DOCSLIB.ORG

Deletion of GPIHBP1 Causing Severe Chylomicronemia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Deletion of GPIHBP1 Causing Severe Chylomicronemia J Inherit Metab Dis (2012) 35:531–540 DOI 10.1007/s10545-011-9406-5 ORIGINAL ARTICLE Deletion of GPIHBP1 causing severe chylomicronemia Jonathan J. Rios & Savitha Shastry & Juan Jasso & Natalie Hauser & Abhimanyu Garg & André Bensadoun & Jonathan C. Cohen & Helen H. Hobbs Received: 18 July 2011 /Revised: 20 September 2011 /Accepted: 22 September 2011 /Published online: 19 October 2011 # The Author(s) 2011. This article is published with open access at Springerlink.com Abstract Lipoprotein lipase (LPL) is a hydrolase that Asian Indian boy who had severe chylomicronemia at 2 cleaves circulating triglycerides to release fatty acids to months of age. Array-based copy-number analysis of his the surrounding tissues. The enzyme is synthesized in genomic DNA revealed homozygosity for a 17.5-kb parenchymal cells and is transported to its site of action on deletion that included GPIHBP1. A 44-year-old aunt with the capillary endothelium by glycophosphatidylinositol a history of hypertriglyceridemia and pancreatitis was also (GPI)-anchored high-density lipoprotein-binding protein 1 homozygous for the deletion. A bolus of intravenously (GPIHBP1). Inactivating mutations in LPL; in its cofactor, administered heparin caused a rapid increase in circulating apolipoprotein (Apo) C2; or in GPIHBP1 cause severe LPL and decreased plasma triglyceride levels in control hypertriglyceridemia. Here we describe an individual with individuals but not in two GPIHBP1-deficient patients. complete deficiency of GPIHBP1. The proband was an Thus, short-term treatment with heparin failed to attenuate the hypertriglyceridemia in patients with GPIHBP1 deficiency. The increasing resolution of copy number microarrays and Communicated by: Ertan Mayatepek their widespread adoption for routine cytogenetic analysis is Competing interest: None declared. likely to reveal a greater role for submicroscopic deletions in Electronic supplementary material The online version of this article Mendelian conditions. We describe the first neonate with (doi:10.1007/s10545-011-9406-5) contains supplementary material, complete GPIHBP1 deficiency due to homozygosity for a which is available to authorized users. deletion of GPIHBP1. J. J. Rios : J. Jasso : N. Hauser : A. Garg : J. C. Cohen (*) : H. H. Hobbs (*) Eugene McDermott Center for Human Growth and Development, Introduction University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd, Dallas, TX 75390, USA Type I hyperlipoproteinemia is a rare, autosomal recessive e-mail: [email protected] disorder characterized by the accumulation of large e-mail: [email protected] triglyceride-rich lipoproteins in the circulation (chylomi- cronemia), which leads to the development of eruptive S. Shastry : A. Garg : J. C. Cohen Division of Nutrition and Metabolic Diseases, Center for Human xanthomas, failure to thrive, and recurrent pancreatitis Nutrition, University of Texas Southwestern Medical Center, (Brunzell and Deeb 2001). The disorder is caused by Dallas, TX, USA mutations that disrupt the lipolytic processing of triglyceride- rich lipoproteins, including inactivating mutations in genes A. Bensadoun Division of Nutritional Sciences, Cornell University, encoding lipoprotein lipase (LPL) (Havel and Gordon 1960), Ithaca, NY, USA the enzyme that hydrolyzes circulating triglycerides; its cofactor, APOC2 (Breckenridge et al. 1978); a lipase- H. H. Hobbs specific chaperone known as lipase maturation factor 1 Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, (Peterfy et al. 2007); and the protein that anchors the enzyme Dallas, TX, USA to the endothelial surface, glycophosphatidylinositol 532 J Inherit Metab Dis (2012) 35:531–540 (GPI)-anchored high-density lipoprotein-binding protein Sequence variants were verified by manually inspecting 1 (GPIHBP1) (Beigneux et al. 2007). GPIHBP1 was chromatograms. originally identified as a high-density lipoprotein (HDL)- binding protein (Ioka et al. 2003), but the subsequent Genotyping and copy number variation (CNV) detection Array- finding that Gpihbp1 knockout mice have severe hyper- based single nucleotide polymorphism (SNP) genotyping triglyceridemia revealed an essential role for the protein in was performed on genomic DNA from proband 1 using the the action of LPL at capillary endothelial surfaces (Beigneux human 1-M Beadchip (Illumina, San Diego, CA, USA) et al. 2007). LPL is synthesized primarily by adipocytes, according to the manufacturer’s Infinium II Assay protocol. skeletal myocytes, and cardiomyocytes and is secreted into Briefly, 750 ng of genomic DNA was amplified, enzymat- the extracellular space where it binds proteoglycans (Brunzell ically fragmented, and precipitated with isopropanol, as and Deeb 2001). GPIHBP1 binds LPL in the capillary described (Illumina’s Infinium II Assay). The fragmented subendothelial spaces and translocates the enzyme to the genomic DNA was hybridized with an Illumina Human 1-M luminal surfaces of endothelial cells (Davies et al. 2010). In beadchip that contained 50-mer probes attached to a silicon- mice lacking GPIHBP1, heparin-releasable LPL activity is based array that interrogates 1,072,820 SNP. A single-base reduced (Beigneux et al. 2007). GPIHBP1 appears to extension reaction was performed to label the annealed DNA function as a platform for lipolysis of circulating triglycerides in an allele-specific manner. The hybridized array was (Beigneux et al. 2007). scanned using the Illumina BeadArray Reader to image the Human GPIHBP1 is located on the distal long arm of laser-excited fluorophores for each probe. Data was analyzed chromosome 8 and encodes a 184-amino-acid protein that using the Beadstudio Genotyping Module (v3.3.7). Individual contains three domains: N-terminal highly acidic, lympho- probe log ratios [logR = log2 (sample intensity/expected cyte antigen (Ly6), and C-terminal to which the glyco- reference intensity)] were plotted by their genomic positions phosphatidylinositol is attached (Beigneux et al. 2009a). using the Genome Browser in the Illumina Genome Viewer Mutations in the acidic and Ly6 domains interfere with the (v3.2.9). A smoothing line was generated using a 200-kb ability of GPIHBP1 to bind LPL and chylomicrons moving average window to enhance visualization of the (Beigneux et al. 2009c; Gin et al. 2008). Several mutations copy number gains and losses in the Genome Viewer. in GPIHBP1 gene have been identified in patients with Probe-intensity data was analyzed using Partek Genomic chylomicronemia (Table 1). Here, we describe the first Suite software (Partek, St. Louis, MO, USA). Briefly, copy reported patient with a complete absence of GPIHBP1 due number was estimated from intensity values relative to to a deletion of GPIHBP1 and assess the therapeutic baseline copy number calculated from array results of seven efficacy of heparin in this individual and in a second unrelated individuals with other genetic disorders. Genomic patient with hypertriglyceridemia who was homozygous for segmentation algorithms were used to identify genomic missense mutation c.203 G >A (p.Cys68Tyr) in GPIHBP1. regions that differed significantly in signal intensity. Genotype data was imported into Partek Genomic Suite software and analyzed using a Hidden Markov Model Materials and methods (Churchill 1989) to identify regions of homozygosity. For comparison, we examined genotype data from an offspring of Study participants The study was approved by the Institu- a second-cousin mating and from six European Americans tional Review Board of the University of Texas Southwestern who were offspring of nonconsanguinious matings. Size Medical Center, USA. Written informed consent was obtained distributions of the regions of homozygosity are represented from all participants prior to collecting venous blood after a asaquantileplot. 12-h fast. Genomic DNA was extracted using the Gentra Puregene Blood Kit (Qiagen, Valencia, CA,USA) or the Easy- GPIHBP1 deletion mapping and pedigree analysis To DNA kit (Invitrogen, Carlsbad, CA,USA) following the define the deletion breakpoints, oppositely oriented oligo- manufacturers’ protocol. Fasting plasma lipids and lipopro- nucleotides complementary to sequences flanking the teins were measured by Quest Diagnostics. putative deletion were used to amplify the deletion junction. The primers used to amplify the junction were as follows: Sequencing coding regions of candidate genes The exons forward, 5′-GCATCAGGTATGAAGAGTTTGG-3′ and re- of LPL, APOC2, APOA5, and LMF1 were amplified from verse, 5′-CAGGGTCTGTGTGGAAGAGG-3′. 50 ng of genomic DNA using the polymerase chain reaction (PCR) and oppositely oriented oligonucleotides Heparin infusion Fasting blood samples were collected that flank the exons of these genes (Supplementary Table 1). from each patient from a heparin lock. A total of 100 U/kg Amplification products were sequenced using dye- heparin was infused intravenously (APP Pharmaceuticals, terminator chemistry and an ABI 3730xl DNA analyzer. Schaumburg, IL, USA). Venous blood samples were then J Inherit Metab Dis (2012) 35:531 Table 1 Clinical characteristics of patients with GPIHBP1 deficiency Reference Wang and Beigneux Olivecrona Franssen Coca-Prieto Charriere This report Hegele 2007 et al. (2009b) et al. (2010) et al. (2010) et al. (2011) et al. (2011) – 540 Mutation in G56R/G56R G56R/G56R Q115P/Q115P C65S/C68G C65S/C68G C65S/C68G C65Y/C65Y C68Y/C68Y C89F/Deletion G175RG175R C68Y/C68Y Deletion/ GPIHBP1 deletion Current Age 47/F 52/M 33/M 40/F 35/M
Load more

Recommended publications
  • A Rare Variant in MCF2L Identified Using Exclusion Linkage in A
    European Journal of Human Genetics (2016) 24, 86–91 & 2016 Macmillan Publishers Limited All rights reserved 1018-4813/16 www.nature.com/ejhg ARTICLE A rare variant in MCF2L identified using exclusion linkage in a pedigree with premature atherosclerosis Stephanie Maiwald1,7, Mahdi M Motazacker1,7,8, Julian C van Capelleveen1, Suthesh Sivapalaratnam1, Allard C van der Wal2, Chris van der Loos2, John JP Kastelein1, Willem H Ouwehand3,4, G Kees Hovingh1, Mieke D Trip1,5, Jaap D van Buul6 and Geesje M Dallinga-Thie*,1 Cardiovascular disease (CVD) is a major cause of death in Western societies. CVD risk is largely genetically determined. The molecular pathology is, however, not elucidated in a large number of families suffering from CVD. We applied exclusion linkage analysis and next-generation sequencing to elucidate the molecular defect underlying premature CVD in a small pedigree, comprising two generations of which six members suffered from premature CVD. A total of three variants showed co-segregation with the disease status in the family. Two of these variants were excluded from further analysis based on the prevalence in replication cohorts, whereas a non-synonymous variant in MCF.2 Cell Line Derived Transforming Sequence-like protein (MCF2L, c.2066A4G; p.(Asp689Gly); NM_001112732.1), located in the DH domain, was only present in the studied family. MCF2L is a guanine exchange factor that potentially links pathways that signal through Rac1 and RhoA. Indeed, in HeLa cells, MCF2L689Gly failed to activate Rac1 as well as RhoA, resulting in impaired stress fiber formation. Moreover, MCF2L protein was found in human atherosclerotic lesions but not in healthy tissue segments.
    [Show full text]
  • Remodeling Adipose Tissue Through in Silico Modulation of Fat Storage For
    Chénard et al. BMC Systems Biology (2017) 11:60 DOI 10.1186/s12918-017-0438-9 RESEARCHARTICLE Open Access Remodeling adipose tissue through in silico modulation of fat storage for the prevention of type 2 diabetes Thierry Chénard2, Frédéric Guénard3, Marie-Claude Vohl3,4, André Carpentier5, André Tchernof4,6 and Rafael J. Najmanovich1* Abstract Background: Type 2 diabetes is one of the leading non-infectious diseases worldwide and closely relates to excess adipose tissue accumulation as seen in obesity. Specifically, hypertrophic expansion of adipose tissues is related to increased cardiometabolic risk leading to type 2 diabetes. Studying mechanisms underlying adipocyte hypertrophy could lead to the identification of potential targets for the treatment of these conditions. Results: We present iTC1390adip, a highly curated metabolic network of the human adipocyte presenting various improvements over the previously published iAdipocytes1809. iTC1390adip contains 1390 genes, 4519 reactions and 3664 metabolites. We validated the network obtaining 92.6% accuracy by comparing experimental gene essentiality in various cell lines to our predictions of biomass production. Using flux balance analysis under various test conditions, we predict the effect of gene deletion on both lipid droplet and biomass production, resulting in the identification of 27 genes that could reduce adipocyte hypertrophy. We also used expression data from visceral and subcutaneous adipose tissues to compare the effect of single gene deletions between adipocytes from each
    [Show full text]
  • Severe Hypertriglyceridemia in a Patient Heterozygous for a Lipoprotein Lipase Gene Allele with Two Novel Missense Variants
    European Journal of Human Genetics (2015) 23, 1259–1261 & 2015 Macmillan Publishers Limited All rights reserved 1018-4813/15 www.nature.com/ejhg SHORT REPORT Severe hypertriglyceridemia in a patient heterozygous for a lipoprotein lipase gene allele with two novel missense variants Ursula Kassner*,1, Bastian Salewsky2,3, Marion Wühle-Demuth1, Istvan Andras Szijarto1, Thomas Grenkowitz1, Priska Binner4, Winfried März4,5,6, Elisabeth Steinhagen-Thiessen1,2 and Ilja Demuth*,2,3 Rare monogenic hyperchylomicronemia is caused by loss-of-function mutations in genes involved in the catabolism of triglyceride-rich lipoproteins, including the lipoprotein lipase gene, LPL. Clinical hallmarks of this condition are eruptive xanthomas, recurrent pancreatitis and abdominal pain. Patients with LPL deficiency and severe or recurrent pancreatitis are eligible for the first gene therapy treatment approved by the European Union. Therefore the precise molecular diagnosis of familial hyperchylomicronemia may affect treatment decisions. We present a 57-year-old male patient with excessive hypertriglyceridemia despite intensive lipid-lowering therapy. Abdominal sonography showed signs of chronic pancreatitis. Direct DNA sequencing and cloning revealed two novel missense variants, c.1302A4T and c.1306G4A, in exon 8 of the LPL gene coexisting on the same allele. The variants result in the amino-acid exchanges p.(Lys434Asn) and p.(Gly436Arg). They are located in the carboxy-terminal domain of lipoprotein lipase that interacts with the glycosylphosphatidylinositol- anchored HDL-binding protein (GPIHBP1) and are likely of functional relevance. No further relevant mutations were found by direct sequencing of the genes for APOA5, APOC2, LMF1 and GPIHBP1. We conclude that heterozygosity for damaging mutations of LPL may be sufficient to produce severe hypertriglyceridemia and that chylomicronemia may be transmitted in a dominant manner, at least in some families.
    [Show full text]
  • Protein O-Glcnacylation Is Essential for the Maintenance of Renal Energy Homeostasis and Function Via Lipolysis During Fasting and Diabetes
    BASIC RESEARCH www.jasn.org Protein O-GlcNAcylation Is Essential for the Maintenance of Renal Energy Homeostasis and Function via Lipolysis during Fasting and Diabetes Sho Sugahara,1 Shinji Kume,1 Masami Chin-Kanasaki,1,2 Issei Tomita,1 Mako Yasuda-Yamahara,1 Kosuke Yamahara,1 Naoko Takeda,1 Norihisa Osawa,1 Motoko Yanagita,3 Shin-ichi Araki,1,2 and Hiroshi Maegawa1 1Department of Medicine, Shiga University of Medical Science, Otsu, Shiga, Japan; 2Division of Blood Purification, Shiga University of Medical Science Hospital, Otsu, Shiga, Japan; and 3Department of Nephrology, Graduate School of Medicine, Kyoto University, Kyoto, Japan ABSTRACT Background Energy metabolism in proximal tubular epithelial cells (PTECs) is unique, because ATP pro- duction largely depends on lipolysis in both the fed and fasting states. Furthermore, disruption of renal lipolysis is involved in the pathogenesis of diabetic tubulopathy. Emerging evidence suggests that protein O-GlcNAcylation, an intracellular nutrient-sensing system, may regulate a number of metabolic pathways according to changes in nutritional status. Although O-GlcNAcylation in PTECs has been demonstrated experimentally, its precise role in lipolysis in PTECs is unclear. Methods To investigate the mechanism of renal lipolysis in PTECs—specifically, the role played by protein O-GlcNAcylation—we generated mice with PTECs deficient in O-GlcNAc transferase (Ogt). We analyzed their renal phenotypes during ad libitum feeding, after prolonged fasting, and after mice were fed a high- fat diet for 16 weeks to induce obesity and diabetes. Results Although PTEC-specific Ogt-deficient mice lacked a marked renal phenotype during ad libitum feeding, after fasting 48 hours, they developed Fanconi syndrome–like abnormalities, PTEC apoptosis, and lower rates of renal lipolysis and ATP production.
    [Show full text]
  • Genetics of Hypertriglyceridemia
    REVIEW published: 24 July 2020 doi: 10.3389/fendo.2020.00455 Genetics of Hypertriglyceridemia Jacqueline S. Dron and Robert A. Hegele* Departments of Medicine and Biochemistry, Schulich School of Medicine and Dentistry, Robarts Research Institute, Western University, London, ON, Canada Hypertriglyceridemia, a commonly encountered phenotype in cardiovascular and metabolic clinics, is surprisingly complex. A range of genetic variants, from single-nucleotide variants to large-scale copy number variants, can lead to either the severe or mild-to-moderate forms of the disease. At the genetic level, severely elevated triglyceride levels resulting from familial chylomicronemia syndrome (FCS) are caused by homozygous or biallelic loss-of-function variants in LPL, APOC2, APOA5, LMF1, and GPIHBP1 genes. In contrast, susceptibility to multifactorial chylomicronemia (MCM), which has an estimated prevalence of ∼1 in 600 and is at least 50–100-times more common than FCS, results from two different types of genetic variants: (1) rare heterozygous variants (minor allele frequency <1%) with variable penetrance in the five causal genes for FCS; and (2) common variants (minor allele frequency >5%) whose individually small phenotypic effects are quantified using a polygenic score. There is indirect evidence of similar complex genetic predisposition in other clinical phenotypes that have a component of hypertriglyceridemia, such as combined hyperlipidemia and Edited by: dysbetalipoproteinemia. Future considerations include: (1) evaluation of whether the Marja-Riitta Taskinen, University of Helsinki, Finland specific type of genetic predisposition to hypertriglyceridemia affects medical decisions Reviewed by: or long-term outcomes; and (2) searching for other genetic contributors, including the Jan Albert Kuivenhoven, role of genome-wide polygenic scores, novel genes, non-linear gene-gene or gene- University Medical Center environment interactions, and non-genomic mechanisms including epigenetics and Groningen, Netherlands Anne Tybjaerg-Hansen, mitochondrial DNA.
    [Show full text]
  • A Learning-Based Framework for Drug-Target Interaction Identification Using Neural Networks and Network Representation
    DLDTI: A learning-based framework for drug-target interaction identication using neural networks and network representation Yihan Zhao Department of Graduate School, Beijing University of Chinese Medicine, Beijing, China Kai Zheng School of Computer Science and Engineering, Central South University, Changsha, China Baoyi Guan National Clinical Research Center for Chinese Medicine Cardiology, Xiyuan Hospital, China Academy of Chinese Medical Sciences, Beijing, China Mengmeng Guo Institute of Cardiovascular Sciences, Health Science Center, Peking University, Key laboratory of Molecular Cardiovascular Sciences, Ministry of Education, Beijing, China Lei Song Department of Graduate School, Beijing University of Chinese Medicine, Beijing, China Jie Gao National Clinical Research Center for Chinese Medicine Cardiology, Xiyuan Hospital, China Academy of Chinese Medical Sciences, Beijing, China Hua Qu National Clinical Research Center for Chinese Medicine Cardiology, Xiyuan Hospital, China Academy of Chinese Medical Sciences, Beijing, China Yuhui Wang Institute of Cardiovascular Sciences, Health Science Center, Peking University, Key laboratory of Molecular Cardiovascular Sciences, Ministry of Education, Beijing, China Dazhuo Shi National Clinical Research Center for Chinese Medicine Cardiology, Xiyuan Hospital, China Academy of Chinese Medical Sciences, Beijing, China Ying Zhang ( [email protected] ) China Academy of Chinese Medical Sciences https://orcid.org/0000-0002-7549-3968 Research Keywords: drug-target interaction; heterogeneous information; network representation learning; stacked auto-encoder; deep convolutional neural networks; atherosclerosis Posted Date: October 27th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-56700/v3 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published on November 13th, 2020.
    [Show full text]
  • The Acidic Domain of the Endothelial Membrane Protein GPIHBP1
    RESEARCH ARTICLE The acidic domain of the endothelial membrane protein GPIHBP1 stabilizes lipoprotein lipase activity by preventing unfolding of its catalytic domain Simon Mysling1,2,3, Kristian Kølby Kristensen1,2, Mikael Larsson4, Anne P Beigneux4, Henrik Ga˚ rdsvoll1,2, Loren G Fong4, Andre´ Bensadouen5, Thomas JD Jørgensen3, Stephen G Young4,6, Michael Ploug1,2* 1Finsen Laboratory, Rigshospitalet, Copenhagen, Denmark; 2Biotech Research and Innovation Centre, University of Copenhagen, Copenhagen, Denmark; 3Department of Biochemistry and Molecular Biology, University of Southern Denmark, Odense, Denmark; 4Department of Medicine, University of California, Los Angeles, Los Angeles, United States; 5Division of Nutritional Science, Cornell University, Ithaca, United States; 6Department of Human Genetics, University of California, Los Angeles, Los Angeles, United States Abstract GPIHBP1 is a glycolipid-anchored membrane protein of capillary endothelial cells that binds lipoprotein lipase (LPL) within the interstitial space and shuttles it to the capillary lumen. The LPL.GPIHBP1 complex is responsible for margination of triglyceride-rich lipoproteins along capillaries and their lipolytic processing. The current work conceptualizes a model for the GPIHBP1.LPL interaction based on biophysical measurements with hydrogen-deuterium exchange/ mass spectrometry, surface plasmon resonance, and zero-length cross-linking. According to this model, GPIHBP1 comprises two functionally distinct domains: (1) an intrinsically disordered acidic N-terminal domain; and (2) a folded C-terminal domain that tethers GPIHBP1 to the cell membrane by glycosylphosphatidylinositol. We demonstrate that these domains serve different roles in *For correspondence: m-ploug@ regulating the kinetics of LPL binding. Importantly, the acidic domain stabilizes LPL catalytic activity finsenlab.dk by mitigating the global unfolding of LPL’s catalytic domain.
    [Show full text]
  • Biochemistry and Pathophysiology of Intravascular and Intracellular Lipolysis
    Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Biochemistry and pathophysiology of intravascular and intracellular lipolysis Stephen G. Young1,2,4 and Rudolf Zechner3,4 1Department of Medicine, 2Department of Human Genetics, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, California 90095; 3Institute of Molecular Biosciences, University of Graz, 8010 Graz, Austria All organisms use fatty acids (FAs) for energy substrates (TGs). A large fraction of FAs in TG-rich lipoproteins and as precursors for membrane and signaling lipids. The (TRLs; chylomicrons and very-low-density lipoproteins most efficient way to transport and store FAs is in the [VLDL]) and in cytoplasmic lipid droplets (LDs) are found form of triglycerides (TGs); however, TGs are not capable in the form of TGs. In response to metabolic demand, of traversing biological membranes and therefore need to TGs can be hydrolyzed to FAs and glycerol by a process be cleaved by TG hydrolases (‘‘lipases’’) before moving in called lipolysis, which involves the enzymatic activity or out of cells. This biochemical process is generally of TG hydrolases (lipases). called ‘‘lipolysis.’’ Intravascular lipolysis degrades lipo- The importance of lipolysis for virtually all organisms protein-associated TGs to FAs for their subsequent became clear with the realization that TGs cannot move uptake by parenchymal cells, whereas intracellular lipo- across cell membranes without first being degraded by lysis generates FAs and glycerol for their release (in the lipases. More than a century ago, it was observed that case of white adipose tissue) or use by cells (in the case of pancreatic juice contains a ‘‘fat-splitting’’ activity and other tissues).
    [Show full text]
  • Supplementary Materials
    Supplementary Materials 1 Supplementary Figure S1. Expression of BPIFB4 in murine hearts. Representative immunohistochemistry images showing the expression of BPIFB4 in the left ventricle of non-diabetic mice (ND) and diabetic mice (Diab) given vehicle or LAV-BPIFB4. BPIFB4 is shown in green, nuclei are identified by the blue fluorescence of DAPI. Scale bars: 1 mm and 100 μm. 2 Supplementary Table S1 – List of PCR primers. Target gene Primer Sequence NCBI Accession number / Reference Forward AAGTCCCTCACCCTCCCAA Actb [1] Reverse AAGCAATGCTGTCACCTTC Forward TCTAGGCAATGCCGTTCAC Cpt1b [2] Reverse GAGCACATGGGCACCATAC Forward GGAAATGATCAACAAAAAAAGAAGTATTT Acadm (Mcad) [2] Reverse GCCGCCACATCAGA Forward TGATGGTTTGGAGGTTGGGG Acot1 NM_012006.2 Reverse TGAAACTCCATTCCCAGCCC Forward GGTGTCCCGTCTAATGGAGA Hmgcs2 NM_008256.4 Reverse ACACCCAGGATTCACAGAGG Forward CAAGCAGCAACATGGGAAGA Cs [2] Reverse GTCAGGATCAAGAACCGAAGTCT Forward GCCATTGTCAACTGTGCTGA Ucp3 NM_009464.3 Reverse TCCTGAGCCACCATCTTCAG Forward CGTGAGGGCAATGATTTATACCAT Atp5b [2] Reverse TCCTGGTCTCTGAAGTATTCAGCAA Pdk4 Forward CCGCTGTCCATGAAGCA [2] 3 Reverse GCAGAAAAGCAAAGGACGTT Forward AGAGTCCTATGCAGCCCAGA Tomm20 NM_024214.2 Reverse CAAAGCCCCACATCTGTCCT Forward GCCTCAGATCGTCGTAGTGG Drp1 NM_152816.3 Reverse TTCCATGTGGCAGGGTCATT Forward GGGAAGGTGAAGAAGCTTGGA Mfn2 NM_001285920.1 Reverse ACAACTGGAACAGAGGAGAAGTT Forward CGGAAATCATATCCAACCAG [2] Ppargc1a (Pgc1α) Reverse TGAGAACCGCTAGCAAGTTTG Forward AGGCTTGGAAAAATCTGTCTC [2] Tfam Reverse TGCTCTTCCCAAGACTTCATT Forward TGCCCCAGAGCTGTTAATGA Bcl2l1 NM_001289716.1
    [Show full text]
  • Lipoprotein Lipase Reaches the Capillary Lumen in Chickens Despite an Apparent Absence of GPIHBP1
    Lipoprotein lipase reaches the capillary lumen in chickens despite an apparent absence of GPIHBP1 Cuiwen He, … , Loren G. Fong, Stephen G. Young JCI Insight. 2017;2(20):e96783. https://doi.org/10.1172/jci.insight.96783. Research Article Metabolism In mammals, GPIHBP1 is absolutely essential for transporting lipoprotein lipase (LPL) to the lumen of capillaries, where it hydrolyzes the triglycerides in triglyceride-rich lipoproteins. In all lower vertebrate species (e.g., birds, amphibians, reptiles, fish), a gene for LPL can be found easily, but a gene for GPIHBP1 has never been found. The obvious question is whether the LPL in lower vertebrates is able to reach the capillary lumen. Using purified antibodies against chicken LPL, we showed that LPL is present on capillary endothelial cells of chicken heart and adipose tissue, colocalizing with von Willebrand factor. When the antibodies against chicken LPL were injected intravenously into chickens, they bound to LPL on the luminal surface of capillaries in heart and adipose tissue. LPL was released rapidly from chicken hearts with an infusion of heparin, consistent with LPL being located inside blood vessels. Remarkably, chicken LPL bound in a specific fashion to mammalian GPIHBP1. However, we could not identify a gene for GPIHBP1 in the chicken genome, nor could we identify a transcript for GPIHBP1 in a large chicken RNA-seq data set. We conclude that LPL reaches the capillary lumen in chickens — as it does in mammals — despite an apparent absence of GPIHBP1. Find the latest version: https://jci.me/96783/pdf RESEARCH ARTICLE Lipoprotein lipase reaches the capillary lumen in chickens despite an apparent absence of GPIHBP1 1 1 1 1 1 1 Cuiwen He, Xuchen Hu, Rachel S.
    [Show full text]
  • Rabbit Anti-GPIHBP1/FITC Conjugated Antibody-SL16276R
    SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-GPIHBP1/FITC Conjugated antibody SL16276R-FITC Product Name: Anti-GPIHBP1/FITC Chinese Name: FITC标记的高密度LipoproteinBinding protein1抗体 Glycosylphosphatidylinositol-anchored high density lipoprotein-binding protein 1; GPI anchored HDL binding protein 1; GPI anchored High Density Lipid binding protein 1; Alias: GPI HBP1; GPI-anchored HDL-binding protein 1; GPI-HBP1; GPIHBP1; Hbp1; HDBP1_HUMAN; High density lipoprotein-binding protein 1. Organism Species: Rabbit Clonality: Polyclonal React Species: Human, ICC=1:50-200IF=1:50-200 Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 18kDa Form: Lyophilized or Liquid Concentration: 1mg/ml immunogen: KLH conjugated synthetic peptide derived from human GPIHBP1 Lsotype: IgG Purification: affinitywww.sunlongbiotech.com purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. background: GPIHBP1 (glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1) is a capillary endothelial cell protein that provides a platform for LPL- Product Detail: mediated processing of chylomicrons. Consisting of 184 amino acids, GPIHBP1 is a single-pass membrane protein that may be regulated by dietary factors and by PPARγ.
    [Show full text]
  • Gpihbp1 (NM 026730) Mouse Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR202733 Gpihbp1 (NM_026730) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Gpihbp1 (NM_026730) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Gpihbp1 Synonyms: 1110002J19Rik; GPI-HBP1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MR202733 representing NM_026730 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGGCTCTCAGGGCTGTCCTCCTGATCTTGCTACTAAGTGGACAGCCAGGGAGTGGCTGGGCACAAG AAGATGGTGATGCGGACCCGGAGCCAGAGAACTACAACTACGATGATGACGATGATGAAGAGGAAGAGGA GGAGACCAACATGATCCCTGGAAGCAGGGACAGAGCACCTCTACAATGCTACTTCTGTCAAGTGCTTCAC AGCGGGGAGAGCTGCAATCAGACACAGAGCTGCTCCAGCAGCAAACCCTTCTGCATCACGCTCGTCTCCC ACAGCGGAACCGACAAAGGTTACCTGACTACCTACTCCATGTGGTGTACTGATACCTGCCAGCCCATCAT CAAGACAGTGGGAGGCACCCAGATGACTCAGACCTGTTGCCAGTCCACACTGTGCAATATTCCACCCTGG CAGAACCCCCAAGTCCAGAACCCTCTGGGTGGCCGGGCAGACAGCCCCCTGGAAAGTGGGACTAGACATC CTCAGGGTGGCAAGTTTAGCCACCCCCAGGTTGTCAAGGCTGCTCATCCTCAGAGCGATGGGGCTAACTT GCCTAAGAGTGGCAAGGCTAACCAGCCCCAGGGAAGTGGGGCAGGATACCCTTCAGGCTGGACCAAATTT GGTAATATAGCCCTCCTGCTCAGCTTCTTCACTTGTCTGTGGGCGTCAGGGGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA This product is to be used for laboratory only. Not for diagnostic
    [Show full text]