US00962991 OB2

(12) United States Patent (10) Patent No.: US 9,629,910 B2 Kupper et al. (45) Date of Patent: Apr. 25, 2017

(54) USE OF TH9 CELLS AND IL-9 FOR THE 5,872,103 A 2, 1999 Belletti TREATMENT OF MELANOMA 7,691,377 B2 4/2010 Goydos et al. 2003.0035790 A1 2/2003 Chen et al. 2008, 0220006 A1 9, 2008 Noelle et al. (75) Inventors: Thomas S. Kupper, Belmont, MA 2008/0299134 A1 12/2008 Reed et al. (US); Rahul Purwar, Arlington, MA 2009/0047277 A1 2/2009 Reed et al. (US) 2009, O148403 A1 6/2009 Bosivert et al. 2010, O247547 A1 9/2010 Dong et al. (73) Assignee: THE BRIGHAM AND WOMENS HOSPITAL, INC., Boston, MA (US) FOREIGN PATENT DOCUMENTS (*) Notice: Subject to any disclaimer, the term of this W. 2005 A2 38: patent is extended or adjusted under 35 U.S.C. 154(b) by 261 days. OTHER PUBLICATIONS (21) Appl. No.: 14/004,438 Lu et al. Utilizing Th9 cells as a novel therapeutic strategy for (22) PCT Filed: Mar. 22, 2012 malignancies. Oncoimmunology. 2:3, e23084, Mar. 2013.* Glimelius et al. IL-9 expression contributes to the cellular compo (86). PCT No.: PCT/US2O12/030104 t Hodgkin lymphoma. Journal of Haematology. 2006; 76: S 371 (c)(1), Heppner et al. Tumor heterogeneity: biological implications and (2), (4) Date: Oct. 30, 2013 therapeutic consequences. Cancer Metastasis Review 2:5-23; 1983.* (87) PCT Pub. No.: WO2012/129394 Jain RK. Barriers to drug delivery in solid tumors. Scientific American, Jul. 1994, 58-65.* PCT Pub. Date: Sep. 27, 2012 Glimelius et al., Eur, J. Haematol., 76:278-283 (2006). “IL-9 (65) Prior Publication Data ES Contributes to the Cellular Composition in Hodgkin US 2014/O186295 A1 Jul. 3, 2014 Nagato et al., Clin. Cancer Res., 11(23):8250-8257 (2005). “Expres sion of Interleukin-9 in Nasal Killer/T-Cell Lymphoma Cell Lines Related U.S. Application Data and Patients.” Neto, C.C., Chapter 2 from the book “Berries and Cancer Preven (60) Provisional application No. 61/466,182, filed on Mar. tion” by Stoner, G.D. and Seeram, N.P., pp. 41-50 (2011). “Ursolic 22, 2011. Acid and Other Pentacyclic Triterpenoids: Anticancer Activities and Occurrence in Berries.” (51) Int. Cl. Renauld et al., Cancer Investigation, 11(5):635-640 (1993). A6 IK 45/00 3.08: “Interleukin-9: AT-Cell Growth Factor with a Potential Oncogenic A6 IK 38/00 2006.O1 Activity.” A6 IK 38/16 (2006.01) Arteaga, “Inhibition of TGFbeta signaling in cancer therapy'. Curr. A 6LX 39/395 (2006.01) Opin. Genet. Dev. 16:30-37 (2006). A6 IK 38/20 (2006.01) Miyazawa et al., “Recombinant Human Interleukin-9 Induces Pro A 6LX 35/7 (2015.01) tein Tyrosine Phosphorylation and Synergizes With Steel Factor to A6 IK3I/7088 (2006.01) Stimulate Proliferation of the Human Factor-Dependent Cell Line, A 6LX 3L/705 (2006.01) M07e”. Blood 80(7): 1685-1692 (1992). A6 IK 3L/45 (2006.01) Xu et al., “Ursolic Acid Suppresses Interleukin-17 (IL-17) Produc A6 IK3I/I9 (2006.01) tion by Selectively Antagonizing the Function of RORgamma t A6 IK 3/426 (2006.01) Protein'”, J. Biol. Chem. 286(26):22707-22710 (2011). A6 IK3I/704 (2006.01) k . A6 IK 35/12 (2015.01) cited by examiner (52) U.S.CPC Cl...... A61K 39/3955 (2013.01): 461K 31/145 'in'' inerin a Yanessa Ford (2013.01); A6 IK3I/I9 (2013.01): A6 IK Assistant Examiner — Sandra Dillahunt 31/426 (2013.01); A61K 31/704 (2013.01); (74). Attorney, Agent, or Firm Nixon Peabody LLP. A6 IK3I/7088 (2013.01); A61 K3I/7105 David S. Resnick; Candace M. Summerford (2013.01); A61K 35/12 (2013.01); A61K 35/17 (2013.01); A61K 38/206 (2013.01) (57) ABSTRACT (58) Field of Classification Search Described herein are methods for the treatment of cancer None (e.g. melanoma, lung cancer, or other cancers). The methods See application file for complete search history. involve administrating to a Subject in need thereof an agonist (56) References Cited of the IL-9 receptor (e.g. IL-9), e.g. an agent that binds and activates the IL-9 receptor, or an agent that increases IL-9 U.S. PATENT DOCUMENTS expression in the subject (e.g. administration of TH9 cells that express IL-9, or administration of an inhibitor of ROR). 5,595,756 A * 1/1997 Bally et al...... 424/450 5,830,454 A 11/1998 Renauld et al. 4 Claims, 24 Drawing Sheets U.S. Patent Apr. 25, 2017 Sheet 1 of 24 US 9,629,910 B2

A R Ry if -ch Ry-f-ch

Sir

FIG. IA

S is U.S. Patent Apr. 25, 2017 Sheet 2 of 24 US 9,629,910 B2

ROR -f-i-et RORy-f-ch

Saxa U.S. Patent Apr. 25, 2017 Sheet 3 of 24 US 9,629,910 B2

se it is 8 oir -. &- &n.

& S.

se ER 8 &

Sai -- i.

S

--- i sa ES

ce > .

S8i - i. / U.S. Patent Apr. 25, 2017 Sheet 4 of 24 US 9,629,910 B2

Rab8 . ..Sc sh; xiii ------

Sis ki ise: asis g SS

S i.is - is assassass g Y s issi his Spils Rapiis s is ... Eises 8:it. i.e.- "Spi. sia E. tgail 3. Seigis:is: Serpin Selenip: s 3. Siasis i S-S-53 is is is 3. 44 3.... s . . . . . l is is is sists FOB CHANGE(RRy-f. (R, +f-i} FIG. 2 U.S. Patent Apr. 25, 2017 Sheet S of 24 US 9,629,910 B2

A RER if-i-ci RORy-f-ci V RERef-ci - ART-I. At

SR FIG. 3A

-23R-i-fi 23R-if-i- 3rf- 3Rf.

U.S. Patent Apr. 25, 2017 Sheet 6 of 24 US 9,629,910 B2

gy --- is W 3-f. : 38-f. ... i-3

SER is FIG. 3C

-23Rf-i- 3f.

U.S. Patent Apr. 25, 2017 Sheet 7 of 24 US 9,629,910 B2

S R

Ri U.S. Patent Apr. 25, 2017 Sheet 8 of 24 US 9,629,910 B2

|

SE i ;

FIG. 4C U.S. Patent Apr. 25, 2017 Sheet 9 of 24 US 9,629,910 B2

& as s six m S se R S R

s & s s s s ES E. t s E. s s sks ES s sh it)3 NATOA Difi

i

E. s s s s ass &^8 x U.S. Patent Apr. 25, 2017 Sheet 10 of 24 US 9,629,910 B2

SS

S as Es s {} . & se (ss RS. sa x s

s

a as se & s is e E. s QSe & x was R s &

(iii) isi OA (iii.

s R& s: s

na &ea -{X-

pear wa (iii)3. TDA SE1 U.S. Patent Apr. 25, 2017 Sheet 11 of 24 US 9,629,910 B2

is --

S.S as **********mraerrºri?tirrrrrrrrr}·?¢rrgrip

uit

U.S. Patent Apr. 25, 2017 Sheet 12 of 24 US 9,629,910 B2

E. St. S. S i SS

k &

R. S. Sii B. S SES FIG. 6C U.S. Patent Apr. 25, 2017 Sheet 13 of 24 US 9,629,910 B2

RORy + i + ch ROR f. ci

| U.S. Patent Apr. 25, 2017 Sheet 14 of 24 US 9,629,910 B2

FIG. 8C U.S. Patent Apr. 25, 2017 Sheet 15 of 24 US 9,629,910 B2

".

ae s s &

SS is

s

2

SS is U.S. Patent Apr. 25, 2017 Sheet 16 of 24 US 9,629,910 B2

E. : - is

U.S. Patent Apr. 25, 2017 Sheet 17 of 24 US 9,629,910 B2

RER f. RER f.

:-i-S -- S

FIG. 9E FIG. 9F

RR f.

is SS S is 3. 3. as

-

Sw

: A

FIG. 9G FIG. OH U.S. Patent Apr. 25, 2017 Sheet 18 of 24 US 9,629,910 B2

&SS Seraa s

ex

s S

Es 3. - SSS is is

visix t e s s

yer were (iii); SO.801. U.S. Patent Apr. 25, 2017 Sheet 19 of 24 US 9,629,910 B2

w xxxv-xxx; S

s

xxxxxxxxxxxxxxxxxxxxxxx

s s s s ES E8 s s SS - U.S. Patent Apr. 25, 2017 Sheet 20 of 24 US 9,629,910 B2

SES - S

FIG. OE U.S. Patent Apr. 25, 2017 Sheet 21 of 24 US 9,629,910 B2

U.S. Patent Apr. 25, 2017 Sheet 22 of 24 US 9,629,910 B2

e is 3 489 e a 399 29, is

U.S. Patent Apr. 25, 2017 Sheet 23 of 24 US 9,629,910 B2

(10.1, isS

e Th17 CELLS H 8. s ES H ES 5 to 15 20 25 go as - - 8 RES : FIG. 12A

s

s

S. S. FIG. I2B U.S. Patent Apr. 25, 2017 Sheet 24 of 24 US 9,629,910 B2

- 8 ~~~~**

US 9,629,910 B2 1. 2 USE OF TH9 CELLS AND IL-9 FOR THE SUMMARY TREATMENT OF MELANOMA Embodiments of the disclosure are based on the discovery CROSS REFERENCE TO RELATED that IL-9 promotes tumor immunity and inhibits cancer APPLICATIONS 5 growth. We have evaluated the role of Th17 transcription factor retinoid-related orphan receptor-gamma (RORY) in This Application is a 35 U.S.C. S371 National Phase tumor immunity and determined that RORy-/- and Entry Application of International Application No. PCT/ IL-23R-/- mice exhibit significant growth inhibition of US2012/030104 filed Mar. 22, 2012, which designates the B16F10 melanoma, with evidence for increased anti-mela U.S., and which claims the benefit under 35 U.S.C. S 119(e) 10 noma immune responses (tumor lymphocyte infiltration and of U.S. Provisional Application No. 61/466,182, filed Mar. increased cytokine expression). In parallel, transcriptional 22, 2011, the contents of each of which are herein incorpo profiling experiments revealed the expected severely rated by reference in their entireties. impaired IL-23R and IL-17A expression in RORy-/- CD4+ T cells differentiated under Th17 polarizing condi SEQUENCE LISTING 15 tions. Unexpected, however, was a dramatic increase in the The instant application contains a Sequence Listing which expression of IL-9 in these CD4+ T cells. has been submitted in ASCII format via EFS-Web and is Our studies demonstrate that it is IL-9 that has an inhibi hereby incorporated by reference in its entirety. Said ASCII tory effect on tumor growth in both normal and RORy-/- or copy, created on Sep. 10, 2013, is named 043214 IL-23R-/- mice. Neutralizing IL-9 antibody abrogated the 070052 SL.txt and is 53,716 bytes in size. growth inhibition observed in both RORy-/- and IL-23R-/- mice. In addition, melanoma growth accelerated in normal FIELD OF INVENTION mice treated with neutralizing antibodies to IL-9, and this effect was further enhanced in mice lacking the receptor for The present disclosure relates to compositions and meth- 25 IL-9 (IL-9R-/-). Adoptive transfer of polarized IL-9 pro ods for the treatment of cancer (e.g. melanoma, lung cancer, ducing CD4 T cells (i.e. Th-9 cells) inhibited melanoma or other cancers). The methods involve administrating to a growth in both normal and lymphopenic hosts; an effect that Subject in need thereof an agonist of the IL-9 receptor (e.g. was also blocked significantly by anti-IL-9 neutralizing Ab. IL-9), e.g. an agent that binds and activates the IL-9 receptor, Furthermore, treatment of melanoma bearing mice with or an agent that increases IL-9 expression in the Subject (e.g. 30 exogenous recombinant IL-9 (rIL-9) inhibited tumor growth administration of IL-9 producing T cells such as tumor and exogenous rIL-9 similarly inhibited the growth an specific TH9 cells that express IL-9, or administration of an unrelated syngeneic tumor (Lewis lung carcinoma) in nor inhibitor of RORy). mal mice. Thus, IL-9 effects tumor growth of multiple cancers through enhancing tumor immunity. BACKGROUND OF THE INVENTION 35 Accordingly, provided herein are methods for treating or preventing cancer comprising administrating to a subject in Even though tumors originate from normal cells, the need thereof (i.e. diagnosed with, or at risk of having immune system often reacts relatively strongly against cancer), a therapeutically effective amount of an agonist of tumor cellular components. However, because the tumors the interleukin-9 receptor (IL-9R), (e.g. IL-9). The agonist closely resemble the original cells, the immune system 40 of the IL-9 receptor (IL-9R) may be a small molecule, a tolerates many tumor types to a variable degree. Thus, the nucleic acid RNA, a nucleic acid DNA, a protein, a peptide, very nature of tumor immunity poses enormous challenges a cell, and an antibody. to harnessing the immune system for the therapy of cancers. In one aspect, the agonist comprises an agent that binds Recent studies have indicated that immunologic targeting of the IL-9 receptor. Any agent that binds and activates the cancer is a promising strategy (Hodi, F. S., et al. N. Engll J 45 IL-9R may be used in the methods described herein. Med 363, 711-723 (2010)); however, how best to achieve In one embodiment, the agent that binds the IL-9 receptor this goal is incompletely understood. comprises the cytokine interleukin 9 (IL-9), or fragment The use of mouse melanoma models is a convenient way thereof, e.g. human recombinant interleukin-9 (rIL-9); to study tumor immunity. Melanoma is a malignant tumor of KP-20 peptide, or KP-89 peptide. In some embodiments, the melanocytes. Primarily melanoma is a skin tumor, but it is 50 agent that binds the IL-9 receptor may be an activating also seen, though less frequently, in the melanocytes of the monoclonal antibody, or Small molecule compound. eye (uveal melanoma). Even though melanoma represents In another aspect, the agonist comprises an agent that one of the rarer forms of skin cancer, it underlies the increases expression of IL-9 in the Subject as compared to majority of skin cancer-related deaths. Yet despite many IL-9 expression in the absence of the agonist. For example, years of intensive laboratory and clinical research, there are 55 in one embodiment, the agonist comprises a population of still limited treatments for melanoma, and the treatments cells that express IL-9, Such as a population of cells that exhibit resistance and multiple unwanted side effects includ comprises Th9 cells, or comprises other cells that express ing back pain, constipation, cough, diarrhea, dizziness, dry IL-9. skin, hair loss, headaches, joint or muscle pain, loss of In an alternative embodiment, the agent that increases appetite; nausea, taste changes, thickening of the skin, 60 expression of IL-9 in the subject as compared to IL-9 tiredness, vomiting, weakness, and severe allergic reaction expression in the absence of the agonist comprises an (e.g. ZelborafTM (Vemurafenb or PLX4032: Hoffman-La inhibitor of RORy. Any inhibitor of RORY may be used in Roche (Madison Wis.)/Daiichi Sankyo (Parsippany, N.J.)). the methods described herein. In one embodiment, the Thus, there is a need for a better understanding of tumor inhibitor of RORY comprises siRNA. In an alternative immunity in order to facilitate efficient harnessing of this 65 embodiment, the inhibitor of RORY is selected from the aspect of immune system as an effective therapy for the group consisting of: ursolic acid, digoxin, SR 1001, and treatment of cancer. TO901317. US 9,629,910 B2 3 4 The agonist of the IL-9R used in the methods described FIG. 1C demonstrates that tumor infiltrating lymphocytes herein may further comprise a pharmaceutically acceptable (TILs) were recovered and counted as described in methods. carrier and may be administered using any suitable means of FIG. 1D demonstrates that tumor draining LNs were isolated administration known to those of skill in the art. In one and restimulated with PMA plus ionomycin for 6 h in embodiment, the agonist may be administered by a route presence of golgistop. Expression of IL-17A, IFN-y, and selected from the group consisting of intravenous, intra TNF-C. by CD4+ and CD8+ T cells was analyzed by flow muscular, Subcutaneous, intradermal, topical, intraperito cytometry. Data is represented as Mean-SEM in a, b (n=8 neal, intrathecal, intrapleural, intrauterine, rectal, vaginal, mice per group (p<0.005: ***), in c (TILs from 4 mice were intrasynovial, intraocular/periocular, intratumor, adoptive pooled and analyzed) and in d (n=8 mice per group, cell transfer, and parenteral administration. 10 p<0.005: ***, p<0.025: **). Two-three additional indepen Any cancer may be treated using the methods described dent experiments provided similar results. herein. In one embodiment, the cancer is selected from the FIG. 2 demonstrates that sorted naive Th cells (CD4+ group consisting of gastrointestinal cancer, prostate cancer, CD25-CD62Lhigh) from RORY--/+ and RORy-/- mice were ovarian cancer, breast cancer, head and neck cancer, lung differentiated under Th17 polarizing conditions. After 4 cancer, non-Small cell lung cancer, cancer of the nervous 15 days, cells were harvested for transcriptional profiling system, kidney cancer, retinal cancer, melanoma skin cancer, experiments. Gene expression analysis was performed and stomach cancer, liver cancer, pancreatic cancer, genital expression of a set of genes is depicted as fold change urinary cancer, prostate cancer, colorectal cancer, and blad (RORy-/- vs. RORY--/+). Two additional microarray analy der cancer. ses provided similar results. The methods described herein can be used either alone, or FIGS. 3A-3D depict the effect on melanoma immunity in conjunction with other treatment methods known to those when IL-9 is inhibited. FIG. 3A demonstrates that B16F10 of skill in the art. For example, Such methods may include, melanoma cells were injected subcutaneously into RORY-/- but are not limited to, chemotherapy, radiation therapy, or ch, and control mice (RORy+/+ch). Anti-IL-9 neutralizing Surgery. antibody was administered (i.p.) to RORy-/- ch mice. FIG. In one embodiment, the subject may be at risk for 25 3B depicts the results when sorted naive Th cells (CD4+ developing cancer and the IL9-R agonist is administered CD25-CD62Lhigh) from IL-23R+/+ and IL-23R-/- mice prophylactically. The risk can be determined genetically. were differentiated under Th17 polarizing conditions. After Alternatively, the risk can be determined by measuring 4 days, cells were harvested and restimulated with plate levels of biomarker proteins in the biological fluids (i.e. bound anti-CD3/CD28 for 48 h. IL-9 and IL-17A were blood, urine) of a patient. 30 estimated by ELISA in cell free supernatants. FIG. 3C In one embodiment, the methods of treatment described depicts the results when B16F10 melanoma cells were herein further comprises the step of selecting a subject in injected subcutaneously into IL-23R-/- and their controls. need thereof of treatment, e.g. selecting a Subject diagnosed Anti-IL-9 neutralizing antibody was administered (i.p.) to with cancer, or a subject at increased risk of cancer (e.g. both IL-23R+/+ and IL-23R-/- mice. Melanoma growth potential cancer relapse). 35 was monitored over time. FIG. 3D depicts the results when In some embodiments of the methods described herein, tumor draining lymph node cells (LNCs) from IL-23R+/+ wherein the subject is administered an agonist of the IL-9R. (WT) and IL-23R-/- mice were isolated and stimulated with the Subject is not additionally administered a co-stimulatory plate bound anti-CD3 (2 ug/ml)/anti-CD28 mAbs (1 lug/ml). molecule activating agent, e.g. an agent that increases the After 48 h, culture supernatant was collected and IL-9 and concentration of a cytokine in a Subject, is not administered 40 IL-17 were estimated by ELISA. Data is represented as to the subject in addition to the agonist of the IL-9R. Mean-SEM and statistically significant differences were In another aspect, methods for the prognosis of cancer observed compared to controls (p<0.005: ***, p<0.025: **, (e.g. melanoma or other cancers) in a subject are provided. p-0.05: *). Two additional independent experiments pro The methods comprise assaying a tumor for the presence of duced similar results. IL-9 producing T cells, wherein the presence of reduced 45 FIGS. 4A-4C depict experiments where differentiated levels of IL-9 producing T-cells (e.g. Th9 cells) within the OT2-Th cells from OT2 mice were generated and trans tumor as compared to the level of IL-9 producing T-cells ferred (iv) into WT mice (WT-C57BL/6: (FIG. 4A) or (e.g. Th9 cells) in normal skin is indicative of increased Rag1-/- C57BL/6 mice (FIG. 4B-4C). On the same day, metastatic potential and a poor prognosis. In one embodi B16F10-ova cells were injected subcutaneously. Melanoma ment, the reduced level of IL-9 producing T-cells indicates 50 growth was monitored over time (FIGS. 4A-4C). Neutral a treatment protocol for the Subject comprising administrat izing anti-IL-9 mab or isotype was given (IP) to OT2-Th9 ing to the subject in need thereof an agonist of the IL-9 treated mice (FIG. 4B). Data is represented as Mean-SEM receptor (e.g. IL-9), e.g. an agent that binds and activates the (FIGS. 4A-4C) and statistically significant differences were IL-9 receptor, or an agent that increases IL-9 expression in observed compared to no-T cells group (FIG. 4A), and as the Subject (e.g. administration of IL-9 producing T cells, 55 depicted (FIGS. 4B-4C) (p<0.005: ***, p<0.025: **, such as tumor specific TH9 cells that express IL-9, or p<0.05: *). administration of an inhibitor of RORY). In certain embodi FIGS. 5A-5F depict the results of experiments where ments, an increased level of RORY expression in T cells various cancer cell types were injected into mice. In FIGS. present within a tumor serves as an indicator that the cancer 5A, 5B, 5D, and 5E B16F10 melanoma cells were injected may be treatment with an inhibitor of RORY. 60 subcutaneously into IL-9R-/- and controls (IL-9R-/+) mice (FIG. 5A), normal WT mice (FIG. 5B) and Rag1-/- mice BRIEF DESCRIPTION OF FIGURES (FIG.5D) and Kit W-sh (mast cell deficient) mice (FIG.5E). In FIGS. 5C and 5F, Lewis lung carcinoma cells were FIGS. 1A-1D depict the results of experiments in which injected subcutaneously into normal WT mice (FIG.5C) and B16F10 melanoma cells were injected subcutaneously into 65 Kit W-sh (mast cell deficient) mice (FIG. 5F). Where RORy-/- ch and RORy+/+ ch mice. Tumor growth (FIG. indicated, rIL-9 was administered (i.p.). Control mice 1A) and mice survival (FIG. 1B) was monitored over time. received PBS. Tumor growth was monitored over time. Data US 9,629,910 B2 5 6 is represented as Mean-SEM (n=4 mice per group, 2-4 in which sorted CD4+CD25-CD62Lhigh (naive CD4+T additional independent experiment produced similar results, cells) from OT2 mice were polarized towards Th(), Th1. and statistically significant differences were observed com Th2, Th9 and Th17 as described in method section. Intrac pared to controls (p<0.025: *, p<0.05: *, ns: not signifi ellular cytokine expression was analyzed by flow cytometry cant). before adoptive transfer into mice. In FIG. 11B, IL-9, IFNg, FIGS. 6A-6C depict the results of experiments to detect T GranzymeB and IL-10 was quantified at mRNA level in cells in human samples. In FIGS. 6A-6B, memory T cells differentiated Th9 cells using quantitative RT-PCR (qPCR). (CD4+CD45RO+) from peripheral blood after stimulation FIGS. 12A-12C depict the results of experiments to with anti-CD3/CD28 mAbs plus TGF-B and skin-resident T determine the ability of various cells to induce apoptosis in cells isolated by skin-explant culture of healthy donors were 10 melanoma cells. FIG. 12A depicts the results of an experi stained for IL-9, IFNY, IL-17 and IL-4 and analyzed by flow ment in which OT2-Tho, OT2-Th9 c, or OT2-Th17 cells cytometry. In FIG. 6C, memory T cells (CD4+CD45RO+) were incubated with B16F10-ova cells for 24 h. B16F10-ova from peripheral blood of healthy donors, skin T cells from cell lysis was quantified by 7AAD staining FIG. 12B depicts healthy donors and tumor-infiltrating lymphocytes of meta the results of an experiment in which OT2-Th9 cells were static melanoma were extracted and stimulated for 2 days 15 pre-incubated (30 min) with granzyme-B inhibitor or control with anti-CD3/CD2/CD28 beads in the presence of IL-2 plus (DMSO) before co-culture with B16F10 ova cells. After 24 TGF-B. IL-9 production was measured in cell free superna h, B16F10-ova cell lysis was quantified by 7AAD staining. tants by luminex assay. Data is represented as Mean-SEM Data is represented as percentage inhibition. Th9 cell cyto (skin: n=8, PBMCs: n=3, MM: n=8). toxicity was considered as 100%. FIG. 12C depicts the FIG. 7 demonstrates comparable numbers of CD4+ and results of an experiment in which CFSE labeled B16F10-ova CD8+ T cells in the spleen of RORy-/- ch and RORy+/+ch cells (5 uM) and EL-4 cells (0.5 LM) were incubated with mice. Rag1-/- mice were reconstituted with bone marrow of different effector/target ratio (E/T ratio: as indicated) with or RORy+/+ or RORy-/- mice. After 8 weeks, numbers of without OT2-ThO, and OT2-Th9 cells for 36 h. Tumor cell CD4+ and CD8+ T cells were analyzed by flow cytometry in lysis was measure as described in methods. the spleen of RORy-/- chimeric mice (RORy-/- ch) and 25 RORy+/+ch mice. DETAILED DESCRIPTION FIGS. 8A-8C depict the comprehensive cytokine profile of RORy-/- T cells. Sorted CD4+CD25-CD62Lhigh-- cells Described herein are methods for treating cancer in a from spleen of WT and RORy-/- mice were polarized under Subject that has, or at risk of having, cancer. The methods Th17 or Th9 conditions. After 4 days of differentiation, cells 30 comprise administration to a Subject a therapeutically effec were harvested for mRNA analysis (FIG. 8A) or intracellular tive amount of an agent that is an agonist of the IL-9 receptor staining of cytokines (FIG. 8B). FIG. 8C depicts FACS (IL-9R). analysis of these cells. As used herein, the term “IL-9 receptor” or “IL-9R refers FIGS. 9A-9H depict IL9 expression in RORy-/- Th2 and to the transmembrane protein that is the cell surface receptor Th9 cells. Sorted CD4+ T cells (FIGS. 9A and 9B), sorted 35 for interleukin 9 (IL-9). The IL9-R is a two subunit receptor. CD4+CD25-CD62Llow cells (memory CD4+T cells, FIGS. The first subunit is the common gamma chain or IL2RG (e.g. 9C-9E), and sorted CD4+CD25-CD62Lhigh-- cells (naive NCBI Gene ID: 3561; SEQ ID NO: 6 (Homo Sapiens)), CD4+ T cells, FIG. 9F) from spleen of WT and RORy-/- which is a shared component of the receptor complexes for mice were stimulated with plate bound anti-CD3 (2 g/ml) at least IL-2, IL-4, IL-7, IL-13, and IL-15. The human and anti-CD28 Abs (1 lug/ml). After 2 and 4 days, cells were 40 IL2RG polypeptide is e.g. encoded by the cDNA of SEQID analyzed for IL9 mRNA expression by real-time RT-PCR NO: 5. The second subunit of the IL-9 receptor is e.g. the (FIGS. 9A, 9C) and supernatant was estimated for IL9 IL-9R protein (NCBI Gene ID: 3581; SEQID NO: 4 (Homo secretion by CBA (FIGS. 9B, 9E and 9F). In FIG. 9D, Sapiens)) which provides specificity for IL-9. The extracel memory CD4+T cells were re-stimulated with PMA plus lular domains of human and murine IL-9R have 67% ionomycin in presence of golgi-stop for 6 h. IL9 was stained 45 homology, while the cytoplasmic regions are less conserved. and analyzed by flow cytometry. A representative data set is The IL9-R is 522 amino acids. The IL-9R polypeptide is e.g. depicted. Two to three additional experiments provided encoded by the cDNA of SEQ ID NO: 3 (Homo Sapiens). similar results. In FIGS. 9G-9H, sorted naive CD4+ T cells IL-9R mediated signal transduction is initiated when the from WT and RORy-/- mice were differentiated under Th2 IL-9 polypeptide is recognized by the IL-9 receptor and Th9 polarizing condition. After 2 and 4 days, Superna 50 expressed on the surface of a target cell. Embodiments of the tant was collected and IL9 was quantified by CBA (FIGS. invention encompass homologs and variants of the IL-9 9G and 9H). receptor described herein. FIGS. 10A-10E depict antitumor effects of IL-9 in vac IL9-R Agonists cinated mice, IL-9R expression on tumor cells and effect of As used herein, the term "agonist” refers to any agent that rIL9 on tumor cell growth. In FIG. 10A, B16F10 melanoma 55 activates or increases activity mediated by the IL-9 receptor cells were injected Subcutaneously into vaccinated normal (IL-9R). Thus, the term “IL-9R agonist' includes any agent WT mice. Mice were treated with IL-9 or PBS. Tumor that activates the IL-9R or increases IL-9R activity in growth was monitored over time. (FIGS. 10B-10C) IL-9R comparison to IL-9R activity in the absence of the agonist. expression was quantified using Taqman real-time RT PCR. An IL-9R agonist may be an agent that binds to the IL-9R Data is represented as MeaniSEM. In FIG. 10D, rIL-9 was 60 thereby inducing signal transduction mediated by the recep added at different concentrations into the B16F10 tumor cell tor (e.g. the cytokine interleukin 9 (IL-9), or an agent that culture and tumor cell growth was measured at indicated mimics IL-9), also known as a directagonist. Alternatively, time points as described in methods. In FIG. 10E, TILs were the IL-9R agonist may be an agent that increases IL-9 isolated from tumor growing in WT mice. IL-9 was stained expression in a Subject, also known as an indirect agonist and quantified by flow cytometry. 65 (e.g. Th9 cells administered by adoptive transfer express FIGS. 11A-11B depict cytokine expression of differenti IL-9, or administration of transforming growth factor beta ated Th cells. FIG. 11A depicts the results of an experiment (TGFB) and interleukin-4 (IL-4)). In certain embodiments, US 9,629,910 B2 7 8 the IL-9R agonist is an agent that induces the activity of a locked nucleic acid (LNA) etc.), antisense molecules, downstream signaling molecule that is activated by the ribozymes, Small inhibitory or activating nucleic acid IL-9R. sequences (e.g. RNAi, shRNAi, siRNA, micro RNAi (mR As used herein, the terms “activity mediated by the IL-9 NAi), antisense oligonucleotides etc.). receptor' and “IL-9R activity” refers to IL-9 receptor (IL An agonist protein and/or peptide agent can be any 9R) mediated signal transduction. An agent that “activates protein that increases IL-9R activity as compared to IL-9R the IL-9R is an agent that stimulates IL-9 receptor (IL-9R) activity in the absence of the agonist, and may be for mediated signal transduction. Signal transduction mediated example a protein or peptide that modulates gene expression by the IL-9R is known to involve, for example, tyrosine or a protein/peptide that modulates protein activity. Non phosphorylation of STAT3 which is unique to the IL-9 10 pathway, and expression of IL-9 specific marker genes limiting examples include mutated proteins; therapeutic including but not limited to TH2AF1 (SEQID NOs: 7-8 and proteins and truncated proteins, e.g. wherein the protein is described in US Patent Publication US 2008/009%981, normally absent or expressed at lower levels in the target which is incorporated by reference herein in its entirety) and cell. Proteins can also be selected from genetically engi ICACC (also CLCA2, SEQID NOs: 9-10; described in U.S. 15 neered proteins, peptides, synthetic peptides, recombinant Pat. No. 6,716.603, which is incorporated by reference proteins, chimeric proteins, or antibodies. herein in its entirety). Means for assaying IL-9R activity are Any agonist of IL-9R can be used in methods described well known to those of skill in the art. For example, an herein. The agonists may be direct or indirectagonists. increase in expression of TH2AF1 or ICACC, at either the In one embodiment, the agent is a directagonist of IL-9R. mRNA or protein level can indicate activation of IL-9 i.e. the agonist binds to the IL-9R and activates the receptor. signaling in a cell. Reporter gene constructs can be useful in For example, in one embodiment, the agonist comprises the such assays. For example, the promoter of TH2AF1 can be cytokine interleukin-9 (IL-9), or fragment thereof, such as coupled to the protein coding sequence of a detectable natural or recombinant interleukin 9 (rIL-9). Example direct reporter gene (e.g. GFP) and the expression of the reporter agonist, include but are not limited to: IL-9; the IL-9 peptide gene detected by, e.g. a fluorescence detector. IL-9 receptor 25 KP-20 (SEQ ID NO:15) or KP-89 (SEQ ID NO: 16) signal transduction activates STAT 1, STAT3 and STAT5 (described in International Patent Publication WO/1998/ transcription factors. Guidance for assays for IL-9R activity 027997; which is incorporated herein by reference in its may also found in Goswami and Kaplan (2011). A brief entirety). history of IL-9 Journal of Immunology Vol. 186 no. 6 As used herein, “IL-9” refers to a 4-helix bundle cytokine 3283-3288. 30 that is produced by T-cells, specifically by CD4+ helper cells As used herein, the term “IL-9R selective agonist” refers (e.g. activated Th2 cells, or Th9 cells). Alternative names for to an IL-9Ragonist that activates the IL-9R to a significantly IL-9 include, but are not limited to, P40, HP40, T-cell greater degree than it stimulates any other receptor, e.g. growth factor p40, interleukin-9, or P40 cytokine IL-9 acts cytokine receptor. In one embodiment, the agent acts as an as a regulator of a variety of hematopoietic cells and is agonist of the IL-9R and for no other cytokine receptor. In 35 known to stimulate cell proliferation and prevent apoptosis. one embodiment, the IL-9R agonist acts primarily as an IL-9 functions through the interleukin-9 receptor (IL-9R), agonist of IL9-R, but also induces minor levels of activity which activates different signal transducer and activator mediated by another cytokine receptor. (STAT) proteins. Both human (e.g. Gene ID: 3578; SEQ ID Any agent that acts as an agonist of the IL-9R can be used NO: 2, Gene bank Accession NP 000581.1) and murine in the methods described herein, e.g. administered to a 40 IL-9 protein sequences contain 144 residues with a signal subject for the treatment of cancer. peptide of 18 amino acids. The IL-9 protein is encoded e.g. As used herein, the terms “compound' or "agent” are used by the cDNA of SEQ ID NO: 1, Gene bank Accession interchangeably and refer any organic or inorganic mol NM 000590.1. IL-9 is expressed by activated T cells and ecule, including modified and unmodified nucleic acids Such mast cells and can function as a T cell growth factor. Further, as antisense nucleic acids, RNAi, such as siRNA or shRNA, 45 IL-9 mediates the growth of erythroid progenitors, B cells, peptides, Small molecules peptidomimetics, receptors, mast cells, eosinophils, and fetal thymocytes, and acts ligands, and antibodies. The agents include, but are not synergistically with interleukin-3 (“IL-3') to induce mast limited to, chemical compounds and mixtures of chemical cell activation and proliferation. IL-9 further promotes the compounds, e.g., Small organic or inorganic molecules: production of mucin by lung epithelium. In addition, IL-9 saccharines; oligosaccharides; polysaccharides; biological 50 potentiates the IL-4 induced production of IgE, IgG, and macromolecules, e.g., peptides, proteins, and peptide ana IgM by normal human B lymphocytes, and the IL4 induced logs and derivatives; peptidomimetics; nucleic acids; release of IgE and IgG by murine B lymphocytes. Embodi nucleic acid analogs and derivatives; extracts made from ments of the invention encompass use of homologs and biological materials such as bacteria, plants, fungi, or animal variants of the IL-9 cytokine described herein. cells or tissues; naturally occurring or synthetic composi 55 In some embodiments, IL-9R activity may be increased in tions; peptides; aptamers; and antibodies, or fragments a subject by administering an IL-9 polypeptide agonist to the thereof. The agent may activate the IL-9 receptor directly subject. An IL-9 polypeptide administered to a subject (e.g. the cytokine IL-9), or may activate the IL-9 receptor according to the methods described herein can be human indirectly, e.g. by inhibition of ROR gamma activity, by IL-9 or a homologue, variant, conservative Substitution, or modulating a downstream signaling molecule of the IL-9R. 60 functional fragment thereof. By way of non-limiting or by increasing expression of IL-9 in a subject. example, the IL-9 amino acid sequences are known for at An agonist agent can be a nucleic acid RNA or DNA, and least mouse, rat, and chimpanzee. One of ordinary skill in can be either single or double stranded. Example nucleic the art is familiar with how to align homologous peptide acid agents include, but are not limited to, a nucleic acid sequences to determine which amino acid residues are encoding a protein inhibitor (e.g. transcriptional inhibitors), 65 particularly conserved. IL-9 variants can include the mature oligonucleotides, nucleic acid analogues (e.g. peptide version of IL-9 lacking the signal peptide, i.e. an IL-9 nucleic acid (PNA), pseudo-complementary PNA (pc-PNA), variant can be amino acids 19-144 of SEQ ID NO: 2. US 9,629,910 B2 9 10 In some embodiments, the IL-9 polypeptide may be In an alternative embodiment, the agonist comprises an recombinant, i.e. expressed in an organism which does not agent that is an indirectagonist of the IL-9 receptor, i.e. the naturally produce IL-9, or variant of IL-9. Means for making agent does not directly bind to the IL-9R and increases the recombinant IL-9 (rIL-9) are well known to those of skill in activity of the receptor indirectly (e.g. by modulating down the art, e.g. as described in U.S. Pat. No. 5,581,753, herein 5 stream IL-9R signal transduction molecules, by increasing incorporated by reference in its entirety, e.g. U.S. Pat. No. expression of IL-9 in the Subject, or by inhibiting antagonists 5,581,753 describes DNA encoding the human cytokine of IL-9R signal transduction). interleukin-9 as well as means for expressing and purifying In some embodiments, the indirectagonist increases the recombinant IL-9. Alternatively, recombinant IL-9 can be amount of IL-9 in the subject, which in turn activates the obtained from commercial sources (e.g. recombinant human 10 IL-9R. We have discovered a role for Th17 transcription or mouse IL-9 may be obtained from PRO SPEC protein factor retinoid related orphan receptor-gamma (ROR-Y) in specialists of Ness-Ziona, Israel; or Cell Sciences of Canton, the increase in production of IL-9 (See Examples). Thus, in Mass.). In one embodiment, the IL-9 is isolated from culture one embodiment the agonist used herein comprises an agent conditioned medium of mitogen- or antigen-stimulated that comprises an inhibitor of RORY. As used herein “Th17 T-helper cells. In cultures of primary lymphocytes, IL-9 is 15 transcription factor retinoid related orphan receptor-gamma produced predominantly by cells expressing CD4. The Syn (ROR-Y), or “RORy” refers to a DNA-binding transcription thesis of IL-9 can be induced by Phorbol esters and Calcium ionophore. factor that is a member of the NR1 subfamily of nuclear In some embodiments, IL-9Ractivity may be increased in receptors. The transcription factor plays an important regu a Subject by administering an agonist cDNA or nucleic acid latory role in thymopoiesis, e.g. by reducing apoptosis of analog that encodes a IL-9 polypeptide (e.g. a nucleic acid thymocytes and promoting thymocyte differentiation into of SEQ ID NO: 1). The nucleic acid encoding an IL-9 pro-inflammatory T helper 17 (Th17) cells. The RORyt polypeptide may comprise a vector. In some embodiments, isoform of RORY is specific for T cells and promotes the nucleic acid encoding an IL-9 polypeptide further com development of TH17 cells. The RORY isoform (SEQ ID prises an expression vector. The term “vector', as used NO: 12) is e.g. encoded by the cDNA of SEQ ID NO: 11 herein, refers to a nucleic acid construct designed for deliv 25 while the RORyt isoform (SEQ ID NO: 14) is e.g. encoded ery to a host cell or for transfer between different host cells. by the cDNA of SEQ ID NO: 13. Embodiments of the As used herein, a vector can be viral or non-viral. The term invention encompass use of homologs and variants of “vector encompasses any genetic element that is capable of “RORy” described herein. replication when associated with the proper control elements As used herein, the phrase “inhibitor of RORy” refers to and that can transfer gene sequences to cells. A vector can 30 an agent that inhibits the biological activity of RORY, an include, but is not limited to, a cloning vector, an expression antagonist. The biological activity of RORY may be inhib Vector, a plasmid, phage, transposon, cosmid, chromosome, ited using an agent that inhibits the transcription regulatory virus, virion, etc. As used herein, the term "expression activity of RORY, or an agent that down regulates expression vector” refers to a vector that directs expression of an RNA or availability of RORY in a cell or organism (e.g. siRNA, or polypeptide from sequences linked to transcriptional 35 shRNA). RORY biological activity may be assessed using in regulatory sequences on the vector. The sequences vitro assays well known to those of skill in the art. In one expressed will often, but not necessarily, be heterologous to embodiment, inhibition of RORY activity is monitored by the cell. An expression vector may comprise additional assaying for inhibition of IL-17 and/or IL-22 production in elements, for example, the expression vector may have two Th17 cells as an indicator of inhibition of RORY activity replication systems, thus allowing it to be maintained in two (e.g. by ELISA assay). In alternative embodiments, RORY organisms, for example in human cells for expression and in 40 activity assayed using cell lines with RORY reporter con a prokaryotic host for cloning and amplification. structs that are commercially available, for example Cat In some embodiments, the agonist of IL-9R comprises an Nos. K1883 and K 1882 from Invitrogen (Grand Island, antibody. The antibody agonist may be a direct or indirect N.Y.) (e.g. See and Xu et al. (2011), J. Biol. Chem. 286(26): agonist. As used herein the term “antibody” refers to immu 22707-22710). noglobulin molecules and immunologically active determi 45 Any inhibitor of RORY may be used in the methods and nants of immunoglobulin molecules, e.g., molecules that compositions described herein. For example, various inhibi contain an antigen binding site which binds, e.g. specifically tors of RORY are described in Soltet al. (2011) Nature, 472: binds, (immunoreacts with) a protein to be activated or 491-496, and Xu et al. (2011), J. Biol. Chem. 286(26): inhibited in order to increase the activity of the IL-9R. (e.g. 22707-22710, which are herein incorporated by reference in immunoreacts with the IL-9R). The term “antibody encom 50 their entirety. passes whole antibodies, e.g., of any isotype (IgG, IgA, IgM, Example RORY inhibitors include, but are not limited to: IgE, etc), and includes fragments thereof which are also antisense RNAs specific for RORY and/or RORyt; digoxin; reactive with IL-9R protein. Antibodies can be fragmented Ursolic acid; SR1001 (Structure 1 below)(see Solt et al. using conventional techniques, e.g. proteolytically-cleaved Nature 2011 472:491-6); and TO901317 (Structure 2 or recombinantly-prepared portions of an antibody molecule below). that are capable of reacting with the particular protein of 55 interest. Non limiting examples of Such proteolytic and/or recombinant fragments include Fab, F(ab')2, Fab'. Fv, dAbs, Structure 1 diabodies, and single chain antibodies (ScPV) containing a CF VL and VH domain joined by a peptide linker. The scFv's O OH may be covalently or non-covalently linked to form anti 60 N/ bodies having two or more binding sites, e.g. divalent, CF trivalent, tetravalent etc. The antibodies may be polyclonal or monoclonal, or other purified preparations of antibodies and recombinant antibodies, e.g. humanized antibodies, bispecific antibodies, and chimeric molecules having at least 65 one antigen binding determinant derived from an antibody molecule. US 9,629,910 B2 11 12 -continued cells are known to those of skill in the art and include FACS Structure 2 sorting of CD4+ cells. Th2 cells can be differentiated from CF other CD4+ cells by the expression of CCR4 and Crth2 and the lack of CSCR3, CCR6, CXCR5, or CD25 expression on ( CF3 the cell surface. O N OH In some embodiments, the indirectagonist that increases N/N ( ) €CF expression of IL-9 in the subject may be a cytokine or N growth factor known to enhance expression of IL-9. In one embodiment, a combination of agonist agents is adminis 10 tered to a subject, e.g. a combination of transforming growth factor beta (TGFB) and interleukin-4 (IL-4). In one embodi ment, the agonist agent is IL-25 (Angkasekwinai et al. In some embodiments, the indirectagonist that increases (2010) Regulation of IL-9 expression by interleukin 25 expression of IL-9 comprises HTLV-1 Tax a 351 amino acid (IL-25) signaling, Nature Immunology 3: 250-257, herein protein produced by Human T-lymphotropic virus 1 (HTLV 15 incorporated by reference in its entirety). 1) (SEQ ID NO: 17) (or comprises a nucleic acid that In addition, agonists for use in the methods described encodes the protein). HTLV-1 Tax-1 is known to induce herein may be identified using screening assays. Candidate expression of IL-9, as described in Chen et al. Blood 2008 agonists of the IL-9R can be screened for the ability to 1 11:5163-5 172, which is incorporated herein by reference in activate IL-9R signaling by contacting a cell expressing the its entirety. IL-9 receptor with the test agent and detecting modulation of In an alternative embodiment, the indirect agonist that IL-9 signaling activity. For example, an increase in expres increases expression of IL-9 in the Subject is cellular agent sion of TH2AF1 or ICACC, at either the mRNA or protein that expresses IL-9, e.g. Th9 cells, or cells genetically level can indicate activation of IL-9R signaling in the cell. engineered to express IL-9. Reporter gene constructs can be useful in Such assays. For In some embodiments, IL-9Ractivity may be increased in 25 example, the promoter of TH2AF1 can be coupled to the a Subject by administering cells which produce IL-9, e.g. protein coding sequence of a detectable reporter gene (e.g. Th9 cells, to the subject. As used herein, “Th9 cells' are GFP) and the expression of the reporter gene detected by, CD4+ T cells which express IL-9 but not IFN-Y, IL-4, IL-5, e.g. a fluorescence detector. IL-13 or IL-17. In humans, Th9 cells also do not express Candidate agents may also be screened for the ability to IL-10. The differentiation of T cells into Th9 cells can be 30 inhibit RORY by contacting a cell expressing the RORY with accomplished in vitro by contacting naive CD4+ T cells with the test agent and detecting the modulation of the expression the combination of TGF-B and IL-4 and activating the cells, of genes which are transcriptionally regulated by RORY. or by contacting Th2 T-helper cells with TGF-B. In some Cell lines with RORY reporter constructs are commercially embodiments, IL-9 signaling can be increased in a subject available, for example Cat Nos. K1883 and K1882 from by adoptive cell transfer of Th9 cells. 35 Invitrogen (Grand Island, N.Y.). In certain embodiments, a Subject in need thereof is As used herein, the terms “test compound' or “test agent' administered autologous tumor specific IL-9 producing are used interchangeably and refers to compounds and/or T-cells (such as, Th9 cells); e.g. cancer specific IL-9 pro compositions that are to be screened for their ability to ducing cells that are isolated from the Subject and expanded inhibit the number of neural crest progenitors. The test in vitro, prior to administration back to patient. In certain 40 agents can include a wide variety of different compounds, embodiments, the autologous cancer specific T cells are including chemical compounds and mixtures of chemical isolated from the subject and transformed into IL-9 produc compounds, e.g., Small organic or inorganic molecules: ing cells, e.g. by overexpression of IL-9, by differentiation saccharines; oligosaccharides; polysaccharides; biological using a cytokine cocktails that produce IL-9 producing cells, macromolecules, e.g., peptides, proteins, and peptide ana or by differentiation using other polarizing/differentiation 45 logs and derivatives; peptidomimetics; nucleic acids; anti agents. bodies, nucleic acid analogs and derivatives; an extract made As used herein, “adoptive cell transfer is the process of from biological materials such as bacteria, plants, fungi, or passively transferring cells, particularly immune-derived animal cells; animal tissues; naturally occurring or synthetic cells, into a new host with the goal of transferring the compositions; and any combinations thereof. In some immunologic functionality and characteristics into the new 50 embodiments, the test agent is a small molecule. host. In some embodiments, IL-9 producing cells are used in As used herein, the term “small molecule” refers to in adoptive cell transfer according to the methods described organic or organic compounds. However, Small molecules herein. In some embodiments, cells comprising a nucleic typically are characterized in that they contain several acid encoding an IL-9 polypeptide are used in adoptive cell carbon-carbon bonds, and have a molecular weight of less transfer according to the methods described herein. In some 55 than 5000 Daltons (5 kD), preferably less than 3 kD, still embodiments. Th9 cells are used in adoptive cell transfer more preferably less than 2 kD, and most preferably less according to the methods described herein. than 1 kD. In some cases it is preferred that a small molecule In some embodiments, the cells administered to the sub has a molecular weight equal to or less than 700 Daltons. ject are autologous cells. For example, a blood sample can The number of possible test agents runs into millions. be obtained from a subject and Th2 T-helper cells isolated 60 Methods for developing Small molecule, polymeric and from the sample. The Th2 T-helper cells can be contacted genome based libraries are described, for example, in Ding, with TGF-B to convert them to Th9 cells and then admin et al. J. Am. Chem. Soc. 124: 1594-1596 (2002) and Lynn, istered to the same subject. In one embodiment the Th9 cells et al., J. Am. Chem. Soc. 123:8155-8156 (2001). Commer are further treated with IL-25 prior to administration to the cially available compound libraries can be obtained from, subject (Angkasekwinai et al. (2010) Regulation of IL-9 65 e.g., ArOule, Pharmacopia, graffinity, Panvera, Vitas-MLab, expression by interleukin 25 (IL-25) signaling, Nature Biomol International and Oxford. These libraries can be Immunology 3: 250-257). Methods of isolating Th2 T-helper screened using the screening devices and methods described US 9,629,910 B2 13 14 herein. Chemical compound libraries such as those from cancer of the oral cavity or pharynx, cervical cancer, colon NIH Roadmap, Molecular Libraries Screening Centers Net cancer, colorectal cancer, esophageal cancer, gastrointestinal work (MLSCN) can also be used. Compound libraries are cancer, glioblastoma, hepatic carcinoma, hepatoma, kidney well known and readily available in the art. A chemical cancer, leukemia, liver cancer, lung cancer, lymphoma, library or compound library is a collection of stored chemi non-Small cell lung cancer, osteosarcoma, ovarian cancer, cals usually used ultimately in high-throughput Screening or pancreas cancer, peripheral nervous system cancer, prostate industrial manufacture. The chemical library can consist in cancer, sarcoma, salivary gland cancer, Small bowel or simple terms of a series of stored chemicals. Each chemical appendix cancer, Small-cell lung cancer, squamous cell has associated information stored in some kind of database cancer, stomach cancer, testis cancer, thyroid cancer, urinary with information Such as the chemical structure, purity, 10 bladder cancer, uterine or endometrial cancer, and Vulval quantity, and physiochemical characteristics of the com CaCC. pound. In certain embodiments, prior to treatment, the patients In the methods of the invention, the test agents are are selected for having a particular cancer, or for being at typically provided free in Solution, however the agent may risk of a particular cancer. The presence of cancer can be be in complex with solid forms. 15 determined by means well known to clinicians. Initial In some embodiments, the test agent increases activation assessment of cancer is based on symptoms presented by the of the IL-9 receptor by at least 5%, 10%, 20%, 30%, 40%, patient. In addition, there are follow-up diagnostic proce 50%, 50%, 70%, 80%, 90%, 1-fold, 1.1-fold, 1.5-fold, dures, including, but not limited to PET scans, CAT scans, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 50-fold, 100-fold or biopsies, and bio-marker assessments. more higher relative to an untreated control, e.g. as mea Symptoms of cancer will vary dependent upon the type of sured by increase in expression of TH2AF1 or ICACC, at cancer that is present. However, symptomatic signs of either the mRNA or protein level. cancer, may include fatigue, weight loss or gain, or pale skin In some embodiments, the test agent inhibits RORY by at color. least 5%, 10%, 20%, 30%, 40%, 50%, 50%, 70%, 80%, In one embodiment of the methods described herein, at 90%, 1-fold, 1.1-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 25 least one symptom of cancer is alleviated by at least 5%, at 10-fold, 50-fold, 100-fold or more higher relative to an least 10%, at least 20%, at least 30%, at least 40%, at least untreated control, e.g. as measured with RORY reporter 50%, at least 60%, at least 70%, at least 80%, or at least constructs are commercially available, for example Cat Nos. 90%. In such an embodiment, the clinical signs and/or the K1883 and K1882 from Invitrogen (Grand Island, N.Y.). symptoms associated with the cancer are lessened as a result Methods of Treatment 30 of the administration of the agonist/s. The signs or symp Provided herein are methods for treating or preventing toms to be monitored are characteristic of a particular cancer cancer in a subject. The methods comprise administering to and are known to the skilled clinician, as well as the methods a subject in need thereof a therapeutically effective amount for monitoring the signs and conditions. of an agent that is an agonist of the interleukin-9 receptor In one embodiment of the methods described herein, the (IL-9R). 35 cancer is a tumor and the size is reduced by at least 5%, at As used herein, “treatment”, “treating”, “prevention” or least 10%, at least 20%, at least 30%, at least 40%, at least “amelioration of cancer refers to inhibition of growth of a 50%, at least 60%, at least 70%, at least 80%, or at least tumor, inhibiting metastasis of cancer, delaying or prevent 90%. ing the onset of cancer, or reversing, alleviating, ameliorat In one embodiment of the methods described herein, the ing, inhibiting, slowing down, or stopping the progression of 40 cancer is a lesion (e.g. melanoma lesion or lung cancer cancer. The term “treatment’ or “treating, as used herein, lesion) and the size is reduced by at least 5%, at least 10%, does not encompass 100% cure of cancer. However, in one at least 20%, at least 30%, at least 40%, at least 50%, at least embodiment, the therapeutic methods described herein may 60%, at least 70%, at least 80%, or at least 90%. result in 100% reversal of disease. In one embodiment of the methods describe herein, can As used herein, the term “subject' or “patient’ or refers 45 cer cell proliferation, or cancer growth, is inhibited by at to any mammal. The patient is preferably a human, but can least 5%, at least 10%, at least 20%, at least 30%, at least also be a mammal in need of Veterinary treatment. 40%, at least 50%, at least 60%, at least 70%, at least 80%, The methods described herein are useful for the treatment or at least 90%. The skilled clinician may monitor the size of any type of cancer in a subject. As used herein, the term or rate of growth of a tumor using a diagnostic imaging "cancer includes any type of cancer. A "cancer in a subject 50 method typically used for the particular tumor (e.g., using refers to the presence of cells possessing characteristics ultrasound or magnetic resonance image (MRI) to monitor a typical of cancer-causing cells, such as uncontrolled prolif tumor). eration, immortality, metastatic potential, rapid growth and In some embodiments, the methods described herein may proliferation rate, and certain characteristic morphological be used to treat melanoma. The term "melanoma' as used features. Often, cancer cells will be in the form of a tumor, 55 herein includes all types of melanoma, including, for but such cells may exist alone within a Subject, or may be a example, melanoma skin cancer, ocular melanoma, and non-tumorigenic cancer cell. Such as a leukemia cell. In mucosal melanoma. Melanoma is caused by changes mel Some circumstances, cancer cells will be in the form of a anocytes that produce melanin. There are four major types of tumor, such cells may exist locally within an Subject, or melanoma: 1) Superficial spreading melanoma, which is circulate in the blood stream as independent cells, for 60 usually flat and irregular in shape and color, with different example, leukemic cells. In one embodiment, the cancer shades of black and brown and is most common in Cauca may be tumorogenic cancer, i.e. a cancer associated with a sians, 2) nodular melanoma, which usually starts as a raised tumor, or a skin lesion such as in melanoma. area that is dark blackish-blue or bluish-red, but can be Examples of cancer include, but are not limited to, breast colorless, 3) Lentigo maligna melanoma, which usually cancer, melanoma, adrenal gland cancer, biliary tract cancer, 65 occurs in the elderly and is most common in Sun-damaged bladder cancer, brain or central nervous system cancer, skin on the face, neck, and arms. The abnormal skin areas bronchus cancer, blastoma, carcinoma, a chondrosarcoma, are usually large, flat, and tan with areas of brown, 4) Acral US 9,629,910 B2 15 16 lentiginous melanoma, which is the least common form and of cancer, or a patient that has had a cancer removed usually occurs on the palms, Soles, or under the nails and is Surgically. Alternatively, administration of the combination more common in African Americans. Melanomas may also therapy may be given to a patient with rising cancer marker appear in the mouth, iris of the eye, or retina at the back of protein levels. Multiple biomarkers for particular cancers are the eye and can be found during dental or eye examinations. 5 known in the art, for example cancer biomarkers are Although very rare, melanoma can also develop in the reviewed in Henry NL, Hayes D F (2012) Cancer biomark vagina, esophagus, anus, urinary tract, and Small intestine. ers. Mol. Oncol. available online February 6, in press. The presence of melanoma can be determined by means Example melanoma markers described in PCT Publications well known to those of skill in the art, e.g. tissue biopsies WO 2008/141275, WO 2009/073513, or in U.S. Pat. No. and in situ assays in which malignant melanoma (malignant 10 7,442,507. melanocytes Scattered in all epidermal layers) show atrophic When provided therapeutically, the administration of the epidermis, prominent dermal Solar elastosis and almost composition comprising the agonist agent may be provided always lymphocytic infiltration. Invasion of the dermis by at (or after) the onset of a symptom of cancer, or upon melanocytes may occur in lentigo maligna melanoma. In indication of tumor. addition, melanoma may be detected by methods that 15 For any combination therapy used herein, e.g. multiple include, but are not limited, immunohistochemistry using agonist Such as IL-4 and TGFB, the agonists can be present the melanoma specific antibody HMB-45, or RT-PCR with in the same or different pharmaceutical composition. When different melanoma associated antigens (MAA) including, administrated at different times, the can be administered but not limited to tyrosinase, MART-1/Melan A, Pmel-17, within 5 minutes, 10 minutes, 20 minutes, 60 minutes, 2 TRP-1, and TRP-2 (see, e.g., Hatta N., et al., J. Clin Pathol. hours, 3 hours, 4, hours, 8 hours, 12 hours, 24 hours of 1998 August; 51 (8):597-601). Biomarkers for melanoma are administration of the other. When the agonist are adminis also known and can be used for example to assess Subjects tered in different pharmaceutical compositions, routes of at risk of melanoma. Non-limiting example biomarkers for administration can be different. melanoma are described in PCT Publications WO 2008/ The effective dosage range for the administration of the 141275, WO 2009/073513, or in U.S. Pat. No. 7,442,507, 25 agonists depends upon the form of the agonist and its which are herein incorporated by reference in their entirety. potency. It is an amount large enough to produce the desired Symptoms of melanoma include, but are not limited to, a effect in which symptoms of cancer are ameliorated (e.g. mole, Sore, lump, or growth on the skin that may bleed, or inhibition of tumor growth). The phrase “therapeutically exhibit change in skin coloring. Often patients are told of an effective amount’ as used herein means that amount of ABCDE system the can help them remember possible 30 agonist agent or composition comprising the agonist/s which symptoms of melanoma to watch out for: Asymmetry: a is effective for producing the desired therapeutic effect, in at mole where one half of the abnormal area is different from least a sub-population of cells, in a subject at a reasonable the other half Borders, the edges of the growth are irregular; benefit/risk ratio applicable to any medical treatment. For Color, the color changes from one area to another, with example, an amount of an agent administered to a subject shades of tan, brown, or black, and sometimes white, red, or 35 that is sufficient to produce a statistically significant, mea blue, e.g. a mixture of colors may appear within one Sore; Surable change in at least one symptom of cancer. Determi Diameter, the spot is usually (but not always) larger than 6 nation of a therapeutically effective amount is well within mm in diameter, about the size of a pencil eraser; and the capability of those skilled in the art. Generally, a Evolution, the mole keeps changing appearance. therapeutically effective amount can vary with the subjects In one embodiment of the methods described herein, at 40 history, age, condition, sex, as well as the severity and type least one symptom of melanoma is alleviated by at least 5%, of the medical condition in the Subject, and administration of at least 10%, at least 20%, at least 30%, at least 40%, at least other pharmaceutically active agents. There are preclinical 50%, at least 60%, at least 70%, at least 80%, or at least melanoma models that are well known to those of skill in the 90%. In such an embodiment, the clinical signs and/or the art which can be used to determine therapeutically effective symptoms associated with the melanoma are lessened as a 45 amounts of the agents and to optimize administration result of the administration of the inhibitor/s. The signs or regimes. See for example Yang et al. (2010) RG7204 symptoms to be monitored are characteristic of a particular (PLX4032). A selective BRAFV600E inhibitor, displays melanoma and are known to the skilled clinician, as well as potent antitumor activity in preclinical melanoma models, the methods for monitoring the signs and conditions. Cancer Research, 70:5518-5527, which is herein incorpo In another embodiment, the practice of the method in 50 rated by reference its entirety. conjunction with other therapies is contemplated Such as In one embodiment, a therapeutically effective amount of conventional chemotherapy, radiation therapy or Surgery agonist, inhibits tumor volume in a preclinical model by at directed against Solid tumors and for control of establish least 5%, at least 10%, at least 20%, at least 30%, at least ment of metastases. The administration of angiogenesis 40%, at least 50%, at least 60%, at least 70%, at least 80%, inhibiting amounts of combination therapy may be con 55 at least 90% and reduces at least one symptom of melanoma ducted before, during or after chemotherapy, radiation by at least 5%, at least 10%, at least 20%, at least 30%, at therapy or Surgery. least 40%, at least 50%, at least 60%, at least 70%, at least Pharmaceutical Compositions and Administration 80%, or at least 90%. For example, tumor volumes in Embodiments of the method described herein comprises Xenograft mice can be calculated using the following ellip administering to a Subject an agonist of the IL-6 receptor for 60 soid formula: Dx(d2)/2, in which D represents the large the treatment of cancer (e.g. melanoma and other cancers). diameter of the tumor, and d represents the Small diameter. The administration of the agonist may be for either “pro Tumor Volumes of treated groups are presented as percent phylactic' or “therapeutic purpose. When provided pro ages of tumor volumes of the control groups (% T/C) using phylactically, therapy is provided in advance of any symp the following formula: 100x(T-T)/(C-C), in which T tom. The prophylactic administration of the therapy serves 65 represents mean tumor volume of a treated group on a to prevent formation of cancer. Prophylactic administration specific day during the experiment. To represents mean may be given to a patient with, for example, a family history tumor Volume of the same treated group on the first day of US 9,629,910 B2 17 18 treatment, C represents mean tumor volume of a control tally, for example, as a pessary, cream or foam; (5) Sublin group on the specific day during the experiment, and Co gually; (6) ocularly; (7) transdermally; (8) transmucosally represents mean tumor Volume of the same treated group on (e.g. as a nasal spray or Suppository); or (9) nasally. Addi the first day of treatment. Percent tumor growth inhibition tionally, agents can be implanted into a patient or injected can be calculated as 100-%T/C, with >100% tumor growth using a drug delivery system. See, for example, Urquhart, et inhibition representing regression. Survival can be calcu al., Ann. Rev. Pharmacol. Toxicol. 24: 199-236 (1984): lated using a predefined cutoff volume of 2,000 mm as a Lewis, ed. “Controlled Release of Pesticides and Pharma surrogate for mortality (See e.g. Yang et al. (2010), Supra). ceuticals” (Plenum Press, New York, 1981): U.S. Pat. No. In one embodiment a therapeutically effective amount of 3,773.919; and U.S. Pat. No. 35 3,270,960. Guidance for agonist of the IL-9R increases the activity of the IL-9R by 10 formulations can be found in e.g. Remington: The Science at least 5%, at least 10%, at least 20%, at least 30%, at least and Practice of Pharmacy by Alfonso R. Gelmaro (Ed.) 20" 40%, at least 50%, at least 60%, at least 70%, at least 80%, edition: Dec. 15, 2000, Lippincott, Williams S Wilkins, or at least 90% and reduces at least one symptom of cancer ISBN: 06833.06472, and are briefly described below. by at least 5%, at least 10%, at least 20%, at least 30%, at As used here, the term “pharmaceutically acceptable' least 40%, at least 50%, at least 60%, at least 70%, at least 15 refers to those compounds, materials, compositions, and/or 80%, or at least 90%. dosage forms which are, within the scope of Sound medical In one embodiment a therapeutically effective amount of judgment, Suitable for use in contact with the tissues of the agonist of the IL9-R inhibits cellular proliferation in a human beings and animals without excessive toxicity, irri preclinical model by at least 5%, at least 10%, at least 20%, tation, allergic response, or other problem or complication, at least 30%, at least 40%, at least 50%, at least 60%, at least commensurate with a reasonable benefit/risk ratio. 70%, at least 80%, or at least 90% and reduces at least one As used here, the term “pharmaceutically-acceptable car symptom of cancer by at least 5%, at least 10%, at least 20%, rier” means a pharmaceutically-acceptable material, com at least 30%, at least 40%, at least 50%, at least 60%, at least position or vehicle, such as a liquid or Solid filler, diluent, 70%, at least 80%, or at least 90%. Inhibition of cellular excipient, manufacturing aid (e.g., lubricant, talc magne proliferation may be evaluated by 3-(4,5-dimethylthiazole 25 sium, calcium or Zinc Stearate, or steric acid), or solvent 2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT. Sigma) encapsulating material, involved in carrying or transporting assay. For example cells can be plated in 96-well microtiter the Subject agent from one organ, or portion of the body, to plates at a density of 1,000 to 5,000 cells per well in a another organ, or portion of the body. Each carrier must be volume of 180 pt. Twenty-four hours after cell plating, 20 LL “acceptable in the sense of being compatible with the other of an appropriate agent dilution can be added to plates in 30 ingredients of the formulation and not injurious to the duplicate. The plates may then be assayed for proliferation patient. Some examples of materials which can serve as 6 days after the cells were plated according to the procedure pharmaceutically-acceptable carriers include: (1) sugars, originally described by Mosmann, Rapid colomeric assay Such as lactose, glucose and Sucrose; (2) starches, such as for cellular growth and survival: application to proliferation corn starch and potato starch; (3) cellulose, and its deriva and cytotoxicity assays. J. Immunol. Methods 1883:65:55 35 tives, such as sodium carboxymethyl cellulose, methylcel 63). Percent inhibition can then be calculated and the IC50 lulose, ethyl cellulose, microcrystalline cellulose and cellu determined from the regression of a plot of the logarithm of lose acetate; (4) powdered tragacanth; (5) malt, (6) gelatin: the concentration versus percent inhibition by XLfit (version (7) lubricating agents. Such as magnesium Stearate, sodium 4.2: IDBS) using a Dose-Response One-Site Model (#205) lauryl Sulfate and talc.; (8) excipients, such as cocoa butter (see e.g. Yang et al. Supra) 40 and Suppository waxes; (9) oils, such as peanut oil, cotton The therapeutically effective dose can be estimated ini seed oil, safflower oil, Sesame oil, olive oil, corn oil and tially from a suitable cell culture or transcription assays (e.g. Soybean oil: (10) glycols, such as propylene glycol; (11) cancer cell growth assays, or e.g. transcription assays for polyols, such as glycerin, Sorbitol, mannitol and polyethyl inhibition of RORgamma activity, or assays to monitor ene glycol (PEG); (12) esters, such as ethyl oleate and ethyl activation of the IL-9R), then a dose of each agent and 45 laurate; (13) agar, (14) buffering agents, such as magnesium treatment regime may be formulated in animal models to hydroxide and aluminum hydroxide; (15) alginic acid, (16) achieve a circulating plasma concentration range that pyrogen-free water, (17) isotonic Saline; (18) Ringer's solu includes the IC50 as determined in cell culture. tion; (19) ethyl alcohol; (20) pH buffered solutions; (21) For administration to a subject, the agents can be provided polyesters, polycarbonates and/or polyanhydrides; (22) in pharmaceutically acceptable compositions. These phar 50 bulking agents, such as polypeptides and amino acids (23) maceutically acceptable compositions comprise a therapeu serum component. Such as serum albumin, HDL and LDL: tically-effective amount of one or more agonists of IL-9R. (22) C-C alcohols, such as ethanol; and (23) other non formulated together with one or more pharmaceutically toxic compatible Substances employed in pharmaceutical acceptable carriers (additives) and/or diluents. The pharma formulations. Wetting agents, coloring agents, release ceutical compositions can be specially formulated for 55 agents, coating agents, Sweetening agents, flavoring agents, administration in Solid or liquid form, including those perfuming agents, preservative and antioxidants can also be adapted for the following: (1) oral administration, for present in the formulation. The amount of agent which can example, drenches (aqueous or non-aqueous solutions or be combined with a carrier material to produce a single Suspensions), lozenges, dragees, capsules, pills, tablets (e.g., dosage form will generally be that amount of the agent those targeted for buccal, Sublingual, and systemic absorp 60 which produces a therapeutic effect. Generally out of one tion), boluses, powders, granules, pastes for application to hundred percent, this amount will range from about 0.1% to the tongue; (2) parenteral administration, for example, by 99% of agent, preferably from about 5% to about 70%, most Subcutaneous, intramuscular, intravenous or epidural injec preferably from 10% to about 30%. tion as, for example, a sterile solution or Suspension, or Formulations Suitable for parenteral administration con Sustained-release formulation; (3) topical application, for 65 veniently include sterile aqueous preparation of the active example, as a cream, ointment, or a controlled-release patch agent which is preferably isotonic with the blood of the or spray applied to the skin; (4) intravaginally or intrarec recipient. Thus, such formulations may conveniently contain US 9,629,910 B2 19 20 distilled water, 5% dextrose in distilled water or saline. intraarticular, Sub capsular, Subarachnoid, intraspinal, intrac Useful formulations also include concentrated solutions or erebro spinal, and intrasternal injection and infusion. Solids containing the agent which upon dilution with an In some embodiments, cells that express IL-9 are admin appropriate solvent give a solution Suitable for parental istered to a subject by adoptive cell transfer. Methods for administration above. administering cells are well known to those of skill in the art For enteral administration, an agent can be incorporated e.g. as provided in WO 2004/048557; WO 2008/033403; into an inert carrier in discrete units such as capsules, U.S. 2008/0279813 WO2008/033403: U.S. Pat. No. 7,572, cachets, tablets or lozenges, each containing a predeter 631; and WO 2009/131712, which are herein incorporated mined amount of the active agent; as a powder or granules; by reference in their entirety. The amount of IL-9 producing or a Suspension or solution in an aqueous liquid or non 10 cells (e.g. Th9 cells or T. cells, among others) which will aqueous liquid, e.g., a Syrup, an elixir, an emulsion or a be effective in the treatment and/or suppression of cancer draught. Suitable carriers may be starches or Sugars and may be determined by standard clinical techniques. The include lubricants, flavorings, binders, and other materials of dosage will depend on the type of cancer to be treated, the the same nature. 15 severity and course of the cancer, previous therapy the A tablet may be made by compression or molding, option recipient has undertaken, the recipient’s clinical history, and ally with one or more accessory ingredients. Compressed the discretion of the attending physician. The IL-9 producing tablets may be prepared by compressing in a Suitable cell population may be administered in various treatment machine the active agent in a free-flowing form, e.g., a regimes, e.g., a single or a few doses over one to several days powder or granules, optionally mixed with accessory ingre to ameliorate symptoms or periodic doses over an extended dients, e.g., binders, lubricants, inert diluents, Surface active time to inhibit cancer progression or to prevent cancer or dispersing agents. Molded tablets may be made by recurrence. The precise dose to be employed in the formu molding in a Suitable machine, a mixture of the powdered lation will also depend on the route of administration, and active agent with any Suitable carrier. the seriousness of the disease or disorder, and should be A syrup or Suspension may be made by adding the active 25 decided according to the judgment of the practitioner and agent to a concentrated, aqueous Solution of a Sugar, e.g., each patient’s circumstances. Effective doses may be Sucrose, to which may also be added any accessory ingre extrapolated from dose-response curves derived from in dients. Such accessory ingredients may include flavoring, an vitro or animal model test systems. Exemplary, non-limiting agent to retard crystallization of the Sugar or an agent to doses that could be used in the treatment of human subjects increase the solubility of any other ingredient, e.g., as a 30 range from at least 3.8x10", at least 3.8x10, at least polyhydric alcohol, for example, glycerol or Sorbitol. 3.8x10, at least 3.8x107, at least 3.8x10, at least 3.8x10, Formulations for rectal administration may be presented or at least 3.8x10" IL-9 producing cells/m2. In certain as a Suppository with a conventional carrier, e.g., cocoa embodiments, the dose used in the treatment of human butter or Witepsol S55 (trademark of Dynamite Nobel subjects ranges from about 3.8x10 to about 3.8x10" IL-9 Chemical, Germany), for a Suppository base. 35 producing cells/m2. Cells may be administered systemically, Formulations for oral administration may be presented or locally at the site of the cancer. with an enhancer. Orally-acceptable absorption enhancers In some embodiments, the agonists of the IL-9R are include Surfactants such as Sodium lauryl Sulfate, palmitoyl nucleic acids, e.g. e.g. including, but not limited to, DNA, carnitine, Laureth-9, phosphatidylcholine, cyclodextrin and antisense, ribozyme or RNAi (e.g. siRNA, shRNA). Meth derivatives thereof; bile salts such as sodium deoxycholate, 40 ods of delivering RNAi interfering (RNAi) agents, other Sodium taurocholate, Sodium glycochlate, and sodium fusi nucleic acid agents (e.g. nucleic acids that encode IL-9, or date; chelating agents including EDTA, citric acid and other agonist nucleic acids or peptides), or vectors contain salicylates; and fatty acids (e.g., oleic acid, lauric acid, ing agonist nucleic acids, to the target cells (e.g., cancer or acylcarnitines, mono- and diglycerides). Other oral absorp tumor cells) can include, for example directly contacting the tion enhancers include benzalkonium chloride, benzetho 45 cell with a composition comprising a modulatory nucleic nium chloride, CHAPS (3-(3-cholamidopropyl)-dimethyl acid, or local or systemic injection of a composition con ammonio-1-propanesulfonate), Big-CHAPS (N.N-bis(3-D- taining the agonist nucleic acid. In one embodiment, nucleic gluconamidopropyl)-cholamide), chlorobutanol, octoxynol acid agents (e.g. RNAi, siRNA, or other nucleic acid, 9, benzyl alcohol, phenols, cresols, and alkyl alcohols. In expression vectors that encode agonists (including viral one embodiment, the oral absorption enhancer may be 50 vectors) are injected directly into a tumor or lymph system. Sodium lauryl Sulfate. In some embodiments agonist nucleic may be delivered by As used herein, the term “administer' or “administering systemic administration, wherein the nucleic acid is com refers to the placement of a composition into a subject by a plexed with, or alternatively contained within a carrier. method or route which results in at least partial localization Example carriers for modulatory nucleic acid agents of the composition at a desired site such that desired effect 55 include, but are not limited to, peptide carriers, viral vectors, is produced. A agent or composition described herein can be gene therapy reagents, and/or liposome carrier complexes administered by any appropriate route known in the art and the like. including, but not limited to, oral or parenteral routes, Alternatively, the agent may be administered in liposomes including intravenous, intramuscular, Subcutaneous, trans or microspheres (or microparticles). Methods for preparing dermal, airway (aerosol), pulmonary, nasal, rectal, and topi 60 liposomes and microspheres for administration to a patient cal (including buccal and Sublingual) administration. are well known to those of skill in the art. U.S. Pat. No. Exemplary modes of administration include, but are not 4,789.734, the contents of which are hereby incorporated by limited to, injection, infusion, instillation, inhalation, or reference, describes methods for encapsulating biological ingestion. "Injection' includes, without limitation, intrave materials in liposomes. A review of known methods is nous, intramuscular, intraarterial, intrathecal, intraventricu 65 provided by G. Gregoriadis, Chapter 14, "Liposomes. Drug lar, intracapsular, intraorbital, intracardiac, intradermal, Carriers in Biology and Medicine, pp. 287-341 (Academic intraperitoneal, transtracheal, Subcutaneous, Subcuticular, Press, 1979) also U.S. Pat. Nos. 4,906,474, 4,925,673 and US 9,629,910 B2 21 22 3,625,214, and Jein, TIPS 19:155-157 (1998), the contents With respect to duration and frequency of treatment, it is of which are hereby incorporated by reference. typical for skilled clinicians to monitor subjects in order to In some embodiments, the agents described herein for determine when the treatment is providing therapeutic ben treatment of cancer may be administered to a subject in efit, and to determine whether to increase or decrease combination with additional pharmaceutically active agents. 5 dosage, increase or decrease administration frequency, dis Exemplary pharmaceutically active compounds/agents continue treatment, resume treatment or make other altera include, but are not limited to, those found in Harrison's tion to treatment regimen. The dosing schedule can vary Principles of Internal Medicine, 13" Edition, Eds. T. R. from once a week to daily depending on a number of clinical Harrison et al. McGraw-Hill N.Y., NY: Physicians Desk factors, such as the Subjects sensitivity. Reference, 50" Edition, 1997, Oradell N.J., Medical Eco 10 nomics Co.: Pharmacological Basis of Therapeutics, 8" The desired dose can be administered at one time or Edition, Goodman and Gilman, 1990; United States Phar divided into Subdoses, e.g., 2-4 Subdoses and administered macopeia, The National Formulary, USP XII NF XVII, over a period of time, e.g., at appropriate intervals through 1990; current edition of Goodman and Oilman's The Phar the day or other appropriate schedule. Such Sub-doses can be macological Basis of Therapeutics; and current edition of 15 administered as unit dosage forms. In some embodiments, The Merck Index, the complete contents of all of which are administration is chronic, e.g., one or more doses daily over incorporated herein by reference. a period of weeks or months. Examples of dosing schedules Toxicity and therapeutic efficacy can be determined by are administration daily, twice daily, three times daily or four standard pharmaceutical procedures in cell cultures or or more times daily over a period of 1 week, 2 weeks, 3 experimental animals, e.g., for determining the LD50 (the weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 dose lethal to 50% of the population) and the ED50 (the dose months, or 6 months or more. The pharmaceutical compo therapeutically effective in 50% of the population). The dose sitions can be administered during infancy (between 0 to ratio between toxic and therapeutic effects is the therapeutic about 1 year of life), childhood (the period of life between index and it can be expressed as the ratio LD50/ED50. infancy and puberty) and during puberty (between about 8 Compositions that exhibit large therapeutic indices, are 25 years of life to 18 years of life). The pharmaceutical com preferred. positions can also be administered to treat adults (greater The data obtained from the cell culture assays and animal than about 18 years of life). A dose administered at least studies can be used in formulating a range of dosage for use once, may be provided as a bolus, a continuous administra in humans. The dosage of Such agents lies within a range of tion or sustained release. Multiple administration over a circulating concentrations that include the ED50 with little 30 period of weeks or months may be preferable. It may also be or no toxicity. The dosage may vary within this range preferable to administer the dose at least once/week and depending upon the dosage form employed and the route of even more frequent administrations (e.g. daily). Subsequent administration utilized. doses may be administered as indicated. The therapeutically effective dose can be estimated ini In one embodiment, the agonist may be administered to a tially from cell culture assays. A dose may be formulated in 35 Subject using an administration regime that results in a animal models to achieve a circulating plasma concentration steady state concentration of 70 g/mL, or 60 ug/mL, or 50 range that includes the IC50 (i.e., the concentration of the ug/mL, 40 ug/mL, 30 mcg/ml, or 20 g/mL (Rozman, B. therapeutic which achieves a half-maximal inhibition of (2002) Clinical pharmacokinetics of leflunomide, Clin. symptoms) as determined in cell culture. Levels in plasma Pharmacokinetic, 41:421-430). In one embodiment, the may be measured, for example, by high performance liquid 40 steady state concentration is 60 ug/mL or less, 50 ug/mL or chromatography. The effects of any particular dosage can be less, 40 g/mL or less, 30 ug/ml or less, or 20 ug/mL or less. monitored by a suitable bioassay. In one embodiment, the agonist may be administered at a The dosage may be determined by a physician and high concentration (e.g. 100 to 1000 mg) daily for 3 days, adjusted, as necessary, to Suit observed effects of the treat followed by lower daily doses of 20 to 100 mg/ml. for a ment. Generally, the compositions are administered so that 45 steady state concentration. In one embodiment, agonist may the agent is given at a dose from 1 Jug/kg to 150 mg/kg, 1 be administered at a dosage of 960 mg twice a day, at a g/kg to 100 mg/kg, 1 Lig/kg to 50 mg/kg, 1 g/kg to 20 dosage less than 900 mg twice a day, less than 850 mg twice mg/kg, 1 g/kg to 10 mg/kg, 1 Jug/kg to 1 mg/kg, 100 g/kg a day, less than 800 mg twice a day, or less than 700 mg to 100 mg/kg, 100 ug/kg to 50 mg/kg, 100 ug/kg to 20 twice per day. mg/kg, 100 g/kg to 10 mg/kg, 100 g/kg to 1 mg/kg, 1 50 The efficacy of a given treatment regime for cancer can be mg/kg to 100 mg/kg, 1 mg/kg to 50 mg/kg, 1 mg/kg to 20 determined by the skilled clinician, for example by assessing mg/kg, 1 mg/kg to 10 mg/kg, 10 mg/kg to 100 mg/kg, 10 physical indicators of cancer, Such as e.g., tumor size or mg/kg to 50 mg/kg, or 10 mg/kg to 20 mg/kg. It is to be lesion size, metastasis, tumor growth rate, etc. However, a understood that ranges given here include all intermediate treatment is considered “effective treatment,” as the term is ranges, for example, the range 1 mg/kg to 10 mg/kg includes 55 used herein, if any one or all of the signs or symptoms of the 1 mg/kg to 2 mg/kg, 1 mg/kg to 3 mg/kg, 1 mg/kg to 4 cancer are altered in a beneficial manner, e.g. improved or mg/kg, 1 mg/kg to 5 mg/kg, 1 mg/kg to 6 mg/kg, 1 mg/kg ameliorated by at least 10% following treatment with an to 7 mg/kg, 1 mg/kg to 8 mg/kg, 1 mg/kg to 9 mg/kg, 2 agent that is an agonist of the IL-9R. Efficacy can also be mg/kg to 10 mg/kg, 3 mg/kg to 10 mg/kg, 4 mg/kg to 10 measured by a failure of an individual to worsen as assessed mg/kg, 5 mg/kg to 10 mg/kg, 6 mg/kg to 10 mg/kg, 7 mg/kg 60 by stabilization of tumor growth, hospitalization or need for to 10 mg/kg, 8 mg/kg to 10 mg/kg, 9 mg/kg to 10 mg/kg medical interventions (i.e., progression of the melanoma is etc. . . . It is to be further understood that the ranges halted or at least slowed). Methods of measuring these intermediate to the given above are also within the scope for indicators are known to those of skill in the art and/or use in methods and pharmaceutical compositions described described herein. Treatment includes in an individual herein, for example, in the range 1 mg/kg to 10 mg/kg, dose 65 includes: (1) inhibiting the disease, e.g., arresting, or slow ranges such as 2 mg/kg to 8 mg/kg, 3 mg/kg to 7 mg/kg. 4 ing tumor or lesion growth; or (2) relieving the disease, e.g., mg/kg to 6 mg/kg etc. causing regression of symptoms, reducing tumor or lesion US 9,629,910 B2 23 24 size; and (3) preventing or reducing the likelihood of the The abbreviation, "e.g. is derived from the Latin exempli development of cancer, or preventing metastasis of the gratia, and is used herein to indicate a non-limiting example. CaCC. Thus, the abbreviation “e.g. is synonymous with the term Also provided are methods for the prognosis of cancer “for example.” (e.g. melanoma or other cancers) in a subject. The methods 5 The terms “polypeptide,” “peptide' and “protein’ refer to comprise determining the level of IL-9 producing T cells in a polymer of amino acid residues. The terms apply to amino a tumor, wherein the presence of reduced levels of IL-9 acid polymers in which one or more amino acid residue is an producing T-cells (e.g. Th9 cells) within the tumor as artificial chemical mimetic of a corresponding naturally compared to the level of IL-9 producing T-cells (e.g. Th9 occurring amino acid, as well as to naturally occurring cells) in normal skin or normal blood is indicative of 10 amino acid polymers and non-naturally occurring amino increased metastatic potential and a poor prognosis. The acids. level of IL-9 producing T cells may be determined by means As used herein, "variant polypeptides' may comprise well known to those of skilled in the art, e.g. as described in conservatively Substituted sequences, meaning that one or Example 1 herein. In one specific embodiment, the cancer is 15 more amino acid residues (such as a native IL-9 polypeptide, melanoma, however any cancer may be prognosed using the or other polypeptide, or cytokine etc.) is replaced by differ methods described herein. ent residues, and that the conservatively substituted poly In certain embodiments, the reduced level of IL-9 pro peptide retains a desired biological activity, that is essen ducing T-cells indicates a treatment protocol for the that tially equivalent to that of the native polypeptide. Examples comprises administrating to the Subject in need thereof an of conservative substitutions include substitution of amino agonist of the IL-9 receptor, e.g. an agent that binds and acids that do not alter the secondary and/or tertiary structure activates the IL-9 receptor such as IL-9 or other agonist; or of the polypeptide. Other examples involve substitution of an agent that increases IL-9 expression in the Subject (e.g. amino acids that have not been evolutionarily conserved. administration of IL-9 producing T cells, such as tumor One or more polypeptide sequences from non-human spe specific TH9 cells that express IL-9, or administration of an 25 cies can be aligned with, for example, human using methods inhibitor of RORy). well known to one of ordinary skill in the art to determine Methods for directing treatment in a subject are also which residues are conserved and which tolerate more provided. In one embodiment, the method comprises deter variability. Advantageously, in Some embodiments, these mining the level of RORY expression in T cells present conserved amino acids are not altered when generating within a tumor, wherein an an increased expression of RORY 30 conservatively Substituted sequences. in T cells of the tumor as compared to T cells in normal Any given amino acid may be replaced by a residue human blood or skin, indicates that the cancer may be having similar physiochemical characteristics, e.g., substi treated with an inhibitor of RORy. The level of RORY may tuting one aliphatic residue for another (Such as Ile, Val, Leu, be determined by means well known to those of skilled in or Ala for one another), or substitution of one polar residue the art, e.g. as described herein and as described in Example 35 for another (such as between Lys and Arg: Glu and Asp; or 1; kits are available for RORY detection. Gln and ASn). Other such conservative Substitutions, e.g., Substitutions of entire regions having similar hydrophobicity DEFINITIONS characteristics, are well known. For example, IL-9 polypep tides comprising conservative amino acid Substitutions can As used herein the term “comprising or “comprises” is 40 be tested in any one of the assays described herein to confirm used in reference to compositions, methods, and respective that a desired apoptotic activity of a native IL-9 is retained. component(s) thereof, that are essential to the invention, yet Amino acids may be grouped according to similarities in open to the inclusion of unspecified elements, whether the properties of their side chains (in A. L. Lehninger, in essential or not. Biochemistry, second ed., pp. 73-75, Worth Publishers, New As used herein the term “consisting essentially of refers 45 York (1975)): (1) non-polar: Ala (A), Val (V), Leu (L), Ile to those elements required for a given embodiment. The (I), Pro (P), Phe (F), Trp (W), Met (M); (2) uncharged polar: term permits the presence of additional elements that do not Gly (G), Ser (S), Thr (T), Cys (C), Tyr(Y), Asn (N), Gln (O); materially affect the basic and novel or functional charac (3) acidic: Asp (D), Glu (E); (4) basic: Lys (K), Arg (R), His teristic(s) of that embodiment of the invention. (H). Alternatively, naturally occurring residues may be The term “consisting of refers to compositions, methods, 50 divided into groups based on common side-chain properties: and respective components thereof as described herein, (1) hydrophobic: Norleucine, Met, Ala, Val, Leu, Ile; (2) which are exclusive of any element not recited in that neutral hydrophilic: Cys, Ser. Thr, Asn., Gln; (3) acidic: Asp, description of the embodiment. Glu; (4) basic: His, Lys, Arg; (5) residues that influence Other than in the operating examples, or where otherwise chain orientation: Gly, Pro: (6) aromatic: Trp, Tyr, Phe. indicated, all numbers expressing quantities of ingredients 55 Non-conservative Substitutions will entail exchanging a or reaction conditions used herein should be understood as member of one of these classes for another class. Conser modified in all instances by the term “about.” The term vative substitutions may include, for example: Ala into Gly "about when used in connection with percentages may or into Ser; Arg into Lys; ASn into Gln or into His; Asp into meant 1%. Glu: Cys into Ser; Gln into Asn; Glu into Asp: Gly into Ala The singular terms “a,” “an,” and “the include plural 60 or into Pro; His into ASnor into Gln, Ile into Leu or into Val; referents unless context clearly indicates otherwise. Simi Leu into Ile or into Val; Lys into Arg, into Glin or into Glu; larly, the word 'or' is intended to include “and” unless the Met into Leu, into Tyr or into Ile; Phe into Met, into Leu or context clearly indicates otherwise. It is further to be under into Tyr; Ser into Thr; Thr into Ser; Trp into Tyr Tyr into stood that all base sizes or amino acid sizes, and all Trp; and/or Phe into Val, into Ile or into Leu. Any cysteine molecular weight or molecular mass values, given for 65 residue not involved in maintaining the proper conformation nucleic acids or polypeptides are approximate, and are of the polypeptide also can be substituted, generally with provided for description. serine, to improve the oxidative stability of the molecule and US 9,629,910 B2 25 26 prevent aberrant crosslinking Conversely, cysteine bond(s) of activity or expression measurable using the same assay in can be added to the polypeptide to improve its stability or the absence of the inhibitor. The IC50 can be as measured in facilitate oligomerization. vitro or in vivo. The IC50 can be determined by measuring As used herein, the term “nucleic acid' or “nucleic acid activity using a conventional in vitro assay (e.g. protein sequence” refers to any molecule, preferably a polymeric activity assay, or gene expression assay e.g. RORY activity, molecule, incorporating units of ribonucleic acid, deoxyri or inhibition of proliferation, migration, or tumor/lesion bonucleic acid or an analog thereof. The nucleic acid can be size). either single-stranded or double-stranded. A single-stranded As used herein, the term “co-stimulatory molecule-acti nucleic acid can be one strand nucleic acid of a denatured Vating agents’ refers to any compound well-known to one of double-stranded DNA. Alternatively, it can be a single 10 stranded nucleic acid not derived from any double-stranded skill in the art that immunospecifically binds to or associates DNA. In one aspect, the template nucleic acid is DNA. In with a co-stimulatory molecule expressed by an immune cell another aspect, the template is RNA. Suitable nucleic acid (preferably, an activated immune cell) and induces the molecules are DNA, including genomic DNA, ribosomal activation of a signal transduction pathway associated with DNA and cDNA. Other suitable nucleic acid molecules are 15 the co-stimulatory molecule. For example, a compound that RNA, including mRNA, rRNA and tRNA. The nucleic acid immunospecifically binds to or associates with a co-stimu molecule can be naturally occurring, as in genomic DNA, or latory molecule selectively expressed by an activated it may be synthetic, i.e., prepared based up human action, or immune cell (e.g., an activated T-cell) and induces the may be a combination of the two. The nucleic acid molecule activation of a signal transduction pathway associated with can also have certain modification Such as 2'-deoxy. 2'-de the co-stimulatory molecule. Co-stimulatory molecule-acti oxy-2'-fluoro. 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE). Vating agents include, but are not limited to, proteinaneous 2'-O-aminopropyl (2'-O-AP). 2'-O-dimethylaminoethyl (2'- agents (e.g., cytokines, peptide mimetics, and antibodies), O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), Small molecules, organic compounds, inorganic compounds, 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or and nucleic acid molecules comprising nucleotide sequences 2'-O N-methylacetamido (2'-O-NMA), cholesterol addi 25 encoding proteins, polypeptides, or peptides (e.g., cytokines, tion, and phosphorothioate backbone as described in US peptide mimetics, and antibodies) that immunospecifically Patent Application 20070213292; and certain ribonucleoside bind to or associate with a co-stimulatory molecule that are is linked between the 2'-oxygen and the 4-carbon expressed by an activated immune cell and induce the atoms with a methylene unit as described in U.S. Pat. No. activation of a signal transduction pathway associated with 6.268,490, wherein both patent and patent application are 30 the co-stimulatory molecule. For example, ligands that incorporated hereby reference in their entirety. immunospecifically bind to a co-stimulatory molecule selec The terms “decrease”, “reduced”, “reduction”, “decrease' tively expressed by activated T-Cells increase the expression or “inhibit are all used herein generally to mean a decrease and/or release of cytokines by immune cells in an in vitro or by a statistically significant amount. However, for avoidance in vivo assay. “Co-stimulatory molecules' include, for of doubt, “reduced, “reduction' or “decrease' or “inhibit” 35 example: 1) B7/CD28 family molecules such as B7-1/CD80 means a decrease by at least 10% as compared to a reference CD28, B7-2/CD86 CTLA-4, B7-H1/PD-L1 Gi24/Dies 1/ level, for example a decrease by at least about 20%, or at VISTA, B7-H2 ICOS, B7-H3 PD-1, B7-H4 PD-L2/B7-DC, least about 30%, or at least about 40%, or at least about 50%, B7-H6 PDCD6 and BTLA: TNF superfamily molecules, or at least about 60%, or at least about 70%, or at least about 4-1BB/TNFRSF9/CD137 CD40 Ligand/TNFSF5, 4-1BB 80%, or at least about 90%. In one embodiment, there is a 40 Ligand/TNFSF9 GITR/TNFRSF18, BAFF/BLyS/ 100% decrease (e.g. absent level as compared to a reference TNFSF13B GITR Ligand/TNFSF18, BAFF R/TNFRSF13C sample). HVEM/TNFRSF14, CD27/TNFRSF7 LIGHT/TNFSF14, The terms “increased, “increase' or "enhance' or “acti CD27 Ligand/TNFSF7 OX40/TNFRSF4, CD30/TNFRSF8 Vate' are all used herein to generally mean an increase by a OX40 Ligand/TNFSF4, CD30 Ligand/TNFSF8 TACI/ statically significant amount; for the avoidance of any doubt, 45 TNFRSF13B, CD40/TNFRSF5; SLAM family 2B4/CD244/ the terms “increased, “increase' or "enhance' or “activate’ SLAMF4 CD84/SLAMF5, BLAME/SLAMF8 CD229/ means an increase of at least 10% as compared to a reference SLAMF3, CD2 CRACC/SLAMF7, CD2F-10/SLAMF9 level, for example an increase of at least about 20%, or at NTB-A/SLAMF6, CD48/SLAMF2 SLAM/CD150, CD58/ least about 30%, or at least about 40%, or at least about 50%, LFA-3; and other co-stimulatory molecules CD2 Ikaros, or at least about 60%, or at least about 70%, or at least about 50 CD53 Integrin alpha 4/CD49d, CD82/Kai-1 Integrin alpha 4 80%, or at least about 90% or up to and including a 100% beta 1, CD90/Thy 1 Integrin alpha 4 beta 7/LPAM-1, CD96 increase or any increase between 10-100% as compared to LAG-3, CD160 LMIR1/CD300A, CRTAMTCL1A, DAP12 a reference level, or at least about a 2-fold, or at least about TCL1B, Dectin-1/CLEC7A TIM-1/KIM-1/HAVCR, a 3-fold, or at least about a 4-fold, or at least about a 5-fold DPPIV/CD26 TIM-4, EphB6 TSLP, HLA Class I TSLP R, or at least about a 10-fold increase, or any increase between 55 HLA-DR. 2-fold and 10-fold or greater as compared to a reference It should be understood that the methods and composi level. tions described herewith are not limited to the particular The term “statistically significant’ or “significantly” methodology, protocols, and reagents, etc., described herein refers to statistical significance and generally means a two and as such may vary. The terminology used herein is for the standard deviation (2SD) below normal, or lower, concen 60 purpose of describing particular embodiments only, and is tration of the marker. The term refers to statistical evidence not intended to limit the scope of the present invention, that there is a difference. It is defined as the probability of which is defined by the claims. making a decision to reject the null hypothesis when the null As used herein and in the claims, the singular forms hypothesis is actually true. The decision is often made using include the plural reference and vice versa unless the context the p-value. 65 clearly indicates otherwise. Other than in the operating As used herein, the term "IC50” refers to the concentra examples, or where otherwise indicated, all numbers tion of an agent that produces 50% of the maximal inhibition expressing quantities of ingredients or reaction conditions US 9,629,910 B2 27 28 used herein should be understood as modified in all non-Small cell lung cancer, cancer of the nervous system, instances by the term “about.” kidney cancer, retinal cancer, melanoma skin cancer, stom All patents and other publications identified are expressly ach cancer, liver cancer, pancreatic cancer, genital-urinary incorporated herein by reference for the purpose of describ cancer, prostate cancer, colorectal cancer, and bladder can ing and disclosing, for example, the methodologies C described in Such publications that might be used in con Paragraph 16. The method of any of paragraphs 1-15, nection with the present invention. These publications are wherein the agonist is administered by a route selected from provided solely for their disclosure prior to the filing date of the group consisting of intravenous, intramuscular, Subcu the present application. Nothing in this regard should be taneous, intradermal, topical, intraperitoneal, intrathecal, construed as an admission that the inventors are not entitled 10 intrapleural, intrauterine, rectal, vaginal, intrasynovial, to antedate such disclosure by virtue of prior invention or for any other reason. All Statements as to the date or represen intraocular/periocular, intratumor, adoptive cell transfer, and tation as to the contents of these documents is based on the parenteral administration. information available to the applicants and does not consti Paragraph 17. Use of an effective amount of an agonist of tute any admission as to the correctness of the dates or 15 an interleukin-9 receptor (IL-9R) for the treatment of cancer. contents of these documents. Paragraph 18. The use of paragraph 17, wherein the Unless defined otherwise, all technical and scientific agonist of the IL-9 receptor (IL-9) is selected from the group terms used herein have the same meaning as those com consisting of a small molecule, a nucleic acid RNA, a monly understood to one of ordinary skill in the art to which nucleic acid DNA, a protein, a peptide, a cell, and an this invention pertains. antibody. Certain embodiments of the invention may be as defined Paragraph 19. The use of any of paragraphs 17-18, in any one of the following numbered paragraphs, i.e. wherein the agonist comprises an agent that binds the IL-9 paragraphs 1-32. receptor. Paragraph 1. A method for treating cancer in a subject Paragraph 20. The use of paragraph 19, wherein the agent comprising administering to a subject in need thereof a 25 that binds the IL-9 receptor comprises the cytokine inter therapeutically effective amount of an agonist of an inter leukin 9 (IL-9), or fragment thereof. leukin-9 receptor (IL-9R). Paragraph 21. The use of paragraph 20, wherein the Paragraph 2. The method of paragraph 1, wherein the cytokine interleukin 9 (IL-9) comprises human recombinant agonist of the IL-9 receptor (IL-9) is selected from the group interleukin-9 (rIL-9). consisting of a small molecule, a nucleic acid RNA, a 30 Paragraph 22. The use of any of paragraphs 17-19. nucleic acid DNA, a protein, a peptide, a cell, and an antibody. wherein the agonist is a monoclonal antibody. Paragraph 3. The method of any of paragraphs 1-2, Paragraph 23. The use of any of paragraphs 17-18, wherein the agonist comprises an agent that binds the IL-9 wherein the agonist comprises an agent that increases receptor. 35 expression of IL-9 in the subject as compared to IL-9 Paragraph 4. The method of paragraph 3, wherein the expression in the absence of the agonist. agent that binds the IL-9 receptor comprises the cytokine Paragraph 24. The use of paragraph 23, wherein the interleukin 9 (IL-9), or fragment thereof. agonist comprises a population of cells that express IL-9. Paragraph 5. The method of paragraph 4, wherein the Paragraph 25. The use of paragraph 24, wherein the cytokine interleukin 9 (IL-9) comprises human recombinant 40 population of cells comprises Th9 cells. interleukin-9 (rIL-9). Paragraph 26. The use of paragraph 23, wherein the Paragraph 6. The method of any of paragraphs 1-3, agonist comprises an inhibitor of RORY. wherein the agonist is a monoclonal antibody. Paragraph 27. The use of paragraph 26, wherein the Paragraph 7. The method of any of paragraphs 1-2, inhibitor of RORY comprises siRNA. wherein the agonist comprises an agent that increases 45 Paragraph 28. The use of paragraph 26, wherein the expression of IL-9 in the subject as compared to IL-9 inhibitor of RORY is selected from the group consisting of: expression in the absence of the agonist. ursolic acid, digoxin, SR 1001, and TO901317. Paragraph 8. The method of paragraph 7, wherein the Paragraph 29. The use of any of paragraphs 17-28, agonist comprises a population of cells that express IL-9. wherein the agonist further comprises a pharmaceutically Paragraph 9. The method of paragraph 8, wherein the 50 acceptable carrier. population of cells comprises Th9 cells. Paragraph 30. The use of any of paragraphs 17-29, Paragraph 10. The method of paragraph 7, wherein the wherein the Subject is human. agonist comprises an inhibitor of RORY. Paragraph 31. The use of any of the paragraphs of 17-30, Paragraph 11. The method of paragraph 10, wherein the wherein the cancer is selected from the group consisting of inhibitor of RORY comprises siRNA. 55 gastrointestinal cancer, prostate cancer, ovarian cancer, Paragraph 12. The method of paragraph 10, wherein the breast cancer, head and neck cancer, lung cancer, non-small inhibitor of RORY is selected from the group consisting of: cell lung cancer, cancer of the nervous system, kidney ursolic acid, digoxin, SR 1001, and TO901317. cancer, retinal cancer, melanoma skin cancer, stomach can Paragraph 13. The method of any of paragraphs 1-12, cer, liver cancer, pancreatic cancer, genital-urinary cancer, wherein the agonist further comprises a pharmaceutically 60 prostate cancer, colorectal cancer, and bladder cancer acceptable carrier. Paragraph 32. The use of any of paragraphs 17-31, Paragraph 14. The method of any of paragraphs 1-13, wherein the agonist is administered by a route selected from wherein the Subject is human. the group consisting of intravenous, intramuscular, Subcu Paragraph 15. The method of any of the paragraphs of taneous, intradermal, topical, intraperitoneal, intrathecal, 1-14, wherein the cancer is selected from the group consist 65 intrapleural, intrauterine, rectal, vaginal, intrasynovial, ing of gastrointestinal cancer, prostate cancer, ovarian can intraocular/periocular, intratumor, adoptive cell transfer, and cer, breast cancer, head and neck cancer, lung cancer, parenteral administration. US 9,629,910 B2 29 30 Paragraph 33, the method or use of any of paragraphs Because of the controversy discussed above, another 1-32, wherein the subject is not administered one or more approach to studying Th17 cells in tumor immunity was co-stimulatory molecule activating agents. pursued, using mice whose T cells were deficient in the Paragraph 34, a method for the prognosis of cancer (e.g. transcription factor retinoid-related orphan receptor-gamma melanoma or other cancers) in a Subject comprising assaying (RORy-/- mice). RORyt, a protein isoform of RORY, is a a tumor for the presence of IL-9 producing T cells, wherein lineage specific transcription factor critical for the develop the presence of reduced levels of IL-9 producing T-cells (e.g. ment of Th17 cells'' 7 whose deficiency abrogates the Th9 cells) within the tumor as compared to the level of IL-9 development of IL-17A secreting Th17 cells. Increased producing T-cells (e.g. Th9 cells) in normal skin is indicative expression of RORY is reported in several inflammatory of increased metastatic potential and a poor prognosis. 10 diseases including multiple Sclerosis/experimental autoim Paragraph 35, the method of paragraph 34 wherein the mune encephalitis (EAE)', while its absence is implicated reduced level of IL-9 producing T-cells indicates a treatment protocol for the Subject comprising administrating to the in attenuation of Ovalbumin induced allergic airway inflam Subject in need thereof an agonist of the IL-9 receptor (e.g. mation'. The role of RORY in tumor immunity has never IL-9), e.g. an agent that binds and activates the IL-9 receptor, 15 been directly assessed. Using RORy-/- mice and IL-23R-/- or an agent that increases IL-9 expression in the Subject (e.g. mice, we observed significant growth inhibition of B16F10 administration of IL-9 producing T cells, such as tumor melanoma, with evidence for increased anti-melanoma specific TH9 cells that express IL-9, or administration of an immune responses (tumor lymphocyte infiltration and inhibitor of RORy). increased cytokine expression). In parallel, transcriptional Paragraph 36, a method for directing treatment in a profiling experiments revealed the expected severely subject comprising determining the level of RORY expres impaired IL-23R and IL-17A expression in RORy-/- sion in T cells present within a tumor, wherein an increased CD4+ T cells differentiated under Th17 polarizing condi expression of RORY in T cells of the tumor as compared to tions. Unexpected, however, was a dramatic increase in the T cells in normal human blood or skin, indicates that the expression of IL-9 in these CD4+ T cells. cancer may be treated with an inhibitor of RORY. 25 The possibility that IL-9 overexpression might be related All references described herein, in the Examples and to the increased melanoma immunity seen in RORY-/- throughout the Specification, are incorporated herein by chimeric mice was therefore tested. Strikingly, depletion of reference in their entirety. IL-9 by neutralizing mAb in IL-23R-/- and RORy-/- chimeric mice was associated with enhanced melanoma EXAMPLES 30 growth. Mice deficient in IL-9 signaling pathways (IL 9R-/- mice), and normal mice treated with blocking IL-9 Robust Tumor Immunity to Melanoma Mediated by antibody had similarly enhanced growth. Administration of Interleukin 9 Th9 cells strongly inhibited melanoma growth, and this could be blocked by antibodies to IL-9. Treatment with The Examples described herein describe a novel and 35 exogenous rL-9 Suppressed melanoma, as well as lung previously unappreciated role for IL-9 in tumor immunity carcinoma growth, in normal hosts as well as in hosts and indicate novel therapeutic strategies. Recent studies deficient in Tand B cells. However, IL-9 did not block tumor have indicated that immunologic targeting of melanoma is a growth in mast cell deficient hosts. Finally, IL-9 producing promising strategy': however, how best to achieve this goal T cells (Th9 cells) were found in healthy human skin and is incompletely understood. There is general agreement that 40 blood, which show a phenotype directly comparable to T cell mediated assault on melanoma is required for an murine Th9 cells. IL-9 producing T cells are reduced or optimal long term result. An important role for CD4+ T cells absent in lesions of human metastatic melanoma. In con in tumor immunity is emerging from several recent clusion, described herein is the identification of previously studies. In combination with radiation therapy and unreported roles of IL-9 and Th9 cells in melanoma immu CTLA-4 blockade, adoptive transfer of naive tumor specific 45 nity. The initial observation that abrogation of pathways CD4+ T cells has been shown to eradicate large established important for Th17 cell development appears to enhance melanomas'. Moreover, anti-melanoma effects of CD4+ T melanoma immunity, may be mediated in large part through cells have been demonstrated in a melanoma lung metastasis the generation of a robust IL-9 mediated anti-melanoma model. response. The role of Th17 cells in tumor immunity is controversial, 50 with apparently contradictory results having been published. Example 1 IL-17A has been reported to favor development of several cancers by promoting angiogenesis and tumor cell Deficiency of RORY is Associated with Inhibited survival’. In contrast, other investigators have found that Melanoma Growth and Increased Tumor IL-17A can inhibit development of hematopoietic cancers by 55 Lymphocytic Infiltration promoting CD8+ T cell activation'''. Treatment of immu nocompetent tumor-bearing mice with Th17 cells reduced To examine the role of RORY in tumor immunity, a tumor colonies in the lung, and this anti-tumor activity of B16F10 murine melanoma model was used. RORy-/- mice Th17 cells was mediated through activation of CD8+T do not develop secondary lymph nodes and have fewer cells'. In another study', antigen specific Th17 cells medi 60 CD4+ and CD8+ T cells as compared to RORy+/+ mice'. ated regression of Subcutaneous tumors in a lymphopenic Therefore, RORy-/- chimeric (RORy-/-ch) and RORY--/+ host, and the anti-tumor effect was IFNY dependent. The ch mice were generated by administering bone marrow cells apparently contradictory reported effects of IL-17A in tumor from RORy-/- or RORy+/+ mice into sublethally irradiated immunity may depend on different experimental models and Rag1-/- C57BL/6 mice'''. After full reconstitution of T approaches' ' ', such as the immune status of the host, 65 cells and restoration of the intact immune system (8-10 endogenous or ectopic expression of IL-17, method of tumor weeks), mice were used for tumor growth experiments (FIG. induction, and the biological nature of the tumor. 7). US 9,629,910 B2 31 32 B16 melanoma cells were injected subcutaneously into Example 3 RORy+/+ chand RORy-/- ch mice, and tumor growth was monitored over time. RORy-/- ch mice were resistant to The Role of IL-9 in Melanoma Immunity in melanoma growth, and survival of the RORY-/- ch mice IL-23R-/- Mice was significantly increased compared to control mice (FIGS. 1A-1B). The infiltration of lymphocytes in tumors removed The most strongly downregulated gene in the transcrip from these mice was examined. Melanomas from RORy-/- tional profiling experiments on RORy-/- CD4 T cells was ch mice contained 3-fold higher numbers of CD4+ T cells IL-23R. In addition, expression of IL-23R is necessary for and CD8+ T cells as compared to RORY--/+ ch controls (FIG. the long-term maintenance of Th17 cells. Melanoma immu 1C). T cells from draining lymph nodes of RORy-/-ch 10 nity was therefore explored in mice deficient in IL-23R-/- melanoma bearing mice secreted negligible IL-17A, and as well. Sorted, naive CD4+ T cells were differentiated from IL-23R+/+ and IL-23R-/- mice under Th17 polarizing increased amounts of IFNY as well as TNFC. (FIG. 1D). conditions and demonstrated attenuated development of There was no difference in the number of melanoma IL-17A secreting Th17 cells in IL-23R-/- CD4+ T cells infiltrating CD4+CD25+FoxP3+T cells (T-regulatory cells) 15 (FIG. 9B). Interestingly, there was increased expression of in RORy+/+ch (7.2%+0.4) and RORy-/-ch (5.9-0.7). IL-9 compared to IL-23R+/+CD4+ T cells (FIG. 9B). Next, melanoma cells were injected Subcutaneously into Example 2 IL-23R+/+ and IL-23R-/- mice and additional groups of mice were subsequently treated with anti-IL-9 mAb. Mela Increased IL-9 Expression in RORY Deficient T noma growth was severely impaired in IL-23R-/- mice. It Cells was next asked, in this completely independent model, what role IL-9 played in this inhibition of tumor growth. Again, To further explore the mechanism of melanoma growth neutralization of IL-9 also led to impaired melanoma immu inhibition in RORy-/- ch mice, transcriptional profiling nity in IL-23R-/- and IL-23R+/+ (WT) mice (FIG. 9C), analysis was performed using CD4+ T cells from RORy-/- 25 suggesting that the production of IL-9 by TIL's observed and RORy+/+ mice differentiated under Th17 polarizing previously (FIG. 10E) was at least partially effective in conditions. As expected, expression of IL-17A, IL-17F and tumor growth suppression. Moreover, T cells from tumor IL-23R in RORy-/- CD4+ T cells was much lower com draining lymph nodes of IL-23R+/+ (WT) and IL-23R-/- pared to RORy+/+ CD4+ T cells (FIG. 2). However, expres mice secreted IL-9 (FIG. 3D) and there was increased IL-9 sion of IL-9 in RORy-/- CD4+ T cells was dramatically 30 secretion by IL-23R-/- T cells compared to IL-23R+/+ increased as compared to RORy+/+CD4+ T cells (FIGS. 2 (WT). and 8A-8C). Granzyme B and C expression were also significantly enhanced. Increased IL-9 mRNA expression Example 4 and increased frequency of IL-9 secreting cells by RORy-/- CD4+ T cells was observed (FIGS. 8A-8C). Because of the 35 Th9 Cells Inhibit Melanoma Growth striking upregulation of IL-9 under these conditions, Subse Since IL-9 is mainly produced by CD4+ T cells, the role quent experiments were focused on the potential role of IL-9 of effector subsets of CD4+ T cells in melanoma immunity in tumor immunity. was examined. Th1. Th2. Th9 and Th17 cells were generated To be certain that the T cells from RORy-/- ch mice did 40 from naive CD4+ T cells of OT2 mice. CD4+ T cells from not have an intrinsic property that predisposed them to IL-9 OT-2 mice express transgenic TCR that recognizes an Ova production; naive and memory CD4+ T cells from these mice peptide expressed on B16F10-ova melanoma cells. Before were examined. CD4+ T cells, CD4+CD25-CD62L low adoptive transfer into mice, in vitro cytokine polarized (memory T cells) and CD4+CD25-CD62L high (naive CD4+ T cells were analyzed for their cytokine expression. As CD4+ T cells) from RORy+/+ and RORy-/- mice were 45 expected, OT2-Th1 cells produced IFN-Y, OT2-Th2 cells culture sorted and stimulated with plate bound anti-CD3/ produced IL-4, OT2-Th9 cells produced abundant IL-9, and CD28 mAbs. There was increased expression of IL-9 in OT2-Th17 cells produced principally IL-17A (FIG. 11A). RORy-/- CD4+ T cells (FIGS. 9A-9B) and memory CD4+T Differentiated OT2-Th1, OT2-Th2, OT2-Th9 or OT2-Th17 cells (FIGS. 9C-9E). However, negligible IL-9 expression cells were transferred into Syngeneic immunocompetent was observed in naive CD4+T cells, and importantly there 50 hosts (WTC57BL/6). On the same day, B16F10-ova mela was no difference in IL-9 expression between RORy+/+ and noma cells were injected subcutaneously. Mice treated with RORy-/- naive CD4+ T cells (FIG.9F). Th2 and Th9 cells OT2-Th9 cells showed the most resistance to melanoma also secrete IL-9''; there was increased IL-9 expression in growth, and mice treated with OT2-Th17 or OT2-Th2 cells, RORy-/- Th2 cells; however, RORy-/- CD4+ T cells under but not OT2-Th1 cells, showed slower melanoma growth 55 compared to the control group (FIG. 4A). Th9 condition showed increased IL-9 production compared To determine if Th9 cells could inhibit the melanoma to RORy+/+Th9 cells (FIGS. 9G-9H). development independent of endogenous T cells, OT2-Tho To explore if the enhanced anti-melanoma response in and OT2-Th9 cells generated from OT2 mice were trans RORy-/- ch mice could be attributed to IL-9, melanoma ferred into immunocompromised hosts (Rag1-/- C57BL/6 cells were injected subcutaneously into RORy-/- ch mice. 60 mice). Here, OT2-Th9 cells inhibited B16F10-ova induced Tumor growth in these mice lagged significantly behind that melanoma growth (FIG. 4B), and survival of OT2-Th9 of RORY--/+ch mice. In an attempt to reverse this, mice were treated mice was significantly increased compared with treated with neutralizing mAb to IL-9. As shown in FIG.3A, control group (FIG. 4C). This data suggest that Th9 cells are the severely impaired melanoma growth in RORY-/- ch capable of inhibiting melanoma development, even in the mice was significantly, but not completely, reversed by 65 absence of CD8+ T cells. To investigate if IL-9 secreted by neutralization of IL-9. These results indicate that this mela OT2-Th9 cells is responsible for the observed anti-mela noma growth inhibition was partially dependent on IL-9. noma responses, blocking IL-9 was used by neutralizing US 9,629,910 B2 33 34 mAb in OT2-Th9 treated mice (FIG. 4B). IL-9 blockade gated. Melanoma cells were injected into Rag1-/- C57BL/6 accelerated melanoma growth in OT2-Th9 treated mice, mice, which lack T and B cells. These mice were treated Suggesting at least partial dependence of this effect directly with either rIL-9 or PBS (control). In this setting, rIL-9 on IL-9. treatment still significantly slowed melanoma growth (FIG. To determine whether Th9 cells could directly kill mela noma cells, CFSE labeled B16F10-ova cells were co-cul 5D), suggesting that the target of the IL-9 effect was not a tured with OT2-Th9 cells for 24 h. At that point, B16F10 T cell or B cell. IL-9 is also known to promote mast cell ova cells were recovered and stained with 7-AAD, a development and function, so mast cell deficient mice (Kit sensitive indicator of apoptotic cell death. Strikingly, OT2 W-sh/HNihrJaeBSmJ) were injected with B16 melanoma Th9 cells alone were capable of inducing apoptosis in and lewis lung carcinoma cells (LLC-1), respectively, melanoma cells, whereas OT2-Tho and OT2-Th17 cells 10 treated mice systemically with rIL-9 in the same fashion, were much less effective in this regard (FIG. 12A). Next, the and measured tumor growth (melanoma: FIG. 5E, LLC-1: mechanism of Th9 cell direct cytotoxicity was assessed. A FIG. 5F). Strikingly, under these conditions, there was no limited profile of effector molecules in Th9 cells was per significant difference in tumor development in IL-9 treated formed (FIG. 11B). Increased expression of granzyme-B in Th9 cells was observed. Therefore, OT2-Th9 cells were 15 mast cell deficient mice, as compared to control. These pre-incubated with a granzyme B inhibitor before co-culture highly reproducible data Suggest that tumor growth inhibi with tumor cells to assess the effect on their cytotoxic tion mediated by IL-9 depends upon the presence of mast activity. cells, but not on the presence of T cells or B cells. Moreover, Inhibition of granzyme B significantly attenuated the the anti-tumor effect of IL-9 was seen on two different tumor OT2-Th9 cell cytotoxic activity (FIG. 12B). To further cell lines of completely different development cellular ori explore the direct cytotoxic effects of Th9 cells, another gin: LLC-1 and B16 melanoma. cytotoxic assay" was used. OT2-Th9 cells were incubated with CFSE labeled (5uM) B16Ova cells and CFSE labeled Example 7 (0.5 LM) EL-4 cells for 36 h. There were dose dependent effects of Th9 cells on tumor cell lysis (FIG. 12C). More 25 Presence of IL-9 Producing T Cells (Th9 Cells) in importantly, OT2-Th9 cells killed B16ova cell but not a Human Skin and Peripheral Blood tumor cell line that did not express Ova, Suggesting that Th cell mediated cytotoxic effects are tumor specific (FIG. The existence of human Th9 cells is controversial; for this 12C). work to be relevant to melanoma patients, these cells were 30 identified in human tissues. Specifically, it was asked if IL-9 Example 5 producing Th9 cells can be identified in humans, and if so, do they possess a phenotype comparable to mouse Th9 cells. Abrogation of IL-9/IL-9R Signaling Promotes Mouse Th9 cells are defined as a distinct population of Melanoma Development, and Treatment with rIL-9 CD4+ T cells that produce IL-9 but not IFNY (Th1), IL-4 Inhibits Melanoma Development 35 (Th2) or IL-17 (Th17). It was possible to demonstrate that human memory T cells isolated from peripheral blood The results above strongly implicated IL-9 in tumor contained a distinct population of IL-9 producing T cells that immunity. To analyze the role of IL-9 in tumor growth more does not produce IFNY, IL-4 and IL-17. T cells with an directly, melanoma cells were injected into IL-9R-/- mice, identical phenotype, and in greater abundance, were also and tumor growth was monitored. Melanoma growth was 40 found skin-resident T cells isolated from healthy skin (FIGS. significantly accelerated in IL-9R-/- mice compared to 6A-6B). Finally, the presence of IL-9 producing T cells in T IL-9R-/- mice (FIG. 5A). It was next asked if administra cells extracted from patients with Stage IV unresectable tion of rL-9 could protect mice against melanoma growth metastatic melanoma was examined (metastasis to lung and progression. Remarkably, treatment of melanoma bear (n=4), skin (n=2), adrenal gland (n=1), bone (n=1)). Detect ing mice with recombinant IL-9 (rIL-9) both impaired 45 able IL-9 producing T cells were observed in 6 out of 8 melanoma growth (FIG. 5B) and increased the survival of biopsies; however, this IL-9 production was significantly mice (data not shown). To examine if rIL-9 could potentiate lower in T cells from metastatic melanoma compared with the anti-melanoma response in mice already vaccinated T cells extracted from healthy donors (FIG. 6c). against melanoma, mice were treated with 1 million irradi Described herein are five findings: 1) Mice deficient in ated melanoma cells (as vaccine) and 7 days later, melanoma 50 pathways related to Th17 development (RORY-/- and cells were injected. Mice were treated with rIL-9 or with IL-23R-/-) show significant resistance to melanoma growth PBS alone. Again, rIL-9 treated mice showed significantly in a fashion that is largely IL-9 dependent; 2) Th9 cells slower melanoma growth (FIG. 4A). To investigate the role inhibit tumor growth in an IL-9 dependent fashion; 3) mice of IL-9 in tumors other than melanoma, Lewis lung carci deficient in IL-9 signaling, either by germline inactivation of noma (LLC-1) cells were used. LLC-1 tumor development 55 the receptor gene or by antibody blockade, exhibit enhanced was significantly Suppressed in rL-9 treated mice compared melanoma growth; 4) treatment of tumor bearing mice with with a control group (FIG.5C), consistent with the extensive exogenous rL-9 inhibits tumor growth in normal mice, and observations with B16 melanoma tumors described above this effect is dependent on the presence of mast cells but not herein. T and B cells; and 5) memory Th9 T cells can be identified 60 in normal human blood and skin, and are present at reduced Example 6 levels in metastatic melanoma lesions. At the outset of the study, the goal was to assess the role Mast Cells, but not Adaptive Immune Cells, are of Th17 cells in melanoma immunity; thus, RORy-/- ch Required for the Anti-Tumor Effect of IL-9 mice and IL-23R-/- mice, which can not generate or 65 maintain Th17 cells, respectively, were used. Melanomas Subsequently, the mechanism of IL-9 mediated tumor implanted in RORy-/- mice and IL-23R-/- showed immunity, specifically as it relates to T cells, was investi impaired growth and increased tumor infiltration by T cells, US 9,629,910 B2 35 36 Suggesting an important role for the Th17 pathway in tumor effects of IL-9 on tumor cell growth was examined (FIGS. immunity. However, the role of other pathways remained an 10B-10D). EL-4 T lymphoma cells were used as a control. open question. Melanoma cells and lung carcinoma show negligible IL-9R To explore the expression of unknown factors with anti expression and IL-9 does not affect the growth of these cells tumor properties, gene expression analysis was performed 5 in vitro, Suggesting that IL-9 mediated anti-tumor effects on with CD4+ T cells of RORy-/- and RORy+/+ controls melanoma cells and on lung carcinoma cells are indirect. differentiated under Th17 polarizing conditions. This analy However, increased IL-9R expression on EL-4 cells was sis revealed a striking increase in IL-9 expression in observed (FIG. 4C). It was asked if the growth of this tumor RORy-/- Th cells. These data indicate that absence of RORY could be inhibited by IL-9, and neither inhibition nor accel promotes IL-9 expression. Little is known about the regu 10 eration of EL-4 tumor growth was observed (data not lation of IL-9. Recent studies have suggested that IL-25 and included). This suggests that the presence of IL-9R on EL-4 IL-21 enhance IL-9 expression in mice and humans, respec cells, and previously reported growth and Survival promot tively'’. The precise mechanism by which the absence of ing properties of IL-9 T cells, may be accountable for RORY promotes IL-9 expression in T cells is not known, negligible anti-tumor effect of IL-9 in this tumor model. although analysis of the IL-9 promoter does not reveal an 15 Therefore, these data indicate that the anti-tumor effects of RORY binding site (data not shown). However, the data IL-9 are indirect, and also indicates that potential tumor presented herein demonstrates severely impaired IL-23R targets of riL-9 therapy should be selected with care: spe expression on RORy-/- CD4+ T cells. In concert, increased cifically, lymphomas and other cells known to express IL-9 expression was observed in IL-23R-/- CD4+ T cells. receptors for this cytokine may not be appropriate candi Therefore, attenuated signaling via IL-23R expression in dates for treatment. RORy-/- CD4+ T cells might be one of the factors respon To explore the adaptive immune-mediated anti-tumor sible for increased in IL-9 expression. To evaluate if effects of IL-9, it was asked if the tumor inhibitor effect of increased IL-9 expression is critical for the observed anti IL-9 would be preserved in mice deficient in T and B cells. melanoma responses in RORy-/- ch mice and IL-23R-/- Strikingly, no difference was found in the degree of tumor mice, IL-9 was blocked by treating mice systemically with 25 inhibition mediated by exogenous IL-9 between normal and a neutralizing anti-IL-9 antibody. Depletion of IL-9 in both Rag-1-f- mice. This suggests that if anything, the effect of RORy-/-ch mice and IL-23R-/- and normal WT mice IL-9 on the adaptive immune system is not sufficient to clearly accelerated melanoma growth. mediate the beneficial effects of IL-9 in tumor growth Since IL-9 is primarily a product of CD4+ T cells, the role inhibition. Furthermore, it appears that the anti-melanoma of IL-9 producing Th cells (Th9 cells) in tumor immunity 30 properties of IL-9 are neither mediated via direct effect on T was explored. Mice treated with Th9 cells showed profound or B cell activation nor via direct effects on tumor cells. resistance to melanoma development. This is believed to be Because the effect of exogenous IL-9 appears to be the first report demonstrating anti-tumor effect of Th9 cells. independent of T and B cells, and because the anti-tumor Previous studies have reported that adoptive transfer of Th9 effects of Th9 cells can be largely abrogated by neutralizing cells can induce colitis and peripheral neuritis in lympho 35 antibodies to IL-9, other immune cells that might be targets poenic host, indicating significant immune effector func for IL-9 were sought. IL-9 is a potent activator of mast cells, tion mediated by these cells. Similar to previous a cell type that has recently been implicated in anti-tumor reports''. Th2 and Th17 cells, but not Th0 and Th1 cells activity". Therefore, mast cell deficient mice were used to inhibited melanoma growth in the experiments described study the IL-9 mediated anti-tumor effect. Strikingly, rIL-9 herein. However the anti-melanoma properties of Th9 cells 40 treatment was observed to have no inhibitory effect on tumor were far superior to Th17 cells, in both immunocompetent growth in mast cell deficient hosts, suggesting that mast cells and immunocompromised hosts. play an important role in the anti-tumor activity mediated by In vitro, Th9 cells showed modest but measurable direct IL-9. Future studies are needed to delineate how IL-9 cytotoxic activity on melanoma cells, a novel and striking modulates the mast cell anti-tumor activity (Survival, and/or observation. Increased expression of Granzyme Band C was 45 function). also observed in Th9 cells, a possible mechanism of Th9 cell Finally, there has been some controversy about whether direct cytotoxicity, and a Granzyme B inhibitor was shown Th9 cells were a purely murine phenomenon, and therefore to partially block Th9 mediated melanoma cytotoxicity. not relevant to human disease. Human skin and blood were Therefore, it appears that Th9 cells possess robust anti examined for the presence of memory T cells that could melanoma activity mediated in large part by direct release of 50 produce IL-9. IL-9 producing T cells were readily found in IL-9. However, in this setting, blockade of IL-9 in Th9 populations of human skin resident memory T cells and in treated mice accelerated tumor growth, Suggesting that Th9 the memory T cell population of PBMCs. Importantly, these cell anti-melanoma activity is significantly IL-9 dependent. IL-9 producing human T-cells appear to be authentic analogs To determine independently whether IL-9 has anti-mela of murine Th9 cells, as they do not produce other Th cell noma activities, melanoma growth was studied in IL-9R-/- 55 lineage cytokines such as IFN-Y (Th1), IL-4 (Th2), and mice. Melanoma growth was reproducibly accelerated in IL-17 (Th17). Production of IL-9 by T cells in tumor IL-9R-/- mice. These data indicate that IL-9 appears to be draining lymph nodes in the B16 melanoma model was an independent factor that influences tumor growth. The data demonstrated, and therefore it was asked whether Th9 cells also indicate that treatment with exogenous IL-9 reproduc could be found in human metastatic melanoma samples. In ibly suppresses the growth of B16 melanoma in the same 60 6 of 8 samples, the presence of memory Th9 TIL's could be tumor model. To rule out the possibility that this process was detected, but at a much lower abundance than memory Th9 unique to a single tumor type, it was asked whether the cells in either normal skin or blood. The finding of low levels growth of a lung carcinoma cell line could be similarly of Th9 T cells in human metastatic melanoma is interesting. inhibited. Reproducibly, LLC-1 growth was significantly These results suggest that Th9 cells are part of the normal inhibited by IL-9. To rule out the unlikely possibility that 65 human immune response to melanoma, and thus augmenting this was a direct effect of IL-9 on the tumor cells, IL-9R their activity, or providing additional IL-9, should be thera expression on tumor cells was investigated and the direct peutically advantageous in this setting. US 9,629,910 B2 37 38 The role of IL-9 in tumor immunity has not been previ day 5, cells were harvested and processed for cytokine ously explored. Interestingly, however, single nucleotide analysis at RNA or protein level by real-time RT-PCR, flow polymorphisms in IL-9 gene were found to be associated cytometry and ELISA. with increased risk of cutaneous malignant melanoma For adoptive transfer experiments, CD4+Th cells differ (CMM). Therefore, IL-9 was suggested as one of the entiation was carried out using above mentioned protocol highly significant modifier genes for CMM using pathway with few modifications. Plate bound anti-CD3 (2 g/ml) and permutation analysis. A very recent paper by Smith et al’ anti-CD28 (1 lug/ml) was used in place of irradiated sple reported that blockade of endogenous IL-9 alone does not nocytes. In addition to above mention polarization condi enhance the Survival of tumor bearing mice; however, in tion, anti-IFNY mAb (10 ug/ml) was added into Th9 cultures 10 and anti-IFN-Y mAb (10 g/ml) plus anti-IL-4 mAb (10 combination with CpG therapy anti-IL-9 increases the sur ug/ml) was added into Th17 cultures. vival of Balb-neuT mice. These investigators speculate that Tumor (Melanoma, Lewis Lung Carcinoma and Thymic blockade of IL-9 signaling inhibits Treg function and thus Lymphoma) Induction. In Vivo T Cell Transfer and IL-9 promotes vaccine induced effector T-cell mediated anti Neutralization. tumor responses. As described herein, however, blockade of 15 Melanoma cell lines (B16F10 cells or B16F10-ova cells), endogenous IL-9 invariably accelerated tumor development T cell lymphoma (EL-4 or ovalbumin expressing EL-4 in the B16 melanoma model, and the absence of IL-9 (EG-7)) and Lewis lung carcinoma (LLC1) were grown in signalling (i.e., IL-9R-/- mice) also enhanced melanoma RPMI1640 supplemented with 10% FBS, and penicillin/ growth. The discrepancy between the results described streptomycin. B16F10 cells (2-4x10 cells/150 ul/mouse), herein and that of Smith et al is difficult to reconcile; EL-4 (2x10 cells/150 LA/mouse), or LLC1 (5x10 cells/ however, there are clear differences between the experimen 150 LA/mouse) were injected subcutaneously into the right tal design described herein and that of Smith et al. First, or left flank of the mice and tumor development was the tumor models used were distinct. In addition, the experi monitored over time. Tumor volume was calculated by ments described herein did not use vaccine or adjuvant in following formula: (major circumferenceXminor circumfer combination with endogenous IL-9 blockade or with exog 25 ence)/2. Mice were sacrificed when there was external enous IL-9 treatment to boost adaptive immune response. In necrosis or/and tumor Volume reached no greater than 2 cm Summary, all of the experiments described herein, using a in any direction. large number of different variables, were consistent with a To investigate the role of effector subsets of Th cells on distinct anti-tumor effect of IL-9. The data presented herein melanoma and thymic lymphoma growth, 2-million differ also show that this anti-tumor effect was largely mediated by 30 entiated cells (Th1, Th2, Th9 and Th17) from CD45.1+ mast cells, which have not been reported to be targets of CD45.2-OT2 TCR transgenic mice were injected (iv) into Treg inhibition. WT-C57BL6 mice or Rag1-f- (C57BL6 background)) mice In conclusion, described herein is an unexpected role of and, on the same day tumor cells (B16F10-ova cells: 3x10 IL-9 and Th9 cells in anti-tumor immune responses. Strat cells/150 ul/mouse) were injected subcutaneously. Tumor egies that favor generation of IL-9 mediated immune 35 growth was monitored over time. responses, while blocking IL-17 mediated responses, may IL-9 activity in vivo was neutralized by injecting (i.p.) have an important clinical role in the treatment of mela 100 ug anti-IL-9 mab (clone: MM9C1, a generous gift by noma. Other Yc chain cytokines, such as IL-2, IL-15, and Jacques van Snick (Ludwig Institute, Belgium)) for 4 times IL-21', have been used in the treatment of human on day 0, day 3, day 6 and day 10. Melanoma cells were melanoma, and the data presented herein indicate that IL-9 40 injected on day 0 and melanoma growth was monitored over and Th9 cells have an important role in treatment of this time. challenging malignancy. rIL-9 (5ug/100 LA PBS/mouse from Cell Sciences, USA) was injected (ip) from day 0 and every third day till the Methods termination of the experiment. In lewis lung carcinoma 45 (LLC-1) model, rIL-9 (50 ng/100 ul PBS/mouse from RnD Mice. systems) was used on every alternate day till the termination WTC57BL/6, Rag1-/- C57BL/6 and IFNY-/- mice were of experiment. Unlike Cell Science rIL-9 (source: E. coli), obtained from Jackson Laboratories. IL-9R-/-, IL23R-/- rIL-9 from RinD systems is glycosylated and therefore has and RORy-/- and their control mice (RORY--/+, IL9R-/+) stronger biological activity compared to Cell Sciences. were provided by Jean-Christophe Renauld (Ludwig Insti 50 Thus, 100 times less rL-9 was used in LLC-1 tumor model tute, Belgium), V K Kuchroo (BWH) and A M Jetten' experiments compared to melanoma model experiments. In (NIH), respectively. Mice were housed in conventional, addition, melanoma bearing mice were treated with rIL-9 pathogen-free facilities at the animal facility of Harvard from RnD systems which produced similar results as were Medical School. observed with rIL-9 from Cell Sciences (data not shown). In Vitro T Cell Differentiation. 55 Cytotoxicity Assay. CD4+CD25-CD62Lhigh cells from RORy-/- mice or For the cytotoxicity assay, CFSE labeled B16F10-ova RORy+/+ controls were sorted by CD4+CD62L+ isolation cells (5x10 cells/500 ul) were cultured with differentiated kit II from Miltenyi Biotech (USA) according to manufac Th cells (OT2-Tho, OT2-Th9 and OT2-Th17) in several turer's protocol. Purity of CD4+CD25-CD62Lhigh was different ratios. After 24 h of co-culture, cells (gate on CFSE >95%. 60 labeled B16F10-ova cells) were analyzed for 7-AAD stain Sorted CD4+CD25-CD62Lhigh cells were differentiated ing by flow cytometry. In addition, another cytotoxicity into Th1 (IL-12:10 ng/ml), Th2 (IL-4: 10 ng/ml), Th9 assay was used as described before". (TGF-3 plus IL-4: 1 ng/ml and 10 ng/ml), and Th17 (TGF-B Growth Curve Assay. plus IL-6: 1 ng/ml and 10 ng/ml) in presence with plate Effect of rIL-9 on growth of B16F10 cells were studied by bound anti-CD3 (1 lug/ml) and irradiated splenocytes (1:5 65 growth curve assay. B16F10 cells were seeded with rIL-9. ratio). After 48 h cells were fed with IL-2 (10 ng/ml) After each incubation period cells were fixed (10% acetic containing fresh media and split into two parts, if needed. On acid in 10% ethanol). Cells were subsequently stained with US 9,629,910 B2 39 40 0.4% crystal violet in 10% ethanol for 30 min. Subsequently, 2. Mumberg, D., et al. CD4 (+) T cells eliminate MHC class 200 ul 10% acetic acid was added. After 30 min, 100 uL II-negative cancer cells in vivo by indirect effects of solution was transferred into 96-well plate and OD was IFN-gamma. Proc Natl Acad Sci USA 96, 8633-8638 measured at 595-wavelength. (1999). Measurement of Cytokines by Intracellular Cytokine 5 3. Perez-Diez, A., et al. CD4 cells can be more efficient at Staining, CBA, ELISA and Quantitative RT-PCR. tumor rejection than CD8 cells. Blood 109, 5346-5354 Intracellular cytokines by Lymph node (LNs) cells, sple (2007). nocytes, TILs or in vitro differentiated Th cells were quan 4. Quezada, S. A., et al. Tumor-reactive CD4(+) T cells tified after restimulation with PMA plus ionomycin and develop cytotoxic activity and eradicate large established GolgiStopTMss described previously. 10 melanoma after transfer into lymphopenic hosts. J Exp Cytokines were quantified in cell free culture Supernatants Med 207, 637-650 (2010). by cytometric bead array (CBA by BD Biosciences) or by 5. Xie. Y., et al. Naive tumor-specific CD4 (+) T cells ELISA (eBioscience) according to the manufacturers differentiated in vivo eradicate established melanoma. J instructions. 15 Exp Med 207, 651-667 (2010). RNA was extracted with High pure RNA isolation kit 6. Mattes, J., et al. Immunotherapy of cytotoxic T cell (Roche), cDNA was made by First strand cDNA synthesis resistant tumors by T helper 2 cells: an eotaxin and kit (BioRad) and quantitative RT-PCR was done using STATE-dependent process. J Exp Med 197, 387-393 multiplex kit (BioRad) on iCyclerTM real time PCR detection (2003). system (BioRad) according to the manufacturers instruc 7. Numasaki, M., et al. Interleukin-17 promotes angiogen tions. IL-9R PCR was carried out by using IL-9R specific esis and tumor growth. Blood 101, 2620-2627 (2003). TaqManTM (Thermofisher) probes and AB Biosystem PCR 8. Numasaki, M., et al. IL-17 enhances the net angiogenic machine. activity and in vivo growth of human non-Small cell lung Cell Purification, Sorting, Intracellular Cytokine Staining cancer in SCID mice through promoting CXCR-2-depen and Cytokine Quantification in Supernatants (Human 25 dent angiogenesis. J Immunol 175, 6177-6189 (2005). Study). 9. Wang, L., et al. IL-17 can promote tumor growth through PBMCs were isolated from buffy coats of healthy donors an IL-6-Stat3 signaling pathway. J Exp Med 206, 1457 by density centrifugation. Memory CD4+ T cells were puri 1464 (2009). fied from freshly isolated PBMCs by negative selection 10. Benchetrit, F., et al. Interleukin-17 inhibits tumor cell using a Memory CD4+ T cells Isolation Kit (Miltenyi 30 growth by means of a T-cell-dependent mechanism. Blood Biotech, Germany) and stimulated with anti-CD3/CD2/ 99, 2114-2121 (2002). CD28 beads (Milyenyi) in presence of TGFb (3 ng/ml). 11. Kryczek, I., et al. Phenotype, distribution, generation, Normal human skin Samples were obtained as discarded and functional and clinical relevance of Th17 cells in the material after cosmetic Surgery according to Institutional human tumor environments. Blood 114, 1141-1149 Review Board of Partners Human Research Committee. 35 (2009). Total skin T cells from healthy donors and T cells of 12. Kryczek, I., Wei, S., Szeliga, W., Vatan, L. & Zou, W. melanoma metastasis were isolated from explant cultures Endogenous IL-17 contributes to reduced tumor growth grown with IL-2 and IL-15 as previously described. and metastasis. Blood 114, 357-359 (2009). Activated memory T cells from PBMCs, and skin T cells 13. Martin-Orozco, N., et al. T helper 17 cells promote and T cells of melanoma metastasis isolated by the explant 40 cytotoxic T cell activation in tumor immunity. Immunity culture technique were stimulated for 5 h in the presence of 31, 787-798 (2009). PMA/ionomycin (Sigma-Aldrich) plus Brefeldin A. After 14. Muranski, P. et al. Tumor-specific Th17-polarized cells incubation, CD4+ T cells were stained for IFNY (anti-IFNY: eradicate large established melanoma. Blood 112, 362 B27), IL-4 (anti-IL-4: MP4-25D2), IL-9 (antiIL-9: MH9A4) 373 (2008). and IL-17 (anti-IL-17: eBio64DEC17) using standard intra 45 15. Ivanov, I I, Zhou, L. & Littman, D. R. Transcriptional cellular staining and analyzed by flow cytometry. regulation of Th17 cell differentiation. Semin Immunol 19, Memory T cells from blood, skin and melanoma metas 409–417 (2007). tasis were stimulated at 10° cells/ml with beads coated with 16. Jetten, A. M. & Joo, J. H. Retinoid-related Orphan CCD3/CCD2/oCD28 (bead:T cell ratio: 1:2 from Miltenyi Receptors (RORs): Roles in Cellular Differentiation and Biotech) in the presence of IL-2 (50 IU/ml) and TGF-B (3 50 Development. Adv Dev Biol 16, 313-355 (2006). ng/ml) for 2 days. IL-9 in culture Supernatants was measured 17. Yang, X. O., et al. T helper 17 lineage differentiation is by Luminex bead-based multiplex assays using a custom programmed by orphan nuclear receptors ROR alpha and made Luminex bead assay as described previously". ROR gamma. Immunity 28, 29-39 (2008). Statistical Analysis. 18. Tilley, S. L., et al. Retinoid-related orphan receptor Student t-test (two tailed) was performed for the data 55 gamma controls immunoglobulin production and Th1/ analysis using GraphPad Prism Software program. A paired Th2 cytokine balance in the adaptive immune response to t-test was used in FIGS. 8H and 8.J. The p value <0.005, allergen. J Immunol 178, 3208-3218 (2007). 0.025 and 0.05 are represented as ***, ** and * respectively. 19. Kurebayashi, S., et al. Retinoid-related orphan receptor All the references cited below and cited throughout the gamma (RORgamma) is essential for lymphoid organo specification, are herein incorporated by reference in their 60 genesis and controls apoptosis during thymopoiesis. Proc entirety. Natl AcadSci USA 97, 10132-10137 (2000). 20. Elyaman, W., et al. IL-9 induces differentiation of TH17 REFERENCES OF THE EXAMPLES cells and enhances function of FoxP3+ natural regulatory T cells. Proc Natl Acad Sci USA 106, 12885-12890 1. Hodi, F. S., et al. Improved survival with ipilimumab in 65 (2009). patients with metastatic melanoma. N Engl J Med 363, 21. Schmitt, E., et al. IL-9 production of naive CD4+ T cells 711-723 (2010). depends on IL-2, is synergistically enhanced by a com US 9,629,910 B2 41 42 bination of TGF-beta and IL-4, and is inhibited by IFN T regulatory cells by blocking IL-9 production enhancing gamma. J Immunol 153, 3989-3996 (1994). antitumor responses. Cancer Immunol Immunother 60, 22. Angkasekwinai, P., Chang, S. H., Thapa, M. Watarai, H. 1775-1787 (2011). & Dong, C. Regulation of IL-9 expression by IL-25 30. Atkins, M. B., Kunkel, L., Sznol, M. & Rosenberg, S. A. High-dose recombinant interleukin-2 therapy in patients signaling. Nat Immunol 11, 250-256 (2010). with metastatic melanoma: long-term Survival update. 23. Wong, M. T., et al. Regulation of human Th9 differen Cancer J Sci Am 6 Suppl 1, S11-14 (2000). tiation by type I interferons and IL-21. Immunol Cell Biol 31. Dougan, M. & Dranoff, G. Immune therapy for cancer. 88, 624-631 (2010). Annu Rev Immunol 27, 83-117 (2009). 24. Dardalhon, V., et al. IL-4 inhibits TGF-beta-induced 32. Ma, H. L., et al. IL-21 activates both innate and adaptive Foxp3+ T cells and, together with TGF-beta, generates 10 immunity to generate potent antitumor responses that IL-9+ IL-10+ Foxp3(-) effector T cells. Nat Immunol 9, require perforin but are independent of IFN-gamma. J 1347-1355 (2008). Immunol 171, 608-615 (2003). 25. Hung, K., et al. The central role of CD4 (+) T cells in the 33. Steenwinckel, V., et al. IL-13 mediates in vivo IL-9 antitumor immune response. J Exp Med 188, 2357-2368 15 activities on lung epithelial cells but not on hematopoietic (1998). cells. J Immunol 178, 3244-3251 (2007). 26. Knoops, L. & Renauld, J. C. IL-9 and its receptor: from 34. Awasthi, A., et al. Cutting edge: IL-23 receptor gfp signal transduction to tumorigenesis. Growth Factors 22, reporter mice reveal distinct populations of IL-17-produc 207-215 (2004). ing cells. J Immunol 182, 5904-5908 (2009). 27. Oldford, S.A., et al. A critical role for mast cells and 35. Purwar, R., et al. Resident memory T cells (T(RM)) are mast cell-derived IL-6 in TLR2-mediated inhibition of abundant in human lung: diversity, function, and antigen tumor growth. J Immunol 185, 7067-7076 (2010). specificity. PLoS One 6, e16245 (2011). 28. Yang, X. R., et al. Identification of modifier genes for 36. Clark, R. A., et al. A novel method for the isolation of cutaneous malignant melanoma in melanoma-prone fami skin resident T cells from normal and diseased human lies with and without CDKN2A mutations. Int J Cancer 25 skin. J Invest Dermatol 126, 1059-1070 (2006). 125, 2912-2917 (2009). 37. O'Leary, F. M., et al. Injury-induced GR-1 + macrophage 29. Smith, S. E., Hoelzinger, D. B., Dominguez, A. L., Van expansion and activation occurs independently of CD4 Snick, J. & Lustgarten, J. Signals through 4-1BB inhibit T-cell influence. Shock 36, 162-169 (2011).

SEQUENCES Human IL-9 mRNA sequence NCBI Ref Seq; NM 000590 SEO ID NO: 1 cc.gctgtcaa gatgcttctg go catggtco ttacct ctogc cctdct cotg togcticcgtgg 6 Caggcc aggg gtgtcCalacc ttggcgggga to CtggaCat Caact tcct c at Caacaaga 12 tgcaggaaga to cagott CC aagtgccact gcagtgctaa ttgaccagt tdt citctgtt 18 tgggcattcc ct ctgacaac to accagac catgct tcag tagagactg. tct Cagatga 24 ccaataccac catgcaaaca agatacccac tdattitt cag togggtgaaa aaatcagttg 3 O aagtactaaa gaacaacaag tdtc catatt titt.cct gtga acagc.catgc aaccaaacca 36 cggcaggcaa cqcgctgaca tttctgaaga gt Cttctgga aattitt coag aaagaaaaga 42 tgagagggat gagaggcaag atatgaagat gaaatatt at titat cotatt tattaaattit 48 aaaaagctitt ct ctittaagt togctacaatt taaaaatcaa gtaagctact ctaaat cagt 541 at cagttgttg attatttgtt taac attgta totctittatt ttgaaataaa t Human IL-9 amino acid sequence NCBI Ref No: NP_000581 SEO ID NO: 2 milliamvlts a lllcsvaggg cptilagildi inflinkmoed paskchc San vits cliclgip 6 sdnctrpcfs erls qmtntt motryplifs rvkksvevlk innkcpyfs ce qipcngittagn 12 altflkslle ifdkekmrgm rgki Human IL-9Ra mRNA sequence NCBI Ref No: NM 002186 SEO ID NO: 3 agcagctctg. taatgcgctt gtggttt Cag atgtgggcgg cctgttgttgaa cctgtcgtgc 61 aaagct cacg to accaactg. citgcagttat ct cotgaatc aggctgaggg totttgctgt 121 go acccagag at agttgggt gacaaatcac ct coaggttggggatgcctic agacittgttga 181 toggactggg cagatgcatc tdggaaggct ggaccttgga gagtgaggcc ctgaggcgag 241 acatgggcac ctggct Cotg gcctgcatct gcatctgcac Ctgttgtctgc titgggagt ct 301 ctgtcacagg ggaaggacaa gggccalaggt ct agaacctt Cacctgcctic accaacaa.ca 361 ttct caggat cattgccac tdgtctgc cc cagagctggg acagggct Co agc.ccctggc 421 to ct ctitcac cagcaiaccag gCtcCtggcg gCacacatala gtgcatcttg C9gggcagtg 481 agtgcaccgt cqtgctgcca cctdaggcag togct cqtgcc atctgacaat titcaccatca 541 ctitt coacca citgcatgtct gggagggagc aggt cagcct ggtggacccg gagtacctgc 601 ccc.gagaca C9ttaa.gctg gaccc.gcc ct ctgacttgca gagcaa.catc agttctggcc 661 actgcatcct gacctggagc at cagt cctd cottggagcc aatgaccaca cittcticagot 721 atgagctggc Cttcaagaag caggaagagg cctgggagca ggcc.ca.gcac agggat caca 781 ttgtcggggt gacctggctt at acttgaag cctittgagct ggaccctggc tittatc catg 841 aggcCaggct gcgtgtc.cag atggcc acac tdgaggatga tigtggtagag gaggagcgtt 901 at acaggcca gtggagtgag tigagc.ca.gc ctgttgttgctt C Caggctic cc cagaga caag 961 gocctctgat cocaccctgg gggtggc.cag goaacaccct tdttgctgtg to catctitt c 1021 to ctgctgac togc.ccgacc tacctic ctgt to aagctgtc. gccCagggitg aagaga at ct 1081 to taccagaa cqtgcc ct ct coagcgatgt tott coagcc cct ctacagt gtacacaatg 1141 ggaact tcca gacttggatggggg.cccacg gggc.cggtgt gctgttgagc Caggactgtg 1201 ctggcacccc acagggagcc ttggagcc ct gcgt.ccagga ggcc actgca Ctgct cactt 1261 gtggcc cagc gcgt.ccttgg aaatctgtgg cc ctggagga ggaacaggag ggc cctggga

US 9,629,910 B2 55 56 - Continued gggtacagac gcttgccitat Ctgccacagg aggactgggc c cc cacgt.cc Ctgactaggc 44 O cggctic cc cc agacticagag ggcagcagga gcago agcag Cagcagcagc agcaacaa.ca SOO acaact actg tgccttgggc tgctatgggg gatggcacct cticagocctic cCaggaalaca 560 Cacagagctic tgggcc catc Ccagc cctgg Cctgtggcct ttcttgttgac Cat Cagggcc tggaga.ccca gcaaggagtt gcctgggtgc tggctggtca Ctgccagagg Cctgggctgc atgaggacct cCagggcatg ttgct coctt ctgtc.ct cag Caaggct cqg tcc tigga cat 74 O tctagg tocc tgacticgc.ca gatgcatcat gtc. cattttg ggaaaatgga ctgaagttt c tggagc cctt gtctgagact gaacct cotg agaaggggcc Cctagoagcg gtcagaggit c 86 O

Ctgtctggat ggaggctgga ggctic ccc cc toaac Cocto tgcticagtgc Ctgttggggag 92 O cago ct citac cct cagcatc Ctggccacaa gttct tcctt c cattgtc.cc titt tott tatt 98 O c cct gacctic tctgagaagt ggggtgttggt citct cagctg ttctg.ccctic attacCottaa. agggc.ca.gc.c tgggcc cagt ggacacaggt aaggcac cat gaccacctgg tgttgacct ct 21OO ctgtgc citta Ctgaggcacc tittctagaga ttaaaagggg Cttgatggct gttaaaaaaa 216 O aaaaaaaaaa. a. 2171

<210s, SEQ I D NO 4 &211s LENGT H: 521 212. TYPE : PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 4 Met Gly Lieu. Gly Arg Cys Ile Trp Glu Gly Trp Thir Lieu. Glu Ser Glu 1. 5 15

Ala Lieu. Arg Arg Asp Met Gly Thr Trp Luell Luell Ala Cys Ile Cys Ile 25 3O

Cys Thr Cys Val Cys Lieu. Gly Val Ser Wall Thir Gly Glu Gly Gln Gly 35 4 O 45

Pro Arg Ser Arg Thr Phe Thr Cys Luell Thir ASn ASn Ile Lieu. Arg Ile SO 55 6 O

Asp Cys His Trp Ser Ala Pro Glu Luell Gly Glin Gly Ser Ser Pro Trp 65 70

Lieu. Lieu. Phe Thir Ser Asn. Glin Ala Pro Gly Gly Thr His Lys Cys Ile 85 90 95

Lieu. Arg Gly Ser Glu. Cys Thr Val Wall Luell Pro Pro Glu Ala Wall Lieu 105 11 O

Wall Pro Ser Asp Asn Phe Thr Ile Thir Phe His His Cys Met Ser Gly 115 12 O 125

Arg Glu Glin Val Ser Lieu Val Asp Pro Glu Tyr Lieu Pro Arg Arg His 13 O 135 14 O

Val Llys Lieu. Asp Pro Pro Ser Asp Luell Glin Ser ASn Ile Ser Ser Gly 145 150 155 160

His Cys Ile Lieu. Thir Trp Ser Ile Ser Pro Ala Lieu. Glu Pro Met Thr 1.65 17O 17s

Thir Lieu. Lieu. Ser Tyr Glu Lieu Ala Phe Glin Glu Glu Ala Trp 18O 185 19 O

Glu Glin Ala Gln His Arg Asp His Ile Wall Gly Val Thir Trp Lieu. Ile 195 2O5

Lieu. Glu Ala Phe Glu Lieu. Asp Pro Gly Phe Ile His Glu Ala Arg Lieu. 21 O 215 22O

Arg Val Glin Met Ala Thir Lieu. Glu Asp Asp Wall Wall Glu Glu Glu Arg US 9,629,910 B2 57 58 - Continued

225 23 O 235 24 O

Thir Gly Gln Trp Ser Glu Trp Ser Glin Pro Wall Phe Glin Ala 245 250 255

Pro Glin Arg Gln Gly Pro Leu. Ile Pro Pro Trp Gly Trp Pro Gly Asn 26 O 265 27 O

Thir Luell Wall Ala Wal Ser Ile Phe Lieu. Luell Luell Thir Gly Pro Thr Tyr 28O 285

Lell Luell Phe Llys Lieu. Ser Pro Arg Val Lys Arg Ile Phe Glin Asn 29 O 295 3 OO

Wall Pro Ser Pro Ala Met Phe Phe Gln Pro Leu Ser Wall His Asn 3. OS 310 315 32O

Gly Asn Phe Gln Thir Trp Met Gly Ala His Gly Ala Gly Wall Lieu. Luell 3.25 330 335

Ser Glin Asp Cys Ala Gly Thr Pro Glin Gly Ala Lell Glu Pro Cys Val 34 O 345 35. O

Glin Glu Ala Thir Ala Lieu. Lieu. Thr Cys Gly Pro Ala Arg Pro Trp Llys 355 360 365

Ser Wall Ala Lieu. Glu Glu Glu Glin Glu Gly Pro Gly Thir Arg Leul Pro 37 O 375

Gly Asn Luell Ser Ser Glu Asp Wall Lieu Pro Ala Gly Thir Glu Trp 385 390 395 4 OO

Arg Wall Glin Thir Lieu Ala Tyr Lieu Pro Glin Glu Asp Trp Ala Pro Thir 4 OS 41O 415

Ser Luell Thir Arg Pro Ala Pro Pro Asp Ser Glu Gly Ser Arg Ser Ser 425 43 O.

Ser Ser Ser Ser Ser Ser Asn. Asn Asn Asn Tyr Ala Luell Gly Cys 435 44 O 445

Gly Gly Trp His Lieu. Ser Ala Leu Pro Gly Asn Thir Glin Ser Ser 450 45.5 460

Gly Pro Ile Pro Ala Lieu Ala Cys Gly Lieu. Ser Asp His Gln Gly 465 470 47s 48O

Lell Glu Thir Glin Glin Gly Val Ala Trp Val Lieu. Ala Gly His Cys Glin 485 490 495

Arg Pro Gly Lieu. His Glu Asp Lieu Gln Gly Met Lell Lell Pro Ser Wall SOO 505 51O

Lell Ser Lys Ala Arg Ser Trp Thr Phe 515

<210s, SEQ ID NO 5 &211s LENGTH: 1560 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 5 agaggaaacg tgttgggtggg gagggg tagt gggtgaggga cc.caggttcc tgacacagac 6 O agactacacc Cagggaatga agagcaa.gcg c catgttgaa gcc at catta CCatt Cacat 12 O coct cit tatt Cctgcagctg CCC ctgctgg gagtggggct galacacgaca attctgacgc 18O c caatgggaa tgaaga cacc acagotgatt tct tcctgac cactatocc c actgact coc 24 O t cagtgtttic cactctg.ccc Ctcc.cagagg ttcagtgttt tgttgttcaat gtcgagtaca 3OO tgaattgcac ttggaacagc agctctgagc cc.cagcc tac Calacct cact ctgcattatt 360 ggtacaagaa citcggataat gataaagt cc agalagtgcag CCaCt at Cta ttct citgaag aaat Cact to tggctgtcag ttgcaaaaaa aggagat.cca CCtectaccala acatttgttg 48O US 9,629,910 B2 59 60 - Continued ttcagotcca ggacccacgg galacc Cagga gacaggccac acagatgcta aaactgcaga 54 O atctggtgat CCC ctgggct ccagagaacc talacact tca caaactgagt gaatcc.cagc tagaactgaa Ctggaacaac agatt cittga accactgttt ggagc acttg gtgcagtacc 660 ggactgactg ggaccacagc tggactgaac aat cagtgga ttataga cat aagttct cot 72 O tgcc tagtgt ggatgggcag aaacgctaca tcggagcc.gc tttalaccCaC tctgtggaag tgcticagoat tggagtgaat ggagccaccc aatccactgg gggagcaata 84 O cittcaaaaga gaatcc titt c ctgtttgcat ggittatctot gttggct coa 9 OO tgggattgat tat cagccitt citctgtgtgt atttctggct ggaacggacg atgcc.ccgaa 96.O titcc cacic ct gaagaaccta gaggat.cttg ttactgaata ccacgggaac ttitt.cggcct ggagtggtgt gtctaaggga Ctggctgaga gtctgcagcc agact acagt gaacgactict gcct cqtcag tgagattic cc cCaaaaggag gggCCCttgg ggaggggcct gggggct coc 14 O catgcaacca gcatagcc cc tactgggc cc c cc catgtta caccctaaag cctgaaacct 2OO gaac cc caat cct ctogacag aagaaccoca gggtc.ctgta gcc ctaagtg gtactaactt 26 O t cott cattic aac ccacctg cgt.ct catac to acct cacc C Cactgtggc tgatttggaa 32O ttttgttgc cc c catgtaagc accoctet Cat ttggcattcc c cacttgaga attac cottt tgcc.ccgaac atgtttittct t ct coct cag tctggcc citt ccttitt cqca ggattct tcc 44 O t coc tocc to titt coctic cc ttoctott to Catct accot ccgattgttc ctgaaccoat SOO gaga aataaa gtttctgttg ataat Cat Ca aaaaaaaaaa. aaaaaaaaaa. aaaaaaaaaa. 560

<210s, SEQ I D NO 6 &211s LENGT H: 369 212. TYPE : PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 6

Met Lieu Lys Pro Ser Leu Pro Phe Thir Ser Luell Lieu. Phe Lieu. Gln Lieu. 1. 5 15

Pro Luell Luell Gly Val Gly Lieu. Asn Thir Thir Ile Lieu. Thir Pro Asin Gly 25 3O

Asn Glu Asp Thir Thr Ala Asp Phe Phe Luell Thir Thir Met Pro Thir Asp 35 4 O 45

Ser Lieu. Ser Wall Ser Thir Lieu. Pro Luell Pro Glu Val Glin Cys Phe Wall SO 55 6 O

Phe Asn. Wall Glu Tyr Met Asn Cys Thir Trp Ser Ser Ser Glu Pro 65 70 8O

Gin Pro Thir Asn Lieu. Thir Lieu. His Trp Lys Asn. Ser Asp Asn 85 90 95

Asp Llys Val Gln Lys Cys Ser His Tyr Luell Phe Ser Glu Glu Ile Thr 105 11 O

Ser Gly Cys Glin Lieu Gln Llys Llys Glu Ile His Lieu. Tyr Glin Thir Phe 115 12 O 125

Wall Wall Glin Lieu. Glin Asp Pro Arg Glu Pro Arg Arg Glin Ala Thr Gin 13 O 135 14 O

Met Lieu Lys Lieu. Glin Asn Lieu Wall Ile Pro Trp Ala Pro Glu Asn Luell 145 150 155 160

Thir Lieu. His Llys Lieu. Ser Glu Ser Glin Luell Glu Lieu. Asn Trp Asn. Asn 1.65 17O 17s

Arg Phe Lieu. Asn His Cys Lieu. Glu His Luell Wall Glin Tyr Arg Thir Asp US 9,629,910 B2 61 62 - Continued

18O 185 19 O

Trp Asp His Ser Trp Thr Glu Glin Ser Wall Asp Tyr Arg His Llys Phe 195 2O5

Ser Lieu. Pro Ser Val Asp Gly Glin Arg Thr Phe Arg Val Arg 21 O 215 22O

Ser Arg Phe Asn Pro Lieu. Cys Gly Ser Ala Glin His Trp Ser Glu Trp 225 23 O 235 24 O

Ser His Pro Ile His Trp Gly Ser Asn Thir Ser Lys Glu Asn Pro Phe 245 250 255

Lieu. Phe Ala Lieu. Glu Ala Wal Wall Ile Ser Wall Gly Ser Met Gly Lieu. 26 O 265 27 O

Ile Ile Ser Lieu. Lieu. Cys Val Tyr Phe Trp Luell Glu Arg Thr Met Pro 27s 285

Arg Ile Pro Thir Lieu Lys Asn Lieu Glu Asp Luell Wall. Thir Glu Tyr His 29 O 295 3 OO

Gly Asin Phe Ser Ala Trp Ser Gly Wall Ser Lys Gly Lieu Ala Glu Ser 3. OS 310 315 32O

Leul Glin Pro Asp Tyr Ser Glu Arg Luell Cys Luell Wall Ser Glu Ile Pro 3.25 330 335

Pro Lys Gly Gly Ala Lieu. Gly Glu Gly Pro Gly Ala Ser Pro Cys Asn 34 O 345 35. O

Gln His Ser Pro Tyr Trp Ala Pro Pro Thir Lieu Lys Pro Glu 355 360 365

Thir

<210s, SEQ I D NO 7 &211s LENGT H: 1209 212. TYPE : DNA <213> ORGANISM: Homo sapiens

<4 OO > SEQUENCE: 7 aggagcgttt ttggagaaag ctgcactctg ttgagct coa ggg.cgcagtg gagggaggga 6 O gtgaaggagc t citctgtacc Caaggaaagt gcagotgaga Ctcagacaag attacaatga 12 O acca acticag citt cotgctg titt ct catag cgaccaccag aggatggagt acagatgagg 18O

Ctaatact ta. Cttcaaggaa tggacctgtt citt cqtctoc atctotgcc c agaagctgca 24 O aggaaatcaa agacgaatgt cct agtgcat ttgatggcct gtattittctic cgcactgaga 3OO atggtgtt at ctaccagacc ttctgtgaca tgacctctgg gggtggcggc tggaccctgg 360 gcacgagaat gacatgcgtg ggaagtgcac ggtgggcgat cgctggit coa gtCagc aggg Cagcaaag.ca gtc.tacccag agggggacgg Caactgggcc alactacaa.ca c ctittggatc tgcagagg.cg gcc acgagcg atgactacaa galacc Ctggc tactacgaca 54 O tccaggccaa ggacct gC atctggcacg tgcc.caataa gtc.ccc.catg Cagcactgga gaaa.ca.gctic Cctgctgagg taccgcacgg acactggctt cct coaga.ca Ctgggacata 660 atctgtttgg catctaccag aaatat coag tgaaatatgg agaaggaaag tgttggactg 72 O acaacggc cc ggtgat Coct gtggit ctatg attittggcga cgc.ccagaaa acagoat citt attact Cacc Ctatggc.cag cgggaattica Ctgcgggatt tgttcagttc agggit attta 84 O atalacgagag agcagccaac gcc ttgttgttg Ctggaatgag ggt caccgga tgtaacactg 9 OO agcaccactg cattggtgga ggaggatact titccagaggc cagtic cc cag Cagtgttggag 96.O atttittctgg ttittgattgg agtggatatg gaact catgt tggittacagc agcagcc.gtg US 9,629,910 B2 63 - Continued agataactgaggcagctgtg Cttct attct atcgttgaga gttttgttggg agggalaccca 108 O gacct citcct cocaac catg agat.cccaag gatggagaac aacttaccca gtagctagaa 114 O tgttaatggc agaagagaaa acaataaatc at attgactic aaaaaaaaaa aaaaaaaaaa 12 OO aaaaaaaaa. 1209

<210s, SEQ ID NO 8 &211s LENGTH: 313 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 8 Met Asin Gln Leu Ser Phe Lieu. Leu Phe Lieu. Ile Ala Thr Thr Arg Gly 1. 5 1O 15 Trp Ser Thr Asp Glu Ala Asn Thr Tyr Phe Lys Glu Trp Thr Cys Ser 2O 25 3O Ser Ser Pro Ser Lieu Pro Arg Ser Cys Lys Glu Ile Lys Asp Glu. Cys 35 4 O 45 Pro Ser Ala Phe Asp Gly Lieu. Tyr Phe Lieu. Arg Thr Glu Asn Gly Val SO 55 6 O Ile Tyr Glin Thr Phe Cys Asp Met Thr Ser Gly Gly Gly Gly Trp Thr 65 70 7s 8O Lieu Val Ala Ser Val His Glu Asn Asp Met Arg Gly Lys Cys Thr Val 85 90 95 Gly Asp Arg Trip Ser Ser Glin Glin Gly Ser Lys Ala Val Tyr Pro Glu 1OO 105 11 O Gly Asp Gly Asn Trp Ala Asn Tyr Asn. Thir Phe Gly Ser Ala Glu Ala 115 12 O 125 Ala Thir Ser Asp Asp Tyr Lys Asn Pro Gly Tyr Tyr Asp Ile Glin Ala 13 O 135 14 O Lys Asp Leu Gly Ile Trp His Val Pro Asn Llys Ser Pro Met Gln His 145 150 155 160 Trp Arg Asn. Ser Ser Lieu. Lieu. Arg Tyr Arg Thr Asp Thr Gly Phe Lieu. 1.65 17O 17s Gln Thr Lieu. Gly His Asn Lieu Phe Gly Ile Tyr Gln Lys Tyr Pro Val 18O 185 19 O Lys Tyr Gly Glu Gly Lys Cys Trp Thr Asp Asn Gly Pro Val Ile Pro 195 2OO 2O5 Val Val Tyr Asp Phe Gly Asp Ala Gln Lys Thr Ala Ser Tyr Tyr Ser 21 O 215 22O Pro Tyr Gly Glin Arg Glu Phe Thr Ala Gly Phe Val Glin Phe Arg Val 225 23 O 235 24 O Phe Asn. Asn. Glu Arg Ala Ala Asn Ala Lieu. Cys Ala Gly Met Arg Val 245 250 255 Thr Gly Cys Asn Thr Glu. His His Cys Ile Gly Gly Gly Gly Tyr Phe 26 O 265 27 O

Pro Glu Ala Ser Pro Glin Gln Cys Gly Asp Phe Ser Gly Phe Asp Trp 27s 28O 285 Ser Gly Tyr Gly Thr His Val Gly Tyr Ser Ser Ser Arg Glu Ile Thr 29 O 295 3 OO

Glu Ala Ala Val Lieu Lleu Phe Tyr Arg 3. OS 310

<210s, SEQ ID NO 9 &211s LENGTH: 4043

US 9,629,910 B2 67 68 - Continued ttgaaagtgc atgtcaatca citctic cca.gc ataag caccc cagcc cactic tatt coaggg 228O agt catgcta totatgtacc aggttacaca gcaaacggta at attcagat gaatgct coa 234 O aggaaatcag taggcagaaa taggaggag caaagtggg gctittagc.cg agt cagctica 24 OO ggaggctic ct titt cagtgct gggagttcca gctggcc.ccc accct gatgt gtttccacca 246 O tgcaaaatta ttgacctgga agctgtaaaa gtagaagagg aattgaccct at Cttggaca 252O gCacctggag aagactittga t cagggc.cag gct acaa.gct atgaaataag aatgagtaaa 2580 agtic tacaga at atccaaga tigactittaac aatgctattt tagtaaatac atcaaag.cga 264 O aatcct cago aagctggcat cagggagata tttacgttct caccc caaat titccacgaat 27 OO ggacctgaac atcago Caaa tigagaaa.ca catgaaagcc acagaattta tittgcaata 276 O cgagcaatgg at aggaactic Cttacagt ct gctgt at cta acattgcc.ca ggcgc.ct Ctg 282O tittatt cocc cca attctga t cctd tacct gccagagatt at cittatatt gaaaggagtt 288O ttaa.ca.gcaa tdggtttgat aggaat catt togcct tatta tagttgttgac acat catact 294 O ttaa.gcagga aaaagaga.gc agacaagaaa gagaatggaa caaaattatt ataaataaat 3 OOO atccaaagtg tott cottct tagatataag acccatggcc titcgactaca aaaacatact 3 O 6 O aacaaagt ca aattaa catc aaaactgt at taaaatgcat tdagtttittg tacaatacag 312 O ataagattitt tacatggtag atcaacaa at t citttittggg ggtagattag aaaac cctta 318O cactittggct atgaacaaat aataaaaatt attctittaaa gtaatgtc.tt taaaggcaaa 324 O gggaagggta aagttcggacc agtgtcaagg aaagtttgtt ttattgaggt ggaaaaatag 33 OO CCC Caagcag agaaaaggag got aggtctg. Cattata act gtctgttgttga agcaatcatt 3360 tagttactitt gattaattitt totttitct cottatctgtgc agaac aggtt gcttgtttac 342O aactgaagat catgctatat tittatatatgaagcc cctaa togcaaagctic tittacct citt 3480 gctattttgt tatatatatt acagatgaaa tot cactgct aatgct caga gat cittittitt 354 O cactgtaaga got aacctitt aacaatatgg g tattacctt tdt citct tca taccggttitt 36OO atgacaaagg totattgaat ttatttgttt gtaagtttct act cocatca aag cagottt 366 O ctaagttatt gcc ttggitta t tatggatga tagttatago ccttataatg cct talactaa 372 O ggaagaaaag atgttatt cit gagtttgttt taatacatat atgaacatat agttt tatt c 378 O aattaalacca aagaagaggt cagcagggag atact aacct ttggaaatga ttagctggct 384 O ctgttttittg gttaaataag agt ctittaat cottt ct coat caagagitta cittaccalagg 3900 gCaggggaag ggggatatag agg to acaag gaaataaaaa t catctitt.ca t ctittaattit 396 O tact cott co tottatttitt ttaaaagatt atcgaacaat aaaat cattt gcc tttittaa 4 O2O ttaaaaaaaa aaaaaaaaaa aaa. 4 O43

<210s, SEQ ID NO 10 &211s LENGTH: 943 212. TYPE: PRT <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 10 Met Thr Glin Arg Ser Ile Ala Gly Pro Ile Cys Asn Lieu Lys Phe Val 1. 5 15

Thir Lieu. Lieu Wall Ala Lieu. Ser Ser Glu Lieu Pro Phe Lieu. Gly Ala Gly 25

Val Glin Lieu. Glin Asp Asn Gly Tyr Asn Gly Lieu. Lieu. Ile Ala Ile Asn 35 4 O 45 US 9,629,910 B2 69 70 - Continued

Pro Glin Wall Pro Glu Asn Glin Asn Luell Ile Ser Asn Ile Lys Glu Met SO 55 6 O

Ile Thir Glu Ala Ser Phe Luell Phe Asn Ala Thir Lys Arg Arg Wall 65 70

Phe Phe Arg Asn Ile Ile Luell Ile Pro Ala Thir Trp Ala Asn 85 90 95

Asn Asn Ser Lys Ile Glin Glu Ser Glu Ala Asn Wall Ile 105 11 O

Wall Thir Asp Trp Ala His Gly Asp Pro Tyr Thir Luell Glin 115 12 O 125

Arg Gly Gly Glu Gly Ile His Phe Thir Pro Asn 13 O 135 14 O

Phe Luell Luell Asn Asp Asn Lell Thir Ala Gly Tyr Gly Ser Arg Gly Arg 145 150 155 160

Wall Phe Wall His Glu Trp Ala His Luell Arg Trp Gly Wall Phe Asp Glu 1.65 17s

Asn Asn Asp Pro Phe Ile Asn Gly Glin Asn Glin Ile 18O 185 19 O

Wall Thir Arg Ser Ser Asp Ile Thir Gly Ile Phe Wall Glu 195

Gly Pro Pro Glin Glu Asn Ile Ile Ser Lys Lell Phe Glu 21 O 215 22O

Gly Cys Thir Phe Ile Tyr Asn Ser Thir Glin ASn Ala Thir Ala Ser Ile 225 23 O 235 24 O

Met Phe Met Gln Ser Lieu Ser Ser Wall Wall Glu Phe Asn Ala Ser 245 250 255

Thir His Asn Glin Glu Ala Pro Asn Luell Glin ASn Glin Met Cys Ser Luell 26 O 265 27 O

Arg Ser Ala Trp Asp Wall Ile Thir Asp Ser Ala Asp Phe His His Ser 285

Phe Pro Met Asn Gly Thir Glu Luell Pro Pro Pro Pro Thir Phe Ser Luell 29 O 295 3 OO

Wall Glin Ala Gly Asp Lys Wall Wall Luell Wall Lell Asp Wall Ser Ser 3. OS 310 315

Met Ala Glu Ala Asp Arg Luell Luell Glin Luell Glin Glin Ala Ala Glu 3.25 330 335

Phe Luell Met Glin Ile Wall Glu Ile His Thir Phe Wall Gly Ile Ala 34 O 345 35. O

Ser Phe Asp Ser Gly Glu Ile Arg Ala Glin Lell His Glin Ile Asn 355 360 365

Ser Asn Asp Asp Arg Lell Luell Wall Ser Lell Pro Thir Thir Wall 37 O 375

Ser Ala Thir Asp Ile Ser Ile Ser Gly Lell Gly Phe 385 390 395 4 OO

Glu Wall Wall Glu Lys Lell Asn Gly Ala Gly Ser Wall Met Ile 4 OS 415

Lell Wall Thir Ser Gly Asp Asp Luell Luell Gly Asn Luell Pro Thir 42O 425 43 O

Wall Luell Ser Ser Gly Ser Thir Ile His Ser Ile Ala Lell Gly Ser Ser 435 44 O 445

Ala Ala Pro Asn Lell Glu Glu Luell Ser Arg Luell Thir Gly Gly Luell 450 45.5 460

Phe Phe Wall Pro Asp Ile Ser Asn Ser Asn Ser Met Ile Asp Ala Phe US 9,629,910 B2 71 72 - Continued

465 470

Ser Arg Ile Ser Ser Gly Thir Gly Asp Ile Phe Glin Glin His Ile Glin 485 490 495

Lell Glu Ser Thir Gly Glu Asn Wall Lys Pro His His Glin Luell Asn SOO 505

Thir Wall Thir Wall Asp Asn Thir Wall Gly Asn Asp Thir Met Phe Luell Wall 515 525

Thir Trp Glin Ala Ser Gly Pro Pro Glu Ile Ile Lell Phe Asp Pro Asp 53 O 535 54 O

Gly Arg Thir Asn Asn Phe Ile Thir Asn Lell Thir Phe Arg 5.45 550 555 560

Thir Ala Ser Luell Trp Ile Pro Gly Thir Ala Pro Gly His Trp Thir 565 st O sts

Thir Luell Asn Asn Thir His His Ser Luell Glin Ala Lell Lys Wall Thir 585 59 O

Wall Thir Ser Arg Ala Ser Asn Ser Ala Wall Pro Pro Ala Thir Wall Glu 595 605

Ala Phe Wall Glu Arg Asp Ser Luell His Phe Pro His Pro Wall Met Ile 610 615

Tyr Ala Asn Wall Glin Gly Phe Pro Ile Lell Asn Ala Thir Wall 625 630 635 64 O

Thir Ala Thir Wall Glu Pro Glu Thir Gly Asp Pro Wall Thir Luell Arg Luell 645 650 655

Lell Asp Asp Gly Ala Gly Ala Asp Wall Ile Asn Asp Gly Ile 660 665 67 O

Ser Arg Tyr Phe Phe Ser Phe Ala Ala Asn Gly Arg Tyr Ser Luell 675 685

Wall His Wall Asn His Ser Pro Ser Ile Ser Thir Pro Ala His Ser Ile 69 O. 695 7 OO

Pro Gly Ser His Ala Met Wall Pro Gly Tyr Thir Ala Asn Gly Asn 7 Os 72O

Ile Glin Met Asn Ala Pro Arg Ser Wall Gly Arg Asn Glu Glu Glu 72 73 O 73

Arg Trp Gly Phe Ser Arg Wall Ser Ser Gly Gly Ser Phe Ser Wall 740 74. 7 O

Lell Gly Wall Pro Ala Gly Pro His Pro Asp Wall Phe Pro Pro 760 765

Ile Ile Asp Luell Glu Ala Wall Wall Glu Glu Glu Lell Thir Luell Ser 770 775

Trp Thir Ala Pro Gly Glu Asp Phe Asp Glin Gly Glin Ala Thir Ser Tyr 79 O 79.

Glu Ile Arg Met Ser Ser Luell Glin Asn Ile Glin Asp Asp Phe Asn 805 810 815

Asn Ala Ile Luell Wall Asn Thir Ser Lys Arg ASn Pro Glin Glin Ala Gly 825 83 O

Ile Arg Glu Ile Phe Thir Phe Ser Pro Glin Ile Ser Thir Asn Gly Pro 835 84 O 845

Glu His Glin Pro Asn Gly Glu Thir His Glu Ser His Arg Ile Wall 850 855 860

Ala Ile Arg Ala Met Asp Arg Asn Ser Luell Glin Ser Ala Wall Ser Asn 865 88O

Ile Ala Glin Ala Pro Lell Phe Ile Pro Pro ASn Ser Asp Pro Wall Pro 885 890 895

US 9,629,910 B2 75 76 - Continued ttgacctgtc t cattt coca tatt cott ca. cacccagctt Ctggaaggca tggggtggct 1920 gggatttalag gacttctggg ggaccalagac atcct caaga aaac aggggc atcCagggct 198O CCCtggatga atagaatgca att cattcag aagct Cagaa gctaagaata agc ctittgaa attacct Catt gcattt coct ttgggctt.cg gCttggggag atggat Caag citcagagact 21OO ggcagtgaga gcc cagaagg acctgtataa aatgaatctg gagctttaca tttitctgcct 216 O citgcct tcct cc.cagotcag Caaggaagta tittgggcacc cit accott ta. Cctgggg.tct 222 O alaccaaaaat ggatgggatg aggatgaga.g gctggagata attgtttitat gggatttggg 228O tgtgggacta ggg tacaatg aaggccaaga gcatctoraga catagagitta aaact caaac 234 O citct tatgtg cactittaaag atagactitta ggggctggca caaatctgat cagagacaca 24 OO tatic Cataca Caggtgaaac acatacagac t caacagcaa t catgcagtt ccagaga cac 246 O atgaac Ctga Cacaat Ct. Ct. cittatccttg aggccacagc ttggaggagc Ctagaggcct 252O

Caggggaaag toccaatcCt gagggacc ct CCCaalacatt tccatggtgc tccagtic cac 2580 tgat Cttggg tctggggtga to Caaatacc accc.cagctic cagctgtc.tt ctaccactag 264 O alagacic caag agalagcagaa gtc.gctcgca Ctggit cagtic ggaaggcaa.g atcagat cot 27 OO ggaggactitt Cctggcctgc cc.gc.cago'cc tgct cittgtt gtggagalagg alagcagatgt 276 O gat cacat ca cc.ccgt catt gggcaccgct gactic cagca tggaggacac Cagggagcag 282O ggCCtgggCC tgtttccc.ca gctgttgat ct tgcc.ca.gaac citct cittggc ttcatalaa.ca 288O gctgttgalacc ctic ccctgag ggattalacag Caatgatggg Cagtcgtgga gttggggggg 294 O ttgggggtgg gattgttgtc.c tctaagggga cgggttcatc tgagtaalaca taalaccCCaa 3 OOO cittgtgcc at totttataaa. atgattittaa aggcaaaaaa aaaaaaaaaa. aaaa. 3 OS 4

<210s, SEQ I D NO 12 &211s LENGT H: 497 212. TYPE : PRT &213s ORGAN ISM: Homo sapiens

<4 OOs, SEQUENCE: 12

Met Arg Thr Glin Ile Glu Wall Ile Pro Cys Ile Cys Gly Asp Llys 1. 5 15

Ser Ser Gly Ile His Tyr Gly Val Ile Thir Glu Gly Cys 25 3O

Phe Phe Arg Arg Ser Glin Arg Cys Asn Ala Ala Tyr Ser Cys Thr Arg 35 4 O 45

Glin Glin Asn Cys Pro Ile Asp Arg Thir Ser Arg Asn Arg Cys Gln His SO 55 6 O

Cys Arg Lieu. Gln Lys Cys Lieu Ala Luell Gly Met Ser Arg Asp Ala Wall 65 70 7s

Llys Phe Gly Arg Met Ser Llys Llys Glin Arg Asp Ser Lieu. His Ala Glu 85 90 95

Val Glin Lys Glin Lieu. Glin Glin Arg Glin Glin Glin Glin Glin Glu Pro Wall 105 11 O

Val Lys Thr Pro Pro Ala Gly Ala Glin Gly Ala Asp Thir Lieu Thr Tyr 115 12 O 125

Thr Lieu. Gly Lieu Pro Asp Gly Glin Luell Pro Luell Gly Ser Ser Pro Asp 13 O 135 14 O

Lieu Pro Glu Ala Ser Ala Cys Pro Pro Gly Luell Lieu Lys Ala Ser Gly 145 150 155 160 US 9,629,910 B2 77 - Continued Ser Gly Pro Ser Tyr Ser Asn. Asn Lieu Ala Lys Ala Gly Lieu. Asn Gly 1.65 17O 17s Ala Ser Cys His Lieu. Glu Tyr Ser Pro Glu Arg Gly Lys Ala Glu Gly 18O 185 19 O Arg Glu Ser Phe Tyr Ser Thr Gly Ser Glin Lieu. Thr Pro Asp Arg Cys 195 2OO 2O5 Gly Lieu. Arg Phe Glu Glu. His Arg His Pro Gly Lieu. Gly Glu Lieu. Gly 21 O 215 22O Gln Gly Pro Asp Ser Tyr Gly Ser Pro Ser Phe Arg Ser Thr Pro Glu 225 23 O 235 24 O Ala Pro Tyr Ala Ser Lieu. Thr Glu Ile Glu. His Leu Val Glin Ser Val 245 250 255 Cys Llys Ser Tyr Arg Glu Thir Cys Glin Lieu. Arg Lieu. Glu Asp Lieu. Lieu. 26 O 265 27 O Arg Glin Arg Ser Asn. Ile Phe Ser Arg Glu Glu Val Thr Gly Tyr Glin 27s 28O 285 Arg Llys Ser Met Trp Glu Met Trp Glu Arg Cys Ala His His Lieu. Thr 29 O 295 3 OO Glu Ala Ile Glin Tyr Val Val Glu Phe Ala Lys Arg Lieu. Ser Gly Phe 3. OS 310 315 32O Met Glu Lieu. Cys Glin Asn Asp Glin Ile Val Lieu Lleu Lys Ala Gly Ala 3.25 330 335 Met Glu Val Val Lieu Val Arg Met Cys Arg Ala Tyr Asn Ala Asp Asn 34 O 345 35. O Arg Thr Val Phe Phe Glu Gly Llys Tyr Gly Gly Met Glu Lieu Phe Arg 355 360 365 Ala Leu Gly Cys Ser Glu Lieu. Ile Ser Ser Ile Phe Asp Phe Ser His 37 O 375 38O Ser Lieu. Ser Ala Lieu. His Phe Ser Glu Asp Glu Ile Ala Lieu. Tyr Thr 385 390 395 4 OO Ala Lieu Val Lieu. Ile Asn Ala His Arg Pro Gly Lieu. Glin Glu Lys Arg 4 OS 41O 415 Llys Val Glu Gln Lieu. Glin Tyr Asn Lieu. Glu Lieu Ala Phe His His His 42O 425 43 O Lieu. Cys Llys Thir His Arg Glin Ser Ile Lieu Ala Lys Lieu Pro Pro Llys 435 44 O 445 Gly Lys Lieu. Arg Ser Lieu. Cys Ser Gln His Val Glu Arg Lieu. Glin Ile 450 45.5 460

Phe Glin His Lieu. His Pro Ile Wal Wall Glin Ala Ala Phe Pro Pro Leu. 465 470 47s 48O Tyr Lys Glu Lieu Phe Ser Thr Glu Thr Glu Ser Pro Val Gly Leu Ser 485 490 495 Lys

<210s, SEQ ID NO 13 &211s LENGTH: 3O84 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 13 gccaggtgct cocqcct tcc accct cogcc ctic ct coctic ccctggg.ccc togctic cctdc 6 O

Cctic ctgggc agcCagggca gcc aggacgg cacca aggga gctgc cc cat gga cagggcc 12 O ccacagagac agcaccgagc ct cacgggag Ctgctggctg caaagaaga C C Cacacctica 18O

US 9,629,910 B2 81 82 - Continued

CCCalaa Catt tccatggtgc tccagtccac tgatcttggg tctggggtga to Caaatac C 264 O accc.ca.gctic cagctgtc.tt ctaccactag aag acccaag agalagcagaa gtc.gctcgca 27 OO

Ctggtcagtic ggaaggcaa.g atcagatcct ggaggactitt Cctggcctgc cc.gc.cagcc c 276 O tgct cittgtt gtggagalagg alagcagatgt gat cacatca cc.ccgt.catt gggcaccgct 282O gact coagca tggaggacac Cagggagcag ggCCtgggCC tgttt cocca gctgttgatct 288O tgcc.ca.gaac citct cittggc ttcatalaa.ca gctgttgalacc ctic ccct gag ggattaa.ca.g 294 O

Caatgatggg Cagtcgtgga gttggggggg ttgggggtgg gattgttgtcC tctaagggga 3 OOO cgggttcatc tgagtaaa.ca taalaccCCaa cittgttgc cat totttataaa. atgattittaa 3 O 6 O aggcaaaaaa aaaaaaaaaa. aaaa. 3O84

<210s, SEQ I D NO 14 &211s LENGT H: 518 212. TYPE : PRT &213s ORGAN ISM: Homo sapiens

<4 OOs, SEQUENCE: 14

Met Asp Arg Ala Pro Glin Arg Glin His Arg Ala Ser Arg Glu Lieu. Luell 1. 5 15

Ala Ala Lys Lys Thr His Thr Ser Glin Ile Glu Wall Ile Pro 25 3O

Ile Cys Gly Asp Llys Ser Ser Gly Ile His Gly Val Ile Thr Cys 35 4 O 45

Glu Gly Cys Lys Gly Phe Phe Arg Arg Ser Gln Arg Cys Asn Ala Ala SO 55 6 O

Tyr Ser Cys Thir Arg Glin Glin Asn Pro Ile Asp Arg Thr Ser Arg 65 70 7s 8O

Asn Arg Cys Gln His Cys Arg Lieu. Glin Lys Lieu Ala Lieu. Gly Met 85 90 95

Ser Arg Asp Ala Val Llys Phe Gly Arg Met Ser Llys Lys Glin Arg Asp 105 11 O

Ser Lieu. His Ala Glu Val Glin Lys Glin Luell Glin Glin Arg Glin Glin Glin 115 12 O 125

Glin Glin Glu Pro Val Val Lys Thr Pro Pro Ala Gly Ala Glin Gly Ala 13 O 135 14 O

Asp Thir Lieu. Thr Tyr Thr Lieu. Gly Luell Pro Asp Gly Glin Lieu. Pro Leu 145 150 155 160

Gly Ser Ser Pro Asp Lieu Pro Glu Ala Ser Ala Cys Pro Pro Gly Lieu. 1.65 17O 17s

Lieu Lys Ala Ser Gly Ser Gly Pro Ser Ser Asn. Asn. Luell Ala Lys 18O 185 19 O

Ala Gly Lieu. Asin Gly Ala Ser Cys His Luell Glu Tyr Ser Pro Glu Arg 195 2O5

Gly Lys Ala Glu Gly Arg Glu Ser Phe Ser Thr Gly Ser Gln Lieu. 21 O 215 22O

Thr Pro Asp Arg Cys Gly Lieu. Arg Phe Glu Glu His Arg His Pro Gly 225 23 O 235 24 O

Lieu. Gly Glu Leu Gly Glin Gly Pro Asp Ser Gly Ser Pro Ser Phe 245 250 255

Arg Ser Thr Pro Glu Ala Pro Tyr Ala Ser Luell Thir Glu Ile Glu. His 26 O 265 27 O

Lieu Wall Glin Ser Val Cys Lys Ser Arg Glu Thr Cys Glin Lieu. Arg US 9,629,910 B2 83 - Continued

27s 28O 285

Lieu. Glu Asp Lieu. Lieu. Arg Glin Arg Ser Asn. Ile Phe Ser Arg Glu Glu 29 O 295 3 OO

Val Thr Gly Tyr Glin Arg Lys Ser Met Trp Glu Met Trp Glu Arg Cys 3. OS 310 315

Ala His His Lieu. Thir Glu Ala Ile Glin Tyr Val Val Glu Phe Ala 3.25 330 335

Arg Lieu. Ser Gly Phe Met Glu Lieu. Cys Glin Asn Asp Glin Ile Wall Luell 34 O 345 35. O

Lieu Lys Ala Gly Ala Met Glu Val Val Lieu Val Arg Met Arg Ala 355 360 365 Tyr Asn Ala Asp Asn Arg Thr Val Phe Phe Glu Gly Lys Gly Gly 37 O 375 38O

Met Glu Lieu. Phe Arg Ala Lieu. Gly Cys Ser Glu Lieu. Ile Ser Ser Ile 385 390 395 4 OO

Phe Asp Phe Ser His Ser Lieu. Ser Ala Lieu. His Phe Ser Glu Asp Glu 4 OS 41O 415

Ile Ala Lieu. Tyr Thr Ala Lieu Wall Lieu. Ile Asn Ala His Arg Pro Gly 42O 425 43 O

Lieu. Glin Glu Lys Arg Llys Val Glu Gln Leu Gln Tyr Asn Luell Glu Luell 435 44 O 445

Ala Phe His His His Lieu. Cys Llys Thr His Arg Glin Ser Ile Luell Ala 450 45.5 460

Llys Lieu Pro Pro Llys Gly Llys Lieu. Arg Ser Lieu. Cys Ser Glin His Wall 465 470 475

Glu Arg Lieu. Glin Ile Phe Gln His Lieu. His Pro Ile Wall Wall Glin Ala 485 490 495

Ala Phe Pro Pro Leu Tyr Lys Glu Lieu Phe Ser Thr Glu Thir Glu Ser SOO 505 51O Pro Val Gly Lieu. Ser Lys 515

<210s, SEQ ID NO 15 &211s LENGTH: 2O 212. TYPE: PRT <213s ORGANISM: Unknown 22 Os. FEATURE: 223 OTHER INFORMATION: Description of Unknown: KP-2O peptide

<4 OOs, SEQUENCE: 15 Phe Ser Arg Val Llys Llys Ser Val Glu Val Lieu Lys Asn. Asn Lys Ala 1. 5 15 Pro Tyr Phe Ser 2O

<210s, SEQ ID NO 16 &211s LENGTH: 27 212. TYPE: PRT <213s ORGANISM: Unknown 22 Os. FEATURE: 223 OTHER INFORMATION: Description of Unknown: KP-89 peptide

<4 OOs, SEQUENCE: 16 Ser Arg Arg Ala Ser Val Gly Phe Ser Arg Val Llys Llys Ser Val Glu 1. 5 15

Val Lieu Lys Asn. Asn Llys Ala Pro Tyr Phe Ser 2O 25 US 9,629,910 B2 85 86 - Continued

<210s, SEQ ID NO 17 &211s LENGTH: 351 212. TYPE : PRT <213> ORGANISM: Human T-lymphotropic virus 1

<4 OOs, SEQUENCE: 17

His Phe Pro Gly Gly Glin Ser Luell Luell Phe Gly Pro Wall 1. 15

Wall Phe Gly Asp Wall Glin Gly Asp Trp Pro Ile Ser Gly Gly 25

Lell Ser Ala Arg Lell His Arg His Ala Luell Lell Ala Thir Pro 35 4 O 45

Glu His Glin Ile Thir Trp Asp Pro Ile Asp Gly Arg Wall Ile Gly Ser SO 55 6 O

Ala Luell Glin Phe Lell Ile Pro Arg Luell Pro Ser Phe Pro Thir Glin Arg 65 70

Thir Ser Thir Lell Wall Luell Thir Pro Pro Ile Thir His Thir Thir 85 90 95

Pro Asn Ile Pro Pro Ser Phe Luell Glin Ala Met Arg Tyr Ser Pro 105 11 O

Phe Arg Asn Gly Tyr Met Glu Pro Thir Luell Gly Glin His Luell Pro Thir 115 12 O 125

Lell Ser Phe Pro Asp Pro Gly Luell Arg Pro Glin Asn Lell Tyr Thir Luell 13 O 135 14 O

Trp Gly Gly Ser Wall Wall Met Luell Tyr Glin Lell Ser Pro Pro 145 150 155 160

Ile Thir Trp Pro Lell Lell Pro His Wall Ile Phe His Pro Gly Glin 1.65 17O 17s

Lell Gly Ala Phe Lell Thir Asn Wall Pro Arg Ile Glu Glu Luell 18O 185 19 O

Lell Lys Ile Ser Lell Thir Thir Gly Ala Luell Ile Ile Luell Pro Glu 195

Asp Cys Luell Pro Thir Thir Lell Phe Glin Pro Ala Arg Ala Pro Wall Thir 21 O 215

Lell Thir Ala Trp Glin Asn Gly Luell Luell Pro Phe His Ser Thir Luell Thir 225 23 O 235 24 O

Thir Gly Luell Ile Trp Thir Phe Thir Asp Gly Thir Pro Met Ile Ser 245 250 255

Gly Pro Asp Gly Glin Pro Ser Luell Wall Lell Glin Ser Ser 26 O 265 27 O

Ser Phe Ile Phe His Phe Glin Thir Ala His Pro Ser Phe 27s 285

Lell Lel Ser His Gly Lell Ile Glin Tyr Ser Ser Phe His Ser Luell His 29 O 295 3 OO

Lell Lel Phe Glu Glu Tyr Thir Asn Ile Pro Ile Ser Lell Luell Phe Asn 3. OS 310 315 32O

Glu Glu Ala Asp Asp Asn Asp His Glu Pro Glin Ile Ser Pro Gly 3.25 330 335

Gly Lel Glu Pro Pro Ser Glu His Phe Arg Glu Thir Glu Wall 34 O 345 35. O US 9,629,910 B2 87 88 The invention claimed is: 1. A method for treating melanoma in a Subject compris ing administering to a Subject in need thereof a therapeuti cally effective amount of an agonist of an interleukin-9 receptor (IL-9R), wherein the agonist of IL9-R comprises a population of Th9 cells or an IL-9 polypeptide, wherein the IL-9 polypeptide is selected from the group consisting of SEQ ID NO: 2, amino acids 19-144 of SEQID NO: 2, SEQ ID NO: 15 and SEQ ID NO: 16. 2. The method of claim 1, wherein the agonist further 10 comprises a pharmaceutically acceptable carrier. 3. The method of claim 1, wherein the subject is human. 4. The method of claim 1, wherein the agonist is admin istered by a route selected from the group consisting of intratumor, adoptive cell transfer, and parenteral adminis 15 tration.