isola- Cowpea associates with a large diversity of rhizobia and tes are more related to -rhizobia than to α-rhizobia, but due to this characteristic it is frequently used as a trap the low similarity with the strains from the Embrapa culture (Melloni et al., 2006; Medeiros et al., 2009). collection suggests that the rhizobia isolated from the However, only 29 and 23% of the isolates from the nodules of M. tenuiflora and M. paraibana are different nodules of M. tenuiflora and M. paraibana formed this bacteria species. 796 Afr. J. Microbiol. Res.

REFERENCES Patreze CM, Cordeiro L (2004). Nitrogen-fixing and vesicular - arbuscular mycorrhizal symbioses in some tropical legume trees of Albuquerque UP, Araújo EL, El-Deir ACA, et al. (2012) Caatinga tribe Mimoseae. Forest Ecology and Management. 196: 275-285. revisited: ecology and conservation of an important seasonal dry Pereira IM, Andrade LA, Sampaio EVSB, Barbosa MRV (2003). Use- forest, The Scientific World Journal: 18 p. history effects on structure and flora of Caatinga. Biotropica. 35:154- Bala A, Murphy PJ, Osunde AO, Giller KE (2003).Nodulation of tree 165. legumes and the ecology of their native rhizobial populations in Queiroz LP (2006). The Brazilian Caatinga: phytogeografical patterns tropical soils. Appl. Soil Ecol. 22:211-223. inferred from distribution data of the Leguminosae. In: Pennington T, Barrett CF, Parker MA (2006). Coexistence of Burkholderia, Lewis GP, Ratter JA (eds) Neotropical Savannas and Seasonally Dry Cupriavidus, and Rhizobium sp. nodule bacteria on two Mimosa spp. Forests Plant Diversity, Biogeography and Conservation, CRC in Costa Rica. Appl. Environ. Microbiol. 77:1198-1206. Press,New York, pp 121-157. Bontemps C, Elliott GN, Simon MF, Reis Jr FB, Gross E, Lawton RC, Queiroz LP (2009). Leguminosas da Caatinga, Universidade Estadual Elias Neto N, Loureiro MF, Faria SM, Sprent JI, James EK, Young de Feira de Santana, Royal Botanic Gardens Kew, Associação JPW (2010). Burkholderia species are ancient symbionts of legumes. Plantas do Nordeste, Feira de Santana. Mol. Ecol. 19:44-52. Rasul A, Amalraj ELD, Kumar GP, Grover M, Venkateswarlu B (2012). Chen WM, Faria SM, Straliotto R, Pitard RM, Araújo JLS, Chou JH, Characterization of rhizobial isolates nodulating Millettia pinnata in Chou YJ, Barrios E, Prescott AR, Elliott GN, Sprent JI, Young JPW, India. FEMS Microbiol. Lett. 336:148-158. James EK (2005). Proof that Burkholderia strains form effective Reis Jr FB, Simon MF, Gross E, Boddey RM, Elliott GN, Neto NE, symbioses with legumes: a study of novel Mimosa-nodulating strains Loureiro MF, Queiroz LP, Scotti MR, Chen WM, Norén A, Rubio MC, from South America. Appl. Environ. Microbiol. 71:7461-7471. Faria SM, Bontemps C, Goi SR, Young JPW, Sprent JI, James EK Elliott GN, Chou JH, Chen WM, Bloemberg GV, Bontemps C, Martínez- (2010). Nodulation and nitrogen fixation by Mimosa spp. in the Romero E, Velázquez E, Young JPW, Sprent JI, James EK Cerrado and Caatinga biomes of Brazil. New Phytol. 186:934-946. (2009).Burkholderia spp. are the most competitive symbionts of Shetta ND, Al-Shaharani TS, Abdel-Aal M (2011). Identification and Mimosa, particularly under N-limited conditions. Environ. Microbiol. characterization of Rhizobium associated with woody legume trees 11(4):762-778. grown under Saudi Arabia condition. Am. Eurasian J. Agric. Environ. EMBRAPA - Embrapa Brasileira de Pesquisa Agropecuária (1997). Sci. 10:410-418. Manual de métodos de análise de solos, Embrapa, Rio de Janeiro. Simon MF, Grether R, Queiroz LP, Särkinen TE, Dutra VF, Hughes CE Ferraz EMN, Rodal MJ, Sampaio EVSB (2003).Physiognomy and (2011). The evolutionary history of Mimosa (Leguminosae): toward a structure of vegetation along an altitudinal gradient in the semi-arid phylogeny of the sensitive plants. Am. J. Bot. 98(7):1201-1221. region of northeastern Brazil. Phytocoenologia 33:71-92. Souza LAG, Bezerra Neto E, Santos CERS, Stamford NP (2007). Fred EB, Waksman SA (1958) Laboratory manual of general Desenvolvimento e nodulação natural de leguminosas arbóreas em microbiology. Mc Grow Hill, New York. solos de Pernambuco. Pesq Agropec Bras. 42(2):207-217. Freitas ADS, Sampaio EVSB, Fernandes AR, Santos CERS (2010). Souza LQ (2010). Fitossociologia em áreas com diferentes históricos Biological nitrogen fixation in legume trees of the Brazilian Caatinga. de uso e fixação biológica de nitrogênio em Caatinga madura na J. Arid Environ. 74:344-349. Paraíba. M.Sc. dissertation, Universidade Federal de Pernambuco, Hammer Ø, Harper DAT, Ryan PD (2001). Past: paleontological Brazil. statistics software package for education and data analysis. Souza LQ, Freitas, ADS, Sampaio EVSB, Moura PM, Menezes RSC Palaeontologia Electronica 4:1-9 (2012). How much nitrogen is fixed by biological symbiosis in tropical Hoagland DR, Arnon DI (1939). The water culture method growing dry forests? 1. Trees and shrubs. Nutr. Cycl. Agroecosist. 94:171- plants without soil. U Calif Agric Exp Sta, California. 179. Jesus EC, Moreira FMS, Florentino LA, Rodrigues MID, Oliveira MS Sprent JI (2007). Evolving ideas of legume evolution and diversity: a (2005). Diversidade de bactérias que nodulam siratro em três taxonomic perspective on the occurrence of nodulation. New Phytol. sistemas de uso da terra da Amazônia Ocidental. Pesq. Agropecu. 174:11-25. Bras. 40:769-776. Teixeira FCP, Borges WL, Xavier GR, Rumjanek NG (2010). Lammel DR, Brancalion PHS, Dias CTS, Cardoso EJBN (2007). Characterization of indigenous rhizobia from caatinga. Braz J Rhizobia and other legume nodule bacteria richness in brazilian Microbiol. 41:201-208. Araucaria angustifolia forest. Sci. Agric. 64(4):400-408. Vincent JM (1970). A manual for the practical study of root nodule Liu XY, Wei1 S, Wang F, James EK, Guo XY, Zagar C, Xia LG, Dong X, bacteria, Blackkwell Scientific, Oxford. Wang YP (2012).Burkholderia and Cupriavidus spp. are the preferred Wolde-Meskel E, Berg T, Peters NK, Frostegard A (2004) Nodulation symbionts of Mimosa spp. in Southern China. FEMS Microbiol. Ecol. status of native woody legumes and phenotypic characteristics of 80:417-426. associated rhizobia in soils of southern Ethiopia. Biol. Fertil. Soils. Medeiros EV, Martins CM, Lima JAM, Fernandes YTD, Oliveira VR, 40:55-66. Borges WL (2009). Diversidade morfológica de rizóbios isolados de Xavier GR, Martins LMV, Neves MCP, Rumjanek NG (1998). Edaphic caupi cultivado em solos do Estado do Rio Grande do Norte. Acta. factors as determinants for the distribution of intrinsic antibiotic Sci. Agron. 31(3):529-535. resistance in a cowpea rhizobia population. Biol. Fertil. Soils. 27:386- Melloni R, Moreira FMS, Nóbrega RSA, Siqueira JO (2006). Eficiência e 392. diversidade fenotípica de bactérias diazotróficas que nodulam caupi (Vigna unguiculata (L.) Walp) e feijoeiro (Phaseolus vulgaris L.) em solos de mineração de bauxita em reabilitação R. Bras. Ci. Solo. 30:235-246. Mishra RPN, Tisseyre P, Melkonian R, Chaintreuil C, Miché L, Klonowska A, Gonzalez S, Bena G, Laguerre G, Moulin L. (2012). Genetic diversity of Mimosa pudica rhizobial symbionts in soils of French Guiana: investigating the origin and diversity of Burkholderia phymatum and other beta-rhizobia. FEMS Microbiol. Ecol. 79:487- 503.

Full Length Research Paper

Microbiological assessment of dentists’ hands in clinical performance

Márcia Rosental da Costa CARMO1*, Jorge Kleber CHAVASCO1, Solange de Oliveira Braga FRANZOLIN2, Luiz Alberto BEIJO1, Júlia Rosental de SOUZA CRUZ3 and Paulo Henrique WECKWERTH2

1Universidade Federal de Alfenas – Unifal-MG, Rua Gabriel Monteiro da Silva, 700. Centro. 37.130-000 Alfenas- MG. Brazil. 2Universidade Sagrado Coração – USC-Bauru, São Paulo, Brazil. 3Acadêmica da Universidade Federal de Alfenas – Unifal-MG, Alfenas-MG, Brazil.

Accepted 30 January, 2014

This study verified the presence of opportunist pathogenic bacteria in the hands of Surgeons Dentists. Biological materials were collected from the hands of 41 professionals, randomly selected. The professional washed his/her hands for around 30 s in a sterile plastic bag, filled with 250 mL of physiologic serum, in three distinct times: Timing 1 (T1), hands without wearing gloves, before attending to the patient; Timing 2 (T2), wearing gloves, right after the patient treatment, when the glove was contaminated with the patients’ biological material; and Timing 3 (T3), collected after removing the gloves. The material obtained was inoculated in culture mediums such as: Brain Heart Infusion Agar (BHI), Manitol Salt Agar (MSA), Eosin Methylene Blue (EMB) and Bile Esculin Agar (BEA). There were identified Staphylococcus aureus and not aureus strains, besides Gram-negative bacteria, suggesting deficient hygiene of the hands. An antibiogram was made for all the Gram-positive and Gram-negative bacteria found. The result shows a high number of strains resistant to the most common used antibiotics. The microbiological count was higher in the T1 for all the culture mediums, suggesting that the act of washing the hands for 30 s decreases the microbiota resident in the hands.

Key words: Antimicrobial agents, hands washing, infection control, odontology, risk due to biological agents.

INTRODUCTION

Infection control has become one of the most discussed contributing for the spread of multiresistant pathogens, topics in odontology, being very important during the besides playing an important role in the development of practice, so that professionals no longer question its post operatory complications. Lately, multiresistant bacte- importance. The knowledge about occupational hazards rial strains are responsible for outbreaks all over the has been largely developed, but unfortunately it has been world and the therapeutic arsenal has become more and short to strengthen awareness and change behaviors, as more scarce, increasing costs and time expending on policies of infection control are not being fully applied treatment. The Staphylococcus aureaus resistant to (Moraes, 2008). methicillin (MRSA) is responsible for important infections According to Lehotsky et al. (2010) the failure in hand and hands are the most common way of transmission disinfection before surgical procedures is considered the (Custódio et al., 2009). major cause of nasocomiais infections worldwide, According to Myers et al. (2008) Odontology profes-

*Corresponding author. E-mail: [email protected]. Tel: 55 (35)3291-1852. 798 Afr. J. Microbiol. Res.

sionals must be bound to principles scientifically accep- grown in BEA underwent the Gram Method and Catalase Test. ted and based on evidences of infection control, con- Finally, the ones grown in EMB Agar underwent the Gram Method sidering that hands hygiene is one of the most important and were identified using Bactray® Kit, for biochemical identification of Gram Negative bacilli with Negative or Positive Oxidase. processes to reduce the transmission of microorganisms The antibiogram using the Agar Disc Diffusion Technique (also between professional and patient. known as Agar Diffusion Method or Kirby- Bauer Test), according to Thus, the ethical responsibility of health professionals CLSI (CLSI document, 2009), using antibiotics discs made by in reducing the risks of contamination is expected. Accor- DME® Sensidisc . There were made the following antibiotics for ding to Dejours (1995), the Health Area may be a health Gram positive bacteria: Amoxicillin/Clavulanic Ac. (AMC 30 - 20/10 µg), Azithromycin (AZI 15 - 15 µg), Ciplofloxacin (CIP 05 - 5µg), provider or a pathogenic producer. This study aimed to Clindamycin (CLI 02 - 2 µg), Doxycycline (DOX 30 - 30 µg), isolate and identify bacterial strains in the collected mate- Norfloxacin (NOR 10 - 10 µg), Oxacillin (OXA 01 - 1 µg), rial extracted from hands of dentists during clinical proce- Vancomycin (VAN 30 - 30 µg), Linezolid (LNZ 30 - 30 µg), Table 4. dures, being a helpful matter in the awareness about the For the Gram negative were used: Cephalotin (30 µg), Sulfazotrin possibility of transmission of pathogenic microorganisms (25µg), Tobramycin (10µg), Chloramphenicol (30µg), Gentamicin through hands. It also intends to determinate the profile (10µg), Doxycycline (30µg), Ciprofloxacin (05µg), Azithromycin (15µg), Norfloxacin (10µg), Table 6. of sensibility of microorganisms to antibiotics, building up The analysis of variance was used to evaluate the factors signi- consciousness and a reasonable use of antimicrobials. ficance and the Scott-Knott test was applied at 5% level of significance to get the average difference. This research was carried out after the Committee of Ethics in MATERIALS AND METHODS Research had authorized the realization of the project on Protocol No 216/10 in November, 25th, 2010. The research was developed starting with a list of 120 names, provided by the Odontology Regional Council from Minas Gerais (CRO-MG), and intermediated by the Regional Office from Alfenas. RESULTS Later, based on the names enrolled in the list, 41 participants were randomly selected and invited to participate in the survey. The timing 1 (T1) which represents the first collection of Professionals were sought after in their workplaces and they the material from professional hands, always presented were informed about the attribute of the study. The participation the highest number of Colony-Forming Unit (CFU/ml), when was linked to a consent form. On the research, dentists from both genders, specialists and general clinical dentist, who perform their compared to the others timing (T2 and T3) from the activities in private and public offices, participated. research (Table 2). T2 presented the lowest count of The study was developed starting with the collection of biological CFU/ml when compared to T1 and T3, with statistical signi- material on the active hand of the dentist. On each sample an sterile ficance for the media used, according to Scott-Knott Test bag measuring 15x32 centimeters containing 250 mL of sterile physio- (Table 1). logic serum was used, where the professional washed their hands 41 pairs of Descarpack® sterile gloves were used, for about 30 s, over three different times: Timing 1 (T1), bare hands before seeing the patient; Timing 2 (T2), gloved hands right after which did not show any damage during the collection, the patient treatment, when the glove was contaminated with the except one glove that had a perforation on the middle patients’ biological material; and Timing 3 (T3), collected after glove finger. The glove that presented the perforation was used removal looking forward to verify microbiota present within the glove. in a long duration surgical procedure. Expecting to obtain standardization during the material collection, The material inoculation in the culture medium (BHI) sterile Descarpack® latex gloves were provided to all participants was used to count the total bacteria, in each one of the (sample) in the research. The material collection did not interfere with the professional routine, in other words, the dentist was told to three timing used in this research, totaling 246 samples. act just like his/her would normally do, which means that the dentist The results show that the T1 relative to the time when had full choice to wash hands before starting treatments and wear the professional gets ready to start the clinical procedure, sterile gloves in the manner they judged more suitable. in other words, before wearing gloves, presented the Right after the three collecting timings in the physiologic serum, highest count of total bacteria, reaching up to more than the obtained material was sent to the Microbiology Laboratory at the Universidade Federal de Alfenas, together with the glove used double of the CFU/ml count in the three media used. by the professional. The glove was filled with methylene blue and The colonies count in the MSA was used to isolate the observed after 24 h in order to verify the presence of perforations. Gram positive cocci in the samples, specifically Overall, samples were collected 123 from the hands of 41 Staphylococcus sp. The colonies counting in this media professionals. At the laboratory, 100 microliters (µL) of physiologic followed the trend observed in BHI. In the same way, serum withdrew from hand washing was inoculated in the culture there was a reduction from T1 to T3, indicating that the media: Brain Heart Infusion Agar (BHI - Himedia), Manitol Salt Agar (MSA), Eosin Methylene Blue (EMB) and Bile Esculin Agar (BEA), act of washing hands in physiologic serum removes part for each one of the timing (T1, T2, T3), in concentrations: undiluted of the microorganisms, thereby, reducing the number of and 1/10, in each one of the three times, and each sample for each CFU/ml (Table 3). one of the four culture medium, totaling 984 samples. In T2, 27 samples had zero count. So, the unfolding of The culture media were incubated at 37°C (98.6°F) in a bacterio- the significance for all the variable T presented a statis- logical incubator for 48 h. The colonies quantification was made tical three timing used in this research. using a colony counter, and the results were obtained in CFU/mL (Colony-Forming Unit per Milliliters). The results indicate the presence of 26 samples of S. Strains which were grown in MSA underwent the Gram Method, aureus and 44 Coagulase-negative Staphylococci (CoNS), Catalase Test, DNase and Coagulase Test. Strains which were from analysis of the 246 samples distributed over the Carmo et al. 799

Table 1. Colonies’ counting average in the culture media BHI, MSA and EMB in CFU/ml.

Culture media T1 (CFU/mL) T2 (CFU/mL) T3 (CFU/mL) BHI 2624,27a 701,83c 1074,32b MAS 1837,93a 48,66c 807,93b BEM 89,27a 0a 20,49a

T1= Bare hands before seeing the patient; T2= Gloved Hands, right after the patient treatment, when the glove was contaminated with the patients’ biological material; T3= collected after glove removal. BHI= Brain Heart Infusion Agar; MSA= Manitol Salt Agar; EMB= Eosin Methylene Blue Note 1: it was not possible to calculate the statistics for the BEA medium, because only one was collected in T1; of all the 246 made showed positive result. The values are means. The means followed by the same lower case letter in the line do not have difference between then by Scott- Knott test, at level 5% of significance.

Table 2. Minimum and Maximum CFU/ml counting in the 4 culture media used.

T1 (CFU/ml) T2(CFU/ml) T3 (CFU/ml) Culture Media Minimum Maximum Minimum Maximum Minimum Maximum BHI 0 Countless 0 9,400 0 6,010 MAS 0 6,000 0 920 0 5,320 BEM 0 1,530 0 0 0 830 BEA 0 Countless 0 0 0 0

T1= Bare Hands before seeing the patient; T2= Gloved hands right after the patient treatment, when the glove was contaminated with the patients’ biological material; T3= collected after glove removal. BHI= Brain Heart Infusion Agar; MSA= Manitol Salt Agar; EMB= Eosin Methylene Blue; BEA= Bile Esculin Agar.

Table 3. Identification of the strains of Staphylococcus aureus and CNS - Coagulase negative Staphylococcus, obtained in T1, T2 and T3.

Timing Staphylococcus aureus CNS - Coagulase negative Staphylococcus T1 13 19 T2 03 07 T3 10 18 Total 26 44

T1= Bare hand before seeing the patient; T2= Gloved hand right after the patient treatment, when the glove was contaminated with the patients’ biological material; T3= collected after glove removal.

three timings established in this research, although, with positive for two samples, and they were: 10 and 830 a higher colonies concentration in T1, for both identifica- CFU/ml. The T2 was equal to zero and for 100% of the tions (Table 3). samples, indicating that those bacteria are not common Both S. aureus and Coagulase-negative Staphylococci in the oral cavity (Table 2). 246 samples were analyzed in strains isolated and identified in this study underwent an the EMB culture medium, and for the three timings used antibiogram, being totally, sensitive to Amoxicillin/ in the research; there were no statistical significance in Clavulanic Acid and Norfloxacin. Also, they presented a the results (Table 1). high resistance to Azitromicin, Clindamicin and Vancomy- The presence of Escherichia coli in 8 samples was cin, according to Table 4. verified, Citrobacter freundii in 7 samples, and one sam- The culture medium EMB is used to differentiate and ple presented Enterobacter cloacae, totaling 16 samples isolate Gram negative bacilli (Enterobacteriaceae and with positive results for Gram negative bacteria, for a total others Gram negative bacilli). Following up the tenden- of 86 samples. cies of the others culture media, T1 in EMB presented the After identification of the 16 samples positive for Gram highest concentration of CFU/mL, resulting to positive in negative bacteria, the antibiogram was done, and the strains six cases with minimum counting as 90 CFU/ml and the were sensitive in 100% of the cases to Cephalotin, Genta- highest counting as 1,530 CFU/ml. In T3, results were micin and Norfloxacin. It is important to point out the 800 Afr. J. Microbiol. Res.

Table 4. Susceptibility profile of 26 strains of Staphylococcus aureus and 44 strains of CNS - coagulase negative Staphylococcus, in response to 9 clinical drugs.

AMC 30 AZI 15 CIP 05 CLI 02 DOX 30 NOR 10 OXA 01 VAN 30 LNZ 30 Antibiotic/Strain R S R S R S R S R S R S R S R S R S S. aureus 0 26 10 16 0 26 9 17 0 26 0 26 7 19 12 14 0 26 SCNS 0 44 26 18 4 40 26 18 14 30 0 44 13 31 25 19 1 43

AMC 30µg: Amoxicilin/Clavulanic Acid; AZI 15µg: Azitromicin; CIP 05µg: Ciprofloxacin; CLI 02µg: Clindamicin; DOX 30µg: Doxycycline; NOR 10µg: Norfloxacin; OXA 01µg: Oxacilin; VAN 30µg: Vancomycin; LNZ 30µg: Linezolid.

Table 5. Distribution of the Gram negative strains (Enterobacteriaceae) isolated in the culture media.

Gram negative Bacilli N (%) Escherichia coli 08 (50.0) Citrobacter freundii 07 (43.75) Enterobacter cloacae 01(6.25) Total 16 (100)

elevated number of strains resistant to Chloramphenicol, associated to diarrhea and pyogenic infections (Custódio Sulfazotrin, Azithromycin, Ciprofloxacin (Table 6). et al., 2009). The BEA is used to isolate and used as presumptive In this study, in the MSA culture were found values that identification of Enterococo faecalis. This bacterium was range from zero to 6,000 CFU/ml. Also isolated in the found in only one sample in T1 (with formation of MSA, in T1 was the presence of 13 S. aureus and 19 bacterial biofilm) for a total of 246 samples. other Staphylococcus; not aureus, from a total of 26 and

44 colonies, respectively (Table 3); totaling 86 samples in DISCUSSION the MSA. In the same way Silva et al. (2003) found a high rate of contamination for Staphylococcus and a lower Professional’s choice of washing or not of hands before number of Gram negative bacilli, in a study that verified wearing gloves, was determinant to the highest CFU/ml the microbiological contamination on surfaces, including counting found in all culture media used. It was so the operator hands’ and the places touched by him. because T1 had the highest count of CFU/ml, when S. aureus is responsible for several types of infection in compared to T2 and T3. And, besides, in some cases in human body, and hands are the main way of T1, the formation of biofilm could be noticed. This topic transmission. In this way, MRSA can be transmitted from was also studied by Agbor and Azodo (2010), when only one patient to another if hands hygiene is neglected. 63.4% of the interviewed reported the practice of hand Lately, MRSA has become an important topic, but it is not washing. more aggressive than Staphylococcus not aureus, and Poor hand hygiene (HH) among professionals on the the actual challenge is a shortage of antibiotics that can health area has motivated a lot of researches. And, combat the bacterium and not its virulence (Johnston and although this practice is a simple act, its interdependence Bryce, 2009). Due to the increasingly frequent and with the behavior sciences makes them complex and it unnecessary use of antibiotics, infections for MRSA have depends on a set of factors and attitudes, beliefs and become more frequent. The infections caused by S. knowledge (Pessoa-Silva et al., 2005). For researchers, aureus are usually treated with penicillin derivates such although professionals valorized and recognize the as Oxacilin, Cefazolin and Cefalotin; all of them were importance of the HH, the inadequate habit results in the used in this study. non adhesion and only the divulgation is not enough to The S. aureus strains were sensitive, in all cases to change behavior (Larson et al., 2007). Amoxicilin and Clavulanic acid, Ciprofloxacin, Doxy- For the culture media EMB and BEA, where T2 was cycline, Norfloxacin and Linezolid, according to Table 4, equal to zero, no result in T3 was higher than in T1; and were resistant to Azitromicin, Clindamicin, Oxacilin relevant fact considered is that Gram negative bacteria and Vancomycin. The occurrence of bacteria resistance (EMB culture) and Enterococcus (BEA culture) are not to antibiotics is a critical point, affecting sharply morbid- usually found in the oral cavity, being found, most times mortality rate and treatment costs (Oliveira et al., 2010). in places poorly sanitized. The Gram negative bacilli are MRSA rates clinical isolated from S. aureus vary from normally found in the environment and make part of the less than 1% in Norway and Sweden, from 5% to 10% in intestinal flora of humans and other animals, and may be Canada, 25% to 50% in USA, reaching up to more than Carmo et al. 801

Table 6. Sensitivity profile of the 16 strains of Enterobacteriaceae in response to 9 clinical drugs.

Antibiotic (µg) Sensitive strain Resistant strain Cefalotin (30) 16 0 Sulfazotrin (25) 8 8 Tobramycin (10) 13 3 Chloraphenicol (30) 5 11 Gentamicin (10) 16 0 Doxycycline (30) 14 2 Ciprofloxacin (05) 10 6 Azitromicin (15) 5 11 Norfloxacin (10) 16 0

50% in Hong Kong and Singapore (Michael and Martin, This situation is unacceptable in clinical offices. This 2010). MRSA are not only resistant to all the regular Gram negative bacilli, was also found and it is the main antibiotics, but also to a combination of them. cause of infections in the urinary tract and neonatal In this study 44 strains of Staphylococcus coagulase meningitis, causing 80% of mortality. It can also cause negative were found, for a total of 70 Staphylococcus sp. infections in wounded skin, peritonitis and septicemia Until the last couple of years, the Staphylococcus coagu- (Fraser and Cunha, 2012) lase negative, were seen as reduced risk in causing Strains of Citrobacter freundii (Gran Negative) identified infections, due to presence in the skin of microbiota. in this study, (Table 5), usually can be found in human However, the Negative Coagulase Staphylococcus begin and other animals feces. Fraser and Cunha (2012) had to be identified as a pathogenic agent, being considered already isolated strains in clinical samples of urine, throat the main cause of bacteremia in the USA; caused by the swabs, expectorations, blood and wound swabs, with increase in the incidence of infections (Grundman et al., characteristics of opportunist pathogen. The presence of 2006). The highest concentration of this pathogen was this bacterium on the hands and in the clinical offices collected on the professionals’ hands in T1 and T3, environment is critical, and not only increases the risk of according to Table 3. Due to similar finding, warning on infection, but also chances of one be infected by a how easy it is to transport the bacterium from one place resistant bacterium. Besides epidemiological vigilance, to another, completing the circle of microbial infection this issue also needs prioritization of health programs, should be done. effective health education, and aiming a reasonable use The antibiogram for Coagulase Negative Staphylococcus of antibiotics (Oliveira et al., 2010). was found in this study; 29.5% of strains were resistant to The strains of E. cloacae, also isolated in this study, Oxacilin, 9% to Ciprofloxacin and 56.8% to Vancomycin. are enterotoxigenic, and showed resistance to antibiotics, What makes the Staphylococcus a pathogen with the according to Table 6. Enterobacter can infect any surgical highest resistant rate to antibiotics is shown in Table 4. wounds, and these infections are clinically indistinguisha- The World Health Organization (2007) has made ble from infections caused by others bacteria (Fraser and reference to the excessive using of antibiotics worldwide, Cunha, 2012). and shows that the resistance to them is one of the three The antibiogram for Gram negative bacilli was made biggest threats to human health. Odontology overuses (Table 6). Most of the strains were resistant to most of antibiotics, and most of the time with no justification. This the antibiotics tested, with exception to Cefalotin, alert must be considered, because this study found 2.27% Gentamicin and Norfloxacin. of strains resistant to Linezolid, 56.8% to Vancomycin, Among the samples analyzed in T1, a strain of E.

29.5% to Oxacilin, 31.8% to Doxycycline, 59% to Clindamicin, faecalis was identified, commensal of human digestive 9% to Ciprofloxacin and 59% to Azitromicin. Only the tract, causing over 90% of the enterococci human infec- Amoxicilin associated to the Clavulanic acid and the tions (Johnston and Bryce, 2009). The strain isolated was Norfloxacin, was shown to be effective in 100% to the resistant to Clindamicin, Cefalotin, Chloraphenicol and cases in this study (Table 4). Oxacilin, with no inhibition, and with Norfloxacin, there Nowadays, the main concern is also applied to the was the formation of a ring of 14 mm. Although, it was specific treatments for infections caused by Gram nega- sensitive to the others antibiotics used, including tive bacteria and multidrug resistant to E. coli, just like the Vancomycin. A multinational study (including countries ones that were isolated in this study, and are indicated in such as South Africa, Egypt, Saudi Arabia and Lebanon) Table 5. These bacteria can survive for around 48 h after on nosocomial pathogens has found a similar result, being deposited on surfaces (Rodrigues et al., 2008). because none of the Enterococcus found in the study The presence of those bacteria in T1 and T3, in other were resistant to Vancomycin. However, 7% of the words on dentists’ hands indicate fecal contamination. Enterococcus isolated in Germany and 16.7% of the ones 802 Afr. J. Microbiol. Res.

isolated in Switzerland and Greece were resistant to Larson EL, Quiros D, Lin SX (2007). Dissemination of the CDC's Hand Vancomycin. Other studies show that environments fre- Hygiene Guideline and impact on infection rates. Am. J. Infect. Control 35(10):666-675. quented by patients with MRSA and Enterococcus resis- Lehotsky Á, Nagy M, Haidegger T (2010). Towards the Objective tant to Vancomycin is often contaminated by MRSA and Evaluation of Hand Disinfection. In: 26th Southerm Biomedical Enterococcus, just like the same contamination found on Engineering Conference. 32:92-96. hands, coats and equipments used by service providers Michael V, Martin MBE (2010). Antimicrobials and dentistry: Are we over prescribing? J. Marmara Univ. Dent. 1(1):15-19. (Johnston and Bryce, 2009). Moraes MS (2008). Em ambiente de risco, conhecimento é The scene is very critical, because in the late years the fundamental. J. Glob. Infect. Dis. Ano XX; 65:3. pharmaceutical industry did not invest on new antibiotics. Myers R, Larson E, Cheng B, Schwartz A, Silva K, Kunzel C (2008). According to Piddock (2011), this has occurred due to Hand hygiene among general practice dentists. JADA 139(7): 948- 957. merging pharmaceutical companies, small profit rates, Oliveira DGM, Souza PR, Watanabe E, Andrade D (2010). Avaliação da high costs and regulatory barriers. Besides all these bar- higiene das mãos na perspectiva microbiológica. Rev. Panam. riers, when the new drug has been finally approved, it is Infectol. 12(3):28-32. will not be effective in a long term, for the bacterium will Pessoa-Silva CL, Posfay-Barbe MD, Touveneau S, Perneger TV, Pittet D (2005). Attitudes and perceptions toward hand hygiene among soon develop resistance mechanism. healthcare workers caring for critically ill neonates. Cienc Enferm.

26(3):305-311. ACKNOWLEDGEMENTS Piddock LJ (2011). The crisis of no new antibiotics--what is the way forward? Lancet Infect. Dis. 12(3):249-253. Rodrigues MVP, Fusco-Almeida AM, Nogueira NGP, Bertoni BW, Part of the financial resources was personal and the Torres SCZ, Pietro RCLR (2008). Evaluation of the spreading of other part of the financial resources was donated by the isolated bacteria from dental consulting-room using RAPD technique. Universidade Federal de Alfenas, Alfenas, Minas Gerais, Lat. Am. J. Pharm. 27(6):805-811. Brazil. Silva FC, Antoniazzi MCC, Rosa LP, Jorge AOC (2003). Estudo da contaminação microbiológica em equipamentos radiográficos. Rev. Bras. Biocienc. 9(2):35-43. Conclusion World Health Organization (2007). The selection and use of essential medicines- Interventions for improvement of antimicrobial use. This study found the presence of Gram negative and Geneva. (Accessed em 2012 abril 9); Avalible in: Gram positive bacteria, based on the collection of http://whqlibdoc.who.int/trs/WHO_TRS_946_eng.pdf biological material on hands of Surgeons Dentists, during clinical procedures, showing deficiency in hand hygiene procedures. The CFU/ml count from hands of professionals before starting the procedure (Timing 1) was the highest for all the culture media used, suggesting that hand washing was neglected or was made improperly. The antibiogram showed the existence of strains resistant to most used antibiotics in the office. Thus, this press the recommendable need for effective programs in orienting professionals to a reasonable use of antibiotics.

REFERENCES

Agbor MA, Azodo CC (2010). Handwashing and barrier practices among Cameroonian dental professionals. Tanzan. Dent. J. 16(2):35- 38. CLSI (2009). Performance Standards for antimicrobial disk susceptibility tests. Approved standard – Tenth edition. CLSI document M02-A10. 29(1):3-34. Custódio J, Alves JF, Silva, FM, Dolinger EJO, Santos JGS; Brito DD (2009). Avaliação microbiológica das mãos de profissionais da saúde de um hospital particular de Itumbiara, Goiás. Rev Cien Med. 18(1):7-11. Dejours C (1995). Com ment formuler une problématque de la santé en ergonomie et en médicine du travail ? Trav. Hum. 58:1-16. Fraser SL, Cunha BA (2012). Enterobacter Infections Clinical Presentation. Medscape J Med (periódico na Internet) May 30 (acessado 2012 jul 12); Disponível em: http://emedicine.medscape.com/article/216845-clinical. Grundman H, Aires SM, Boyce J, Tiemersma E (2006). Emergence and resurgence of meticilin-resistant Staphylococcus aureus as a public health threat. Lancet Infect Dis. 368:874-885. Johnston BL, Bryce E (2009). Hospital infection control strategies for vancomycin-resistant Enterococcus, methicillin-resistant Staphylococcus aureus and Clostridium difficile. CMAJ 180(6):627- 631.

Full Length Research Paper

Evaluation of marine macro alga, Ulva fasciata against bio-luminescent causing Vibrio harveyi during Penaeus monodon larviculture

Krishnamoorthy Sivakumar, Sudalayandi Kannappan*, Masilamani Dineshkumar and Prasanna Kumar Patil

Genetics and Biotechnology Unit, Central Institute of Brackishwater Aquaculture (Indian Council of Agricultural Research), 75, Santhome High Road, Raja Annamalai Puram, Chennai - 600 028, Tamilnadu, India.

Accepted 23 January, 2014

Vibrio harveyi is one of the major disease causing bacterium in shrimp larviculture and grow-out practices. V. harveyi produces many virulence cum pathogenic factors. Application of antibiotics against luminescence causes development of antibiotic resistance among V. harveyi. Therefore, it is obligatory to develop bio-inhibitory agents as substitute in lieu of antibiotics. Under this study, Ulva fasciata was collected and extracted for crude compounds, 300 µg extract showed 12.3 mm of bio- inhibition against V. harveyi through “agar well diffusion assay”. Further, U. fasciata extract at 300 µg/ml was treated against V. harveyi in LB broth and showed reductions on phospholipase and proteolysis. Production of bio-luminescence was reduced to 7.3, 7.7, 13.0, 17.0 counts per second (CPS) and growth also reduced to 24.91%. Further, U. fasciata extract at 200 g/ml was tested against V. harveyi during Penaeus monodon larviculture and showed 32.40% reduction in the cumulative percentage mortality on postlarvae due to V. harveyi. Chemical constituents of U. fasciata was characterized by FTIR and GCMS. GC-MS analysis, reported to contain organic compounds such as Bis(2-ethylhexyl) phthalate was highest (88.42%), followed by 1,2- benzenedicarboxylic acid- butyl (2.47%). Therefore, it was concluded that U. fasciata may be a better bio-inhibitory agent against V. harveyi in shrimp larviculture.

Key words: Ulva fasciata extracts, antagonism, virulence factors, Vibrio harveyi, challenging shrimp postlarvae, cumulative mortality reduction.

INTRODUCTION

Penaeid shrimp farming have become a momentous quently reported in hatcheries (Raissy et al., 2011) and aquaculture activity in many countries in the tropics. grow-out ponds (Zhou et al., 2012). V. harveyi has been However, this grow-out practice is constantly under threat established as well-known bacterium to produce extra due to the outbreak of infectious diseases. Among the cellular products indicating its virulence factors such as infectious diseases the luminescent disease causing luminescence, proteases, phospholipases, lipases, side- Vibrio harveyi is one of the most important bacterial rophores, chitinases and hemolysins (Soto-Rodriguez et pathogen, capable of causing higher mortality among the al., 2012). The applications of antimicrobial chemicals, marine invertebrates (Vezzulli et al., 2010). In the last two especially antibiotics, led to the emergence of more decades, mass mortalities (80-100%) among Penaeid virulent as well as resistant among the bacterial shrimps resulting from V. harveyi infections were fre- pathogens (Rahman et al., 2010). Under this condition, it

*Corresponding author. E-mail: [email protected]. Tel: +91-44-24616948 or +91-96770 39103. Fax: +91-44-24610311.

804 Afr. J. Microbiol. Res.

Figure 1. Marine macro alga U. fasciata.

is indispensible to develop an alternative agent in place against shrimp pathogens such as Vibrio fischeri, of antibiotics that are commendably biodegradable and postlarvae (Selvin et al., 2011). incorporated diet was eco-friendly too. Vibrio alginolyticus, Vibrio Marine resources are an unmatched reservoir of The bio-potential of marine algae such as Skeletonema biologically active natural products, many of which exhibit costatum, U. fasciata and Kappaphycus alvarezii were structural features that has not been found in terrestrial studied against luciferase and luminescence producing V. organism (Saritha et al., 2013). There are numerous harveyi (Sivakumar and Kannappan, 2013). However, reports on compounds derived from macro algae with a numerous studies showed the biological activity of U. broad range of biological activities such as the anti- fasciata against many aquatic pathogens, but not closely microbial, antiviral, anti-tumor and anti-inflammatory as determined against luminescent disease causing V. well as neurotoxins (Osman et al., 2013). In addition, the harveyi and its virulence factors. Thus, this study was macro algae derived polysaccharides for example algi- under taken to discover the antagonistic effect of crude nate, carrageenan was capable of improving the healthi- U. fasciata extract against luminescent disease causing ness of marine candidate fish species in aquaculture, V. harveyi during P. monodon larviculture with the, when they were added to the diets (Peso-Echarri et al., description of functional compounds by FTIR and 2012). quantification of phytochemicals by GC-MS. Current studies reported that the solvent extracts of the red seaweed Gracilaria fisheri prevent V. harveyi MATERIALS AND METHODS infections in Penaeus monodon postlarvae (Kanjana et al., 2011). The crude extract obtained from Sargassum Isolation of V. harveyi hemiphyllum var. Chinense, show increased immunity and resistance against Vibrio alginolyticus and white spot V. harveyi strains were isolated from the P. monodon larviculture syndrome virus (WSSV) infection on Litopenaeus tanks. The isolates were identified using standard biochemical tests vannamei (Huynh et al., 2011). Ulva fasciata is a green and further confirmed by polymerase chain reaction (PCR) (Sivakumar and Kannappan, 2013). The pathogenicity of V. harveyi marine macro alga (Chlorophyceae), which grows cells were ascertained by spotting in 3% blood agar (Hi-media, abundantly in both intertidal and deep water regions of India). The isolates were re-confirmed by V. harveyi selective agar sea, and documented to be the potential sources of (VHSA) (Harris et al., 1996) and then stored in Luria-Bertani (LB) bioactive compounds (Paul and Devi, 2013). Further- broth with sterile glycerol (15% v/v) (Hi-media, India). more, various extracts from U. reticulata and U. lactuca were tested for antagonism against human pathogens Macro alga collection (Kolanjinathan and Stella, 2011). Aqueous extract of U. fasciata show inhibition against aquatic bacterial The marine macro alga U. fasciata was collected with a knife from pathogens (Priyadharshini et al., 2012). Antimicrobial all over the substrate (rock, plant, wood, etc.) (Figure 1) from efficiency of U. fasciata, Chaetomorpha antennina was intertidal region of Tuticorin (Latitude 8.7874°N; Longitude 78.1983°E), Tamilnadu, India (Figure 2). The alga was washed in studied against many pathogenic bacteria (Premalatha, permanganate solution [1% KMnO4 (w/v)] to remove the epiphytes, 2011). The efficacy of U. fasciata harveyi and sand and other extraneous matters and then shadow dried. The Aeromonas spp. challenged with P.monodon tested dried alga was weighed, pulverised using mechanical grinder and

Sivakumar et al. 805

Figure 2. Map showing Tuticorin region (Latitude 8.7874°N; Longitude 78.1983°E), India where macro alga U. fasciata was collected.

used for extracting crude fatty acids. Active 24 h old V. harveyi of 500 µl (1.8 OD) was inoculated into LB broth and shaker incubated at 28°C/100 rpm/5 days. The growth with various virulence factors such as luminescence, proteolytic, Solvent extraction lipolytic, phospholipase, thermonuclease activities, crude bacteriocin production, exopolysaccharide (EPS) and protease Ethyl acetate was used for extracting the crude compounds from produced by V. harveyi were estimated. Cell surface hydrophobicity alga at 30°C called “cold extraction method”. The U. fasciata extract was examined by salt aggregations test (SAT) and cell adhesion was prepared by taking 1.0 g of shadow dried powder, and then was examined by bacterial adhesion to hydrocarbons test (BATH) mixed with 10.0 ml of ethyl acetate and shaker incubated at 30°C (Soto-Rodriguez et al., 2012). Each test was performed in triplicates for 96 h at 50 rpm. Then the extract was filtered by Whatman filter and values were expressed in average with SD. paper No. 1, rotary evaporated (30°C) under vacuum and stored at

4°C for additional use. The resultant extract was liquefied with 5 mg/ml of 30% (v/v) dimethyl sulfoxide (DMSO) and used for testing Fourier transform infra red spectroscopy (FTIR) analysis antagonism against V. harveyi (Sivakumar and Kannappan, 2013).

The shadow dried U. fasciata was ground to powder by pestle and Estimation of MIC mortar. The FTIR spectra was recorded using BRUKER IFS 66 -1 model FTIR spectrometer in the region 4000-400 cm by employing The minimum inhibitory concentration (MIC) of U. fasciata against standard KBr pellet technique (D‟Souza et al., 2008). V. harveyi was evaluated (Islam et al., 2008).

Gas chromatography and mass spectrometry analysis Antibacterial assay Gas chromatography-mass spectrometry (GC-MS) analysis was Antibacterial activity was ascertained against V. harveyi using the performed by using Agilent GC-MS-5975C with the Triple-Axis “agar well diffusion assay” (Sivakumar and Kannappan, 2013). Detector equipped with an auto sampler. The GC column used was fused with silica capillary column (length 30 m × diameter 0.25 mm × film thickness 0.25 m) with helium at 1.51 ml for 1 min as a Effect of crude U. fasciata extract against the growth and carrier gas. The mass spectrometer was operated in the electron virulence of V. harveyi impact (EI) mode at 70 eV in the scan range of 40-700 m/z. The split ratio was adjusted to 1:10 and injection volume was 1 μl. The U. fasciata extract at 300 g/ml was added in 100 ml of LB medium. injector temperature was 250°C; the oven temperature was kept at

806 Afr. J. Microbiol. Res.

70°C for 3 min, rose to 250°C at 14°C min-1 (total run time 34 min). The maximum reduction on bacteriocin production (OD) The temperature of the transfer line and of the ion source was set was on 4th and 5th day (0.177 and 0.184) and minimum to a value of 230°C and the interface temperature at 240°C, (0.064) observed on 1st day as compared to the control respectively. Full mass data was recorded between 50-400 Dalton th th st per second and scan speed 2000. Mass start time is at 5 min and (OD 1.986 and 1.978 on 4 and 5 , and 2.082 on 1 end time at 35 min. Peak identification of crude U. fasciata extract days). Although, reductions of crude extra cellular protein was performed by comparison with retention times of standards and released was noticed in all the treatment days (Figure the mass spectra obtained was compared with those available in 3b). The EPS production in the treatment was reduced to the NIST libraries (NIST 11- Mass Spectral Library 2011 version) 0.525, 0.556, 0.585, 0.551 and 0.507 from 1st to 5th days with an acceptance criterion of a match above a critical factor of 80% (Musharraf et al., 2012). as compared to the control (OD 2.026, 2.408, 2.242, 2.262 and 2.250) (Figure 3c). The protease level was reduced from 0.047 and 0.051 as compared to the control Challenge of crude U. fasciata extract against V. harveyi during (OD 0.146 and 0.171) (Figure 3d). larviculture of P. monodon Further, the treated V. harveyi cells were subjected to phospholipase, proteolysis, lipolysis and thermonuclease The plastic tubs were washed with 1% KMnO4 solution. Tubs were filled with 20 L of saline water at 20 Practical Salinity Units-PSU. activities, determined based on the hydrolysis of medium Disease free postlarvae (PL 10) of P. monodon, procured from in the plate assay (Table 1). The activities were coded shrimp hatchery were acclimatized at 20 PSU for 5 days under with qualitative parameters like weak, moderate, high and laboratory conditions at 28 ± 1°C with continuous aeration. The very high. In treatment, the moderate level of average body weight of PL ranged from 17 to 18 mg and stocked at phospholipase and proteolysis activity was noticed on 1st, 1000 numbers per each tub. The control tub was inoculated with V. 2nd and 3rd days. Weak activities were noticed on 4th and harveyi (10 ml of 1.80 OD) alone. Second tub was considered as 5th days (very high). But moderate level of lipolysis and treatment inoculated with V. harveyi and 200 µg (2 gm/10L) of st th crude U. fasciata extract per ml. Third tub was considered as thermonuclease activities was shown on 1 to 5 day as control where crude U. fasciata extract was added at 200 µg per ml compared to the control (very high). alone with PL. The fourth tub was a control for PL, where neither V. Cell surface hydrophobicity was examined using SAT harveyi nor extract was added. The aeration was given for each tub and BATH tests (Table 1). SAT test was determined as to provide oxygen level not more than 4 ppm. The PL feed was given twice at 15% of their body weight. The water quality the lowest molarity of ammonium sulphate (0.05-4.0 M) parameters such as temperature, salinity and pH were measured that caused visible agglutination of a test organism. In once in 5 days. The mortality of PL was counted daily. No water SAT test, the control V. harveyi revealed strong hydro- exchange was given for all the tubs till 30 days. The water samples phobic activity for 1st to 5th day whereas, the treated were collected once in 5 days by sterile water bottles. The total showed moderate hydrophobic activity for 1st to 5th day. heterotrophic and V. harveyi bacterial counts were enumerated Similar way, BATH test also exhibited strong level of using LB medium and V. harveyi selective agar medium under st th spread plate method. All the experimental tubs were top covered to hydrophobic activity for control from 1 to 5 day. When avoid any external contaminations. For each experiment, triplicates crude extract of macro alga of U. fasciata was treated were maintained and the values are average of three with V. harveyi, the production on luminescence was determinations (Traifalgar et al., 2009; Kannappan et al., 2013). reduced to 7.3, 7.7, 13.0 and 17.0 CPS (counts per second) for the 4 days period (Figure 3e). The maximum reduction on luminescence was reported on 4thday (17.0 RESULTS CPS) and minimum was observed on the 1st day (7.3

CPS) when compared with the control (39.6, 50.3, 59.3, Minimum inhibitory concentration (MIC) of U. fasciata 63.6 CPS).

The MIC of crude extracts of U. fasciata was established at 30 µg concentration. The zone of inhibition was 12.3 FTIR of U. fasciata mm, established at 300 µg level of extract of U. fasciata whereas, the 200 and 100 µg level of concentrations The FTIR spectrum of dried powder of U. fasciata is showed 8.3 and 3.3 mm zones, respectively, against the shown in Figure 4 and functional groups identified were growth of V. harveyi. compared from the FTIR standard library data. FTIR spectrum showed the presence of significant functional groups such as alcohols, phenols, esters, ethers, Effect of crude extract of U. fasciata against the alkanes, alkenes, primary amines, nitro compounds, changes in growth and virulence factors produced by aromatics and carboxylic acids, alkyl halides and aliphatic V. harveyi amines, etc (Table 2).

The treatment reduced the growth of V. harveyi (1.8 OD) from 1st to 5th day. The highest growth differences was GC-MS of U. fasciata observed on 3rd day (0.532 OD) and lowest on 1st and 5th day (0.468 OD) as compare to the control (Figure 3a). GC-MS analysis of crude ethyl acetate extract of U.

Sivakumar et al. 807

Figure 3. Crude extract of U. fasciata against the changes of growth and virulences produced by V. harveyi in LB broth for 5 days.

fasciata was found to have mixture of volatile P. monodon postlarvae for 30 days, the reduction on compounds. A total of 36 peaks were observed with re- cumulative percentage of mortality on postlarvae was tention times as shown in Figure 5. Chemical constituents noticed as 32.40% as compared to the control (76.30%). were identified using spectrum data base NIST 11 Two trails were maintained under larviculture as negative software installed in GC-MS. controls to distinguish any influence of U. fasciata extract The GC-MS analysis of the crude extract revealed that on PL. However, it was noticed that treatment does not the main chemical-constituent was organic compound affect PL as compared to the control (76.30%) which Bis(2-ethylhexyl) phthalate (tR = 23.21 min) (88.42 %) showed less reduction on cumulative percentage mortality followed by 1,2-benzenedicarboxylic acid- butyl (tR = with extract and PL (29.56%) and with PL alone (28.39%). 18.14 min) (2.47%) (Figure 6a and b). It is possible that The weight of the PL was measured for both the control bioactive compounds primarily consisting of Bis(2- and treatments. There was no much weight difference ethylhexyl)phthalate (tR =23.21 min) (88.42%) may be observed both in the treatment and control. On 30th day, involved in biological activity (Table 3) with other the average weight of the PL was 269.3 and 266.5 mg for compounds. control and treatment, respectively (initial weight of the PL for control was 17.7 and 18.1 mg for treatment,

Challenge of crude U. fasciata extract against V. respectively). The maximum decrease on V. harveyi counts were harveyi during P. monodon larviculture th th, th th observed on 5 , 10 15 and 20 days and mean values When U. fasciata extract was tested against V. harveyi in for treatment were 2.38 x 104, 1.56 x 104, 4.30 x 103 and

808 Afr. J. Microbiol. Res.

Table 1. Effect of U. fasciata extract against the changes of virulences produced by V. harveyi.

Virulence studied Cell surface hydrophobicity Day Proteolysis Phospholipase Lipolysis Thermonuclease SAT (M) BATH (%) Control Treated Control Treated Control Treated Control Treated Control Treated Control Treated 1 ++++ ++ ++++ ++ ++++ ++ ++++ ++ 0.86± 0.02 1.29± 0.04 86.78±4.11 46.33±2.13 2 ++++ ++ ++++ ++ ++++ ++ ++++ ++ 0.89± 0.03 1.35± 0.05 85.66±3.91 43.11 ±1.65 3 ++++ ++ ++++ ++ ++++ ++ ++++ ++ 0.91± 0.04 1.44± 0.06 82.33± 3.03 39.56± 1.33 4 ++++ + ++++ + ++++ ++ ++++ ++ 0.91± 0.03 1.49± 0.04 76.31±3.13 36.81± 1.29 5 ++++ + ++++ + ++++ ++ ++++ ++ 0.99± 0.04 1.55± 0.06 73.46± 2.96 36.31± 1.19

Control- V. harveyi untreated with crude extract; Treated- V. harveyi treated with crude extract of U. fasciata; Activity of V. harveyi + = weak; ++ = moderate; +++ = high; ++++ = very high; SAT test (0.0 to 1.0 molarity (M) = strongly hydrophobic, 1.0 to 2.0 M = moderately hydrophobic; 2.0 to 4.0 M = weakly hydrophobic, and >4.0 M = not hydrophobic); BATH-test (>50% partitioning = strongly hydrophobic, 20 to 50% partitioning = moderately hydrophobic; and <20 % partitioning = not hydrophobic).

-1 Transmission/wavelength (cm )

Figure 4. FTIR spectrum of shadow dried powder of U. fasciata.

Sivakumar et al. 809

Table 2. The wave number (cm-1) of dominant peak obtained from the FTIR absorption spectra of U. fasciata.

Frequency (cm-1) Bond Functional groups 3425.4 O-H stretch, H-bonded Alcohols, phenols O-H stretch Carboxylic acids 2926.1 C-H stretch Alkanes

-C=C- stretch Alkenes 1647.7 N-H bend Primary amines

1541.8 N-O asymmetric stretch Nitro compounds

1419.9 C-C stretch (in-ring) Aromatics

Aromatic amines C-N stretchC-O stretch 1256.1 Alcohols, carboxylic acids, esters, ethers C-H wag (-CH X) 2 Alkyl halides

C-O stretch Alcohols, carboxylic acids, esters, ethers

1154.9 C-H wag (-CH2X) Alkyl halides C-N stretch Aliphatic amines

1054.2 C-N stretch Aliphatic amines

=C-H bend Alkenes 897.65 C-H "oop" Aromatics N-H wag Primary, secondary amines

=C-H bend Alkenes N-H wag Primary, secondary amines 848.08 C-H "oop" Aromatics C-Cl stretch Alkyl halides

=C-H bend Alkenes N-H wag Primary, secondary amines 791.88 C-H "oop" Aromatics C-Cl stretch Alkyl halides

3.40 x 103 cfu/ml as compared to control which is 3.40 x Priyadharshini et al. (2012) observed that aqueous and 105, 1.44 x 105, 1.45 x 105 and 2.49 x 104 cfu/ml, solvent based extracts of U. fasciata showed inhibition respectively. Various water quality parameters like against fish-borne bacteria and fungal pathogens. temperature, salinity and pH were observed in every Kolanjinathan and Stella (2011) reported that crude sampling are presented in Table 4. There were not much extracts of U. reticulata and U. lactuca are inhibitory to changes of water quality parameters both in the treat- human pathogenic bacteria and fungi. The dietary ment and control. Although, in the treatment, and with administration of U. fasciata extracts controlled marine V. extract alone, light greenish coloration was observed harveyi in shrimp grow-out system (Selvin et al., 2011). when compared with control due to the crude nature of In a recent study, reductions on crude bacteriocin were extract. noticed in all the days by U. fasciata extract on V. harveyi. The moderate and weak levels of reduction on proteolysis, phospholipase, lipolysis and thermonuclease DISCUSSION of V. harveyi were observed treating against U. fasciata extract. Silva et al. (2013a) has observed that U. fascita In the present study, U. fasciata extract reduced the extract exhibited antagonism against V. parahaemolyticus. growth of V. harveyi. The preliminary phytochemical In this study, the cell surface hydrophobicity of V. harveyi characterization and antimicrobial efficacy of macro algae exhibit moderate hydro-phobicity by U. fasciata treatment U. fasciata and Chaetomorpha antennina were studied when compared with the control. This was corroborated against pathogenic bacteria (Premalatha, 2011). with the values reported by Sivakumar and Kannappan

810 Afr. J. Microbiol. Res.

Figure 5. GC-MS chromatogram of the crude ethyl acetate extract of U. fasciata.

Figure 6. Major compounds isolated from U. fasciata. (a) Structure of Bis(2-ethylhexyl)phthalate (C24H38O4) extracted and detected by GC-MS from U. fasciata (b) Structure of 1,2-benzenedicarboxylic acid, butyl 2-ethylhexyl ester (C20H30O4), extracted and detected by GC-MS from U. fasciata.

(2013) from the marine algae such as S. costatum and K. Sargassum muticum using FTIR. Though the GC-MS alvarezii. analysis of crude extract of U. fasciata revealed many The FTIR spectra of U. fasciata showed various components, the main chemical constituents observed in functional groups of compounds which agreed with the high percentage were Bis(2-ethylhexyl) phthalate and FTIR values reported for marine macro algae Laminaria 1,2-benzenedicarboxylic acid-butyl which may also be digitata (Dittert et al., 2012). Similarly, Azizi et al. (2013) involved in antagonism against V. harveyi. observed various functional compounds like water, Challenge against V. harveyi during P. monodon post- protein, polysaccharide and lipids from marine algae larvae revealed that U. fasciata extract showed 32.40%

Sivakumar et al. 811

Table 3. GC-MS profile of U. fasciata.

Retention Peak area Molecular Molecular Compound’s name time (min) (%) formula weight

4.03 Anisole 0.80 C7H8O 108.13

5.29 1-Decene 0.09 C10H20 140.26

8.75 5-Tetradecene, (E)- 0.34 C12H28 196.37

8.88 Dodecane 0.05 C12H26 170.33

9.37 Benzothiazole 0.14 C7H5NS 135.18

11.67 1-Tetradecene 0.52 C14H28 196.37

11.77 Tetradecane 0.07 C14H30 198.38

13.15 Phenol, 2,4-bis(1,1-dimethylethyl) 0.34 C14H22O 206.32

14.21 Cetene 0.60 C16H32 224.42

14.29 Hentriacontane 0.10 C31H64 436.83

15.21 8-Heptadecene 0.23 C17H34 238.45

15.44 Heptadecane 0.06 C17H36 240.46

15.70 Phenol, 2-(1-phenylethyl)- 0.19 C14H14O 198.26

16.46 1-Octadecene 0.47 C18H36 252.48

16.53 Octadecane 0.06 C18H38 254.49 Bicyclo[3.1.1]heptanes, 2,6,6-trimethyl- 16.91 0.32 C H 138.24 ,(1.alpha.,2.beta.,5.alpha) 10 18

16.97 2-Undecanone, 6,10-dimethyl- 0.13 C13H26O 198.34

17.18 Dibutyl phthalate 0.30 C16H22O4 278.34

17.36 Phytol, acetate 0.11 C22H42O2 338.56

17.66 Phthalic acid, butyl isohexyl ester 0.45 C18H26O4 306.39

17.84 Phthalic acid, 2-ethylhexyl pentyl ester 0.09 C21H32O4 348.47

18.14 1,2-Benzenedicarboxylic acid, butyl 2.47 C20H30O4 334.44

18.32 Phthalic acid, butyl isohexyl ester 1.12 C18H26O4 306.39

18.51 5-Eicosene, (E)- 0.66 C20H40 280.53

18.56 Dodecane, 1,1'-oxybis- 0.10 C24H50O 354.65 Silanetriamine,1-azido-N,N,N',N', N'',N''- 19.89 0.21 C H N Si 202.33 hexamethyl- 6 18 6

20.36 Behenic alcohol 0.26 C22H46O 326.60 1,2-Benzenedicarboxylic acid, butyl 2- 20.87 0.27 C H O 334.44 ethylhexyl ester 20 30 4

21.70 Methyl dehydroabietate 0.10 C21H30O2 314.46

22.08 Octacosanol 0.12 C28H58O 410.75

22.24 Phenol, 2,4-bis(1-phenylethyl)- 0.25 C30H29N3O3 479.56

22.37 Phenol, 2,4-bis(1-phenylethyl)- 0.49 C30H29N3O3 479.56

22.80 Bis(2-ethylhexyl) phthalate 0.45 C24H38O4 390.55

23.02 Naphthalene, 6-chloro-1-nitro- 0.13 C10H6ClNO2 207.61

23.21 Bis(2-ethylhexyl) phthalate 88.42 C24H38O4 390.55

26.89 Benzo[h]quinoline, 2,4-dimethyl- 0.22 C15H13N 207.27

reduction in the cumulative percentage of mortality as al., 2009). Marine algae are impending source for owning compared to control; but, Saptiani et al. (2011) has repor- extensive range of polyunsaturated fatty acids (PUFA), ted that ethyl acetate, n-butanol fractions of crude carotenoids, phycobiliproteins, polysaccharides and phy- Acanthus ilicifolius extract controlled P. monodon post- cotoxins, etc (Chu, 2012). It was reported that lipids ob- larvae from V. harveyi infections. The supplementation of struct microbesby distracting cellular membrane (Bergsson Undaria pinnatifida and fucoidon incorporated diet proved et al., 2011) of bacteria, fungi and yeasts. These fatty to enhance growth with reduced mortalities among P. acids may further distress the expression of bacterial monodon postlarvae caused by V. harveyi (Traifalgar et virulence which was significant for establishing infections.

812 Afr. J. Microbiol. Res.

Table 4. Challenging of crude extracts of U. fasciata against V. harveyi during P. monodon larviculture with the cumulative percentage mortality reduction.

Treatment tubs Average weight of Water quality parameters for treatment and control Cumulative percentage mortality Control tubs (cfu/ml) (cfu/ml) postlarvae (mg) tubs Day Control Treatment Tubs with Total pH in pH in Tubs with Total plate V. Treatment Control Temperature Salinity tubs with tubs extract extract and plate V. harveyi control treatment PL alone count harveyi tubs tubs (°C) (PSU) V. harveyi with V. harveyi PL alone count tubs tubs 0 0.00 0.00 0.00 0.00 1.24106 1.15106 1.18106 2.41106 17.7 ± 3 18.1±2 29.0±1.0 20±0.5 8.40±0.2 8.30±0.2 5th 13.66±0.3 06.96±0.2 2.390.1 3.230.1 2.42104 2.38104 3.18105 3.40105 60.9 ± 4 63.6±3 29.5±1.0 20±0.5 8.50±0.2 8.40±0.2 10th 26.05±0.9 14.36±0.3 6.190.2 6.030.2 2.15104 1.56104 2.94105 1.44105 121.1 ± 4 127.5±5 29.0±1.0 20±0.5 8.20±0.2 8.30±0.2 15th 35.63±1.1 21.33±0.6 12.050.5 13.330.5 7.40104 4.30103 1.51105 1.45105 156.3 ± 5 157.5±5 30.0±1.0 20±0.5 8.40±0.2 8.50±0.2 20th 47.33±1.5 27.81±1.1 18.130.6 17.430.5 1.29104 3.40103 2.66104 2.49104 201.5 ± 9 197.9±7 30.0±1.0 21±0.5 8.10±0.2 8.30±0.2 25th 62.13±2.3 36.63±1.3 24.690.9 23.861.0 9.40104 5.40103 1.80104 1.74104 236.9 ± 8 240.1±9 31.0±1.0 21±0.5 8.40±0.2 8.20±0.2 30th 76.30±2.9 43.90±1.3 29.561.0 28.391.0 8.20104 4.10103 1.74104 1.51104 269.3 ± 9 266.5±8 30.0±1.0 21±0.5 8.10±0.2 8.00±0.2

Values of average of three determinations with standard deviation (SD)

It has been demonstrated that fatty acids of chain the presence of various chemical constituents as sponsoring the project entitled “Development of length more than 10 carbon atoms would induce described. Hence, macro algae U. fasciata extract inhibitors for controlling quorum sensing lysis of bacterial protoplasts. Due to the tough will have immense applications in aquaculture. luminescence disease causing Vibrio harveyi in

environments in which many macro algae exists, shrimp larviculture system” during 2010. This work effective defense mechanisms have been Conclusion was a component under this project established and consequently, amusing source of (BT/PR/13383/AAQ/03/501/2009). bioactive compounds, including polysaccharides, Results from this study proved that the crude polyphenols, fatty acids and peptides, with extract of U. fasciata at 300 µg/ml inhibited the growth and modulated the virulences produced by REFERENCES dissimilar structures and activities than those found in terrestrial plants (Tierney et al., 2010). V. harveyi. U. fasciata extract at 200 µg/ml also Al-Saif SSAL, Abdel-Raouf N, El-Wazanani HA, Aref IA (2013). Many species of macro algae had foremost controlled the mortality caused by V. harveyi Antibacterial substances from marine algae isolated from constituentslike tetradecanoic acid, hexadecanoic during shrimp larviculture. Based on this study, Jeddah coast of Red Sea, Saudi Arabia. Saudi J. Biological Sci. (article in press). acid, octadecanoic acid methyl esters etc the U. fasciata extract can be used as alternative Azizi S, Namvar F, Mahdavi M, Ahmad MB, Mohamad R (Balamurugan et al., 2013) which may reveal bio-inhibitors for the aquaculture practices. (2013). Biosynthesis of silver nanoparticles using brown antagonism against marine bacteria (Al-Saif et al., Application of such bio-products would moderate marine macro alga, Sargassum muticum aqueous extract. 2013). Lately, the secondary metabolites and the undesirable contamination from applying the Materials 6:5942-5950. organic extracts obtained from U. fasciata has synthetic compounds with reduced cost and eco- Balamurugan M, Selvam GG, Thinakaran T, Sivakumar K (2013). Biochemical Study and GC-MS Analysis of Hypnea potential applications (Silva et al., 2013b) and the friendly nature. musciformis (Wulf) Lamouroux. American-Eurasian J. Sci.

diverse derivatives of diterpenoids extracted from Res. 8(3):117-123. U. fasciata exhibited antagonism against Vibrio Bergsson G, Hilmarsson H, Thormar H (2011). Antibacterial, ACKNOWLEDGEMENTS antiviral and antifungal activities of lipids. In: Thormar H. parahaemolyticus and V. harveyi (Chakraborty et (eds), Lipids and essential oils as antimicrobial agents. John al., 2010). Thus, in the present study, biological The authors greatly acknowledge the Department Wiley and Sons Limited, Chichester, United Kingdom. pp. activity of U. fasciata against V. harveyi was due to of Biotechnology (DBT), Government of India for 47-80.

Sivakumar et al. 813

Chakraborty K, Lipton AP, Paulraj R, Vijayan KK (2010). Antibacterial Raissy M, Momtaz H, Moumeni M, Ansari M, Rahimi E (2011). labdanediterpenoidsof Ulva fasciata Delile from southwestern coast Molecular detection of Vibrio spp. in lobster haemolymph. Afri. J. of the Indian Peninsula. Food Chem. 119(4):1399-1408. Microbiol. Res. 5(13):1697-1700. Chu WL (2012). Biotechnological applications of microalgae. IeJSME Saptiani G, Prayitno SB, Anggoro S (2011). Inhibition test of jeruju 6(1):S24-S37. (Acanthus ilicifolius) leaf extracts on the in vitro growth of the Vibrio Dittert I M, Vilar VJP, da Silva EAB, de Souza SMAGU, de Souza AAU, harveyi. Paper. Simposium Nasional Kimia Bahan Alam XIX. Simnas Botelho CMS, Boaventura RA (2012). Adding value to marine macro KBA. Samarinda 11-12 p October (In Indonesian). algae Laminaria digitata through its use in the separation and Saritha K, Mani AE, Priyalaxmi M, Patterson J (2013). Antibacterial recovery of trivalent chromium ions from aqueous solution. Chem. activity and biochemical constituents of seaweed Ulva lactuca. Global Eng. J. 193:348-357. J. Pharmacol. 7(3):276-282. D'Souza L, Devi P, Shridhar DM, Naik CG (2008). Use of Fourier Selvin J, Manilal A, Sujith S, Kiran GS, Lipton AP (2011). Efficacy of Transform Infrared (FTIR) spectroscopy to study cadmium-induced marine green alga Ulva fasciata extracts on the management of changes in Padina tetrastromatica (Hauck). Anal. Chem. Insights shrimp bacterial diseases. Lat. Am. J. Aquat. Res. 39(2):197-204. 3:135-143. Silva GC, Albuquerque-Costa R, Oliveira-Peixoto JR, Macedo-Carneiro Harris L, Owens L, Smith S (1996). A selective and differential PBD, Fernandes-Vieira RHSD (2013a).Tropical Atlantic marine medium for Vibrio harveyi. Appl. Enviorn. Microbiol. 62(9):3548-3550. macro algae with bioactivity against virulent and antibiotic resistant Huynh TG, Yeh ST, Lin YC, Shyu JF, Chen LL, Chen JC (2011). Vibrio. Lat. Am. J. Aquat. Res. 41(1):183-188. White shrimp Litopenaeus vannamei immersed Silva M, Vieira L, Almeida AP, Kijjoa A (2013b). The marine macro in seawater containing Sargassum hemiphyllum var. Chinense algae of the genus Ulva: chemistry, biological activities and potential powder and its extract showed increased immunity and resistance applications. Oceanography 1:101. doi:10.4172/ocn.1000101. against Vibrio alginolyticus and white spot syndrome virus. Fish Sivakumar K, Kannappan S (2013). Inhibitory effect of marine algae Shellfish Immunol. 31(2):286-93. collected from the East and West coast of India against luciferase Islam MA, Alam MM, Choudhury ME, Kobayashi N, Ahmed MU (2008). and luminescence producing Vibrio harveyi. Afri. J. Biotechnol. Determination of minimum inhibitory concentration of cloxacillin for 12(22):3493- 3502. selected isolates of methicillin-resistant Staphylococcus aureus Soto-Rodriguez SA, Gomez-Gil B, Lozano R, del Rio-Rodriguez R, (MRSA) with their antibiogram. Bangl. J. Vet. Med. 6(1):121-126. Dieguez AL, Romalde JL (2012). Virulence of Vibrio harveyi Kanjana K, Radtanatip T, Asuvapongpatana S, Withyachumnarnkul B, responsible for the "Bright-red" Syndrome in the Pacific white shrimp Wongprasert K (2011). Solvent extracts of the red seaweed Litopenaeus vannamei. J. Invertebrate Pathol. 109(3):307-317. Gracilaria fisheri prevent V. harveyi infections in the black tiger Tierney MS, Croft AK, Hayes M (2010). A review of antihypertensive shrimp Penaeus monodon. Fish Shellfish Immunol. 30(1):389-396. and antioxidant activities in macro algae. Botanica Marina 53(5):387- Kannappan S, Sivakumar K, Patil PK (2013). Effect of garlic extract on 408. the luciferase, bio-luminescence, virulence factors produced by V. Traifalgar RF, Serrano AE, Corre V, Kira H, Tung HT, Fady RM, Kader harveyi with a challenge during Penaeus monodon larviculture. Afr. J. Md. A, Laining A, Yokoyama S, Ishikawa M, Koshio S (2009). Microbiol. Res. 7(18):1766-1779. Evaluation of dietary fucoidan supplementation effects on growth Kolanjinathan K, Stella D (2011). Comparative studies on antimicrobial performance and Vibriosis resistance of Peneaus monodon activity of Ulva reticulata and Ulva lactuca against human pathogens. postlarvae. Aquaculture Sci. 57:167-174. Int. J. Pharma. Biol. Archives 2(6):1738-1744. Vezzulli L, Previati M, Pruzzo C, Marchese A, Bourne DG, Cerrano C Musharraf SG, Ahmed MA, Zehra N, Kabir N, Choudhary MI, Rahman (2010). Vibrio infections triggering mass mortality events in a AU (2012). Biodiesel production from micro algal isolates of southern warming Mediterranean Sea. Environ. Microbiol. 12:2007-2019. Pakistan and quantification of FAMEs by GC-MS/MS analysis. Chem. Zhou J, Fang W, Yang X, Zhou S, Hu L, Li X, Qi X, Su H, Xie L (2012). Cent. J. 6(1):1-10. A non-luminescent and highly virulent V. harveyi strain is associated Osman MEH, Aboshady AM, Elshobary ME (2013). Production and with „„bacterial white tail disease‟‟ of Litopenaeus vannamei shrimp. characterization of antimicrobial active substance from some macro PLoS One 7(2): e29961. algae collected from Abu- Qir bay (Alexandria) Egypt. Afr. J. Biotechnol. 12(49):6847-6858. Paul JJP, Devi SDKS (2013). Seasonal variability of Ulva species (Green seaweed) in Tirunelveli region, the southeast coast of Tamil Nadu, India. Res. J. Marine Sci. 1(1):14-17. Peso-Echarri P, Frontela-Saseta C, Gonzalez-Bermudez CA, Ros- Berruezo GF, Martinez-Gracia C (2012). Polysaccharides from seaweed as ingredients in marine aquaculture feeding: alginate, carrageenan and ulvan. Revista de Biologia Marina y Oceanografia 47(3):373-381. Premalatha M (2011). Phytochemical characterization and antimicrobial efficiency of seaweed samples, Ulva fasciata and Chaetomorpha antennina. Int. J. Pharma Bio Sci. 2(1):P288-293. Priyadharshini S, Bragadeeswaran S, Prabhu K, Sophia Rani S (2012). Antimicrobial and hemolytic activity of seaweed extracts Ulva fasciata (Delile 1813) from Mandapam, Southeast coast of India. Asian Pac. J. Trop. Biomed. S38-S39. Rahman S, Khan SN, Naser MN, Karim MM (2010). Isolation of Vibrio spp. from Penaeidshrimp hatcheries and coastal waters of Cox‟s Bazar, Bangladesh. Asian J. Exp. Biol. Sci. 1(2):288-293.

Full Length Research Paper

Characterization and determination of antibiotic susceptibility pattern of bacteria isolated from some fomites in a teaching hospital in northern Nigeria

Aminu Maryam1*, Usman-Sani Hadiza1 and Usman M. Aminu2

1Department of Microbiology, Faculty of Science, Ahmadu Bello University, Zaria, Kaduna State, Nigeria. 2University Health Services, Ahmadu Bello University, Main Campus, Zaria, Kaduna State, Nigeria.

Accepted 30 January, 2014

Fomites are inanimate objects that can serve as vehicles for pathogens transfer. This study was conducted to determine the antibiogram of bacteria isolated from fomites in a teaching hospital in Nigeria. Exactly 35 samples were used for the study. Twenty three (65.7%) isolates were obtained; the ratio of Gram positive to Gram negative organisms was 12 to 11. The bacteria isolated were Staphylococcus aureus (21.7%), Staphylococcus epidermidis (8.7%), Streptococcus spp. (8.7%), Bacillus spp. (13.0%), Escherichia coli (26.1%), Pseudomonas spp. (8.7%) and Klebsiella spp. (13.0%). The isolated bacteria showed varying susceptibility pattern to the antibiotics used and were all susceptible to erythromycin and streptomycin.

Key words: Bacteria, fomites, antibiotics, susceptibility, teaching hospital, Nigeria.

INTRODUCTION

Fomites consist of either porous or nonporous surfaces Stethoscopes, neckties (Merlin et al., 2009; Williams or inanimate objects that whencontaminated with patho- and Davis, 2009), skin cells, hair, food, computer genic microorganisms can transfer them to a new host keyboards, pens, tables, artificial acrylic fingernails thereby serving as vehicles in transmission (Greene, (McNeil et al., 2001), bedding and clothing are common 2009; Cramer, 2013). Fomites are associated particularly hospital sources of pathogens (Boyce et al., 1997; with hospital acquired infections (HAIs) that remain a Cramer, 2013). Up to 60% of hospital staff’s uniforms are major cause of patient morbidity and mortality (Weber et usually colonized with potentially pathogenic bacteria, al., 2010; Nwankiti et al., 2012). An estimated 20 to 40% including drug-resistant organisms (Munoz-Price et al., of HAIs have been attributed to cross infection via the 2012). Intravenous fluid (IVF) tubes/stands, catheters, hands of health care workers (HCWs), who have become water systems and life support equipment can also be contaminated from direct contact with the patient or carriers, when the pathogens form biofilms on the indirectly by touching contaminated hospital environmen- surfaces (Willey et al., 2011; Cramer, 2013). tal surfaces (Kelly, 2002; Christensen et al., 2007; Identification of common fomites and associated Mangicaro, 2012). Fomites can therefore serve as reser- pathogens in any hospital settings is important because voir with pathogens being spread from the inanimate the most important factor in prevention of a disease is to environment to an animate (patient) environment via the simply identify what has been transferring the disease in hands of HCWs (Bhalla et al., 2004; Kramer et al., 2006; the first place (Cramer, 2013). Fomites are therefore an Ikeh and Isamade, 2011; Nwankiti et al., 2012). opportunity to interrupt the spread of infection.

*Corresponding author. E-mail: [email protected]. Tel: +234 803 328 7031.

Maryam et al. 815

Table 1. Distribution of growth and organisms isolated from fomites in the A&E ward of ABUTH, Zaria-Nigeria.

Fomite Total no. of sample Number with growth (%) Organism(s) isolated Table 5 3 (60) S. aureus, Bacillus spp. Stethoscope 5 3 (60) S. epidermidis, E. coli Klebsiella spp. Uniform 5 4 (80) S. aureus, E. coli, Streptococcus spp., Pen 5 3 (60) S. aureus, Bacillus spp, E. coli Streptococcus spp., S. epidermidis, Klebsiella IVF Stand 5 4 (80) spp. Pseudomonas spp. Door knob 5 3 (60) S. aureus, E. coli Chair 5 3 (60) S. aureus, E. coli, Bacillus spp. Total 35 23 (65.7)

By recognizing them, avoiding them, disinfecting them, or study in Nigeria (Ikeh and Isamade, 2011). Majority of the cleansing the hands after touching them, the spread of isolates were Gram positives organisms (52.2%: 12/23) many infections can be halted (Greene, 2009; Cramer, as compared to the Gram negative (47.8%: 11/23). 2013). This study was therefore conducted to isolate Staphylococci were isolated from all the fomites; S. bacteria from fomites in the Accident and Emergency epidermidis (8.7%: 2/23) from IVF stand and stethoscope (A&E) ward of Ahmadu Bello University Teaching and S. aureus (21.7%: 5/23) from the other fomites Hospital, Zaria, Nigeria and to determine their antibiotic (Table 2). susceptibility pattern. Isolation of more Gram positive organisms is consistent with previous reports (Neely and Maley, 2000; Chikere et al., 2008) and agree with the statement that Gram- METHODOLOGY positive bacteria have overtaken the Gram-negative as the predominant bacteria isolated from fomites A total of thirty-five (35) samples were collected from fomites (Inweregbu et al., 2005). Gram-positive organism have (tables, chairs, stethoscopes, pens, uniforms, doorknobs and IVF stands) after the early morning cleaning and disinfection process in earlier been noted to be causing more serious infections the A&E ward of Ahmadu Bello University Teaching Hospital, Zaria than ever before in surgical patients, who are increasingly between the months of July and October 2010. The samples were aged, ill and debilitated (Barie, 1998). In a more recent collected using sterile swab sticks, transported immediately to the study, only Gram positive organisms were isolated (Ikeh laboratory and cultured using the streak plate method on nutrient and Isamade, 2011). agar, MacConkey agar, Eosin methylene blue, mannitol salt agar, blood agar and centrimide agar as described by Cheesbrough Isolation of more Gram positive organisms is probably (2006). The plates were incubated at 37°C for 24 h; the isolates because they are members of the body flora of both were sub-cultured, maintained on Nutrient Agar slants and asymptomatic carriers and sick persons. These identified based on their cultural morphology, Gram and bioche- organisms can be spread by the hand, expelled from the mical reactions (Cheesbrough, 2006). respiratory tract or transmitted by animate or inanimate Antibiotic sensitivity testing was performed using Mueller-Hinton objects (Chikere et al., 2008). Their main source(s) of agar. Inoculums were prepared by standardizing using the McFarland’s standard. Standard antibiotic discs containing colonization on the fomites might likely be nasal carriage augmentin, ampiclox, septrin, ceftriaxone, ampicillin, ciprofloxacin, by hospital personnel (Graham et al., 2006), likely erythromycin, lincomycin, nitrofurantoin, ofloxacin, streptomycin, facilitated by hand-to-mouth or hand-to-nose contact tetracycline and gentamycin with concentrations of 30, 3, 250, 30, while using these fomites, and/or by poor hand-washing 15, 25, 10 m, 30, 200, 10, 10, 25, 10 mcg, respectively were used. habits (ASM, 2005). The discs were placed on the plates which were inverted and kept Isolation of Staphylococcus aureus from almost all the in the refrigerator for 30 min and then incubated at 37°C for 24 h. A clear zone of growth inhibition around a disc determined the relative fomites show their ubiquitous nature and that they can be susceptibility of each isolate to the antibiotics. sources of infection to patients as previously noted (Hartmann et al., 2004; Inweregbu et al., 2005; Ikeh and Isamade, 2011). Although the strains of the isolated S. RESULTS AND DISCUSSION aureus were not determined in this study, methicillin resistant Staphylococcus aureus (MRSA) strains have A total of 23 (65.7%) bacterial growths were obtained been shown to be transmissible from many fomites to from the culture with uniforms and IVF stands showing skin (Desai et al., 2011). For example, an earlier highest number of growth each (80%: 4/5), followed by study showed that one in three stethoscopes tested to tables, stethoscopes, pens, door knobs and chairs each harbour Staphylococcus aureus and that 15% of all having 60% (3/5) (Table 1). The percentage of growth stethoscopes tested were contaminated with MRSA obtained was lower than the 99% obtained in a previous (Williams and Davis, 2009). Staphylococcus epidermidis

816 Afr. J. Microbiol. Res.

Table 2. Frequency of isolation of bacteria from fomites in the A&E Ward of ABUTH, Zaria-Nigeria (N = 23).

Bacteria Isolated Frequency Percentage (%) Staphylococcus aureus 5 21.7 Staphylococcus epidermidis 2 8.7 Streptococcus spp. 2 8.7 Bacillus spp. 3 13.0 Escherichia coli 6 26.1 Pseudomonas spp. 2 8.7 Klebsiella spp. 3 13.0

Table 3. Parentage susceptibility of bacterial isolates to common antibiotic.

Organism CN OFX CPX CRO SXT E L S APX AG COX C N PM T S. aureus 40 40 60 60 60 100 80 100 80 20 - - - - - S. epidermidis 50 50 100 100 50 100 50 100 100 50 - - - - - Streptococcus spp. 50 50 100 50 100 100 100 100 50 50 - - - - - Bacillus spp. 33.3 33.3 66.7 100 100 100 100 66.7 66.7 ------E. coli 100 50 83.3 66.7 16.7 - - - - - 100 100 83.3 50 50 Pseudomonas spp. 100 100 50 50 50 ------50 - - 50 Klebsiella spp. 100 33.3 - 100 10 - - - - - 66.7 100 66.7 100 66.7

CN = Gentamycin; OFX = ofloxacin; CPX = ciprofloxacin; CRO = ceftriazone; SXT = cotrimozazole; E = erythromycin; L = lincomycin; S = streptomycin; APX = ampiclox; AG = augmentin; COX = cephalexin ; C = chloramphenicol; N = nitrifurantoin; PM = ampicillin; T= tetracyclin.

was isolated with the lowest frequency in this study. stands and tables probably due to fecal contamination as Though these strains of staphylococci are known to be a result of improper hand washing after the use of toilet. non-pathogenic on the body, when they harbor antimi- This is evident in its isolation from pens, stethoscopes crobial resistance genes they constitute serious health and doorknobs which are usually held and touched by hazard. This coagulase negative Staphylococci have hands. been isolated from keyboards on multiple user computers As previously reported (Williams and Davis, 2009), the (Hartmann et al., 2004) and increased virulence of this Gram negative bacteria Klebsiella spp. and organism resulting from the acquisition of methicillin Pseudomonas spp. were isolated from stethoscopes and resistance has been recognized (Ben-Saida et al., 2006). IVF stand in this study. Gram-negative bacteria are Other bacteria isolated were Streptococcus spp. (8.7%: responsible for a high proportion of HAIs, particularly 2/23) from IVF stand and uniforms, Bacillus spp. (13.0%: among the critically ill and those in hospital for long 3/23) from pens, tables and chairs, Escherichia coli periods (Gould and Chamberlain, 1994). (26.1%: 6/23) from all the fomites except table and IVF The isolated bacteria showed varying susceptibility stand, Klebsiella spp. (13.0%: 3/23) from IVF stand and pattern to the antibiotics used (Table 3). All the S. aureus stethoscopes and Pseudomonas spp. (8.7%: 2/23) from and S. epidermidis isolates were sensitive to erythro- only IVF stand. mycin and streptomycin (100%). Streptococcus spp. were Bacillus spp., the only Gram positive bacilli most sensitivity (100%) to ciprofloxacin, septrin, encountered in this study has been isolated with the erythromycin, streptomycin and ampiclox. All the isolated highest frequency in some studies in Nigeria: 84 E. coli were susceptible to gentamycin, cephalexin and (Nwankiti et al., 2012) and 90% (Ikeh and Isamade, chloramphenicol while all the isolated Pseudomonas spp. 2011). This organism forms endospores, which, probably were susceptible to gentamycin and ofloxacine. Similarly, from the air can settle on the surface of fomites in the all the Klebsiella spp. isolates were susceptible to hospital, explaining why they were isolated mainly from gentamycin, ceftriazone, chloramphenicol and ampicillin. tables and chairs. Susceptibility of all the organisms isolated to Although, Gram positive organisms were more Erythromycin and Streptomycin does not necessary imply frequently isolated in this study, the Gram negative that these antibiotics may represent therapeutic options bacterium Escherichia coli was the most prevalent. E. coli for infections caused by these organisms. S. aureus and were isolated from almost all the fomites except IVF S. epidermidis showed similar susceptibility pattern being

Maryam et al. 817

highly susceptible to Streptomycin and resistant to settling on them or by hand, to survive and be transmitted Augmentin. Augmentin may therefore not be a drug of to patient or HCWs. Although surface cleaners play a role choice for treatment of infections caused by these in reducing the spread of infections, not all disinfectants organisms. The Gram positive isolates were resistant to work equally well at killing all pathogens (Boskey, 2011). gentamycin and ofloxacin while the Gram negative iso- Some pathogens are more susceptible to specific lates were resistant to Cotrimozazole, indicating that detergents than others. Therefore, the need for regular these antibiotics might not be very effective in the treat- cleaning and effective disinfection of fomites identified to ment of HAIs that might results from infection with these be easily contaminated with specific pathogens is very pathogens. Similar weakness and susceptibility in activity crucial. The effective use of disinfectants constitutes an of antibiotics against bacteria from clinical specimens important factor in preventing HAIs and improved have been shown (Chikere et al., 2008). As more cleaning/disinfection of environmental surfaces and hand bacteria become resistant to antibiotics, the ability to hygiene have been shown to reduce the spread of control the spread of these bacteria with antibiotic treat- hospital acquired pathogens (Rutala and Weber, 2001; ments decreases. Nicolle, 2002; Christensen et al., 2007; Weber et al., The isolation of potential pathogens such as S. aureus 2010; Boskey, 2011). and Streptococcus spp. from IVF stands and uniforms of HCWs in the A&E ward confirms the possibility of cross infections from workers to patients. This implies that Conclusion and recommendation these fomites might act as vehicles for transfer of these pathogens hence etiologic agents for infectious The isolation of pathogenic bacteria from fomites in this pathogens. Many studies have shown uniforms to be study indicates that they can be vehicles for disease potential reservoirs for hospital organisms, potentially re- transmission. In the light of this, there is need therefore infecting the hands of HCWs (Boyce et al., 1997; Snyder for thorough disinfection and conscientious contact et al., 2008; Munoz-Price et al., 2012). Treakle et al. control procedures to minimize the spread of these (2009) showed a large proportion of HCWs' white coats pathogens in the A&E ward where interaction between to be contaminated with S. aureus, including MRSA and patients, HCWs and caregivers is very common and postulated that white coats may be an important vector frequent. It is also necessary to encourage the effective for patient-to-patient transmission of S. aureus. Potential use of disposable hand gloves between patients and to pathogens such as S. aureus, Acinetobacter spp. and avoid touching fomites with gloved hands, which may be enterococci have been recently isolated from hands that acting as sources of infection. were used to touch uniforms (Munoz-Price et al., 2012). Similarly, isolation of E. coli from door knobs simply implies that they can be easily transmitted to anybody Limitation of study that opened the door to the A&E ward. One can therefore Small sample size and inability to determine if the S. easily postulate how these fomites could become vectors aureus isolated were MRSA. for the spread of pathogenic organisms in the A&E ward as a HCW moves from one patient to another and these fomites contacts different patients. ACKNOWLEDGEMENTS In the A&E Ward of ABUTH, we observed that reusable cleaning cloths soaked in bucket of water containing R We acknowledge all the personnel at the Accident and Omo detergent are used irregularly to clean door knobs Emergency ward of ABUTH for their cooperation during and tables; while methylated spirit is used to clean the IV sample collection. stands once or twice a week. Floors are cleaned with R mops dipped in diluted Salvon every morning and even- ing while JikR is used only when there is contamination REFERENCES with blood. The cloths and mops used in cleaning are American Society for Microbiology (ASM) (2005). Women better at hand however not adequately cleaned and disinfected, as most hygiene habits, hands down. ASM Press Releases: 2005. Available often, the water containing the disinfectant is not changed from: http://www.asm.org/Media/index.asp. Cited 2013 July 9. until the cleaning is completed. It has been shown that if Barie PS (1998). Antibiotic-resistant Gram-positive cocci: implications water-disinfectant mixture used in cleaning is not for surgical practice. Wld. J. Surg. 22(2):118-126. Ben-Saida N, Ferjeni A, Benhadjtaher N, Monastiri K, Boukadida J changed regularly, the mopping procedure actually can (2006). Clonality of clinical methicillin resistant Staphylococcus spread heavy microbial contamination throughout the epidermidis isolates in a neonatal intensive care unit. Patholo. Biol. health-care facility (Mangicaro, 2012). 54:337-342. Irregular cleaning and effective disinfection of door Bhalla A, Pultz NJ, Gries DM, Ray AJ, Eckstein EC, Aron DC, Donskey CJ (2004). Acquisition of nosocomial pathogens on hands after knobs to the A&E ward, tables, chairs and IV stands in contact with environmental surfaces near hospitalized patients. Infect. the ward may allow pathogens that contaminate them by Control Hosp. Epidemiol. 25:164-167.

818 Afr. J. Microbiol. Res.

Boskey E (2011). What is Fomite Transmission. Updated April 06, 2011. Nicolle EL (2002). Nosocomial infections. Available from: Accessed 13th Nov 2013. Available from: http://www.sciencedirect.com/. Accessed 7 August 2012. http://std.about.com/od/glossary/g/What-Is-Fomite-Transmission.htm. Nwankiti OO, Ndako JA, Nwankiti AJ, Okeke OI, Uzoechina AR, Agada Boyce JM, Potter-Bynoe G, Chenevert C, King T (1997). Environmental GO (2012). Computer keyboard and mouse: etiologic agents for contamination due to methicillin-resistant Staphylococcus aureus: microbial infections. Nat. Sci. 10(10):162-166. possible infection control implications. Infect. Control Hosp. Rutala WA, Weber DJ (2001). Surface disinfection: should we do it? J. Epidemiol. 18:622-627. Hosp. Infect. 48 Suppl A:S64-68. Cheesbrough M (2006). District Laboratory Practice in Tropical Snyder GM, Thom KA, Furuno JP, Perencevich EN, Roghmann MC, Countries. Part 2. Cambridge University Press, United Kingdom. Strauss SM, Netzer G, Harris AD (2008). Detection of methicillin- Chikere, CB, Omoni VT, Chikere BO (2008). Distribution of potential resistant Staphylococcus aureus and vancomycin-resistant nosocomial pathogens in a hospital environment. Afri J. Biotech. enterococci on the gowns and gloves of healthcare workers. Infect. 7(20):3535 -3538. Control Hosp. Epidemiol. (7):583-9. Christensen TE, Jørgensen JS, Kolmos HJ (2007). The importance of Treakle AM, Thom KA, Furuno JP, Strauss SM, Harris AD, Perencevich hygiene for hospital infections. Ugeskr Laeger. 169(49):4249-4251. EN (2009). Bacterial contamination of health care workers' white Cramer L (2013). Fomites, fomite, fomite! Available from: coats. Am. J. Infect. Control 37(2):101-5. http://www.microbiology.com//p=961. Accessed 19 Nov 2013. Weber DJ, Rutala WA, Miller MB, Huslage K, Sickbert-Bennett E Desai R, Pannaraj PS, Agopian J, Sugar CA, Liu GY, Miller LG (2011). (2010). Role of hospital surfaces in the transmission of emerging Survival and transmission of community-associated methicillin- health care-associated pathogens: norovirus, Clostridium difficile, and resistant Staphylococcus aureus from fomites. Am. J. Infect. Contrl. Acinetobacter species. Am. J. Infect. Control 38(5 Suppl 1):S25-33. 39(3):219-225. Willey JM, Sherwood LM, Woolverton CJ. (2011). Epidemiology and Gould D, Chamberlain A (1994). Gram-negative bacteria: the challenge public health microbiology: Nosocomial infections. In: Willey JM, of preventing cross-infection in hospital wards: a review of the Sherwood LM and Woolverton CJ. edited Prescott’s Microbiology.8th literature. J. Clin. Nurs. 3(6):339-345. Edition, New York. The McGraw Hill Companies. International Graham P, Lin S, Larson EA (2006). US population based survey of Edition. pp. 873,884-886. Staphylococcus aureus colonization. Ann. Internal Med. 144:318-325. Williams C, Davis DL (2009). Methicillin-resistant Staphylococcus Greene A (2009). Fomites. Available from: aureus fomite survival. Clin. Lab. Sci. 22(1):34-38. http://www.drgreene.com/articles/fomites/. Reviewed by Le-Bucklin K-V, Hicks R January 12, 2009. Accessed 4 Nov 2013. Hartmann B, Benson M, Junger A, Quinzio L, Röhrig R, Fengler B, Färber UW, Wille B, Hempelmann G (2004). Computer keyboard and mouse as a reservoir of pathogens in an intensive care unit. J. Clin. Monitor Comput.18 (1):7-12. Ikeh EI, Isamade ES (2011). Bacterial flora of fomites in a Nigerian multi-disciplinary intensive care unit. Lab. Med. 42:411-413. Inweregbu K, Dave J, Pittard (2005). Nosocomial infections. Contin. Educ. Anaesth, Crit. Care Pain 5(1):4-17. Kelly MP (2002). Fomites role in disease transmission is still up for debate. Cited 2012 August 12. Available from: http://www/infectioncontroltoday.com. Kramer A, Scwebke I, Kampf G (2006). How long do nosocomial pathogens persist on inanimate surfaces? A systematic review. BMC Infect. Dis 6:130. Mangicaro S (2012). Fomites: a vector for infection transmission. Updated March 20, 2012; cited July 9 2013. Available from: http://www.gnyhaservices.com/801/File.aspx. McNeil SA, Foster CL, Hedderwick SA, Kauffman CA (2001). Effect of hand cleansing with antimicrobial soap or alcohol-based gel on microbial colonization of artificial fingernails worn by health care workers. Clin. Infect. Dis. 32(3):367-372. Merlin MA, Wong ML, Pryor PW, Rynn K, Marques-Baptista A, Perritt R, Stanescu CG, Fallon T (2009). Prevalence of methicillin-resistant Staphylococcus aureus on the stethoscopes of emergency medical services providers. Prehosp. Emerg. Care. 13(1):71-74. Munoz-Price LS, Arheart KL, Mills JP (2012). Associations between bacterial contamination of health care workers' hands and contamination of white coats and scrubs. Am. J. Infect. Contrl. 40(9):e245-8. doi: 10.1016/j.ajic.2012.03.032. Neely AN, Maley MP (2000). Survival of enterococci and staphylococci on hospital fabrics and plastic. J. Clin. Microbiol. 38(2):724-726.

Full Length Research paper

Prevalence of different enterococcal species isolated from blood and their susceptibility to antimicrobial drugs in Vojvodina, Serbia, 2011-2013

Mihajlović-Ukropina Mira*, Medić Deana, Jelesić Zora, Gusman Vera, Milosavljević Biljana and Radosavljević Biljana

Institute of Public Health of Vojvodina, Centre for Microbiology, University of Novi Sad, Faculty of Medicine, Serbia.

Accepted 20 January, 2014

Enterococci are one of the leading causes of nosocomial infections worldwide. Enterococcus faecalis and Enterococcus faecium are the most commonly isolated. The aim of this study was to determine prevalence of these species isolated from blood samples of hospitalized patients and their susceptibility to antibiotics particularly to vancomycin and high concentrations of aminoglycosides. A total of 89 enterococcal strains isolated from blood samples between January 1st 2011 and August 31st 2013 were tested. The species identification and susceptibility to antimicrobial drugs were performed using automated VITEK 2 system. The most common species was E. faecalis (55.05%), followed by E. faecium (41.57%). The enterococcal isolates were multidrug resistant with E. faecium resistance to vancomycin of 54.05%, while resistance in E. faecalis was not found. All vancomycin resistant enterococci had VanA phenotype of resistance. Thirty three (89.18%) isolates of E. faecium were high-level gentamycin resistant and 32 (91.4%) were resistant to high concentration of streptomycin, whereas frequency of resistant E. faecalis was 61.2 and 63.04%, respectively. This study shows that resistance in enterococcal species is a serious clinical problem in our hospital and suggests the need for regular susceptibility test and species level identification of enterococcal isolates.

Key words: Enterococci, blood culture, antimicrobial resistance.

INTRODUCTION

Enterococci are part of normal flora of gastrointestinal became one of faecium) are responsible for the majority tract of humans and animals, but they have also emerged of infections in the most frequent causes of intrahospital as significant cause of serious infection such as endo- infections particularly because of increasing resistance to carditis, urinary and blood stream infections, intra- a wide range of antibiotics (Schaberg et al., 1991; Low et abdominal end intra-pelvic abscesses (Moellering, 1992; al., 2001; Chou, 2008; Hidron et al., 2008; Bereket, 2012; Teixeira and Facklan, 2003). Among enterococci, Sievert et al., 2013). Enterococcus faecalis (E. faecalis) and Enterococcus Enterococci have both an intrinsic and acquired faecium (E. humans. Over the last two decades, they resistance (Murray, 1990, 2000; Leclercq, 1997). They

*Corresponding author. E-mail: [email protected]. Tel: +381638657743. Fax: +381216613989.

Abbreviations: E. faecalis, Enterococcus faecalis; E. faecium, Enterococcus faecium; ATCC, American Type Culture Collection; PBP, penicillin binding protein; HLAR, high-level aminoglycoside resistance; VRE, vancomycin resistant enterococci; SPSS, statistical package for the social sciences; ICU, intensive care unit. 820 Afr. J. Microbiol. Res.

are intrinsically resistant to penicillinase-susceptible faecalis American Type Culture Collection (ATCC) 29212 was used penicillins (low level), penicillinase-resistant penicillins, as control. cephalosporins, sulphonamides, clindamycin and low- level concentrations of aminoglycosides. Acquired Statistical analysis resistance to penicillins, chloramphenicol, tetracyclins, aminoglycosides (high-level) and vancomycin develops The statistical differences were analyzed using x2 test. The test was either by mutation or transfer of plasmids and trans- performed using SPSS (statistical package for the social sciences). posons. Resistance of many beta-lactams is as a result A p-value of < 0.05 was considered significant. of overproduction and modification of penicilin-binding- proteins (PBPs), particularly PBP5, with low affinity for antibiotics. RESULTS High-level aminoglycoside resistance (HLAR) can be mediated by single mutation within a protein of the 30S Among 89 enterococci isolated from blood samples, the ribosome subunit or by production of amino-glycoside- most common species was E. faecalis (55.05%), followed modifying enzymes. Acquired resistance to glycopeptides by E. faecium (41.57%). There was no significant occurs because of synthesis of modified cell wall difference between prevalence of these two species (p precursors with decreased affinity for these drugs. Nine value = 0.196). Prevalence of all enterococcal species phenotypes of glycopeptide resistance (VanA, B, C, D, E, isolated from blood is given in Table 1. Susceptibility of E. G, L, M, N) have been detected (Arthur, 1993; Perichon faecium and E. faecalis to antibiotics is shown in Table 2. et al., 1997; Fines et al., 1999; Xu et al., 2010; Lebreton Resistance of E. faecium isolates to all antibiotic tested, et al., 2011). The most common and clinically significant except to chloramphenicol, was higher as compared to E. are VanA, that determine high-level resistance to both faecalis strains. A high percentage of E. facium resistant vancomycin and teicoplanin, and VanB with variable to vancomycin (54.05%) was detected, while resistance resistance to vancomycin only. in E. faecalis was not found. All vancomycin resistant Resistance to wide range of antibiotics is a great enterococci (VRE) were resistant to teicoplanin also, problem to clinicians because it has seriously affected the belonging to VanA phenotype of resistance. Thirty three treatment of enterococcal infections leaving limited (89.18%) isolates of E. faecium were high-level therapeutic options. gentamycin resistant and 32 (91.4%) were high-level Keeping in mind that antimicrobial susceptibility of streptomycin, whereas the number of resistant E. faecalis enterococci is not predictable and that it differs by was 30 (61.2%) and 29 (63.04%), respectively. The enterococcal species and changes rapidly over time, difference in resistance to gentamycin and streptomycin species identification and its susceptibility to antimicrobial in these two species was statistically significant (p = drugs are important for clinicians for choosing the most 0.004 and p = 0.003, respectively). The most effective effective drug and also useful for epidemiological antibiotics were linezolid and tigecycline against all investigations. isolates tested. Unlike E. faecium, all isolates of E. The aim of this study was to determine prevalence of E. faecalis were susceptible to vancomycin and teicoplanin faecalis and E. faecium isolated from blood and their also. E. faecium isolates were susceptible to quino- susceptibility to antibiotics particularly, vancomycin and pristin/dalfopristin. Resistance to other antibiotics range high concentration of aminoglycosides. from 37.2% for chloramphenicol to 83.3% for ciprofloxacin in E. faecalis isolates. In E. faecium it was between 9.3% for chloramphenicol and 97.2% for MATERIALS AND METHODS ampicillin. All E. faecium 89.7% isolates of E. faecalis were resistant to three or more groups of antibiotics and This study was conducted at the Centre for Microbiology of Institute the most common multidrug resistant profile in E. faecium of Public Health, Vojvodina. A total of 89 enterococcal strains that were isolated from blood samples of hospitalized patients between was resistance to ampicillin, high-level concentrations of January 1st 2011 and August 31st 2013 were included in the study. aminoglycosides, vancomycin, and ciprofloxacin. All blood samples were routinely cultured in blood culture bottles Resistance to ampicillin, high-level concentrations of (Bio Merieux, France) using semi-automated blood culture system aminoglycosides, quinipristin/ dalfopristin and (Bact/Alert, Bio Merieux, Marcyl’ Etoile, France). The positive ciprofloxacin was the most commonly found pattern in samples were inoculated onto blood and MacConkey agar plate isolates of E. faecalis. The rates of VRE isolates from (HiMedia, India) that were incubated aerobically for 24 h at 37°C. Enteococcal genus identification was based on colony different wards are given in Table 3. morphology, Gram staining results, catalase reaction, growth on Enterococcal species and VRE were most commonly bile-esculin agar and tolerance to 6.5% NaCl. The species found in patients from intensive care unit (ICU), followed identification was done using automated VITEC 2 system by those from haematology/oncology ward. (BioMerieux). Susceptibility to ampicillin, gentamycin (high-level), There was no significant difference between proportion streptomycin (high-level), ciprofloxacin, vancomycin, teicoplanin, linezolid, tigecycline, chloramphenicol and quinopristin/ dalfopristin of enterococcal isolates and VRE found in different was determined using VITEK 2 system according to Clinical hospital wards (p value=0.068 and p value=0.894, Laboratory Standards Institute guideline (2010, 2011, 2012). E. respectively). Demographic characteristics of patients with Mira et al. 821

Table 1. Prevalence of enterococcal species isolated from blood.

Species No. (%) of isolates E. faecalis 49 (55.05%) E. faecium 37 (41.57%) E. gallinarum 2 (2.24%) E. caseiflavus 1 (1.12%) Total 89 (100%)

Table 2. Susceptibility of E. faecium and E. faecium to antibiotics.

E. faecium E. faecalis Antibiotic No. of isolates No. (%) of resistant No. of isolates No. (%) of resistant tested isolates tested isolates Ampicillin 37 36 (97.2) 49 28 (57.1) Gentamycin (hl) 37 33 (89.1) 49 30 (61.2) Streptomycin 35 32 (91.4) 46 29 (63.0) (hl) Ciprofloxacin 26 25 (96.1) 36 30 (83.3) Vancomycin 37 20 (54.05) 49 0 (0) Teicoplanin 37 19 (53.1) 49 0 (0) Linezolid 37 0 (0) 49 0 (0) Tigecycline 37 0 (0) 46 0 (0) Chloramphenicol 32 3 (9.37) 43 16 (37.2) Quinopristin/ dalfopristin 29 0 (0) 30 30 (100) hl- High-level.

Table 3. Distribution of E. faecium, E. faecalis and VRE within hospital ward.

Ward No. of E. faecium and E. faecalis No. (%) of VRE Intensive care unit (ICU) 32 8(25) Haematology/oncology 20 5(25) Internal 17 4(23) Other 17 3(17) Total 86 20

positive blood cultures and VRE are showed in Table 4. a wide range of antibiotics. Until 1990s, glycopeptides Proportion of E. faecalis and E. faecium isolates in were antibiotics of choice in treating serious infections males (62.7%) was higher than in females (32.2%), (p = caused by enterococci, but occurrence of strains resistant 0.018). Prevalence of VRE also was higher in males to these drugs significantly decreased their efficiency. (25.9%) than in females (18.8%), but the difference was VRE were first detected in France and United Kingdom in not statistically significant (p = 0.619). The number of 1986, a year later similar strains were isolated in enterococcal isolates found in patients above 60 years of hospitals in United States and since then VRE have been age was higher than in other age groups (p = 0.004). discovered throughout the world (Uttley, 1988; Murray, There was no significant difference in proportion of VRE 2000; Edmond et al., 1999; Treitman et al., 2005; Goossens, between different age groups (p = 0.737). 1998). The main reason for emergence of resistant isolates is widespread use of vancomycin. Broad spectrum antibiotics, such as third-generation cephalosporins and DISCUSSION fluoroquinolons, also contributed to the selection of resistant isolates (Sood et al., 2008; Heath et al., 1996). Enterococci are one of the leading causes of nosocomial In some European countries the outbreaks of VRE were infections worldwide because of increasing resistance to related to the extensive use of avoparcin, as growth 822 Afr. J. Microbiol. Res.

Table 4. Demographic characteristics of patients.

Variable No. (%) of E. fecium and E. faecalis No. (%) of VRE Sex Male 54 (62.7) 14 (25.9) Female 32 (37.2) 6 (18.8)

Age group 0-19 23 (26.7) 0 (0) 20-39 11 (12.7) 3 (27.3) 40-59 18 (20.9) 7 (38.9) ≥60 34 (39.5) 10 (29.4)

promoter in farm animals (McDonald et al., 1997; Bates, 2007), Czech Republic (Kolar et al., 2006), Poland 1997; Bager et al., 1997). Avoparcin causes bacterial cross- (Sadowy et al., 2013), Serbia (Mihajlovic-Ukropina et al., resistance to vancomycin and teicoplanin. 2011) and other European countries (Werner et al., Resistant enterococcal isolates are reported all over the 2008). world, but prevalence of enterococcal species and their Enterococcal infections develop usually in patients with resistance vary widely in different geographic regions. some risk factors, such as severe underlying disease, In this study, E. faecalis (55.04%) was the most common long hospital stay, particularly in ICU, immune-suppression enterococcal species isolated from blood samples, followed and haematological malignance. The largest number of by E. faecium (41.57%). E. faecalis was predominant isolate vancomycin resistant E. faecium in this study was found in studies from India (62.2% by Ajay et al. (2012), 76% by in samples of patients from ICU and haematology/oncology Sreeja et al. (2012) and 82% by Bose et al. (2012), UK ward that is in agreement with results of other authors (62% by Brown et al. (2008) and 63% by Fisher and (Kolar et al., 2006; Brown et al., 2008). Phillips (2009) and Turkey (76% by Shah et al. (2012). In addition to intrinsic resistance to low-level resistance Until the early to mid-1990s this species was the most to aminoglycosides, enterococci can acquire resistance frequent isolated enterococci in US hospitals (Treitman et to high concentrations of aminoglycosides. Very high al., 2005). Since then there has been an important increase percentages of HLAR in E. faecium (~90%) and E. in the incidence of E. faecium as a cause of nosocomial faecalis (~60%) were found in this study, similar to the infections (Hidron et al., 2008). results reported in India (Sood et al., 2008; Jain et al., Prevalence of vancomycin resistant E. faecium (50.05%) 2011), Iran (Talebi et al., 2007) and Turkey (Baldir et al., in this study was very high, much higher than that 2013). HLAR in E. faecalis was reported from all reported in most of the other countries. Some European European counties except Iceland. The majority of countries (Bulgaria, Cyprus, Estonia, Iceland, Malta, countries reported frequency of resistant isolates Slovenia and Sweden) reported an absence or very low between 25 and 50%. The highest percentages were prevalence (Denmark-1.3%, Norvey-1.8%, Netherland-1% detected in Italy (50%), Slovakia (49.5%), Hungary and France-1.4%) of vancomycin resistance (European (48.6%) and Poland (48.4%). (European Centre for Centre for Disease Prevention and Control, 2012). Disease Prevention and Control, 2012). Similar results were reported from India (Sreeja et al., Combinations of aminoglycosides with beta-lactam anti- 2012) and Turkey (Shah et al., 2012). Among European biotics or glycopeptides are the treatment of choice for countries, the highest rates of VRE were obtained from serious enterococcal infections, such as endocarditis, Ireland (34.9%), Greece (23.1%) and Portugal (20.2%). due to their synergistic activity. Occurrence of resistance In other parts of the world the highest frequency of to these antibiotics and loss of their synergistic vancomycin resistant E. faecium was found in US (60% bactericidal activity significantly limited therapeutic by Bearman et al (2005), 67% by Forrest (2008), 80% by options. Arias et al. (2010). Newer antibiotics, such as linezolid, tygecyclin, Resistance to vancomycin is still very rare in E. faecalis daptomycin and quinopristin/dalfopristin have been isolates. In this study all E. faecalis were susceptible to suggested as an alternative option for treating infections vancomycin. Bose et al. (2012), Sunilkumar and Karthika caused by multidrug resistant enterococci (Aksoy and (2012) and Bearman and Wenzel (2005) also reported Unal, 2008; Yemisen et al., 2009, Arias et al., 2010; Tsai low prevalence of resistant isolates (0, 1 and 2%, et al., 2012). The results obtained in this study confirmed respectively). All E. faecium in this study had VanA good activity of linezolid and tygecyclin against both phenotype of resistance. This type is widely distributed enterococcal species tested and quinopristin/dalfopristin and predominant type of resistance in Iran (Talebi et al., against E. faecium only. Unfortunately, their clinical use Mira et al. 823

may be limited by emergence of resistance that is a new type of acquired glycopeptides resistance in Enterococcus reported in several studies (Werner et al., 2008; Berdal faecalis. BM4405. Antimicrob. Agents Chemother. 42(9):2161-2164. Fisher K, Phillips C (2009). The ecology, epidemiology and virulence of and Eskesen, 2008; Bonora et al., 2006; Kainer et al., Enterococcus. Microbiology 155(6):1749-1757. 2007). Forrest (2008). Enterococcal Bacteremia. Antimicrob. Agents. In conclusion, this study shows a very high prevalence Chemother. 52(10):3558-2563. of multi drug resistant enterococci isolated from blood Goossens H (1998). Spread of vancomycin-resistant enterococci: Differences between the United States and Europe. Infect. Control. samples. These results suggest that regular susceptibility Hosp. Epidemiol. 19(8):546-551. test and species level identification of enterococcal Heath CH, Blackmore TK, Gordon DL (1996). Emerging resistance in isolates are important in order to treat enterococcal Enterococcus spp. Med. J. Aust. 164(2):116-120. infections effectively and implement appropriate infection Hidron AL, Edwards JR, Patel J, Horan TC, Sievert DM, Pollock DA, Fridkin SK (2008). NHSN annual update: antimicrobial-resistant control measures to limit the spread in nosocomial pathogens associated with healthcare-associated infections: annual settings. summary of data reported to the National Healthcare Safety Network at the Centre for Disease Control and Prevention, 2006-2007. Infect. Control Hosp. Epidemiol. 20(11):996-1011. REFERENCES Jain S, Kumar A, Kashyap B, Kaur JR (2011). Clinico-epidemiological profile and high-level aminoglycoside resistance in enterococcal Ajay KO, Rajeshwari H, Nagaveni S, Kelmani CR (2012). Antimicrobial septicemia fro tertiary care hospital in Delhi. Int. J. App. Basic. Med. susceptibility pattern of Enterococcus species isolated from clinical Res.1:80-83. samples in South India. JRAAS. 27:5-10. Kainer MA, Devasia RA, Jones TF, Simmons BP, Melton K, Chow S, Aksoy DY, Unal S (2008). New antimicrobial agents for the treatment of Broyler J, Moore KL, Craig AS, Schaffners W (2007). Response to Gram-positive bacterial infections. Clin. Microbial. Infect. 14:411-420. emerging infection leading to outbreak of linezolid-resistant Arias CA, Conreras GA, Murray BE (2010). Management of multidrug- enterococci. Emerg. Infect. Dis. J. 13(7):1024-1030. resistant enterococcal infections. Clin. Microbiol. Infect. 16(6):555- Kolar M, Pantucek R, Vagnerova I, Sauer P, Kesselova M, Cekanova L, 562. Koukalova D, Doskar J, Ruzickova V (2006). Prevalence of Arthur M, Courvalin P (1993). Genetics and mechanisms of vancomycin-resistant enterococci in hospitalized patients and those glycopeptides resistance in enteroocci. Antimicrob. Agents living in the community in the Czeech Republic, New Microbiologica Chemother. 37:1563-1571. 29:121-125. Bager F, Madsen M, Christensen J, Aarestrup FM (1997). Avoparcin Lebreton F, Depardieu F, Bourdon N, Fines-Guyon M, Berger P, used as a growth promoter is associated with the occurrence of Camiade S (2011). VanN-type transferable vancomycin resistance in vancomycin-resistant Enterococcus faecium in Danish poultry and pig Enterococcus faecium. Antimicrob. Agents Chemother. 55:4606- farms. Prev. Vet. Med. 31:95-112. 4612. Baldir G, Engin DO, Kucukercan M, Inan A, Akcay S, Ozyuker S, Leclercq R (1997). Enterococci acquire new kinds of resistance. Clin. Asaray S (2013). High-level resistance to aminoglycoside, Infect. Dis. 24(1):s80-84. vancomycin and linezolid in enterococci strains. J. Microbiol. Infect. Low DE, Keller N, Barth A, Jones RN (2001). Clinical prevalence, Dis. 3(3):100-103. antimicrobial susceptibility,and geographic resistance patterns of Bates J (1997). Epidemiology of vancomycin-resistant enteroccoci in enterococci: Results from the SENTRY Antimicrobial Surveillence the community and the relevance of farm animals to human jnfection. program, 1997-1999. Clin. Infect. Dis. 32:S133-145. J. Hosp. Infect. 37:89-101. McDonald LC, Kuehnert MJ, Tenover FC, Jarvis WR (1977). Bearman GML, Wenzel RP (2005). Bacteriemias: a leading cause of Vancomycin- resistant enteroccoci outside the health-care death. Arch. Med. Res. 36(6):646-659. setting:prevalence,source and public health Berdal JE, Eskesen A (2008). Short-term success, but long-term implications.Emerg.Infect.Dis.3:311-317. treatment failure with linezolid for enterococcal endocarditis. Scand. Mihajlovic-Ukropina M, Medic D, Jelesic Z, Gusman V, Milosavljevic B J. Infect. Dis. 40:765-766. (2011). Frequency of vancomycin-resistant enterococci isolated from Bereket W, Hemalatha K, Getener B, Wondwossen T, Solomon A, blood cultures from 2008 to 2010, Med. Preg. 64(9-10):481-485, Zeynudin A, Kannan S (2012). Update on bacterial nosocomial Moellering RC Jr. (1992). Emergence of Enterococcus as a significant infections. Eur. Rev. Med. Pharmacol. Sci. 16(8):1039-1044. pathogen. Clin. Infect. Dis. 14(6):1173-1176. Bonora MG, Solbiati M, Stepan E, Zorzi A, Luzzani A, Catania MR, Murray BE (1990). The life and times of enterococcus. Clin. Microbiol. Fontana R (2006). Emergence of linezolid resistance in the Rev. 3:45-65. vancomycin-resistant Enterococcus faecium multilocus sequence Murray BE (2000). Vancomycin-resistant enterococcal infections. N. typing C1 epidemic lineage. J. Clin. Microbiol. 44(3):1153-1155. Engl. J. Med. 10:710-721. Bose S, Ghosh AK, Barapatre R (2012). Prevalence of drug resistance Perichon B, Reynolds P, Courvalin (1997). VanD-type glycopeptides among Enterococcus spp from a tertiary care hospital. Int. J. Med. resistant Enterococcus faecium BM4339. Antimicrob. Agents Health. Sci. 1(3):38-44. Chemother 41(9):2016-2018. Brown DFJ, Hope R, Livermore DM, Brick G, Broughton K, George RC, Sadowy E, Sienko A, Gawryszewska J, Bojarska A, Malinowska K, Reynolds R (2008). Non-susceptibility trends among enterococcci Hryniewicz W (2013). High abundance and diversity of antimicrobial and non-pneumococcal streptococci from bacteraemias in UK and resistance determinants among early vancomycin-resistant Ireland, 2001-06. J. Antimicrob. Chemother. 62(2):ii75-ii85. Enterococcus faecalis in Poland.Eur.J. Clin. Microbiol. Infect. Dis. Chou Y, Lin T, Lin J, Wang N, Peng M, Chang F (2008). Vancomycin- 32(9):1193-1203. resistant enterococcal bacteremia: comparison of clinical features Schaberg DR, Culver DH, Gaynes RP (1991). Major trends in the and outcome between Enterococcus faecium and Enterococcus microbial etiology of nosocomial infection. Am. J. Med. 91(3B):72S- faecalis. J. Immunol. Infect. 41(2):124-129. 75S. Edmond MB, Wallace SE, McClish DK, Pfaller MA, Jones RN, Wenzel Shah L, Mulla S, Patel KG, Rewadiwala S (2012). Prevalence of RP (1999). Nosocomial bloodstream infections in United States enterococci with higher resistance level in a tertiary care hospital: a hospitals: A three-year analysis. Clin. Infect. Dis. 29(2):239-244. matter of concern. Natl. J. Med. Res. 291:25-27. European Centre for Disease Prevention and Control (2012). Sievert DM, Ricks P, Edwards JR, Schneider A, Patel J, Srinivasen A, Antimicrobial resistance surveillance in Europe 2011. Annual Report Kallen A, Limbago B, Fridkun S (2013). Antimicrobial-resistant of the European Antimicrobial Resistance Network (EARS-Net). pathogens associated with healthcare-associated infections: Stockholm; ECDC:59-63. Summary of data reported to the National Healthcare Safety Network Fines M, Perichon B, Reynolds P, Sahm DF, Courvalin P (1999). Van E, at the Centres for Disease Control and Prevention, 2009-2010, Infect. 824 Afr. J. Microbiol. Res.

Control Hosp. Epidemiol. 34(1):1-14. Uttley AH, Collins CH, Naidoo J, George R (1988). Vancomycin Sood S, Malhotra M, Das BK, Kapil A (2008). Enterococcal infection resistant enteroccoci. Lancet.1:57-58. and antimicrobial resistance. Indian J. Med. Res.128:111-121. Werner G, Coque TM, Hammerum AM, Hope R, Hryniewicz W, Sreeja S, Babu PRS, Prathab AG (2012). The prevalence and the Johnson A, Klare I, Kristinsson KG (2008). Emergence and spread of characterization of the enterococcus species from various clinical vancomycin resistance among enterococci in Europe. samples in the tertiary care hospital. J. Clin. Diagn. Res. 6(9):1486- Eurosurvailance,13:8-18. 1488. Werner G, Gfrorer S, Fleige C, Witte W, Klare I (2008). Tigecyclin- Sunilkumar J, Karthika J (2012). Prevalence of Enteroccocus species resistant Enreococcus faecium strain isolated from a German from various clinical specimens in Shri Sathya Sai Medical College intensive care unit patient. J. Antimicrob. Chemother. 61(5):1182- and Research Institute with special reference to speciation and their 1183. resistance to vancomycin.Int. J. Med. Clin. Res. 3:154-160. Xu X, Lin D, Yan G, Ye X, Wu S, Guo Y, Zhu D, Hu F Zhang Y, Wang M Talebi M, Eshraghi SS, Pourshafle MR, Pourmand MR, Eshraghian MR (2010). VanM, a new glyopeptide resistance gene cluster found in (2007). Characterization of vancomycin resistant Enterococcus Enterococcus faecium. Antimicrob. Agents Chemother. 54:4643- faecium. Iranian. J. Publ. Health 36(4):20-25. 4647. Teixeira LM, Facklan RR (2003). Enterococcus In: Murray PR, Baron Yemisen M, Demirel A, Mete B, Kaygusuz A, Mert A, Tabak F, Ozturk R EJ, Jorgensen JH,Pealler MA, Yolken RH (2003). Mannual of clinical (2009). Comparative in vitro antimicrobial activity of tigecyclin against microbiology.8th ed. Washington. AMS Press č423-433. clinical isolates of vancomycin-resistant enterooccus. Indian. J. Med. Treitman AN, Yarnold PR, Warren J, Noskin G (2005). Emerging Microbiol. 27:373-374. incidence of Enterococcus faecium among hospital isolates 1993- 2002. J. Clin. Microbiol. 43:462-463. Tsai HY, Liao CH, Chen YH, Lu PL, Huang CH, Lu CT, Chuang YC, Tsao SM, Chen YS, Lui YC, Chen WY, Jang TN, Lin HC, Chen CM, Shi ZY, Pan SC, Yang JL, Kung CE, Liu CE, Cheng YJ, Liu JW, Sun W, Wang LS, Ko WC, Yu KW, Chiang PC, Lee MH, Lee CM, Hsu GJ, Hsueh PR (2012). Trends in susceptibility of vancomycin-resistant Enterococcus faecium to tigecyclin, daptomycin and linezolid and molecular epidemiology of the isolates: results from the tigecyclin in vitro surveillance in Taiwan study, 2006 to 2010. Antimicrob. Agents Chemother. 56(6):3402-3405.

Full Length Research paper

Prevalence of anti-Anaplasma phagocytophilum antibodies among dogs from Monterrey, Mexico

J. A. Salinas-Meléndez, R. Villavicencio-Pedraza, B. V. Tamez-Hernández, J. J. Hernández- Escareño, R. Avalos-Ramírez, J. J. Zarate-Ramos, F. J. Picón-Rubio and V. M. Riojas-Valdés*

Universidad Autónoma de Nuevo León, UANL. Facultad de Medicina Veterinaria y Zootecnia. Av. Universidad S/N, Ciudad Universitaria, San Nicolás de los Garza, Nuevo León, CP 66451, México.

Accepted 23 January, 2014

Infection with Anaplasma phagocytophilum is of importance in dogs. It is called canine anaplasmosmosis and causes persistent clinical signs for long periods of time. Its main vector is a tick of the genus Ixodes. Diagnosis of anaplasmosis can be achieved either by serological or molecular methods. Presence of the disease has been reported in the U.S.A., Europe and Asia, but little is known about its prevalence in Mexico. In the present study, the enzyme-linked immunosorbent assay (ELISA) diagnostic method was used to determine the prevalence of antibodies against A. phagocytophilum at the city of Monterrey, Mexico. A total of 391 dogs were tested using a commercial kit. A 3% prevalence was found that included dogs of the breeds Doberman, French Puddle and Maltese, as well as mixed breed.

Key words: Anaplasma phagocytophilum, dogs, Mexico.

INTRODUCTION

Anaplasma phagocytophilum produces infection in some as in Europe (Petrovec et al., 1997; Arnež et al., 2001; animal species including man. It has been informed that Walder et al., 2003). this disease can cause fever, anorexia, pain, neutropenia, Studies in dogs have shown seroprevalence ranging from thrombocytopenia, as well as the formation of cytoplasmatic 17 to 50% at European countries (Barutzki et al., 2006; inclusion bodies in granulocytic neutrophiles (Rikihisa, Liebisch et al., 2006; Jensen et al., 2007; Krupka et al., 1991; Greig et al., 1996; Engvall et al., 1997; Engvall and 2007; Schaarschmidt-Kiener and Miller, 2007). The clinical Engvall, 2002). The genus Anaplasma was previously disease in dogs is often associated to the acute infection. known as the Ehrlichia phagocytophila group (Dumler et Development of clinical signs during the acute phase can al., 2001). vary, lasting from one to several days (Engvall et al. Infection with A. phagocytophilum was first reported in 1998). Persistent infection, either clinical or subclinical, in canines at Minnesota and Wisconsin states in 1996 (Greig dogs experimentally inoculated with A. phagocytophilum et al., 1996). It is a zoonotic disease transmitted by vectors has been documented for time lapses of more than six and apparently its presence in dogs is related to its presence months (Engvall et al., 2000; Alleman et al., 2006). in humans (Bakken et al., 1994). Confirmed clinical cases This pathogen has been reported in 8 years old dogs or by A. phagocytophilum in humans have been informed in older, and is more common in certain breeds (Greig et the U.S.A. (Chen et al., 1994; Demma et al., 2005), as well al,. 1996; Engvall et al., 1997; Beall et al., 2008).

*Corresponding author. E-mail: [email protected]. Tel.: 83294000, Ext. 3610.

826 Afr. J. Microbiol. Res.

Clinical signs more often found in dogs infected with A. for A. phagocytophilum detection and identification from phagocytophilum are articular pain and lameness blood and skin samples, as well as from ticks. 16 SrRNA resulting from poli-artritis; other less often observed signs gen has been used as reference for studies on the can be gastrointestinal such as vomit and diarrhea, and phylogenetic classification of the bacteria (Blanco and some respiratory clinical signs like coughing and disnea. Oteo, 2002). In some cases the central nervous system can be affected causing meningitis, leading to neurologic manifestations like ataxia and convulsions. Infection with A. MATERIALS AND METHODS phagocytophilum is often unapparent, but after eight to 15 days incubation period it can cause fever, generalized Blood samples were obtained from 391 dogs of different breeds in the city of Monterrey, using as inclusion factor only dogs with fixed adenopathy, leucopenia, moderate anemia, moderate address, age over 6 months. It was decided to sample only one dog hypogammaglobulinemia, hypoalbuminemia, per house in case of having more than one dog. The examination of hypocalcaemia and specially thrombocytopenia (Engvall the dogs started with physical evaluation followed by blood et al. 1998; Engvall et al., 2000; Alleman et al., 2006). sampling. All dogs showed no clinical signs of any disease. The main vector for A. phagocytophilum in Europe is This study was carried out in the city of Monterrey, Nuevo Leon, located in the northeast of Mexico, with a territorial extension of Ixodes ricinus (Parola and Raoult, 2001, Strle, 2004). In 2 451.30 km . Location coordinates are 25°40´17´´ N, 100° 18´31´´ the U.S.A. it is associated to Ixodes scapularis and W. Altitude is 530 m above sea level. The climate of the region has Ixodes pacificus (Barlough et al., 1997a; Chang et al., an average of 21°C, but because of annual thermal oscillation of 1998). Other authors indicate that the main vector is I. 18°C, with important contrast among seasons. In summertime scapularis in the east coast and I. pacificus in the west temperatures above 30°C are common with an average in July and coast (Parola et al., 2005). There are also reports about august of 34°C. In winter, cold air arrive constantly to the region, often accompanied of humidity from the coast, making the its detection in Ixodes spinipalis and Ixodes dentatus in temperature descend drastically, and every year at least 2 to 3 days the U.S.A. (Zeidner et al., 2000; Goethert and Telfort, are recorded with 0°C or less. The average annual precipitation is 2003). of 600 m spread mainly in summer, with September as the rainiest Studies in the Asian countries mention the presence of month. The city was divided in quadrants in accordance with its A. phagocytophilum in Ixodes perseculatus and Ixodes cartographic plan. ovatus (Cao et al., 2000; Ohashi et al., 2005). In North- From this map, the 15 most urbanized quadrants were chosen, since the others belonged to not well developed neighborhoods and America it has been observed that certain rodents in little human population. Sampling was performed according the dog particular and White-tail deer can act as natural hosts of population density and owner cooperation, sampling only one dog A. phagocytophilum (Bunnell et al., 1998; Belongia et al., per city block and only one dog in each house. To determine the 1997). Other wild animals detected as positive for the sample size, calculations were made in basis of the population’s disease include foxes, wild hogs (Petrovec et al., 2003), representative sample (infinite), with precision level of 5%, con- fidence level of 95% and a power of statistical test of 80% in order bison, donkey, moose, hare and lynx (Grzeszczuk et al., to ensure reliability of the results and that they could be translated 2004, de la Fuente et al., 2005, Jenkins et al., 2001). to the population under study using a 16% prevalence, according to Canine anaplasmosis is often diagnosed directly by previous studies in the country. Sample size was determined using microscopic identification of A. phagocytophilum morulae Epidat 3.1. Blood was extracted from the jugular vein with in circulating neutrophyles an in some cases in synovial Vacutainer vacuum tubes and sterile needles, drawing close to 5 m fluid. These findings can be seen at the acute phase of from each animal. No anesthetic or tranquilizer was used. The samples were carried in a container with refrigerant material to the the disease. laboratory and kept al 4o C until they were centrifugated at 3000 Using serological tests as a diagnostic tool, the early rpm for 5 min to separate the serum, after which were processed to phases of the disease and the dogs at terminal phase determine the presence of antibodies against Anaplasma can show negative results; in the former because there phagocytophilum. For the in vitro detection of the mentioned has not been enough time for the immune response and antibodies in the samples, the commercial kit “canine SNAP*4Dx” in the latter because it is exhausted (Weisiger et al., (IDEXX labs, Inc. USA) was used, according to the manufacture’s instructions. Before starting the procedure samples must be at room 1975; Waner et al., 2001; Cohn, 2003). In the blood temperature. The sera, either fresh or refrigerated, were utilized serum antibodies can be detected around 7-28 days after after no more than a week from the sampling. Sensibility and infection (Ristic et al., 1972; Buhles et al., 1974); at 20 specificity of the kit for the disease are reported with a minimum of days almost all dogs are seropositive, reaching maximum 98.8 and 100%, respectively. values of antibodies titers at 80 days (Buhles et al., 1974; Maeda et al., 1987). Antibody detection is the most RESULTS utilized way to identify the disease, including immuno- fluoresence and ELISA techniques. However, some For the present work, 391 blood samples were taken reports exist about false-positive results due to cross- from dogs located in the city of Monterrey, Mexico; reactions with Ricketsias such as Ehrlichia chafensis antibodies against Anaplasma phagocytophilum were (Blanco and Oteo, 2002). found in 12 samples, resulting in 3% prevalence. Polymerase chain reaction is a fast and sensitive tool Regarding to sex, dogs’ samples comprised 173 males

Salinas-Meléndez et al. 827

Table 1. Seropositive dogs to Anaplasma phagocytophilum.

Breed Sex Place of stay Kind of floor Parasite treatment Vaccination Presence of ticks 2 grass Doberman 3 Females Outside Yes Yes No 1 soil French Poodle 2 Males Both Cement No Yes No Maltese 2 Females Outside Cement Yes Yes No

3 Males 5 outside 4 cement 5 Yes 5 Yes 3 Yes Mixed-breed 2 Females 1 inside 1 mixed* 1 No 1 No 3 No

*Mixed: cement and soil.

and 218 females of which five males and seven females 2007; Schaarschmidt-Kiener and Miller, 2007), which were positive, giving a prevalence of 3.4% and 3.2% represents a higher value than the one informed in the respectively (Table 1). present work. Positive dogs varied in age from 21 to 132 months old. The clinical disease has often been reported in 8 year Only 3 positive dogs presented ticks (2 females and 1 old and older dogs and with some breeds such as male); however, the questionnaire applied to the dog’s Labrador and Golden Retriever among the most affected; owners revealed that 11 dogs of the 13 that resulted these findings are in agreement with the results pre- positive had ticks within a period of two months before sented in this study, since positive dogs having 11 years the sampling. Additionally, only three owners mentioned of age were found (Greig et al., 1996; Engvall et al., the use of anti-tick baths and treatment against internal 1997; Beall et al., 2008). parasites in a constant way every 3 months. Only one Recent studies report higher frequencies of A. among the 13 positive dogs had record of anti-rabies phagocytophilum in dogs, from 14% in Poland vaccination (Table 1). (Ryamasewka et al., 2011) to 46.9% in Germany (Kohn Regarding the place of stay, 12 of the positive dogs et al., 2010). However, in other countries the results are were kept outside of the owner home and only one lived closer that the ones reported in the present work, since in the house all the time. Among the positive dogs, 8 lived absence of the bacteria was informed at Canada (Bryan on cement floor, 2 on grass, 2 in both and one on soil. et al., 2011) and Korea (Lim et al., 2010). With regard to breed, 6 were mixed-breed, 3 dogs were Little work on this disease has been realized in Mexico Doberman, 2 French Poodle and 2 Maltese (Table 1). because of its relatively new presence; therefore, information in our geographical area is scarce. This is not the case of European countries, where many cases have been DISCUSION documented and much more knowledge exists about this disease of dogs. Anaplasmosis is a disease that must be considered for On the other hand, other members of the same Rickettsia differential diagnosis in dogs because due to its diverse family such as Ehrlichia canis, which causes monocytic clinical manifestations, it can be confused with other canine ehrlichiosis, have been documented in the common diseases of dogs. Currently there are not data on metropolitan area of Monterrey by serological methods the prevalence of this disease in the area studied, as well like ELISA; this study reported a general seropositivity of as in many states of the country. In the present study, a 44%, which is much higher than the one informed here prevalence of 3% was found, whereas a work done at for A. phagocytophilum. The results were also in

Switzerland reported 7.5% prevalence (Pusterla et al., disagreement according to age, since E. canis was found 1998). more often in four year old dogs, whereas for A. The disease has been reported in the following domesti- phagocytophilum was e years old. One possible reason cated species: horse (Bjöersdorff et al., 2002; Engvall et for these discordances could be that in the present work al., 1996, Engvall and Engvall, 2002), dog (Engvall et al., only dogs living in the urban area were sampled, whereas 1996; Engvall and Engvall, 2002; Skotarczak, 2003; it can be assume that a bigger number of ticks will be Lester et al., 2005, Poitout et al., 2005), cat (Bjöersdorff present in the country side, outside the city. et al., 1999), cattle (Engvall et al., 1996), sheep (Steere et al., 1998) and lama (Barlough et al., 1997b). At some European countries, prevalence in dogs varying Conclusion from 17 to 50% have been found (Barutzki et al., 2006; Liebisch et al., 2006; Jensen et al., 2007; Krupka et al., The results observed in the present study allows the

828 Afr. J. Microbiol. Res.

conclusion that A. phagocytophilum is being transmitted (2000). Granulocytic Ehrlichiae in Ixodes persulcatus Ticks from an amongst the canine population at Monterrey county Area in China Where Lyme Disease is Endemic. J. Clin. Microbiol. 38:4208-4210. through ticks, although at a frequency lower than the one Chang YF, Novosel V, Chang CF, Kim JB (1998). Detection of human informed for other countries or other infectious agents of granulocytic ehrlichiosis agent and Borrelia burgdorferi in ticks by the same family. New studies will be necessary to polymerase chain reaction. J. Vet. Diagn. Invest. 10:56-59. confirm the presence of the bacteria in the ticks, as well Chen SM, Dumler JS, Bakken JS, Walker DH (1994). Identification of a granulocytotropic Ehrlichia species as the etiologic agent of humen as to determine its presence in humans. disease. J. Clin. Microbiol. 33:589-595. Cohn LA (2003). Ehrlichiosis and related infections. Vet. Clin. North. Am. Small Anim. Pract. 33:863-884 ACKNOWLEDGEMENT De La Fuente J, Torina A, Caracappa S, Tumino G (2005). Serologic and molecular characterization of Anaplasma species infection in farm animals and ticks from Sicily. Vet. Parasitol. 5:357-362. We will like to thank MHICO de Mexico, S.A. de C.V., Demma L J, Holman R C, McQuiston J H, Krebs J W, Swerdlow D L Monterrey, Nuevo Leon, for support with laboratory (2005). Epidemiology of human Ehrlichiosis and anaplasmosis in the supplies United States, 2001- 2002. Am. J. Trop. Med. Hyg. 73:400-409. Dumler J S, Barbet AF, Bekker CPJ, Dasch GA, Palmer GH, Ray SC, Rikihisa Y, Rurangirwa FR (2001). Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order REFERENCES Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, Alleman AR, Chandrashekar R, Beall M (2006). Experimental descriptions of six new species combinations and designation of inoculation of dogs with a human isolate (Ny18) of Anaplasma Ehrlichia equi and 'HGE agent' as subjective synonyms of Ehrlichia phagocytophilum and demonstration of persistent infection following phagocytophila. Int. J. Syst. Evol. Microbiol. 51:2145-2165. doxycycline therapy. J. Vet. Int. Med. 20:763. Engvall A, Bjöersdorff A, Lilliehöök I (1998). Early manifestations of Arnež M, Petrovec M, Lotric-Furlan S, Avsic Zupanc T, Strle F (2001). granulocytic ehrlichiosis in dogs inoculated experimentally with a First European Pediatric Case of Human Granulocytic Ehrlichiosis. J. Swedish Ehrlichia species isolate. Vet. Rec. 143:412-417. Clin. Microbiol. 39:4591-4592. Engvall A, Lilliehöök I, Bjöersdorff A (2000). Detection of granulocytic Bakken JS, Dumler JS, Chen SM (1994). Human granulocytic Ehrlichia species DNA by PCR in persistently infected dogs. Vet. ehrlichiosis in the upper Midwest United States. A new species Rec. 146:186-190. emerging? J.A.M.A. 272:212-218. Engvall AE, Hedhammar AA, Bjöersdorff AI (1997). Clinical features Barlough JE, Madigan JE, Kramer VL, Clover JR (1997a). Ehrlichia and serology of 14 dogs affected by granulocytic ehrlichiosis in phagocytophila genogroup rickettsiae in Ixodid ticks from California Sweden. Vet. Rec. 140:222-226. collected in 1995 and 1996. J. Clin. Microbiol. 35:2018-2021. Engvall EO, Engvall A (2002). Granulocytic ehrlichiosis in Swedish dogs Barlough JE, Madigan JE, Turoff DR, Clover JR (1997b). An Ehrlichia and horses. Int. J. Med. Microbiol. 291:100-103. strain from a llama (Lama glama) and Llama-associated ticks (Ixodes Engvall EO, Pettersson B, Persson M, Artursson K, Johansson KE pacificus). J. Clin. Microbiol. 35:1005-1007. (1996). A 16S rRNA-based PCR assay for detection and identification Barutzki D, De Nicola A, Zeziola M, Reule M (2006). Seroprävalenz der of granulocytic Ehrlichia species in dogs, horses, and cattle. J. Clin. Anaplasma phagocytophilum-Infektion bei Hunden in Deutschland. Microbiol. 34(9):2170-2174. Berl. Münch. Tierärztl. Wochenschr. 119:342-347. Goethert HK and Telford SR (2003). Enzootic transmission of the agent Beall MJ, Chandrashekar R, Eberts MD, Cyr KE, Diniz PP, Mainville C, of human granulocytic ehrlichiosis among cottontail rabbits. Am. J. Hegarty BC, Crawford JM, Breitschwerdt EB (2008). Serological and Trop. Med. Hyg. 68:633-637. molecular prevalence of Borrelia burgdorferi, Anaplasma Greig B, Asanovich KM, Armstrong PJ, Dumler JS (1996). Geographic, phagocytophilum, and Ehrlichia species in dogs from Minnesota. clinical, serologic, and molecular evidence of granulocytic Vector Borne Zoonotic. Dis. 8(4):455-464. ehrlichiosis, a likely zoonotic disease, in Minnesota and Wisconsin Belongia EA, Reed KD, Mitchell PD, Kolbert CP (1997). Prevalence of dogs. J. Clin. Microbiol. 34:44-48. granulocytic Ehrlichia infection among white-tailed deer in Wisconsin. Grzeszczuk A, Ziarko S, Prokopowicz D, Radziwon PM (2004). J Clin Microbiol. 35:1465-1468. Evidence of Anaplasma phagocytophilum infection in European Bjöersdorff A, Bagert B, Massung RF (2002). Isolation and Bisons in the Bialowieza Primeral Forest, Poland. Med. Weter characterization of two European strains of Ehrlichia phagocytophila 60:600-601. of equine origin. Clin. Diagn. Lab. Immunol. 9:341-343. Jenkins A, Handeland K, Stuen S, Schouls L (2001). Ehrlichiosis in a Bjöersdorff A, Svendenius L, Owens JH, Massung RF (1999). Feline moose calf in Norway. J. Wildl. Dis. 37:201-203. granulocytic ehrlichiosis- a report of a new clinical entity and Jensen J, Simon D, Escobar H, Soller J T, Bullerdieck J, Beelitz P, characterization of the infectious agent. J. Small. Anim. Pract. 40:20- Pfister K, Nolte I (2007). Anaplasma phagocytophilum in dogs in 24. Germany. Zoonoses Public Health 54:94-101. Blanco JR, Oteo JA (2002). Human granulocytic ehrlichiosis in Europe. Kohn B, Silaghi C, Galke D, Arndt G, Pfister I (2010). Infection with A. Clin. Microbiol. Infect. 8:763-772. phagocytophilum in dogs in Germany. Res. Vet. Sci. 91:71-76. Bryan HM, Darimont CT, Paquet PC, Ellis JA, Goji N, Gouix M, Smiths Krupka I, Pantchev N, Lorentzen L, Weise M, Straubinger RK (2007). JC (2011). Exposure to infectious agents in dogs in remote coastal Durch Zecken übertragene bakterielle Infektionen bei Hunden: British Columbia: Possible sentinels of disease in wildlife and Seroprävalenzen von Anaplasma phagocytophilum, Borrelia humans. Can. J. Vet. Res. 75:11-17. burgdorferi sensu lato und Ehrlichia canis in Deutschland. Der Buhles WC Jr., Huxsoll DL, Ristic M (1974). Tropical canine praktische Tierarzt. 88:776-788. pancytopenia: clinical, hematologic, and serologic responses of dogs Lester SJ, Breitschwerdt EB, Collis CD, Hegarty BC (2005). Anaplasma to Ehrlichia canis infection, tetracycline therapy, and challenge phagocytophilum infection (granulocytic anaplasmosis) in a dog from inoculation. J. Infect. Dis. 130:357-367. Vancouver Island. Can. Vet. J. 46:825-827. Bunnell JE, Dumler JS, Childs JE, Glass GE (1998). Retrospective Liebisch G, Thiet W, Liebisch A (2006). Die canine monocytäre (CME) serosurvey for human granulocytic ehrlichiosis agent in urban white- und die canine granulocytäre Ehrlichiose (CGE), zwei durch Zecken footed mice from Maryland. J. Wildl. Dis. 34:179-181. übertragene Infektionskrankheiten bei Hunden in Deutschland. Der Cao WC, Zhoa QM, Zhang PH, Dumler JS, Zhang XT, Fang L, Yang H praktische Tierarzt. 87:342-353.

Salinas-Meléndez et al. 829

Lim S, Irwin PJ, Lee S, Oh M, Ahn K, Myung B, Shin S (2010). Steere AC, Sikand VK, Meurice F, Parenti DL, Fikrig E, Schoen RT, Comparison of selected canine vector-borne disease between urban Nowakowski J, Schmid CH, Laukamp S, Buscarino C, Krause DS animal shelter and rural hunting dogs in Korea. Parasit. Vectors 3:32. (1998). Vaccination against Lyme disease with recombinant Borrelia Maeda K, Markowitz N, Hawley RC, Ristic M, Cox D, McDade JE burgdorferi outer-surface lipoprotein A with adjuvant. New Engl. J. (1987). Human infection with Ehrlichia canis a leukocytic rickettsia. N. Med. 339: 209-215 Engl. J. Med. 316:853-856. Strle F (2004). Human granulocytic ehrlichiosis in Europe. Int. J. Med. Ohashi N, Inayoshi M, Kitamura K, Kawamori F, Kawaguchi D, Microbiol. 293 (Suppl. 37):27-35. Nishimura Y, Naitou H, Hiroi M, Masuzawa T (2005). Anaplasma Walder G, Tiwald G, Dierich M P, Würzner R (2003). Serological phagocytophilum-infected ticks, Japan. Emerg. Inf. Dis. 11:1780-1783. Evidence for Human Granulocytic Ehrlichiosis in Western Austria. Parola P, Davoust B, Raoult D (2005). Tick- and flea-borne rickettsial Eur. J. Clin. Microbiol. Infect. Dis. 22:543-547. emerging zoonoses. Vet. Res. 36:469-492. Waner T, Harrus S, Jongejan F, Bark H, Keysary A, Cornelissen AW Parola P, Raoult D (2001). Tick-borne bacterial diseases emerging in (2001). Significance of serological testing for ehrlichial diseases in Europe. Clin. Microbiol. Infect. 7: 80-83. dogs with special emphasis on the diagnosis of canine monocytic Petrovec M, Lotric-Furlan S, Avsic-Zupank T, Strle F, Brouqui P, Roux ehrlichiosis caused by Ehrlichia canis. Vet. Parasitol. 95:1-15. V, Dumler S (1997). Human Disease in Europe caused by a Weisiger RM, Ristic M, Huxsoll DL (1975). Kinetics of antibody Granulocytic Ehrlichia Species. J. Clin. Microbiol. 35:1556-1559. response to Ehrlichia canis assayed by indirect fluorescent antibody Petrovec M, Sixl W, Schweiger R, Mikulasek S (2003). Infections of method. Am. J. Vet. Res. 36:689-694. wild animals with Anaplasma phagocytophila in Austria and the Zeidner NS, Burkot TR, Massung R, Nicholson WL, Dolan MC, Czech Republic. Ann. N. Y. Acad. Sci. 990:103-106. Rutherford JS, Biggerstaff BJ, Maupin GO (2000). Transmission of Poitout FM, Shinozaki JK, Stockwell PJ, Holland CJ (2005). Genetic the agent of human granulocytic ehrlichiosis by Ixodes spinipalpis variants of Anaplasma phagocytophilum infecting dogs in Western ticks: evidence of an enzootic cycle of dual infection with Borrelia Washington State. J. Clin. Microbiol. 43:796-801. burgdorferi in Northern Colorado. J. Infect. Dis. 182:616-619. Pusterla N, Berger J, Pusterla, Deplazes P, Wolfensberger C, Müller W, Hörauf A, Reusch C, and Lutz H (1998). Seroprevalence of Ehrlichia canis and of canine granulocytic Ehrlichia infection in dogs in Switzerland. J. Clin. Microbiol. 36:3460 3462. Rikihisa Y (1991). The tribe Ehrlichieae and ehrlichial diseases. Clin. Microbiol. Rev. 4:286-308. Ristic M, Huxsoll DL, Weedier RM, Hildebrandt PK, Nyindo, MB (1972). Serological diagnosis of tropical canine pancytopenia by indirect immunofluorescence. Infect. Immun. 6:226-231. Ryamasewka A, Adamska M (2011). Molecular evidence of vector- borne pathogens coinfecting dogs from Poland. Acta Vet. Hung. 59: 215-229. Schaarschmidt-Kiener D, Miller W (2007). Labordiagnostische und klinische Aspekteder kaninen Anaplasmose. Tierärztl. Prax. 35:129- 136. Skotarczak B (2003). Canine ehrlichiosis. Ann. Agric. Environ. Med. 100:137-141.

Full Length Research Paper

Hala Badawi1*, Aisha Abu Aitta1, Maisa Omar1, Ahmed Ismail2, Hanem Mohamed3, Manal El Said1, Doaa Gamal1, Samah Saad El Dine1 and Mohamed Ali Saber3

1Microbiology Department, Theodor Bilharz Research Institute, Giza, Egypt. 2Urosurgery Department, Theodor Bilharz Research Institute, Giza, Egypt. 3Biochemistry Department, Theodor Bilharz Research Institute, Giza, Egypt.

Accepted 23 January, 2014

Chlamydia trachomatis is responsible for the most common sexually transmitted bacterial infection worldwide. Infections with Ureaplasma urealyticum and genital Mycoplasma hominis have been recognized for about a decade as common sexually transmitted infections (STIs) in developed countries. The aim of this study was to assess the diagnostic value of novel simple diagnostic kits used in the detection of C. trachomatis, U. urealyticum and M. hominis in urine of patients with complicated urinary tract infections (UTIs) and to compare these simple methods to molecular and cultural ones as gold standards. This study was conducted on two male patient’s groups; group I: 30 patients with compilcated UTIs and Group II: 50 patients with non complicated UTIs. Twenty (20) healthy male control subjects (Group III) were also included. The patients were chosen from those admitted to the urosurgery department or attending the urosurgery outpatient clinic in Theodor Bilharz Research Institute (TBRI). First voided urine (FVU) samples and mid-stream urine (MSU) were collected from patients and controls. FVU samples were investigated for C. trachomatis plasmid DNA using polymerase chain reaction (PCR) and for C. trachomatis antigen using Chlamyfast OIA test. MSU samples were used for inoculating of conventional culture media and three culture kits; Mycoplasma DUO, Mycoplasma IST and Mycokit NUM. Blood samples were investigated for the presence of C. trachomatis IgG antibodies using enzyme- linked immunosorbent assay (ELISA) and ImmunoComb Chlamydia Kit and for mycoplasmal antibodies using mycokit sero. C. trachomatis infection was found in 35% (28/80) of patients in both groups, 56.7% (17/30) was detected in group I and 22% (11/50) in group II compared to none of the controls. C. trachomatis infection was significantly higher in group I versus group II (P˂0.05). Chlamyfast OIA test was less sensitive

but more specific than serological assays. ImmunoComb assay had a higher sensitivity but lower specificity than ELISA. A total of 34 cases (42.5%) were positive in a pathogenic level for U. urealyticum and or M. hominis and 30% were positive for U. urealyticum only, 7.5% were positive for M. hominis only and 5% had mixed infection with both organisms. Mycoplasmas infection in group I was found to be significantly higher than in group II (P˂0.05). Mycoplasma IST has the highest sensitivity (100%) andin identification of U. urealyticum while both mycoplasma ISTand mycoplasma DUO showed the highest sensitivity in identification of M.hominis. Serological evidence was detected in 16/24 (66.7%), 2/6 (33.3%) and 4/4 (100%) of U. urealyticum, M. hominis and mixed infections respectively. The serological response to each infection is significantly higher in group I than in group II (P value ˂0.05). Our study detects a high prevalence rate of C. trachomatis, M. hominis and U. urealyticum in cases with complicated UTI. Commercially available kits are simple and sensitive methods to use in laboratories which do not routinely test for these pathogens.

Key words: Chlamydia trachomatis, urinary tract infections (UTIs), non gonorrheal urethritis (NGU). Badawi et al. 831

INTRODUCTION

Urinary tract infections (UTI) are frequent type of diseases such as urethritis, postpartum endometritis, infectious pathology treated in primary care clinics. The chorioamnionitis, spontaneous abortion and premature participation of microorganisms associated with sexually birth, as well as low birth weight, pneumonia, bacteremia, transmitted infection has been reported recently as meningitis and chronic lung disease in prematurely born possible cause of UTI (González-Pedraza et al., 2003). infants (Dhawan et al., 2012; Al-Sweih et al., 2012). According to a World Health Organization (WHO, 2001) Mycoplasma hominis is also associated with bacterial report, Chlamydia trachomatis is responsible for the most vaginosis, pelvic inflammatory disease, arthritis and even common sexually transmitted bacterial infection world- neonatal meningitis (Hopfe et al., 2013). wide, affecting more than 90 million people and has been The aim of this study was to asses diagnostic value of known to have a significant effect on human reproduction novel simple diagnostic kits used in the detection of C. (Paavonen and Eggert-Kruse, 1999; Al-Sweih et al., trachomatis, U. urealyticum and M. hominis in urine of 2012). The prevalence of C. trachomatis in woman under patients with complicated urinary tract infections (UTIs) 25 years of age is very high (up to 30%) hence, young and to compare these simple methods to molecular and sexually active women are the most at risk (Mangin et al., cultural ones as gold standards. 2012). C. trachomatis is one of the causes of acute and chronic urinary tract infections and acute or silent MATERIALS AND METHODS salphingitis (Wanic-Kossowska et al., 2001) that if not treated in an early stage can lead to severe compli- Patients cations, such as pelvic inflammatory disease (PID), ectopic pregnancy and tubal infertility (Marrazo and This study was conducted on 80 patients that were divided into two Stamm, 1998; Gaydos et al., 2004). patient’s groups; group I: 30 male patients with clinically diagnosed Most C. trachomatis genital tract infections in men and complicated UTIs complained of recurrent UTI that resist treatment with conventional antibiotics (cystitis, prostatitis, epididymititis, women are asymptomatic, so the opportunity for cancer bladder, urethral stricture,stone fomation, hydronephrosis unchecked transmission is high even in countries with and urinary bilharziais), their Group II: 50 male patients with non advanced public health care systems (Dean et al., 2012; complicated UTIs. Twenty male healthy control subjects (Group III) Vicetti Miguel et al., 2013). Dysuria and increased were also included. The patients were chosen from those admitted urinary frequency associated with presumed urinary tract to urosurgery department or attending the urosurgery outpatient infection are extremely common reasons for seeking clinic in TBRI. The controls were selected from those admitted, during the same period, for Surgery Department with normal urine treatment in primary care. About 10% of women suffer analysis. The patients diagnosis was based on complete history from symptoms of a urinary tract infection in any year, taking including increased frequency of micturation, dysuria, and seeking treatment provides a potential opportunity to haematuria, uretheral discharge, antischistosomal treatment, detect both symptomatic and asymptomatic infection with instrumentation or any previous pelvic troubles. Complete clinical C. trachomatis (Mangin et al., 2012). assessment, radiological investigation, cystoscopy and histopa- C. trachomatis infection is easily treatable with thological examination, urine analysis and culture were also performed. The patients or controls did not receive antibiotics two antibiotics, so detection and treatment of infected indivi- weeks before the study. duals is a key element of Chlamydia control programs (Gaydos et al., 2004; Van der Helm et al., 2013). Although there are a variety of methods for testing for C. Sample collection trachomatis, no single test is ideal (Mangin et al., 2012). Early morning first voided urine (FVU) samples and mid-stream Culture, nucleic acid hybridization tests, and nucleic acid urine (MSU) were collected from patients and controls. FVU amplification tests (NAATs) are available for the detection samples were stored at -70°C untill investigated for C. trachomatis of C. trachomatis. Culture and hybridization tests require antigen using enzyme immunoassay (EIA) and C. trachomatis urethral swab specimens, whereas NAATs can be plasmid DNA using PCR. MSU samples were centrifuged and the performed on urine specimens. The sensitivity and pellets were then used for inoculating of three culture kits; specificity of the NAATs are clearly the highest of any of Mycoplasma DUO, Mycoplasma IST and Mycokit NUM and conventional culture media. Blood samples were collected and sera the test platforms for the diagnosis of chlamydial were stored at -70°C to be investigated for the presence of C. infections (Lee and Lee, 2013). trachomatis antibodies and mycoplasmal antibodies using ELISA Infections with Ureaplasma urealyticum and genital and ImmunoComb Chlamydia Kit and Mycokit Sero respectively. mycoplasmas (M. hominis and M. genitalium) have been recognized for about a decade as a common STD in developed countries (Yoshida et al., 2002). Genital urea- Detection of Chlamydia trachomatis plasmas and mycoplasmas are natural inhabitants of the PCR analysis of C. trachomatis plasmid DNA in urine specimens male urethra, contaminating the semen during ejacu- lation. However, U. urealyticum, are implicated in invasive Eight (8) ml of FVU samples were mixed thoroughly and centrifuged

*Corresponding author. E-mail: [email protected]. 832 Afr. J. Microbiol. Res.

at 3000 rpm for 30 min at room temperature. The precipitate was EIA ImmunoComb Chlamydia Kit for semi-quantitative transferred to 1.5 ml microcentrifuge tube and centrifuged at 14000 determination of Chlamydia IgG in serum rpm for 30 min. The pellets were stored at -20°C until DNA extraction. DNA extraction was performed using QIA amp Viral RNA The ImmunoComb Chlamydia Bivalent IgG Kit (ImmunoComb, Mini kit (Qiagen GmbH, Germany) because the AVL buffer used in PBS, Orgenics, France) is an EIA test intended for the semi- this kit, inactivates the numerous unidentified PCR inhibitors found quantitative of IgG antibodies to C trachomatis in serum. in urine. The extraction was done following the QIA amp using spin- ImmunoComb consist of a solid-phase EIA. The solid phase is a column protocol with slight modification as follows: The urine pelet comb with 12 projections. Each tooth is sensitized at two positions; was dissolved in 1ml PBS. 250 μl of urine solution were added to upper spot: goat antibodies to human immunoglobulin (Internal 560 μl of the buffer AVL/carrier RNA followed by vortexing and Control), lower spot: inactivated antigens of C. trachomatis. The incubation for 15 min at room temperature. 750 μl of absolute developing plate has 6 rows (A-F) of 12 wells, each row containing ethanol were then added and mixed by pulse-vortex for 20 s. The a reagent solution ready for use at a different step in the assay. The mixture was then applied to the QIA amp spin column and test was performed stepwise, by moving the comb from row to row, centrifuged at 8000 rpm for 2 min followed by washing with buffer with incubation at each step. Serum specimens were added to the AW1 then AW2. DNA adsorbed onto the QIA amp silica gel diluent in the wells of row A of developing plate. The comb was membrane was eluted by adding 60 μl buffer AVE followed by then inserted in the wells of row A. Anti-C. trachomatis antibodies, if incubation for 5 min and centrifugation for 5 min at 8000 rpm. The present in the specimens, will specifically bind to the respective elution step was repeated to increase the yield of DNA. The eluted chlamydial antigens on the lower spot of each tooth of the comb. o solution was stored in aliquots at -20 C untill performance of Simultaneously, immunoglobulins present in the specimens would amplification. PCR amplification: performed with PCR kit (DiaSorin, be captured by the anti-human immunoglobulin on the upper spot Italy-UAS). Primers set used : It delineated PCR amplification (Internal Control). Unbound components would be washed away in product of 207 bp within the cryptic plasmid of C. trachomatis : PC24 row B. In row C, the human IgG captured on the teeth will react with : 5`GGG ATT CTT GTA ACA ACA AGT CAGG 3` and PC27 : alkaline phosphatase-labeled anti-human IgG. In the next two rows, 5`CCT CTT CCC CAG AAC AAT AAG AAC AC 3`. The 207 bp unbound components were removed by washing. In row F, the product obtained with primers PC24 and PC27. bound alkaline phosphatase will react with chromogenic components. The results were visible as gray-blue spots on the Reaction mixture: The reaction volume was 100 μl containing 1 × surface of the teeth of the comb. A positive control (anti- C. PCR buffer, 2.5 mM MgCl2, 0.2 mM each deoxynucleoside trachomatis IgG) and a negative control were included in each triphosphate, 2.5U Taq DNA polymerase (Promega, Madison WI, assay run. Upon completion of the test, the tooth used with the USA), 50 P mole of each primer. Ten microliters of extracted DNA positive control should show 2 gray-blue spots. The tooth used with were added to 100 μl of the PCR mixture in the reaction tube. the negative control should show the upper spot and either no other Enzymatic amplification was performed using a programmable spot or a faint lower spot. The upper spot should also appear on all thermal cycler 480 version (Perkin Elmer Ceteus, Norwalk, Conn). other teeth, to confirm the addition of the specimen, proper Amplification started with an initial denaturation step at 94°C for 5 functioning of the kit and correct performance of the test. min followed by 35 cycles. Each cycle consisted of denaturation at 94°C for 1 min, annealing at 60°C for 1 min and primer extension at 72°C for 1 min. The reaction was stopped by cooling at 4°C. Detection of mycoplasmas

Detection of amplification product: Fifteen microliters of the PCR Conventional Culture for Mycoplasmas product were electrophoresed through 2% agarose gel containing ethidium promide (0.5 mg/ml) at constant current 100 volt for 45 Urine sediment was cultured for M.hominis by direct plating on min. Bands were observed under UVR light and photographed. enriched heart infusion (HN) mycoplasma agar and indirect

inoculation of HN mycoplasma broth, which were then incubated at

37°C in a candle Jar. It was also cultured for U. urealyticum on U Optical immunoassay (Chlamyfast OIA, International Microbio, 9 broth and A agar (Int-mycolpasma-France) and incubated France) in urine 7 anaerobically according to El-Mishad et al. (1992). The plates were

then examined under a dissecting microscope for up to 10 days. Optical immunoassay is a two-step procedure involving antigen The results have been determined in terms of identification and extraction and detection. The test surface is a silicon water quantification of U. urealyticum and M. hominis. For quantification; reflecting white light into a predominant gold color. The sample was two different levels have been determined for both U. urealyticum placed on the test surface. If it contains the antigen, binding would and M. hominis: a non-pathogenic level which was determined as occur between the antigen and the water surface and it was then <104 colour changing units (CCUs)/ml and a pathogenic level which recognized by the anti-LPS conjugate. After washing to remove was determined as ≥104 CCU/ml. unbound components, an optical enhancer was applied to the test surface. Its precipitation leads to an increased thickness in the molecular thin film with subsequent change in the color of the Detection and Antibiotic Susceptibility Testing of Urogenital reflected light from gold to blue/purple. If chlamydial antigen was Mycoplasmas not present in the sample, there would be no change in color. The centrifuged pellets were resuspended in sterile saline and then processed with the following 3 kits: Enzyme-linked immunosorbent assay for detection of Chlamydia IgG in serum Mycoplasma DUO (Sanofi, Diagnostics Pasteur, France): The kit composed of microplates, each of 6 wells containing substrates Enzyme-linked immunosorbent assay (ELISA) (DRG Diagnostics, and growth factors for mycoplasma to ensure optimal sensitivity, Germany) was performed and interpreted according to manufac- besides inhibitors for polymorphic flora to ensure optimal selectivity. turer’s instractions. IgG titer greater than 1:512 was a criterion for It was designed for identification and enumeration of mycoplasmas. serodiagnosis of acute or current infection. Identification was based on specific metabolic properties; hydrolysis Badawi et al. 833

of urea by U. urealyticum or arginine by M.hominis which was Table 1. Distribution of 30 patients Group I among different indicated, after 24 or 48 h of incubation, by a change in colour of complicated clinical condition. the well containing the relevant substrate without clouding of the medium. Titration was based on applying successive dilutions of Complicated No. % the specimens to the lower three wells. The titer was expressed as Clinical Status* the number of CCUs/ml specimen. The technique allowed titration around the level of 103 and 104/ml which were the accepted Cystitis 8 27 pathogenicity levels Prostatitis 15 50 Epididymitis 13 43 Mycoplasma IST (bioMerieux, France): The principle and Cancer bladder 9 30 components were similar to those of DUO with the addition of eleven more wells for determining the susceptibility of the strain to Urethra stricture 6 20 six antibiotics including doxycycline, josamycine, ofloxacine, Stone formation 11 37 erythromycine, tetracycline and pristinamycin. Hydronephrosis 4 13 Urinary 16 53 Mycokit-NUM (PBS-Orgenics, france): Serial tenfold dilutions Bilharzial were made from the urine and inoculated into the transport medium; urea broth (U9) for U. urealyticum in the first column and *One patient may have more than one clinical status into arginine broth (M42) for M. hominis in the second column; in presence of appropriate PH indicator. After 48 h incubation, the titer was estimated in CCU/ml as the reciprocal of the highest dilution the controls. Serological evidence was detected in 76% revealing a colour change. (13/17) and in 27% (3/11) of positive cases of group I and

group II respectively. C. trachomatis infection was Serological assessment for mycoplasmas (Mycokit-SERO, significantly higher in group I versus group II (P˂0.05). PBS-Orgenics, France) Table 2 shows the diagnostic performance of different tests used for the detection of C. trachomatis infection For detection of mycoplasmal antibodies; anti-U.urealyticum and among all studied patients using PCR assay (Figure 1) as anti-M.hominis; in sera. The principle and components of the kit reference standard. It was noticed that Chlamyfast OIA were similar to those of Mycokit-NUM, except that lyophlized test which detects chlamydial antigen in urine specimens U.urealyticum and M.hominis were added to U9 and M42 columns respectively. After incubation for 48 h at 37°C, growth of was less sensitive but more specific than serological mycoplasma induced a pH change of the medium, turning its colour assays that detect IgG antibodies in serum. from yellow to blue. If serum contained specific antibodies, ImmunoComb assay had a higher sensitivity but lower inhibition of multiplication of mycoplasma would occur preventing specificity than ELISA. the colour change (metabolic inhibition test). The antibody titer was the least dilution showing no colour change (remained yellow). In this study, out of 80 urine specimens of infected groups, a total of 34 cases (42.5%) were positive in a pathogenic level for U. urealyticum and or M. hominis Statistical analysis by at least one of the diagnostic procedures used. It was found that 30% were positive for U. urealyticum only and The statistical analysis was performed using SPSS version 10.0 7.5% were positive for M. hominis only and 5 % had statistical software (SPSS Inc, Chicago, IL). Data were presented as mean ± SD and range or as an absolute number and mixed infection with both organisms. In the control group, percentage. Sensitivity, specificity and predective values were U. urealyticum and M. hominis were isolated from 5 and calculated. Chi-square tests were used for the analysis of the 2.5% of normal subjects respectively in a non-pathogenic categorical variables and Quantitative data with uneven distribution level. The distribution of different types of mycoplasma were analyzed with the Mann-Whitney U test. P < 0.05 was among the studied groups are shown in Table 3. considered statistically significant. Mycoplasmas infection in group I was found to be significantly higher than in group II (P˂0.05). The diagnostic value of different identification proce- RESULTS dures for U. urealyticum and M. hominis among studied groups were shown in Table 4. It was observed that Two groups of patients were included in the present Mycoplasma IST has the highest sensitivity (100%) and study; Group (I): consists of 30 male patients with clinical absolute negative predictive value (NPV) in identification diagnosis of complicated UTIs. Their ages were ranged of U. urealyticum while both Mycoplasma ISTand from 29 to 54 years with a mean of 30 ± 9.8 years Mycoplasma DUO showed the highest sensitivity and (average ± SD) (Table 1). Group (II): consists of 50 absolute NPV in identification of M. hominis. patients with simple non complicated UTIs. Their ages The serologic reactivity to U. urealyticum and M. were ranged from 32 to 59 years with a mean of 32 ± 8.7 hominis infection among positive cases was illustrated in years (average ± SD). Using amplified PCR assay, C. Table 5. Serological evedince was detected in 16/24 trachomatis infection was found in 35% (28/80) of (66.7%), 2/6 (33.3%) and 4/4 (100%) of U. urealyticum, patients in both groups, 56.7% (17/30) was detected in M. hominis and mixed infections respectively. group I and 22% (11/50) in group II compared to none of Serologic reactivity to C. trachomatis, U. urealyticum, 834 Afr. J. Microbiol. Res.

Table 2. Diagnostic performance of recent tests used for detection of C. trachomatis among all studied patients with UTI.

C. trachomatis PCR Test result On urine sediment Sensitivity Specificity PNV* NPV** Pos. (No=28) Neg. (No=52) Chlamyfast OIA

Pos 17 9 61 83 65 80 Neg 11 43

ELISA IgG

Pos 16 11 57 79 59.5 77.4 Neg 12 41

ImmunoComb IgG

Pos 26 14 93 67 61 95 Neg 2 38

*NPV: Negative predictive value. **Positive predictive value.

Figure 1. PCR Results for FVU specimens from male patients with recurrent urogenital infections. The 207 bp product obtained with primers PC24 and PC27. Lane 1: molecular weight marker, Lanes 2-5: amplification products of four Chlamydia trachomatis positive specimens, Lane 6: a positive control and Lane 7: negative control.

M. hominis among studied groups are shown in Table 6. sexually transmitted pathogens of humans. According to It was noted that the serological respond to each infection the Centers for Disease Control (CDC), C. is significantly higher in group I than in group II (P value trachomatis infection is among the most prevalent of all ˂0.05). STDs, and since 1994, has comprised the largest proportion of all STDs reported to CDC (CDC, 2010). Since most of infected men and women are DISCUSSION asymptomatic, this high number of unrecognized infected individuals may provide the reservoir for spreading the Chlamydia trachomatis is one of the most common infection to other men and women via sexual intercourse Badawi et al. 835

Table 3. Distribution of different types of mycoplasmas among disease groups.

M. hominis U. urealyticum Mixed Total Group isolates No. % No. % No. % No. % Group I (No=30) 4 13.3 18 60 2 6.7 24* 80 Group II (No=50) 2 4 6 12 2 4 10 20 Total (No=80) 6 7.5 24 30 4 5 34 42.5

*P value ˂0.05 versus group II.

Table 4. Diagnostic value of different identification for U. urealyticum and M. hominis in disease groups.

Diagnostic performance Culture system Sensitivity (%) Specificity (%) PPV (%) NPV (%) Mycoplasma IST U. urealyticum 100 89.7 78.6 100 M. hominis 100 98.6 90 100

Mycoplasma DUO U. urealyticum 90.9 89.7 76.9 96.3 M. hominis 100 97.2 80 100

Mycokit - NUM U. urealyticum 80 90 72.7 93.1 M. hominis 70 100 100 95.9

Table 5. Serologic Reactivity to U.urealyticum and M.hominis among positive cases using Mycokit-NUM.

Positive Negative Positive case No. % No. % U. urealyticum (No. = 24) 16 66.7 8 33.3 M. hominis (No = 6) 2 33.3 4 66.7 Mixed infection (No.= 4) 4 100 0 0 Total (No. =34) 22 64.7 12 35.3

(Nassar, 2007). not been adequately studied and the prevalence of C. Reported rates of chlamydial infection have increased trachomatis, genital ureaplasmas and genital myco- dramatically over the past decade, reflecting expansion of plasmas has not been determined so infections by these chlamydial screening activities, highly sensitive nucleic pathogens may be higher than those reported (Gdoura et acid amplification tests and improvements in information al., 2008; Ghanaat et al., 2008). systems used for reporting rather than a true increase in In our study C. trachomatis infection was found in 35% disease burden (Workowski and Berman 2007 ; Geisler, (28/80) of patients in both groups, 56.7% (17/30) was 2010). However, screening and treatment are focused on detected in group I and 22% (11/50) in group II compared females, with the burden of this infection and infertility to none of the controls. These results were similar to a sequelae considered to be a predominantly female study done by Vasic et al. (2004) who reported that problem, although the prevalence of chlamydial infection Chlamydia infection has been determined in 35.55% is similar in males and females (Cunningham and (128/360) of male patients with urethritis symptoms. Our Beagley 2008; Fernández-Benítez et al., 2013). Preva- results was comparable to a previous study in Egypt by lence of C. trachomatis varies according to geographic El Sayed et al. (2006) where C. trachomatis was detected area, age and status of patients (Ghazvini et al., 2012; in 25 out of 50 (50%) of examined urine samples. In a Fernández-Benítez et al., 2013). In developing countries, Japanese study, 47.7% (73/153) of FVU specimens in infections caused by Chlamydia and Mycoplasma have men with urethritis were positive for C. trachomatis 836 Afr. J. Microbiol. Res.

Table 6. Serologic reactivity to C. trachomatis, U. urealyticum, M. hominis among studied groups.

Group I (No. = 30) Group II (No. = 50) Total (No. = 80) Test result No. % No. % No. % C. trachomatis Positive 18 60 9 18 27 33.8 Negative 12 40 41 82 53 66.2

U. urealyticum Positive 17 56.7 3 6 20 25 Negative 13 43.3 47 94 60 75

M. hominis Positive 4 13.3 2 4 6 7.5 Negative 26 86.7 48 96 74 92.5

(Maeda et al., 2004). Wiggins et al. (2006) reported that assist but cannot replace direct antigen detection or up to 30% of urethritis cases were due to a C. isolation of the organism by the culture technique (Kamel, trachomatis infection, compared to only 4% in healthy 2013). control subjects. Mycoplasma pathogens have been discovered in the C. trachomatis is a frequent pathogen associated with urogenital tract of patients suffering from PID, urethritis upper and lower urinary tract infections (El-Sayed et al., and other urinary tract diseases (Goulet et al., 1995). M. 2006). Chlamydial infection in the male urethra can be hominis is frequently recovered from the genitourinary complicated by urethritis, epididymitis and prostatitis tract. In addition, M. hominis causing bacterial vaginosis (Gdoura et al., 2008), Although the role of Chlamydia in in women, has been proposed as one cause of NGU in the development of prostatitis is controversial, it is highly men (Workowski and Berman, 2007). suggested that Chlamydia is considered to be an etio- In our study pathogenic level for U. urealyticum and or logical agent, with incidences of up to 39.5% reported in M. hominis was found in 42.5% of our patients; 30% were patients with prostatitis (Cunningham and Beagley, positive for U. urealyticum only and 7.5% were positive 2008). This may explain the higher prevalence of C. for M. hominis only and 5 % had mixed infection with both trachomatis in the group of complicated UTI, as 50% of organisms. U. urealyticum and M. hominis were isolated our patients suffer from prostatitis, 43% suffer from in a non-pathogenic level from 5% and 2.5% of normal epididymitis and 30% had urethral stricture. subjects respectively. Our results were comparable to In this study, the diagnostic performance of different those in a previous study from Turkey in which U. tests used for the detection of C. trachomatis infection urealyticum was found in 48% of patients (24/50) with among all studied patients was compared using PCR as non-gonococcal urethritis. Thirteen (13) of these patients a reference standard. Chlamyfast OIA test which detects had only U. urealyticum, and the rest had mixed chlamydial antigen in urine specimens was less sensitive pathogenic organisms; 14% (7/50) U. urealyticum with M. but more specific than ImmunoComb assay that detect hominis; 6% (3/50) U. urealyticum with C. trachomatis IgG antibodies in serum. ImmunoComb IgG had a higher and 2% (1/50) U. urealyticum with M. hominis and C. sensitivity but lower specificity than ELISA IgG. Vasic et trachomatis (Kılıç et al., 2004). Also Takahashi et al. al. (2004) reported that Chlamyfast OIA test detected (2006) in Japan detected Mycoplasma and Ureaplasma significant percentage of the Chlamydia infections in in FVU of young men at comparable rates of 4% for M. patients, which emphasizes the diagnostic importance in hominis and 12% for U. urealyticum. Whereas in Tunisia diagnosing STIs. Chernesky et al. (1998) concluded that genital M. huminis and genital ureaplasmas affected a supplemental to the C. trachomatis antigen detection, the large number of infertile male patients, reaching 10.6% easily performed ImmunoComb IgG is of great value in and 15.4% respectively (Gdoura et al., 2008). routine diagnosis of genital chlamydial infections. How- Mycoplasma IST and Mycoplasma DUO showed high ever, Bakardzhie et al (2011) noted a lack of specificity of sensitivity compared to culture as gold standard method the ImmunoComb IgG compared to PCR. In an Egyptian of detection. This finding was similar to previous studies study performed by El-Sayed et al. (2006), ELISA IgG which found no difference between Mycoplasma IST and showed high level of specificity (100%) and low level of culture regarding isolation of Mycoplasma (Kılıç et al., sensitivity (40%) when compared to the cell culture 2004) and considered Mycoplasma Duo assay as a method. As sensitivity of the ELISA test is low, this can simple and a sensitive method comparable to culture and Badawi et al. 837

PCR for the detection of Ureaplasma spp. (Cheah et al., Serology diagnose upper genital tract Chlamydia trachomatis 2005; Ekiel et al., 2009). Biernat-Sudolska et al. (2013) infection? Studies on women with pelvic pain, with or without chlamydial plasmid dna in endometrial biopsy tissue. Sex. Transm. reported that the sensitivity and specificity of the Dis. 25(1):14-19. Mycoplasma IST test when compared to the culture Clegg A, Passey M, Yoannes M, Michael A (1997). High rates of genital method as a “gold standard” were determined as 91 and mycoplasma infection in the highlands of Papua New Guinea 96%, respectively, while the positive and negative determined both by culture and by a commercial detection kit. J. Clin. Microbiol. 35:197-200. predictive value of the commercial test was 27 and 99%, Cunningham KA, Beagley KW (2008). Male genital tract chlamydial respectively for detection of M. hominis in clinical infection: Implications for pathology and infertility. Biol. Reprod. samples. Clegg et al. (1997) demonstrated sensitivity of 79(2):180-189. 93% and specificity of 87% of Mycoplasma IST kit Dean D, Turingan RS, Thomann H-U, Zolotova A, Rothschild J, Joseph SJ, Read TD, Tan E, Selden RF (2012). A multiplexed microfluidic compared to the culture of M. hominis. These findings PCR assay for sensitive and specific point-of-care detection of make the current tests suitable for use in diagnostic Chlamydia trachomatis. PLoS ONE 7(12): e51685. doi:10.1371/ laboratories that do not currently test for Ureaplasma spp. journal.pone.0051685. or Mycoplasma. Ekiel AM, Friedek DA, Romanik MK, Jozwiak J, Martirosian G (2009). Occurrence of Ureaplasma parvum and Ureaplasma urealyticum in It is interesting that 53% of our patients were suffering women with cervical dysplasia in Katowice, Poland. J. Korean Med. from urinary bilharziasis. This coexistence between Sci. 24(6):1177-1181. urogenital schistosomiasis and sexually transmitted El-Mishad AM, Mokhtar S, Adu Aitta AM, Ahmed A (1992). Ocurrence of infection including Chlamydia trachomatis and U. urealyticum, M. hominis and anaerobic bacteria in urine of patients with UTI and haematobiasis. Med. J. Cairo Univ. 60(1):167-176. Mycoplasma genitalium has been previously reported in El-Sayed M, Badwy W, Bakr A (2006). Rapid hybridization probe assay the area of Madagascar, where Schistosoma and PCR for detection of Chlamydia trachomatis in urinary tract haematobium is endemic. Authors in that study sug- infections: a prospective study, Curr. Microbiol., 53(5):379-383. gested that similar situation can be anticipated in most Fernández-Benítez C, Mejuto-López P, Otero-Guerra L, Margolles- Martins MJ, Suárez-Leiva P, Vazquez F, Chlamydial Primary Care other schistosoma-endemic areas in sub-Saharan Africa Group (2013). Prevalence of genital Chlamydia trachomatis infection presenting the two disease entities as a diagnostic among young men and women in Spain. BMC Infect. Dis. 13:388. challenge for the local health care providers in these Gaydos CA, Theodore M, Dalesio N, Wood BJ, Quinn TC (2004). areas (Leutscher et al., 2008). Comparison of three nucleic acid amplification tests for detection of Chlamydia trachomatis in urine specimens. J. Clin. Microbiol.

42(7):3041-3045. Conclusion Gdoura R, Kchaou W, Chaari C, Znazen A, Keskes L, Rebai T, Hammami A (2008). Assessment of Chlamydia trachomatis,

Ureaplasma urealyticum, Ureaplasma parvum, Mycoplasma hominis, Our study detects a high prevalence rate of C. and Mycoplasma genitalium in semen and first void urine specimens trachomatis, M. hominis and U. urealyticum in cases with of asymptomatic male partners of infertile couples. J. Androl. complicated UTI. Patients with urinary symptoms should 29(2):198-206. be evaluated for three pathogens as common causes of Geisler WM (2010). Duration of untreated, uncomplicated Chlamydia trachomatis genital infection and factors associated with chlamydia NGU. Commercially available kits are simple and resolution: a review of human studies. J. Infect. Dis. 201(2):S104- sensitive methods to use in laboratories which do not 113. routinely test for these pathogens. The association Ghanaat J, Afshari JT, Ghazvini K, Malvandi M (2008). Prevalence of between STD and S. haematobium requires further genital chlamydia in Iranian males with urethritis attending clinics in Mashhad. Eastern Mediterranean Health J. 14(6):1333-1337. studies. Ghazvini K, Ahmadnia H, Ghanaat J (2012). Frequency of Chlamydia trachomatis among male patients with urethritis in northeast of iran detected by polymerase chain reaction. Saudi J. Kidney Dis. Transpl. REFERENCES 23(2):316-320. González-Pedraza A, Ortiz C, Mota R, Dávila R, Dickinson E (2003). Al-Sweih NA, Al-Fadli AH, Omu AE, Rotimi VO (2012). Prevalence of Role of bacteria associated with sexually transmitted infections in the Chlamydia trachomatis, Mycoplasma hominis, Mycoplasma etiology of lower urinary tract infection in primary care. Enferm Infecc. genitalium, and Ureaplasma urealyticum infections and seminal Microbiol. Clin. 21(2):89-92. quality in infertile and fertile men in Kuwait. J. Androl. 33(6):1323- Goulet M, Dular R, Tully JG, Billowes G, Kasatiya S (1995). Isolation of 1329. Mycoplasma pneumoniae from the human urogenital tract. J Clin Bakardzhie I, Pehlivanov G, Kovachev E (2011). Correlations between Microbiol, 33(11):2823-2825. Contemporary Methods in the Diagnosis of Chlamydia Trachomatis Hopfe M, Deenen R, Degrandi D, Ko¨hrer K, Henrich B (2013). Host urogenital infections. J. IMAB 17(1):158-160. /DOI: Cell Responses to Persistent Mycoplasmas - Different Stages in 10.5272/jimab.2011171.158 Infection of HeLa Cells with Mycoplasma hominis. PLoS ONE 8(1): Biernat-Sudolska M, Rojek-Zakrzewska D, Zawilińska B, Magdalena K- e54219. doi:10.1371/journal.pone. 0054219. V (2013). The need to verify of positive Mycoplasma hominis results Kamel RM (2013). Screening for Chlamydia trachomatis infection obtained using the Mycoplasma IST2 tests. J of Lab Diag, 49 (1):5-8. among infertile women in Saudi Arabia. Int J Women’s Health, 5: Centers for Disease Control (CDC) (2010). Sexually transmitted 277-284. diseases surveillance, 2010. Kılıç D, Basar MM, kaygusuz S,Yilmaz E, Basar H, Batislam E (2004). Cheah F-C, Anderson TP, Darlow BA, Murdoch DR (2005). Comparison Prevelance and treatment of chlamydia trachomatis, Ureaplasma of the mycoplasma duo test with PCR for detection of Ureaplasma urealyticum and Mycoplasma hominis in patients with non- species in endotracheal aspirates from premature infants. J Clin gonococcal urethritis. Jpn. J. Infect Dis. (8):17-20. Microbiol, 43(1):509. DOI: 10.1128/JCM.43.1.509-510.2005. Lee Y-S, Lee K-S (2013). Chlamydia and Male Lower Urinary Tract Chernesky M, Luinstra K, Sellors J, Schachter J, Moncada J, Caul O, Diseases. Korean J. Urol. 54:73-77. Paul I, Mikaelian L, Toye B, Paavonen J, Mahony J (1998). Can Leutscher PDC, Ramarokoto C-E, Hoffmann S, Jensen JS, Ramaniraka 838 Afr. J. Microbiol. Res.

V, Randrianasolo B, Raharisolo C, Migliani, R, Christensen N Van der Helm JJ, Bom RJM, Gru¨nberg AW, Bruisten SM, Schim van (2008).Coexistence of urogenital schistosomiasis and sexually der Loeff MF, Sabajo LOA, de Vries HJC (2013). Urogenital transmitted infection in women and men living in an area where Chlamydia trachomatis Infections among Ethnic Groups in Schistosoma haematobium is endemic. Clin. Infect. Dis. 47(6):775. Paramaribo, Suriname; Determinants and Ethnic Sexual Mixing Maeda S-I, Deguchi T, Ishiko H, Matsumoto T, Naito S, Kumon H, Patterns. PLoS ONE 8(7): e68698. doi:10.1371/ Tsukamoto T, Onodera S, Kamidono S (2004). Detection of journal.pone.0068698 Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma parvum Vasic A, Tasic NM, Zdravkovic D, Tasic S (2004). Chlamyfast-OIA test (biovar 1) and Ureaplasma urealyticum (biovar 2) in patients with in the genital chlamydia male infection diagnosis. Acta Medica non-gonococcal urethritis using polymerase chain reaction-microtiter Medianae 43:33-36. plate hybridization. Int. J. Urol. 11(9):750-754. Vicetti Miguel RD, Harvey SAK, LaFramboise WA, Reighard SD, Mangin D, Murdoch D, Wells JE, Coughlan E, Bagshaw S, Corwin P, Matthews DB, Cherpes TL (2013). Human Female Genital Tract Chambers S, Toop L (2012). Chlamydia trachomatis testing Infection by the Obligate. Intracellular bacterium Chlamydia sensitivity in midstream compared with first-void urine specimens. trachomatis elicits robust type 2 immunity. PLoS ONE 8(3): e58565. Ann. Fam. Med. 10:50-53. doi:10.1370/afm.1323. doi:10.1371/journal.pone.0058565. Marrazo J, Stamm WE (1998). New approaches of chlamydial infection. Wanic-Kossowska M, Kozioł L, Bajew L, Czekalski S (2001). Acute and Curr. Top Clin. Infect. Dis.18:37-59. chronic urinary tract infections caused by Chlamydia trachomatis. Int. Nassar F (2007). Chlamydia trachomatis, Mycoplasma hominis, Urol. Nephrol. 32(3):437-438. Mycoplasma genitalium, and Ureaplasma urealyticum in Patients with Wiggins RC, Holmes CH, Andersson M, Ibrahim F, Low N, Horner PJ Sterile Pyuria in Gaza-Palestine. Master thesis in Microbiology, (2006). Quantifying leukocytes in first catch urine provides new Biological Sciences, Faculty of Science, The islamic University-Gaza. insights into our understanding of symptomatic and asymptomatic Paavonen J, Eggert-Kruse W (1999). Chlamydia trachomatis: impact on urethritis. Int. J. STD AIDS 17(5):289-295. human reproduction. Hum. Reprod. Update 5(5):433-447. Workowski KA, Berman SM (2007). Centers for Disease Control and Sethi S, Singh G, Samanta P, Sharma M (2012). Mycoplasma Prevention sexually transmitted diseases treatment guidelines. Clin. genitalium: An emerging sexually transmitted pathogen. Indian J. Infect. Dis. 44 (3):S73-76. Med. Res. 136(6):942-955. World Health Organization (WHO) (2001). Global prevalence and Takahashi S, Takeyama K, Miyamoto S, Ichihara K, Maeda T, incidence of selected curable sexually transmitted infections. Kunishima Y, Matsukawa M, Tsukamoto T (2006). Detection of overviews and estimates. Geneva, Switzerland: WHO. Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma Yoshida T, Maeda S, Deguchi T, Ishiko H (2002). Phylogeny-based urealyticum, and Ureaplasma parvum DNAs in urine from rapid identification of mycoplasmas and ureaplasmas from urethritis asymptomatic healthy young Japanese men. J. Infect. Chemother. patients. J. Clin. Microbiol. 40(1):105-110. 12(5): 269-271.

UPCOMING CONFERENCES

7th Asia-Pacific Organization for Cell Biology Congress, Biopolis, Singapore, 24 February 2014

18th Annual International Conference on Research in Computational Molecular Biology Pittsburgh, Pennsylvania April 2-5, 2014

Conferences and Advert

February 2014 7th Asia-Pacific Organization for Cell Biology Congress, Biopolis, Singapore, 24 February 2014

March 2014 VIII International Symposium on Antimicrobial Resistance, Cartegena, Colombia, March 5- 7, 2014

April 2014 Annual Meeting of the Association of Medical Microbiology and Infectious Disease Canada, Victoria, Canada, April 2-5, 2014

18th Annual International Conference on Research in Computational Molecular Biology Pittsburgh, Pennsylvania April 2-5, 2014

African Journal of Microbiology Research

Related Journals Published by Academic Journals

African Journal of Biotechnology African Journal of Biochemistry Research Journal of Bacteriology Research Journal of Evolutionary Biology Research Journal of Yeast and Fungal Research Journal of Brewing and Distilling