Proc. Nati. Acad. Sci. USA Vol. 81, pp. 3332-3336, June 1984 Biochemisty Copper metallothionein of yeast, structure of the gene, and regulation of expression (Saccharomyces cerevisiae/metal-induced gene/metallothionein promoter-galactokinase gene fusions) TAUSEEF R. BUTT*, EDMUND J. STERNBERG*, JESSICA A. GORMANt, PHILIP CLARKt, DEAN HAMERt, MARTIN ROSENBERGt, AND STANLEY T. CROOKE* Departments of *Molecular Pharmacology and tMolecular Genetics, Smith Kline and French Laboratories, 1500 Spring Garden Street, Philadelphia, PA 19101; and MLaboratory of Biochemistry, National Cancer Institute, National Institutes of Health, Bethesda, MD 20205 Communicated by Robert P. Perry, February 14, 1984

ABSTRACT Addition of copper to yeast cells leads to the strain and showed that it protects a cupP strain from copper induction of a low molecular weight, cysteine-rich protein that toxicity (14). The restriction map of this clone indicated that binds copper. This protein, termed copper chelatin or thio- it is identical to the CUP] gene previously cloned and char- nein, is related to the metallothionein family of proteins that acterized by Fogel and Welch (12). To provide a basis for are induced in response to cadmium and zinc in vertebrate understanding the function and regulation of this gene, we cells. We have determined the structure of the yeast copper- determined the primary structure of the coding region and binding protein by DNA sequence analysis of the gene. Al- flanking sequences. We show that it encodes a protein with though the 6573-dalton yeast protein is substantially divergent both similarities to and differences from the MTs of higher from vertebrate metallothioneins, the arrangement of 12 cyste- eukaryotes. We refer to this protein as copper metallothio- ine residues, which is a hallmark of metal-binding proteins, is nein (Cu-MT) because it belongs to the metallothionein fam- partially conserved. We analyzed the regulatory DNA se- ily of proteins as defined in ref. 1. In addition, we used an quence of the gene by fusing it with the Escherichia coli galac- Escherichia coli galactokinase fusion gene vector to show tokinase gene and assaying the levels of enzyme activity in that all of the DNA sequence information required for cop- yeast in response to copper. The transcriptional activation has per induction of this gene lies within 460 base pairs (bp) up- a specific requirement for copper. Zinc, cadmium, and gold stream from the translational initiation codon. Our prelimi- were unable to regulate the galactokinase activity. The yeast nary results on the structure of Cu-MT gene have been re- copper metallothionein regulatory sequences represent a pre- ported (15). viously unreported class of yeast promoter that is regulated by After this manuscript was submitted, the DNA sequence copper. of the CUP] locus was published by Karin et al. (16). The DNA sequence of the Cu-MT gene is identical to that of the Methallothioneins (MTs) are thought to play a central role in CUP] gene. the protection against heavy metal toxicity and zinc homeo- stasis (see ref. 1 for a review). Recent interest in the molecu- MATERIALS AND METHODS lar biology of MT stems from the observation that the genes Strains. The following yeast strains were used in the pres- for mammalian MT are regulated by heavy metals as well as ent study: Sc3, MATa ura3, trpl, his3, gal2, gallO CUpir; by glucocorticoids (2-3). MT genes from several different RH17-3d, MATa, leu2-3, leu2-112, his2, cuplS (Richard Hen- mammalian systems such as mouse, Chinese hamster, mon- derson); BR10, MATa trpl-1, his4-519, his-3 ade, gall CUpjr key, and human have been cloned and sequenced (4-7). (Brian Rymond). Although the precise mechanism of MT gene activation by Plasmids. The yeast plasmid YEp13 is a pBR322 derivative heavy metals has not been elucidated, a DNA sequence up- that carries a 2-,um segment as a yeast origin of replication stream of the 5' end of the mouse MT I gene, which is re- and the LEU2 gene for selection in yeast (17). The yeast sponsible for cadmium inducibility, has been identified (8, plasmid YEp36 containing the cloned yeast Cu-MT gene is a 9). Progress in defining other regulatory DNA sequences and derivative of YEp13 as described (14). Plasmid pYSK7 (un- isolating protein factors involved in regulation of the MT published data) is a galactokinase expression vector derived gene family has been hampered by the gene complexity of by insertion of a 1700-bp EcoRI-HindIII fragment containing higher eukaryotes. We have studied the yeast, Saccharomy- the E. coli galactokinase gene (galK) and the yeast cyto- ces cerevisiae, in which efficient DNA transformation tech- chrome c gene from plasmid YRpR72 (18) and a 630-bp niques have enhanced the power of classical yeast genetics. BamHI-Sau3A CEN3 fragment from pY3(CEN3)41 (19) into Copper-binding proteins have been detected in yeast and YRp7 (17). This low-copy-number plasmid contains unique termed either copper chelatin (10) or copper thionein (11). It restriction endonuclease sites upstream of the E. coli galK is also known that the CUP] locus is an important genetic structural gene, which allow insertion of sequences to be determinant of copper resistance in yeast (12). Fogel and tested for promoter activity. Plasmid pYSK12, containing Welch (12) have cloned the CUP] locus of yeast and shown the 431-bp Rsa I-BamHI fragment from YEp36, was con- that it is present in multiple, tandemly amplified copies in structed using standard methods for cloning and bacterial copper-resistant (genotype, CUPJr) strains but only one transformation (20) (see Fig. 4). Growth and transformation copy in copper-sensitive (cupJS) strains. They also have of yeast were performed as described previously (17). demonstrated that copper induces the accumulation of DNA Sequence Determination. The DNA sequence of the CUP] mRNA and of a small copper-binding protein desig- cloned yeast gene was determined as described (21). The se- nated copper chelatin in their work (13). quence was determined by 5' and 3' 32P-labeled ends of the Recently we cloned a copper-inducible gene from a CUpir restriction fragment, as described in the text. Analysis of the DNA sequence data was performed by computer programs The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" Abbreviations: bp, base pair(s); MT, metallothionein; Cu-MT, cop- in accordance with 18 U.S.C. §1734 solely to indicate this fact. per metallothionein; galK, E. coli galactokinase gene. 3332 Downloaded by guest on October 6, 2021 Biochemistry: Butt et aL Proc. NatL Acad. Sci. USA 81 (1984) 3333 of Intelligenetics Incorporated, Palo Alto, CA. cloned DNA fragment was amplified up to 30-fold in our Galactokinase Assay. Yeast cells (BR10) were grown in CUPir yeast strain (unpublished results; ref. 12); (iii) trans- yeast nitrogen base supplemented with adenine and histidine formation with YEp36 conferred copper resistance to other- (20 ,ug/ml each). Approximately 6 hr after addition of wise copper-sensitive yeast strains, indicating that the CuSO4, the cells were harvested (midlogarithmic phase). cloned DNA fragment contains the necessary information Cell extracts were prepared by breakage with glass beads required for copper-mediated gene activation (14); and (iv) (14). Galactokinase activity was determined essentially as the clone had restriction sites similar to those of the CUP] described (22) by using [14C]galactose as a substrate. For gene isolated previously (12). each assay, three time points were taken, and the activity Fig. 2 describes the DNA sequencing strategy. The nucle- was determined from the slope of the curve. Appropriate otide sequence of 936 bases, starting from one of the BamHI controls were included. A unit of galactokinase is defined as sites, is presented. For several of the restriction fragments, the amount of enzyme needed to convert 1 pmol of galactose the sequence was determined from both of the strands. The to galactose 1-phosphate per hr. DNA sequence was confirmed by sequencing three times in Other Methods. K562 tissue culture cells were challenged the same direction. Computer analysis of the sequence indi- with 6 /iM CdCl2 for 6 hr to induce MT. RNA gel electropho- cated a 186-nucleotide open reading frame (Fig. 2). This resis was performed in 1.5% agarose/6% formaldehyde (14). reading frame encodes a 61-amino-acid protein molecule that contains 12 cysteine and 8 serine residues. Thus, cysteine RESULTS accounts for 20% of the total amino acid residues in the yeast Yeast Cu-MT Is Related to Vertebrate MT. Previous stud- Cu-MT, as compared to the 32% cysteine that is present in ies (10, 14) indicate that the yeast Cu-MT is similar to mam- higher eukaryotic MTs (6, 7). The coding block is significant- malian MTs in that it is (i) a low molecular weight protein, (ii) ly G+C rich, whereas the controlling sequences flanking the rich in cysteine, and (iii) associated with as much as 90% of gene are 70% A+T. The TGC codon for cysteine is utilized the total cellular copper in yeast (14). We did not observe a twice as frequently as TGT. Apart from glutamine, which is MT-like protein when yeast cultures were challenged with preferentially coded by CAA, the codon usage for the rest of cadmium or zinc (14). Only copper induced a small molecu- the amino acids is random. Analysis of 1350-bp Cu-MT DNA lar weight, cysteine-rich protein, Cu-MT. and poly(A)+ RNA hybrid molecules by electron microsco- Fig. 1 shows blot hybridization analysis of total yeast py "R loop analysis" did not reveal the presence of any inter- RNA from a CUpir strain (Sc3) and a cupis strain (RH17-3d) vening sequences in the Cu-MT gene (data not shown). With transformed with YEp36 and of total RNA from cadmium- the exception of actin and ribosomal protein genes (23, 24), induced K562, a human chronic myelogenous leukemia cell the yeast RNA polymerase II genes do not contain introns. line. We observed a dramatic induction of Cu-MT mRNA A surprising observation was the presence of two phenylala- when yeast were challenged with 1 mM CuSO4 (lane 2). nine codons in the gene at positions 1 and 7 of the polypep- While synthesis of the yeast Cu-MT mRNA was detectable tide. None of the mammalian MTs studied to date contain in RH17-3d transformed with the high copy number plasmid phenylalanine. The significance of phenylalanine in the met- YEp36 (lane 3), the transcription was stimulated 50-fold after al binding or metal-transfer properties of the yeast MT is un- the addition of 0.5 mM CuSO4 (lane 4). The sizes of Cu-MT known. mRNA transcribed from the YEp36-transformed Cupls Dissimilarities to Other Metallothioneins. The structure of yeast strain were heterogenous. The most striking observa- the protein deduced from the DNA sequence analysis cor- tion was that the mobility of yeast Cu-MT mRNA was identi- relates moderately well with the amino acid composition of cal to the human MT mRNA. The electrophoretic mobility of the yeast copper thionein described by Weser et al. (11) and the proteins and the size of mRNA suggest that metal-regu- copper chelatin described by Premakumar et al. (10) with lated genes may be conserved. To further delineate the regard to the high content of cysteine, lysine, and serine. chemical basis of the apparent similarity, we determined the The discrepancies for several other amino acids may be due sequence of the yeast Cu-MT gene. to impurity of the protein studied by these groups. Table 1 Nucleotide Sequence of the Cu-MT Gene. Several lines of compares the amino acid composition of yeast Cu-MT, cop- evidence indicate that the clone isolated in our previous per thionein, and human MT. Several features of the yeast study encoded the yeast Cu-MT: (i) the transcription of the protein are common to higher eukaryotic MTs; however, cloned fragment was induced 50-fold by copper (14); (ii) the there also exist striking differences. The yeast Cu-MT con- tains 20% cysteine as compared to 32% present in the human and mouse MT, while lysine and serine are present in ap- 1 2 3 4 5 6 proximately similar amounts. The yeast protein contains _ 1078 10% glutamic acid, and the overall negative charge on the 868 protein is reflected by slower mobility on polyacrylamide gel 63 electrophoresis (unpublished results). The most surprising finding was the presence of two phenylalanine residues in the yeast Cu-MT. This is in contrast to MTs from higher eu- karyotes, which are devoid of aromatic amino acids. The tandem arrangement of cysteine residues in vertebrate MT is FIG. 1. Copper-mediated induction of yeast Cu-MT mRNA and believed to play a key role in clustering of the metals in the its comparison with human MT mRNA. Total RNA (50 ug) was protein. Fig. 3 shows a comparison of the arrangement of electrophoresed on a 1.5% agarose/formaldehyde gel. After electro- cysteine residues in the yeast Cu-MT to that of human MT. phoresis, the gel was blotted to nitrocellulose paper and hybridized Note that many of the cysteine residues in the yeast Cu-MT, with 32P-labeled nick-translated yeast Xba I-Kpn I fragment of Cu- as in human MT DNA (lanes 1-4) and monkey MT I and MT II cDNA probes MT, are flanked by serine or glycine. The clus- (lane 5) (9). Total RNA from lanes: 1, Sc3 CUpir yeast, uninduced; ters of cysteine in the yeast protein are not as frequent as in 2, Sc3 CUPYr yeast induced with 1.0 mM CUSO4; 3, RH17-3d cupls the case in human MT-e.g., Cys-Ser-Cys or Cys-Lys-Cys. yeast transformed with YEp36, uninduced 4 as in lane 3 but in- However, one striking homology is evident. The amino acid duced with 0.5 mM CuSO4; 5, K562, a human leukemic cell line sequence Lys-Lys-Ser-Cys-Cys-Ser (positions 54-59 in treated with 6 jxM CdCl2; 6, Hea III-cleaved 32P-labeled OX174 as a yeast) is precisely conserved in human MT. From these DNA marker. The yeast Cu-MT and monkey MT genes do not studies, it appears likely that the yeast protein binds copper cross-hybridize. Sizes are shown in bp. through thiolate metal clusters similar to those in the MTs of Downloaded by guest on October 6, 2021 3334 Biochemistry: Butt et aL Proc. Natl. Acad. Sci. USA 81 (1984)

4- 4-

YEP 36 1 B D* R A 0 RK B PBR - > 21cr vector vector

-4 100 Base Pairs A AluI 8 B*m HI D Dde I R RsaI X Xbol K KpnI

Bam HI -450 -440 -430 -420 -410 -400 GGATCCCATTACCGACAT TT GGGCGCTATACGTGCATATGTTCATGTATGTATCTGTATTTAAAACACT -390 -380 -370 -360 -350 -340 -330 TTTGTATTATTTTTCCTCATATATGTGTATAGGTTTATACGGATGATTTAATTATTACTTCACCACCCTT -290 -280 -270 -260 -320TATTTCAGGCTGATATCTTAGCCTTGTTACTAGTTAGAAAAAGACATTTTTGCTGTCAGTCACTGTCAAG-310 -300 -250 -240 -230 XbaI -220 -210 -200 -1 90 AGATTCTTTTGCTGGCATTTCTTCTAGAAGCAAAAAGAGCGATGCGTCTTTTCCGCTGAACCGTTC -180 -170 -160 -150 -140 -130 -120 CAGCAAAAA AGACTACCAACG CA ATATGGATTGTCAGAATCATATAAAAGAGAAGCAAATAACTCCTT -110 -1 00 -90 -80 -70 -60 -50 GTCTTGTATCAATTGCATTATAATATCTTCTTGTTAGTGCAATATCATATAGAAGTCATCGAAATAGATAT Rsa I -40 -30 -20 -1 0 1 0 20 TAAGAAAAACAAACTGTACAATCAATCAATCAATCATCACATAAA ATG TTC AGC GAA TTA ATT AAC METPhe Ser Glu Leu Ile Asn 30 40 50 60 70 80 TTC CAA AAT GAA GGT CAT GAG TGC CAA TGC CAA TGT GGT AGC TGC AAA AAT AAT GAA CAA Phe Gln Asn Glu Gly His Glu Cys Gln Cys Gln Cys Gly Ser Cys Lys Asn Asn Glu Gln 90 100 110 120 130 140 TGC CAA AAA TCA TGT AGC TGT CCA ACG GGG TGT AAC AGC GAC GAC AAA TGC CCT TGC GGT Cys Gln Lys Ser Cys Ser Cys Pro Thr Gly Cys Asn Ser Asp Asp Lys Cys Pro Cys Gly 150 160 170 180 190 200 AAC AAG TCT GAA GAA ACC AAG AAG TCA TGC TGC TCT GGG AAA TGA AAC GAA TAG TCTTTAA Asn Lys Ser Glu Glu Thr Lys Lys Ser Cys Cys Ser Gly Lys ** 210 220 230 240 250 260 270 TATATTCATCTAACTATTTGCTGTTTTTAATTTTTAAAAGG AGAAGGAAGTTTAATCGACGATTCTACTCAG 280 290 300 310 320 330 340 TTTGAGTACACTTATGTATTTTGTTTAGATACTTTGTTAATTTATAGGTATACGTTAATAATTAAGAA 350 360 370 380 390 400 410 AAGGAAATAAAGTATCTCCATATGTCGCCCCAAGAATAAAATATTATTAGCAAATTCTAGTTTGCCTAACT 420 430 440 450 460 470 KpnI TACAACTCTGTATAGAATCCCCAGATTTCGGATAAAAAAAAAAAAAAAAGCTATTCATGGTACC FIG. 2. DNA sequence of yeast gene. The strategy of DNA sequencing is shown at the top of the figure. The number of nucleotides has been marked on the upper margin. The termination codon is marked by a double asterisk. The transcriptional signals are highlighted by underlines. higher eukaryotes. However, because of the lack of exten- transcriptional signals 5' upstream from the coding block, sive primary sequence homology, it is impossible to know this alone is not unequivocal proof that the gene is function- whether these proteins are the product of convergent or di- al. To directly demonstrate that the DNA sequence at the 5' vergent evolution. end of the gene contains a promoter and regulatory informa- Transcriptional Signals in Cu-MT Gene. We analyzed the tion, the 431-bp BamHI-Rsa I fragment of the Cu-MT gene, DNA sequences present at the 5' and 3' flanking regions of was inserted into the hybrid plasmid pYSK7 as described in the gene, which are involved in the regulation of RNA tran- Materials and Methods (Fig. 4). Ligation of this fragment scription and termination, respectively. Based on the esti- into BamHI-Hpa I-cut pYSK7 places the Cu-MT regulatory mated size of mature poly(A)-containing Cu-MT mRNA of sequences upstream of the translation start codon of the E. 540 bases, we assume that the 3' end of the Cu-MT transcript coli galK gene. The resulting low-copy-number plasmid was is approximately in the region of position + 370. It is note- designated pYSK12. worthy that the hexanucleotide sequence A-A-T-A-A-A, A galactokinase-deficient strain, BR10, was transformed which is the only structure common to the 3' end of eukary- with pYSK12, and the transformants were selected for otic mRNAs (25), is present at position + 377. Analysis of the growth in the absence of tryptophan. The yeast transform- 5' end of Cu-MT sequence indicates that a T-A-T-A-A se- ants harboring pYSK7 or pYSK12 were examined for cop- quence is present at position -98 from the ATG. In addition per-induced synthesis of galactokinase. Cells were grown in to this sequence, a second T-A-T-A-A element is present at minimal medium containing 0, 20, 100, or 500 ,uM CUSO4. position - 138. The galactokinase activity of these cultures is summarized in Identification of Cu-MT Promoter and Regulatory DNA Se- Table 2. Plasmid pYSK7, lacking the yeast Cu-MT promoter quences. Although the DNA sequence data indicated that the sequences, produced very low levels of the enzyme under cloned gene contained the appropriate reading frame and any growth conditions. In cells containing pYSK12, the ga- Downloaded by guest on October 6, 2021 Biochemistry: Butt et aL Proc. Natl. Acad. Sci. USA 81 (1984) 3335 Table 1. Comparison of amino acid composition of yeast and human MT Percentage Amino acid Yeast* Yeastt Humant Alanine 0 2.2 11.5 Cysteine 20.0 20.0 32.8 Aspartic acid 3.3 0.§ 3.3 Glutamic acid 10.0 16.1 1.6 Phenylalanine 3.3 0 0 Glycine 8.3 10.1 8.2 Histidine 1.6 1.8 0 Isoleucine 1.6 1.1 0 BomHI HpoI EcoRI Lysine 11.6 12.0 11.5 GGATCCGTTAACGAATTCC CGAATCCGGAGTGTAAG Leucine 1.6 0 1.3 linker E coli gal K Methionine 1.6 0.5 1.6 t t Asparagine 10.0 14.5§ 1.6 Proline 3.3 4.7 1.6 XbaI-I"RsaI KpnI _ YEP 36 . NEI//I I Glutamine 8.3 0 1.6 Bam ; Bam HI HI ATG Arginine 0 0.2 PBR 0 -- TATAA Serine 13.3 9.5 13.1 vector vector Threonine 3.3 5.2 4.9 Valine 0 1.7 4.9 FIG. 4. The construction of yeast Cu-MT regulatory DNA se- Tryptophan 0 0 0 quences and E. coli galK fusion plasmid. The BamHI-Rsa I frag- Tyrosine ment containing the copper regulatory DNA sequences was ligated 0 0 0 to BamHI-Hpa I-cleaved pYSK7. The resultant fusion plasmid (pYSK12) contains Cu-MT regulatory sequences upstream of the E. Molecular weight 6573.18 10,000 5888.68 coli galK gene and CYC1 termination signals downsteam ofthe galK *From the DNA sequence of this study. gene. tAmino acid composition of the yeast copper thionein on the basis of the estimated molecular weights (11). transformants harboring pYSK12 in the presence of zinc, tHuman MT 11 (10). cadmium, or gold. The data in Table 2 indicate that the galac- §Determined as asparagine or aspartic acid. tokinase activity was not induced in response to these met- als. We conclude that the yeast Cu-MT sequences are specif- lactokinase activity was dramatically induced at all concen- ically responsive to copper and not responsive to zinc, cad- trations of CuS04 (Table 2). Maximum activity was ob- mium, or gold. served at a concentration of 100 AM CuSO4. These results clearly demonstrate that the DNA sequences upstream of DISCUSSION the Cu-MT coding sequences are responsible for copper-me- The yeast Cu-MT serves as an excellent model system for diated activation of galK in pYSK12. Our ability to select biophysical studies of a copper metalloprotein (11). At- and regulate the galk system in yeast should allow us to dis- tempts have been made to purify the protein to study its bio- sect cis- as well as trans-acting regulatory elements of the chemical properties; however, the structure of the protein Cu-MT gene. has not been elucidated (10, 11, 14). The DNA sequence of To test whether the yeast Cu-MT gene is regulated by oth- the yeast Cu-MT genomic clone described in this paper and er heavy metals, we assayed the galactokinase levels in yeast by Karin et al. (16) should provide a basis for (i) study of the elements involved in regulation of the gene by CuS04; HLmA MT: MET -ASP-PRO-ASNIJ-SERw ALA-ALA-GLY-ASP- (it) elucidation of DNA sequences involved in amplification -PH-L-SNGUGY-I-GU of Cu-MT gene; (iii) elucidation of protein structure, allow- YEAST CutMT: WIT-PHE-SERW-GLu-FuIL-E-ASN4E-PHELN-ASN-GWu-Y-HIS-Gwt& ing better understanding of the metal-protein interactions; 1 0 and (iv) comparison with higher eukaryotic MTs. Our results indicate HLr MT: SER ()THR LYsj}Lys-GLu-(LYs that the yeast Cu-MT shares common )A'A-GLY-SER-( features with the higher eukaryotic MT, yet there are strik- YEAST Cu-M: GLN-(E)-GLN-@GLY-SER-( LYS-ASN-ASN-GLu-GLN-(GLN-LYS- ing differences. The molecular weight of the yeast Cu-MT is 20 30 6573 daltons, while the vertebrate MTs are around 5900 (1). Although the presence of cysteine in yeast Cu-MT is a typi- Hiw Mi: THR-SER LSLSSREPOV LLY-G cal feature of a metal-binding protein, the arrangement of cysteine residues is somewhat different from cadmium and YEAST Cu-Mi: SER &SER -( NO-THR-GLY-0)ASN-SER-ASP-ASP-LYS-&PRO- zinc MTs of higher eukaryotes. Application of the Chou- 40 Fasman method for secondary structure prediction (26) sug- gests that, except for short regions of a helix and P sheets, Hum MT: ALA-Lys &ALA-GLN-GLY-ft-ILE-&LYS-GLY-ALA-SER-ASP-LYS- the dominant structure of the protein is composed of 3 turns in the absence of metals. This is consistent with secondary YEAST Cu-M: -GLY-AsN-Lys-SER-GLu-GL-THRtLYS-LysSE-S SER]GLY- structure of mammalian MT obtained by 1"3Cd NMR/'H 50 NMR studies (27) and with the structure of yeast Cu-MT ob- HLAN MT: ALA tained by circular dichroism (11). The apparent lack of sec- &SER-& ondary structure is ideal for the binding of multiple metal YEAST CU-Mi: Lys- ions and poises the protein to acquire an appropriate struc- 61 ture depending upon the metal bound. Based on an assumed stoichiometry of copper:cysteine-sulphur of 1:2 as deter- FIG. 3. Comparison of cysteine residues in yeast Cu-MT and hu- mined-for the yeast copper thionein (11), one mol of protein man MT. would chelate 6 mol of copper. Downloaded by guest on October 6, 2021 3336 Biochemistry: Butt et aL Proc. Nat{. Acad. Sci. USA 81 (1984)

Table 2. Copper-mediated induction of E. coli galK in yeast metal storage, metal transport, and regulation of metalloen- zyme activity. With the advent of "reverse yeast genetics" Galactokinase, units per 1.25 x 106 (28), it is possible to ask whether disruption of the Cu-MT cells gene is a lethal event for yeast. Yeast-harboring Yeast-harboring Metal pYSK12 pYSK17 The authors thank Michael Karin for his data on the CUP] locus and Ms. Judy Seaman for her assistance in preparation of this manu- None 4.9 (± 4.4) 5.1 (± 1.4) script. T.R.B. thanks Dr. R. Simpson and Dr. L. W. Bergman ofthe CuSO4 National Institute of Arthritis, Diabetes, and Digestive and Kidney 20 ,M 125 Diseases for his encouragement during the early stages of this work. 100 AM 242 7.2 (± 4.2) 500 AM 197 1. Kagi, J. H. R. & Nordberg, M. (1979) Metallothionein (Berk- ZnSO4 haser, Basel). 1.0 juM 3.5 (± 0.5) 2. Enger, M. D., Rall, L. B. & Hildebrand, C. E. (1979) Nucleic CdSO4 Acids Res. 7, 271-288. 3. Karin, M. & Herschman, H. R. (1981) Eur. J. Biochem. 113, 2.0 AuM 2.3 (± 2.0) 267-272. 5.0 AM 3.9 (± 0.8) 4. Glanville, N., Durnam, D. M. & Palmiter, R. D. (1981) Nature NaAuCl4 (London) 292, 267-269. 3.0 AtM 3.2 (± 0.6) 5. Griffith, B. B., Walters, R. A., Enger, M. D., Hildebrand, C. E. & Griffith, J. K. (1983) Nucleic Acids Res. 11, 901-910. 5' 6. Schmidt, C. J. & Hamer, D. H. (1983) Gene 24, 137-146. Definitive proof that the 5'-upstream and/or untranslat- 7. Karin, M. & Richards, R. I. (1982) Nature (London) 299, 797- ed DNA sequences are responsive to copper regulation was 802. obtained by fusing the cloned fragment with the E. coli galK 8. Palmiter, R. D., Brinster, R. L., Hammer, R. E., Trumbauer, gene (Fig. 4). We observed a 50-fold increase in galK expres- M. E., Rosenfeld, M. G., Birnberg, N. C. & Evans, R. M. sion upon addition of CuSO4, using a plasmid present in sin- (1982) Nature (London) 300, 611-615. gle copy (Table 2). This indicates that copper inducibility of 9. Pavlakis, G. N. & Hamer, D. H. (1983) Proc. Nati. Acad. Sci. Cu-MT is retained on autonomously replicating plasmids in USA 80, 397-401. yeast. The ability to regulate the transcription on multicopy 10. Premakumar, R., Winge, D. R., Wiley, R. D. & Rajagopalan, YEp36 (Fig. 1)-suggests that the activator K. V. (1975) Arch. Biochem. Biophys. 170, 267-277. plasmids-i.e., 11. Weser, U., Hartman, H., Fretzdorff, A. & Strobel, G. (1977) or repressor of the gene may be present in multiple numbers Biochim. Biophys. Acta 493, 465-477. in the cell. Thus, the minichromosomes of the yeast Cu-MT 12. Fogel, S. & Welch, J. S. (1982) Proc. Natl. Acad. Sci. USA 79, present a promising system to isolate protein factors that 5342-5346. regulate transcription of the gene. Our findings concerning 13. Fogel, S., Welch, J. W., Cathala, G. & Karin, M. (1983) Curr. the Cu-MT promoter (Table 2) show it to be an excellent Genet. 7, 347-355. system for the expression of heterologous gene products in 14. Butt, T. R., Steinberg, E., Herd, J. & Crooke, S. T. (1984) yeast. We also demonstrated that the yeast Cu-MT gene se- Gene 27, 23-33. quences are specifically regulated by copper, while zinc, 15. Butt, T., Herd, J. & Crooke, S. T. (1983) The Molecular Biolo- are unable to induce 2). gy of Yeast: The 1983 Annual Yeast Meeting (Cold Spring Har- cadmium, and gold (Table bor Laboratory, Cold Spring Harbor, NY). The inability to induce the yeast Cu-MT with cadmium or 16. Karin, M., Najarian, R., Haslinger, A., Valenzuela, P., Welch, zinc raises the question as to how yeast responds to these J. & Fogel, S. (1984) Proc. Natl. Acad. Sci. USA 81, 337-341. metals. It is possible that zinc and cadmium toxicity is allevi- 17. Sherman, F., Fink, G. R. & Hicks, J. B. (1982) Methods in ated by a transport barrier. We speculate that cadmium- and Yeast Genetics: A Laboratory Manual (Cold Spring Harbor zinc-inducible MT loci may not be present in the yeast Laboratory, Cold Spring Harbor, NY). strains studied by us. This view is consistent with the obser- 18. Rymond, B. C., Zitomer, R. S., Schumperli, D. & Rosenberg, vation that, when monkey MT I and II cDNA (6) was hybrid- M. (1983) Gene 25, 249-262. ized with yeast DNA, even under nonstrigent conditions we 19. Clarke, W. & Carbon, J. (1980) Nature (London) 287, 504-509. re- 20. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular did not observe any cross-hybridization (unpublished Cloning: A Laboratory Manual (Cold Spring Harbor Labora- sults). It is probable that, in the vertebrate system, the cad- tory, Cold Spring Harbor, NY). mium/zinc MT is a member of a gene family whose gene 21. Maxam, A. M. & Gilbert, W. (1980) Methods Enzymol. 65, activity is regulated by a variety of stimuli including gluco- 499-560. corticoids cadmium and zinc (2, 3). It is likely that a variety 22. Nogi, Y., Matsumoto, K., Thoe, A. & Oshima, Y. (1977) Mol. of heavy metals, including copper and gold, may interact Gen. Genet. 152, 137-144. with MTs and yet not induce the transcription of the gene(s). 23. Gallwitz, D., Perrin, F. & Seidel, R. (1981) Nucleic Acids Res. Indeed previous studies have identified 11 MT-related genes 9, 6339-6350. K. & J. R. in humans (7). Since no detailed studies concerning the cop- 24. Fried, H. M., Pearson, N. J., Kim, C. Warner, (1981) J. Biol. Chem. 251, 10176-10183. per metallothionein isolated from higher eukaryotes (10) 25. Montell, C., Fisher, E. F., Caruthers, M. H. & Berk, A. J. have been performed, we do not know whether these Cu- (1983) Nature (London) 305, 600-605. MTs are related to the yeast or to human MTs. 26. Chou, P. & Fasman, G. D. (1978) Adv. Enzymol. 47, 45-147. We have observed that the yeast Cu-MT mRNA is synthe- 27. Boulanger, Y., Goodman, C. M., Forte, C. P., Fesik, S. W. & sized at a detectable level in the absence of the metal (Fig. 1; Armitage, I. M. (1983) Proc. Natl. Acad. Sci. USA 80, 1501- ref. 14). Thus, in addition to their role as detoxification 1505. agents, MTs may also perform essential functions such as 28. Struhl, K. (1983) Nature (London) 305, 391-397. Downloaded by guest on October 6, 2021