The Role of Cited2 in Left-Right Patterning and Placental Development in the Mouse

The role of Cited2 in left-right patterning and placental development in the mouse.

Stanley Troy Meredor Artap Bachelor of Science (Advanced) (First Class Honours)

This thesis is submitted in fulfilment of the requirements of the degree of Doctor of Philosophy 2012

Developmental Biology Program, The Victor Chang Cardiac Research Institute, and St. Vincent’s Clinical School, Faculty of Medicine, University of New South Wales Australia

PLEASE TYPE THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet

Surname or Family name: Artap

First name: Stanley Troy Other name/s: Meredor

Abbreviation for degree as given in the University calendar: PhD

School: St. Vincent’s Clinical School Faculty: Medicine

Title: The role of Cited2 in left-right patterning and placental development in the mouse.

Abstract 350 words maximum: (PLEASE TYPE)

Cited2 is a member of the CITED gene family of transcriptional co-factors widely expressed in the mouse conceptus. It interacts with various transcriptional factors to drive the proper development of many organs in the mouse. Territories of Cited2 expression in the mouse coincide with the tissues most affected in Cited2 null mice. Embryos deficient in Cited2 display complex heart defects that may have multiple origins. One possibility is that the establishment of the left-right body axis that provide morphological cues for developing organs, like the heart, is perturbed in these mutant embryos. Cited2 is expressed in the relevant left-right patterning tissues such as the node and the lateral plate mesoderm. Therefore, the biochemical role Cited2 plays in left-right patterning was explored. This part of the study provides insight into how Cited2 may function in left-right development and organogenesis.

Cited2 is also very important in the developing mouse placenta, where it is expressed in many trophoblast subtypes and vascular cells. Cited2 deficient placentas are grossly small in size, with reduced trophoblast numbers and an expanded foetal vasculature. This part of the study further characterised the cellular expression of Cited2 in placental cells. It also further describes the vascular phenotype in Cited2 mutants, and biochemically relevant molecules to inform on the potential molecular workings of the phenotype. Furthermore, conditional deletion of Cited2 was also performed to understand which placental compartments Cited2 is primarily required. It was found that endothelial cell-specific deletion of Cited2 phenocopied much of the complete Cited2 null placental phenotype, indicating that Cited2 is necessary in endothelial cells of the mouse placenta.

Declaration relating to disposition of project thesis/dissertation

I hereby grant to the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or in part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all property rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation.

I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstracts International (this is applicable to doctoral theses only).

…………………………………………………………… ……………………………………..……………… ……….……………………...…….… Signature Witness Date

The University recognises that there may be exceptional circumstances requiring restrictions on copying or conditions on use. Requests for restriction for a period of up to 2 years must be made in writing. Requests for a longer period of restriction may be considered in exceptional circumstances and require the approval of the Dean of Graduate Research.

FOR OFFICE USE ONLY Date of completion of requirements for Award:

THIS SHEET IS TO BE GLUED TO THE INSIDE FRONT COVER OF THE THESIS ORIGINALITY STATEMENT

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’

Signed ……………………………………………......

Date ……………………………………………...... COPYRIGHT STATEMENT

‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.'

Signed ……………………………………………......

Date ……………………………………………......

AUTHENTICITY STATEMENT

‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’

Signed ……………………………………………......

Date ……………………………………………......

“Mon esprit, prends garde. Pas de partis de salut violents. Exerce-toi ! - Ah ! la science ne va pas assez vite pour nous !”

- “Une Saison en Enfer” by Arthur Rimbaud (April-August, 1873)

Acknowledgements

To my supervisor Sally, you will forever be etched in my mind as the supervisor who had a song for every occasion. So in keeping with your habit to break into song I tried to find a tune that aptly described you. I could only find one that was the least inappropriate. So to quote Little Richard, “Long Tall Sally”, I thank you for your guidance and support throughout this candidature. Thank you for allowing me to discover the wonderful world that is developmental biology.

I would also like to thank my other mentors Richard and Duncan who together provided great technical guidance, advice and words of encouragement over the course of this PhD. Thank you to you both.

To the Dunwoodie lab, past and present, thank you for all your advice, assistance and friendship throughout the years. I would like to especially mention a couple of people who made the time in the lab very enjoyable and academically stimulating: Gavin, my pseudo-mentor (deny all you want but we both know this is true) thank you for your listening ear, your mentoring, for introducing me to the wonderfully eerie music of Sigur Ros, but most of all for your friendship; Wendy, my lab sister thank you for sharing your world of gastronomy, there was one less hungry PhD student throughout your adventures into the world of food and pastries, but most of all I cherish your friendship.

A large number of postdocs, research assistants, student members and support staff, past and present, of the Developmental Biology Program at the Victor Chang Cardiac Research Institute and throughout the institute itself have helped to colour my time at the institute. Thank you to all for your words of encouragement, desk space (for I had many) and friendship, but among them I would like to especially mention a few. Danielle, my Thursdays will never be the same again thanks to you. Lady, by the way, my shoulder has knots, care to get rid of them? To my French “amis” Rom-boules and Mimi, thank you for the support, laughter and your French-ship [sic]. “Tout d'abord, Rom-boules, suggérer aux doctorants d'abandonner avant qu'il ne soit trop tard est une manière vi ingénieuse de provoquer la réaction inverse et au final de les motiver à terminer rageusement - Chapeau bas, monsieur”! Mimi, ma petite baleine, tu es la soeur que je n'ai jamais eue, merci de prendre soin de moi et de m'offrir ton amitié”. Megumi, “domo arigato” for introducing me to Japanese culture, your help in the lab and of course your friendship. Brendan, thank you very much for all your hard work and swift IT help, without you this thesis would never have seen the light of day. Thank you!

I would also like to extend my thanks to my fellow SAVI students, PhD and Honours students, past and present, for sharing the scientific experience with me. Thank you for all the drinks, tales and late nights shared contemplating everything and anything. I would like to particularly thank Jacque and Michelle for coordinating the genesis of SAVI, which brought a collegial atmosphere to the Institute’s student body. Also, I would like to thank my SAVI co-chair, Leah, for the tremendous effort spent with me in trying to maintain the existence of SAVI.

My science was all influenced by many scientists in the nearby Garvan Institute of Medical Research for which I am truly thankful. I would like to especially name Amanda, thank you for sharing your happy disposition that always cheered me up, your technical advice and your zeal for science that is so infectious.

I would like to express my deepest and sincere thanks to my very good friend, Ting, who I shared many great and not-so-great moments in and outside of the lab. Mate, thank you for just being there, for the coffees, for the stories, for the dumplings, for the “yeung chi gam lo”, for the laughter, for the lego and the list goes on. You are truly a special person to me. My memories at the Chang will most definitely be coloured by your litany of Engrish [sic]. I will wait for your Engrish [sic] book, without doubt I know it will be your magnum opus. Can you believe it? We have finished! Sic transit gloria mundi!!! “Diu lei”!!

A special shout out goes to my Nunu, thank you for being a constant in my life throughout this adventure. Thank you for being my compass, steering me in the right

vii direction when things got a little too confusing to manoeuvre in. A little belated, I know, but I thought it was important to recognise this as I deeply appreciate the effort and efficiency in which you procured the necessary resources to print out my Honours thesis. The method in which you did it can only be described as Machiavellian. Thank you!

This thesis and PhD was made possible by a University of New South Wales Postgraduate Scholarship and financial assistance from the Victor Chang Cardiac Research Institute, for which I am very grateful to both institutions.

Finally, I would like to express my gratitude to my parents whose love and support were essential for the completion of this work. “Maraming salamat sa lahat ng kahihirap na ginawa ninyo para sa akin. Maraming salamat sa pagmamahal na araw araw niyong pinapakita. Mahal na mahal ko kayo”. It is to them I would like to dedicate this thesis.

viii

Publications related to findings during this candidature

Lopes Floro K, Artap ST, Preis JI, Sparrow DB, Fatkin D, Chapman G, Furtado MB, Harvey RP, Hamada H and Dunwoodie, SL (2011) Loss of Cited2 causes congenital heart disease by perturbing left-right patterning of the body axis. Human Molecular Genetics 20(6):1097-110 .

Oral presentation of work to external audiences

The 19th St. Vincent’s & Mater Health Sydney Research Symposium, September 2009.

Abstract

Cited2 is also very important in the developing mouse placenta, where it is expressed in many trophoblast subtypes and vascular cells. Cited2 deficient placentas are grossly small in size, with reduced trophoblast numbers and an expanded foetal vasculature. This part of the study further characterised the cellular expression of Cited2 in placental cells. It also further describes the vascular phenotype in Cited2 mutants, and biochemically relevant molecules to inform on the potential molecular workings of the phenotype. Furthermore, conditional deletion of Cited2 was also performed to understand which placental compartments Cited2 is primarily required. It was found that endothelial cell- specific deletion of Cited2 phenocopied much of the complete Cited2 null placental phenotype, indicating that Cited2 is necessary in endothelial cells of the mouse placenta.

List of Abbreviations

4311 Trophoblast specific protein alpha (now referred to as Tpbpa) A-P Anterior-posterior Acvr1b Activin A receptor, type 1B Acvr2b Activin receptor IIB Acvrl1 Activin A receptor, type II-like 1 Akt1 Activate thymoma viral proto-oncogene 1 Angpt1 Angiopoietin 1 Angpt2 Angiopoietin 2 Angpt3 Angiopoietin 3 Angpt4 Angiopoietin 4 Ascl2 Achaete-scute complex homolog 2 (Drosophila) αSMA Alpha smooth muscle actin AU Arbitrary units BCIP 5-bromo-4-chloro-3-indolyl phosphate p-toluidine Bmp4 Bone morphogenetic protein 4 bp Base pair BSA Bovine serum albumin C Celsius C-TGC Canal trophoblast giant cell

CaCl2 Calcium chloride CBP Creb-binding protein Cdkn1c Cyclin-dependent kinase inhibitor 1C (P57) Cebpa CCAAT/enhancer binding protein (C/EBP), alpha Cfc1 Cripto, FRL-1, cryptic family 1 CHAPS 3-[(3-Cholamidopropyl)dimethylammonio]-1- propanesulfonate CITED Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain family of transcriptional co-factors Cited1 Cbp/p300-interacting transactivator, with Glu/Asp-rich xii

carboxy-terminal domain, 1 Cited2 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 Cited3 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 3 Cited4 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4 cm Centimetre CMV Human cytomegalovirus promoter

CO2 Carbon dioxide CR1 Conserved region 1 CR2 Conserved region 2 CSL CBF1, Suppressor of Hairless, Lag-1 Ctsq Cathepsin Q D-V Dorso-ventral DIG-11-dUTP Digoxigenin-11-uridine-5'-triphosphate Dll1 Delta-like 1 DMEM Dulbecco's Modified Eagle Medium DMF Dimethylformamide DNA Deoxyribonucleic acid DNase Deoxyribonuclease dNTP Deoxyribonucleotide triphosphate dpc Days post coitum DTT Dithiothreitol E Embryonic day E.coli Escherichia coli ECM Extracellular matrix EDTA Ethylenediaminetetraacetic acid EGFP Enhanced green fluorescent protein EGTA Ethylene glycol tetraacetic acid Elk1 ELK1, member of the ETS oncogene family xiii

Eng Endoglin EPC Ectoplacental cone EPI Epiblast EtBr Ethidium bromide Ets1 E26 avian leukemia oncogene 1, 5' domain EXE Extraembryonic FCS Fetal calf serum Fgf2 Fibroblast growth factor 2 FLAG-Smad2 FLAG-tagged Smad2 Foxh1 Forkhead box H1 frbc Fetal red blood cell fv Fetal vessel g Acceleration of gravity (9.8 ms-2) Gcm1 Glial cells missing homolog 1 (Drosophila) Gdf1 Growth differentiation factor 1 GlyT Glycogen trophoblast Gys1 Glycogen synthase 1, muscle HA Haemagglutinin HA-Cited2 Haemagglutinin-tagged Cited2 Hand1 Heart and neural crest derivatives expressed transcript 1 HCl Hydrochloric acid HEK Human embryonic kidney HEPES 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid HIF Hypoxia inducible factor Hif1a Hypoxia inducible factor 1, alpha subunit Hif2a Endothelial PAS domain protein 1 Hif3a Hypoxia inducible factor 3, alpha subunit Hnf4a Hepatic nuclear factor 4, alpha HRP Horseradish peroxidase IC Immunochemistry ICM Inner cell mass xiv

IEM Intraembryonic Ifng Interferon gamma Ifngr Interferon gamma receptor Ig Immunoglobulin Il10 Interleukin 10 IP Immunoprecipitation IRES Internal ribosome entry site ITGA Integrin alpha subunit ITGB Integrin beta subunit

K2S2O5 Potassium metabisulfite kb Kilobase KCl Potassium chloride Klf2 Kruppel-like factor 2 (lung) L Litre L-R Left-right LDS Lithium dodecyl sulfate Lefty1 Left right determination factor 1 Lefty2 Left right determination factor 2 Lhx1 LIM homeobox protein 1 Lhx2 LIM homeobox protein 2 LPM Lateral plate mesoderm LSE Left side-specific enhancer Mapk1 Mitogen-activated protein kinase 1 Mapk3 Mitogen-activated protein kinase 3 MesP1 Mesoderm posterior 1 μg Microgram mg Milligram

MgCl2 Magnesium chloride μL Microlitre mL Millilitre μm Micrometer xv

μM Micromolar mm Millimetre mM Millimolar MMP Matrix metallopeptidase Mmp1 Matrix metallopeptidase 1 Mmp19 Matrix metallopeptidase 19 Mmp3 Matrix metallopeptidase 3 Mmp7 Matrix metallopeptidase 7 Mmp9 Matrix metallopeptidase 9 MOPS 3-morpholinopropane-1-sulfonic acid ms Maternal sinusoid Myc Myelocytomatosis oncogene Myc-Foxh1 Six Myc-tagged Foxh1

Na2HPO4 Disodium hydrogen orthophosphate

Na3VO4 Sodium orthovanadate NaAc Sodium acetate NaCl Sodium chloride NaF Sodium fluoride

NaH2PO4.2H2O Sodium dihydrogen orthophosphate NBT Nitro blue tetrazolium nd Not determined NDE node-specific enhancer of Nodal ng Nanogram NK Natural killer nm Nanometre Nodal ASE Asymmetric enhancer of the Nodal gene Nos3 Nitric oxide synthase 3 Notch1 Notch gene homologue 1 Notch2 Notch gene homologue 2 NP-40 Nonyl phenoxypolyethoxylethanol NTP Ribonucleotide triphosphate xvi

OCT Optimal Cutting Temperature compound

ODn Optical density at a wavelength of nm P-TGC Parietal trophoblast giant cell p300 E1A binding protein p300 PAS Periodic Acid-Schiff PBS Phosphate Buffered Saline PBT Phosphate Buffered Saline supplemented with 0.1% Tween- 20 Pcdh12 Protocadherin 12 PCR Polymerase chain reaction Pdgfb Platelet derived growth factor, B polypeptide Pdgfrb Platelet derived growth factor receptor, beta polypeptide Pdpk1 3-phosphoinositide dependent protein kinase 1 PE Primitive endoderm Pecam1 Platelet/endothelial cell adhesion molecule 1 PFA Paraformaldehyde Pgf Placental growth factor (was PLGF) PGK Phosphoglycerate kinase gene promoter PGK-Neo Phosphoglycerate kinase gene promoter driving expression of a Neomycin resistance gene

PI(3,4,5)P3 Phosphatidylinositol-3,4,5-triphosphate

PI(4,5)P2 Phosphatidylinositol-4,5-biphosphate Pik3 Phosphatidylinositol 3-kinase Pitx2 Paired-like homeodomain transcription factor 2 Pl1 Placental lactogen 1 (now referred to as Prl3d1) Pl2 Placental lactogen 2 (now referred to as Prl3b1) Plau Plasminogen activator, urokinase Plf Proliferin (now referred to as Prl2c) PLGF Placental growth factor (now referred to as Pgf) PLP-A Prolactin-like protein A (now referred to as Prl4a1) PM Paraxial mesoderm xvii

PMSF Pphenylmethanesulfonylfluoride Ppara Peroxisome proliferator activated receptor alpha Pparg Peroxisome proliferator activated receptor gamma PPS Primitive streak PRL Prolactin/lactogen/growth hormone family Prl2c Prolactin family 2, subfamily c (was Proliferin (Plf)) Prl3b Prolactin family 3, subfamily b Prl3b1 Prolactin family 3, subfamily b, member 1 (was Placental lactogen 2 (Pl2)) Prl3d Prolactin family 3, subfamily d Prl3d1 Prolactin family 3, subfamily d, member 1 (was Placental lactogen 1 (Pl1)) Prl4a1 Prolactin family 4, subfamily a, member 1 (was PLP-A) Prl7d1 Prolactin family 7, subfamily d, member 1 (was PRP) Prlr Prolactin receptor PRP Proliferin-related protein PTGS Prostaglandin-endoperoxide synthase PVDF Polyvinylidene fluoride PVP Polyvinylpyrrolidone R26R ROSA26 reporter rcf Relative centrifugal force RNA Ribonucleic acid RNase Ribonuclease RNasin Ribonuclease inhibitor S-TGC Sinusoidal trophoblast giant cell SDS Sodium dodecyl sulfate SEM Standard error of the mean Serpine1 Serine (or cysteine) peptidase inhibitor, clade E, member 1 Shh Sonic hedgehog Smad1 MAD homolog 1 (Drosophila) Smad2 MAD homolog 2 (Drosophila) xviii

Smad3 MAD homolog 3 (Drosophila) Smad4 MAD homolog 4 (Drosophila) Smad5 MAD homolog 5 (Drosophila) Sp1 Trans-acting transcription factor 1 SpA-TGC Spiral artery trophoblast giant cell SpT Spongiotrophoblast SSC Sodium chloride and sodium citrate Syna Syncytin A Synb Syncytin B SynT-I Syncytiotrophoblast layer I SynT-II Syncytiotrophoblast layer II TAE Tris acetate EDTA TBS Tris buffered saline TBST Tris buffered saline supplemented with 0.05% Tween-20 Tcfap2 Transcription factor AP-2 Tdgf1 Teratocarcinoma-derived growth factor 1 TGC Trophoblast giant cell Tgfb1 Transforming growth factor, beta 1 Tgfbr1 Transforming growth factor, beta receptor I Tie2 Endothelial-specific receptor tyrosine kinase Tie2-Cre Tie2 regulatory driven expression of Cre-recombinase TIMP Tissue inhibitor of metalloproteinases tk Human thymidine kinase gene promoter tk-Renilla Renilla gene expression driven by the human thymidine kinase gene promoter Tpbpa Trophoblast specific protein alpha (was 4311) Tpbpa-Cre Trophoblast specific protein alpha promoter driven Cre- recombinase Tris Base Tris (hydroxymethyl)-aminomethane Tris-HCl Tris (hydroxymethyl) aminomethane hydrochloride TS Trophoblast stem xix

Tween-20 Polyoxyethylene (20) sorbitan monolaurate U Units V Volts Vegfa Vascular endothelial growth factor A Vegfr1 Vascular endothelial growth factor receptor 1 Vegfr2 Vascular endothelial growth factor receptor 2 WB Western blot X-Gal 5-bromo-4-chloro-3-indolyl β-D-galactopyranoside

List of Figures

Chapter 2 Figure 2.1 Schematic diagram of embryonic breaking of symmetry about the left- right body axis of the mouse...... 38 Figure 2.2 Schematic diagram of Nodal molecular signalling in determining left. .... 44 Figure 2.3 Cited2 potentiates transcriptional activation of Nodal ASE...... 50 Figure 2.4 HA-Cited2 and Myc-Foxh1 co-localise in the nucleus...... 54 Figure 2.5 Cited2 is suggested to interact with Foxh1 ...... 56

Chapter 3 Figure 3.1 Development of the mouse placenta and the lineage relationships of trophoblast derivatives ...... 64 Figure 3.2 The yolk sac placenta...... 72 Figure 3.3 The trilaminar trophoblast structure of the mouse placental labyrinth ...... 80 Figure 3.4 The developing vasculature and its associated blood cells ...... 86 Figure 3.5 Signalling pathways in the assembly of vascular conduits ...... 92 Figure 3.6 Cited2 is expressed in vascular endothelial and mural cells...... 106 Figure 3.7 Cited2 is expressed in syncytiotrophoblasts and maternal sinusoidal trophoblast giant cells of the placental labyrinth...... 108 Figure 3.8 The fetal vasculature of the mouse placenta ...... 112 Figure 3.9 Schematic of capillary loops in the mouse placenta ...... 114 Figure 3.10 Placentas null for Cited2 have poor pericyte investment around capillaries in the placental labyrinth...... 116 Figure 3.11 Placentas null for Cited2 have poor smooth muscle cell coverage of moderately sized fetal vessels in the placental labyrinth...... 118 Figure 3.12 Placentas null for Cited2 have less smooth muscle cell investment around large-sized vessels at the base of the placenta...... 120 Figure 3.13 Placentas null for Cited2 do not have significantly different protein expression of α-SMA, although the ratio of α-SMA expressing mural cells to Pecam1 expressing endothelial ce]ls is disorgansied...... 124 xxi

Figure 3.14 Placentas null for Cited2 have unaltered Pdgfb-Pdgfrb protein expression...... 128 Figure 3.15 Vegfr2 protein expression is not perturbed in Cited2 null placentas. .... 130 Figure 3.16 MAPK signalling is increased in placentas null for Cited2...... 134 Figure 3.17 Placentas null for Cited2 have perturbed Akt1 protein expression...... 138

Chapter 4 Figure 4.1 Schematic representation of the Cited2 alleles ...... 160 Figure 4.2 The activity of Cre-recombinase derived from the Tie2-Cre transgene .. 164 Figure 4.3 Comparison of pup weight and survival of mouse pups supported by placentas null for Cited2 specifically in endothelial cells...... 168 Figure 4.4 Placentas null for Cited2 restricted to endothelial cells are smaller at 16.5 dpc...... 172 Figure 4.5 Mouse embryos and the placentas null for Cited2 restricted to endothelial cells that support them are both reduced at 18.5 dpc...... 174 Figure 4.6 Endothelial cell-restricted excision of Cited2 results in smaller placentas with a perturbed junctional zone although the ratio of α-SMA expressing mural cells to Pecam1 expressing endothelial cells is normal...... 178 Figure 4.7 Comparison of GlyT and SpT cells in the junctional zone of placentas lacking Cited2 in endothelial cells only...... 182 Figure 4.8 Specific deletion of Cited2 in endothelial cells does not affect microvessel caliber and pericyte investment in the placental fetal capillaries...... 186 Figure 4.9 Endothelial cell-restricted deletion of Cited2 does not affect mural cell investment in moderately sized vessels of the placental fetal vasculature...... 188 Figure 4.10 Endothelial specific deletion of Cited2 does not affect mural cell coverage of large sized vessels in the placental fetal vasculature...... 190

Chapter 5 Figure 5.1 Cre-recombinase derived from the Tpbpa-Cre transgene is active in the chorionic plate of the conceptus at 9.5 dpc ...... 202 xxii

Figure 5.2 Cre-recombinase derived from the Tpbpa-Cre transgene is active in various trophoblast compartments in the 14.5 dpc mouse placenta ...... 204 Figure 5.3 Mouse pups supported by placentas with Cited2 deficient trophoblast derivatives are small and die perinatally...... 208 Figure 5.4 Comparison of weights of placentas and embryos null for Cited2 in a subset of trophoblasts at 14.5 dpc...... 212 Figure 5.5 Trophoblast derivative-restricted ablation of Cited2 suggests a reduced junctional zone ...... 214 Figure 5.6 Placentas lacking Cited2 in trophoblast cells appear to have a reduced junctional zone...... 216 Figure 5.7 Specific deletion of Cited2 in trophoblast cell subtypes does not affect pericyte coverage of capillaries in the placental labyrinth ...... 220 Figure 5.8 Specific deletion of Cited2 in trophoblast cell subtypes does not affect smooth muscle cell coverage of moderately sized fetal vessels in the placental labyrinth...... 222 Figure 5.9 Endothelial specific deletion of Cited2 does not affect mural cell coverage of large sized vessels in the placental fetal vasculature...... 224

xxiii

List of Tables

Chapter 1 Table 1-1 Plasmid, restriction enzyme digestion and polymerase used to generate anti-sense RNA in situ hybridisation probes ...... 9 Table 1-2 Oligonucleotides ...... 11 Table 1-3 The source, uses and dilution of primary antibodies...... 13 Table 1-4 Source, usage and dilution of secondary antibodies ...... 14 Table 1-5 Primers and PCR programs used to genotype the various mouse lines ...... 24 Table 1-6 PCR program specifications for the various genotyping protocols ...... 26

Chapter 3 Table 3-1 Trophoblast giant cell subtypes, their location and functions in the mouse placenta ...... 70 Table 3-2 Cellular expression of various placenta relevant signalling molecules ...... 94 Table 3-3 Comparison of previous and current characterisation of Cited2 null placentas ...... 104

xxiv

Table of Contents

Preface ...... 1

Chapter 1: Materials and Methods ...... 2

1.1 Materials ...... 3

1.1.1 Chemical and reagents ...... 3

1.1.2 Kits ...... 4

1.1.3 Enzymes ...... 4

1.1.4 Buffers and Solutions ...... 5

1.1.5 Plasmids ...... 8

1.1.6 Oligonucleotides ...... 10

1.1.7 Bacterial strains ...... 10

1.1.8 Bacterial growth media ...... 10

1.1.9 DNA markers ...... 12

1.1.10 Antibodies ...... 12

1.1.11 Protein experimental materials ...... 12

1.1.12 Immunochemical materials ...... 15

1.1.13 Miscellaneous materials ...... 15

1.2 Methods ...... 16

1.2.1 Molecular Biological Techniques ...... 16

1.2.2 Mouse lines and embryological techniques ...... 21

1.2.3 Histology ...... 25

1.2.4 Immunochemistry ...... 30

Chapter 2: Cited2 potentiates Nodal signalling in patterning the left-right body axis ...... 33

xxv

2.1 Cited2 is an important transcriptional co-factor in organogenesis ...... 34

2.2 Establishing the left-right body axis ...... 36

2.2.1 The node ...... 37

2.2.2 The lateral plate mesoderm and the midline ...... 41

2.3 Cited2 is required for left-right patterning ...... 46

2.4 Aims and hypothesis ...... 47

2.5 Results ...... 48

2.5.1 Cited2 potentiates Nodal expression via the asymmetric enhancer element (ASE) ...... 48

2.5.2 Cited2 may interact with Foxh1 to indirectly potentiate Nodal expression ...... 52

2.6 Discussion ...... 58

2.7 Summary ...... 60

Chapter 3: Characterisation of the Cited2 null mouse placenta ...... 62

3.1 Placental development in the mouse ...... 63

3.2 Trophoblasts ...... 67

3.2.1 Trophoblast giant cells ...... 68

3.2.2 Spongiotrophoblasts and glycogen trophoblast cells of the junctional zone ...... 76

3.2.3 Labyrinthine trophoblasts and their functions ...... 79

3.3 Fetal blood vessels of the mouse placenta ...... 83

3.3.1 Development of the yolk sac and fetal vasculatures of the murine placenta ...... 83

3.3.2 The extracellular matrix plays a role in vascular development ...... 89

3.3.3 Signalling pathways in vascular development ...... 91 xxvi

3.4 Hypoxia and placental development ...... 98

3.5 CITED genes in placental development ...... 100

3.5.1 Cited1 is required in the developing mouse placenta...... 100

3.5.2 Cited2 is necessary in mouse placental development ...... 100

3.6 Aims and hypothesis ...... 102

3.7 Results ...... 102

3.7.1 Cited2 is expressed in mural and endothelial cells within the labyrinth of the mouse placenta ...... 102

3.7.2 Cited2 is expressed in syncytiotrophoblasts and sinusoidal trophoblast giant cells of the labyrinthine layer of the mouse placenta ...... 103

3.7.3 Mouse placentas null for Cited2 have disorganised mural cell deposition around capillaries and large fetal vessels of the placental labyrinth ...... 110

3.7.4 Alpha-smooth muscle actin expression is not reduced, but the ratio of α- SMA expressing mural cells to Pecam1 expressing endothelial cells are disorganised in Cited2 null placentas...... 122

3.7.5 Various signalling pathways are perturbed in Cited2 null placentas ...... 122

3.8 Discussion ...... 136

3.8.1 Cited2 is expressed in vascular and trophoblast cell subtypes of the mouse placenta ...... 140

3.8.2 Endothelial and mural cells in the developing fetal vessels of the mouse placenta are altered in the absence of Cited2 ...... 142

3.8.3 Placenta relevant molecular signalling pathways are differentially affected in Cited2 null placentas ...... 145

3.9 Summary ...... 154

Chapter 4: Site-specific deletion of Cited2 in fetal endothelial cells of the mouse placenta ...... 156

xxvii

4.1 Introduction ...... 157

4.2 Aims and hypothesis ...... 162

4.3 Results ...... 162

4.3.1 Documenting the activity of Cre-recombinase from the Tie2-Cre mouse ...... 162

4.3.2 Phenotypic analysis of mutant mouse embryos and placentas conditionally deleted of Cited2 in endothelial cells ...... 166

4.4 Discussion ...... 192

4.4.1 Cre-recombinase from the Tie2-Cre locus is active in the precursor tissue of the placental fetal vasculature and extraembryonic mesodermal cells ...... 192

4.4.2 A requirement for Cited2 in vascular endothelial cells of the mouse placenta for proper fetal growth ...... 194

4.4.3 Cited2 is necessitated in vascular endothelial cells for the correct formation of the placenta and the trophoblasts that reside in it...... 196

4.4.4 Cited2 is not required in endothelial cells for morphogenesis of the placental fetal vasculature and its maturation by pericyte and smooth muscle cell envelopment...... 197

4.5 Summary ...... 198

Chapter 5: Trophoblast cell-restricted deletion of Cited2 in the mouse placenta ... 199

5.1 Introduction ...... 200

5.2 Aims and hypotheses ...... 200

5.3 Results ...... 201

5.3.1 Documenting the activity of Cre-recombinase from the Tpbpa-Cre mouse ...... 201

5.3.2 Phenotypic analysis of mutant mouse embryos and placentas conditionally deleted of Cited2 in trophoblast derivatives ...... 206 xxviii

5.4 Discussion ...... 226

5.4.1 Cre-recombinase from the Tpbpa-Cre locus is active in some trophoblast derivatives in and near the junctional zone ...... 226

5.4.2 A requirement for Cited2 in trophoblast derivatives of the mouse placenta for proper fetal growth ...... 227

5.4.3 A suggestion that Cited2 is required in trophoblast cells for the correct formation of the placenta...... 228

5.4.4 Cited2 is not required in trophoblast cells for the correct formation of the placental vasculature...... 229

5.5 Summary ...... 230

Chapter 6: General Discussion ...... 231

6.1 Cited2 may be important in initiating L-R signals for organogenesis in the mouse ...... 232

6.2 Cited2 may function in multiple placental cell compartments for proper placentogenesis ...... 235

6.3 Summary ...... 237

Chapter 7: References...... 239

xxix

Preface

This thesis explores the role of the gene, Cited2, in two different contexts of mouse development and is thus laid out in roughly two parts. The layout of this thesis breaks convention and omits the chapter dedicated to a general introduction, and instead incorporates the introduction into the two separate topics. The first part of this thesis investigates the importance of Cited2 in patterning the left-right body axis. This is explored in Chapter 2 and includes the relevant background introduction to the study and the study itself. The second part of this thesis explores Cited2 function in mouse placental development. This is examined in Chapters 3-5 with the general introduction to placental development for all three chapters expounded in Chapter 3. This highlights the pleiotropic effects Cited2 exerts and is reflected in its ubiquity in the mouse conceptus.

Chapter 1: Materials and Methods

1.1 Materials

1.1.1 Chemical and reagents

Ajax Finechem Ethanol, Isopropanol, N-Hexane Amyl Media Bacto® tryptone, Bacto yeast extract Astral PBS tablets BDH Chemicals Formamide, Xylene, Triton X-100 Boehringer Blocking reagent Diploma Skim milk Gibco/BRL DMEM, FCS, L-glutamine, Penicillin/Streptomycin, Sodium Pyruvate ICN Glycerol, NP-40 and Tween-20 Invitrogen Lipofectamine™ Reagent and PLUS™ Reagent Progen Ampicillin (sodium salt) and X-Gal Promega RNasin Pro Sci Tech OCT Compound R&D Systems Tgfb1 Roche Anti-DIG-AP FAB fragments, Complete protease inhibitors – EDTA, DIG-11-dUTP, dNTPs, NBT/BCIP tablets, phenylmethanesulfonylfluoride (PMSF), PhosSTOP® phosphatase inhibitors, rNTPs Sigma Agar, Agarose, Alcoholic Eosin, Aprotinin, BCIP tablets, Benzamidine, β-glycerophosphate, Bouin’s

fixative, BSA, CaCl2, CHAPS, Citric Acid, Disodium hydrogen orthophosphate, Dextran sulfate, DMF, DTT, EtBr, EDTA, EGTA, Ficoll®, Glucose, Gluteraldehyde, Glycine, Haematoxylin, HCl, HEPES

Acid, K2S2O5, KCl, Leupeptin, Levamisole, MgCl2, MOPS, Manganese chloride, Magnesium sulfate,

maleic acid, Na3VO4, NaAc, NaCl, NaF, Orange G, Paraplast, Pararosaniline chloride, Pepstatin, Periodic

Acid, PFA, Phenol, Phenol Red, Polyvinylpyrrolidone (PVP), Potassium Acetate, Potassium chloride, Potassium hydroxide, Potassium ferricyanide, Potassium ferrocyanide, Potassium phosphate, Rubidium chloride, rNTPs, Sodium bicarbonate, Sodium desoxycholate, Sodium dihydrogen orthophosphate, SDS, Sheep serum, Sodium lactate, Sodium pyruvate, Spermidine, Sucrose, Torula, Tris HCl, Tris Base and Trisodium citrate.

1.1.2 Kits

BMG Labtech Dual-Luciferase Reporter 1000 Assay System Clontech Chromaspin 100 DEPC columns Qiagen QIAGEN Plasmid Maxi Kit Thermo Fisher Scientific Pierce® BCA Protein Assay Kit Supersignal® West Pico Chemiluminescent Substrate

1.1.3 Enzymes

Most enzymes were sourced from Promega and New England Biolabs. Other enzymes were supplied by:

Applied Biosystems Big Dye 3.1 Ambion T3 and T7 RNA polymerase Roche Proteinase K RNase, DNase free Taq DNA polymerase

1.1.4 Buffers and Solutions

1.1.4.a Buffers and Solutions for General Molecular Biology:

General buffers and solutions 1x TAE: 40mM Tris-HCl (pH 8.2), 20mM NaAc and 10mM EDTA (pH 8.2)

1x TE: 10mM Tris-HCl (pH 7.5) and 1mM EDTA

5x ABI dilution buffer:

400mM Tris-HCl (pH 9.0) and 10mM MgCl2

Murine tail DNA lysis solution: 100mM Tris (pH 8.8), 1M Trizma-HCl (pH8.8), 200mM NaCl, 5mM EDTA and 0.2% SDS

Orange G loading dye: 50% glycerol and Orange G to colour

TBS 1.2% Tris Base, 8.7% NaCl

Yolk sac DNA lysis solution: 50mM Tris (pH 8.0), 1M Trizma-HCl (pH 8.0), 1mM EDTA and 0.5% Tween-20

Rubidium chloride competent cell transformation buffer TFB1:

30mM Potassium acetate, 100mM Rubidium chloride, 10mM CaCl2, 50mM Manganese chloride and 15% Glycerol, pH 5.8

TFB2:

10mM MOPS, 75mM CaCl2, 10mM Rubidium chloride and 15% Glycerol, pH 6.5

1.1.4.b Buffers and Solutions for RNA in situ hybridisation:

PBT: Phosphate buffered saline with 0.1% Tween-20

20x SSC: 3M NaCl, 0.3M Trisodium citrate with the pH adjusted to 4, 5 or 7 using citric acid

10x Salt

1.95M NaCl, 90mM Tris-HCl, 10mM Tris-Base, 50mM NaH2PO4.2H2O (Sodium dihydrogen orthophosphate), 50mM Na2HPO4 (Disodium hydrogen orthophosphate), 0.05M EDTA

100x Denhardt’s solution 2% (w/v) bovine serum albumin, 2% (w/v) Ficoll™, 2% (w/v) polyvinylpyrrolidone (PVP).

Hybridisation solution: 1x Salt, 50% Formamide, 10% dextran sulfate, 10mg/mL Torula yeast RNA, 1x Denhardt’s solution

Wash Solution: 50% Formamide, 1x SSC (pH4.5)

5x MABT 500mM maleic acid pH 7.5, 750mM NaCl, 0.5% Tween-20

10% Blocking reagent

Blocking reagent (Boehringer BM 1096 176) made up in maleic acid pH 7.5

Alkaline phosphatase staining buffer (NTMT):

0.1M NaCl, 0.1M Tris pH 9.5, 0.05M MgCl2, 0.1% Tween-20

NBT/BCIP stain: 337.5μg NBT and 175μg BCIP (dissolved in DMF) per mL of NTMT

1.1.4.c Buffers and Solutions for X-Gal Staining:

Phosphate buffer (0.1M) (pH 7.3): Twenty-one volumes of 0.1M disodium hydrogen orthophosphate to 6 volumes of 0.1M sodium dihydrogen orthophosphate

X-Gal (Glutaraldehyde) fixation solution:

5mM EGTA, 2mM MgCl2, 0.1M Phosphate buffer (pH 7.3) and 0.2% (v/v) Glutaraldehyde

X-Gal wash solution:

0.1M Phosphate buffer (pH 7.3), 0.05% (w/v) BSA, 2mM MgCl2, 0.02% (w/v) NP- 40 and 0.1% (w/v) sodium desoxycholate

X-Gal stain solution: 0.1% (v/v) X-Gal, 0.025% (w/v) spermidine, 5mM potassium ferricyanide, 5mM potassium ferrocyanide, 1.1x10-5 % (w/v) NaCl prepared in X-Gal wash solution (see above)

1.1.4.d Buffers and Solutions for Embryo and Placenta Dissection:

1x PBS:

Four phosphate buffer saline tablets (Astral) were dissolved in 400mL of MilliQ water and the solution autoclaved.

M2 dissecting media: Preparation of M2 media involved addition of: 10mL of Solution A (947mM NaCl, 47.7mM KCl, 11.9mM potassium phosphate, 11.8mM magnesium sulfate, 230mM sodium lactate and 50mM glucose), 1.6mL of Solution B (sodium bicarbonate, 264.3μM Phenol Red); 1mL of Solution C (33μM sodium pyruvate); 1mL of Solution

D (171.45mM CaCl2.2H20); 8.4mL of Solution E (250mM HEPES Acid, 282.18μM Phenol Red); 11mL of heat inactivated FCS then made to a final volume of 100mL with MilliQ water and with a final pH of 7.4. The dissecting media was then filter sterilised and stored at 4oC for up to two weeks.

1.1.5 Plasmids

1.1.5.a RNA in situ hybridisation probes

The restriction digest, polymerase used to generate antisense RNA in situ hybridisation probes and the source of plasmids are listed in Table 1.1.

1.1.5.b Expression vectors used in luciferase assays

The haemagglutinin-tagged Cited2 (HA-Cited2) expression vector was made by cloning a PCR product containing the entire Cited2 open reading frame derived from IMAGE Clone 3372312 into pCMX-PL2. An amino-terminal HA tag was added using oligonucleotides containing an optimal Kozak sequence and translation initiation codon (created by Duncan Sparrow). The Renilla (CMV) luciferase reporter was generated by cloning the Renilla gene from tk-Renilla plasmid into pCMX-PL2 (created by Gavin Chapman). Other expression vectors and reporters used in luciferase assays have been described elsewhere: FLAG-tagged Smad2 (FLAG- Smad2) (Nakao et al., 1997), six Myc-tagged FoxhI (Myc-Foxh1)

Table 1-1 Plasmid, restriction enzyme digestion and polymerase used to generate anti-sense RNA in situ hybridisation probes

Plasmid Restriction enzyme, RNA polymerase Source/Reference

mouse Tpbpa XbaI, T3 Janet Rossant (Carney et al., 1993)

mouse Prl3b1 XhoI, T7 (Shida et al., 1992)

(Saijoh et al., 2000), constitutively active Tgfb receptor (Tgfbr1) (Nakao et al., 1997), firefly (Nodal ASE) reporter (Saijoh et al., 2000).

1.1.6 Oligonucleotides

Synthetic DNA primers used for both genotyping and sequencing were synthesised by Geneworks using a 380 Applied Biosystems DNA Synthesiser and are listed in Table 1.2.

1.1.7 Bacterial strains

DH5α(supE44 Δlac U169 (phi80 lacZΔM15) hsdR17 recA1 endA1gyrA96 thi-1relA1) E. coli were used for chemical heat shock constituting routine subcloning (Bethesda Research Laboratories, Gaithersburg, Maryland, U.S.A.).

1.1.8 Bacterial growth media

1.1.8.a Luria broth agar

10 g/L Bacto® tryptone peptone digest, 5 g/L Bacto® yeast extract, 10 g/L Sodium chloride, 15 g/L Agar agar; gum agar made up to a volume of 1L with RO water before autoclaving. Once the media had cooled to approximately 55oC, ampicillin (100 μg/mL) was added and plates subsequently poured into petri dishes and stored at 4oC.

1.1.8.b Luria broth

10 g/L Bacto® tryptone peptone digest, 5 g/L Bacto® yeast extract, 10 g/L Sodium chloride made up to a volume of 1L with RO water before autoclaving. Once the media had cooled it was stored at 4oC for up to several weeks.

Table 1-2 Oligonucleotides

Laboratory Locus Type Sequence assigned primer Number 1 T7 RNA S GTAATACGACTCACTATAGGGC polymerase promoter 2 T3 RNA S ATTAACCCTCACTAAAGGGA polymerase promoter 79 T7 RNA S TAATACGACTCACTATAGGG polymerase promoter 80 SP6 RNA S ATTTAGGTGACACTATAG polymerase promoter 268 Cited2ΔlacZ G GACAACCCCCCCCAAATGACTGAC 270 G GGCGATGCCTGCTTGCCGAATATC 310 Cited2F G GTCTCAGCGTCTGCTCGTTT 311 G CTGCTGCTGTTGGTGATGAT 316 Cited2FΔ G GACAGTATCGGCCTCAGGAA 320 G AGCTTGCGGAACCCTTAATA 412 Cre- G CATTTGGGCCAGCTAAACAT 413 recombinase G ATTCTCCCACCGTCAGTACG 713 Tpbpa-Cre- G TCCAGTGACAGTCTTGATCCTTAAT 714 recombinase G AAATTTTGGTGTACGGTCAGTAAAT Primers used for sequencing (S) and genotyping (G) are denoted

1.1.8.c Psi broth

20 g/L Bacto® tryptone peptone digest, 5 g/L Bacto® yeast extract, 0.5% Magnesium sulfate adjusted to pH 7.6 with Potassium hydroxide.

All bacterial growth media was prepared in MQ water and sterilised by autoclaving.

Ampicillin (100 μg/mL) was added after the medium had cooled to 55oC. This maintained selection for transformed bacteria containing recombinant plasmids.

1.1.9 DNA markers

100 bp and 500 bp ladder markers were purchased from Geneworks. Band sizes ranged from 100 bp to 1 kb, and 500 bp to 5 kb.

DNA fragment sizes and approximate concentrations were determined by loading agarose mini-gels with 500 ng of marker DNA.

1.1.10 Antibodies

Antibodies were used in several immuno-based experiments. The source, uses and dilutions of primary antibodies listed in Table 1.3. Secondary antibodies and their source, usage and dilution are listed in Table 1.4.

1.1.11 Protein experimental materials

1.1.11.a NuPAGE® Gels and NuPAGE® Buffers

The NuPAGE® Pre-Cast polyacrylamide gel system from Invitrogen was used for protein gel electrophoresis. NuPAGE® Bis-Tris Pre-Cast Gels for small to mid-sized molecular weight proteins, and NuPAGE® Tris-Acetate Gels for larger proteins in combination with optimised buffers (NuPAGE® MES or NuPAGE® MOPS Running Buffers) were used according to the desired band separation. NuPAGE® lithium 12

Table 1-3 The source, uses and dilution of primary antibodies

Antibody (Manufacturer) Source (clonality if known) Use Dilution Akt (Cell Signaling Technology) rabbit WB 1:1000 α-SMA (1A4) (Dako CytoMation) mouse (monoclonal) IC, WB 1:100 β-galactosidase (Abcam) rabbit (polyclonal) IC 1:100 β-tubulin (Sigma) mouse (monoclonal) WB 1:5000 HA (16B12) (Covance) mouse IC, IP, WB 1:1000

Chrompure IgG1 whole molecule (Jackson Labs) mouse IP 1:1000

Chrompure IgG1 whole molecule (Jackson Labs) rabbit IC 1:100 Mapk3/Mapk1 (Cell Signaling Technology) rabbit WB 1:1000 Myc (Developmental Studies Hybridoma Bank) mouse IC, IP, WB 1:500 Pdgfb (H-55) (Santa Cruz Biotechnology, Inc.) rabbit (polyclonal) WB 1:200 Pdgfrb (Santa Cruz Biotechnology, Inc.) rabbit WB 1:500 Pecam1 (BD Pharmingen) rat IC 1:200 phospho-Akt (Ser473) (193H12) (Cell Signaling Technology) rabbit (monoclonal) WB 1:1000

phospho-Mapk3/Mapk1 (Thr202/Tyr204, E10) (Cell Signaling Technology) mouse WB 1:1000

phospho-Elk1 (Ser383) (Cell Signaling Technology) rabbit WB 1:1000 Vegfr2 (Abcam) rabbit WB 1:500 Abbreviations: HA, haemagglutinin; IC, immunochemistry; IP, immunoprecipitation; WB, western blot

Table 1-4 Source, usage and dilution of secondary antibodies

Antibody Use Dilution (Manufacturer) donkey anti-mouse Alexa Fluor 488 (Molecular IC 1:500 Probes)

donkey anti-mouse Cy3 IC 1:500 (Jackson Immunoresearch)

donkey anti-rabbit Alexa Fluor 488 (Molecular IC 1:500 Probes)

donkey anti-rat Cy3 IC 1:500 (Jackson Immunoresearch)

donkey anti-rat Cy5 IC 1:500 (Jackson Immunoresearch)

Donkey anti-mouse HRP WB 1:10,000 Donkey anti-rabbit HRP WB 1:20,000 Abbreviations: HRP, horseradish peroxidase; IC, immunochemistry; WB, western blot

14 dodecyl sulfate (LDS) Sample Buffer, NuPAGE® Transfer Buffer and NuPAGE® gel equipment were accordingly used by the manufacturer’s instructions.

1.1.11.b Protein markers

Precision Plus protein standards were purchased from Bio-Rad. Protein markers sizes ranged from 10 – 250 kD.

1.1.11.c Protein Membrane

Polyvinylidene Fluoride (PVDF) membrane was used to transfer proteins onto from protein gels. The PVDF used was obtained from Millipore.

1.1.11.d Protein G Sepharose beads

Immunoprecipitation of antibody-protein complexes were performed using Protein G Sepharose beads obtained from GE Healthcare.

1.1.12 Immunochemical materials

Hoechst 33258 and TO-PRO®-3: Invitrogen Mouse-On-Mouse (M.O.M.™) Blocking Reagent: Vector Laboratories ProLong® Antifade Mounting Medium: Molecular Probes

1.1.13 Miscellaneous materials

Tissue culture grade plates, wells and falcon tubes: Falcon and Corning Coverslips and glass slides: Menzel-Glaser Superfrost® Plus slides: ThermoFisher Scientific

1.2 Methods

1.2.1 Molecular Biological Techniques

1.2.1.a Restriction endonuclease digestion of DNA

Plasmid DNA was digested with 4 units of enzyme per 1 μg of DNA for 1-6 hours. All restriction digestions were carried out in the appropriate buffer and temperature as recommended by the manufacturer. Plasmid and genomic DNA was assayed for complete digestion by TAE agarose gel electrophoresis.

1.2.1.b Agarose gel electrophoresis

0.8%-2.0% agarose gels were used in the analysis of plasmid DNA and PCR products. The agarose powder was dissolved in boiling 1x TAE before the addition of EtBr to a final concentration of 0.5mg/mL. Gels were then set in horizontal gel boxes. One tenth the volume of Orange G loading dye was added to DNA samples and size markers before loading. DNA gels, immersed in 1x TAE buffer, were electrophoresed at 5V/cm for 40-70 minutes. The EtBr stained DNA was visualised by medium wavelength UV light and photographed using the Gel Doc System (BioRad) in conjunction with Quantity One-4.2.1 software.

1.2.1.c Preparation of RbCl2 competent cells

Five millilitres of Psi broth was inoculated with a single colony of DH5α strain bacteria and grown overnight at 37oC with shaking. Five hundred microlitres of overnight culture was used to inoculate 15mL of Psi broth. The culture was grown at o 37 C to an OD600 of 0.6. Five millilitres of bacteria were subcultured in 95mL of Psi o broth and grown to an OD600 of 0.6 at 37 C with shaking. Cells were poured into 40mL Oakridge tubes and chilled on ice for 5 minutes prior to centrifugation at 4000g for 5 minutes at 4oC. The supernatant was aspirated and the cell pellet was resuspended in 40mL of TFB1, left on ice for 5 minutes and centrifuged at 4000g for 5 minutes at 4oC. The supernatant was aspirated and the pellet was resuspended in

4mL of TFB2. After 15 minutes on ice 100μL aliquots were snap frozen in a dry ice/ethanol bath and stored at -80oC.

1.2.1.d Bacterial heat shock transformation

RbCl2 competent DH5α E.coli cells were thawed on ice for 5-10 minutes. Fifty microlitre aliquots were mixed with DNA (approximately 10ng of plasmid DNA; half of a ligation reaction) and left on ice for 30 minutes. The cell/DNA mixture was heat shocked for 2 minutes at 42oC and mixed with 1mL of Luria broth. Cells were allowed to recover by incubation at 37oC for 30 minutes and were pelleted by brief centrifugation in a microfuge at maximum speed. The majority of the Luria broth was removed, leaving around 100μL, and cells were resuspended and plated on Luria broth plates containing 100μg/mL ampicillin.

1.2.1.e Large scale (Maxi) plasmid preparation

Five hundred millilitres of Luria broth containing 100μg/mL ampicillin was inoculated either with a single bacterial colony of 5mL from an overnight culture, and incubated overnight at 37oC in an orbital shaker. The cells were harvested by centrifugation at 4000g for 5 minutes at 4oC, and the bacterial pellets drained. Plasmid DNA was extracted using the QIAGEN Plasmid Maxi Kit according to the manufacturer’s instructions. Yield and quality of plasmid DNA was determined, at wavelengths of 260nm and 280nm, using a spectrophotometer.

1.2.1.f Ethanol Precipitation

Samples were precipitated in 1/10 volume of 3M NaAc (pH 5.2) and 2 volumes of 100% ice cold ethanol at -20oC for 20 minutes. The samples were then centrifuged at 12000g for 20 minutes. The pellet was subsequently washed in 70% (v/v) ethanol and air-dried for 10 minutes before resuspending in 1x TE.

1.2.1.g Automated capillary sequencing of plasmid DNA

One hundred nanograms per 100bp of plasmid DNA was subjected to cycle sequencing in the presence of 25ng of primer, 1μL Big Dye terminator mix (PE Biosystems), 3.5μL of 5x ABI dilution buffer in a total volume of 20μL. The reaction was cycled through the following steps 25 times:

Step 1: 96oC for 30 seconds Step 2: 50oC for 15 seconds Step 3: 60oC for 4 minutes

Completed reactions were precipitated for 15 minutes in 80μL of 75% isopropanol at room temperature. DNA was pelleted for 20 minutes at 12000g, washed in 250μL of 75% isopropanol, re-centrifuged for 5 minutes and air dried. Reactions were analysed at the DNA Sequencing Facility, University of New South Wales, Sydney, Australia, and viewed on the Seqman II program (DNASTAR).

1.2.1.h Cell culture

Human Embryonic Kidney (HEK) 293T cells (a gift from Urban Lendahl) were maintained in GIBCO® Dulbecco’s Modified Eagle Medium (DMEM, Invitrogen) supplemented with 10% fetal calf serum (FCS), L-glutamine, sodium pyruvate and

50U/mL penicillin/streptomycin, at 37°C under 5% CO2.

1.2.1.i Luciferase Assay

Approximately 24 hours prior to transfection, 7 x 104 HEK 293T cells were seeded onto 12-well plates so that the culture was approximately 80% confluent on the day of transfection. The Nodal-ASE luciferase transcriptional reporter assay using lipofectamine and Plus reagent as described by the manufacturer (Invitrogen, USA), was performed on Tgfb1-responsive HEK 293T cells that were co-transfected with expression vectors containing HA-Cited2, FLAG-Smad2, Myc-Foxh1 and/or

18 constitutively active Tgfbr1; and firefly (Nodal ASE) and Renilla (CMV) luciferase reporters. For experiments involving Tgfbr1, luciferase activity was assayed 36 hours after transfection. For experiments involving exogenous application of growth factor (Tgfb1), 20 hours post-transfection cells were serum-starved for 2 hours by reduction of the concentration of fetal calf serum in the culture medium to 0.2%, and then incubated with or without recombinant Tgfb1 (0.1 ng/ml; R&D Systems) for a further 12-18 hours prior to luciferase assay. A concentration of 0.1 ng/mL of Tgfb1 to stimulate cells was determined by a dose response assay – it represented the concentration that allowed either repression or transactivation of luciferase reporters by Cited2 to be observed. Cells were harvested to determine luciferase activity using a FLUOstar OPTIMA luminometer (BMG Labtech, GmbH, Germany) and the Dual- Luciferase Reporter 1000 Assay System (Promega, Madison, WI, USA). These experiments were performed in triplicate.

1.2.1.j Protein (Western) Blots

Whole placentas were dissected out with careful attention given to removing as much of the maternal decidua to prevent contamination with unwanted cells. The placentas were weighed and snap frozen in liquid nitrogen. Five millilitres of solubilisation buffer (20mM Tris-HCl pH 7.2, 1mM EDTA, 1mM EGTA, 1mM Na3VO4, 10mM β- glycerophosphate, 5mM NaF, 1mM DTT, 0.27M sucrose, 1% Triton X-100, 0.5% NP-40, 1x Roche complete protease inhibitors – EDTA, 1x PhosSTOP © phosphatase inhibitors supplemented further with aprotinin, leupeptin, benzamidine, PMSF and pepstatin) was added to every gram of placental tissue. Subsequently, placentas were homogenised using a PRO200 hand-held electric homogeniser (PRO Scientific, Connecticut, USA) at 4oC. Homogenates were then passed through an insulin needle/syringe (BD Biosciences, Franklin Lakes, NJ, USA) spun at 16.1rcf for 15 minutes at 4oC to remove cellular debris. A Bradford assay was then performed to determine protein concentration by using the Pierce® BCA Protein Assay Kit (Thermo Scientific, Rockford, IL, USA). A total of 50μg of total protein with 1x LDS load buffer was loaded on either a 4-12% Bis-Tris or 7% Tris-Acetate

NuPAGE® gradient gel (Invitrogen, USA) in combination with the appropriate running buffers to obtain adequate separation of protein bands. Proteins were transferred from the gel onto PVDF membranes and then incubated in blocking solution (5% skim milk, 1x TBS) for 1hr to block non-specific sites. Membranes were subsequently incubated in primary antibodies in appropriate dilutions (1% skim milk, 1x TBS, 0.05% Tween-20) (TBST) for 1hr or overnight at 4oC. Following this, membranes were washed 3x in TBST, once in 1xTBS, then incubated with appropriate HRP conjugated secondary antibodies diluted in TBST for 1 hr at room temperature. After incubation in secondary antibodies, membranes were again washed 3x in TBST, once in 1xTBS, then probed with Supersignal® West Pico Chemiluminescent Substrate (Thermo Fisher Scientific, IL, USA) for 5 minutes. Films were overlayed onto the membrane at various exposure times and were then developed using a developer.

1.2.1.k Immunoprecipitation

HEK 293T cells were co-transfected with HA-Cited2 and Myc-Foxh1 expression vectors as per the instructions of the manufacturer (Invitrogen). The culture media was aspirated and the cells washed twice in 1x PBS prior to scraping into eppendorf tubes. Cells were lysed with ice cold cell lysis buffer (20mM HEPES pH 7.8, 150mM KCl, 2mM EGTA, 1% CHAPS, 1x complete protease inhibitors (Roche), 1mM PMSF, 1x phosphatase inhibitors) in ice for 30 minutes with intermittent physical dissociation of cells using a pipette. The lysate was cleared of cellular debris by centrifugation at maximum speed for 15 minutes at 4oC. A fraction of the supernatant was kept as an input control, with the rest incubated with the desired antibodies gently rotating overnight at 4oC. Subsequently, 50μL of pre-prepared protein G sepharose beads (GE Healthcare) was added per 1 mL of the lysate/antibody mixture and allowed to rotate gently for 2 hours at 4oC. The slurry was then allowed to settle by gravity in ice. The supernatant was kept as a control for appropriate pull down of antibodies, whilst the pellet containing the antibody- mediated pull down of protein complexes was washed with four times with wash

20 buffer (1% Triton X-100, 150mM NaCl, 50mM HEPES pH 7.5, 5mM EDTA and 0.05% (w/v) SDS) at 4oC. Following the last wash lysates were centrifuged at maximum speed for 5 minutes at 4oC, subsequently the pellet was resuspended in LDS loading buffer, heat denatured at 70oC for 10 minutes and loaded on NuPAGE® gradient gel (Invitrogen, USA) for western blotting. Western blotting was performed as described above.

1.2.2 Mouse lines and embryological techniques

This research was performed following the guidelines, and with the approval, of the Garvan Institute of Medical Research/St. Vincent’s Animal Experimentation Ethics Committee. All lines were housed in the Biological Testing Facility in the Garvan Institute of Medical Research, Sydney and subsequently in the Victor Chang Cardiac Research Institute, Sydney on a perpetual 12 hour light/dark cycle at 23oC and kept under the animal ethics numbers. Males and females were separately caged unless needed for specific breeding purposes and fed ad libitum.

1.2.2.a Gene targeted mouse lines

Cited2 mouse lines The Cited2ΔlacZ mouse line was obtained from the National Institute of Medical Research, London. It was created by Juan Pedro Martinez Barbera who replaced the entire coding region of the Cited2 gene (i.e. exon 2) with a cassette containing a lacZ reporter gene (Martinez-Barbera et al., 2002). This line was maintained on C57BL/6;129 hybrid genetic background which had been backcrossed onto the C57/B6 background. Heterozygous intercrosses produced wildtype (Cited2+/Cited2+), heterozygous (Cited2ΔlacZ/Cited2+) and null (Cited2ΔlacZ/Cited2ΔlacZ) embryos.

The Cited2F mouse line was created by Jost Preis at the Victor Chang Cardiac Research Institute, Sydney. In this construct two loxP sites flank the Cited2 locus.

Consequently, upon Cre-recombinase expression, the two loxP sites recombine and the intervening DNA becomes deleted. Excision of the Cited2 locus results in the lacZ reporter gene, normally 3’ to the Cited2 locus, becoming in frame and regulated by the endogenous Cited2 regulatory elements (Preis et al., 2006). This line was generated on a C57BL/6;129 hybrid genetic background, which were backcrossed onto the C57BL/6 background.

R26Rtg mouse The R26Rtg mouse line was obtained from Richard Harvey who imported this mouse line from Philippe Soriano, Fred Hutchinson Cancer Research Center, Washington. This allele was created by the targeted insertion of the lacZ gene into the ROSA26 locus; a locus which is ubiquitously expressed throughout the embryo. Within this locus a transcriptional termination sequence, which is flanked by loxP sites, precedes a lacZ reporter gene. This results in β-galactosidase activity in tissues which express Cre-recombinase (Soriano, 1999). This sub colony has been maintained as homozyotes, and are thought to have a mixed, C57BL/6;129, genetic background, with possibly more C57BL6.

1.2.2.b Transgenic mouse lines

Tie2-Cre mouse The Tie2-Cre mouse line has been previously described (Koni et al., 2001). Briefly, the transgene was created by placing the Cre-recombinase coding region under the control of the endothelial-specific receptor tyrosine kinase (Tek also known as Tie2, and hereinafter referred to as Tie2) promoter and enhancer regulatory elements (Schlaeger et al., 1997), to drive expression in haematopoietic and endothelial cells.

Tpbpa-Cre mouse The Tpbpa-Cre mouse line has been previously described (Simmons et al., 2007). The construct was created by placing a Cre-recombinase-IRES-EGFP cassette under

22 the influence of the Tpbpa promoter (Calzonetti et al., 1995), to drive Cre- recombinase expression in a subset of trophoblast cells in the placenta.

1.2.2.c Genotyping

Preparation of DNA from mouse tails DNA was extracted from all mice by tail biopsy of approximately 3mm in length. This tissue was lysed in 500μL murine tail DNA lysis solution containing Proteinase K (0.5mg/mL) at 55oC overnight. Any undigested tissue was removed by centrifugation for 5 minutes at 12000g. Following centrifugation, the sample was precipitated with an equal volume of isopropanol and centrifuged for 5 minutes. The sample was then washed in 70% ethanol and air dried at room temperature for 15 minutes. Prior to PCR, the DNA was resuspended in 300μL of milliQ water at room temperature.

Preparation of DNA from mouse embryos The yolk sac, or part thereof, was removed and rinsed in milliQ water prior to digestion in 40μL of Yolk sac DNA lysis solution containing 5mg/mL of Proteinase K for one to twelve hours at 55oC. Prior to Proteinase K heat inactivation at 95oC for 5 minutes, any remaining undigested tissue was removed by centrifugation for 5 minutes, prior to Proteinase K heat inactivation at 95oC for 5 minutes.

Screening mouse lines and embryos using the polymerase chain reaction Polymerase Chain Reaction (PCR) was used to genotype the various mouse lines and cross lines.

The different lines were genotyped by amplifying the various loci as described in Table 1.5. The primer sequence used to amplify these loci has been described in Table 1.2. All genotyping results were verified by amplifying the Cited2 loci as a positive control.

All PCR amplifications were amplified in a 20μL reaction containing 0.5U of Taq DNA polymerase (Roche # 1 647 687), 10x PCR buffer (Roche # 1 647 687) with a final concentration of 1.5mM MgCl2, 1μM of each primer and 0.25mM of each

Table 1-5 Primers and PCR programs used to genotype the various mouse lines

Primer pair (PCR Mouse line Locus PCR program product size) Cited2F Cited2 that flanks Cited2ΔlacZ/Cited2+; the 5’ loxP sites 310 and 311 Tie2-Cre Tails and (166bp and 210bp) Cited2ΔlacZ/Cited2+; Cited2F Tpbpa-Cre Cited2ΔlacZ Cited2ΔlacZ/Cited2+; 268 and 270 Tie2-Cre Cited2ΔlacZ Tails (500bp) Cited2ΔlacZ/Cited2+; Tpbpa-Cre Tie2-Cre 412 and 413 Cited2ΔlacZ/Cited2+; Cre-recombinase Tails (300bp) Tie2-Cre Tpbpa-Cre Tpbpa-Cre- 713 and 714 Cited2ΔlacZ/Cited2+; Tpbpa-Cre recombinase (200bp) Tpbpa-Cre 310 and 316 Cited2FΔ Deleted Cited2F Tails (410bp)

24 dNTP. Table 1.6 describes the denaturation, annealing and extension specifications for the various PCR programs.

1.2.2.d Embryo and placenta dissections

Embryos and placentas were dissected as described in (Hogan et al., 1994). In brief, after the detection of the vaginal plug, pregnant females were sacrificed on the appropriate day. Females were dissected to reveal the uterine horns, which were then placed in PBS. The deciduas were removed from the uterus by making longitudinal tears adjacent to each decidua and carefully sliding them out. The deciduas were then placed in M2. In early conceptuses, the deciduas appeared pear-shaped with the embryo lying in the narrow end. In this instance, the embryo was freed by making a circular incision around the narrow base, whilst keeping the developing placenta at the broad end intact for further study. Once the embryo was free, the Reichert’s membrane was removed. In older conceptuses, the decidua surrounding the embryo is reduced, making the embryo visible and able to be freed with greater ease. The yolk sacs were biopsied and washed in 1x PBS for genotyping, and subsequently embryos were separated from the placenta by severing the umbilicus. Mouse embryos were staged using morphological structures.

1.2.3 Histology

1.2.3.a Embedding placentas, sectioning and processing slides

Paraffin embedding and sectioning

Placentas were fixed overnight in 4% PFA and then serially dehydrated once in 70%, twice in 80%, twice in 90% and three times in 100% ethanol washes. Placentas were transferred to xylene, washed three in paraplast at 55oC for 30 minutes and allowed to equilibrate, and finally orientated. Embedded placentas were left overnight prior to sectioning at 7μm using a Leica DSC1 microtome.

Table 1-6 PCR program specifications for the various genotyping protocols

PCR Program Temperature (Step) Time Tails 96oC (denaturation) 1 minute 96oC (denaturation) 30 seconds 58oC (annealing) 30 seconds 72oC (extension) 30 seconds 72oC (extension) 10 minutes

Tpbpa-Cre 94oC (denaturation) 2 minutes 94oC (denaturation) 15 seconds 56oC (annealing) 20 seconds 72oC (extension) 30 seconds 72oC (extension) 10 minutes All PCR programs were cycled for an extra 34 times between the second denaturation step and the first elongation step.

Cryo embedding placentas and sectioning

Placentas were fixed in 4% PFA at 4oC overnight with rocking for RNA in situ hybridisation, or fixed in 1% PFA for one hour with rocking for X-Gal staining. Subsequently, the tissue was infused in 30% sucrose until the placenta had sunk. The placentas were then equilibrated in OCT for 15 minutes, and subsequently placed in moulds filled with OCT. The OCT embedded placentas were snap frozen in liquid nitrogen frozen N-hexane. Embedded placentas were equilibrated to -20oC prior to sectioning at 10μm using a Leica JUNG CM 300 cryostat (chamber temperature: - 20oC; object temperature: -17oC).

Processing slides Paraffin dehydrated sections were dewaxed by 2x 20 second xylene washes. If sections were to be counterstained they were rehydrated in a 100% ethanol, then 2x 70% ethanol washes each lasting 20 seconds before equilibration in water. All sections, paraffin or cryosections, were then counterstained in eosin for 1-2 minutes and then quickly dehydrated in ethanol by dipping in 70% and then 100% ethanol. Prior to depex mounting, sections were equilibrated by two quick dips in xylene.

1.2.3.b Periodic Acid Schiff Staining

Placental sections pre-fixed in 4% PFA were dewaxed and rehydrated prior to incubation with either TBS or a solution of fresh saliva and TBS in a ratio of 1:1 for 2 hours at 37oC. Following incubation, slides were then treated in 0.5% periodic acid for 5 minutes at room temperature. Subsequently, slides were washed 3x in distilled water and then immersed in Schiff’s reagent (0.5% pararosaniline chloride, 0.15M

HCl, 0.425% K2S2O5) for 15 minutes at room temperature. After this, slides were rinsed in 0.55% K2S2O5 to remove excess Schiff’s reagent, and washed in distilled water to develop the colour. Haematoxylin (Sigma) was used to counterstain and visualise nuclei. Following this, sections were dehydrated through an alcohol series then made hydrophobic with xylene washes in order to be mounted using Depex

27 resin. Digital photographs were taken of three central sections, indicated by the presence of the umbilicus in the section, of each placenta. The NIH Image software, ImageJ, was used to measure the areas of interest in each section. For each placental section, the area was measured for the whole placenta and the junctional zone. Since the total size of Cited2 null and conditional null placentas were reduced compared to their respective controls, the area of the placental layers was represented as a percentage of the total placental area.

1.2.3.c X-Gal staining for β-galactosidase activity

Whole mount staining of embryos To visualise reporter gene expression, embryos were stained with X-Gal solution post dissection. Embryos were fixed in X-Gal fixative, washed twice in filtered X-Gal wash buffer for 10 minutes, and stained in freshly prepared filtered X-Gal stain at 37oC protected from light. After X-Gal staining embryos were photographed, fixed in 4% PFA for 10 minutes, followed by eight-ten hours in Bouin’s fixative and subsequently processed for wax histology.

X-Gal staining of cryosections Sections were fixed for two minutes in X-Gal fixative and subsequently washed twice for two minutes in wash buffer. Sections were stained at 37oC in X-Gal stain. The colour was then fixed at 4oC for 10 minutes in X-Gal fix solution and washed briefly in wash buffer. Subsequently sections were washed in water for 5 minutes and stained in 1% eosin for 20 seconds. The slides were then processed for mounting as described.

1.2.3.d Section RNA in situ hybridisation

Synthesis of Riboprobes Twenty-five micrograms of plasmid DNA was linearised with the appropriate restriction enzyme, as indicated in Table 1.1, in a 200μL reaction volume. The

28 linearised DNA was purified by phenol extraction followed by ethanol precipitation. The resulting pellet was resuspended at 0.5mg/mL in RNA quality MilliQ water. In vitro transcription was subsequently performed in a 50μL reaction containing: 2.5μg template DNA; 40U RNasin (Promega); 1x Transcription buffer (Ambion, matched to each respective polymerase); 50U of polymerase; 0.5mM each of GTP, ATP and CTP, 0.32mM UTP and 0.18mM DIG-11-dUTP. The in vitro transcription assay was performed at 37oC for 2 hours. Chromaspin 100 DEPC columns (Clontech) were then pre-spun at 500g for 3 minutes. The samples were loaded onto the columns and the products were collected in RNase-free tubes by spinning at 500g for 5 minutes. Probes were stored in aliquots at -80oC for up to 3 years. Table 1.1 describes the plasmid, source, enzyme used to linearise the plasmid and the polymerase used to transcribe the RNA.

Section RNA in situ hybridisation Slides containing placental cryosections were equilibrated at room temperature, and then incubated in 10μg/mL of Proteinase K (50mM Tris-HCl pH 7.5, 5mM EDTA) for 2 minutes. The digestion was stopped by washing the sections in freshly prepared 0.2% glycine (in 1x PBS) for 30 seconds and then washed twice in 1x PBS. The sections were re-fixed in 4% PFA (1x PBS) for 15 minutes and then washed twice in 1x PBS in RNase-free coplin jars. The sections were then prehybridised in hybridisation solution at 65-70oC for one hour in a humidifier (1x salts and 50% formamide). After which, sections were incubated overnight at 65-70oC in hybridisation solution containing denatured probe (0.1-1μg/mL) in a humidifer. The following day sections were washed in wash solution at 65-70oC, once for 15 minutes and a further two washes each for 30 minutes in duration. Subsequently, sections were washed twice in 1x MABT supplemented with 100mg of levamisole per 200mL of MABT solution for 30 minutes at room temperature. Sections were then blocked using 2% blocking reagent (levamisole, 20% heat inactivated sheep serum, 1x MABT) to block endogenous alkaline phosphatase for at least 1 hour at room temperature. Following this, sections were then incubated overnight in anti-DIG AP FAB fragments at a dilution of 1:1000 in 2% blocking reagent (20% heat inactivated 29 sheep serum, 1x MABT) overnight in a humidified chamber at room temperature. The following day, sections were washed 4-5 times each for 20 minutes with 1x MABT supplemented with levamisole to remove excess antibodies. Sections were washed twice for 10 minutes at room temperature in alkaline phosphatase staining buffer (NTMT) with levamisole prior to incubation in NBT/BCIP stain in a humidifier at 37oC in the dark. The reaction was stopped by washing the sections twice in PBT (1mM EDTA). Subsequently, sections were washed in water for 5 minutes, counterstained with 1% eosin, dehydrated in 70% ethanol, twice in 100% ethanol, dipped in xylene and finally mounted in Depex mountant. Digital photographs were taken of three central sections, indicated by the presence of the umbilicus in the section, of each placenta. The NIH Image software, ImageJ, was used to measure the areas of interest in each section. For each placental section, the area was measured for the whole placenta, the labyrinth and the junctional layers. Since the total size of Cited2 null and conditional null placentas were reduced compared to their respective controls, the area of each placental layer was represented as a percentage of the total placental area.

1.2.4 Immunochemistry

1.2.4.a Immunocytochemistry

HEK 293T cells were grown on coverslips and co-transfected with HA-Cited2 and Myc-Foxh1 expression vectors using lipofectamine and Plus reagent as described by the manufacturer (Invitrogen, USA). Cells were rinsed twice with 1x PBS and fixed for 15 minutes in 4% paraformaldehyde. The fixative was removed and excess aldehyde groups were quenched by incubating the cells in 150mM glycine (1x PBS) for 15 minutes at room temperature. Glycine was aspirated, the cells rinsed twice in 1x PBS and then blocked for 30 minutes in blocking solution (5% BSA, 0.3% Triton X-100 and 10% goat serum in 1x PBS). Subsequently, cells were incubated with primary antibody in blocking solution for 1 hour at room temperature or overnight at 4oC. The cells were extensively washed in 1x PBS and incubated in the dark with

30 fluorochrome-conjugated secondary antibody in blocking solution for 45-60 minutes. Cells were washed three times in 1x PBS, incubated in Hoechst 33258 (Invitrogen) nucleic acid stain for 10 minutes at room temperature in the dark, and then washed once in 1x PBS prior to mounting in ProLong® antifade mounting medium (Molecular Probes) on a slide. Primary antibodies were polyclonal rabbit anti-β- galactosidase (Abcam; diluted 1:100), rat anti-Pecam1 (BD Pharmingen; diluted 1:200) and monoclonal mouse anti-αSMA (Dako CytoMation; diluted 1:100). Secondary antibodies were donkey anti-rabbit Alexa Fluor 488 (Molecular Probes; diluted 1:500), donkey anti-rat Cy5 (Jackson Immunoresearch; diluted 1:500) and donkey anti-mouse Cy3 (Jackson Immunoresearch; diluted 1:500). Cells were analysed at room temperature by microscopy using the Zeiss Axiocam MRm connected to the upright microscope Axio Imager M1 with a Plan Apochromat 40× differential interference contrast objective. Images were processed using AxioVision software. Pictures were processed and assembled using ImageJ and Adobe Photoshop CS.

1.2.4.b Immunohistology and quantification of Pecam1-positive endothelial cells and αSMA-positive mural cells in the mouse placental labyrinth

Placentas were cryosectioned as described above. Sections were washed three times in 1x PBS, then simultaneously blocked and permeabilised in M.O.M.™ Blocking Reagent (Vector Laboratories) (0.1% Triton X-100 in 1x PBS) for 1 hour at room temperature in a humidified chamber. Sections were subsequently washed three times in 1x PBS, and then incubated in primary antibodies (1% BSA in 1x PBS) in a humidified chamber for 1 hour at room temperature or overnight at 4oC. Primary antibodies were removed and the sections washed three time in 1x PBS to eliminate residual antibodies. Following this, sections were incubated in fluorochrome- conjugated secondary antibodies (1% BSA in 1x PBS) in a humidified chamber for 1 hour at room temperature in the dark. Sections were washed three times in 1x PBS, incubated in either Hoechst 33258 or TO-PRO®-3 (Invitrogen) nucleic acid stain for 10 minutes at room temperature in the dark, and then washed once in 1x PBS prior to

31 mounting in ProLong® antifade mounting medium (Molecular Probes). Primary antibodies were rat anti-Pecam1 (BD Pharmingen; diluted 1:200) and monoclonal mouse anti-αSMA (Dako CytoMation; diluted 1:100). Secondary antibodies were donkey anti-mouse Alexa Fluor 488 (Molecular Probes; diluted 1:500), donkey anti- rat Cy3 (Jackson Immunoresearch; diluted 1:500). Sections were imaged by confocal laser-scanning microscopy using either a Zeiss 700 scan head on an upright Axio Imager Z1 microscope or a Zeiss 710 scan head on an inverted Axio Observer Z1 microscope. Images were acquired using ZEN 2009 software (Zeiss). Pictures were then processed and assembled using ImageJ and Adobe Photoshop CS, respectively. Acquisition and quantification of stained placenta sections was performed as follows. Spectral images encompassing 417 nm to 729 nm were acquired using the 710 Quasar detector with the 10x objective and 488, 561 and 633 lasers. Typically, a 10 x 5 tile scan in combination with 5 plane z-stack was required to acquire fluorescence from the entire placenta section. The resulting spectral data were subjected to linear unmixing using predefined reference spectra for Alexa-488, Cy3 and Cy5 obtained from mono-labelled samples using the ZEN 2009 software. The resulting 3-channel tiled z-stack was then maximally-projected using ImageJ to obtain a single 3-channel image of the entire placenta. Background was removed from the image by subtracting the average pixel intensity in a region outside the placenta from the entire image. The amount of Pecam1-positive endothelial cells and αSMA-positive mural cells in the labyrinth were quantified by the measuring the intensity of each and normalising to the area of the labyrinth.

Chapter 2: Cited2 potentiates Nodal signalling in patterning the left-right body axis

2.1 Cited2 is an important transcriptional co-factor in organogenesis

Cbp/p300-interacting transactivators, with Glutamic acid [E]/Aspartic acid [D]-rich carboxy-terminal domain 2 (Cited2) encodes a transcriptional co-factor whose locus maps to chromosome 10 in the mouse, and chromosome 6 in humans (www.ensembl.org). Cited2 is a 269 amino acid protein encoded by a single protein coding exon (Leung et al., 1999, Shioda et al., 1997). The homologous human and mouse Cited2 are very similar to one another, sharing 80% nucleotide identity and 99% amino acid sequence (Han et al., 2001). The promoter region of Cited2 contains binding sites for E26 avian leukemia oncogene 1, 5' domain (Ets1) and trans-acting transcription factor 1 (Sp1) (Han et al., 2001). Upstream of this, it also has trimeric hypoxia inducible factor-1 (HIF1) binding sites (Bhattacharya et al., 1999).

Cited2 belongs to the Cbp/p300-interacting transactivators, with Glutamic acid [E]/Aspartic acid [D]-rich carboxy-terminal domain (CITED) gene family encoding transcriptional co-factors that do not bind DNA. The CITED family is comprised of: Cited1 (also known as Msg1), Cited2 (also known as Mrg1), Cited3 (not expressed in mammals) and Cited4. They are characterised by two protein domains termed conserved region one (CR1) and conserved region two (CR2). These protein motifs are highly conserved, and unique to CITED proteins as these motifs are non- homologous to any other protein domains. The CR2 domain of Cited2 confers binding to the homologous acetyltransferases, Creb-binding protein (Crebbp also known as CBP, and hereinafter referred to as CBP) and E1A binding protein p300 (Ep300 also known as p300, and hereinafter referred to as p300), which both act as activators of transcription and are commonly referred together as CBP/p300 (Bhattacharya et al., 1999, Chan and La Thangue, 2001). Cited1 and Cited4 are also shown to interact with CBP/p300 (Bhattacharya et al., 1999, Braganca et al., 2002, Yahata et al., 2000).

Physical association with CBP/p300 is important for the CITED family function, including Cited2, as it imparts its dichotomous role as both a negative and positive

34 transcriptional regulator. Despite its inability to bind DNA, Cited2 is able to activate transcription of target genes and reporter genes, through synergistic interaction with CBP/p300 and other factors such as: LIM homeobox protein 1 (Lhx1) and LIM homeobox protein 2 (Lhx2); transcription factor AP-2 (Tcfap2); peroxisome proliferator activated receptor alpha (Ppara) and peroxisome proliferator activated receptor gamma (Pparg); and MAD homolog 2 (Drosophila) (Smad2) and MAD homolog 3 (Drosophila) (Smad3) (Bamforth et al., 2004, Braganca et al., 2003, Chou and Yang, 2006, Glenn and Maurer, 1999, Tien et al., 2004, Yahata et al., 2001). Mediated by CBP/p300-dependent mechanisms, Cited2 is also capable of negative transcriptional regulation by binding and squelching CBP/p300 from other transcriptional co-factors. It is shown that Cited2 can compete with hypoxia inducible factor 1, alpha subunit (Hif1a) for binding to CBP/p300 (De Guzman et al., 2004, Freedman et al., 2003) to affect Hif1a target gene expression (Bhattacharya et al., 1999, Yin et al., 2002). Moreover, Cited2 is also shown to contend with Ets1 for CBP/p300 association (Yokota et al., 2003).

As illustrated, Cited2 is functionally versatile acting either as an activator or repressor of gene transcription, which is context-dependent contingent on its biochemical association. Cited2 is widely expressed in the embryo (Dunwoodie et al., 1998, Weninger et al., 2005). It is a developmentally important transcriptional molecular effector as its genetic knockout reveals a range of developmentally affected organs including: the adrenal glands, heart, neural crest cells, neural tube (Bamforth et al., 2001, Bamforth et al., 2004, Martinez-Barbera et al., 2002, Weninger et al., 2005, Yin et al., 2002); eye (Chen et al., 2009, Chen et al., 2008); gonads (Buaas et al., 2009, Combes et al., 2010); liver (Chen et al., 2007, Qu et al., 2007); lungs (Xu et al., 2008) and placenta (Withington et al., 2006). In fact, to further illustrate how organogenesis is dictated by the proteins that interacts with Cited2, it is shown that Cited2 directly functions to interact with the liver-enriched transcription factor hepatic nuclear factor 4, alpha (Hnf4a) to drive fetal liver development (Qu et al., 2007). In addition to these defective organs, approximately half of Cited2 null embryos exhibit laterality

35 defects that are consistent with improper set up of the left-right (L-R) body axis (Bamforth et al., 2004, Weninger et al., 2005).

2.2 Establishing the left-right body axis

The vertebrate body plan can be divided into the: anterior-posterior (A-P), dorso- ventral (D-V) and L-R body axes. In development, the establishment of these orthogonal axes is important for organogenesis, as they are responsible for providing cues for downstream patterning of organs. Of these, the L-R aspect is the final axis to be determined. External appearances of body symmetry camouflages intrinsic asymmetry in structure and placement of internal organs with respect to the midline. This normal body arrangement is termed situs solitus. The origin of organ asymmetry is imputed to the proper establishment of the L-R axis. Bilateral symmetry is broken at the node with asymmetric expression of Nodal, a member of the transforming growth factor-beta (TGFb) family of diffusible cytokines, on the crown cells of the node (see following sections for detailed explanation of structures). The biased Nodal signal is transferred from the node to the left lateral plate mesoderm (LPM). Nodal expression and signalling is initiated in the left LPM and propagated along this entire tissue. Subsequently, the target genes of Nodal are also expressed and propagated along the left LPM where it acts to convey left information to the developing organs (Shiratori and Hamada, 2006). Errors in appropriate set up of the L-R axis can result in congenital birth defects known as laterality defects. In very rare circumstances, genetic disturbances can cause the complete reversal of organ assignment – this is referred to as situs inversus – and is a state that is still compatible with supporting life. However, other genetic anomalies can create isomeric organ compositions in which one side mirrors the other, and is a situation that is discordant with life. A malformed L-R axis commonly affects cardiac development as it takes its developmental cues from the left (Maclean and Dunwoodie, 2004). A point in case is a heart with both atrial identities assuming right-sided morphology – this is consistent with right isomerism and is highlighted here as it is pertinent to describing the Cited2 mutant in this thesis.

In the mouse, at about 8 days post coitum (dpc), symmetry is broken about the L-R axis within the transient structure of the node. The biased signals are disseminated between L-R pertinent tissues including the node, the LPM and the midline (consisting of the notochord and floorplate). Mechanisms to ensure breaking of symmetry in the node is contingent on various stimuli ranging from diffusible factors, ions and biophysical means that include: Notch signalling, Hedgehog signalling, calcium and motile cilia (Krebs et al., 2003, McGrath et al., 2003, Nonaka et al., 1998, Nonaka et al., 2005, Okada et al., 1999, Okada et al., 2005, Przemeck et al., 2003, Tabin and Vogan, 2003, Tanaka et al., 2005). Together these ensure the expression of the downstream asymmetric expression of Nodal. Nodal further acts downstream in the L-R asymmetric cascade, as it is expressed and propagated in the left LPM. In addition to this, Nodal is also vital in limiting the asymmetric cue to the left LPM to maintain the left bias. Subsequently, Nodal and its target genes including: left right determination factor 1 (Lefty1); left right determination factor 2 (Lefty2); and paired-like homeodomain transcription factor 2 (Pitx2) are propagated in the LPM. Pitx2 expression in the left LPM is used as positional cues by the developing organs. These embryonic tissues and associated molecular effectors important in L-R patterning are further discussed below.

2.2.1 The node

The A-P and D-V axes are established before the L-R axis. It is the responsibility of the node to integrate the A-P and D-V positional directives and translate this to the developing L-R axis. The node is a transient depression towards the ventral tip of the embryo that is evident between 7.5 -9.0 dpc (Figure 2.1). It is a cellular bilayer consisting of proliferative ectodermal cells on the dorsal side, and pit cells with crown cells lying laterally on the ventral side (Oki et al., 2007) (Figure 2.1). These layers are contiguous with the ectodermal and endodermal germ layers, respectively,

Figure 2.1 Schematic diagram of embryonic breaking of symmetry about the left-right body axis of the mouse. (A) Sagittal view of a symmetric 7.5 dpc embryo with the appearance of the node (purple) at the ventral tip of the embryo. The box underneath (A) depicts a cross section through the node from the posterior view. The node is a cellular bilayer consisting of pit cells (yellow oval cells) flanked by crown cells (blue oval cells) on the ventral side, and ectodermal cells (orange oval cells) on the dorsal side. These are continuous with the endoderm (green oval cells) and ectoderm germ layers of the embryo, respectively. Symmetry is broken in and around the node by motile primary cilia on the pit cells of the node. The beating of these cilia creates a leftward fluid flow of extraembryonic fluid that is necessary for asymmetric expression of Nodal in crown cells of the node. The laterality cue is transferred from the node through the paraxial mesoderm (PM) (grey) with the aid of sulfated glycosaminoglycans to the left lateral plate mesoderm (LPM) (blue stellate-like cells). (B) Sagittal view of an 8.0-8.5 dpc embryo highlighting the LPM (blue) where left-determinant genes such as Nodal, Lefty1, Lefty2 and Pitx2 are initiated and propagated to extend along this tissue to establish left, and the notochord and neural floorplate that make up the midline (green) and represents a barrier for left signals crossing over to the right and compromising left-right integrity. (C) Ventral view of the same 8.0-8.5 dpc embryo in (B) showing the spatial relationship between the node, LPM and midline structures. Abbreviations: A, anterior; P, posterior; L, left; R, right. This figure is adapted from Maclean and Dunwoodie, 2004 and Oki et.al., 2007.

of the mouse embryo (Figure 2.1). Motile primary cilia are present on the pit cells of the node tilted in an acute angle. These cilia beat in a clockwise direction to create a leftward fluid flow of extraembryonic fluid across the face of the node. This left directed fluid flow is necessary for breaking symmetry as it is required in generating the asymmetric expression of Nodal around the node (Nonaka et al., 1998, Nonaka et al., 2005, Okada et al., 1999, Okada et al., 2005). However, the precise manner in which leftward fluid flow establishes asymmetry remains elusive. Several studies have proposed a calcium-mediated chemosensory mechanism (McGrath et al., 2003, Tabin and Vogan, 2003). Aside from the motile primary cilia in the pit of the node, non-motile cilia are also found on the crown cells of the node that are thought to act in interpreting the leftward fluid flow, to subsequently signal the induction of asymmetric expression of left-sided determinant genes (McGrath et al., 2003, Tabin and Vogan, 2003). Alternatively, it is also suggested that retinoic acid- and sonic hedgehog (Shh)-containing vesicles are carried to the left of the node by the leftward flow, and upon fragmentation on the non-motile cilia causes calcium-dependent asymmetric gene expression (Nonaka et al., 2002, Tanaka et al., 2005). However, these mechanisms require further clarification. Establishment of asymmetry at the node is indicated by expression of Nodal on both sides of the crown cells of the node, with greater and biased expression on the left (Collignon et al., 1996, Lowe et al., 1996, Zhou et al., 1993). Upstream of this, Notch signalling is necessitated in ensuring Nodal asymmetric expression, as targeted gene disruption to mouse Notch gene homologue 1 (Notch1), Notch gene homologue 2 (Notch2) and Delta-like 1 (Dll1) lack Nodal expression in the peri-nodal region with concomitant randomised assignment of heart looping consistent with laterality defects (Krebs et al., 2003, Przemeck et al., 2003, Raya et al., 2003). This is corroborated by the finding that the node-specific enhancer (NDE) of Nodal contains binding sites for CSL (CBF1, Suppressor of Hairless, Lag-1) that is indispensable for peri-nodal expression of Nodal; the activated intracellular component of Notch receptors translocate to the nucleus and interacts with CSL to relieve its transcriptional repressing activity and thus induce target gene expression. Therefore, this indicates that L-R axis

40 determination through asymmetric Nodal expression in the node is a Notch- dependent phenomenon.

2.2.2 The lateral plate mesoderm and the midline

The asymmetric expression of Nodal in the crown cells of the node is a principal event that must take place for Nodal to be expressed in the left LPM (Brennan et al., 2002, Saijoh et al., 2003). Recently, it is shown that laterality cues are directly transferred from the node to the left LPM via the intervening paraxial mesoderm that is continuous with the node and the LPM (Oki et al., 2007) (Figure 2.1). Although it is not exclusively shown that Nodal is the factor that travels from the node to the LPM, given that Nodal is a secreted protein that can act over long distances (Chen and Schier, 2001, Sakuma et al., 2002), and it can induce its own expression in the left LPM (Yamamoto et al., 2003), Nodal is a good candidate for transferring laterality cues from the node to the LPM. It is shown indirectly that Nodal travels from the node to the left LPM through the paraxial mesoderm by interaction with sulfated glycosaminoglycans, as perturbations in the biosynthesis of sulfated glycosaminoglycans prevents Nodal expression in the left LPM (Oki et al., 2007).

With the transmission of the Nodal laterality cue from the node to the left LPM, Nodal itself initiates and propagates its own expression in the left LPM. Expression of Nodal in the left LPM is mediated by two regulatory elements, the asymmetric enhancer element (ASE) and the left side-specific enhancer (LSE) (Adachi et al., 1999, Norris et al., 2002, Norris and Robertson, 1999, Saijoh et al., 2000, Saijoh et al., 2005, Vincent et al., 2004). In the mouse, genetic ablation of either the ASE or LSE variably affects Nodal expression; deletion of the ASE results in perturbations in the asymmetric expression of Nodal and its targets and accordingly consequents in laterality defects; excision of the LSE moderately affects Nodal expression but does not overtly perturb the asymmetric expression of Nodal and its target genes or result in laterality defects (Norris et al., 2002, Norris and Robertson, 1999, Saijoh et al., 2005, Vincent et al., 2004). Therefore, this indicates that the ASE is the principal

41 regulatory element that establishes asymmetric expression of Nodal in the left LPM, with the LSE acting as an accessory element for ensuring maximal left-biased expression of Nodal in this embryonic tissue. Nodal binds activin A receptor, type 1B (Acvr1b also known as Alk4) and activin receptor IIB (Acvr2b) (Reissmann et al., 2001, Sakuma et al., 2002, Yeo and Whitman, 2001), and its co-receptors cripto,

FRL-1, cryptic family 1 (Cfc1) and teratocarcinoma-derived growth factor 1 (Tdgf1 also known as cryptic) (Yan et al., 2002, Yeo and Whitman, 2001), triggering phosphorylation of Smad2 and Smad3 (Jornvall et al., 2001, Macias-Silva et al., 1996, Sakuma et al., 2002, Yeo and Whitman, 2001, Zhang et al., 1996), which then associate with MAD homolog 4 (Drosophila) (Smad4) (Lagna et al., 1996, Zhang et al., 1996), and translocate to the nucleus (Zhang et al., 1997) (Figure 2.2). Here they form a complex with the forkhead box H1 (Foxh1 also known as Fast2) transcription factor (Labbe et al., 1998, Saijoh et al., 2000, Weisberg et al., 1998) on the ASE (Figure 2.2), which contains two Foxh1 binding sites that are necessary and sufficient for asymmetric gene expression (Saijoh et al., 2000). The result is the expansion of Nodal expression along the entire length of the left LPM, as it regulates its own expression in a positive feedback loop (Shiratori and Hamada, 2006, Yamamoto et al., 2003). In addition, Nodal also sets up the expression of its regulators to ensure it is not able to diffuse to the right domain of the embryo. It does so by inducing the expression of Lefty1 and Lefty2, both members of the TGFb superfamily of diffusible factors, in the left LPM (Meno et al., 1997, Saijoh et al., 2000). Lefty1 and Lefty2 exert their inhibitory effects by binding and squelching both Nodal and its co-receptor Tdgf1 (Chen and Shen, 2004, Cheng et al., 2004, Meno et al., 1998, Meno et al., 2001). Nodal also induces the expression of Pitx2 in the left LPM, which is an important transcription factor in left-side-specific morphogenesis of organs that are morphologically asymmetric in the embryo and that are also asymmetric in the way they develop such as the heart (Campione et al., 2002, Campione et al., 2001, Campione et al., 1999, Franco and Campione, 2003, Gage et al., 1999, Kitamura et al., 1999, Lin et al., 1999, Liu et al., 2001, Logan et al., 1998). The mechanism by which Pitx2 confers “leftness” to the developing viscera remains unknown.

Figure 2.2 Schematic diagram of Nodal molecular signalling in determining left. Nodal induces and propagates its own expression together with its target genes Lefty1, Lefty2 and Pitx2 in the left LPM to establish left. The diagram depicts the molecular events that govern this process. The diffusible Nodal factor binds to its coreceptors Cfc1/Tdgf1 that associate with Acvr1b. Subsequently, this complex triggers the assembly with Acvr2b, which activates the Acvr1b by phosphorylating its cytoplasmic domain. In turn, this activated receptor complex phosphorylates Smad2, which recruits and associates with Smad3 that together translocate into the nucleus where it interacts with Foxh1 (also known as Fast1). The Smad2/Smad3/Foxh1 complex binds to the asymmetric enhancer element (ASE) of Nodal to enhance its own expression in the left LPM (positive feedback loop). Target genes of Nodal such as Lefty2 and Pitx2 also contain Nodal-responsive ASE regulatory elements that drive their expression in the left LPM. Nodal-induced expression of inhibitory Lefty proteins regulates and restricts Nodal expression in the left domain to confer the left identity; they do so by competing with Nodal for binding to Cfc1/Tdgf1. This figure is adapted from Maclean and Dunwoodie, 2004.

The diffusible nature of many L-R molecular effectors necessitates an impediment to prevent their spurious migration to the right side domain, as failure to do this compromises the integrity of the developing L-R axis. This is substantiated in the frog and the zebrafish where excision of equivalent midline structures results in bilateral expression of Nodal homologues and reversed heart structures (Danos and Yost, 1996, Lohr et al., 1997). The midline structure of the mouse embryo, comprised of the notochord and neural floorplate, provides a similar barrier. Lefty1 is expressed in the midline (and weakly in the left LPM) and represents the inhibitory factor that impedes Nodal-induced laterality cues to restrict them to the left (Meno et al., 1997); Lefty1 antagonises the action of Nodal by binding to Nodal and its coreceptors (Chen and Shen, 2004, Cheng et al., 2004, Nakamura et al., 2006). The expression of Shh in the midline, and Nodal in the left LPM are requisite events that must occur for Lefty1 expression in the neural floorplate of the midline of the mouse (Tsukui et al., 1999, Yamamoto et al., 2003). In accordance with Lefty1 function in left-biased inhibition, Lefty1 null embryos display bilateral expression in the LPM of TGFb left-side determinant genes Nodal, Lefty2 and Pitx2, and consequents in left isomerism (Meno et al., 1998). Shh is vitally important in Lefty1 expression as it is required to pattern the notochord and neural floorplate that constitute the midline (Chiang et al., 1996). Embryos null for Shh or with disruptions to Shh signalling components have absent Lefty1 expression in the neural floorplate of the midline, consequently these embryos display bilateral expression of Nodal, Lefty2 and Pitx2 with concomitant left isomerism (Izraeli et al., 2001, Izraeli et al., 1999, Meyers and Martin, 1999, Tsukui et al., 1999).

2.3 Cited2 is required for left-right patterning

Cited2 is expressed in tissues that are key in patterning the L-R body axis. It is expressed within the pit of the node, as well as along the crown of the node with greatest expression in the caudal crown cells (Weninger et al., 2005). Cited2 is also expressed in the paraxial mesoderm and the lateral plate mesoderm, tissues vital in the L-R signalling cascade (Weninger et al., 2005). The first morphological sign of

46 breaking of symmetry about the L-R axis is indicated by heart looping in the embryo. This is subsequently followed by asymmetries in the lungs, liver, spleen, intestines and vascular system (Mine et al., 2008, Peeters and Devriendt, 2006). Cited2 null embryos exhibit laterality defects that are incompletely penetrant, achieving roughly 50% penetrance in C57BL/6J isogenic embryos (Bamforth et al., 2004, Weninger et al., 2005). These laterality defects are akin to right isomeric defects that include: reversely looped hearts, right atrial isomerism and right pulmonary isomerism. As outlined above, the asymmetric expression of left-determinant genes in the left LPM is used as positional cues by the developing organs, with Pitx2 conferring left identity to morphing viscera (Logan et al., 1998, Yoshioka et al., 1998). Accordingly, the left-sided determinant Nodal and its genetic targets Lefty1, Lefty2 and Pitx2 are not expressed in the left LPM to establish left in roughly one-third of Cited2 null embryos. It is noteworthy that coincident with the right isomeric hearts, Cited2 null embryos also show a spectrum of heart malformations that is fully penetrant. Together, the morphological defects and perturbations in molecular effectors indicate a lack of proper establishment of the L-R body axis in Cited2 null embryos. This indicates that Cited2 is important for L-R patterning that impacts heart development.

2.4 Aims and hypothesis

On account of Cited2 expression in L-R pertinent tissues; Cited2 null embryos exhibiting partially penetrant laterality defects; absence of left-determinant genes in the left LPM, together these indicate that Cited2 acts upstream of Nodal and other left-sided determinant genes in determining the L-R axis. It is shown that Cited2 interacts with Smad2 and Smad3 (Chou et al., 2006) that are important molecular effectors of the Nodal signal. Therefore, this places Cited2 as potentially important in either the initiation or propagation (or both) of laterality cues in the LPM. To this end, the aim of this chapter was to determine if Cited2 potentiated Nodal, and being a transcriptional co-factor shown in some circumstances to be a positive regulator of transcription it was hypothesised that Cited2 enhances Nodal signalling.

2.5 Results

2.5.1 Cited2 potentiates Nodal expression via the asymmetric enhancer element (ASE)

As outlined earlier, the ASE is the major regulatory element in specifying asymmetric expression of Nodal in the left LPM, with the LSE required for its maximum expression. It is also predicted that two potential Smad binding sites exist near the 3’ end Foxh1 binding site of the ASE (Saijoh et al., 2000). Given: the laterality defects seen in half of Cited2 deficient embryos; Cited2 expression in L-R patterning relevant embryonic compartments; and that Cited2 is shown to physically associate with Smad2 and Smad3, it was hypothesised that Cited2 acts via the ASE for the initiation of Nodal expression in the left LPM. The transcriptional output of the ASE can be measured in vitro using a Nodal ASE-luciferase reporter. To study the functional role Cited2 plays in Nodal signalling, Tgfb1-responsive human embryonic kidney (HEK) 293T cells were transiently transfected with the Nodal ASE-luciferase reporter and Foxh1 that is a prerequisite for Nodal ASE activity (Saijoh et al., 2000). Tgfb1 was used to initiate the Nodal signalling pathway instead of Nodal itself as it activates the same pathway, but has the advantage of signalling independently of the co-receptor Cfc1 that is not commonly present in established cell lines. Myc-tagged Foxh1 (Myc- Foxh1) with and without haemagglutinin-tagged Cited2 (HA-Cited2) were transiently co-transfected into HEK 293T cells in the presence or absence of Tgfb1 that stimulated the signalling pathway. FLAG-tagged Smad2 (FLAG-Smad2) was also transfected to ensure it was not a limiting component in the assay, as Smad2 is posited to complex with Foxh1 and assemble on the Nodal ASE (Saijoh et al., 2000). The concentration of exogenous Tgfb1 that gave a moderate robust induction of the signalling pathway was used to provide the system with the capacity to observe either an enhancement or reduction of the signal from the reporter. The presence of HA- Cited2 resulted in a modest but statistically significant increase in activity of the Nodal ASE-luciferase reporter, and this increase was further enhanced with exogenous Tgfb1 application (Figure 2.3), compare columns 1 and 3, and columns 5 and 7). This suggests that, as shown in other systems, Cited2 acts as a co-factor to

Figure 2.3 Cited2 potentiates transcriptional activation of Nodal ASE. (A) The Nodal ASE-luciferase reporter and six myc (Myc)-tagged Foxh1 (Myc- Foxh1) were transiently transfected into human embryonic kidney (HEK) 293T cells together with haemagglutinin-tagged Cited2 (HA-Cited2) and FLAG-tagged Smad2 (FLAG-Smad2) as indicated. Twenty hours post-transfection, cells were serum- starved and incub -18 hours where indicated prior to luciferase assay. (B) The Nodal ASE-luciferase reporter and Myc-Foxh1 were transiently transfected into HEK 293T cells together with HA-Cited2, FLAG-Smad2 and constitutively active TGFb receptor, Tgfbr1* as indicated, and luciferase activity determined 36 hours later. Assays were performed in triplicate, with error bars representing standard deviations. One-way analysis of variance was performed, and significance was determined using Tukey’s post hoc test. *** p<0.0001.

enhance transcription (Bamforth et al., 2001, Bamforth et al., 2004, Bhattacharya et al., 1999, Braganca et al., 2003, Chou et al., 2006, Chou and Yang, 2006, Glenn and Maurer, 1999, Tien et al., 2004, Yahata et al., 2001, Yokota et al., 2003). A second assay was performed where Tgfb1 was replaced with a constitutively active Tgfbr1 receptor (Nakao et al., 1997) (Figure 2.3). Here, addition of HA-Cited2 resulted in a statistically significant increase in ASE-luciferase activity (Figure 2.3 (B), compare columns 5 and 7), which was further enhanced when all the obligatory molecular effectors of the Nodal pathway were present (Figure 2.3 (B), compare column 8). Together, these data argue for Cited2 function in potentiating ASE-driven transcription.

2.5.2 Cited2 may interact with Foxh1 to indirectly potentiate Nodal expression

The Nodal ASE-luciferase reporter study above indicates that Cited2 can enhance Nodal expression via the ASE. Within the ASE are two Foxh1 binding sites that are required for ASE activity, as well as two predicted Smad binding sites near the 3’ end Foxh1 binding motif in the ASE (Saijoh et al., 2000). Foxh1 is a known binding partner of Smads, and together are important mediators of the TGFb superfamily signal (Attisano et al., 2001). Moreover, Cited2 is shown to interact with Smad2 and Smad3 that assemble on the matrix metallopeptidase 9 (Mmp9) promoter to enhance Tgfb1-mediated transcription (Chou et al., 2006). Therefore, to begin to understand the biochemistry of Cited2 in Nodal signalling, it was questioned whether Cited2 functionally associated with Foxh1.

To address whether Cited2 and Myc-Foxh1 form a complex, in vitro immunoprecipitation of Cited2 to see whether Foxh1 could be co-precipitated was performed. In parallel, to confirm that transfection of HA-Cited2 and Myc-Foxh1 into HEK 293T cells co-localised to the same cellular compartment for interaction, transiently tranfected HEK 293T cells were co-immunolabelled with antibodies towards HA and Myc. These experiments show that both HA-Cited2 and Myc-Foxh1 are transiently overexpressed and co-localise in the nucleus of HEK 293T cells,

52 though not all cells express both with some singly overexpressing HA-Cited2 or Myc-Foxh1 or neither in the nucleus (Figure 2.4). This sorting to the nuclear cellular compartment increases their likelihood of interacting, and is where they are expected to be found to exert their roles on DNA as transcription factors. For immunoprecipitation experiments, HA-Cited2 and Myc-Foxh1 were transiently overexpressed singly to act as controls (Figure 2.5, column 1 and 2) or in combination with one another (Figure 2.5, column 3 and 4) in HEK 293T cells. Lysates were prepared and an antibody against HA was used to pull down HA-Cited2 for immunoprecipitation experiments. Immunoblots show that prior to antibody pull down (input), HA-Cited2 and Myc-Foxh1 are successfully overexpressed in lanes that should express them (Figure 2.5). Following antibody pull down, lanes where HA-Cited2 was overexpressed were successfully pulled down (immunoprecipitate) (Figure 2.5, lane 1 and 3), whereas the HA antibody accordingly did not pull any proteins in control lanes that did not overexpress HA-Cited2 (Figure 2.5, lane 2). Similarly, the non-specific IgG control did not pull down HA-Cited2, which remained in the supernatant (Figure 2.5, lane 4). This suggests that the HA antibody can specifically pull down HA-Cited2. The same membrane was subsequently probed with an antibody against Myc to detect Myc-Foxh1. Pulldown of HA-Cited2 with HA revealed that Myc-Foxh1 was also co-precipitated (Figure 2.5 (A), column 3). However, a weaker band at the same level as Myc-Foxh1 was detected with immuno-pull-down using the non-specific IgG antibody (Figure 2.5 (A), lane 4). IgG antibodies are commonly found to non-specifically bind to proteins and to sides of tubes. Therefore, in order to ascertain whether the HA-Cited2/Myc-Foxh1 interaction (Figure 2.5 (A), lane 3) is true, the experiment was repeated with the inside lining of tubes coated with silicon. Also, following incubation with Protein G agarose beads, the lysate-Protein G slurry were transferred to new tubes to minimise non-specific proteins being pulled down (Figure 2.5 (B)). This removed the non-specific band equivalent in size to Myc-Foxh1 pulled down by the non-specific IgG antibody (Figure 2.5 (B), lane 4), but retained the Myc-Foxh1 pulled down specifically by HA- Cited2 (Figure 2.5 (B), lane 3). Together, and with further replications using silicon- coated tubes, this would suggest that Cited2 forms a 53

Figure 2.5 Cited2 is suggested to interact with Foxh1 HEK 293T cells were either transfected with either HA-Cited2 alone (lane 1), or Myc-Foxh1 alone (lane 2), or co-transfected with both HA-Cited2 and Myc-Foxh1 (lanes 3 and 4). Cell lysates were either pulled down using an HA antibody (lanes 1, 2 and 3), or with a non-specific IgG antibody control (lane 4). Lanes 1, 2 and 4 are control lanes. Immunoprecipitations were performed in (A) tubes not silicon-coated (n=2) (B) silicon-coated tubes to minimise proteins non-specifically sticking to the sides of the tube (n=1). The input represents a fraction of the cell lysate prior to antibody pull down, the supernatant depicts the proteins left in the buffer after antibody pull down, and the immunoprecipitate illustrates the proteins that the antibody has pulled down. Where doublets are seen, arrows indicate the band of interest, a single arrowhead represents non-specific detection of the denatured immunoglobulin (Ig) light chain, and double arrowheads depict non-specific detection of the denatured Ig heavy chain. Abbreviations: WB, western blot; IP, immunoprecipitating antibody.

transcriptional complex with Foxh1.

2.6 Discussion

This study demonstrates that Cited2 can potentiate Nodal-ASE activity. Notwithstanding the need to replicate the immunoprecipitation experiments above, it is also suggested that Cited2 may form a complex with Foxh1, whose binding sites are necessary and sufficient for Nodal-ASE activity (Saijoh et al., 2000). It is worthy to note that: Foxh1 is a known binding partner of Smads in transducing TGFb supefamily signals (Attisano et al., 2001); and Cited2 is shown to interact with both Smad2 and Smad3 in upregulating Tgfb1-mediated expression of Mmp9 (Chou et al., 2006). Together, it may be proposed that Cited2 interacts with Smads and Foxh1 to form a tripartite transcriptional complex, which acts via the Nodal-ASE to potentiate Nodal expression to ensure its asymmetric expression in the left LPM as left-sided cues for the developing organs. However, the evidence put forward here can only suggest this proposition indirectly. In order to show that Cited2 directly acts on the Nodal-ASE through interaction with Smads and Foxh1, the proposed triplet transcriptional complex must be shown to interact with the Nodal-ASE. This can be addressed through chromatin immunoprecipitation of the Nodal-ASE by the Cited2/Smads/Foxh1 assembly. In fact, these experiments are currently being optimised to address this.

To corroborate this proposed biochemical action of Cited2 in boosting Nodal expression, the relevant L-R tissues of the embryo with a requirement for Cited2 needs to be elucidated. Cited2 is shown to be expressed in L-R pertinent tissue compartments including: within the pit of the node as well as along the crown of the node having greatest expression in the caudal crown cells; the lateral plate mesoderm; and in the intervening paraxial mesoderm between the node and lateral plate mesoderm (Weninger et al., 2005). It is plausible that Cited2 is required in each of these tissues for correct establishment of the L-R body axis.

The compartments that need Cited2 function for L-R patterning can be addressed by spatially constrained deletion of Cited2 in each compartment. This can be done by specific transgenic mouse lines that allow Cre-recombinase-mediated deletion of the gene of interest. On account that Cited2 is expressed in and around the node (Weninger et al., 2005); phosphorylated forms of Smad2 and Smad3 are present within the node (Oki et al., 2007); Cited2 interacts with Smad2 and Smad3 (Chou et al., 2006), and Cited2 can augment Nodal signalling in a Smad2-dependent manner (Section 2.5.1), it is hypothesised that Cited2 function is required in the node. There exists a node-specific deleting Cre-recombinase mouse line which should facilitate this line of questioning. Briefly, Cre-recombinase is placed under the control of the node-specific enhancer (NDE) of Nodal (Brennan et al., 2002) which drives Cre- recombinase expression in the crown cells of the node (NDE-Cre) (Saijoh et al., 2003). The NDE-Cre can be mated with a mouse line harbouring a conditional null allele of Cited2 (Preis et al., 2006) and assessment of heart looping and Pitx2 expression, which is a regulator of left-side specific morphogenesis (Logan et al., 1998, Yoshioka et al., 1998), as a genetic readout of defective development should elucidate Cited2 function in the node. It is predicted that if heart loops are reversed and Pitx2 expression lost in conditional embryos to recapitulate the complete Cited2 null embryo, then that would suggest that Cited2 is required in the transient node. These experiments were conducted by Dr Lopes Floro in our laboratory. Deletion of Cited2 with NDE-Cre neither morphologically (heart loop) or molecularly (Pitx2 expression) affect the establishment of laterality (Lopes Floro et. al., under revision). This suggests that either: the activity of Cre-recombinase occurred too late in the node to address Cited2 function in the crown cells; or that Cited2 is not required in the Nodal-expressing crown cells of the node; or that Cited2 function is required in the pit cells of the node where NDE-Cre is not expressed.

Given Cited2 is expressed in the LPM, and that half of Cited2 null embryos have absent expression of left-sided determinant genes in the left LPM, it is plausible that Cited2 may also be required in the LPM to initiate and propagate laterality signals. In much the same way as addressing Cited2 function in the node discussed above, 59 conditional deletion of Cited2 in the LPM should also elucidate Cited2 function in the LPM. There exist two independent Cre-recombinase mouse lines, the MesP1Cre and Lefty2 3.0-Cre, which can both widely delete Cited2 in mesodermal cells including the LPM (Saga et al., 1999, Saijoh et al., 2003, Yamamoto et al., 2003). Generation of the MesP1Cre allele involved replacement of a part of exon 1 and the whole of exon 2 of the mesoderm posterior 1 (MesP1) gene by a Cre-recombinase cassette (Saga et al., 1999). In doing so, this rendered the locus MesP1 null, with the allele expressing Cre-recombinase under the control of MesP1 regulatory elements (Saga et al., 1999). Meanwhile, creation of the Lefty2 3.0-Cre allele entailed engineering Cre- recombinase under the control of Lefty2 enhancer elements to drive Cre-recombinase expression in largely mesodermal compartments including the LPM (Saijoh et al., 2003, Yamamoto et al., 2003). Again, by mating either MesP1Cre or Lefty2 3.0-Cre with a conditional null allele of Cited2 and assessing heart looping and Pitx2 expression as indicators of maldeveloped L-R axis formation should inform on Cited2 function in the LPM. Reversed heart loops and absent Pitx2 expression in conditional embryos that are reminiscent of the complete Cited2 null embryonic phenotype would suggest that Cited2 is required in the LPM for establishment of the L-R body axis. These experiments were conducted by Dr Lopes Floro in our laboratory and showed that deletion of Cited2 with MesP1Cre or Lefty2 3.0-Cre did not result in morphological or molecular perturbations of L-R patterning (Lopes Floro et. al., under revision). Careful examination of the Cre-recombinase activity suggested that Cited2 was deleted anterior of the node but not adjacent to it where Nodal expression in the left LPM is initiated. This indicates that these experiments did not address the role of Cited2 in the initiation of Nodal. However, they did show that Cited2 is not required for the propagation of Nodal along the left LPM once initiated.

2.7 Summary

The genetic experiments conducted by Dr Lopes Floro demonstrate that Cited2 is not required in the LPM for the propagation of Nodal signalling and expression. They

60 are less conclusive with respect to Cited2 having a role in the initiation of Nodal signalling and expression in the LPM. The investigation in this chapter illustrate that Cited2 is a positive regulator of Nodal expression that works through the regulatory Nodal-ASE required for the initiation of Nodal expression in the LPM. Indirectly, it also suggests that Cited2 may form a complex with Foxh1 that is critical for Nodal- ASE activity.

Chapter 3: Characterisation of the Cited2 null mouse placenta

3.1 Placental development in the mouse

The success of carrying a pregnancy to term is heavily reliant on a properly functioning placenta. A prerequisite for this to occur is the appropriate development of placental form. Despite its transitory function during gestation, the importance of a functioning placenta is clear when it fails to form properly and impinges greatly on the embryo. Clinical manifestations of poor placental structure and function can range from intrauterine growth retardation of the embryo (with deleterious effects on developing organs) to embryonic demise (Cross et al., 1994). This should not be surprising as the placenta, in its ever changing form, facilitates: the implantation of the conceptus to the uterine wall; escape from maternal immune detection and rejection; transformation of maternal vessels to direct maternal blood to the conceptus; production of paracrine and endocrine secretions that act on maternal physiology to adapt to the demands of pregnancy; and the exchanges of gases, nutrients and wastes between mother and fetus.

The development of the mouse extraembryonic placental structures can be traced back to the uterine implanting blastocyst at 4.5dpc. The blastocyst is a ball of cells that consists of the inner cell mass (ICM) surrounded by trophectodermal cells. The ICM forms the embryo proper as well as the extraembryonic endoderm and mesoderm of the yolk sac and extraembryonic allantois, while the trophectoderm gives rise to much of the trophoblast cell derivatives of the extraembryonic component of the conceptus. Trophectodermal cells overlying the inner cell mass are referred to as polar trophectodermal cells, while cells of the trophectoderm adjacent to the inner cell mass are termed the mural trophectoderm. During implantation, mural trophectodermal cells differentiate to parietal trophoblast giant cells (P-TGC) that are important in aiding uterine invasion and decidualisation (Figure 3.1) (see also Section 3.2 below). At the same developmental timepoint, the primitive endoderm has already segregated from

the epiblast of the ICM – the former giving the extraembryonic endoderm of the visceral and parietal yolk sacs, whilst the latter forms the entire fetus and the extraembryonic mesoderm. After implantation, the polar trophectodermal cells continue to proliferate, giving rise to diploid trophoblast cells of the extraembryonic ectoderm and later the ectoplacental cone. Approaching the end of gastrulation, the extraembryonic ectoderm forms a bilayer with the extraembryonic mesoderm that together constitutes the chorion, from which the labyrinthine trophoblasts (see Section 3.2.3 below) will develop. The ectoplacental cone represents another pool of diploid cells that will go on to form the SpT, GlyT and other trophoblast subtypes of the mature placenta. At roughly 8.5 dpc, the allantois (that will later form the placental fetal vasculature and umbilicus) grows from the posterior pole of the embryo and attaches to the chorion. Subsequently, the chorion begins to buckle to form the villi into which the fetal vasculature grows to form the elaborate network of vessels in the placenta. The maternal vasculature must associate with the placental fetal vessels for nutrient-waste exchange. It is brought close to the fetal vasculature from radial arteries that enter the uterus and branches into several spiral-shaped arteries. These spiral arteries then converge at the level of the TGCs near where they collect into large canals (lined by another subset of trophoblasts) that drain maternal blood to the base of the placenta, and then branch into the vast sinusoidal spaces (Adamson et al., 2002).

The mature mouse placenta forms through a complex interaction of cells contributed by both the mother and the conceptus (embryonic- and extraembryonic-derived). It can be arbitrarily divided into three compartments: the maternal decidua that is the most distal to the fetus; the intervening junctional zone; and the labyrinthine layer that is proximal to the fetus. The proper development of the placenta crucially requires the formation of each layer with all the appropriate cells types in adequate numbers. The maternal decidua contains: maternal uterine stromal cells involved in decidualisation (see Section 3.2.1 below); spiral arteries that carry maternal blood to the implantation site, and the associated trophoblast cells that line the inside of these arteries; uterine natural killer (NK) cells (maternally derived lymphocytes involved in 66 remodelling maternal spiral arteries); and glycogen trophoblast (GlyT) cells derived from the conceptus that invade the decidua (Adamson et al., 2002). The junctional zone is a dense layer comprised of spongiotrophoblast (SpT) and GlyT cells, separated from the decidua by a layer of trophoblast giant cells (TGC). Bordering the junctional zone, distal to the decidual layer, is the labyrinthine zone where fetal blood vessels and maternal blood spaces come in close proximity to one another. These two blood conduits in the labyrinth are separated by a trichotomous arrangement of trophoblast cells (see Section 3.2.3 below). Clearly the mouse placenta is comprised of many cellular effectors, each playing a unique role in development. Each of these cell types and their functions are described further below.

3.2 Trophoblasts

Populating the mouse placenta is a diverse range of differentiated epithelial cell types, termed trophoblasts, which perform a multitude of tasks throughout gestation. The trophoblast lineage is the first terminally differentiated cell type to form in rodents; this occurs at the blastocyst stage when mural trophectodermal cells cease dividing to differentiate and give rise to trophoblast giant cells (TGC). In contrast, the polar trophectodermal cells continue to proliferate and give rise to the remainder of the trophoblast cell subtypes in the mouse placenta including SpT cells, GlyT cells, labyrinthine trophoblasts and more TGCs. The TGCs that arise from the second wave of differentiation are termed “secondary TGCs”; this nomenclature is put in place in order to discern them from “primary TGCs” that arose from the first wave of differentiation. Trophoblast cells populate the mouse placenta at various stages of development and can differ markedly in structure, DNA content and function. Some trophoblasts are mononuclear and polyploid, while others can exist as a syncytium with diploid nuclei. The different trophoblast cell types and their functions are further described below.

3.2.1 Trophoblast giant cells

As already mentioned, TGCs are the first terminally differentiated cell types to form in development, arising in two waves. Briefly, “primary TGCs” stop dividing following implantation and differentiate from the mural trophectodermal cells of the blastocyst; whilst the proliferative polar trophectodermal cells become the ectoplacental cone precursors that are fated to give rise to the “secondary TGCs”. TGCs are large polyploid mononuclear cells that are the result of endoreduplication – a process whereby TGCs undergo several rounds of DNA replication without subsequent mitoses. They are invasive and phagocytic in nature, enabling them to perform their role in implantation; TGCs are also endocrine in character, releasing various paracrine acting factors important for promoting pregnancy (see below). The purpose of endoreduplication and the ensuing polyploidy in TGCs is posited to bolster their protein synthesis abilities (Hu and Cross, 2010), but this remains speculative. It is interesting to note that TGC differentiation is coincident with augmented golgi apparatus and endoplasmic reticulum content (Bevilacqua and Abrahamsohn, 1988) that increases the capacity for protein synthesis. In a similar fashion, polyploidy has also been shown in follicular cells and salivary glands of Drosophila melanogaster that are nutritive and secretory in function, akin to TGC function. Alternatively, TGCs are inherently invasive and are able to promote angiogenesis by secreting angiogenic factors, therefore endoreduplication in TGCs may provide rapid growth of tissue with reduced risk of tumour formation since such cells have exited from the mitotic cycle (Hemberger, 2008).

In the mouse placenta, TGCs are a heterogeneous cell population. Recently, it was elegantly shown that four TGC subtypes exist with very distinct functions (Simmons et al., 2007). These include: parietal TGCs (P-TGC) that line the implantation site and separate the developing fetus and extraembryonic components from the maternal decidua; spiral artery-associated TGC (SpA-TGC) that invade and displace endothelial cells to line the inside of maternal spiral arteries; maternal blood canal- associated TGC (C-TGC) that serve a structural role by lining maternal canals to

68 funnel nutrient-rich maternal blood to the labyrinth; and the sinusoidal TGC (S-TGC) that form part of the trilaminar trophoblast arrangement in the placental labyrinth. These four disparate TGC populations can be identified by their anatomical locations and the genes that they express; they are discerned from each other by the expression of a combination of genes from the prolactin/lactogen/growth hormone (PRL) family and cathepsins (members of the papain superfamily) (Table 3.1) (Simmons et al., 2007). These TGC subtypes originate from distinct and diverse lineages and arise at different developmental timepoints (Table 3.1). P-TGCs arise from mixed lineages; a proportion of P-TGCs originate from the approximately 60 trophectodermal cells of the blastocyst in a process termed primary TGC differentiation; whereas most of the P-TGC present at mid-gestation are derived from the polar trophectoderm, which in turn give rise to Tpbpa-positive precursors via secondary TGC differentiation. C- TGCs, like P-TGCs, have assorted origins with lineage tracing experiments indicating that approximately half come from Tpbpa-positive precursor cells in the outer ectoplacental cone (later becoming the spongiotrophoblast cell layer) (Simmons et al., 2007). Most SpA-TGC that line the spiral arteries of the maternal vasculature are derived from Tpbpa-positive cells in the ectoplacental cone. This is in complete contrast to S-TGC that originate from Tpbpa-negative precursor cells (see Section 3.2.3 below). To summarise, TGC differentiation is complex as evidenced by the lineage tracing studies of the four TGC subtypes; TGC subtypes can have different developmental origins, and even within the same subtype TGCs can be derived from more than one precursor cell.

Paracrine secretions of TGCs in implanting blastocysts and the postimplanted conceptus As described in Section 3.1, adequate attachment of the blastocyst to the uterine epithelium is necessary early in development. The coordinated events that ensure sufficient depth of blastocyst implantation rely on the highly invasive and phagocytic nature of trophoblasts, mediated by their paracrine secretions. During implantation, ovary-derived progesterone and oestrogen prime the maternal uterine epithelium for

Table 3-1 Trophoblast giant cell subtypes, their location and functions in the mouse placenta

Time of appearance TGC subtype Location Marker gene/s Suggested Function (dpc)

Inside lining of spiral Mediate SpA remodelling to bias SpA-TGC 10.5 Prl2c (Plf) 1 arteries maternal blood flow to placenta

Prl3d (Pl1) 1 Regulates implantation, Implantation site and P-TGC 7.5 Prl3b (Pl2) 1 decidualisation and maternal parietal yolk sac Prl2c (Plf) 1 physiology

Inside lining of maternal Prl3b (Pl2) 1 Performs structural support for C-TGC 10.5 canals Prl2c (Plf) 1 maternal vessels

Ctsq Modifies hormones and growth Maternal blood sinusoids S-TGC 10.5 Prl3b (Pl2) 1 factors prior to entry into fetal blood. in the labyrinthine zone Also regulates maternal physiology 1Gene symbols (alternate names) for the PRL family consistent with MGI and Simmons et. al., 2008. This table is adapted from Hu et. al., 2010. Abbreviations: C-TGC, maternal canal associated trophoblast giant cell; P-TGC, parietal trophoblast giant cell; SpA, spiral artery; SpA-TGC, spiral artery associated trophoblast giant cell; S-TGC, maternal sinusoidal trophoblast giant cell.

the implanting blastocyst (Dey et al., 2004); TGCs also secrete progesterone that may aid in establishing and maintaining a blastocyst-competent uterus (Yamamoto et al., 1994). Simultaneously, the differentiating mural trophectodermal cells of the blastocyst become more adherent with the expression of combinations of integrin alpha (ITGA) and integrin beta (ITGB) subunits (Basak et al., 2002, Klaffky et al., 2001, Rout et al., 2004, Schultz and Armant, 1995), and attach to the extracellular matrix (ECM) of the receptive uterus (Armant, 2005). Following blastocyst implantation, uterine decidualisation – a process that causes the uterine stromal cells to proliferate and differentiate into decidual cells – occurs to transform the uterus into a dense cellular matrix to regulate trophoblast invasion. TGCs secrete progesterone and a type 1 interferon (Bany and Cross, 2006, Petraglia et al., 1998, Roberts et al., 1999) which are necessary for differentiation of uterine stromal cells into decidual cells. The mural trophectoderm differentiates to “primary TGCs” that shallowly invade the uterus to mediate the disintegration of the uterine epithelium and thereby playing a crucial role in embryo attachment. Primary TGCs aid in the invasion of the uterus by the conceptus by secreting a suite of matrix metallopeptidases (MMPs) and corresponding tissue inhibitor of metalloproteinases (TIMPs) (Alexander et al., 1996, Das et al., 1997, Harvey et al., 1995, Teesalu et al., 1999, Zhang et al., 2003); plasminogen activator, urokinase (Plau also known as uPA) (Teesalu et al., 1998a, Teesalu et al., 1999) and cathepsins (Afonso et al., 1999, Deussing et al., 2002, Hemberger et al., 2000, Ishida et al., 2004) that remodel the ECM (Cross et al., 1994). Permeation of the uterine stroma by TGCs is vitally important for the formation of the parietal yolk sac. This is a transient structure comprised of TGCs and parietal endoderm cells separated by the Reichert’s basement membrane (Welsh and Enders, 1987) that nourishes the early postimplantation conceptus through passive nutrient-gas exchange (Figure 3.2). This process is reliant on TGCs adequately penetrating the uterine epithelium at the implantation site to anastomose with maternal blood spaces. TGCs localise nutrient-filled maternal sinusoids near the conceptus by protruding extensions to surround them and thereby allow nutrient- waste exchange.

Figure 3.2 The yolk sac placenta The yolk sac represents an early postimplantation structure that mediates nutrient exchange for the nourishment of the conceptus (inset); it also serves to provide signals to establish the anterior-posterior axis of the developing embryo. Both the parietal and visceral yolk sacs that envelope the mouse conceptus are derived from the primitive endoderm. Briefly, the extraembryonic visceral endoderm monolayer abut both the developing embryo and extraembryonic mesoderm (forms the blood islands of the yolk sac and together with the extraembryonic visceral endoderm is known as the splanchnopleure); cells of the parietal endoderm migrate out from the developing embryo to appose the basal aspect of parietal trophoblast giant cells (this bilayer is termed the parietal yolk sac). Parietal endodermal cells subsequently deposit a basement membrane (Reichert’s membrane) between the trophoblast cells and itself. Trophoblasts form sinuses that surround maternal blood to concentrate it around the developing embryo and facilitate early maternal-fetal nutrient exchange; trophoblasts also reciprocally signal with maternal cellular effectors to mediate uterine invasion, decidualisation, pregnancy promotion and evasion of the maternal immune system. Embryo (green), extraembryonic mesoderm (yellow), yolk sac (pink), trophoblast derivatives (purple), maternal dceidua (orange). This figure is adapted from Cross, 1994.

Endocrine secretions of TGCs in the postimplanted conceptus and latter placental development TGCs also possess endocrine functions by releasing factors that act over greater distances to stimulate maternal and fetal responses to pregnancy. In the mouse, the prolactin/lactogen/growth hormone (PRL) gene superfamily consisting of just over 20 gene members (Simmons et al., 2008b) represent important hormones produced by TGCs and other trophoblast cell subtypes that act on maternal physiology such as the corpus luteum in the ovary (Forsyth, 1994), pancreas (Sorenson and Brelje, 1997), mammary glands, as well as maternal behaviour (Mann and Bridges, 2001) to promote pregnancy. Briefly, prolactin (Prl) is a pituitary-derived hormone first identified to function in mammary gland development (Brisken et al., 1999). However, it has since been recognised as having multiple biological actions. In the mouse, several Prl related genes – suspected to evolve from gene duplications and succeeding divergence – are principally expressed by trophoblasts (Simmons et al., 2008b). These extrapituitary-derived and lactogenic Prl related genes are known as placental lactogen proteins, and include amongst others: prolactin family 3, subfamily b, member 1 (Prl3b1 also known as mPL-II and Csh2) and prolactin family 3, subfamily b, member 1 (Prl3d1 also known as mPL-I and Csh1). One subset of the placental lactogens emulate Prl by binding to the same receptor (prolactin receptor, Prlr) and exerting similar effects on maternal physiology (Kelly et al., 1976), including the luteotrophic effect of protracting progesterone production from the corpus luteum of the ovary to ensure promotion of pregnancy (Forsyth, 1994). Early in gestation, pregnancy is maintained by ovary-derived progesterone that mediates maternal physiological uterine adaptations to pregnancy. However, from midgestation and onwards, another source of progesterone is demanded for appropriate uterine adaptations to sustain pregnancy, which is proffered by the extrapituitary-derived placental lactogens from trophoblasts. In addition, there is a smaller subset of Prl- and placental lactogen-related genes that do not bind Prlr, and include amongst others: prolactin family 3, subfamily c (Prl2c also known proliferin, Plf) and prolactin family 7, subfamily d, member 1 (Prl7d1 also known as proliferin- related protein, Plfr or PLF-RP). These have angiogenic and anti-angiogenic effects 74 on endothelial cells (Jackson et al., 1994, Linzer and Nathans, 1984, Linzer and Nathans, 1985).

A remarkable phenomenon of pregnancy is that even though the placenta is comprised of fetal and maternal components that are genetically dissimilar (semiallogenic), it avoids immune rejection by the mother. TGCs play an important role in evading maternal immune surveillance by secreting hormones such as progesterone that have immunosuppressive properties (Rocklin et al., 1979). Data also suggest that TGC-derived progesterone may indirectly aid in circumventing immune detection by stimulating type 2 T helper cells (Szekeres-Bartho and Wegmann, 1996) to release interleukin 10 (Il10), which subsequently act on type 1 T helper cells to decrease their proliferation (de Waal Malefyt et al., 1992, Ding et al., 1993, Howard and O'Garra, 1992) and thus subvert normal maternal immune response.

The latter half of pregnancy in the mouse represents a time of sizeable embryonic growth, with organogenesis in the mouse embryo predominantly completed by midgestation. To support the increased energy demand, a shift in the mode of nutrient-waste exchange between the embryo and the mother is warranted; the passive nutrient exchange offered by the parietal yolk sac that is functional throughout gestation is aided by the development of the more elaborate chorioallantoic placenta from 8-10 dpc (see above). Accordingly, the maternal blood vessels transform with this transition, with TGCs yet again playing a central part. Uterine NK cells are recruited to the decidua to partly regulate the vasodilation of maternal spiral arteries, through their secretions of interferon gamma (Ifng) (Ashkar et al., 2000) that bias blood flow to the conceptus; SpA-TGCs generate prolactin family 4, subfamily a, member 1 (Prl4a1 also known as PLP-A) that can modulate uterine NK cell secretions of Ifng (Muller et al., 1999, Simmons et al., 2008b). TGCs also secrete Ifng that may act in a paracrine fashion on uterine NK cells that express the interferon gamma receptor (Ifngr) (Platt and Hunt, 1998). In conjunction with uterine NK cells, SpA-TGC specifically express cathepsin 8 (Cts8) in the placenta that provides the 75 ability to degrade actin, alpha 2, smooth muscle, aorta (Acta2 also known as alpha smooth muscle actin, α-SMA, and hereinafter referred to as α-SMA) and facilitate maternal vascular remodelling with spiral arteries lined with SpA-TGCs (Screen et al., 2008, Hemberger et al., 2000, Varanou et al., 2006).

TGC secrete a suite of vasoactive molecules. Early in development, the P-TGCs secrete PRLs that have angiogenic and haematopoietic effects that are thought to function in the parietal yolk sac prior to the formation of the countercurrent feto- maternal circulation in the mature mouse placenta (Hu and Cross, 2010, Simmons et al., 2008b). P-TGC also express potent angiogenic mitogens such as vascular endothelial growth factor A (Vegfa) (Voss et al., 2000) and placental growth factor (Pgf also known as PLGF) (Tayade et al., 2007); the soluble form of their competitive antagonist FMS-like tyrosine kinase 1 (Flt1, also known as vascular endothelial growth factor receptor-1, Vegfr1, and hereinafter referred to as Vegfr1) is also expressed in the placenta (Cross et al., 2002, He et al., 1999). Moreover, the S- TGCs secrete PRL hormones posited to inhibit labyrinthine endothelial cells in order to maintain the trilaminar arrangement of trophoblast cells. S-TGCs also express the protease cathepsin Q (Ctsq) that can cleave Prl into bioactive peptides (Clapp et al., 2006, Hilfiker-Kleiner et al., 2007, Piwnica et al., 2006); its position lining maternal sinusoids facilitates Prl bioprocessing and availability and affect maternal physiology (Hu and Cross, 2010). The four TGC subtypes would appear to have distinct roles from each other, based on their vast spatial distribution in the placenta and their diverse genetic expression profiles.

3.2.2 Spongiotrophoblasts and glycogen trophoblast cells of the junctional zone

The junctional zone of the mouse placenta is largely colonised by diploid SpT and GlyT cells. The volume of the junctional zone is biphasic during development, voluminously increasing until 16.5 dpc after which it decreases in dimensions (Coan et al., 2004); the dynamicity of the junctional zone dimensions is attributed to changes in size, proliferative and migratory behaviours of resident cells (Coan et al.,

2006). The precise roles of the SpT and GlyT cells of the junctional zone remain to be clarified; nevertheless its proper formation is obligatory in fetal viability (Guillemot et al., 1994, Tanaka et al., 1997).

The suggested origin and functions of spongiotrophoblasts SpT cells are a subtype of trophoblast cells that on account of marker expression and histological analyses are highly likely to be derivatives of diploid cells in the ectoplacental cone. The importance of the SpT cells in the junctional zone for embryonic viability is best exemplified in mice lacking achaete-scute complex homolog 2 (Drosophila) (Ascl2 also known as Mash2) gene function – it encodes a basic helix-loop-helix transcription factor (Murre et al., 1989). Mash2 deficient placentas lack diploid precursor cells in the ectoplacental cone, and consistently, absence of their derivative SpT cells (Guillemot et al., 1994). Placental failure and subsequent embryo demise ensues. Little is known about SpT cell function, but it is predicted to be tasked with structurally supporting the underlying developing labyrinthine layer (Tanaka et al., 1997). It is also inferred that, along with secondary TGCs, SpT cells exert luteotrophic effects by secreting PRLs (Soares et al., 1996) that maintain the production of progesterone from the corpus luteum and encourage the pregnant state. Moreover, SpT cells are capable of producing a secreted form of Vegfr1 (He et al., 1999), a receptor that can bind and impede Vegfa to prevent maternal vasculature growth into the junctional zone (Cross et al., 2002).

Glycogen trophoblast cell development and their predicted placental role GlyT cells are trophoblast derivatives of unknown origin. Recently, these cells have been the focus of study in an attempt to characterise their ontogeny and function. Based on coincident expression of the SpT cell marker, trophoblast specific protein alpha (Tpbpa also known as 4311) – which has recently been shown to be non- exclusively expressed by spongiotrophoblasts (Simmons et al., 2008b) – by GlyT cells (Lescisin et al., 1988); their non-expression of the secondary TGC cell marker Prl3d1; as well as their distribution amongst and subsequent arrival after SpT cells (Adamson et al., 2002, Redline et al., 1993, Teesalu et al., 1998b) in the junctional 77 zone, together have led many to believe that GlyT cells arise from SpT cells (Adamson et al., 2002, Cross et al., 2003, Georgiades et al., 2002, Simmons and Cross, 2005). However, observation of the expression of protocadherin 12 (Pcdh12 also known as vascular endothelial cadherin-2) in a distinctive cluster of cells in the ectoplacental cone, later confirmed to be exclusively expressed in GlyT cells, argue for lineage-independence of GlyT cells from SpT cells (Bouillot et al., 2006).

Pcdh12 expressing cells are first observed at 7.5 dpc in the ectoplacental cone; and later at 10.5 dpc, Pcdh12-positive cells localise to cells beginning to accumulate glycogen in the junctional zone (Bouillot et al., 2006). Consistent with these findings, the cellular environment of the junctional zone at 12.5 dpc is still largely comprised of SpT cells, with concomitant clusters of distinct glycogen-amassing cells predicted to be pre-GlyT cells (Coan et al., 2006). Ultrastructural analysis of these posited pre-GlyT cells reveal that they are enveloped by an ECM as they garner glycogen granules (Coan et al., 2005). The period between 12.5-14.5 dpc represents a time of immense GlyT cell proliferation and massive glycogen accrual, manifesting in the vacuolated appearance characteristic of these cells (Coan et al., 2006). Occurring concurrently, GlyT cells begin to express cyclin-dependent kinase inhibitor 1C (P57) (Cdkn1c also known as p57Kip2) thought to mark putative pre-GlyT cell exit from the cell cycle to undergo differentiation into mature GlyT cells. GlyT cells also begin to express matrix metallopeptidase 9 (Mmp9) that may assist in invasion of the maternal decidua (Coan et al., 2006). Collectively, this may explain the increasing volume of the junctional zone at this developmental stage.

Once they have migrated to the decidual tissue, GlyT cells do not seem to be replenished in the junctional zone. In addition, GlyT cells are cytolytic, with half of those that reach the decidua still being present just prior to parturition. The functional role of GlyT cells remains elusive. However, the timing and localisation of expression of glucagon overlaps with GlyT cell migration to and invasion of the maternal decidua. Glucagon is a hormone that breaks down glycogen (glycogenolysis) into simple sugars that can be used a source of energy. Therefore, 78 this suggests a nutritive function for GlyT cells in late gestation, with its provision of nutrients at a time of increased energy requirement. Alternatively, GlyT cells are proposed to be important in parturition. Oxidative stress is shown to increase with gestation in normal murine pregnancies (Burdon et al., 2007) and results in prostaglandin-endoperoxide synthase (PTGS also known as cyclooxygenase, COX) enzyme induction. This enzyme directly produces prostaglandins, which are potent stimulators of parturition (Cook et al., 2003, Gross et al., 1998, Reese et al., 2000). GlyT cells in the decidua strongly express PTGS, and therefore, the prostaglandins that they produce may trigger parturition upon GlyT cell cytolysis.

3.2.3 Labyrinthine trophoblasts and their functions

The labyrinthine zone of the mouse placenta is the major site of nutrient, gas and waste exchange between mother and fetus via juxtaposed maternal and fetal vasculatures. Here the maternal and fetal vessels are separated by three layers of trophoblast cells consisting of S-TGCs and two syncytiotrophoblast (SynT) cells designated SynT-I and SynT-II. The trilaminarity of the trophoblasts is arranged such that S-TGCs surround maternal sinusoids, the S-TGC abuts SynT-I and SynT-II cells, with SynT-II cells then bordering with the endothelial cells that line the fetal vessels (Enders, 1965, Hernandez-Verdun, 1974) (Figure 3.3). The labyrinthine trophoblasts (S-TGC, SynT-I and SynT-II) are dissimilar in form and function from each other; S-TGCs are largely secretory mononuclear polyploid trophoblast cells (Simmons and Cross, 2005, Simmons et al., 2007); while SynT-I and SynT-II cells are multinuclear diploid cells arising from the fusion of trophoblast cells (Enders, 1965, Hernandez-Verdun, 1974, Jollie, 1964) that transport nutrients and produce hormones, as well as mediating evasion of the maternal immune system (Dupressoir et al., 2009). The two SynT layers differ from each other in their cellular content and the molecular make up at intercellular junctions (Dupressoir et al., 2009).

Figure 3.3 The trilaminar trophoblast structure of the mouse placental labyrinth The labyrinth of the mouse placenta is the site of nutrient-waste exchange permitted by the close apposition of the maternal and fetal vasculatures. (A) Electron micrograph of the labyrinth of the mouse placenta. (B) Inset in (A) shows the trilaminar arrangement of trophoblasts in the labyrinthine zone of the murine placenta. Maternal sinusoids (m) are surrounded by sinusoidal trophoblast giant cells (S-TGC, blue). Bordering S-TGCs are two layers of syncytiotrophoblast (SynT-I, green; SynT-II, yellow) cells. SynT-II cells then abut the endothelial-lined (red) fetal vessels carrying nucleated fetal red blood cells (frbc). (C) The conceptus at 7.5 dpc and the placental tissues thought to give rise, based on gene expression studies, to the trilaminar trophoblasts of the labyrinth are shown. Prior to the occlusion of the ectoplacental cone cavity, the chorion (light grey) and the ectoplacental cone (EPC) (grey) are separated from each other; coincidentally, Gcm1-expressing diploid chorionic trophoblasts (yellow) are first evident at this stage. Upon occlusion, these two compartments are brought together and Gcm1+ chorionic trophoblast cells persist. Soon after this, Cebpa and Synb are expressed within the same Gcm1-expressing cells, and are thought to represent the SynT-II precursor (orange). As development progresses, cells in the apical chorion express Syna in a cell restricted manner and thought to correspond to SynT-I cell precursors (green). Hand1+/Prl3d- cells (blue) in the EPC represent the developing S-TGCs that surround maternal blood sinuses (mbs); these cells will later (at 12.5 dpc) express the S-TGC specific marker Ctsq. The allantois (red) that will give rise to the endothelial cells and other vascular components of the fetal vasculature is also shown. Gene symbols are standard (http://www.informatics.jax.org). This figure is modified from Simmons et. al., 2008.

The developmental origin of these trophoblast cell types has recently been inferred from gene expression studies; each cell of the trilaminar arrangement of trophoblasts in the labyrinth is thought to derive from distinct and autonomous precursor cells in the chorion and ectoplacental cone (Simmons et al., 2007, Simmons et al., 2008a). Just prior to occlusion of the ectoplacental cavity, trophoblast cell clusters in the extraembryonic ectoderm – fated to become the chorion – begin to express glial cells missing homolog 1 (Drosophila) (Gcm1) (Basyuk et al., 1999). At approximately 8 dpc, the ectoplacental cavity is occluded, bringing the cells of the ectoplacental cone adjacent to the chorionic trophoblast cells. Gcm1 expression persists in the trophoblast cells of what has become the basal chorion, and continues to about 8.5dpc. At this point, CCAAT/enhancer binding protein (C/EBP), alpha (Cebpa) and syncytin B (Synb) are expressed in the same Gcm1 expressing cells that are believed to be fated to become the SynT-II cells; it remains a matter of speculation whether Gcm1 directly or indirectly regulates Cebpa and Synb expression. As soon as the Gcm1/Cebpa/Synb pattern of expression is set up in the cells of the basal chorion, the trophoblast cells in the apical chorion between the Hand1-positive S-TGCs and the Gcm1-, Cebpa-, Synb-positive potential SynT-II precursors begin to express syncytin A (Syna). Syna expression is restricted to what is hypothesised to be the SynT-I precursor cells that allows their identification. SynT-II restricted expression of Gcm1/Cebpa/Synb is not required for the induction or maintenance of SynT-I restricted Syna expression; though, Gcm1/Cebpa/Synb expressing SynT-II precursor cell interaction with Syna expressing SynT-I cells is required for the fusion of Syna- positive cells to form a syncytium (Anson-Cartwright et al., 2000, Hernandez- Verdun, 1974). In support of these inferred cellular origins of SynT-I and SynT-II cells, notwithstanding the need to perform lineage tracing experiments to confirm cell lineages, knockout of either Syna and Synb result in failure of SynT cell fusion and malformation of SynT-I and SynT-II layers, respectively. These studies highlight the importance of these gene products in labyrinthine SynT cell fusion and proper placental morphogenesis (Dupressoir et al., 2009, Dupressoir et al., 2011). Concurrently at 8.5dpc, Tpbpa-negative cells of the ectoplacental cone that are in contact with the apical chorion begin to express the basic helix-loop-helix 82 transcription factor heart and neural crest derivatives expressed transcript 1 (Hand1 also known as eHAND), these cells will later express cathepsin Q (Ctsq) in a cell restricted manner and are thought to be the S-TGC precursors (Scott et al., 2000, Simmons et al., 2007). Therefore just after 8.5 dpc, in advance of trophoblast cell- cell fusion and morphogenesis, the chorionic-ectoplacental cone interface has established the discrete cellular precursors of the labyrinthine trophoblasts.

3.3 Fetal blood vessels of the mouse placenta

The genesis of the intimate structural apposition of the maternal and fetal cells within the mouse placenta is central to understanding the ontogeny of poor placental function. A rich number of cell types are present in the placenta including trophoblast derivatives (as already discussed above) and vascular cells. Existing in each cell type are various evolutionary conserved signalling pathways that participate in dictating placental cell behaviour. The organisation of these cells has evolved an elaborate network of cross-talk between these signalling pathways. Aberrations in these signalling pathways have downstream effects on cell outcome, amplifying cellular disorder which in turn manifests in improper organogenesis to eventually culminate in poor functional output.

3.3.1 Development of the yolk sac and fetal vasculatures of the murine placenta

Blood vessels are the first tissue structures to form and infiltrate the entire body. In development, the vasculatures of the early embryo and extraembryonic yolk sac, as well as the placenta that supports fetal life, are derived from de novo construction of vascular channels (vasculogenesis) from a cellular plexus of angioblasts (Coultas et al., 2005). They are comprised of endothelial and mural cells in a bed of ECM for support. Blood vessels represent important conduits for carrying nutrients, small molecules, immune and blood cells to and from all bodily tissues; as well as carrying wastes for eventual disposal. Despite, the convoluted nature of the vasculature, the vast network of vessels are arranged in an ordered manner (Jain, 2003).

From the posterior primitive streak of the conceptus, vascular progenitors (angioblasts) arise through fibroblast growth factor 2 (Fgf2 also known as basic fibroblast growth factor, bFGF) and bone morphogenetic protein 4 (Bmp4) signalling (Coultas et al., 2005) (Figure 3.4). Angioblasts are identified by positivity for platelet/endothelial cell adhesion molecule 1 (Pecam1, also known as CD31), CD34 antigen (Cd34), and kinase insert domain protein receptor (Kdr, also known as

Figure 3.4 The developing vasculature and its associated blood cells (A) Originating from mesodermal cells of the posterior aspect of the primitive streak (PPS) of the conceptus, haemangioblast cells that represent the progenitors for both blood (haematopoietic) and vascular (angioblastic) cells arise in response to fibroblast growth factor 2 (Fgf2) and bone morphogenetic protein 4 (Bmp4) signals. These progenitor cells migrate into both the intraembryonic (IEM) and extraembryonic (EXE) tissues where their fates become restricted to the haematopoietic and angiogenic lineages; these progenitors become specified into arterial, venous and haematopoietic identities early in development (B) and (C). (D) In the extraembryonic space, these progenitors: migrate to the yolk sac to form blood islands of haematopoietic precursors surrounded by endothelial precursor cells and will form the primary capillary plexus; in the allantois, these progenitors will give rise to the fetal vasculature of the mature placenta. (E) In the intraembryonic compartment, the angioblasts aggregate medially to form the primary large vessels of the dorsal aorta and cardinal vein without forming an intermediate plexus. (F) Together, the intraembryonic primary large vessels and extraembryonic primary capillary plexus remodel to form a connected vascular network. (G) These conduits mature when equipped with vessel stabilising mural cells (pericytes and smooth muscle cells) that proliferate and differentiate in response to transforming growth factor-beta (TGFb) and migrate to primitive vessels through platelet derived growth factor, B polypeptide (Pdgfb) and angiopoietins (ANGPT). Gene symbols are standard (http://www.informatics.jax.org). This figure is modified from Coultas et. al., 2005.

vascular endothelial growth factor receptor 2, VEGFR2 and fetal liver kinase 1, flk1, and hereinafter referred to as Vegfr2) (Jain, 2003). Upon appearing, angioblasts: migrate to the extraembryonic yolk sac to synthesise blood islands consisting of haematopoietic (blood cell) progenitors surrounded by endothelial cell progenitors to form a capillary plexus. In addition they form the allantoic mesenchyme that will later form the fetal vessels of the mature placenta. Angioblasts also migrate towards embryonic domains to form the major vessels including the dorsal aorta (representing the root systemic artery) and the cardinal vein. The major vascular conduits of the dorsal aorta and cardinal vein, together with the extraembryonic capillary plexus, form a mature ordered vascular network through further remodelling (Coultas et al., 2005).

Stemming from the root systemic artery of the aorta, vessels branch off along the anterior-posterior axis of the body with vessel calibre successively decreasing down to the arteriole. The arterioles then communicate with capillaries – the smallest vessels where nutrient-waste exchange occurs between blood and tissue – and subsequently empty into venules similar in diameter to arterioles. From the venules, the vascular system then connects into the larger veins that carry blood back to the heart. This complex organisation is a direct result of the role the vasculature has in ensuring sufficient nourishment of tissues, and is repeated in many organs including the transient placenta. The number and arrangement of mural cells around these different vascular entities differ owing to their distinct functions. Larger arterial and venous vessels are invested with greater numbers of mural cells to maintain vessel tone and structural wall integrity in the face of immense blood pressures. By contrast, the microvasculature bed consists of endothelial tubes embedded in a basement membrane populated with scant pericytes to facilitate nutrient-waste exchange (Jain, 2003).

The ordered pattern of the vasculature is achieved through vasculogenesis, with subsequent maturation of nascent vessels at both the structural wall and network levels (Carmeliet, 2003). At the level of the vascular wall, primitive vascular 88 channels mature into stable conduits by successive mural cell recruitment, ECM deposition and endothelial-mural cell specialisations (formation of intercellular junctions, apical-basal body polarisation and development of foot processes). At a global level, in order to meet the changing demands of tissues, the network of vessels must mature by undergoing coordinated expansion by either sprouting of new vessels from existing channels or by intussusception (whereby existing vessels split to form new vessels). This process is known as angiogenesis. Pathologies arise from malformed and immature vascular systems incapable of effecting homeostasis in the face of constant biological flux.

3.3.2 The extracellular matrix plays a role in vascular development

The ECM is an often neglected component of tissues; it plays important roles in the development of vessels. Maturation of blood vessels is reliant on sufficient deposition of ECM, which impacts on both endothelial and mural cells. It represents a physical obstruction to both cell types and impedes over-vascularisation. The origin of many vascular dysplasias can be attributed to over activity of the angiogenic process. This is exemplified in hereditary haemorrhagic telangiecstasia, a vascular disease characterised by capillary dilation concomitant with localised bleeding and arteriovenous malformations (Adams and Alitalo, 2007). The ECM also functions to prevent vessel collapse by providing a platform for heterotypic cell contacts between intervascular cells to strengthen vessels. However, the ECM is also identified as being more than just a physical barrier; it is a rich source of latent growth factors important in vessel formation. For instance, decorin, a proteoglycan present in the ECM, is a reservoir for latent Tgfb1 (Imai et al., 1997). The ECM also orchestrates the bioactivity of another important vascular growth factor, vascular endothelial growth factor A (Vegfa). Exons 6 and 7 of Vegfa encode the ECM-binding domain, and alternative splice variants containing these exons become ECM-bound and thus sequestered (Houck et al., 1991, Houck et al., 1992, Park et al., 1993).

The release of angiogenic factors is dependent on the degradation of the ECM by enzymes such as the MMPs; homeostasis of the ECM landscape is coordinated by a delicate balance between degradation and remodelling performed by MMPs and their inhibitors TIMPs. MMPs are a 26-member family of zinc endopeptidases with variant substrate specificities, and have multiple functions related to bioactivation and bioavailability of ligands. It has been shown that a subset of MMP can breakdown the ECM to liberate Vegfa, and therefore control its bioavailability (Lee et al., 2005). Biochemical studies have also reported that Vegfa itself can act as a substrate for Mmp-3, -7, -9 and -19, and to a lesser extent Mmp-1 and -16. Its cleavage into bioactive molecules affects different aspects of angiogenesis. Mice deficient in Mmp9 (also known as gelatinase B) have impaired pericyte recruitment (Chantrain et al., 2004). Thus, the activity of MMPs and TIMPs is crucial in controlling the bioavailability of important vascular factors, which ultimately organises the vasculature into its hierarchical complexity.

In addition to being an impediment to migrating vascular cells and harbouring morphogenic molecules, the ECM also serves to influence the spatial arrangement of other vascular important molecular effectors such as platelet derived growth factor, B polypeptide (Pdgfb) and endothelial-specific receptor tyrosine kinase (Tek also known as Tie2, and hereinafter referred to as Tie2). The ECM acts to anchor Pdgfb close to endothelial cells that secrete Pdgfb – in this way the ECM promotes pericyte coverage of vessels by maintaining the pericyte attracting Pdgfb signal in a peri- endothelial distribution (Abramsson et al., 2003, Eming et al., 1999, Lindblom et al., 2003, Ostman et al., 1991). Through its interactions with angiopoietin 1 (Angpt1), distinct Tie2 receptor complexes in endothelial cells occur and transduce differential vascular responses. The distinct assemblies are conferred by whether the Angpt1 ligands are bound to the ECM or not, with each ligand-receptor arrangement preferentially activating different signal transducers; inter-endothelial cell Tie2 clusters associated with free Angpt1 ligands preferentially activate thymoma viral proto-oncogene 1 (Akt1 also known as PKBalpha) and subsequently upregulates Kruppel-like factor 2 (lung) (Klf2 also known as Lklf); while ECM-anchored Tie2 90 preferentially activate mitogen-activated protein kinase 3 (Mapk3 also known Elk related tyrosine kinase 1, Erk1) and mitogen-activated protein kinase 1 (Mapk1 also known as Elk related tyrosine kinase 2, Erk2) when cell-cell adhesions have been broken down (Fukuhara et al., 2008, Saharinen et al., 2008).

3.3.3 Signalling pathways in vascular development

The vast molecular effectors involved in placental vascular formation and maturation are largely similar to those that function in other vascular beds (Coultas et al., 2005), and include: Vegfa and Vegfr2 ligand-receptor couplet; Pdgfb and its associated receptor platelet derived growth factor receptor, beta polypeptide (Pdgfrb); Angpt1 and angiopoietin 2 (Angpt2) that both bind the Tie2 receptor; and the Tgfb1 ligand that can couple with either activin A receptor, type II-like 1 (Acvrl1 also known as Alk1 , and hereinafter referred to as Alk1) and transforming growth factor, beta receptor I (Tgfbr1 also known as Alk5 , and hereinafter referred to as Alk5) whose signal can be further propagated by downstream signal transducers MAD homolog 1 (Drosophila) / MAD homolog 5 (Drosophila) (Smad1/5) and MAD homolog 2 (Drosophila) / MAD homolog 3 (Drosophila) (Smad2/3), respectively (Figure 3.5). These vascular relevant ligand-receptor signals converge at and are further transduced and modified by molecular transduction systems such as Mapk3 and Mapk1 as well as Akt1; Mapk3/Mapk1 and Akt1 are suggested to be important for cell proliferation, survival and migration (Kanda et al., 2005, Kim et al., 2000, Papapetropoulos et al., 2000, Teichert-Kuliszewska et al., 2001, Yoon et al., 2003). The mechanistic roles that these signal transduction systems play in vascular development are highlighted below – it is noteworthy that some of these signalling pathways are also important in placental trophoblast development (Table 3.2).

Vegfa-Vegfr2 signalling pathway in vascular formation Vegfa initiates the de novo formation of blood vessels (vasculogenesis); angioblasts (see Section 3.3.1 above) respond to Vegfa signal by differentiating and proliferating

Figure 3.5 Signalling pathways in the assembly of vascular conduits Mesodermal cells give rise to angioblasts that represent the precursor cells of endothelial cells. Angioblasts begin to differentiate into endothelial cells and form tubes probably in response to Vegfa via Vegfr1 and Vegfr2. Upon formation of endothelial cell- lined tubes, mural cells (pericytes and smooth muscle cells) from the mesenchyme are recruited to these nascent blood vessels. Pericytes are recruited to microvessels through Pdgfb-Pdgfrb signalling, while smooth muscle cells are recruited to larger conduits through Anpgt1 and Tie-2 signalling. Differentiation and maturation of mural cells are mediated by TGFb signalling. Receptors are denoted by their gene symbol within brackets. This figure is adapted from Cleaver and Melton, 2006 (Nature Medicine).

Table 3-2 Cellular expression of various placenta relevant signalling molecules

Endothelial Trophoblas Molecule Mural cells Placental phenotype cells t cells

ǩ-SMA + No known placental phenotype

Reduced pericyte envelopment of blood vessels within the labyrinth Pdgfb + + (Bjarnegard et al., 2004, Ohlsson et al., 1999)

Reduced pericyte envelopment of blood vessels within the labyrinth Pdgfbr + + (Ohlsson et al., 1999)

Vegfr2 + + No known placental phenotype

Erk2 mutant embryos fail to form the ectoplacental cone and extra- Mapk3, 1 + + + embryonic ectoderm, which give rise to mature trophoblast derivatives (Saba-El-Leil et al., 2003)

Elk1 + + + No known placental phenotype

Hypotrophic placentas with reduced GlyT cells in the junctional zone Akt + + + and hypovascular labyrinth (Yang et al., 2003)

into endothelial cells to form the primary vascular plexus. Early in development, these nascent vessels first form the dorsal aorta and cardinal vein of the embryo as well as the arterial and venous aspects of the embryonic yolk sac. With further remodelling and morphogenesis, these primitive unstable vessels mature through ECM deposition and mural cell association (discussion of mechanisms and key pathways are to follow).

Vegfa is a potent angiogenic factor secreted by the surrounding peri-endothelial cells, which upon secretion becomes bound to the ECM (Park et al., 1993) via its ECM- binding domain contained in the carboxy-terminus (Houck et al., 1991, Houck et al., 1992). It can bind both Vegfr1 and Vegfr2, receptors that are present on endothelial cells that have contrasting effects on endothelial cell development (Fong et al., 1995, Shalaby et al., 1995). Vegfa is haploinsufficient, with embryo lethality occurring at 9.5 dpc associated with severely reduced blood islands and embryonic vasculature (Carmeliet et al., 1996, Ferrara et al., 1996). Similarly, knockout of Vegfr2 results in embryonic lethality at 8.5 dpc with a catastrophic failure of endothelial and haematopoietic cell development (Shalaby et al., 1995). Therefore, the Vegfa-Vegfr2 signalling couplet is vitally important for vascular establishment.

The importance of Angpt1/2-Tie2 signalling system in vessel development Recruitment of mural cells to newly formed endothelial-lined vessels is necessary in the development of mature and stable conduits. Cellular association of these two populations of cells is carried out by various paracrine signalling pathways. One such pathway is the angiopoietin (ANGPT) gene family of growth factors that include Angpt1, Angpt2, Angpt3, Angpt4 which encode for ligands of the Tie2 receptor (Gaengel et al., 2009). Angpt1 is considered to be the primary agonist for Tie2 (Suri et al., 1996) while Angpt2 is the main antagonist for Tie2 (Maisonpierre et al., 1997); the in vivo roles of Angpt3 and Angpt4 are still underappreciated. Angpt1 is secreted by mural and perivascular cells (Davis et al., 1996, Sundberg et al., 2002, Wakui et al., 2006) and signal in a paracrine manner to Tie2 receptors present on endothelial cells (Dumont et al., 1992, Wakui et al., 2006). Angpt2 is secreted by endothelial 95 cells that compete with Angpt1 for Tie2 binding to exert its antagonistic effect by an autocrine feedback loop (Fiedler et al., 2006); Angpt2 is also documented to be secreted by perivascular, mural cells and pericytes (Maisonpierre et al., 1997, Wakui et al., 2006) to indicate a deeper complexity in its mode of action. With respect to the placenta, Angpt1, Angpt2 and Tie2 are all strongly expressed in trophoblast derivatives and differentially expressed in placental vascular cells (Abbott and Buckalew, 2000). Although, the exact functions of Angpt1, Angpt2 and Tie2 in the mouse placenta remain unclear. Knockout of Tie2 in the mouse results in a spectrum of vascular defects that can be ascribed to failure of angiogenesis (Dumont et al., 1994); it seems unlikely that vasculogenesis is impaired as these mutants are able to develop, albeit rudimentary, vascular plexuses (Patan, 1998, Sato et al., 1995). Similarly, deletion of Angpt1 phenocopies aspects of the failed vascular remodelling in Tie2 mutants (Suri et al., 1996); while ablation of mouse Angpt2 results in defects in the highly vascularised tissues of the lymphatic system, retina and kidney (Gale et al., 2002, Hackett et al., 2000, Pitera et al., 2004). Of note, Tie2 and Angpt1 mutant vessels are observed to lack associated mural cells as well as poor intercellular association between vascular cells and the ECM, respectively; this substantiates the in vitro finding that ECM-associated Angpt1 concentrates Tie2 receptor complexes at cell-matrix contacts for endothelial cell adhesion and migration (Fukuhara et al., 2008, Saharinen et al., 2008) (see Section 3.3.2 above). Clinically, a mutation in TIE2 that renders the kinase domain constitutively active (Vikkula et al., 1996) is ascribed to human venous malformation that is characterised by poor or a complete lack of mural cell coverage around particular veins. Therefore, the Angpt-Tie signalling axis is important for maturing vascular networks; Angpt1-Tie2 perform vascular stabilising roles through mural cell recruitment; in contrast, Angpt2-Tie2 antagonise the vessel maturing effects of Angpt1 by loosening interactions between endothelial and mural cells.

Pdgfb-Pdgfrb is necessary for vascular maturation The Pdgfb-Pdgfrb couplet is another essential ligand-receptor system involved in mural cell recruitment and vessel maturation; it functions in mural cell proliferation, 96 directed migration and integration into vascular walls (Abramsson et al., 2003, Bjarnegard et al., 2004, Hellstrom et al., 1999, Hirschi et al., 1999). In contrast to the Angpt1-Tie2 axis, the Pdgfb-Pdgfrb paracrine signalling occurs in an endothelial-to- mural cell direction; Pdgfb ligand is expressed by endothelial cells participating in angiogenesis and in remodelling vessels; it signals to pericytes that express Pdgfrb to proliferate and migrate towards the blood vessel (Lindahl et al., 1997). Upon secretion, Pdgfb can either be retained on the cell surface or bound to the ECM through an ECM-binding motif present in the carboxy-terminus (Ostman et al., 1991). Knockout of either Pdgfb or Pdgfrb results in poor investment of pericytes around vessels prominent in many tissues including the labyrinth of the mouse placenta; though, not all vascularised tissues are affected in either Pdgfb or Pdgfrb deficient mice (Bjarnegard et al., 2004, Hellstrom et al., 1999, Hellstrom et al., 2001, Kaminski et al., 2001, Leveen et al., 1994, Lindahl et al., 1997, Soriano, 1994). In the placenta, Pdgfb or Pdgfrb deficiency compromises the integrity of placental labyrinthine vessels; labyrinthine capillaries are posited to be dilated due to reduced placental pericytes that hold and arrange the capillaries into loops (Ohlsson et al., 1999).

TGFb ligands and their associated receptors are required for vessel maturation The transforming growth factor-beta (TGFb) family of cytokines and the receptors they interact with are vital ligand-receptor systems in establishing the heterotypic cell contact between endothelial cells and pericytes of capillaries. TGFb cytokines are expressed by both endothelial and mural cells and have multi-factorial roles in vessel development. TGFb ligands exert pleiotropic effects in vascular development that is concentration-dependent and can either promote or inhibit angiogenesis. TGFb signal via both Alk1 and Alk5 receptors and their associated downstream signal transducers Smad1/5 and Smad2/3, respectively. These alternate pathways transduce opposing effects on cellular proliferation/migration and differentiation of both endothelial and mural cells; activation of the TGFb-Alk5-Smad2/3 axis results in anti-angiogenic actions by preventing endothelial cell migration and proliferation, as well as vessel maturation by differentiation of mesenchymal cells to mural cells; conversely, activation of the TGFb-Alk1-Smad1/2 axis results in pro-angiogenic actions to 97 stimulate endothelial cell migration and proliferation, and oppose vessel maturation by inhibiting mural cell differentiation (Chen et al., 2003, Goumans et al., 2002, Ota et al., 2002). These disparate cellular responses are partly determined by the concentration and temporal period of the TGFb signal (Goumans et al., 2002).

Another function of TGFb is the formation and deposition of ECM that is necessary for vessel stabilisation; it is also shown that TGFb promotes vessel stability by preventing the breakdown of the matrix surrounding growing vessels via induction of serine (or cysteine) peptidase inhibitor, clade E, member 1 (Serpine1 also known as plasminogen activator inhibitor 1, PAI-1) (Chambers et al., 2003). However, TGFb signalling in vascular development becomes more complex; endothelial-derived TGFb signalling is essential for synthesis of ECM-bound latent TGFb. The activation of latent TGFb is integrin-dependent (Cambier et al., 2005) and requires sufficient endothelial-mural cell contacts (Antonelli-Orlidge et al., 1989, Hirschi et al., 2003, Sato et al., 1990). Subsequent availability of bioactive TGFb into the vascular milieu becomes important in endothelial paracrine signalling to mesenchymal cells that outcome in their differentiation into mural cells through activation of Alk5-Smad3 (Chen et al., 2003). Gene inactivation of various components of the Tgfb pathway exhibit reduced investment of mural cells (Arthur et al., 2000, Dickson et al., 1995, Larsson et al., 2001, Li et al., 1999, Oh et al., 2000, Oshima et al., 1996, Urness et al., 2000, Yang et al., 1999). Therefore, TGFb signalling is demanded for maturity of the vascular network.

3.4 Hypoxia and placental development

Oxygen is a significant morphogen in the developing conceptus (Dunwoodie, 2009); the mouse placenta develops in an environment of low oxygen (hypoxia). This hypoxic background would appear to conflict with the function of the placenta in bringing oxygen-rich maternal blood close to oxygen-poor fetal blood, however, hypoxia in the placenta may provide the trigger for the induction and maintenance of the angiogenic action of the hypoxia inducible factor (HIF) family of transcription

98 factors. At the level of transcription, HIFs mediate tolerance to hypoxia through several biochemical pathways that serve to simultaneously diminish oxygen usage and increase oxygen supplies. Many cells in the murine decidua and placenta are hypoxic and/or express the HIF subunits hypoxia inducible factor 1, alpha subunit (Hif1a) and endothelial PAS domain protein 1 (Epas1 also known as Hif2a, and hereinafter referred to as Hif2a) from 6.5dpc until 14.5dpc (Pringle et al., 2007, Withington et al., 2006). Yet despite the establishment of the placental feto-maternal vascular axis for oxygen transfer, trophoblast derivatives in the placenta remain hypoxic (Okazaki and Maltepe, 2006, Withington et al., 2006).

Hypoxia affects the development of both trophoblastic and vascular cells of the placenta; oxygen tension is shown to influence trophoblast differentiation as well as endothelial cell proliferation (Adelman et al., 2000, Damert et al., 1997, Levy et al., 2000, Schaffer et al., 2003). Adaptations to hypoxia can be mediated by HIFs that form heterodimers consisting of two subunits; aryl hydrocarbon receptor nuclear translocator (Arnt also known as Hif1b) can dimerise with either Hif1a, Hif2a or hypoxia inducible factor 3, alpha subunit (Hif3a) and its isoforms to form HIF1, HIF2 and HIF3, respectively. Indeed, gene targeted deletion of HIF components and their downstream target genes show that they are important for placental development (Abbott and Buckalew, 2000, Adelman et al., 2000, Constancia et al., 2002, Cowden Dahl et al., 2005, DeChiara et al., 1990, Kozak et al., 1997, Sibley et al., 2004). The main placental defects in the various HIF mouse knockouts are poor chorioallantoic interactions and reduced SpT and SynT cells, with embryonic demise occurring either side of 10 dpc (Abbott and Buckalew, 2000, Adelman et al., 2000, Cowden Dahl et al., 2005, Kozak et al., 1997). This highlights the importance of HIF-mediated responses to low oxygen in the developing placenta and ultimately for embryonic outcome. Therefore, the regulation of HIF activity may provide further mechanistic insight into oxygen driven placental morphogenesis, one of these HIF molecular regulators is Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 (Cited2).

3.5 CITED genes in placental development

The Cbp/p300-interacting transactivators, with Glutamic acid [E]/Aspartic acid [D]- rich carboxy-terminal domain (CITED) gene family encoding unique transcriptional co-factors is comprised of: Cited1 (also known as Msg1), Cited2 (also known as Mrg1), Cited3 (not expressed in mammals) and Cited4. Of the four family members, Cited1 and Cited2 have been shown to be essential for development of the mouse placenta (Rodriguez et al., 2004, Withington et al., 2006). Cited4 protein is expressed in the 11.5 dpc mouse placenta (Yahata et al., 2002); however its role in the mouse placenta remains unclear.

3.5.1 Cited1 is required in the developing mouse placenta

Briefly, Cited1 is required in trophoblast development; loss of Cited1 results in an enlarged junctional zone and expanded maternal sinusoids in the labyrinth (Rodriguez et al., 2004). In mouse, the irregularity in placental form of Cited1 null placentas is associated with poor feto-maternal nutrient-waste exchanges. This placental insufficiency results in inadequate oxygenation of the conceptus, impacting greatly on the developing kidneys to result in renal medullary dysplasia (Sparrow et al., 2009). The embryonic renal deficit may explain the perinatal pup death observed in Cited1 mutants. On account of placental phenotype and overlap expression of Cited1 and Cited2 in the mouse, it was proposed that these two CITED gene family members may compensate one another. However, compound deletion of both Cited1 and Cited2 revealed that Cited1 genotype did not affect the Cited2 null placental phenotype, suggesting that these two CITED genes function independently (Withington et al., 2006).

3.5.2 Cited2 is necessary in mouse placental development

During mouse development, Cited2 is expressed in extraembryonic components with several descriptions already published (Dunwoodie et al., 1998, Withington et al., 2006) and is the focus of this study. By way of RNA in situ hybridisation, Cited2

100 was initially found to be expressed in extraembryonic mesoderm and endoderm that give rise to the placenta, as well as the developing blood islands of the visceral yolk sac (Dunwoodie et al., 1998). Exploiting the Cited2ΔlacZ mouse strain, in which the lacZ reporter gene has been genetically engineered to be under the control of endogenous Cited2 regulatory elements, has permitted further characterisation of Cited2 expression in the placenta (Withington et al., 2006). This allele was created by removing exon 2, which encodes the entire Cited2 coding region, and substituting in this locus a lacZ-reporter gene encoding the β-galactosidase enzyme (Martinez- Barbera et al., 2002). As a result, Cited2ΔlacZ is rendered a Cited2 null allele as it is biologically incapable of making Cited2 transcript, and therefore conceptuses homozygous for the Cited2ΔlacZ allele are null for Cited2. Alternatively, lacZ is expressed in cells that would have otherwise expressed Cited2 on account of the influence of the endogenous Cited2 enhancer and promoter elements. Placentas lacking Cited2 were generated by intercrossing mice heterozygous for the Cited2ΔlacZ allele (Withington et al., 2006). In this particular study, Cited2 was shown to be expressed in TGCs, SpT, GlyT cells and in the fetal endothelial cells of the labyrinthine layer. In agreement with these observed domains of Cited2 expression, Cited2 is expressed in the appropriate precursor placental tissues at earlier developmental timepoints: in the extraembryonic allantoic mesoderm (which gives rise to the fetal vasculature of the placenta); and the ectoplacental cone (the placental tissue in which many trophoblast cell subtypes are derived).

Cited2 activity is required for normal placentation; loss of Cited2 in the mouse causes abnormal placental development and contributes to embryonic demise at midgestation (Withington et al., 2006). Specifically, the total size and weight of Cited2 deficient placentas are smaller than wildtype controls (Withington et al., 2006). In addition to this, Cited2 null placentas exhibit fewer TGCs, SpT and invasive GlyT cells. Also, the fetal vasculature of Cited2 nulls is abnormally patterned, exhibiting: an expanded labyrinth characterised by poor elaboration of capillaries; and poor mural cell investment that suggests vascular immaturity. Moreover, the yolk sac (an extraembryonic tissue that aids embryo survival early in gestation) of these mutants 101 are poorly vascularised. The territories of Cited2 expression coincide with the cellular compartments heavily affected in the Cited2 null placental phenotype.

3.6 Aims and hypothesis

Previous published work provides a global understanding of Cited2 expressivity in the mouse placenta (Withington et al., 2006). To date, the exact placental cell types in which Cited2 is expressed remains elusive. Furthermore, there is a lack of molecular data to explain the placental phenotype seen in Cited2 null placentas. To this end, the aims of this study were to: perform a detailed expression analysis of Cited2 at the cellular level using the Cited2ΔlacZ mouse with the novelty of double labelling to confirm cell types; and, to investigate the effect of Cited2 deletion on mural cells in the labyrinth at a later timepoint in development, as well as the protein expression profiles of key signalling molecules to gain a molecular understanding of the Cited2 null placental phenotype.

3.7 Results

3.7.1 Cited2 is expressed in mural and endothelial cells within the labyrinth of the mouse placenta

As outlined earlier, studies into Cited2 expression highlighted its ubiquity in extraembryonic tissues. Cited2 was shown to be expressed in P-TGC, SpT, GlyT cells and suggested to be expressed in fetal endothelial cells of the labyrinthine layer (Withington et al., 2006) (Table 3.3). However, these expression analyses did not define Cited2 expression in mural cells: vascular smooth muscle cells in arteries, arterioles and veins; and pericytes in capillaries. Therefore, similarly taking advantage of the Cited2ΔlacZ mouse, placentas heterozygous and homozygous for the Cited2ΔlacZ allele at 14.5 dpc were examined for Cited2 expression in these cellular compartments. Antibodies against α-SMA and β-galactosidase were applied in situ on placental sections, to identify mural cells and cells which would have otherwise expressed Cited2, respectively. Alpha-SMA staining marked out the bodies of mural

102 cells (Figure 3.6), while β-galactosidase staining appeared punctate (Figure 3.6). Cells doubly positive for α-SMA and β-galactosidase were observed in the placenta. Viewed for the first time at the cellular level, it was also confirmed that Cited2 is expressed in endothelial cells marked by the surface marker, Pecam1 (Figure 3.6). Cited2 expression in mural cells is greater than that observed in endothelial cells.

3.7.2 Cited2 is expressed in syncytiotrophoblasts and sinusoidal trophoblast giant cells of the labyrinthine layer of the mouse placenta

Applying a similar strategy to identify Cited2 expression in mural cells (refer to Section 3.7.1), the same antibody against β-galactosidase was used to ascertain Cited2 cellular expression in other placental cells. Using Hoechst to counterstain for nuclei, S-TGCs were identified by their mononuclear appearance and their location surrounding maternal sinusoids that neighbour endothelial-lined fetal vessels, while SynT cells were identified by their distinct location between endothelial cells and the large mononuclear S-TGCs. These nuclei co-localised with β-galactosidase positivity, indicating that Cited2 is expressed in SynT cells of the mouse placenta (Figure 3.7). Moreover, S-TGCs that line maternal sinusoids were observed to co- localise with β-galactosidase to indicate Cited2 is also expressed in S-TGCs (Figure 3.7). This is the first report of the cellular expression of Cited2 in the trilaminar arrangement of trophoblast in the mouse placental labyrinth (Table 3.3).

103

Table 3-3 Comparison of previous and current characterisation of Cited2 null placentas

Placental cell type Cited2ΔlacZ Cited2ΔlacZ Withington1 Artap

Parietal TGC + nd

Spongiotrophoblasts + nd

Glycogen cells + nd

Canal TGC + nd

Sinusoidal TGC nd +

Syncytiotrophoblasts nd +

Endothelial cells nd +

Mural cells nd +

1 Withington et. al., 2006 (Developmental Biology). Abbreviation: nd, not determined.

Figure 3.6 Cited2 is expressed in vascular endothelial and mural cells. Confocal photomicrographs of the mid-section of a 14.5 dpc placenta (n=5) showing the intimate relationship between fetal endothelial and mural cells of the vessels within the labyrinth. Sections were counterstained using Hoechst (A and F) to visualise nucleated fetal red blood cells (frbc) within fetal vessels (fv) composed of endothelial and mural cells, maternal sinusoidal trophoblasts (arrowhead) surrounding maternal sinusoids (ms), and individual nuclei within the syncytium of syncytiotrophoblast cells (arrows). Cited2ΔlacZ positive cells (green) were identified using a β-galactosidase antibody (B) (Inset to the bottom right is a zoomed image of the area bounded by the white box in panel B). Mural cells (red) were identified by α-SMA-positivity (C), whilst endothelial cell bodies (blue) were demarcated by positivity for Pecam1 (a cell surface marker) (D). The merged image (E) (as well as the inset at the bottom right depicting a zoomed image of the area bounded by the white box in panel E) was generated using the ImageJ software and shows expression of Cited2 in both endothelial and mural cells (compare panels B,C and D; as well as comparing the insets in panels B and E) . Expression of β-galactosidase in mural cells is much greater than in endothelial cells. Available and appropriate negative controls on serial sections were performed in parallel: a rabbit IgG antibody to determine the specificity of the rabbit β-galactosidase antibody (G), and a no 1o antibody (Ab) negative control to ascertain the non-specific binding of the secondary antibody that detects the mouse α-SMA antibody (H) and the rat Pecam1 antibody (I). The merged image (J) was similarly generated using the ImageJ software. Scale bar: 20μm (A-E).

Figure 3.7 Cited2 is expressed in syncytiotrophoblasts and maternal sinusoidal trophoblast giant cells of the placental labyrinth. Confocal micrographs of the mid-section of a 14.5 dpc placenta (n=5) in the labyrinth showing the close relationship between trophoblast-lined maternal sinusoids and endothelial-lined fetal vessels. Sections were counterstained using Hoechst (A) to show nucleated fetal red blood cells (frbc) within fetal vessels (fv), maternal sinusoidal trophoblasts surrounding maternal sinusoids (ms), and the nuclei within the syncytium of syncytiotrophoblast cells. Cited2ΔlacZ positive cells (green) were identified using a β- galactosidase antibody (B). Endothelial cell bodies (blue) were demarcated by positivity for the cell surface marker, Pecam1 (C). The merged images (D) and (E) were generated using the ImageJ software. Available and appropriate negative controls on serial sections were performed in parallel: a rabbit IgG antibody to determine the specificity of the rabbit β-galactosidase antibody (F), and a no 1o antibody (Ab) negative control to ascertain the non-specific binding of the secondary antibody that detects the rat Pecam1 antibody (F). A merged and zoomed in image from another placental section (I) illustrating nucleated frbc within fv, and the expression of Cited2ΔlacZ positive cells (green) in maternal sinusoidal trophoblasts (arrowhead) surrounding ms, and syncytiotrophoblast cells (arrows) separating these two compartments. Scale bar: 100μm in A-H; 20μm in I.

3.7.3 Mouse placentas null for Cited2 have disorganised mural cell deposition around capillaries and large fetal vessels of the placental labyrinth

Reported previously, at 11.5 dpc of gestation, the capillaries and larger vessels of the fetal vasculature of placentas null for Cited2 had disorganised coverage of pericytes and smooth muscle cells, respectively. In this study, this aspect of placental development was further interrogated in Cited2 null placentas at 14.5 dpc of development. The degree of mural cell investment around capillaries, and moderately- and large-sized vessels in the labyrinth (Figure 3.8) were assessed by doubly immunostaining mouse placental cryosections with α-SMA and Pecam1 antibodies. Pecam1 served to mark out the cellular body of endothelial cells, while α- SMA outlined the mural cells that together constitute mature blood vessels.

The documented disorganisation in α-SMA-positive mural cells in the placental bed of Cited2 null placentas at 11.5 dpc (Withington et al., 2006) was recapitulated at 14.5 dpc of gestation. In the labyrinthine region proximal to the junctional zone (comprised of SpT and GlyT cells) of Cited2 wildtype placentas, endothelial-lined capillaries are organised into “loops” (Figures 3.9 and 3.10). In between these capillary loops are pericyte clusters that appear to affix the loops to one another to maintain structural order. These observations are consistent with published reports (Ohlsson et al., 1999). Similarly, the labyrinth of placentas heterozygous for the Cited2ΔlacZ allele was akin to those of Cited2 wildtype placentas (Figure 3.10). However, the lumenal caliber of capillaries in the Cited2 null placental labyrinth appeared enlarged consistent with the findings of Withington et. al. (2006). Concurrent with these enlarged vessels is a paucity of pericyte envelopment. Capillary loops were still observed but to a lesser extent than wildtype placentas (Figure 3.10). In much the same way, mid-sized vessels within the labyrinthine zone of Cited2 null placentas had sparse envelopment of endothelial-lined vessels by mural cells (Figure 3.11). Larger vessels towards the base of Cited2 null placenta were also poorly ensheathed by mural cells (Figure 3.12). Taken together this indicates that

110 there are widespread vascular endothelial deficits in Cited2 null placentas, and that the defects are concurrent with abnormal mural cell deposition.

111

Figure 3.8 The fetal vasculature of the mouse placenta Depicted are the fetal vessels and its location in the labyrinthine zone (Lab) with respect to the other the placental layers such as the maternal decidua (Dec); and the junctional zone comprised of trophoblast giant cells (TGC) and spongiotrophoblast (Sp). The green arrows show the direction of blood flow, where oxygen-poor blood from the fetus is carried from large arteries at the base of the placenta into moderately sized arterioles through the labyrinth towards the maternal side, prior to branching into capillaries where gas exchange occurs with the maternal sinusoids. The now oxygen-rich blood is carried by the fetal venous system en route to nourish the fetus. This figure is adapted from Adamson et. al., 2002.

Figure 3.9 Schematic of capillary loops in the mouse placenta (A) Illustration of the organisation of microvessels into capillary loops in the mouse placental labyrinth. Endothelial cell-lined fetal vessels (yellow and orange) are restricted in their vessel caliber and held tightly together by “islands” of pericytes (black). This pattern of arrangement facilitates adequate nutrient exchange/excretion between fetal vessels and maternal lacunae (pink) that are interspersed between labyrinthine trophoblasts (blue). (B) Depicts Pdgfb null and Pdgfrb null placental labyrinths that both exhibit reduced pericyte coverage (black) to result in a correlated dilation of fetal vessels (yellow and orange). This figure is taken from Ohlsson et. al., 1999 (Developmental Biology).

Figure 3.10 Placentas null for Cited2 have poor pericyte investment around capillaries in the placental labyrinth. Confocal micrographs depicting capillaries within 14.5 dpc mid-placental sections (n=3) by co-staining with α-SMA (green) (A, E, I) and Pecam1 (red) (B, F, J). Counterstaining with TO-PRO®-3 (C, G, K) allowed visualisation of nucleic acids (blue). Images were merged (D, H, L) using the ImageJ software. Cited2+/+ placentas (A-D) displayed the typical pattern of microvascular beds made up of regularly sized Pecam1-positive (red) endothelial-lined capillaries held together by α-SMA-positive (green) pericytes into capillary loops (Inset in panel D). In a similar manner, Cited2ΔlacZ/+ placentas (E-H) had comparably uniform capillary vessels intercommunicated by pericytes that served to keep them in order. In contrast, Cited2ΔlacZ/ΔlacZ placentas (I-L) displayed less pericyte coverage (I). Vessels that had little or no pericyte investment appeared enlarged (refer to J and inset in panel L). Scale bar: 40μm (A-L).

Figure 3.11 Placentas null for Cited2 have poor smooth muscle cell coverage of moderately sized fetal vessels in the placental labyrinth. Confocal micrographs showing mid-sized vessels in 14.5 dpc mid-placental sections (n=3) by co-staining with α-SMA (green) (A, E, I) and Pecam1 (red) (B, F, J). Counterstaining with TO-PRO®-3 (C, G, K) enabled demarcation of nucleic acids (blue). Images were merged (D, H, L) using the ImageJ software. Cited2+/+ (A-D) and Cited2ΔlacZ/+ (E-H) placentas exhibited normal Pecam1- positive endothelial-lined (red) mid-sized vessels with adequate α-SMA-positive (green) mural cell investment running the entire vessel length (inset in panels D and H). However, Cited2ΔlacZ/ΔlacZ placentas (I-L) appeared to have larger, non-uniform vessels with sparse mural cells covering them (inset in panel L). Scale bar: 40μm (A-L).

Figure 3.12 Placentas null for Cited2 have less smooth muscle cell investment around large-sized vessels at the base of the placenta. Confocal micrographs showing large vessels at the base of 14.5 dpc mid-placental sections (n=3) by co-staining with α-SMA (green) (A, E, I) and Pecam1 (red) (B, F, J). Counterstaining with TO-PRO®-3 (C, G, K) enabled demarcation of nucleic acids (blue). Images were merged (D, H, L) using the ImageJ software. Cited2+/+ (A-D) and Cited2ΔlacZ/+ (E-H) placentas showed Pecam1-positive endothelial-lined (red) large-sized vessels with well endowment of α-SMA-positive (green) mural cells. In contrast, Cited2ΔlacZ/ΔlacZ placentas (I-L) appeared to have fewer mural cells surrounding the large vessels. Scale bar: 40μm (A-L).

3.7.4 Alpha-smooth muscle actin expression is not reduced, but the ratio of α- SMA expressing mural cells to Pecam1 expressing endothelial cells are disorganised in Cited2 null placentas.

The immunohistochemical analysis presented above shows perturbed mural cell investment of vascular endothelial cells in Cited2 null placentas. In order to quantify this qualitative observation, α-SMA protein was quantified by western blot. In Cited2 null placentas, α-SMA protein expression was not statistically different compared to heterozygous control placentas (Figure 3.13, Q). Protein blots were checked for equal loading by assaying for tubulin beta (Tubb, hereinafter referred to as β-tubulin) protein expression; the β-tubulin antibody used recognises three mouse beta isoforms (Tubb1, Tubb2a and Tubb2c) that all run at the same molecular weight and cannot be discerned from one another.

Furthermore, on account of the intimate apposition of α-SMA expressing mural cells and Pecam1 expressing endothelial cells, the ratio of the amount of fluorescently labelled α-SMA to the amount of fluorescently labelled Pecam1 in the whole placental labyrinthine area was determined to gain insight into mural cell coverage of endothelial-lined vessels. The ratio of α-SMA:Pecam1 for a placental specimen was determined as an average value from at least three serial sections, with at least one section being the middle of the placenta distinguished by the presence of the umbilicus. The ratio of α-SMA:Pecam1 is decreased in Cited2 null placentas compared to heterozygous control placentas (Figure 3.13), suggesting disorganised vessels. This is in agreement with the observed disruption to α-SMA-positive mural cells in the placental bed of the Cited2 null placenta at 11.5dpc (Withington et al., 2006) and 14.5 dpc (refer to Section 3.7.3).

3.7.5 Various signalling pathways are perturbed in Cited2 null placentas

The results presented thus far have shown that Cited2 is expressed in trophoblast derivatives as well as vascular endothelial and mural cells of the placental labyrinth, and that these compartments are perturbed in placentas lacking Cited2. To begin to

122 understand the molecular defects in Cited2 null placentas, the molecular effectors that control cellular proliferation, differentiation, migration and apoptosis as well as pertinent signalling axes were studied. The protein expression profiles of important signalling molecules in the mouse placenta were investigated by western blot, with all checked for equal loading of total protein using β-tubulin. The relevant pathways and their related transducing molecules studied were chosen based on the presence of a placental phenotype in independent knockout mouse studies. This investigation was centred on placentas at 14.5 dpc as this represents a stage of placental maturity when the labyrinthine layer is well developed.

123

Figure 3.13 Placentas null for Cited2 do not have significantly different protein expression of α-SMA, although the ratio of α-SMA expressing mural cells to Pecam1 expressing endothelial ce]ls is disorgansied. Whole placental sections of Cited2ΔlacZ/+ (n=3) and Cited2ΔlacZ/ΔlacZ (n=5) were stained with Pecam1 (A,D, J and M) and α-SMA (B, E, K and N) to identify endothelial and mural cells, respectively. The merged images (C, F, I, L and O) were generated using the ImageJ software. Appropriate negative controls on serial sections were performed in parallel: a no 1o antibody (Ab) negative control to ascertain the non-specific binding of the secondary antibody that detects rat Pecam1 antibody (G) and the mouse α-SMA antibody (H). Also depicted are zoomed images of the labyrinth of control Cited2ΔlacZ/+ heterozygous placentas (J-L) and Cited2ΔlacZ/ΔlacZ null placentas (M-O). Scale bar: 200μm in A-I; 20μm in J-O. The amount of fluorescently labeled α-SMA expressing mural cells (green) and Pecam1 expressing endothelial cells (blue) in the whole placental labyrinth and their ratios (red) are represented (P). A Student’s t-test was performed to compare differences between the two genotypes (* p ≤ 0.05). Whole tissue lysates from Cited2ΔlacZ/ΔlacZ (n=5), Cited2ΔlacZ/+ (n=5) and Cited2+/+ (n=6) placentas were also assessed for α-SMA expression by western blot (Q). Representative blots for each genotype are depicted, with β-tubulin used as a loading control. The bands were quantified and normalised to the β-tubulin controls to give arbitrary units (AU). It is also graphically demonstrated with each point representing each placenta, and the mean (middle line) and standard error of the mean (SEM) also shown. One-way analysis of variance was performed (p-values reported to 2 significant figures).

3.7.5.a Pdgfb ligand and Pdgfrb protein levels are not disrupted in Cited2 null placentas

As described earlier, Pdgfb-Pdgfrb is important for maturing vessels as it functions to recruit mural cells to nascent vessels. Briefly, Pdgfb is released by endothelial cells that recruit mural cells through communication with Pdgfrb present on the mural cell surface. Based on the observed poor pericyte and smooth muscle cell coverage, it was reasoned that Pdgfb-Pdgfrb signalling may be perturbed in Cited2 null placentas. Therefore, the protein levels of both the ligand and receptor were determined by western blot. There is no statistically significant difference in the protein levels of Pdgfb between Cited2 null, heterozygous or wildtype placentas. Similarly, expression of Pdgfrb was not different in Cited2 null or heterozygous placentas as measured against wildtype controls (Figure 3.14). Protein expression was normalised to β-tubulin protein expression that served as a loading control.

3.7.5.b Vegfr2 protein levels are unperturbed in Cited2 null placentas

The differentiation of endothelial cells and their subsequent formation into vessels is contingent on adequate Vegf-Vegfr2 signalling. Vegfr2 is necessary for embryo survival as deletion of Vegfr2 results in catastrophic arrest of the endothelial and haematopoietic development (Shalaby et al., 1995). In the 9.5 dpc mouse placenta, Vegfr2 is expressed in endothelial cells of the labyrinth, and to a lesser extent in trophoblast derivatives of the junctional zone. It is also described that through Vegfr2-expressing cells, Vegfa enhances Pdgfb expression in endothelial cells, and simultaneously Fgf2 enhances Pdgfrb expression in mural cells to synergistically promote angiogenesis (Kano et al., 2005). Dysregulation in this vascular signalling axis may explain the potential increase in Pdgfb expression in Cited2 null placentas, and therefore the protein expression of Vegfr2 was probed. Vegfr2 expression in Cited2 null and heterozygous placentas is unperturbed as assessed against wildtype placentas (Figure 3.15).

126

Figure 3.14 Placentas null for Cited2 have unaltered Pdgfb-Pdgfrb protein expression. Whole tissue lysates from Cited2ΔlacZ/ΔlacZ (n=5), Cited2ΔlacZ/+ (n=6) and Cited2+/+ (n=7) placentas were evaluated for Pdgfb ligand protein expression by western blot. Similarly, Pdgfrb protein expression was also investigated in Cited2ΔlacZ/ΔlacZ (n=5), Cited2ΔlacZ/+ (n=6) and Cited2+/+ (n=7) placentas. Representative blots for each genotype are shown. On the same protein blots, β-tubulin was used to ascertain equal protein loading. The intensities in arbitrary units (AU) are also illustrated graphically showing mean (middle line), standard error of the mean (SEM) and each placenta depicted by each point. One-way analysis of variance was performed (p-values reported to 2 significant figures).

128

Figure 3.15 Vegfr2 protein expression is not perturbed in Cited2 null placentas. The protein expression of Vegfr2 in whole tissue lysates from Cited2ΔlacZ/ΔlacZ (n=5), Cited2ΔlacZ/+ (n=5) and Cited2+/+ (n=6) placentas was investigated by western blot. Representative blots for each genotype are shown. On the same protein blots, β- tubulin was used to determine equal protein loading. The intensities in arbitrary units (AU) are also illustrated graphically showing mean (middle line), standard error of the mean (SEM) and each point denoting each placenta. One-way analysis of variance was performed (p-values reported to 2 significant figures).

130

3.7.5.c Mapk3 and Mapk1 and their downstream direct target Elk1 are differentially perturbed in Cited2 null placentas

Mitogen-activated protein kinase 3 (Mapk3 also known as Elk related tyrosine kinase 1, Erk1 and p44mapk) and mitogen-activated protein kinase 1 (Mapk1 also known as Elk related tyrosine kinase 2, Erk2 and p42mapk) are members of the widely conserved Mitogen-Activated Protein Kinases (MAPKs) family of serine/threonine kinases, involved in directing cellular proliferation, differentiation, motility and death. The MAPK signalling pathways can be activated by a spectrum of extracellular stimuli which causes a cascade of kinase activity; lying at the bottom of this signalling cascade are Mapk3 and Mapk1. Many of the angiogenic relevant ligand-receptor systems such as Pdgfb-Pdgfrb and Vegf-Vegfr2 converge on Mapk3 and Mapk1 in order to transduce the morphogenic signals. Therefore, the level and activity of the Mapk3 and Mapk1 were determined by western blot.

The total levels of Mapk3 and Mapk1 are unchanged between placentas null, heterozygous and wildtype for Cited2 (Figure 3.16). However, Mapk3 and Mapk1 are differentially activated in Cited2 null, heterozygous and wildtype placentas as assessed by their phosphorylation; Mapk1 activity is elevated (normalised to total Mapk1) in Cited2 null placentas compared to wildtype placentas (Figure 3.16). Mapk3 activity (phosphorylated Mapk3 normalised to total Mapk3) was also moderately increased in Cited2 null compared to heterozygous and wildtype placentas, although this was not statistically significant.

ELK1, member of the ETS oncogene family (Elk1) encodes a transcriptional factor that mediates gene activity in response to many growth factors (Hill and Treisman, 1995, Kortenjann et al., 1994, Marais et al., 1993). The carboxy terminus of Elk1 contains the transcriptional activation domain, which becomes activated upon phosphorylation by MAPKs (Marais et al., 1993). Given the differential expression of Mapk1 in Cited2 null placentas; and that Elk1 is shown to be a direct target and good substrate for MAPKs, the level of phosphorylation of Elk1 was explored to determine Elk1 activity. The amount of

132

Figure 3.16 MAPK signalling is increased in placentas null for Cited2. Whole tissue lysates from Cited2ΔlacZ/ΔlacZ (n=5), Cited2ΔlacZ/+ (n=6) and Cited2+/+ (n=7) placentas were analysed for the phosphorylation status of proteins involved in MAPK signalling by western blot. Representative blots of each gentoype for each molecule are shown. The same protein blots were probed for β-tubulin as a loading control. The level of Mapk3 and Mapk1 phosphorylation (p-Mapk3/1) were normalised to the total Mapk3 and Mapk1 (t-Mapk3/1) protein levels. The antibody used to detect MAPKs recognises both Mapk1 and Mapk3. For phosphorylated Elk1 (p-Elk1), whole tissue lysates from Cited2ΔlacZ/ΔlacZ (n=3), Cited2ΔlacZ/+ (n=4) and Cited2+/+ (n=5) placentas were analysed and the levels were normalised to β-tubulin loading controls. The intensity levels in arbitrary units (AU) were also graphed with individual circles representing the normalised intensity values for each placenta, depicted are the mean normalised intensity (middle line) and standard error of the mean (SEM). One-way analysis of variance was performed, and significance was determined using Tukey’s post hoc test to identify differences between genotypes (*p ≤ 0.05, with p-values reported to 2 significant figures).

134

Elk1 activity, as judged by the level of phosphorylated Elk1 normalised to β-tubulin loading control, was not significantly different between Cited2 null, heterozygous and wildtype placentas (Figure 3.16).

3.7.5.d Thymoma viral proto-oncogene 1 (Akt1 also known as PKBalpha) protein expression is abnormal in Cited2 deficient placentas

Akt1 is a serine/threonine protein kinase that is a major downstream target of phosphatidylinositol 3-kinase (Pik3 also known as PI3K). The Pik3-Akt1 signalling axis is implicated in regulating transcription and angiogenesis, with Pi3k being activated by Vegfa and ANGPTs, and subsequently inducing the expression of vascular important genes such as HIF1 and Vegfa (Jiang and Liu, 2009). Cited2 is known to be a negative regulator of HIF1 through competition with the closely related transcriptional co-activating proteins CREB binding protein (Crebbp also known as Cbp) and E1A binding protein p300 (Ep300 also known as p300) (Bhattacharya et al., 1999), it is thus possible that Cited2 may interact with the Pik3- Akt1 signalling system in the placental angiogenic process. Therefore, Akt1 activity in these Cited2 null placentas was investigated. Akt1 activity is elevated in Cited2 null placentas compared to heterozygous control placentas as evidenced by the increase in the phosphorylated form of Akt1 (Figure 3.17).

3.8 Discussion

This examination verifies that Cited2 is present in a number of placental cells, and for the first time shows the cellular expression of Cited2 in trophoblast derivatives as well as vascular cells. The vascular defects observed in Cited2 null placentas are further scrutinised. Moreover, the significance of the perturbations to a number of molecular effectors in Cited2 null placentas in multiple cell compartments is explored.

136

Figure 3.17 Placentas null for Cited2 have perturbed Akt1 protein expression. Whole tissue lysates from Cited2ΔlacZ/ΔlacZ (n=5), Cited2ΔlacZ/+ (n=6) and Cited2+/+ (n=7) placentas were analysed for the phosphorylation state of Akt1 by western blot. Representative blots of each gentoype for each molecule are shown, with the same protein blots probed with β-tubulin as a loading control. The level of phosphorylated Akt1 (p-Akt1) was normalised to total Akt1 (t-Akt1) protein levels. The intensity levels in arbitrary units (AU) were also graphed with individual circles representing the normalised intensity values for each placenta, depicted are the mean normalised intensity (middle line) and standard error of the mean (SEM). One-way analysis of variance was performed, and significance was determined using Tukey’s post hoc test to identify differences between genotypes (*p ≤ 0.05, with p-values reported to 2 significant figures).

138

3.8.1 Cited2 is expressed in vascular and trophoblast cell subtypes of the mouse placenta

Detection of β-galactosidase activity in mouse tissues harbouring the Cited2ΔlacZ allele provides a swift method for locating cells fated to express Cited2 due to the stability of the enzyme (perdurance). It is this feature that confers a robust readout compared to the unstable transcriptional message used in RNA in situ hybridisation. However, this enzymatic stability is a double-edged sword; the strong signal from β- galactosidase is widely used for spatially visualising gene products; but this assay cannot provide temporal or quantitative information as the output from the lacZ reporter represents the cumulative transcriptional activity due to the perdurance of the β-galactosidase protein. Therefore, it cannot give information on the history of gene activity (whether it was on or off and/or the duration of activity) at the time of assaying. Notwithstanding, this strategy has been proven to facilitate exploration of sites of Cited2 expression (Martinez-Barbera et al., 2002, Weninger et al., 2005, Withington et al., 2006); the spatial pattern of the Cited2ΔlacZ allele agrees with Cited2 transcript localisation (Dunwoodie et al., 1998). Another means of analysing Cited2 expression is to document the localisation of the protein. Our laboratory has tested a number of commercially available antibodies against Cited2 without success.

Despite the limitations of the lacZ reporter approach in its inability to provide information on temporal gene activity, it does offer valuable information on spatial transcriptional activity. The expression analysis performed in Section 3.7.1 represents the first cellular localisation of Cited2 in vascular cells. On account of the presence of β-galactosidase positivity, Cited2 is expressed in both α-SMA-positive mural cells and Pecam1-positive endothelial cells, with greater expression in mural cells. These two cellular compartments are closely apposed, separated only by a basement membrane, and can signal to one another. Knowing that Cited2 is expressed in both cell types should aid in discerning the vascular cell-specific roles of Cited2 in vessel development of the mouse placenta. Conceivably, Cited2 may be primarily required in endothelial cell development that is independent of a direct necessity for Cited2 in mural cells. Alternatively, owing to the intercellular

140 communication that occurs between these two vascular cells, cell-specific deletion of Cited2 in either vascular compartment may have secondary paracrine cellular effects on the other. This can be addressed by cell-specific conditional deletion of Cited2. There exists two vascular cell-specific mouse Cre lines – the endothelial-specific Tie2-Cre (Koni et al., 2001) and the mural cell-specific Sm22alpha-Cre (Lepore et al., 2005, Miano et al., 2004) – that should be amenable in addressing these questions. In fact, the endothelial cell-specific role of Cited2 in fetal placental development will be addressed using the Tie2-Cre line and discussed in the next chapter. One might expect varying phenotypic severity upon conditional deletion of Cited2 in either endothelial or mural cells owing to the differing degrees of Cited2 expression in these cell types.

In addition to the vascular cell expression of Cited2, this study also revealed for the first time the cellular expression of Cited2 in SynT cells and S-TGCs. However, whether Cited2 is expressed in either SynT-I, or SynT-II, or both cell layers remains to be determined. The current resolution did not allow the SynT layers to be distinguished. As stated in Section 3.2.3, it is reported that the trophoblasts that reside in the labyrinth (S-TGCs, SynT-I and SynT-II) arise from distinct precursors within the chorion and ectoplacental cone (Simmons et al., 2008a). An initial observation was made reporting poor chorioallantoic interaction as assessed by reduced buckling in Cited2 nulls but would later appear to be overcome with the formation of an elaborate labyrinth (Withington et al., 2006). This initial poor tissue communication may have, as yet to be determined, morphological effects on the labyrinthine trophoblast development. Although, this is probably unlikely as the trilaminar labyrinthine trophoblast precursors are patterned quite early on prior to and just at the beginning of allantoic interaction with the chorion by 8.5 dpc. Therefore, it must be determined whether the allantois plays a crucial role in the patterning the chorionic trophoblast precursors through a paracrine manner or by direct cell-cell interactions.

141

Based on resin casts of maternal blood spaces, there are no major defects observed in this compartment of Cited2 null placentas (Withington et al., 2006). However, this does not exclude the possibility that S-TGCs that line maternal sinusoids and the closely associated SynT cells are improperly patterned in Cited2 null placentas. Moreover, presuming S-TGCs and SynT cells are patterned appropriately, it still cannot be excluded that cell signalling in these Cited2 deficient trophoblast populations are not perturbed. The number and morphology of S-TGCs and SynT cells in Cited2 null placentas is important to ascertain as they have the ability to regulate the endothelial cells of the adjacent fetal vessels through the action of cathepsin proteases. Cathepsin D is capable of cleaving Prl (an angiogenic hormone) into shorter fragments that have anti-angiogenic activity (Lkhider et al., 2004, Piwnica et al., 2004, Struman et al., 1999); S-TGCs are demonstrated to express the placenta-specific cathepsin protease, Ctsq, which may cleave a number of the placental PRLs to inhibit labyrinthine endothelial cells and maintain the trilaminar arrangement of trophoblasts. This is an interesting line of thought as Cited2 is present in Ctsq-expressing S-TGCs, and it may explain the dysregulation in fetal endothelial cells of Cited2 null placentas. Conceivably, a lack of Cited2 may impact on Ctsq expression, limiting the bioprocessing of placental relevant PRLs and allowing unregulated endothelial cell development. To date, there has been no formal study done to assess the extent of S-TGC and SynT cell development in Cited2 null placentas. Although, attempts were made using labyrinthine trophoblast cell type- specific RNA in situ markers to determine adequate cell numbers and morphology in this PhD candidature (Simmons et al., 2008a) to address this lack of knowledge (not shown). Therefore, this will require re-visiting and optimisation in order to ascertain if Cited2 plays a role in S-TGC and SynT cell ontogeny.

3.8.2 Endothelial and mural cells in the developing fetal vessels of the mouse placenta are altered in the absence of Cited2

This study, for the first time, has allowed the endothelial and mural cell phenotypes of Cited2 null placentas to be studied simultaneously. In doing so, the abnormally

142 enlarged endothelial-lined vessels in Cited2 null placentas were observed to be connected with insufficiency in mural cells. In spite of the insignificant difference in α-SMA expression between Cited2 null and control placentas , evidence for disorganised mural cell vascular coverage is provided by the altered α-SMA:Pecam1 ratio. Briefly, dilated fetal vessels were associated with poorly invested mural cells in Cited2 null placentas. The disorganisation of mural cells in Cited2 null placentas can explain the vascular dysplasia observed in these mutant placentas; this should come as no surprise as mural cells function to regulate the proliferation, survival, migration, differentiation and branching of endothelial cells (Carmeliet, 2003). Previous observations of expanded and disorganised placental vessels in Cited2 null placentas (Withington et al., 2006) required the use of resin casts and scanning electron microscopy that proved long and laborious. This particular methodology did not allow inquiry into the intimate relationship that exists between the endothelial and mural cells of the placental vasculature. The approach taken in the current study - doubly immunolabelling both cellular compartments and using confocal microscopy - proved to be a swift method and amenable to studying the close cellular relationship between endothelial and mural cells in tandem. It should also be noted that this approach is the first account, to our knowledge, of imaging of the whole placental section by confocal microscopy.

The current analysis into the mural cell defect in Cited2 null placentas at 14.5dpc extends the previous work (Withington et al., 2006) to deduce that the paucity in mural cells first seen at 11.5 dpc, associated with the enlarged endothelial-lined vessels, is not rectified with further development. The poor investment of mural cells seen in Cited2 null placentas indicates Cited2 is necessary for various aspects of vessel stabilisation and maturation. Conceivably, Cited2 being a transcriptional co- factor may interact with various factors to directly or indirectly affect molecular effectors controlling cellular proliferation, differentiation, migration and/or apoptosis. Therefore, loss of Cited2 may have deleterious effects on both endothelial and mural cell development. In exploring possible explanations for the Cited2 placental vascular defects it is plausible that there is reduced mural cell proliferation and 143 differentiation that fall short in number to sufficiently envelope and be able to properly mature vessels. Alternatively, proliferation and differentiation of mural cells may be normal in the placental bed of Cited2 nulls, but they may have altered migratory abilities and/or poor receptivity to recruiting factors and thus incapable of surrounding nascent vessels to mature them. In either case, owing to the fact that mural cells limit endothelial cell proliferation, the result may be to dysregulate endothelial development and result in dilated fetal vessels. Although, given the expression of Cited2 in both endothelial and mural cells, this then prompts the question: In which vascular cells is Cited2 primarily required? As stated in the previous section, it is plausible that there may be a requirement for Cited2 in either endothelial or mural cells that is mutually exclusive from one another. Alternatively, on account of the complex paracrine signalling that occurs between these two vascular cell types, cell-specific deletion of Cited2 may have secondary effects on the other; a complex heterotypic cellular regulation may exist. Vascular spatial conditional deletion of Cited2 using the Cre-lox system should elucidate this.

Despite the reduced investment of mural cells around vessels, Cited2 null placentas still develop an elaborate vascular network, albeit structurally poor. This would indicate that these malformed placental beds are competent in carrying out the vasculogenic process, though potentially be defective in angiogenic remodelling. Given that HIF directly target genes involved in angiogenesis (Mole et al., 2009, Xia et al., 2009), and the fact that Cited2 is a HIF-responsive gene (Bhattacharya et al., 1999, Wenger et al., 2005), it is plausible that a HIF-Cited2 regulatory axis for angiogenic remodelling in the mouse placenta may exist. Indeed, hypoxic cells are present in the developing mouse placenta, and deletion of HIF components result in poor vascularisation of the mouse placenta (Abbott and Buckalew, 2000, Adelman et al., 2000, Kozak et al., 1997) that is consistent with this argument. Previous work show hypoxic trophoblast cells types, but not labyrinthine cells, in the 14.5 dpc mouse placenta using the drug, pimonidazole (Withington et al., 2006). However, this does not preclude the possibility that some or all labyrinthine cells are hypoxic earlier in development, and thus warrants study into the oxygen levels experienced by 144 these cells during midgestation. Moreover, a caveat when using pimonidazole is that it only binds to protein and DNA exposed to <2% of oxygen (O2) (Mahy et al., 2003). Therefore, it cannot detect tissues that are experiencing oxygen concentrations correlating to moderate hypoxia. In fact, it is shown that Hif1a is present in the labyrinth of 9.5 dpc placenta, specifically cells surrounding maternal sinusoids, in the absence of hypoxic cells (<2% O2) as judged by pimonidazole (Pringle et al., 2007). This can be explained by either the labyrinthine cells being exposed to mild forms of hypoxia that the drug can not pick up at this stage, or there is placental HIF induction that is oxygen-independent (Maltepe et al., 2005).

3.8.3 Placenta relevant molecular signalling pathways are differentially affected in Cited2 null placentas

To begin to decipher the molecular events that define the defects in Cited2 null placentas, relevant signalling molecules were explored. These include many receptor-bound growth factors that elicit intracellular signals that lead to the phosphorylation and activation of numerous intracellular kinases and transcription factors that results in changes in patterns of gene expression. The molecular effectors studied have multi-cellular relevance in the placental bed, controlling cellular proliferation, differentiation, migration and/or apoptosis. Therefore, where pertinent the relevance of the signalling molecule in each cell compartment is discussed.

3.8.3.a The role of Pdgfb and Pdgfrb in pericyte-endothelial cell interface of the mouse placenta

Pdgfrb-expressing mural cells are recruited to immature vascular conduits through Pdgfb secreted by endothelial-lined vessels (Cleaver and Melton, 2003). Given the vascular expression pattern of Cited2 and the vascular phenotype observed in Cited2 null placentas, the protein levels of Pdgfb and Pdgfrb were studied to ascertain whether the abnormally low pericyte and smooth muscle deposition in Cited2 null placentas could be explained by perturbations in Pdgfb-Pdgfrb signalling. The amount of Pdgfb protein is not significantly different between whole Cited2 null and control placentas. This would suggest normal recruiting signals to attract mural cells 145 to nascent vessels, but yet there is mural cell disorganisation in the labyrinthine placental bed. Although normal Pdgfb levels are present in Cited2 null placentas, the prospect that the spatial distribution of Pdgfb ligand may be disrupted cannot be excluded. This proposition should be explored as it may explain why, despite the normal expression of Pdgfb, there is insufficient mural cell deposition around placental vessels. If the distribution of Pdgfb is disrupted then the chemoattractant force of Pdgfb would be undirected with resultant vascular dysmorphogenesis. To determine the spatial distribution of Pdgfb, immunohistochemical techniques may be employed to provide a global picture.

Pdgfrb protein levels was also assayed and observed to be normal in Cited2 null placentas. This suggests that there are adequate numbers of Pdgfrb expressing mural cells that can respond to the Pdgfb signal, but this cannot explain the poorly organised mural cells. The phosphorylation state of Pdgfrb should be determined as it may provide insight as to whether this receptor is over- or under-active. This should inform the study on whether perhaps the receptors are not receptive to the signal despite normal receptor levels. There are commercially available antibodies to detect phosphorylated forms of Pdgfrb that can be used in western blots to achieve this aim.

3.8.3.b Pdgfb and Pdgfrb and their roles in trophoblast development of the mouse placenta

Aside from the vascular roles Pdgfb and Pdgfrb play, the Pdgfb-Pdgfrb signalling axis may also function primarily in trophoblast derivatives. Pdgfb and Pdgfrb are both reported to be expressed in labyrinthine trophoblasts (Ohlsson et al., 1999), although the exact cellular localisation is unclear. Genetic ablation of either Pdgfb or Pdgfrb in the mouse results in reduced labyrinthine trophoblast numbers (Ohlsson et al., 1999). Cited2, as shown earlier, is expressed in S-TGCs that line maternal sinusoids and SynT cells of the labyrinth. As already reported, Cited2 nulls have malformed vessels in the labyrinth (Withington et al., 2006), however, the exact

146 phenotype of the labyrinthine trophoblasts in these null placentas remain unknown. On account of the normal expression of molecular effectors in PDGF signalling in Cited2 null placentas, it is rather unlikely that there exists a PDGF-dependent labyrinthine trophoblast phenotype in Cited2 nulls although this needs to be verified.

3.8.3.c Vegfr2 is important in vascular development of the mouse placenta

Vegfr2 is a vitally important angiogenic tyrosine kinase receptor on endothelial cells, as it promotes endothelial cellular proliferation, survival, growth, differentiation and migration (Shibuya and Claesson-Welsh, 2006). Vegfr2 is expressed in endothelial cells that make up the vessels in the mouse placental labyrinth (Abbott and Buckalew, 2000). As already described earlier, loss of Vegfr2 is an impediment to developmental endothelial and haematopoietic progress (Shalaby et al., 1995). Cited2 is shown to be expressed in endothelial cells of the labyrinth, and Cited2 null placentas display abnormal labyrinthine vessels (Withington et al., 2006). Therefore, the protein expression profile of Vegfr2 in Cited2 null placentas was explored to ascertain whether perturbations in its expression could explain the vascular phenotype. Vegfr2 expression is not perturbed in Cited2 null placentas, this cannot account for the enlarged vessels seen in these mutant placentas.

Despite the normal level of Vegfr2 protein in Cited2 null placentas, protein quantity alone cannot give an indication of the activity of Vegfr2. The receptor activity of Vegfr2 can be deduced by the phosphorylation of its tyrosine residues (denoted by Y), and should therefore be investigated. Upon ligand binding, monomeric Vegfr2 dimerise and subsequently activate the tyrosine kinase. Phosphorylation of distinct tyrosine residues on Vegfr2 determines various endothelial cell functions. For example, phosphorylation of Y951 present in the kinase insert of the receptor mediates endothelial cell migration, via interactions with a multitude of signal transducers that ultimately affect the actin cytoskeleton. In contrast, phosphorylation of Y1175 (Y1173 in the mouse) transduces endothelial cell survival and proliferation (Sakurai et al., 2005). It is interesting to note that phosphorylated Y951 is

147 preferentially associated with endothelial cells deficient in mural cell coverage, which is consistent with vessels undergoing active angiogenesis (Matsumoto et al., 2005). Conceivably, loss of the tight regulation of Y951 phosphorylation may result in excessive endothelial cell migration and angiogenesis preventing mural cell deposition. As discussed already, Cited2 null placentas have sparse mural cell deposition associated with dysregulated endothelial-lined vessels, perhaps a disruption to Y951 phosphorylation may explain the Cited2 null placental phenotype (Matsumoto et al., 2005). The residue and extent of tyrosine phosphorylation should inform on the behaviour of endothelial cells in Cited2 null placentas. There are commercially available antibodies to detect phosphorylated forms of Vegfr2. Using these antibodies in western blots should allow determination of the phosphorylated state of specific tyrosine residues of Vegfr2 to give an indication of endothelial cell state in Cited2 lacking placentas.

The phosphorylation of tyrosine residues on Vegfr2 is a downstream event of Vegf ligand binding to Vegfr2. Therefore, if the amount of Vegfr2 tyrosine phosphorylation is altered in Cited2 null placentas, then the possibility of molecular aberrances upstream at the level of the Vegf ligand must be considered. Given the dysregulated vessels in Cited2 nulls, the scenario wherein Vegf ligand is overexpressed is consistent with and a plausible model to explain this vascular abnormality. By inference, the presence of more Vegf ligand would provide ample source of angiogenic signal, resulting in greater chances of Vegfr2 homodimerising, subsequent phosphorylation of appropriate tyrosine residues and ultimately transducing the signal. In accordance, Vegf is a direct target gene of HIF (Wenger et al., 2005); Cited2 negatively modulates Hif1a (Bhattacharya et al., 1999); it is thus tempting to speculate that loss of Cited2 indirectly results in an overactivity of Vegf through loss of HIF suppression. Therefore, the levels and localisation of Vegf ligand in the placental milieu of Cited2 null placentas should be determined by western blot and immunohistochemical methods, respectively.

148

3.8.3.d MAPK signalling transduce important morphogenic cues in mouse placental development

MAPKs link extracellular stimuli to the various biochemical targets in various compartments of the cell (Rubinfeld and Seger, 2005, Seger and Krebs, 1995). MAPKs are serine/threonine protein kinases that generally transduce prosurvival signals by controlling cellular proliferation, differentiation, motility and apoptosis (Fischer et al., 2005, Johnson and Vaillancourt, 1994, Meloche and Pouyssegur, 2007, Roux and Blenis, 2004, Ussar and Voss, 2004). Upon extracellular stimulation with mitogens, cytokines and growth factors, a sequential three-tiered protein kinase cascade commences that includes; a MAPK kinase kinase (MAP3K) that acts on a MAPK kinase (MAP2K) and subsequently onto a MAPK. Independent genetic deletion of various molecules in the MAPK signalling pathway result in a spectrum of placental defects, ranging from vascular to trophoblastic in nature, which highlights its critical role in development (Adams et al., 2000, Hatano et al., 2003, Kuida and Boucher, 2004, Mudgett et al., 2000, Nadeau et al., 2009, Saba-El-Leil et al., 2003).

Many ligand-receptor systems biochemically descend on MAPKs, and based on its centrality in many signalling cascades are developmentally important molecules. With respect to the vascular component of the mouse placenta, it is shown that Mapk1 is vitally important for the developing labyrinth. Genetic ablation of Mapk1 in the mouse results in embryo lethality at 11.5 dpc with concomitant thinning of the labyrinthine layer, containing fewer fetal placental blood vessels (Hatano et al., 2003). Conversely, in Cited2 null placentas, the labyrinth and fetal vessels are expanded (Withington et al., 2006), and there is increased Mapk1 activity as shown in this study. These genetic and biochemical data agree with one another, which may indicate a role for Cited2 in regulating Mapk1 activity in vascular cells either directly or indirectly. In sheep, Mapk1 and Mapk3 are expressed in both endothelial and smooth muscle cells (Zhu et al., 2007). Cited2, in the present study, is shown to be expressed in both these vascular cells. Therefore, endothelial- and mural-cell specific Mapk1 and Mapk3 activities should be queried in order to determine cellular

149 requirement for Cited2 function. Plausibly, there may be a primary need for Cited2 in each of these vascular cells independent of the other. To address this, western blots on protein lysate preparations from placentas containing either Cited2 deficient endothelial or Cited2 lacking mural cells using Mapk1 and Mapk3 phospho-specific antibodies may provide an indication of cell-specific MAPK activity. In doing so, this should inform on Cited2 function with respect to MAPK signalling in vascular cell behaviour. However, a caveat of this approach is that the changes in MAPK signalling may potentially be subtle, and therefore below the level of detection using semi-quantitative western blotting. As alternatives, a combination of enzyme-linked immunosorbent assay (ELISA) and fluorescence-activated cell sorting (FACS) should allow vascular cell specific isolation and quantitation of Mapk1 and Mapk3 levels and activities.

In related placental cells, MAPKs are also shown to be important in the development of trophoblast cells where they are expressed (Saba-El-Leil et al., 2003). In one Mapk1 mouse knockout model, conceptuses lacking Mapk1 fail to form the tissues that give rise to much of the trophoblast derivatives of the mature placenta, resulting in early embryonic demise (Saba-El-Leil et al., 2003). Cited2 null placentas have reduced numbers of trophoblast derivatives (placental cells that express Cited2) (Withington et al., 2006), and this investigation also shows that Mapk1 activity is abnormally increased in these mutant placentas. Mapk1 and Mapk3 are reported to be important in regulating the cell-cycle (Lavoie et al., 1996, Pages et al., 1993, Roovers and Assoian, 2000), these MAPKs can be positive and negative regulators of cell-cycle re-entry with the outcome being dictated by a combination of the level of MAPK signal amplitude and duration (Roovers and Assoian, 2000). Therefore, the disruption in Mapk1 signalling in Cited2 null placentas, and therefore MAPK- dependent cell cycle control, could explain the reduction in trophoblast numbers. Perhaps Cited2 is primarily required in trophoblasts to control cellular proliferation and differentiation into various trophoblast subtypes, via a MAPK-mediated mechanism. Due to the wide expression of Cited2 in the mouse conceptus, understanding the cell-specific primary requirement for this gene is hampered. 150

Similar to the approach proposed above to dissect a potential Cited2-Mapk1 axis in vascular cells, one might be able to address the primary roles of Cited2 in trophoblast development by spatially restricted deletion of Cited2 in trophoblast cells, and subsequently determine MAPK activity by western blot using phospho-specific antibodies. It is interesting to note that in another mouse model, knockout of Mapk1 results in defective labyrinthine trophoblast branching that is thought to be indispensable for vascularisation of the mature placenta (Hatano et al., 2003). It is curious to speculate whether the raised activity of Mapk1 in Cited2 null placentas results in abnormal labyrinthine trophoblast branching morphogenesis (which is yet to be determined), and in turn result in the enlarged fetal vessels. Given the plethora of receptor-mediated signal transduction events that converge on Mapk1 and Mapk3, the next challenge is to ascertain which upstream ligand-receptor systems are dysregulated in Cited2 null placentas to cause perturbations in MAPK signalling.

Elk1 belongs to the E-Twenty six (ETS) family of transcription factors. Elk1 forms a ternary complex that binds the serum response element (SRE) and drives the multitude of biological responses to serum and growth factors. Studies indicate Elk1 is good substrate for MAPK phosphorylation, which is sufficient to relieve Elk1 of its auto-inhibition and thus be activated to increase its DNA binding capacity (Gille et al., 1995, Janknecht et al., 1994, Sharrocks, 1995, Shore et al., 1996, Strahl et al., 1996). Phosphorylated Elk1, which is diagnostic of its activity, is potentially augmented in Cited2 null placentas and should be elucidated with greater sampling of placentas. Notwithstanding verification of the increased Elk1 activity and supposing it holds true, this is consistent with Elk1 being a direct target for the kinase activity of MAPKs, and thus bolsters the argument for the observed increase in Mapk1 activity in Cited2 null placentas being true.

Other molecular effectors of the MAPK pathway are also relevant in placental development, as knockout of a number of these genes in the mouse have been reported to have placental phenotypes. These include all aspects of the MAPK signalling cascade, from growth factors (Hgf) and receptors (Met, Fgfr2, and Pdgfr), 151 as well as the downstream signal transducers of the MAPK cascade (Grb2, Gab, Sos1, Raf1, Map2k1 and Mapk1) and MAPK regulators (Dusp9) (Belanger et al., 2003, Bissonauth et al., 2006, Christie et al., 2005, Giroux et al., 1999, Lu et al., 1999, Meloche et al., 2004, Mudgett et al., 2000, Nadeau et al., 2009, Saba-El-Leil et al., 2003, Yan et al., 2003, Yang et al., 2000). Many of these mouse models exhibit labyrinthine defects within the placenta, with both trophoblast and vascular cells being affected. Of particular pertinence to this discussion is p38α (Mapk14), which is required in placental development as knockout mice show placental dysmorphogenesis characterised by a reduction in the SpT layer and poor vascularisation in the labyrinth (Adams et al., 2000, Mudgett et al., 2000). Given the increased activity in the related MAPK, Mapk1, in Cited2 null placentas, it would be interesting to see if lacking Cited2 also affects other MAPK family members like p38α. An increase in p38α signalling with loss of Cited2 would predict an enlarged or overdeveloped fetal vasculature that is congruent with the Cited2 null placental vascular phenotype. Therefore, it is worth pursuing to ascertain the levels and localisation of p38α in the placental milieu of Cited2 null placentas by western blot and immunohistochemical methods, respectively.

Moreover, genetic ablation of known upstream activators of p38α, Mkk3/Map2k3 and Mkk6/Mapk6, results in placental dysgenesis with abnormalities in the developing fetal vasculature. Mice with targeted disruption in either Mkk3/Map2k3 or Mkk6/Mapk6 are viable and display mild phenotypes (Lu et al., 1999, Tanaka et al., 2002, Wysk et al., 1999). However, Mkk3/Map2k3 and Mkk6/Mapk6 appear to serve redundant functional roles in survival; compound deletion of Mkk3/Map2k3 and Mkk6/Mapk6 in the mouse results in embryonic demise at midgestation with embryos displaying vascular deficiencies and defective placental morphology (Brancho et al., 2003). Mkk4 is shown to activate p38, although genetic deletion of Mkk4 does not display a placental phenotype. Mekk3/Map3k3 that is upstream of deletion results in impaired development of blood vessels in the placenta (Yang et al., 2000). Therefore, it is also worth pursuing to determine the activity, protein levels and localisation of

152

Mkk3/Map2k3 and Mkk6/Mapk6 in the placental milieu of Cited2 null placentas by western blot and immunohistochemistry.

3.8.3.e Akt1 is an important signalling molecule in the developing placenta

The lipids of the cellular membrane bilayer are able to be phosphorylated by enzymes such Pik3 in response to stimulation by secreted factors. Pik3 catalyses the conversion of phosphatidylinositol-4,5-biphosphate [PI(4,5)P2] to phosphatidylinositol-3,4,5-triphosphate [PI(3,4,5)P3], which becomes an important signalling phospholipid that recruits protein serine-threonine kinases such as Akt1 and 3-phosphoinositide dependent protein kinase 1 (Pdpk1 also known as PDK1) (Downward, 1998, Engelman et al., 2006). Pik3 exerts its multiple cellular functions such as cellular metabolism, proliferation, cell cycle entry and survival through Akt1 (Jiang and Liu, 2009). Akt1 is activated upon phosphorylation by Pdpk1, whereby Akt1 subsequently translocates to the nucleus as well as within the cytoplasm to phosphorylate downstream effector molecules (Sarbassov et al., 2005, Stokoe et al., 1997). Therefore, the transduction of morphogenic signals from the constellation of cellular ligands and receptors can be orchestrated by Akt1. Akt1 is absolutely required for proper development of the mouse placenta. Genetic knockout of Akt1 in the mouse results in placental hypotrophy, with reductions in the maternal decidua, glycogen cells and placental vascularisation (Yang et al., 2003). Akt1 is widely expressed in the mouse placental bed; it is present in both vascular endothelial cells and all trophoblast derivatives (Yang et al., 2003).

In endothelial cells, activated Akt1 phosphorylates downstream effectors such as nitric oxide synthase 3 (Nos3 also known as eNOS) to trigger endothelial cell migration (Hafezi-Moghadam et al., 2002, Kureishi et al., 2000, Luo et al., 2000, Scotland et al., 2002). Therefore, the increased activity of Akt1 in Cited2 null placentas has great implications for the forming placental fetal vasculature. Both Akt1 and Cited2 are expressed in vascular endothelial cells of the mouse placental labyrinth (Withington et al., 2006, Yang et al., 2003). Akt1 deletion results in poor

153 angiogenesis that is attributed to defects in activated Nos3-dependent endothelial cell survival and migration (Yang et al., 2003). Conversely, increased Akt1 activity observed in Cited2 null placentas may explain the genesis of expanded fetal blood vessels. These genetic and biochemical aberrances agree with the placental vascular phenotypes, suggesting a potential Cited2-Akt1 signalling axis in extraembryonic vascularisation. Therefore, it is attractive to investigate whether Nos3 activity is accordingly increased in Cited2 null placentas; this can be answered by western blot using phospho-specific Nos3 antibodies on whole Cited2 null placenta lysates.

In addition to its vascular relevance, the Pik3-Akt1 signal transduction pathway is also implicated in the differentiation of trophoblasts in the mouse placenta (Kamei et al., 2002). Akt1 is posited to be expressed in all trophoblast derivatives, with disruption to Akt1 gene function resulting in a smaller decidual compartment and with fewer GlyT cells (Yang et al., 2003). Like Akt1, Cited2 is important for trophoblast development as it is expressed in trophoblast derivatives, and loss of Cited2 in the mouse placenta results in a reduction in trophoblast cell types and placental hypotrophy (Withington et al., 2006). However, Akt1 activity is increased in Cited2 null placentas. This is incongruent with the trophoblast phenotype of Akt1 null placentas and therefore perturbations to Akt1 bioactivation cannot explain the Cited2 trophoblast phenotype. Perhaps Akt1 has a unique role in the vascular cells of the mouse placenta.

3.9 Summary

Cited2 is an important transcriptional co-factor in mouse placental development. Here, the cellular localisation of Cited2 is shown in both vascular endothelial and mural cells, as well as in S-TGCs and SynT cells of the placental labyrinthine zone. For the first time, the enlarged fetal vessels in Cited2 null placentas can be formally associated with disorganised of mural cell (pericytes and smooth muscle cells) coverage. This should not be unexpected as pericytes and smooth muscle cells function to ensheath nascent vessels and provide structural support. The study

154 additionally characterises the Cited2 null placental phenotype, showing that the poor mural cell investment of remodelling fetal vessels is not rectified with further development. Moreover, the protein expression of molecular effectors relevant to placental development in Cited2 null placentas is beginning to be unravelled. A spectrum of signalling pathways important in various aspects of placental development are suggested to be disrupted in Cited2 deficient placentas; there are perturbations in Mapk1 and Akt1 activity. The protein levels of receptors are unchanged in Cited2 null placentas, although the phosphorylation status of both Vegfr2 and Pdgfrb should also be explored to gain insight into receptor activity.

155

Chapter 4: Site-specific deletion of Cited2 in fetal endothelial cells of the mouse placenta

156

4.1 Introduction

The development of the mouse placenta is a complex process. It requires active interaction of several initially separated and distinct tissues early in development, with subsequent remodelling as it matures. Therefore, it should come as no surprise that over 85 genes are necessary to pattern the mouse placenta (Watson and Cross, 2005). As already described, Cited2, is one of these genes essential for proper placental maturation (refer to previous chapter) (Withington et al., 2006). Placentas lacking Cited2 are smaller in size with a smaller pool of trophoblast cells and a disrupted placental fetal vascular system. The previous chapter described the vast expression of Cited2 in the mouse placenta. Briefly, the territories of Cited2 expression can be classified into two groups: trophoblast cell derivatives and fetal vascular endothelial and mural cells. These regions of Cited2 expression in extraembryonic tissues coincide with the most affected cellular compartments seen in the placental phenotype of the Cited2 null mouse. The next challenge is to elucidate the potential contributions of Cited2 in vascular and trophoblast cells. Uncoupling Cited2 potential function in these highly intermingled structures can be achieved by independent cell-restricted excision of Cited2.

The enzyme, Cre-recombinase, can be used to achieve temporal- and site-specific deletion of genes. Cre-recombinase recognises a sequence stretching 34 base pairs known as a loxP site (Abremski and Hoess, 1984, Hoess et al., 1982). DNA sequences intervening two loxP sites are recombined by Cre-recombinase, resulting in the loxP flanked sequence being deleted. Therefore, taking advantage of the interaction between Cre recombinase and the loxP sequence, a pair of unidirectional loxP sites can be manipulated to flank a genetic locus in such a way that disrupts the protein coding sequence. Placing Cre-recombinase under the control of genetic temporal and spatial regulatory elements restricts Cre-recombinase-mediated gene deletion to cell- and temporal-specific domains.

157

In fact two conditional null alleles of Cited2 have been generated and used to explore tissue-specific requirements of Cited2 (Figure 4.1) (Preis et al., 2006). Both alleles were devised to have a downstream lacZ reporter that is only expressed upon Cre- recombinase-mediated excision of the Cited2 protein coding in cells that would otherwise express Cited2. For the purpose of this study only one Cited2 conditional null allele, the Cited2-flox (Cited2F) allele, was used. The other Cited2 conditional null allele, the Cited2-flox-neo (Cited2FN) allele engineered to have a neomycin resistance cassette driven by the genetic promoter of phosphoglycerate kinase (PGK- Neo), was not used as it appears to be leaky with ectopic and widespread expression of β-galactosidase (Preis et al., 2006).

Previous studies interrogating the function of Cited2 in the mouse placenta observed early defects in the chorioallantoic interaction in Cited2 deficient placentas. These initially separate extraembryonic tissues give rise to two different placental compartments and their union underscores the highly interactive nature of the compartments of the developing placenta. The suboptimal chorioallantoic interaction in Cited2 null placentas is overcome as judged by the formation of a highly elaborated labyrinthine structure, albeit with a disorganised fetal vasculature. This placental malformation highlights that the structural outcome of one compartment is innately dictated by the other, and vice versa. It is posited that a deficit in one compartment may lead to a compensatory over growth in the other, suggesting an active participation of the different compartments. Alternatively, the loss of the physical limiting effect of one compartment may result in the passive overgrowth in space of the other. In fact, it has been shown that the degree of trophoblast branching influences the density and organisation of the placental blood spaces (Watson and Cross, 2005). With this in mind, phenotypic analyses of many mutant placentas that ascribe a vascular defect may be a secondary result of abnormal trophoblast branching. However, phenotypic analysis to determine primary gene function is

158

Figure 4.1 Schematic representation of the Cited2 alleles Depicted from top to bottom are: the wild-type Cited2 locus; the targeting vector (pCited2-floxneolacZ); the targeted allele (Cited2FN); the partially deleted allele (Cited2F) with the neomycin resistance gene (neo) removed; and the completely deleted allele (Cited2FΔ) in targeted tissues after Cre-recombinase-mediated recombination. Solid black boxes represent Cited2 exons. Intronic regions in a 5’ to 3’ direction are shown as solid black lines. The loxP sites are symbolised by grey triangles, the neomycin resistance cassette under the control of the phosphoglycerate kinase promoter (PGK-neo) in grey boxes and the lacZ reporter gene in white boxes. Thick solid black lines under the Cited2 wild-type locus depict the probes used in Southern blot analyses, arrows represent the translational start sites, while arrowheads denote primers used to identify the 5’ loxP site. Diagnostic restriction sites are also shown: E, EcoRI; S, SacI; X, XbaI. This figure was taken from Preis et. al., 2006.

made difficult in genes with widespread expression like Cited2. The vascular defects seen in Cited2 null placentas may be the result of a direct requirement for Cited2 in vascular cells.

4.2 Aims and hypothesis

Given the innate inter-compartmental signalling that occurs between vascular and trophoblast cells, and Cited2 expression in both these cells, it is possible that there is an independent primary requirement for Cited2 in either cell type. Alternatively, there may be a principal necessity for Cited2 in one of these cellular compartments, and perhaps owing to paracrine signalling may impinge on the development of the other compartment. Focussing on the vascular phenotype observed in the complete Cited2 null placentas, it is possible that either Cited2 has a primary function in vascular cells, or this gene is primarily required in trophoblast cells and through a paracrine manner secondarily affects vascular patterning. The latter is not implausible as the Cited2 null placental phenotype also displays reduced trophoblast numbers. This chapter aimed to determine whether the vascular phenotype in Cited2 mutant placentas is a primary defect in vascular cells, specifically in endothelial cells. Therefore, to address this question Cre-recombinase mediated endothelial cell- specific deletion of Cited2 in the mouse was achieved using the Tie2-Cre transgenic mouse (Koni et al., 2001). It is proposed that if restricted deletion of Cited2 in endothelial cells using Tie2-Cre phenocopied the complete Cited2 null placental phenotype, then this indicates that Cited2 is required in endothelial cells for the appropriate patterning of the fetal vessels of the placenta.

4.3 Results

4.3.1 Documenting the activity of Cre-recombinase from the Tie2-Cre mouse

Tie2-Cre is generally accepted and widely used as an endothelial cell-specific target gene deleter. The Tie2-Cre mouse line used had Cre-recombinase driven by the mouse endothelial-specific receptor tyrosine kinase promoter/enhancer (Koni et al.,

162

2001). Many studies have been done to locate the domains of Cre-recombinase activity in the Tie2-Cre mouse, most of which are focused heavily on the embryo. However, in relation to the aims of this study, it was unclear in which placental cells Tie2-Cre is expressed. To this end, expression analysis of Tie2-Cre in the developing mouse placenta was performed.

The activity of Cre-recombinase in the placenta was reported using the ROSA26 reporter (R26R) mouse. The R26R transgenic mouse strain was derived by targeting the lacZ gene into the Rosa26 locus that is ubiquitously expressed in the embryo throughout development (Soriano, 1999). Upstream of the lacZ reporter gene, the locus contains a trimeric polyadenylation sequence flanked by loxP sites (loxP- STOP-loxP) to prevent spurious expression of the reporter gene. Upon ablation of the loxP-STOP-loxP sequence mediated by Cre-recombinase, β-galactosidase is expressed. Therefore, Tie2-Cre mice were crossed with R26R mice, with β- galactosidase activity used as a readout of Cre-recombinase activity.

At 9.5 dpc, Cre-recombinase activity from the Tie2-Cre locus was observed in the allantoic mesenchyme. It was also seen in endothelial cells invading the buckling chorion forming the villous tree. In addition to this, Cre-recombinase activity was shown to be in the extraembryonic mesoderm of the developing blood islands of the yolk sac, but not in the visceral endoderm component of the yolk sac (Figure 4.2). More importantly cell-specific deletion in endothelial cells by Tie2-Cre is confirmed by the absence of Cre-recombinase activity in: the chorion and the ectoplacental cone that both give rise to many trophoblast cell derivatives, trophoblast giant cells, as well as the maternal decidua containing decidual cells and maternal blood vessels (Figure 4.2). As expected, being an endothelial cell-specific gene delete, Cre-recombinase is also active in the heart, the branchial arches, intersomitic vessels and throughout the developing vasculature of the embryo (Figure 4.2).

163

4.3.2 Phenotypic analysis of mutant mouse embryos and placentas conditionally deleted of Cited2 in endothelial cells

The following subsections describe the analyses performed to determine the phenotype in placentas with endothelial cell-restricted Cited2 deletion.

4.3.2.a Mouse pups supported by placentas lacking Cited2 in endothelial cells are either growth restricted or die perinatally

Complete Cited2 null embryos die in utero; lethality is observed during midgestation with the absence of Cited2 null embryos after 14.5 dpc (Weninger et al., 2005, Withington et al., 2006). With Cited2 being taken out of only a subset of cells – endothelial cells of the placenta and embryo – one objective of this study was to see whether these mouse pups supported by placentas with Cited2 deficient endothelial cells could survive past weaning stage. It was conjectured that with the cell-restricted deletion of Cited2, the placental phenotype would be less severe as compared to the complete null. In relation to this, the embryo that it supports may also be predicted to be less severely affected.

Embryos and their associated placentas with endothelial cell confined ablation of Cited2 (Cited2ΔlacZ/Cited2F; Tie2-Cre) were generated by mating Cited2ΔlacZ/Cited2+; Tie2-Cre stud males with a conditional Cited2F female mouse. Given that Cited2ΔlacZ heterozygous mice appear to be normal, this approach was taken so that the targeted expression of Cre-recombinase in endothelial cells had to only excise the lone conditional Cited2F allele for efficiency. Pups were weighed and their weights represented as a proportion of the average of the control placentas (Cited2ΔlacZ/Cited2F; +/+ and Cited2F/Cited2+; Tie2-Cre and Cited2F/Cited2+; +/+) within the litter. This was done to correct for interlitter variation and inherent biological noise. Cited2 conditional null mouse pups of the experimental genotype (Cited2ΔlacZ/Cited2F; Tie2-Cre) were either growth restricted or died perinatally (Figure 4.3). Pup death was seen across most genotypes, however, there was a greater proportion of Cited2ΔlacZ/Cited2F; Tie2-Cre pups that 166

Figure 4.3 Comparison of pup weight and survival of mouse pups supported by placentas null for Cited2 specifically in endothelial cells. Depicted are pup weights at birth represented as individual pup weights normalised to the average weights of the controls (Cited2ΔlacZ/Cited2F; +/+, Cited2F/Cited2+; Tie2- Cre/+, Cited2F /Cited2+; +/+) within their respective litter. Generally, white dots represent pups null for Cited2, and grey dots depict pups heterozygous for Cited2 in vascular endothelial cells. Red dots represent perinatal death of pups found at birth or the following days. One-way analysis of variance was performed, and significance was determined using Tukey’s post hoc test to identify differences between genotypes (***p ≤ 0.001).

168

were either found dead at birth, or those that survived birth died the following day compared to control genotypes. The proportional distribution of genotypes were tested for fit to expected Mendelian ratios (1:1:1:1) by χ2 analysis (3 degrees of freedom) and showed that no particular genotype was under represented (p = 0.84).

4.3.2.b Mouse embryos and the placentas that support them that lack Cited2 in endothelial cells are both smaller late in gestation

It is also plausible that mouse pups die due to placental insufficiency earlier in the development. Thus, embryos and their placentas were collected at 16.5 dpc and 18.5 dpc to determine if this is the case in Cited2ΔlacZ/Cited2F; Tie2-Cre conceptuses.

At 16.5 dpc, weights of Cited2ΔlacZ/Cited2F; Tie2-Cre placentas are statistical different when compared to Cited2F/Cited2+; Tie2-Cre/+ control placentas that are heterozygous for Cited2 (Figure 4.4). The embryos associated with Cited2ΔlacZ/Cited2F; Tie2-Cre placentas at 16.5 dpc are not different in weight compared to control embryos (Cited2ΔlacZ/Cited2F; +/+ and Cited2F/Cited2+; Tie2- Cre and Cited2F/Cited2+; +/+) (Figure 4.4). Cited2ΔlacZ/Cited2F; Tie2-Cre embryos at 16.5 dpc did not display an overt defect, although of the Cited2ΔlacZ/Cited2F; Tie2- Cre embryos, one was observed to be avascular and associated with a pale placenta and avascular yolk sac. Ratios of genotypes at 16.5 dpc fit expected Mendelian segregation (1:1:1:1) as revealed by χ2 analysis (3 degrees of freedom) (p = 0.63). At 18.5 dpc, Cited2ΔlacZ/Cited2F; Tie2-Cre placental weights are statistically different to Cited2ΔlacZ/Cited2F; +/+ and Cited2F/Cited2+; +/+ placentas with about 15% reduction in wet weight (Figure 4.5). In correlation, embryos sustained by Cited2ΔlacZ/Cited2F; Tie2-Cre placentas have reduced weights compared to Cited2ΔlacZ/Cited2F; +/+ and Cited2F/Cited2+; +/+

170

embryos (Figure 4.5). Much like in early development, Cited2ΔlacZ/Cited2F; Tie2-Cre embryos at 18.5 dpc did not exhibit an overt defect, although of the Cited2ΔlacZ/Cited2F; Tie2-Cre embryos, one was observed to be oedematous with a smaller placenta and less vascularised yolk sac. Ratios of genotypes at 18.5 dpc fit expected Mendelian segregation (1:1:1:1) as revealed by χ2 analysis (3 degrees of freedom) (p = 0.18).

4.3.2.c Midgestation placentas with Cited2 conditionally excised in endothelial cells are smaller with disrupted trophoblast compartments

With the observation of growth retarded Cited2ΔlacZ/Cited2F; Tie2-Cre pups and mouse embryos during late gestation, it was then aimed to show that this was due to a poor in utero environment and placental insufficiency. Therefore, the morphology of Cited2ΔlacZ/Cited2F; Tie2-Cre mouse placentas were studied. The developmental timepoint of 14.5 dpc was chosen for this study for consistency and comparison as most of the analyses for the complete Cited2 null placenta was done at this stage. Trophoblast derivatives were identified by genetic markers using RNA in situ hybridisation: Prl3b1 (previously known as mPL-II) marks a subset of TGCs (P- TGC, C-TGC, S-TGC and SpT cells) (Simmons et al., 2008b); and Tpbpa identifies SpT and GlyT cells in the junctional zone.

Generally, placental areas were calculated from the average of three serial sections, with at least one section in the middle of the placenta distinguished by the presence of the umbilicus. Firstly, it was observed that placentas with Cited2 conditionally deleted in endothelial cells are smaller in size compared to control placentas (Figure 4.6). This is very much reminiscent of the Cited2 complete null placental phenotype (Withington et al., 2006). Secondly, the TGC layer in the junctional zone is thinner in conditional deletants (averaging 18.5% ± 0.03 of the whole placental area) contrast to controls (averaging 24.6% ± 0.04 of the whole placental area) when assessed by the Prl3b1 gene marker (Figure 4.6), however not to the same extent as the absolute

176

Cited2 null placenta (Withington et al., 2006). Thirdly, the junctional zone of Cited2ΔlacZ/Cited2F; Tie2-Cre placentas appear to have fewer SpT and GlyT cells

Figure 4.6 Endothelial cell-restricted excision of Cited2 results in smaller placentas with a perturbed junctional zone although the ratio of α-SMA expressing mural cells to Pecam1 expressing endothelial cells is normal. Transverse sections through 14.5 dpc (A, C) Cited2ΔlacZ/F control (n=2) and (B, D) Cited2ΔlacZ/F; Tie2-Cre (n=3) placentas, probed with (A and B) Prl3b1 (also known as mPL-II) that marks a subset of trophoblast giant cells and labyrinthine trophoblasts and (C and D) Tpbpa (also known as 4311) that marks spongiotrophoblasts and glycogen trophoblast cells. Glycogen cells that invade the maternal decidua are marked with an asterisk. Sections were counterstained with eosin. Also, whole sections of (E, G and I) Cited2ΔlacZ/F control (n=5) and (F, H and J) Cited2ΔlacZ/F; Tie2-Cre (n=4) placentas were stained with Pecam1 (E and F) and α-SMA (G and H) to identify endothelial and mural cells, respectively. The merged images (I and J) were generated using the ImageJ software. Appropriate negative controls on serial sections were performed in parallel (not shown). The amount of fluorescently labeled α-SMA expressing mural cells (green) and Pecam1 expressing endothelial cells (blue) in the whole placental labyrinth and their ratios (red) are represented (K). A Student’s t-test was performed to compare differences between the two genotypes. Scale bar: 500μm in A-J.

178

when evaluated by the Tpbpa trophoblast genetic marker (Figure 4.6), but the SpT: GlyT cell ratio appears similar, again the reduction is not to the same magnitude as the Cited2 total null placenta (Withington et al., 2006). However, unlike the complete Cited2 null placenta, GlyT cells appear to migrate and invade into the maternal decidual compartment of Cited2ΔlacZ/Cited2F; Tie2-Cre placentas. Finally, the labyrinthine layer of Cited2ΔlacZ/Cited2F; Tie2-Cre placentas seem to be expanded (averaging 57.25% ± 0.06 of the whole placental area) having similar dimensional coverage when assessed against control placentas (averaging 56.50% ± 0.01 of the whole placental area). Furthermore, the interdigitations at the interface between the junctional and labyrinthine zones are smoother and arch-like in appearance (Figure 4.6). Although, the amount of α-SMA expressing mural cells (p=0.20) and Pecam1 expressing endothelial cells (p=0.21) in the labyrinth of Cited2 conditional null placentas is similar to control placentas (Figure 4.6). Furthermore, when the ratio of α-SMA to Pecam1 is calculated to give an indication of mural cell coverage of vessels, the mural cell coverage of Cited2 conditional placental labyrinths are similar to control placental labyrinths(p=0.27) (Figure 4.6). Taken together, certain aspects of the conditional null placenta partially phenocopy the complete Cited2 null placenta.

The Tpbpa genetic marker identifies both SpT and GlyT cells of the junctional zone. Therefore, periodic acid-Schiff (PAS) stain was used to demarcate between these two cell populations. PAS is a histological stain manifesting as a pink colouration in tissues and is routinely used to identify glycogen, and thus can be used to recognise GlyT cells. However, PAS is non-specific and also stains such things as mucin in the placental bed. Therefore, to distinguish between GlyT cells and false-positive cells, α-amylase found in saliva was used. Alpha-amylase breaks down glycogen into simple sugar moieties, and this is seen as a disappearance in the PAS pink colour. When serial sections of the placental bed are stained with PAS, differentially treated with and without saliva-derived α-amylase, the loss of the PAS pink hue will indicate α-amylase-mediated breakdown of glycogen and thus identification of GlyT cells. In both Cited2ΔlacZ/Cited2F; Tie2-Cre and control placentas, GlyT cells were identified 180 by their distinct vacuolated cytoplasm in the placental bed (Figure 4.7). There appeared to be the same ratio of GlyT:SpT cells in the junctional zone of both placental genotypes. However, the junctional zone was reduced in thickness in Cited2ΔlacZ/Cited2F; Tie2-Cre placentas (Figure 4.7), as found earlier in the Tpbpa RNA in situ experiments. Curiously, PAS staining also facilitated visualisation of the smoother appearance of the border between the junctional and labyrinthine zones

181

observed earlier in the RNA in situ experiments. The junctional-labyrinthine zone interface was hemispherically smooth manifesting in the loss of the characteristic finger-like projections of the trophoblast derivatives (Figure 4.7).

4.3.2.d Placentas with Cited2 null endothelial cells exhibit normal vessels dissimilar to Cited2 complete null placentas

In Chapter 3, the relationship between the expanded endothelial-lined vessels and the disorganisation in mural cell investment was made for the first time. To confirm that Cited2ΔlacZ/Cited2F; Tie2-Cre mouse placentas do not have a subtle vascular phenotype in the labyrinth despite similar mural cell coverage of vessels compared to control placentas, the fetal vasculature of Cited2ΔlacZ/Cited2F; Tie2-Cre placentas and more specifically the relationship between the endothelial-lined vessels and its degree of pericyte and smooth muscle cell envelopment was looked at closer. The same approach as in Chapter 3 was utilised to determine the extent of mural cell investment around capillaries, moderately- and large-sized vessels in the labyrinth. Briefly, mouse placental cryosections were assessed by co-immunostaining with α-SMA and Pecam1 antibodies to mark out the cellular bodies of endothelial and mural cells, respectively.

In microvessels of the fetal vasculature of the mouse placental labyrinth, endothelial cell-lined conduits are normally kept regular in size by α-SMA-positive pericytes. These pericytes are arranged into “islands” that extend protrusions to microvessels to form capillary loops and maintain vascular structure (Figure 4.8). In Cited2ΔlacZ/Cited2F; Tie2-Cre mouse placentas, microvessels appeared to be largely normal, although on occasion enlarged vessels associated with poor pericyte interaction was observed. These abnormally large vessels intermingled with normal capillary loops held in place by pericytes (Figure 4.8) in the placental bed. Similarly, moderately- (Figure 4.9) and large-sized (Figure 4.10) vessels in the vascular bed of Cited2ΔlacZ/Cited2F; Tie2-Cre placentas appeared to be normally enveloped with smooth muscle cells as compared to controls.

184

Figure 4.8 Specific deletion of Cited2 in endothelial cells does not affect microvessel caliber and pericyte investment in the placental fetal capillaries. Confocal micrographs of 14.5dpc mid-placental sections doubly immunostained with α-SMA (green) (A, E) and Pecam1 (red) (B, F), counterstained with TO-PRO®-3 to visualise nucleic acids (blue) (C, G), with images merged (D, H) using the ImageJ software. Cited2ΔlacZ/F (n=3) control placentas (A-D) exhibit the normal tortuous pattern of α-SMA-positive (green) pericytes (A) and their arrangement into “islands” of pericytes that hold endothelial cell-lined (red) capillaries into tight conduits to form capillary loops (inset in panel D). Similarly, Cited2ΔlacZ/F; Tie2-Cre (n=3) placentas (E-H) show normal investment of pericytes (white arrow in panel H). On occasion, these normal microvessels are coexistent with expanded vessel size associated with poor pericyte coverage (inset in panel H). Scale bar: 40μm (A-H).

Figure 4.9 Endothelial cell-restricted deletion of Cited2 does not affect mural cell investment in moderately sized vessels of the placental fetal vasculature. Confocal images of 14.5 dpc mid-placental sections co-stained with α-SMA (green) (A, E) and Pecam1 (red) (B, F), counterstained with TO-PRO®-3 to visualise nucleic acids (blue) (C, G), with images merged (D, H) using the ImageJ software. Cited2ΔlacZ/F (n=3) control placentas (A-D) display regular coverage of endothelial-lined (red) vessels with α-SMA-positive (green) mural cells (inset in panel D). Cited2ΔlacZ/F; Tie2-Cre (n=3) placentas (E-H) taken at the same exposure are shown. To better appreciate the pattern of staining, the same Cited2ΔlacZ/F; Tie2-Cre placenta depicted in E-H is re-represented in an enhanced manner (I-L). Similar to controls, Cited2ΔlacZ/F; Tie2-Cre (I-L) placentas showed normal investment of mural cells (inset in panel L). Scale bar: 40μm (A-L).

Figure 4.10 Endothelial specific deletion of Cited2 does not affect mural cell coverage of large sized vessels in the placental fetal vasculature. Confocal images of 14.5 dpc mid-placental sections co-stained with α-SMA (green) (A, E) and Pecam1 (red) (B, F), counterstained with TO-PRO®-3 to visualise nucleic acids (blue) (C, G), with images merged (D, H) using the ImageJ software. Cited2ΔlacZ/F (n=3) control placentas (A-D) exhibit endothelial-lined (red) vessels covered with multiple layers of α-SMA-positive (green) smooth muscle cells. Similarly, Cited2ΔlacZ/F; Tie2-Cre (n=3) placentas (E-H) show normal investment of mural cells. Scale bar: 40μm (A-H).

4.4 Discussion

The assessment that follows describes confirmation of Tie2-Cre activity in the precursor cells of the placental fetal vasculature, as well as in the very well documented mesodermal cells of the extraembryonic yolk sac (Gerety and Anderson, 2002). This discussion also analyses the phenotype of the placenta with endothelial cell confined ablation of Cited2.

4.4.1 Cre-recombinase from the Tie2-Cre locus is active in the precursor tissue of the placental fetal vasculature and extraembryonic mesodermal cells

Midgestation marks a unique time in the embryo and its support structures. At 9.5 dpc, there is a shift in the way the embryo garners its nutrients and expels of its wastes. It marks the developmental timepoint in which there is an increased demand for nutrients which passive diffusion cannot sustain. It highlights the growing need for the placenta. It was therefore chosen as an early timepoint to confirm Cre- recombinase activity from the Tie2-Cre locus in the developing placenta. Briefly, it was confirmed that Cre-recombinase is expressed in the endothelial cells of the allantoic mesenchyme of the developing placental fetal vasculature. Not surprisingly, Cre-recombinase is also expressed in the highly vascularised yolk sac where it is expressed in the mesodermal component of the forming blood islands. To further confirm that Cre-recombinase from the Tie2-Cre locus excises the gene of interest in the desired endothelial cells, Cre-recombinase spatial expression at a later developmental timepoint should be tested. At the time of writing this thesis, R26R; Tie2-Cre placentas have been collected for this purpose. More importantly for this study, excision of Cited2 in endothelial cells only should be substantiated in order to be able to draw definitive conclusions about endothelial cell-specific functions of Cited2. The design of the Cited2ΔlacZ null allele is such that the lacZ reporter gene can be utilised to identify cells that would have expressed Cited2 normally. Therefore, it is possible to check where Cited2 is spatially deleted and to verify that Tie2-Cre has taken Cited2 out of endothelial cells in the placental fetal vasculature.

192

However, because Tie2-Cre is a pan endothelial cell gene deleter it also excises genes in endothelial cells of the embryo. There is no clear data to show that Cited2 is expressed in endothelial cells of the embryo, and thus should be pursued. This is important to consider before one can draw any conclusions about cell-specific gene function of Cited2 in the placenta. Taking Cited2 out of endothelial cells in the placenta results in growth retarded embryos late in gestation but with no overtly distinct embryonic phenotype. However, retrospective genotyping allowed discernment of one 16.5 dpc Cited2ΔlacZ/Cited2F; Tie2-Cre embryo as avascular and one 18.5 dpc Cited2ΔlacZ/Cited2F; Tie2-Cre embryo as oedematous upon dissection. This can be ascribed to endothelial-specific deletion of Cited2 in the placenta with secondary effects on the embryo. Alternatively, given Cited2 expression during development at multiple sites that form mesodermal structures (Dunwoodie et al., 1998), in which endothelial cells are derived, it is possible that these embryonic defects is primarily due to Cited2 deletion in embryonic endothelial cells. However, as proposed, Cited2 expression in embryonic endothelial cells will require further verification for any conclusions to be made. Upon validation of this and given the poor mural cell investment of the placental vasculature, it is curious to see whether this is recapitulated in the embryo. Embryos were collected and snap frozen for this purpose, and will be analysed for embryonic vascular defects.

In addition, Tie2-Cre is also active in haematopoietic cells (Batard et al., 1996, Koni et al., 2001, Takakura et al., 1998) and shown in this study to be active in the developing blood islands of the mesodermal component of the yolk sac. Cited2 is suggested to be expressed in the mesodermal component of the developing yolk sac, an important tissue for early haematopoietic development. Moreover, Cited2 is shown to be vitally important in haematopoietic development in the fetal liver (Chen et al., 2007). The observation that avascular and less vascularised yolk sacs are associated with either avascular or oedematous Cited2ΔlacZ/Cited2F; Tie2-Cre embryos (at 16.5 dpc and 18.5 dpc) curiously raise the question of whether these embryonic defects are due to Cited2 playing a role in haematopoiesis in the extraembryonic yolk sac. This will be pursued later. 193

4.4.2 A requirement for Cited2 in vascular endothelial cells of the mouse placenta for proper fetal growth

Despite the extra-placental endothelial cell expression of Cre-recombinase in the embryo from the Tie2-Cre locus, this mouse line still proved to be useful in dissecting Cited2 function in the placenta. Conditional deletion of Cited2 in endothelial cells of the placenta (as well as the embryo) resulted in growth-restricted pups, and those severely affected either die at birth or perinatally. This was further evidenced by growth retarded 18.5 dpc Cited2ΔlacZ/Cited2F; Tie2-Cre embryos as compared to controls. The Cited2ΔlacZ/Cited2F; Tie2-Cre placentas that support these 18.5 dpc growth retarded embryos are about 15% lighter compared to controls. This is an important finding as low birthweight is the strongest current clinical surrogate marker for an adverse intrauterine environment, and suggests that Cited2 is vitally important in endothelial cells for proper placentation. Knowing the caveat that Tie2- Cre is a pan endothelial and haematopoietic cell gene deleter, thus deleting Cited2 in embryonic endothelial and haematopoietic cells in addition to placental endothelial cells, the possibility that the poor embryonic development and subsequent pup death is due to an inherent loss of Cited2 in the embryo cannot be eliminated. Despite this, it still suggests that Cited2 is needed in endothelial cells for proper maturation of the placenta. Conceivably, this malformed placenta would certainly have an effect on its ability to sufficiently support the growing embryo.

Being a partial loss of Cited2, it was predicted that the endothelial cell-restricted loss of Cited2 should manifest in a less severe placental phenotype compared to the complete null. In accordance with this it was observed that, at least by reduction in tissue wet weight as an indicator of malformation, the phenotype of Cited2ΔlacZ/Cited2F; Tie2-Cre placentas and its effect on the embryo are developmentally protracted. Previously, reduced Cited2 null embryo weights were observed (at 14.5 dpc) two days following the decrease in weight of Cited2 null placentas first seen at 12.5 dpc (Withington et al., 2006). Significant reductions in

194

Cited2ΔlacZ/Cited2F; Tie2-Cre placental wet weights are first observed at 16.5 dpc, with no effect on the 16.5 embryos that they support. Two developmental days later at 18.5 dpc, Cited2ΔlacZ/Cited2F; Tie2-Cre placental wet weights are markedly diminished compared to control placentas; the 18.5 dpc embryos that they sustain are equally growth retarded. Furthermore, it has been reported that complete Cited2 null pups are never observed at the time of weaning (Weninger et al., 2005). However, pups that are supported by Cited2ΔlacZ/Cited2F; Tie2-Cre placentas are observed and are growth-restricted; thus supporting the hypothesis that a moderate phenotype results from a partial loss of Cited2 in only the endothelial cells of the placenta relative to the complete Cited2 null placenta. The observation of a placental phenotype in the conditional Cited2 deletants, despite a delayed manifestation as compared to absolute Cited2 nulls, highlights the importance of the contribution of Cited2 in endothelial cells in proper placentology. It is interesting that deletion of Cited2 in endothelial cells of the placental labyrinth affects trophoblast development – this suggests that Cited2 in endothelial cells affect trophoblast cells in a paracrine manner. To our knowledge, this is the first description of a mouse model where gene deletion in the vascular compartment of the placenta results in defects in trophoblast cells. Conversely, it is worth highlighting that application of tetraploid assays to p38α mouse mutants resulted in restoration of proper placental vascular morphology (Adams et al., 2000). By the nature of the tetraploid assay, this implies that p38α is required in trophoblasts by the developing labyrinthine vasculature in a paracrine fashion. Therefore, in contrast to the findings in this current thesis where Cited2 can be deleted in vascular cells but affect trophoblast cells, it has been documented that the converse is true where other genes (like p38α) may be expressed in trophoblast cells but affect the vascular compartment of placentas in a paracrine manner. It is plausible that Cited2 may also be independently required in other placental compartments such as trophoblast cells in order to view the full placental defect. This will be explored in the next chapter where trophoblast-specific functions of Cited2 are explored.

195

4.4.3 Cited2 is necessitated in vascular endothelial cells for the correct formation of the placenta and the trophoblasts that reside in it.

To tie in the poor embryonic growth and demise of Cited2ΔlacZ/Cited2F; Tie2-Cre embryos with placental insufficiency, the morphology of the placentas that nourish them was investigated. This study found that, in support of the reduced placental weights at 16.5 dpc onwards, even as early as 14.5 dpc the Cited2ΔlacZ/Cited2F; Tie2- Cre placentas were morphologically smaller compared to controls. The junctional zone of the conditional deletants was observed to be reduced when probed with gene markers and histological stains that identified TGCs, SpT and GlyT cells that reside in this placental compartment. This indicates that endothelial cell-derived Cited2- dependent processes are required to properly pattern trophoblasts in the junctional zone. This should not be surprising as vascular and trophoblast cells in the placenta intimately associate with one another, with the existence of a complex signal interplay between these two cellular compartments (Rossant and Cross, 2001). It is curious to note that unlike the total Cited2 null placenta, placentas lacking Cited2 in endothelial cells (Cited2ΔlacZ/Cited2F; Tie2-Cre) still exhibited GlyT cells invading the maternal decidua. Therefore, the conditional Cited2 deletants are analogous to but do not completely phenocopy the complete Cited2 null placenta. This indicates that Cited2 is primarily required in endothelial cells to determine placental size as well as expansion of trophoblast derivatives. Although, it would appear that not all of the trophoblast defects seen in Cited2 total null placentas can be attributed to endothelial cell-derived Cited2-dependent events. Specifically, GlyT cell invasion of the maternal decidua is independent of Cited2-mediated molecular events originating from endothelial cells. However, GlyT cellular expansion in the junctional zone seems to require endothelial-derived Cited2.

196

4.4.4 Cited2 is not required in endothelial cells for morphogenesis of the placental fetal vasculature and its maturation by pericyte and smooth muscle cell envelopment.

The characteristic interdigitations at the margin of the labyrinthine and junctional zones appear to be reduced in Cited2ΔlacZ/Cited2F; Tie2-Cre placentas. Although, the labyrinthine vasculature is similar in size compared to control placentas. The previous chapter linked for the first time the enlarged vessels in Cited2 complete null placentas with the poorly organsied mural cell deposition within the same vascular bed. Therefore, employing the same technique to visualise the placental vasculature as in the previous chapter, the placental bed of Cited2ΔlacZ/Cited2F; Tie2-Cre was assessed by α-SMA and Pecam1 co-immunostaining.

Briefly, it was found that microvessels of Cited2ΔlacZ/Cited2F; Tie2-Cre placentas were not enlarged and were normally covered by pericytes like control placentas. Similarly, intermediate- and large-sized vessels were normally covered by smooth muscle cells. Also, by comparing the ratio of α-SMA expressing mural cells and Pecam1 expressing endothelial cells to give an indication of mural cell coverage of vessels, Cited2ΔlacZ/Cited2F; Tie2-Cre placental vessels were normally covered by mural cells. This observation in Cited2 conditional placentas not phenocopying the vascular perturbations seen in Cited2 complete null placentas indicates that Cited2 is not principally required in endothelial cells for appropriate vascular morphogenesis. Moreover, the fact that deleting Cited2 in endothelial cells does not result in a vascular phenotype is in line with its weak expression in endothelial cells in the placental vasculature,observed in the previous chapter. Therefore, this begs the question, is Cited2 primarily required in mural cells (where it is expressed strongly) for its own cellular proliferation or differentiation and subsequent morphogenesis? This can be addressed by using the Sm22alpha-Cre mouse (Lepore et al., 2005, Miano et al., 2004) that should conditionally delete Cited2 in mural cells.

To begin to tease out the molecular mechanism of the cellular defects in Cited2ΔlacZ/Cited2F; Tie2-Cre placentas, key signalling molecules should be

197 investigated as in the Cited2 complete null placenta study. In much the same way, protein levels of pertinent molecules should be studied by western blot. These protein studies should begin to build a framework for the molecular basis of the phenotype of Cited2 conditional mutant placentas, and elucidate Cited2 function. At the time of writing, Cited2ΔlacZ/Cited2F; Tie2-Cre and control placentas were collected for this purpose and will be pursued.

4.5 Summary

Dissecting cell-specific gene function is made impossible when the gene of interest is widely expressed in many tissues. Cited2 is one such gene, whose ablation causes deleterious effects on embryonic and extraembryonic development (Bamforth et al., 2001, Bamforth et al., 2004, Buaas et al., 2009, Chen et al., 2009, Chen et al., 2008, Chen et al., 2007, Combes et al., 2010, MacDonald et al., 2008, Qu et al., 2007, Weninger et al., 2005, Withington et al., 2006, Xu et al., 2008, Yin et al., 2002). Therefore, cell-restricted deletion of Cited2 will inform on its primary genetic requirement in the cells and tissue where it is excised. This study has provided genetic evidence for a requirement for Cited2 in endothelial cells, acting in a paracrine manner, to affect trophoblast development. Conditional deletion of Cited2 in endothelial cells using Tie2-Cre to uncouple Cited2 function in other cells, results in partial phenocopy of the Cited2 absolute null placenta. This indicates that Cited2 is principally required in endothelial cells in determining placental size as well as expansion of trophoblast derivatives. However, not all of the trophoblast defects seen in Cited2 total null placentas can be attributed to endothelial cell-derived Cited2- dependent events; GlyT cell invasion of the maternal decidua still occurs in the conditional mutant placentas.

198

Chapter 5: Trophoblast cell-restricted deletion of Cited2 in the mouse placenta

199

5.1 Introduction

Cited2 is expressed in both the mesoderm-derived fetal vasculature as well as in various trophoblast derivatives of the mouse placenta; the totality of which represents a significant contribution to the mature placenta. When Cited2 is absent in the placenta both compartments are severely affected: there is a reduction in spongiotrophoblasts, in various trophoblast giant cells as well as the fetal vasculature being disorganised. Therefore, primary Cited2 function in the placenta is complicated by its widespread expression and the highly interactive nature of trophoblasts and vascular cells in the placenta. Therefore, using the same approach as described in the previous chapter, although this time probing the trophoblast cell- specific roles of Cited2, trophoblast-restricted deletion of Cited2 was attained using the Tpbpa-Cre mouse. Briefly, this mouse was generated by engineering a Cre- recombinase-IRES-EGFP cassette under the control of the endogenous Tpbpa promoter (Calzonetti et al., 1995, Simmons et al., 2007).

5.2 Aims and hypotheses

An efficiently functioning placenta is necessary for pregnancy to be carried to term. This is contingent on a properly structured placenta of organised compartments with adequate numbers of cells populating them. The placental compartment with a direct requirement for Cited2 expression can be determined by conditional deletion of the gene in the cell population of interest where it is expressed. The previous chapter underscored the importance of Cited2 in vascular components for proper mouse placentogenesis. This chapter will concentrate on the specific role Cited2 plays in trophoblast cells of the mouse placenta by using the Tpbpa-Cre mouse. It is surmised that, if a trophoblast-specific deficit of Cited2 exhibit a phenotype reminiscent of the complete Cited2 null placenta, then this implies that Cited2 is required in these cellular compartments.

200

5.3 Results

5.3.1 Documenting the activity of Cre-recombinase from the Tpbpa-Cre mouse

Gene regulatory elements of Tpbpa have been mapped, and shown to be sufficient for specific spatial and temporal expression in SpT cells (Calzonetti et al., 1995). Taking advantage of this, the Tpbpa-Cre mouse was created by placing a Cre-recombinase- IRES-EGFP cassette 5.4kb downstream of the Tpbpa promoter (Simmons et al., 2007). The Tpbpa-Cre mouse has been characterised (Simmons et al., 2007) by crossing them with the Z/AP reporter mouse (Lobe et al., 1999) that constitutively expresses the lacZ reporter gene throughout embryonic gestation and into adulthood, however Cre-recombinase mediated excision of lacZ results in the subsequent expression of the second gene reporter, human alkaline phosphatase. This method is a reliable readout of Cre-recombinase activity from the Tpbpa-Cre locus, showing that in the midgestation placenta Cre-recombinase is expressed in P-TGC, C-TGC, SpA-TGC and SpT cells (Simmons et al., 2007). These cellular sites of expression were confirmed for this study by mating R26R reporter mice with the Tpbpa-Cre mouse.

Early in gestation, Cre-recombinase is expressed in a subset of cells in the chorionic plate of the 9.5 dpc conceptus (Figure 5.1). Not surprisingly, it is not expressed in the allantois, yolk sac and maternal decidua at the same developmental stage (Figure 5.1). In the associated 9.5 dpc embryo, Cre-recombinase is very sparsely and non- uniformly expressed (Figure 5.1). Later in gestation at 14.5 dpc, Cre-recombinase is expressed in P-TGCs, C-TGCs and SpT cells, but it does not seem to be expressed in GlyT cells (Figure 5.2). In subsequent serial sections, SpA-TGC expression was also observed (data not shown). There is the odd anomalous positive cell in vessels of the umbilicus at the base of the placenta, as well as in the labyrinthine zone, but both

201

placental domains are largely negative for Cre-recombinase activity (Figure 5.2). This is in agreement with published data showing Tpbpa-Cre is active in various trophoblast cell derivative compartments of the mouse placenta (Simmons et al., 2007).

5.3.2 Phenotypic analysis of mutant mouse embryos and placentas conditionally deleted of Cited2 in trophoblast derivatives

The subsequent subsections characterise the phenotype of placentas with trophoblast cell-specific ablation of Cited2.

5.3.2.a Mouse pups supported by placentas null for Cited2 in a subset of trophoblasts are smaller at birth and die perinatally

Much like in the previous chapter, with Cited2 being removed from only a subset of trophoblast cells it was speculated that the phenotype would be less acute than the Cited2 absolute nulls. It was thus investigated whether mouse pups supported by placentas with Cited2 deficient trophoblast derivatives could survive past weaning stage.

Cited2ΔlacZ/Cited2+; Tpbpa-Cre/+ sires were crossed to Cited2F dams who had progeny with perceptible differences in weight between pups null for Cited2 (i.e. Cited2ΔlacZ/Cited2F; Tpbpa-Cre) and controls. This was seen in the background of quite a wide range of weights within genotype groups (data not shown) that may be a reflection of inter-litter variations and intrinsic biological noise. Therefore, to account for these factors, individual pup weights were normalised to the average weight of the control genotypes (Cited2ΔlacZ/Cited2F; +/+, Cited2F/Cited2+; Tpbpa- Cre/+ and Cited2F/Cited2+; +/+) within the litter. Mouse pups null for Cited2 (i.e. Cited2ΔlacZ/Cited2F; Tpbpa-Cre) were smaller at birth compared to controls (Figure 5.3). Moreover, there were more perinatal mouse pup deaths in the test genotype with approximately 30% of dead pups within the cohort, compared to controls with an average of about 10% death between all three genotypes (Figure 5.3). Ratios of 206

Figure 5.3 Mouse pups supported by placentas with Cited2 deficient trophoblast derivatives are small and die perinatally. Depicted are pup weights at birth represented as individual pup weights normalised to the average weights of the controls (Cited2ΔlacZ/Cited2F; +/+, Cited2F/Cited2+; Tpbpa-Cre/+, Cited2F/+; +/+) within their respective litter. White dots represent pups null for Cited2, and grey dots depict pups heterozygous for Cited2. Red dots represent perinatal death of pups found at birth or the following days. One-way analysis of variance was performed, and significance was determined using Tukey’s post hoc test to identify differences between genotypes (**p ≤ 0.01).

208

genotypes fit expected Mendelian segregation (1:1:1:1) as revealed by χ2 analysis (3 degrees of freedom) (p = 0.78).

5.3.2.b Midgestation placentas with Cited2 conditionally excised in distinct trophoblast cell compartments is suggested to have a perturbed junctional zone

With the observation that Cited2ΔlacZ/Cited2F; Tpbpa-Cre mouse pups are growth retarded and with a noticeable greater occurrence of perinatal pup death, it was thus endeavoured to demonstrate that this was due to an inadequate in utero environment and placental insufficiency. Therefore, the morphology of Cited2ΔlacZ/Cited2F; Tpbpa-Cre mouse placentas were studied, which were generated by crossing Cited2ΔlacZ /Cited2+; Tpbpa-Cre/+ sires with Cited2F heterozygous dams (note that this is a slightly different cross to all other crosses concerning mouse Cre- recombinase lines described in this thesis, and will generate eight different genotypic progeny). SpT and GlyT cells in the junctional zone were identified by RNA in situ hybridisation using the genetic marker, Tpbpa. Firstly, it was found that the morphological size of the 14.5dpc Cited2 conditional placenta was similar to the control (Figure 5.4) with the placental areas quantified in the same way as described in Chapter 4. Preliminary data suggests that the wet weight of Cited2ΔlacZ/Cited2F; Tpbpa-Cre placentas are reduced compared to control placentas, however the embryos that they support do not appear to be vastly different in weight compared to controls (Figure 5.4). Secondly, on account of the area outlined by Tpbpa expression, the junctional zone appears to be reduced in Cited2ΔlacZ/Cited2F; Tpbpa-Cre placenta (22.6% of the whole placental area) compared to the control placenta (32.3% of the whole placental area) (Figure 5.5). The proportional distribution of genotypes were tested for fit to expected Mendelian ratios (1:1:1:1:1:1:1:1) by χ2 analysis (7 degrees of freedom) and suggested that there was deviation from the expected numbers (p = 0.01). However, this is due to small sampling and thus biases the analysis. PAS stain used to identify GlyT cells, and using salivary alpha-amylase to confirm glycogen content, also illustrated comparable morphological size between Cited2ΔlacZ/Cited2F; Tpbpa-Cre and control placentas (Figure 5.6). The PAS stain also suggested a

210 reduced junctional zone in the Cited2ΔlacZ/Cited2F; Tpbpa-Cre placenta (36.6% of the total placental area) with decreases in both GlyT and SpT cells compared to the control placenta (31.4% of the total placental area), although this will require further

211

Figure 5.4 Comparison of weights of placentas and embryos null for Cited2 in a subset of trophoblasts at 14.5 dpc. Represented are placental and embryonic weights at 14.5 dpc depicted as individual (A) placental or (B) embryonic weights normalised to the average weights of the controls (Cited2ΔlacZ/Cited2F; +/+, Cited2F/Cited2+; Tpbpa-Cre/+, Cited2F/Cited2+; +/+, Cited2ΔlacZ/Cited2+; Tpbpa-Cre, Cited2ΔlacZ/Cited2+; +/+, Cited2+/Cited2+; Tpbpa-Cre, Cited2+/Cited2+; +/+,) within their respective litter. White dots represent placentas and embryos null for Cited2, grey dots depict placentas and embryos heterozygous for Cited2, and black dots illustrate placentas and embryos wildtype for Cited2.

Figure 5.5 Trophoblast derivative-restricted ablation of Cited2 suggests a reduced junctional zone Transverse sections through a 14.5 dpc (A) Cited2ΔlacZ/F control (n=1) and (B) Cited2ΔlacZ/F; Tpbpa-Cre (n=1) placenta probed with Tpbpa (also known as 4311) that marks spongiotrophoblasts and glycogen trophoblast cells. Sections were counterstained with eosin. Scale bar: 500μm in A and B.

Figure 5.6 Placentas lacking Cited2 in trophoblast cells appear to have a reduced junctional zone. Depicted are histological sections through 14.5 dpc placentas stained with periodic acid-Schiff (PAS). Serial sections of a Cited2ΔlacZ/F (n=1) control placenta stained with PAS and either (A) untreated with α-amylase or (B) treated with α-amylase are shown. Boxes in panels A and B correspond to magnified images in panels E and F, respectively. The PAS reaction unspecifically stains glycogen and mucin present in many tissue beds to give a magenta colour. Glycogen, and therefore glycogen trophoblast (GlyT) cells in the placenta, was positively identified by treatment with salivary α-amylase that breaks down glycogen into simple sugars. This is seen as a loss of the magenta colour in serial sections, giving GlyT cells their vacuolated cytoplasm appearance (compare E and F, as well as G and H). The junctional zone of the Cited2ΔlacZ/F control placentas is thick containing relatively equal amounts of GlyT and spongiotrophoblast (SpT) cells, with parietal trophoblast giant cells (arrows) in the junctional zone as well as around the periphery (E and F). In contrast, serial sections of Cited2ΔlacZ/F; Tpbpa-Cre (n=1) placentas stained with PAS and either (C) untreated or (D) treated with α-amylase suggests a smaller junctional zone compared to the Cited2ΔlacZ/F control placenta. Boxes in panels C and D correspond to magnified images in panels G and H, respectively. Scale bar: 622μm in A-D; 50μm in E, F, G and H.

verification as the reduction is not uniform throughout the thickness of the junctional zone (Figure 5.6). Together, these data are preliminary and only suggest perturbations in the junctional zone of Cited2ΔlacZ/Cited2F; Tpbpa-Cre placentas, and will therefore require further sampling to draw definite conclusions.

5.3.2.c Placentas lacking Cited2 in trophoblast cells have normal placental fetal vasculature

The preceding chapter showed a direct requirement for Cited2 in endothelial cells of the fetal vasculature, and consequently had downstream effects on mural cell investment and trophoblast numbers in the mouse placenta. Consistent with the endocrine role of trophoblasts, these cells synthesise and release cytokines that impinge on vascular cell survival (Geng et al., 1996, Whitley and Cartwright, 2010). Given that Cited2 is expressed by trophoblast cells in the junctional zone of the mouse placenta (Withington et al., 2006), it possible that Cited2 functions in trophoblast cells with paracrine effects on the placental vasculature. In determining this proposition, Cited2 was specifically deleted in a subset of trophoblast cells in the junctional zone of the mouse placenta using the Tpbpa-Cre mouse.

Cited2ΔlacZ /Cited2+; Tpbpa-Cre/+ sires were crossed to Cited2F dams and the placentas harvested at 14.5 dpc. Cryosections of test placentas with genotype Cited2ΔlacZ/Cited2F; Tpbpa-Cre and control placentas were doubly co-stained with the same Pecam1 and α-SMA antibodies as used in Chapters 3 and 4. This approach enabled outlining of endothelial and mural cell bodies, respectively, and permitted spatial analysis of these tightly associated cellular compartments with respect to each other. It revealed that placentas with trophoblasts null for Cited2 did not have perturbed vessel caliber or pericyte investment at the level of capillaries (Figure 5.7). Endothelial-lined vessels were regular in size and held together by pericytes into capillary loops. Similarly, mid-sized (Figure 5.8) and large-sized (Figure 5.9) vessels at the base of the placenta appeared to have consistent diameters with adequate

218

Figure 5.7 Specific deletion of Cited2 in trophoblast cell subtypes does not affect pericyte coverage of capillaries in the placental labyrinth Confocal micrographs of 14.5dpc mid-placental sections doubly immunostained with α-SMA (green) (A, E) and Pecam1 (red) (B, F), counterstained with TO-PRO®-3 to visualise nucleic acids (blue) (C, G), with images merged (D, H) using the ImageJ software. The Cited2ΔlacZ/F control placenta (n=1) (A-D) exhibited the normal tortuous pattern of α-SMA-positive pericytes (green) (A) and their arrangement into “pockets” of pericytes that hold endothelial cell-lined capillaries (red) into tight conduits and form capillary loop structures (inset in panel D). Similarly, Cited2ΔlacZ/F; Tpbpa-Cre placentas (n=2) show the same vermicular pattern of pericytes associated with regularly sized vessels (inset in panel H). Scale bar: 40μm (A-H).

Figure 5.8 Specific deletion of Cited2 in trophoblast cell subtypes does not affect smooth muscle cell coverage of moderately sized fetal vessels in the placental labyrinth. Confocal micrographs showing 14.5 dpc mid-placental sections co-stained with α-SMA (green) (A, E) and Pecam1 (red) (B, F). Counterstaining with TO-PRO®-3 (C, G) enabled demarcation of nucleic acids (blue). Images were merged (D, H) using the ImageJ software. The Cited2ΔlacZ/F control placenta (n=1) (A-D) had uniform investment of α-SMA-positive smooth muscle cells spanning the entire length of moderately sized vessels. Cited2ΔlacZ/F; Tpbpa-Cre placentas (n=2) (E-H) taken at the same exposure are shown. To better appreciate the pattern of staining, the same Cited2ΔlacZ/F; Tpbpa-Cre placenta depicted in E-H is re-represented in an enhanced manner (I-L). In a similar manner, Cited2ΔlacZ/F; Tpbpa-Cre (I-L) placentas had moderately-sized vessels with consistent coverage of α-SMA-positive smooth muscle cells (inset in panel L). Scale bar: 40μm (A-L).

Figure 5.9 Endothelial specific deletion of Cited2 does not affect mural cell coverage of large sized vessels in the placental fetal vasculature. Confocal micrographs of 14.5 dpc mid-placental sections doubly stained with α-SMA (green) (A, E) and Pecam1 (red) (B, F), counterstained with TO-PRO®-3 to visualise nucleic acids (blue) (C, G). Images were merged (D, H) using the ImageJ software. The Cited2ΔlacZ/F control placenta (n=1) (A-D) exhibited endothelial-lined (red) vessels endowed with multiple layers of α-SMA- positive (green) smooth muscle cells. Similarly, Cited2ΔlacZ/F; Tpbpa-Cre placentas (n=2) (E-H) have vessels adequately covered with smooth muscle cells. Scale bar: 40μm (A-H).

coverage of mural cells. This indicates that Cited2 is not required in trophoblasts to affect vascular cells in a paracrine manner.

5.4 Discussion

The discussion that follows verifies published Cre-recombinase activity from the Tpbpa-Cre locus in the midgestation conceptus. It will also suggest the phenotype of placentas with trophoblast derivative restricted excision of Cited2, and its effect on the growing fetus it nourishes.

5.4.1 Cre-recombinase from the Tpbpa-Cre locus is active in some trophoblast derivatives in and near the junctional zone

The late expression of Cre-recombinase from the Tpbpa-Cre locus at 14.5 dpc in P- TGC, SpA-TGC, C-TGC and SpT cells at 14.5 dpc fits in with lineage tracing of Tpbpa-positive cells in the placenta; Tpbpa-positive cells that reside in the ectoplacental cone are progenitors for certain TGC subtypes and SpT cells (Simmons et al., 2007). This confirmatory evaluation of Tpbpa-Cre activity in the mouse placenta agrees well with published data.

Moreover, to our knowledge, we have reported the first documentation of Tpbpa-Cre activity in the 9.5 dpc embryo; Tpbpa-Cre activity in the embryo overlaps with published data on in vivo expression of Tpbpa in the mouse conceptus (Calzonetti et al., 1995). The activity of Tpbpa-Cre in a subset of cells in the chorion at 9.5 dpc is a curious observation. To our knowledge, this is the first report of Tpbpa-Cre activity in this tissue. The chorion gives rise to cells of the labyrinthine zone of the placenta including SynT-I, SynT-II and S-TGC (Simmons et al., 2008a). However, Tpbpa- Cre activity was largely undetected in these placental cellular compartments; it is highly probable that the Tpbpa-Cre-negative cells in the chorion may represent the precursor cells to these labyrinthine trophoblasts (i.e. SynT-I, SynT-II and S-TGC). It is interesting to figure out which cells these Tpbpa-Cre-positive chorionic cells

226 give rise to. From previous analysis, the possible cells that can arise from Tpbpa- Cre-positive cells are P-TGC, SpA-TGC, C-TGC and SpT cells (Simmons et al., 2007). If any of these cells are truly derived from these Tpbpa-Cre-positive chorionic cells, then this would represent a novel finding as P-TGC, SpA-TGC, C-TGC and SpT cells are thought to derive from Tpbpa-positive cells in the outer ectoplacental cone distal to the chorion (Figure 3.1). Tpbpa expression is initiated at 8.5 dpc in the ectoplacental cone but only encompasses the ectoplacental cone distal to the chorion were it is not expressed. Fittingly, it is also noted in the previous spatial analysis of Tpbpa-Cre activity (Simmons et al., 2007) that this Cre transgene is active as early as 8.5 dpc. Therefore, perhaps Tpbpa is expressed a day later at 9.5 dpc in a subset of cells in the chorion, which is a source of trophoblast stem cells early in development, which give rise to TGC subtypes other than labyrinthine TGCs.

5.4.2 A requirement for Cited2 in trophoblast derivatives of the mouse placenta for proper fetal growth

Mouse pups supported by placentas that are spatially restricted nulls for Cited2 in trophoblast derivatives are significantly smaller and more pups are observed to die perinatally compared to controls (Figure 5.3). This suggests that placentas with trophoblast cells deficient in Cited2 are less efficient in supporting the developing fetus. Therefore, by inference this also suggests that Cited2 function is required in the trophoblasts of the placenta for successful perinatal outcome.

Previously reported, complete Cited2 null embryos die in utero during midgestation with the absence of Cited2 null embryos after 14.5 dpc (Weninger et al., 2005, Withington et al., 2006). At 12.5 dpc, a significant decrease in placental wet weights of Cited2 nulls was observed and that this had a detrimental effect on the embryo with reductions in embryonic weights seen in the two days that followed (Withington et al., 2006). Given that pups are seen postnatally, and that it is a partial deletion of Cited2 in a subset of trophoblast cells, it is predicted that the placental phenotype will be less acute than the total Cited2 null. It is expected that, like the Tie2-Cre-mediated

227 deletion of Cited2 in endothelial cells, partial deletion of Cited2 in trophoblasts results in a delay in the observation of the placental phenotype.

5.4.3 A suggestion that Cited2 is required in trophoblast cells for the correct formation of the placenta.

The low birth weight and poor perinatal outcome of Cited2ΔlacZ/Cited2F; Tpbpa-Cre mouse pups is suggestive of placental insufficiency. To make this connection, the morphology of placentas with Cited2 deficient trophoblast cells was evaluated. Briefly, it is suggested that placentas conditionally deleted of Cited2 in a subset of trophoblasts appear to have a diminished junctional zone, histologically assessed by Tpbpa RNA in situ hybridisation (Figure 5.5) and PAS stain (Figure 5.6). Notwithstanding the need to increase sampling to confirm these conclusions, this suggests that there is a direct requirement for Cited2 in a subset of trophoblast cells, namely the P-TGC, C-TGC and SpT cells (i.e. cells positive for Tpbpa-Cre activity), to properly pattern the junctional zone of mouse placentas. Moreover, since Cited2 is expressed in P-TGCs and Tpbpa-Cre is active in this cellular compartment, Prl3b1 RNA in situ hybridisation experiments should elucidate whether there are perturbations to these cells in Cited2ΔlacZ/Cited2F; Tpbpa-Cre placentas. At the time of writing this thesis, placentas were collected for these purposes and will be pursued.

The poor outcome of Cited2ΔlacZ/Cited2F; Tpbpa-Cre mouse pups also beg the questions: when does the conditionally deleted placenta begin to be compromised? and how does it affect the embryo? It will be important to ascertain when the placental defects arise that lead to the reduced pup weights and mortality in these conditional deletants. The logical experiments to determine when placental form is compromised and the subsequent occurrence of embryonic demise are to ascertain placental and embryonic weights at earlier developmental timepoints like 14.5dpc, 16.5 dpc and 18.5 dpc. Preliminary data suggest that as early as 14.5 dpc, the placentas of Cited2ΔlacZ/Cited2F; Tpbpa-Cre are slightly reduced in weight compared to controls, although this is fragmentary and will require further sampling. However,

228 again pending increased sampling, the embryos that these 14.5 dpc Cited2ΔlacZ/Cited2F; Tpbpa-Cre placentas support are equivalent in weight to controls. Therefore, placental and embryonic weights later in gestation, such as 16.5 dpc and 18.5 dpc, are warranted. Previously, reduced Cited2 null embryo weights were observed (at 14.5 dpc) two days following the decrease in weight of Cited2 null placentas first seen at 12.5 dpc (Withington et al., 2006). Therefore, on account of the fact that Cited2ΔlacZ/Cited2F; Tpbpa-Cre placentas is less severe in the domains that Cited2 is deleted from, it is predicted that the two day lag in the observation of embryonic deficits from seeing placental perturbations will be protracted. Perhaps it will manifest later in gestation (i.e. 16.5 dpc or 18.5 dpc) compared to complete Cited2 null placentas when placental deficits are first seen at 12.5 dpc. Temporal determination of compromised placental form will inform as to when to perform morphological and molecular analysis. Alternatively, related to the intrinsic endocrine function of trophoblasts, the placental deficit may not be structural or morphological, but rather hormonal.

Assuming that the suggested placental phenotype in trophoblast-restricted Cited2 nulls remains true, it is curious to note that the size of these conditional deletants is comparable to controls at 14.5dpc. Broadly, this might suggest that Cited2 function in TGC, C-TGC and SpT cells is to partly pattern the junctional zone but not determine overall placental size; whereas remembering that in the previous chapter, placentas with endothelial cell-restricted Cited2 deletion were morphologically smaller in size from 14.5 dpc with concomitant reduction in junctional zone thickness and vascular abnormalities, indicating that Cited2 function in endothelial cells is to determine global placental size, and proper junctional zone and vascular size.

5.4.4 Cited2 is not required in trophoblast cells for the correct formation of the placental vasculature.

Trophoblast cells are shown to be capable of synthesising and releasing cytokines that can affect the survival of vascular cells (Geng et al., 1996, Whitley and Cartwright,

229

2010). On account of Cited2 expression in trophoblast cells of the placental junctional zone (Withington et al., 2006), it could not be excluded that a direct requirement for Cited2 function in trophoblast cells exists to affect the placental vasculature in a paracrine fashion. In this study, the observation that placentas with trophoblast cell-restricted deficiency in Cited2 have normally patterned and mature placental vasculatures adequately enveloped by mural cells argues against this proposition. It indicates that Cited2 is not primarily required in P-TGC, C-TGC and SpT cells to affect the vasculature in a paracrine manner.

5.5 Summary

This study has further characterised the placental tissues that may require Cited2 function. It was found that placentas null for Cited2 in a subset of trophoblasts delivered mouse pups that were smaller at birth and a higher incidence of perinatal death. Although fragmentary, preliminary genetic evidence is also provided that suggests Cited2 is required in P-TGC, C-TGC and SpT cells to determine trophoblast cell expansion in the junctional zone at 14.5 dpc, but is not needed to affect placental vascular morphogenesis through a paracrine mechanism. Moreover, Cited2 in trophoblast cells is not essential to establish overall placental size at 14.5 dpc. In contrast, the study conducted in the previous chapter where Cited2 was deleted in an endothelial cell-restricted manner informed on Cited2 function in determining the final size of the placenta. The compound effects of Cited2 loss in either vascular or trophoblast cells contributes greatly to the manifestation of the Cited2 complete null placental phenotype. Although, it should be noted that neither cell-specific deletion of Cited2 in either endothelial or trophoblast cell types give rise to overt vascular defects as seen in the complete Cited2 null placenta; perhaps, Cited2 is required in mural cells where it is strongly expressed (Chapter 3) compared to vascular endothelial cells and thus warrants its study. Despite this, together, this would suggest that Cited2 is required in endothelial cells to establish placental size and partially to pattern the junctional zone appropriately; whereas, Cited2 is suggested to be necessitated in P-TGC, C-TGC and SpT cells to pattern the junctional zone.

230

Chapter 6: General Discussion

231

6.1 Cited2 may be important in initiating L-R signals for organogenesis in the mouse

The first part of this thesis has provided evidence that Cited2 can potentiate Nodal signalling via the Nodal ASE, an important regulatory element that ensures initiation and propagation of Nodal itself and its target genes in the left LPM to determine left. The Nodal ASE contains two Foxh1 binding sites that are indispensible for its activity. Biochemically, it is also suggested that Cited2 interacts with Foxh1 that together may form a complex on the Nodal ASE to establish left. These studies represent the beginnings of understanding the function of Cited2 in determining laterality at the molecular level.

Cited2 is functionally versatile, performing dual roles as a positive or negative gene regulator of transcription. The function of Cited2 as a positive regulator of transcription is contingent on its interaction with CBP/p300. Together with CBP/p300, Cited2 can synergistically interact with other factors such as: Lhx1; Lhx2; Tcfap2; Ppara; Pparg; Smad2; and Smad3 to activate transcription of target genes and reporter genes (Bamforth et al., 2004, Braganca et al., 2003, Chou and Yang, 2006, Glenn and Maurer, 1999, Tien et al., 2004, Yahata et al., 2001). At the same time, Cited2 is also illustrated to be a negative regulator of transcription. This aspect of Cited2 function is again related to its association with CBP/p300. Cited2 can compete with the transcription factors Hif1a and Ets1 for binding with CBP/p300, squelching CBP/p300 bioavailability and prevent activation of Hif1a-dependent and Ets1-dependent target gene expression (Bhattacharya et al., 1999, De Guzman et al., 2004, Freedman et al., 2003, Yin et al., 2002, Yokota et al., 2003). Thus, it is the association of Cited2 with a wide range of specific transcriptional partners that is developmentally important for the generation of diverse biological responses important in organogenesis; a case in point is the direct biochemical interaction of Cited2 with the liver-enriched transcription factor Hnf4a to drive fetal liver development (Qu et al., 2007). In addition, Cited2 is also important for the development of other organs including: the eye (Chen et al., 2009, Chen et al., 2008);

232 the gonads (Buaas et al., 2009, Combes et al., 2010); the lungs (Xu et al., 2008); the adrenal glands, heart, neural crest cells, neural tube (Bamforth et al., 2001, Bamforth et al., 2004, Martinez-Barbera et al., 2002, Weninger et al., 2005, Yin et al., 2002). Here, we can potentially add Foxh1 to the list of Cited2 interactors, whose complex formation on the Nodal ASE potentiates Nodal signalling to provide left cues to developing organs.

It is curious to note that although Cited2 can potentiate Nodal transcription through the Nodal ASE, absence of Nodal expression in the left LPM in Cited2 null embryos is only approximately 50% penetrant (Weninger et al., 2005). It was initially hypothesised that there is insufficient Nodal in the left LPM of half of Cited2 null embryos, thus requiring Cited2 to boost Nodal expression in the left LPM in these Cited2 null embryos (Lopes Floro et. al., under revision). However, genetic experiments performed by Dr Lopes Floro reducing Nodal dosage in Cited2 null embryos did not increase the incidence of laterality defects. This indicates that the amount of Nodal reaching the left LPM is unlikely to be limited. This then begs the question: what other molecular effectors might be perturbed in the embryo to curtail the initiation and propagation of Nodal in the left LPM via the Nodal ASE? The TGFb superfamily member, growth differentiation factor 1 (Gdf1), is a molecular candidate worthy of further interrogation owing to the fact that: loss of Gdf1 results in laterality defects that are fully penetrant (Rankin et al., 2000); Gdf1 is expressed in the node that is a prerequisite for the initiation of Nodal in the left LPM (Tanaka et al., 2007); and Gdf1 dimerises with Nodal to enhance its long range action in a Foxh1-dependent manner (Tanaka et al., 2007). It would be predicted that if Gdf1 dosage is reduced in Cited2 null embryos and resulted in increased incidence of laterality defects, then this would argue for Gdf1 being the limiting factor that prevents Nodal initiation in the left LPM. Alternatively, another TGFb superfamily member with the same genetic and biochemical characteristics as Gdf1 may exist to define the molecular basis for the failed Nodal expression in the left LPM of half of Cited2 null embryos.

233

The conditional deletion of Cited2 in the node and the LPM anterior to the node performed by Dr Lopes Floro revealed that: Cited2 is not required in the Nodal expressing crown cells of the node but may be required in the pit cells; and that Cited2 is not required in the propagation of the Nodal signal in the left LPM once it is initiated. However, due to the domains of Cre-recombinase activity from the various Cre mouse lines used, the role that Cited2 plays in the initiation of the Nodal signal in the left LPM could not be addressed. Therefore, the role of Cited2 in the initiation of Nodal in the left LPM cannot be excluded. In fact, this thesis has provided in vitro evidence through transcriptional luciferase reporter assays that addresses this, indicating that Cited2 potentiates Nodal transcription through the Nodal ASE that is the enhancer genetically shown to be required for the initiation of Nodal expression in the LPM. What is now warranted is the genetic evidence to back this up. Cited2 function can only be truly defined with the generation of very specific tissue restricted, with concomitant correct temporal expression, of Cre-recombinase in the intervening tissue between the node and the LPM anterior to the node. This demands Cre-recombinase spatially active in the paraxial mesoderm, the tissue bordering the node and the LPM for initiation, to test the Nodal initiating role that Cited2 may play in the left LPM.

Our current understanding of L-R patterning includes a diverse array of proteins with varied function including: proteins required for ciliogenesis and function (Essner et al., 2005, Nonaka et al., 2002, Nonaka et al., 1998, Okada et al., 1999); secreted growth factors like Nodal that is expressed and restricted to the left side of the embryo by the actions of its TGFb superfamily co-member growth factors and co- ligands such as Lefty1, Lefty2 and Gdf1 (Meno et al., 1997, Meno et al., 1996, Meno et al., 1998, Meno et al., 2001, Rankin et al., 2000, Tanaka et al., 2007, Tsukui et al., 1999, Yamamoto et al., 2003); direct target genes of Nodal like Pitx2 that imparts laterality to developing organs via unknown mechanisms (Liu et al., 2001); and chemical molecules such calcium ions thought to trigger asymmetric expression of genes (McGrath et al., 2003, Tabin and Vogan, 2003). To our knowledge, this thesis describes for the first time the requirement for a transcriptional co-factor in 234 establishing embryonic laterality; Cited2 achieves this through potentiating the initiation of the left-sided determinant Nodal in the left LPM.

The role of Cited2 in left-right patterning was identified following a reverse genetic approach, which entails finding a gene then knocking it out of the genome to determine what it is required for in the embryo. This unbiased approach has proven to be fruitful as Cited2 was identified as a gene required for L-R patterning. A more focussed approach which is likely to yield additional genes required for L-R patterning is a forward genetic screen whereby genes are randomly mutagenised and mouse pedigrees chosen for study based on a L-R defect. Alternatively, a molecular approach based on transcriptional target genes could be employed. Additional gene targets of Nodal may be identified by ChIP sequencing the cistrome, defined as the set of DNA binding sites of a trans-acting factor such as a transcription factor on a genome scale, of Foxh1.

6.2 Cited2 may function in multiple placental cell compartments for proper placentogenesis

The latter half of this thesis deals with Cited2 function in the mouse placenta. Cited2 expression in vascular endothelial and mural cells in the placenta is confirmed. Also, for the first time, the previously observed enlarged fetal vessels and reduced mural cell investment in complete Cited2 null placentas is formally connected to one another. As well, the molecular effectors perturbed in absolute Cited2 null placentas are beginning to be identified, which should inform on the molecular circuitry that may be responsible for the defects seen. Finally, conditional deletion studies of Cited2 in the placenta indicate that Cited2 is directly required in endothelial cells for the appropriate development of trophoblast derivatives. Conditional deletion of Cited2 in a subset of trophoblasts also suggests that Cited2 is likely to be primarily required in trophoblast cells for appropriate placentogenesis, but will require further verification.

235

In Chapter 4, genetic evidence places Cited2 as being an important factor in endothelial cells for the appropriate development of trophoblasts. The logical explanation for this is a Cited2-dependent indirect paracrine mechanism. This is a novel finding as, to our knowledge, it is the first report of endothelial-specific deletion of a gene that affects the developing trophoblast in a paracrine manner. On account of the signalling interplay that exists between vascular and trophoblast cells of the placenta, perhaps Cited2 regulates the expression of a vascular specific secreted factor that then impacts on the development of trophoblast cells. In fact, one such vascular related candidate gene is Pdgfb. Pdgfb is shown to be expressed in the labyrinth of mouse placentas (a compartment largely populated by fetal vessels), though the exact cellular localisation remains ambiguous (Ohlsson et al., 1999). In agreement with the hypothesis, genetic deletion of Pdgfb results in reduced trophoblast numbers (Ohlsson et al., 1999). However, given that the protein expression of Pdgfb is normal in Cited2 null placentas (Chapter 3), it is unlikely that Pdgfb is a direct or indirect target of Cited2. Despite this, perhaps the spatial distribution of Pdgfb is perturbed in the Cited2 null placental milieu that may explain the malformed trophoblasts

In Chapter 5, preliminary genetic evidence suggests Cited2 as being an important factor in trophoblast components of the mouse placenta for their own maturation. Owing to the poor survival of pups supported by placentas with Cited2 conditionally deleted in trophoblast cells, this would argue for a primary requirement for Cited2 in trophoblasts. Further sampling will elucidate the function of Cited2 in this placental compartment. Notwithstanding this, with Cited2 being a negative regulator of Hif1a, it is tempting to speculate a Cited2-HIF signalling axis for trophoblast development. Indeed, trophoblast differentiation is greatly impacted by oxygen tension (Adelman et al., 2000, Levy et al., 2000, Schaffer et al., 2003). Moreover, hypoxia upregulates glycogen accumulation through HIF-mediated induction of glycogen synthase 1, muscle (Gys1) (Pescador et al., 2010), and may potentially play a role in GlyT cell development in the mouse placenta. In the future, to truly define Cited2 function in

236 the placenta, Cre-recombinase mouse lines with placental cell-specific activity and appropriate temporal activity will be required.

Placental development in the mouse entails the union of maternal and fetal cells. It is a complex process involving vascular endothelial, mural and trophoblast cell derivatives that proliferate, migrate, secrete growth factors, express ECM components as well as the MMPs and TIMPS that degrade and regulate the ECM. Studies on a specific placental cell compartments have often focused on a single or restricted number of these steps in placentogenesis. Furthermore, many studies have been limited to in vitro assays. Cited2 appears to exert pleiotropic effects in many compartments throughout the developing mouse conceptus. Moving forward, the vascular (and potentially trophoblast cell) abnormalities in Cited2 null and conditional placentas can be addressed by functional genomic studies looking at large scale differences at the genomic level. This is achievable by studying placental endothelial, mural or trophoblast cells in isolation and obtaining genetic material from Cited2 null, heterozygous and wildtypes for deep sequencing. Subsequent data analysis of genes differentially expressed between these genotypes should inform on the biochemical experiments to be performed to understand Cited2 function in these placental cells. An understanding of trans-acting transcriptional co-factors like Cited2, whose interaction and cooperation with other transcriptional regulators and components of the general transcriptional machinery on cis-acting DNA targets is critical to gaining a more complete understanding of the complex organogenesis of the mouse placenta.

6.3 Summary

Cited2 is important in establishing the L-R body axis as deletion of the gene results in laterality defects consistent with right isomerism. Here, it is shown that Cited2 can potentiate Nodal signalling, via the Nodal ASE, which is necessary for determining left. The Nodal ASE contains two Foxh1 binding sites which are necessary and sufficient for activity in ensuring the asymmetric expression of Nodal and its target

237 genes in the left LPM; it is suggested that Cited2 interacts with Foxh1 to potentiate Nodal ASE activity to ensure the establishment of laterality.

Also, Cited2 is widely expressed in extraembryonic compartments and is important in patterning the mouse placenta. Cited2 deletion results in smaller placentas with reduced trophoblast cells, an expanded labyrinthine layer and disrupted fetal vessels. It is shown here by conditional deletion that Cited2 is required in endothelial cells to correctly pattern trophoblast cell derivatives. Conditional deletion studies also suggest a direct requirement for Cited2 in trophoblast cells for its proper development in the mouse placenta, but not for placental vascular maturity. However, this will require further verification. The molecular effectors of signalling cascades perturbed in Cited2 null placentas are also beginning to be elucidated, and should inform on the biochemical basis for the placental defects seen in Cited2 null placentas.

238

Chapter 7: References

239

Abbott, B. D. & Buckalew, A. R. 2000. Placental defects in ARNT-knockout conceptus correlate with localized decreases in VEGF-R2, Ang-1, and Tie-2. Dev Dyn, 219, 526-38. Abramsson, A., Lindblom, P. & Betsholtz, C. 2003. Endothelial and nonendothelial sources of PDGF-B regulate pericyte recruitment and influence vascular pattern formation in tumors. J Clin Invest, 112, 1142-51. Abremski, K. & Hoess, R. 1984. Bacteriophage P1 site-specific recombination. Purification and properties of the Cre recombinase protein. J Biol Chem, 259, 1509-14. Adachi, H., Saijoh, Y., Mochida, K., Ohishi, S., Hashiguchi, H., Hirao, A. & Hamada, H. 1999. Determination of left/right asymmetric expression of nodal by a left side-specific enhancer with sequence similarity to a lefty-2 enhancer. Genes Dev, 13, 1589-600. Adams, R. H. & Alitalo, K. 2007. Molecular regulation of angiogenesis and lymphangiogenesis. Nat Rev Mol Cell Biol, 8, 464-78. Adams, R. H., Porras, A., Alonso, G., Jones, M., Vintersten, K., Panelli, S., Valladares, A., Perez, L., Klein, R. & Nebreda, A. R. 2000. Essential role of p38alpha MAP kinase in placental but not embryonic cardiovascular development. Mol Cell, 6, 109-16. Adamson, S. L., Lu, Y., Whiteley, K. J., Holmyard, D., Hemberger, M., Pfarrer, C. & Cross, J. C. 2002. Interactions between trophoblast cells and the maternal and fetal circulation in the mouse placenta. Dev Biol, 250, 358-73. Adelman, D. M., Gertsenstein, M., Nagy, A., Simon, M. C. & Maltepe, E. 2000. Placental cell fates are regulated in vivo by HIF-mediated hypoxia responses. Genes Dev, 14, 3191-203. Afonso, S., Romagnano, L. & Babiarz, B. 1999. Expression of cathepsin proteinases by mouse trophoblast in vivo and in vitro. Dev Dyn, 216, 374-84. Alexander, C. M., Hansell, E. J., Behrendtsen, O., Flannery, M. L., Kishnani, N. S., Hawkes, S. P. & Werb, Z. 1996. Expression and function of matrix metalloproteinases and their inhibitors at the maternal-embryonic boundary during mouse embryo implantation. Development, 122, 1723-36. Anson-Cartwright, L., Dawson, K., Holmyard, D., Fisher, S. J., Lazzarini, R. A. & Cross, J. C. 2000. The glial cells missing-1 protein is essential for branching morphogenesis in the chorioallantoic placenta. Nat Genet, 25, 311-4. Antonelli-Orlidge, A., Saunders, K. B., Smith, S. R. & D'Amore, P. A. 1989. An activated form of transforming growth factor beta is produced by cocultures of endothelial cells and pericytes. Proc Natl Acad Sci U S A, 86, 4544-8. Armant, D. R. 2005. Blastocysts don't go it alone. Extrinsic signals fine-tune the intrinsic developmental program of trophoblast cells. Dev Biol, 280, 260-80. Arthur, H. M., Ure, J., Smith, A. J., Renforth, G., Wilson, D. I., Torsney, E., Charlton, R., Parums, D. V., Jowett, T., Marchuk, D. A., Burn, J. & Diamond, A. G. 2000. Endoglin, an ancillary TGFbeta receptor, is required for extraembryonic angiogenesis and plays a key role in heart development. Dev Biol, 217, 42-53. Ashkar, A. A., Di Santo, J. P. & Croy, B. A. 2000. Interferon gamma contributes to initiation of uterine vascular modification, decidual integrity, and uterine 240

natural killer cell maturation during normal murine pregnancy. J Exp Med, 192, 259-70. Attisano, L., Silvestri, C., Izzi, L. & Labbe, E. 2001. The transcriptional role of Smads and FAST (FoxH1) in TGFbeta and activin signalling. Mol Cell Endocrinol, 180, 3-11. Bamforth, S. D., Braganca, J., Eloranta, J. J., Murdoch, J. N., Marques, F. I., Kranc, K. R., Farza, H., Henderson, D. J., Hurst, H. C. & Bhattacharya, S. 2001. Cardiac malformations, adrenal agenesis, neural crest defects and exencephaly in mice lacking Cited2, a new Tfap2 co-activator. Nat Genet, 29, 469-74. Bamforth, S. D., Braganca, J., Farthing, C. R., Schneider, J. E., Broadbent, C., Michell, A. C., Clarke, K., Neubauer, S., Norris, D., Brown, N. A., Anderson, R. H. & Bhattacharya, S. 2004. Cited2 controls left-right patterning and heart development through a Nodal-Pitx2c pathway. Nat Genet, 36, 1189-96. Bany, B. M. & Cross, J. C. 2006. Post-implantation mouse conceptuses produce paracrine signals that regulate the uterine endometrium undergoing decidualization. Dev Biol, 294, 445-56. Basak, S., Dhar, R. & Das, C. 2002. Steroids modulate the expression of alpha4 integrin in mouse blastocysts and uterus during implantation. Biol Reprod, 66, 1784-9. Basyuk, E., Cross, J. C., Corbin, J., Nakayama, H., Hunter, P., Nait-Oumesmar, B. & Lazzarini, R. A. 1999. Murine Gcm1 gene is expressed in a subset of placental trophoblast cells. Dev Dyn, 214, 303-11. Batard, P., Sansilvestri, P., Scheinecker, C., Knapp, W., Debili, N., Vainchenker, W., Buhring, H. J., Monier, M. N., Kukk, E., Partanen, J., Matikainen, M. T., Alitalo, R., Hatzfeld, J. & Alitalo, K. 1996. The Tie receptor tyrosine kinase is expressed by human hematopoietic progenitor cells and by a subset of megakaryocytic cells. Blood, 87, 2212-20. Belanger, L. F., Roy, S., Tremblay, M., Brott, B., Steff, A. M., Mourad, W., Hugo, P., Erikson, R. & Charron, J. 2003. Mek2 is dispensable for mouse growth and development. Mol Cell Biol, 23, 4778-87. Bevilacqua, E. M. & Abrahamsohn, P. A. 1988. Ultrastructure of trophoblast giant cell transformation during the invasive stage of implantation of the mouse embryo. J Morphol, 198, 341-51. Bhattacharya, S., Michels, C. L., Leung, M. K., Arany, Z. P., Kung, A. L. & Livingston, D. M. 1999. Functional role of p35srj, a novel p300/CBP binding protein, during transactivation by HIF-1. Genes Dev, 13, 64-75. Bissonauth, V., Roy, S., Gravel, M., Guillemette, S. & Charron, J. 2006. Requirement for Map2k1 (Mek1) in extra-embryonic ectoderm during placentogenesis. Development, 133, 3429-40. Bjarnegard, M., Enge, M., Norlin, J., Gustafsdottir, S., Fredriksson, S., Abramsson, A., Takemoto, M., Gustafsson, E., Fassler, R. & Betsholtz, C. 2004. Endothelium-specific ablation of PDGFB leads to pericyte loss and glomerular, cardiac and placental abnormalities. Development, 131, 1847-57. Bouillot, S., Rampon, C., Tillet, E. & Huber, P. 2006. Tracing the glycogen cells with protocadherin 12 during mouse placenta development. Placenta, 27, 882-8.

241

Braganca, J., Eloranta, J. J., Bamforth, S. D., Ibbitt, J. C., Hurst, H. C. & Bhattacharya, S. 2003. Physical and functional interactions among AP-2 transcription factors, p300/CREB-binding protein, and CITED2. J Biol Chem, 278, 16021-9. Braganca, J., Swingler, T., Marques, F. I., Jones, T., Eloranta, J. J., Hurst, H. C., Shioda, T. & Bhattacharya, S. 2002. Human CREB-binding protein/p300- interacting transactivator with ED-rich tail (CITED) 4, a new member of the CITED family, functions as a co-activator for transcription factor AP-2. J Biol Chem, 277, 8559-65. Brancho, D., Tanaka, N., Jaeschke, A., Ventura, J. J., Kelkar, N., Tanaka, Y., Kyuuma, M., Takeshita, T., Flavell, R. A. & Davis, R. J. 2003. Mechanism of p38 MAP kinase activation in vivo. Genes Dev, 17, 1969-78. Brennan, J., Norris, D. P. & Robertson, E. J. 2002. Nodal activity in the node governs left-right asymmetry. Genes Dev, 16, 2339-44. Brisken, C., Kaur, S., Chavarria, T. E., Binart, N., Sutherland, R. L., Weinberg, R. A., Kelly, P. A. & Ormandy, C. J. 1999. Prolactin controls mammary gland development via direct and indirect mechanisms. Dev Biol, 210, 96-106. Buaas, F. W., Val, P. & Swain, A. 2009. The transcription co-factor CITED2 functions during sex determination and early gonad development. Hum Mol Genet, 18, 2989-3001. Burdon, C., Mann, C., Cindrova-Davies, T., Ferguson-Smith, A. C. & Burton, G. J. 2007. Oxidative stress and the induction of cyclooxygenase enzymes and apoptosis in the murine placenta. Placenta, 28, 724-33. Calzonetti, T., Stevenson, L. & Rossant, J. 1995. A novel regulatory region is required for trophoblast-specific transcription in transgenic mice. Dev Biol, 171, 615-26. Cambier, S., Gline, S., Mu, D., Collins, R., Araya, J., Dolganov, G., Einheber, S., Boudreau, N. & Nishimura, S. L. 2005. Integrin alpha(v)beta8-mediated activation of transforming growth factor-beta by perivascular astrocytes: an angiogenic control switch. Am J Pathol, 166, 1883-94. Campione, M., Acosta, L., Martinez, S., Icardo, J. M., Aranega, A. & Franco, D. 2002. Pitx2 and cardiac development: a molecular link between left/right signaling and congenital heart disease. Cold Spring Harb Symp Quant Biol, 67, 89-95. Campione, M., Ros, M. A., Icardo, J. M., Piedra, E., Christoffels, V. M., Schweickert, A., Blum, M., Franco, D. & Moorman, A. F. 2001. Pitx2 expression defines a left cardiac lineage of cells: evidence for atrial and ventricular molecular isomerism in the iv/iv mice. Dev Biol, 231, 252-64. Campione, M., Steinbeisser, H., Schweickert, A., Deissler, K., van Bebber, F., Lowe, L. A., Nowotschin, S., Viebahn, C., Haffter, P., Kuehn, M. R. & Blum, M. 1999. The homeobox gene Pitx2: mediator of asymmetric left-right signaling in vertebrate heart and gut looping. Development, 126, 1225-34. Carmeliet, P. 2003. Angiogenesis in health and disease. Nat Med, 9, 653-60. Carmeliet, P., Ferreira, V., Breier, G., Pollefeyt, S., Kieckens, L., Gertsenstein, M., Fahrig, M., Vandenhoeck, A., Harpal, K., Eberhardt, C., Declercq, C., Pawling, J., Moons, L., Collen, D., Risau, W. & Nagy, A. 1996. Abnormal 242

blood vessel development and lethality in embryos lacking a single VEGF allele. Nature, 380, 435-9. Carney, E. W., Prideaux, V., Lye, S. J. & Rossant, J. 1993. Progressive expression of trophoblast-specific genes during formation of mouse trophoblast giant cells in vitro. Mol Reprod Dev, 34, 357-68. Chambers, R. C., Leoni, P., Kaminski, N., Laurent, G. J. & Heller, R. A. 2003. Global expression profiling of fibroblast responses to transforming growth factor-beta1 reveals the induction of inhibitor of differentiation-1 and provides evidence of smooth muscle cell phenotypic switching. Am J Pathol, 162, 533- 46. Chan, H. M. & La Thangue, N. B. 2001. p300/CBP proteins: HATs for transcriptional bridges and scaffolds. J Cell Sci, 114, 2363-73. Chantrain, C. F., Shimada, H., Jodele, S., Groshen, S., Ye, W., Shalinsky, D. R., Werb, Z., Coussens, L. M. & DeClerck, Y. A. 2004. Stromal matrix metalloproteinase-9 regulates the vascular architecture in neuroblastoma by promoting pericyte recruitment. Cancer Res, 64, 1675-86. Chen, C. & Shen, M. M. 2004. Two modes by which Lefty proteins inhibit nodal signaling. Curr Biol, 14, 618-24. Chen, S., Kulik, M. & Lechleider, R. J. 2003. Smad proteins regulate transcriptional induction of the SM22alpha gene by TGF-beta. Nucleic Acids Res, 31, 1302- 10. Chen, Y., Carlson, E. C., Chen, Z. Y., Hamik, A., Jain, M. K., Dunwoodie, S. L. & Yang, Y. C. 2009. Conditional deletion of Cited2 results in defective corneal epithelial morphogenesis and maintenance. Dev Biol, 334, 243-52. Chen, Y., Doughman, Y. Q., Gu, S., Jarrell, A., Aota, S., Cvekl, A., Watanabe, M., Dunwoodie, S. L., Johnson, R. S., van Heyningen, V., Kleinjan, D. A., Beebe, D. C. & Yang, Y. C. 2008. Cited2 is required for the proper formation of the hyaloid vasculature and for lens morphogenesis. Development, 135, 2939-48. Chen, Y., Haviernik, P., Bunting, K. D. & Yang, Y. C. 2007. Cited2 is required for normal hematopoiesis in the murine fetal liver. Blood, 110, 2889-98. Chen, Y. & Schier, A. F. 2001. The zebrafish Nodal signal Squint functions as a morphogen. Nature, 411, 607-10. Cheng, S. K., Olale, F., Brivanlou, A. H. & Schier, A. F. 2004. Lefty blocks a subset of TGFbeta signals by antagonizing EGF-CFC coreceptors. PLoS Biol, 2, E30. Chiang, C., Litingtung, Y., Lee, E., Young, K. E., Corden, J. L., Westphal, H. & Beachy, P. A. 1996. Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature, 383, 407-13. Chou, Y. T., Wang, H., Chen, Y., Danielpour, D. & Yang, Y. C. 2006. Cited2 modulates TGF-beta-mediated upregulation of MMP9. Oncogene, 25, 5547- 60. Chou, Y. T. & Yang, Y. C. 2006. Post-transcriptional control of Cited2 by transforming growth factor beta. Regulation via Smads and Cited2 coding region. J Biol Chem, 281, 18451-62. Christie, G. R., Williams, D. J., Macisaac, F., Dickinson, R. J., Rosewell, I. & Keyse, S. M. 2005. The dual-specificity protein phosphatase DUSP9/MKP-4 is 243

essential for placental function but is not required for normal embryonic development. Mol Cell Biol, 25, 8323-33. Clapp, C., Gonzalez, C., Macotela, Y., Aranda, J., Rivera, J. C., Garcia, C., Guzman, J., Zamorano, M., Vega, C., Martin, C., Jeziorski, M. C. & de la Escalera, G. M. 2006. Vasoinhibins: a family of N-terminal prolactin fragments that inhibit angiogenesis and vascular function. Front Horm Res, 35, 64-73. Cleaver, O. & Melton, D. A. 2003. Endothelial signaling during development. Nat Med, 9, 661-8. Coan, P. M., Conroy, N., Burton, G. J. & Ferguson-Smith, A. C. 2006. Origin and characteristics of glycogen cells in the developing murine placenta. Dev Dyn, 235, 3280-94. Coan, P. M., Ferguson-Smith, A. C. & Burton, G. J. 2004. Developmental dynamics of the definitive mouse placenta assessed by stereology. Biol Reprod, 70, 1806-13. Coan, P. M., Ferguson-Smith, A. C. & Burton, G. J. 2005. Ultrastructural changes in the interhaemal membrane and junctional zone of the murine chorioallantoic placenta across gestation. J Anat, 207, 783-96. Collignon, J., Varlet, I. & Robertson, E. J. 1996. Relationship between asymmetric nodal expression and the direction of embryonic turning. Nature, 381, 155-8. Combes, A. N., Spiller, C. M., Harley, V. R., Sinclair, A. H., Dunwoodie, S. L., Wilhelm, D. & Koopman, P. 2010. Gonadal defects in Cited2-mutant mice indicate a role for SF1 in both testis and ovary differentiation. Int J Dev Biol, 54, 683-9. Constancia, M., Hemberger, M., Hughes, J., Dean, W., Ferguson-Smith, A., Fundele, R., Stewart, F., Kelsey, G., Fowden, A., Sibley, C. & Reik, W. 2002. Placental-specific IGF-II is a major modulator of placental and fetal growth. Nature, 417, 945-8. Cook, J. L., Shallow, M. C., Zaragoza, D. B., Anderson, K. I. & Olson, D. M. 2003. Mouse placental prostaglandins are associated with uterine activation and the timing of birth. Biol Reprod, 68, 579-87. Coultas, L., Chawengsaksophak, K. & Rossant, J. 2005. Endothelial cells and VEGF in vascular development. Nature, 438, 937-45. Cowden Dahl, K. D., Fryer, B. H., Mack, F. A., Compernolle, V., Maltepe, E., Adelman, D. M., Carmeliet, P. & Simon, M. C. 2005. Hypoxia-inducible factors 1alpha and 2alpha regulate trophoblast differentiation. Mol Cell Biol, 25, 10479-91. Cross, J. C., Baczyk, D., Dobric, N., Hemberger, M., Hughes, M., Simmons, D. G., Yamamoto, H. & Kingdom, J. C. 2003. Genes, development and evolution of the placenta. Placenta, 24, 123-30. Cross, J. C., Hemberger, M., Lu, Y., Nozaki, T., Whiteley, K., Masutani, M. & Adamson, S. L. 2002. Trophoblast functions, angiogenesis and remodeling of the maternal vasculature in the placenta. Mol Cell Endocrinol, 187, 207-12. Cross, J. C., Werb, Z. & Fisher, S. J. 1994. Implantation and the placenta: key pieces of the development puzzle. Science, 266, 1508-18. Damert, A., Ikeda, E. & Risau, W. 1997. Activator-protein-1 binding potentiates the hypoxia-induciblefactor-1-mediated hypoxia-induced transcriptional 244

activation of vascular-endothelial growth factor expression in C6 glioma cells. Biochem J, 327 ( Pt 2), 419-23. Danos, M. C. & Yost, H. J. 1996. Role of notochord in specification of cardiac left- right orientation in zebrafish and Xenopus. Dev Biol, 177, 96-103. Das, S. K., Yano, S., Wang, J., Edwards, D. R., Nagase, H. & Dey, S. K. 1997. Expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases in the mouse uterus during the peri-implantation period. Dev Genet, 21, 44-54. Davis, S., Aldrich, T. H., Jones, P. F., Acheson, A., Compton, D. L., Jain, V., Ryan, T. E., Bruno, J., Radziejewski, C., Maisonpierre, P. C. & Yancopoulos, G. D. 1996. Isolation of angiopoietin-1, a ligand for the TIE2 receptor, by secretion- trap expression cloning. Cell, 87, 1161-9. De Guzman, R. N., Martinez-Yamout, M. A., Dyson, H. J. & Wright, P. E. 2004. Interaction of the TAZ1 domain of the CREB-binding protein with the activation domain of CITED2: regulation by competition between intrinsically unstructured ligands for non-identical binding sites. J Biol Chem, 279, 3042-9. de Waal Malefyt, R., Yssel, H., Roncarolo, M. G., Spits, H. & de Vries, J. E. 1992. Interleukin-10. Curr Opin Immunol, 4, 314-20. DeChiara, T. M., Efstratiadis, A. & Robertson, E. J. 1990. A growth-deficiency phenotype in heterozygous mice carrying an insulin-like growth factor II gene disrupted by targeting. Nature, 345, 78-80. Deussing, J., Kouadio, M., Rehman, S., Werber, I., Schwinde, A. & Peters, C. 2002. Identification and characterization of a dense cluster of placenta-specific cysteine peptidase genes and related genes on mouse chromosome 13. Genomics, 79, 225-40. Dey, S. K., Lim, H., Das, S. K., Reese, J., Paria, B. C., Daikoku, T. & Wang, H. 2004. Molecular cues to implantation. Endocr Rev, 25, 341-73. Dickson, M. C., Martin, J. S., Cousins, F. M., Kulkarni, A. B., Karlsson, S. & Akhurst, R. J. 1995. Defective haematopoiesis and vasculogenesis in transforming growth factor-beta 1 knock out mice. Development, 121, 1845- 54. Ding, L., Linsley, P. S., Huang, L. Y., Germain, R. N. & Shevach, E. M. 1993. IL-10 inhibits macrophage costimulatory activity by selectively inhibiting the upregulation of B7 expression. J Immunol, 151, 1224-34. Downward, J. 1998. Mechanisms and consequences of activation of protein kinase B/Akt. Curr Opin Cell Biol, 10, 262-7. Dumont, D. J., Gradwohl, G., Fong, G. H., Puri, M. C., Gertsenstein, M., Auerbach, A. & Breitman, M. L. 1994. Dominant-negative and targeted null mutations in the endothelial receptor tyrosine kinase, tek, reveal a critical role in vasculogenesis of the embryo. Genes Dev, 8, 1897-909. Dumont, D. J., Yamaguchi, T. P., Conlon, R. A., Rossant, J. & Breitman, M. L. 1992. tek, a novel tyrosine kinase gene located on mouse chromosome 4, is expressed in endothelial cells and their presumptive precursors. Oncogene, 7, 1471-80. Dunwoodie, S. L. 2009. The role of hypoxia in development of the Mammalian embryo. Dev Cell, 17, 755-73. 245

Dunwoodie, S. L., Rodriguez, T. A. & Beddington, R. S. 1998. Msg1 and Mrg1, founding members of a gene family, show distinct patterns of gene expression during mouse embryogenesis. Mech Dev, 72, 27-40. Dupressoir, A., Vernochet, C., Bawa, O., Harper, F., Pierron, G., Opolon, P. & Heidmann, T. 2009. Syncytin-A knockout mice demonstrate the critical role in placentation of a fusogenic, endogenous retrovirus-derived, envelope gene. Proc Natl Acad Sci U S A, 106, 12127-32. Dupressoir, A., Vernochet, C., Harper, F., Guegan, J., Dessen, P., Pierron, G. & Heidmann, T. 2011. A pair of co-opted retroviral envelope syncytin genes is required for formation of the two-layered murine placental syncytiotrophoblast. Proc Natl Acad Sci U S A, 108, E1164-73. Eming, S. A., Yarmush, M. L., Krueger, G. G. & Morgan, J. R. 1999. Regulation of the spatial organization of mesenchymal connective tissue: effects of cell- associated versus released isoforms of platelet-derived growth factor. Am J Pathol, 154, 281-9. Enders, A. C. 1965. A Comparative Study of the Fine Structure of the Trophoblast in Several Hemochorial Placentas. Am J Anat, 116, 29-67. Engelman, J. A., Luo, J. & Cantley, L. C. 2006. The evolution of phosphatidylinositol 3-kinases as regulators of growth and metabolism. Nat Rev Genet, 7, 606-19. Essner, J. J., Amack, J. D., Nyholm, M. K., Harris, E. B. & Yost, H. J. 2005. Kupffer's vesicle is a ciliated organ of asymmetry in the zebrafish embryo that initiates left-right development of the brain, heart and gut. Development, 132, 1247-60. Ferrara, N., Carver-Moore, K., Chen, H., Dowd, M., Lu, L., O'Shea, K. S., Powell- Braxton, L., Hillan, K. J. & Moore, M. W. 1996. Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature, 380, 439-42. Fiedler, U., Reiss, Y., Scharpfenecker, M., Grunow, V., Koidl, S., Thurston, G., Gale, N. W., Witzenrath, M., Rosseau, S., Suttorp, N., Sobke, A., Herrmann, M., Preissner, K. T., Vajkoczy, P. & Augustin, H. G. 2006. Angiopoietin-2 sensitizes endothelial cells to TNF-alpha and has a crucial role in the induction of inflammation. Nat Med, 12, 235-9. Fischer, A. M., Katayama, C. D., Pages, G., Pouyssegur, J. & Hedrick, S. M. 2005. The role of erk1 and erk2 in multiple stages of T cell development. Immunity, 23, 431-43. Fong, G. H., Rossant, J., Gertsenstein, M. & Breitman, M. L. 1995. Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium. Nature, 376, 66-70. Forsyth, I. A. 1994. Comparative aspects of placental lactogens: structure and function. Exp Clin Endocrinol, 102, 244-51. Franco, D. & Campione, M. 2003. The role of Pitx2 during cardiac development. Linking left-right signaling and congenital heart diseases. Trends Cardiovasc Med, 13, 157-63. Freedman, S. J., Sun, Z. Y., Kung, A. L., France, D. S., Wagner, G. & Eck, M. J. 2003. Structural basis for negative regulation of hypoxia-inducible factor- 1alpha by CITED2. Nat Struct Biol, 10, 504-12. 246

Fukuhara, S., Sako, K., Minami, T., Noda, K., Kim, H. Z., Kodama, T., Shibuya, M., Takakura, N., Koh, G. Y. & Mochizuki, N. 2008. Differential function of Tie2 at cell-cell contacts and cell-substratum contacts regulated by angiopoietin-1. Nat Cell Biol, 10, 513-26. Gaengel, K., Genove, G., Armulik, A. & Betsholtz, C. 2009. Endothelial-mural cell signaling in vascular development and angiogenesis. Arterioscler Thromb Vasc Biol, 29, 630-8. Gage, P. J., Suh, H. & Camper, S. A. 1999. Dosage requirement of Pitx2 for development of multiple organs. Development, 126, 4643-51. Gale, N. W., Thurston, G., Hackett, S. F., Renard, R., Wang, Q., McClain, J., Martin, C., Witte, C., Witte, M. H., Jackson, D., Suri, C., Campochiaro, P. A., Wiegand, S. J. & Yancopoulos, G. D. 2002. Angiopoietin-2 is required for postnatal angiogenesis and lymphatic patterning, and only the latter role is rescued by Angiopoietin-1. Dev Cell, 3, 411-23. Geng, Y. J., Wu, Q., Muszynski, M., Hansson, G. K. & Libby, P. 1996. Apoptosis of vascular smooth muscle cells induced by in vitro stimulation with interferon- gamma, tumor necrosis factor-alpha, and interleukin-1 beta. Arterioscler Thromb Vasc Biol, 16, 19-27. Georgiades, P., Ferguson-Smith, A. C. & Burton, G. J. 2002. Comparative developmental anatomy of the murine and human definitive placentae. Placenta, 23, 3-19. Gerety, S. S. & Anderson, D. J. 2002. Cardiovascular ephrinB2 function is essential for embryonic angiogenesis. Development, 129, 1397-410. Gille, H., Kortenjann, M., Thomae, O., Moomaw, C., Slaughter, C., Cobb, M. H. & Shaw, P. E. 1995. ERK phosphorylation potentiates Elk-1-mediated ternary complex formation and transactivation. EMBO J, 14, 951-62. Giroux, S., Tremblay, M., Bernard, D., Cardin-Girard, J. F., Aubry, S., Larouche, L., Rousseau, S., Huot, J., Landry, J., Jeannotte, L. & Charron, J. 1999. Embryonic death of Mek1-deficient mice reveals a role for this kinase in angiogenesis in the labyrinthine region of the placenta. Curr Biol, 9, 369-72. Glenn, D. J. & Maurer, R. A. 1999. MRG1 binds to the LIM domain of Lhx2 and may function as a coactivator to stimulate glycoprotein hormone alpha- subunit gene expression. J Biol Chem, 274, 36159-67. Goumans, M. J., Valdimarsdottir, G., Itoh, S., Rosendahl, A., Sideras, P. & ten Dijke, P. 2002. Balancing the activation state of the endothelium via two distinct TGF-beta type I receptors. EMBO J, 21, 1743-53. Gross, G. A., Imamura, T., Luedke, C., Vogt, S. K., Olson, L. M., Nelson, D. M., Sadovsky, Y. & Muglia, L. J. 1998. Opposing actions of prostaglandins and oxytocin determine the onset of murine labor. Proc Natl Acad Sci U S A, 95, 11875-9. Guillemot, F., Nagy, A., Auerbach, A., Rossant, J. & Joyner, A. L. 1994. Essential role of Mash-2 in extraembryonic development. Nature, 371, 333-6. Hackett, S. F., Ozaki, H., Strauss, R. W., Wahlin, K., Suri, C., Maisonpierre, P., Yancopoulos, G. & Campochiaro, P. A. 2000. Angiopoietin 2 expression in the retina: upregulation during physiologic and pathologic neovascularization. J Cell Physiol, 184, 275-84. 247

Hafezi-Moghadam, A., Simoncini, T., Yang, Z., Limbourg, F. P., Plumier, J. C., Rebsamen, M. C., Hsieh, C. M., Chui, D. S., Thomas, K. L., Prorock, A. J., Laubach, V. E., Moskowitz, M. A., French, B. A., Ley, K. & Liao, J. K. 2002. Acute cardiovascular protective effects of corticosteroids are mediated by non-transcriptional activation of endothelial nitric oxide synthase. Nat Med, 8, 473-9. Han, B., Liu, N., Yang, X., Sun, H. B. & Yang, Y. C. 2001. MRG1 expression in fibroblasts is regulated by Sp1/Sp3 and an Ets transcription factor. J Biol Chem, 276, 7937-42. Harvey, M. B., Leco, K. J., Arcellana-Panlilio, M. Y., Zhang, X., Edwards, D. R. & Schultz, G. A. 1995. Proteinase expression in early mouse embryos is regulated by leukaemia inhibitory factor and epidermal growth factor. Development, 121, 1005-14. Hatano, N., Mori, Y., Oh-hora, M., Kosugi, A., Fujikawa, T., Nakai, N., Niwa, H., Miyazaki, J., Hamaoka, T. & Ogata, M. 2003. Essential role for ERK2 mitogen-activated protein kinase in placental development. Genes Cells, 8, 847-56. He, Y., Smith, S. K., Day, K. A., Clark, D. E., Licence, D. R. & Charnock-Jones, D. S. 1999. Alternative splicing of vascular endothelial growth factor (VEGF)- R1 (FLT-1) pre-mRNA is important for the regulation of VEGF activity. Mol Endocrinol, 13, 537-45. Hellstrom, M., Gerhardt, H., Kalen, M., Li, X., Eriksson, U., Wolburg, H. & Betsholtz, C. 2001. Lack of pericytes leads to endothelial hyperplasia and abnormal vascular morphogenesis. J Cell Biol, 153, 543-53. Hellstrom, M., Kalen, M., Lindahl, P., Abramsson, A. & Betsholtz, C. 1999. Role of PDGF-B and PDGFR-beta in recruitment of vascular smooth muscle cells and pericytes during embryonic blood vessel formation in the mouse. Development, 126, 3047-55. Hemberger, M. 2008. IFPA award in placentology lecture - characteristics and significance of trophoblast giant cells. Placenta, 29 Suppl A, S4-9. Hemberger, M., Himmelbauer, H., Ruschmann, J., Zeitz, C. & Fundele, R. 2000. cDNA subtraction cloning reveals novel genes whose temporal and spatial expression indicates association with trophoblast invasion. Dev Biol, 222, 158-69. Hernandez-Verdun, D. 1974. Morphogenesis of the syncytium in the mouse placenta. Ultrastructural study. Cell Tissue Res, 148, 381-96. Hilfiker-Kleiner, D., Kaminski, K., Podewski, E., Bonda, T., Schaefer, A., Sliwa, K., Forster, O., Quint, A., Landmesser, U., Doerries, C., Luchtefeld, M., Poli, V., Schneider, M. D., Balligand, J. L., Desjardins, F., Ansari, A., Struman, I., Nguyen, N. Q., Zschemisch, N. H., Klein, G., Heusch, G., Schulz, R., Hilfiker, A. & Drexler, H. 2007. A cathepsin D-cleaved 16 kDa form of prolactin mediates postpartum cardiomyopathy. Cell, 128, 589-600. Hill, C. S. & Treisman, R. 1995. Transcriptional regulation by extracellular signals: mechanisms and specificity. Cell, 80, 199-211.

248

Hirschi, K. K., Burt, J. M., Hirschi, K. D. & Dai, C. 2003. Gap junction communication mediates transforming growth factor-beta activation and endothelial-induced mural cell differentiation. Circ Res, 93, 429-37. Hirschi, K. K., Rohovsky, S. A., Beck, L. H., Smith, S. R. & D'Amore, P. A. 1999. Endothelial cells modulate the proliferation of mural cell precursors via platelet-derived growth factor-BB and heterotypic cell contact. Circ Res, 84, 298-305. Hoess, R. H., Ziese, M. & Sternberg, N. 1982. P1 site-specific recombination: nucleotide sequence of the recombining sites. Proc Natl Acad Sci U S A, 79, 3398-402. Hogan, B., Beddington, R., Costantini, F. & Lacey, E. 1994. Manipulating the mouse embryo; A laboratory manual., Cold Spring Harbour Laboratory Press. Houck, K. A., Ferrara, N., Winer, J., Cachianes, G., Li, B. & Leung, D. W. 1991. The vascular endothelial growth factor family: identification of a fourth molecular species and characterization of alternative splicing of RNA. Mol Endocrinol, 5, 1806-14. Houck, K. A., Leung, D. W., Rowland, A. M., Winer, J. & Ferrara, N. 1992. Dual regulation of vascular endothelial growth factor bioavailability by genetic and proteolytic mechanisms. J Biol Chem, 267, 26031-7. Howard, M. & O'Garra, A. 1992. Biological properties of interleukin 10. Immunol Today, 13, 198-200. Hu, D. & Cross, J. C. 2010. Development and function of trophoblast giant cells in the rodent placenta. Int J Dev Biol, 54, 341-54. Imai, K., Hiramatsu, A., Fukushima, D., Pierschbacher, M. D. & Okada, Y. 1997. Degradation of decorin by matrix metalloproteinases: identification of the cleavage sites, kinetic analyses and transforming growth factor-beta1 release. Biochem J, 322 ( Pt 3), 809-14. Ishida, M., Ono, K., Taguchi, S., Ohashi, S., Naito, J., Horiguchi, K. & Harigaya, T. 2004. Cathepsin gene expression in mouse placenta during the latter half of pregnancy. J Reprod Dev, 50, 515-23. Izraeli, S., Lowe, L. A., Bertness, V. L., Campaner, S., Hahn, H., Kirsch, I. R. & Kuehn, M. R. 2001. Genetic evidence that Sil is required for the Sonic Hedgehog response pathway. Genesis, 31, 72-7. Izraeli, S., Lowe, L. A., Bertness, V. L., Good, D. J., Dorward, D. W., Kirsch, I. R. & Kuehn, M. R. 1999. The SIL gene is required for mouse embryonic axial development and left-right specification. Nature, 399, 691-4. Jackson, D., Volpert, O. V., Bouck, N. & Linzer, D. I. 1994. Stimulation and inhibition of angiogenesis by placental proliferin and proliferin-related protein. Science, 266, 1581-4. Jain, R. K. 2003. Molecular regulation of vessel maturation. Nat Med, 9, 685-93. Janknecht, R., Zinck, R., Ernst, W. H. & Nordheim, A. 1994. Functional dissection of the transcription factor Elk-1. Oncogene, 9, 1273-8. Jiang, B. H. & Liu, L. Z. 2009. PI3K/PTEN signaling in angiogenesis and tumorigenesis. Adv Cancer Res, 102, 19-65. Johnson, G. L. & Vaillancourt, R. R. 1994. Sequential protein kinase reactions controlling cell growth and differentiation. Curr Opin Cell Biol, 6, 230-8. 249

Jollie, W. P. 1964. Fine Structural Changes in Placental Labyrinth of the Rat with Increasing Gestational Age. J Ultrastruct Res, 10, 27-47. Jornvall, H., Blokzijl, A., ten Dijke, P. & Ibanez, C. F. 2001. The orphan receptor serine/threonine kinase ALK7 signals arrest of proliferation and morphological differentiation in a neuronal cell line. J Biol Chem, 276, 5140- 6. Kamei, T., Jones, S. R., Chapman, B. M., KL, M. C., Dai, G. & Soares, M. J. 2002. The phosphatidylinositol 3-kinase/Akt signaling pathway modulates the endocrine differentiation of trophoblast cells. Mol Endocrinol, 16, 1469-81. Kaminski, W. E., Lindahl, P., Lin, N. L., Broudy, V. C., Crosby, J. R., Hellstrom, M., Swolin, B., Bowen-Pope, D. F., Martin, P. J., Ross, R., Betsholtz, C. & Raines, E. W. 2001. Basis of hematopoietic defects in platelet-derived growth factor (PDGF)-B and PDGF beta-receptor null mice. Blood, 97, 1990-8. Kanda, S., Miyata, Y., Mochizuki, Y., Matsuyama, T. & Kanetake, H. 2005. Angiopoietin 1 is mitogenic for cultured endothelial cells. Cancer Res, 65, 6820-7. Kano, M. R., Morishita, Y., Iwata, C., Iwasaka, S., Watabe, T., Ouchi, Y., Miyazono, K. & Miyazawa, K. 2005. VEGF-A and FGF-2 synergistically promote neoangiogenesis through enhancement of endogenous PDGF-B-PDGFRbeta signaling. J Cell Sci, 118, 3759-68. Kelly, P. A., Tsushima, T., Shiu, R. P. & Friesen, H. G. 1976. Lactogenic and growth hormone-like activities in pregnancy determined by radioreceptor assays. Endocrinology, 99, 765-74. Kim, I., Kim, H. G., So, J. N., Kim, J. H., Kwak, H. J. & Koh, G. Y. 2000. Angiopoietin-1 regulates endothelial cell survival through the phosphatidylinositol 3'-Kinase/Akt signal transduction pathway. Circ Res, 86, 24-9. Kitamura, K., Miura, H., Miyagawa-Tomita, S., Yanazawa, M., Katoh-Fukui, Y., Suzuki, R., Ohuchi, H., Suehiro, A., Motegi, Y., Nakahara, Y., Kondo, S. & Yokoyama, M. 1999. Mouse Pitx2 deficiency leads to anomalies of the ventral body wall, heart, extra- and periocular mesoderm and right pulmonary isomerism. Development, 126, 5749-58. Klaffky, E., Williams, R., Yao, C. C., Ziober, B., Kramer, R. & Sutherland, A. 2001. Trophoblast-specific expression and function of the integrin alpha 7 subunit in the peri-implantation mouse embryo. Dev Biol, 239, 161-75. Koni, P. A., Joshi, S. K., Temann, U. A., Olson, D., Burkly, L. & Flavell, R. A. 2001. Conditional vascular cell adhesion molecule 1 deletion in mice: impaired lymphocyte migration to bone marrow. J Exp Med, 193, 741-54. Kortenjann, M., Thomae, O. & Shaw, P. E. 1994. Inhibition of v-raf-dependent c-fos expression and transformation by a kinase-defective mutant of the mitogen- activated protein kinase Erk2. Mol Cell Biol, 14, 4815-24. Kozak, K. R., Abbott, B. & Hankinson, O. 1997. ARNT-deficient mice and placental differentiation. Dev Biol, 191, 297-305. Krebs, L. T., Iwai, N., Nonaka, S., Welsh, I. C., Lan, Y., Jiang, R., Saijoh, Y., O'Brien, T. P., Hamada, H. & Gridley, T. 2003. Notch signaling regulates left-

250

right asymmetry determination by inducing Nodal expression. Genes Dev, 17, 1207-12. Kuida, K. & Boucher, D. M. 2004. Functions of MAP kinases: insights from gene- targeting studies. J Biochem, 135, 653-6. Kureishi, Y., Luo, Z., Shiojima, I., Bialik, A., Fulton, D., Lefer, D. J., Sessa, W. C. & Walsh, K. 2000. The HMG-CoA reductase inhibitor simvastatin activates the protein kinase Akt and promotes angiogenesis in normocholesterolemic animals. Nat Med, 6, 1004-10. Labbe, E., Silvestri, C., Hoodless, P. A., Wrana, J. L. & Attisano, L. 1998. Smad2 and Smad3 positively and negatively regulate TGF beta-dependent transcription through the forkhead DNA-binding protein FAST2. Mol Cell, 2, 109-20. Lagna, G., Hata, A., Hemmati-Brivanlou, A. & Massague, J. 1996. Partnership between DPC4 and SMAD proteins in TGF-beta signalling pathways. Nature, 383, 832-6. Larsson, J., Goumans, M. J., Sjostrand, L. J., van Rooijen, M. A., Ward, D., Leveen, P., Xu, X., ten Dijke, P., Mummery, C. L. & Karlsson, S. 2001. Abnormal angiogenesis but intact hematopoietic potential in TGF-beta type I receptor- deficient mice. EMBO J, 20, 1663-73. Lavoie, J. N., Rivard, N., L'Allemain, G. & Pouyssegur, J. 1996. A temporal and biochemical link between growth factor-activated MAP kinases, cyclin D1 induction and cell cycle entry. Prog Cell Cycle Res, 2, 49-58. Lee, S., Jilani, S. M., Nikolova, G. V., Carpizo, D. & Iruela-Arispe, M. L. 2005. Processing of VEGF-A by matrix metalloproteinases regulates bioavailability and vascular patterning in tumors. J Cell Biol, 169, 681-91. Lepore, J. J., Cheng, L., Min Lu, M., Mericko, P. A., Morrisey, E. E. & Parmacek, M. S. 2005. High-efficiency somatic mutagenesis in smooth muscle cells and cardiac myocytes in SM22alpha-Cre transgenic mice. Genesis, 41, 179-84. Lescisin, K. R., Varmuza, S. & Rossant, J. 1988. Isolation and characterization of a novel trophoblast-specific cDNA in the mouse. Genes Dev, 2, 1639-46. Leung, M. K., Jones, T., Michels, C. L., Livingston, D. M. & Bhattacharya, S. 1999. Molecular cloning and chromosomal localization of the human CITED2 gene encoding p35srj/Mrg1. Genomics, 61, 307-13. Leveen, P., Pekny, M., Gebre-Medhin, S., Swolin, B., Larsson, E. & Betsholtz, C. 1994. Mice deficient for PDGF B show renal, cardiovascular, and hematological abnormalities. Genes Dev, 8, 1875-87. Levy, R., Smith, S. D., Chandler, K., Sadovsky, Y. & Nelson, D. M. 2000. Apoptosis in human cultured trophoblasts is enhanced by hypoxia and diminished by epidermal growth factor. Am J Physiol Cell Physiol, 278, C982-8. Li, D. Y., Sorensen, L. K., Brooke, B. S., Urness, L. D., Davis, E. C., Taylor, D. G., Boak, B. B. & Wendel, D. P. 1999. Defective angiogenesis in mice lacking endoglin. Science, 284, 1534-7. Lin, C. R., Kioussi, C., O'Connell, S., Briata, P., Szeto, D., Liu, F., Izpisua-Belmonte, J. C. & Rosenfeld, M. G. 1999. Pitx2 regulates lung asymmetry, cardiac positioning and pituitary and tooth morphogenesis. Nature, 401, 279-82.

251

Lindahl, P., Johansson, B. R., Leveen, P. & Betsholtz, C. 1997. Pericyte loss and microaneurysm formation in PDGF-B-deficient mice. Science, 277, 242-5. Lindblom, P., Gerhardt, H., Liebner, S., Abramsson, A., Enge, M., Hellstrom, M., Backstrom, G., Fredriksson, S., Landegren, U., Nystrom, H. C., Bergstrom, G., Dejana, E., Ostman, A., Lindahl, P. & Betsholtz, C. 2003. Endothelial PDGF-B retention is required for proper investment of pericytes in the microvessel wall. Genes Dev, 17, 1835-40. Linzer, D. I. & Nathans, D. 1984. Nucleotide sequence of a growth-related mRNA encoding a member of the prolactin-growth hormone family. Proc Natl Acad Sci U S A, 81, 4255-9. Linzer, D. I. & Nathans, D. 1985. A new member of the prolactin-growth hormone gene family expressed in mouse placenta. EMBO J, 4, 1419-23. Liu, C., Liu, W., Lu, M. F., Brown, N. A. & Martin, J. F. 2001. Regulation of left- right asymmetry by thresholds of Pitx2c activity. Development, 128, 2039-48. Lkhider, M., Castino, R., Bouguyon, E., Isidoro, C. & Ollivier-Bousquet, M. 2004. Cathepsin D released by lactating rat mammary epithelial cells is involved in prolactin cleavage under physiological conditions. J Cell Sci, 117, 5155-64. Lobe, C. G., Koop, K. E., Kreppner, W., Lomeli, H., Gertsenstein, M. & Nagy, A. 1999. Z/AP, a double reporter for cre-mediated recombination. Dev Biol, 208, 281-92. Logan, M., Pagan-Westphal, S. M., Smith, D. M., Paganessi, L. & Tabin, C. J. 1998. The transcription factor Pitx2 mediates situs-specific morphogenesis in response to left-right asymmetric signals. Cell, 94, 307-17. Lohr, J. L., Danos, M. C. & Yost, H. J. 1997. Left-right asymmetry of a nodal-related gene is regulated by dorsoanterior midline structures during Xenopus development. Development, 124, 1465-72. Lowe, L. A., Supp, D. M., Sampath, K., Yokoyama, T., Wright, C. V., Potter, S. S., Overbeek, P. & Kuehn, M. R. 1996. Conserved left-right asymmetry of nodal expression and alterations in murine situs inversus. Nature, 381, 158-61. Lu, H. T., Yang, D. D., Wysk, M., Gatti, E., Mellman, I., Davis, R. J. & Flavell, R. A. 1999. Defective IL-12 production in mitogen-activated protein (MAP) kinase kinase 3 (Mkk3)-deficient mice. EMBO J, 18, 1845-57. Luo, Z., Fujio, Y., Kureishi, Y., Rudic, R. D., Daumerie, G., Fulton, D., Sessa, W. C. & Walsh, K. 2000. Acute modulation of endothelial Akt/PKB activity alters nitric oxide-dependent vasomotor activity in vivo. J Clin Invest, 106, 493-9. MacDonald, S. T., Bamforth, S. D., Chen, C. M., Farthing, C. R., Franklyn, A., Broadbent, C., Schneider, J. E., Saga, Y., Lewandoski, M. & Bhattacharya, S. 2008. Epiblastic Cited2 deficiency results in cardiac phenotypic heterogeneity and provides a mechanism for haploinsufficiency. Cardiovasc Res, 79, 448- 57. Macias-Silva, M., Abdollah, S., Hoodless, P. A., Pirone, R., Attisano, L. & Wrana, J. L. 1996. MADR2 is a substrate of the TGFbeta receptor and its phosphorylation is required for nuclear accumulation and signaling. Cell, 87, 1215-24. Maclean, K. & Dunwoodie, S. L. 2004. Breaking symmetry: a clinical overview of left-right patterning. Clin Genet, 65, 441-57. 252

Mahy, P., De Bast, M., Gallez, B., Gueulette, J., Koch, C. J., Scalliet, P. & Gregoire, V. 2003. In vivo colocalization of 2-nitroimidazole EF5 fluorescence intensity and electron paramagnetic resonance oximetry in mouse tumors. Radiother Oncol, 67, 53-61. Maisonpierre, P. C., Suri, C., Jones, P. F., Bartunkova, S., Wiegand, S. J., Radziejewski, C., Compton, D., McClain, J., Aldrich, T. H., Papadopoulos, N., Daly, T. J., Davis, S., Sato, T. N. & Yancopoulos, G. D. 1997. Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis. Science, 277, 55-60. Maltepe, E., Krampitz, G. W., Okazaki, K. M., Red-Horse, K., Mak, W., Simon, M. C. & Fisher, S. J. 2005. Hypoxia-inducible factor-dependent histone deacetylase activity determines stem cell fate in the placenta. Development, 132, 3393-403. Mann, P. E. & Bridges, R. S. 2001. Lactogenic hormone regulation of maternal behavior. Prog Brain Res, 133, 251-62. Marais, R., Wynne, J. & Treisman, R. 1993. The SRF accessory protein Elk-1 contains a growth factor-regulated transcriptional activation domain. Cell, 73, 381-93. Martinez-Barbera, J. P., Rodriguez, T. A., Greene, N. D., Weninger, W. J., Simeone, A., Copp, A. J., Beddington, R. S. & Dunwoodie, S. 2002. Folic acid prevents exencephaly in Cited2 deficient mice. Hum Mol Genet, 11, 283-93. Matsumoto, T., Bohman, S., Dixelius, J., Berge, T., Dimberg, A., Magnusson, P., Wang, L., Wikner, C., Qi, J. H., Wernstedt, C., Wu, J., Bruheim, S., Mugishima, H., Mukhopadhyay, D., Spurkland, A. & Claesson-Welsh, L. 2005. VEGF receptor-2 Y951 signaling and a role for the adapter molecule TSAd in tumor angiogenesis. EMBO J, 24, 2342-53. McGrath, J., Somlo, S., Makova, S., Tian, X. & Brueckner, M. 2003. Two populations of node monocilia initiate left-right asymmetry in the mouse. Cell, 114, 61-73. Meloche, S. & Pouyssegur, J. 2007. The ERK1/2 mitogen-activated protein kinase pathway as a master regulator of the G1- to S-phase transition. Oncogene, 26, 3227-39. Meloche, S., Vella, F. D., Voisin, L., Ang, S. L. & Saba-El-Leil, M. 2004. Erk2 signaling and early embryo stem cell self-renewal. Cell Cycle, 3, 241-3. Meno, C., Ito, Y., Saijoh, Y., Matsuda, Y., Tashiro, K., Kuhara, S. & Hamada, H. 1997. Two closely-related left-right asymmetrically expressed genes, lefty-1 and lefty-2: their distinct expression domains, chromosomal linkage and direct neuralizing activity in Xenopus embryos. Genes Cells, 2, 513-24. Meno, C., Saijoh, Y., Fujii, H., Ikeda, M., Yokoyama, T., Yokoyama, M., Toyoda, Y. & Hamada, H. 1996. Left-right asymmetric expression of the TGF beta- family member lefty in mouse embryos. Nature, 381, 151-5. Meno, C., Shimono, A., Saijoh, Y., Yashiro, K., Mochida, K., Ohishi, S., Noji, S., Kondoh, H. & Hamada, H. 1998. lefty-1 is required for left-right determination as a regulator of lefty-2 and nodal. Cell, 94, 287-97. Meno, C., Takeuchi, J., Sakuma, R., Koshiba-Takeuchi, K., Ohishi, S., Saijoh, Y., Miyazaki, J., ten Dijke, P., Ogura, T. & Hamada, H. 2001. Diffusion of nodal 253

signaling activity in the absence of the feedback inhibitor Lefty2. Dev Cell, 1, 127-38. Meyers, E. N. & Martin, G. R. 1999. Differences in left-right axis pathways in mouse and chick: functions of FGF8 and SHH. Science, 285, 403-6. Miano, J. M., Ramanan, N., Georger, M. A., de Mesy Bentley, K. L., Emerson, R. L., Balza, R. O., Jr., Xiao, Q., Weiler, H., Ginty, D. D. & Misra, R. P. 2004. Restricted inactivation of serum response factor to the cardiovascular system. Proc Natl Acad Sci U S A, 101, 17132-7. Mine, N., Anderson, R. M. & Klingensmith, J. 2008. BMP antagonism is required in both the node and lateral plate mesoderm for mammalian left-right axis establishment. Development, 135, 2425-34. Mole, D. R., Blancher, C., Copley, R. R., Pollard, P. J., Gleadle, J. M., Ragoussis, J. & Ratcliffe, P. J. 2009. Genome-wide association of hypoxia-inducible factor (HIF)-1alpha and HIF-2alpha DNA binding with expression profiling of hypoxia-inducible transcripts. J Biol Chem, 284, 16767-75. Mudgett, J. S., Ding, J., Guh-Siesel, L., Chartrain, N. A., Yang, L., Gopal, S. & Shen, M. M. 2000. Essential role for p38alpha mitogen-activated protein kinase in placental angiogenesis. Proc Natl Acad Sci U S A, 97, 10454-9. Muller, H., Liu, B., Croy, B. A., Head, J. R., Hunt, J. S., Dai, G. & Soares, M. J. 1999. Uterine natural killer cells are targets for a trophoblast cell-specific cytokine, prolactin-like protein A. Endocrinology, 140, 2711-20. Murre, C., McCaw, P. S. & Baltimore, D. 1989. A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins. Cell, 56, 777-83. Nadeau, V., Guillemette, S., Belanger, L. F., Jacob, O., Roy, S. & Charron, J. 2009. Map2k1 and Map2k2 genes contribute to the normal development of syncytiotrophoblasts during placentation. Development, 136, 1363-74. Nakamura, T., Mine, N., Nakaguchi, E., Mochizuki, A., Yamamoto, M., Yashiro, K., Meno, C. & Hamada, H. 2006. Generation of robust left-right asymmetry in the mouse embryo requires a self-enhancement and lateral-inhibition system. Dev Cell, 11, 495-504. Nakao, A., Imamura, T., Souchelnytskyi, S., Kawabata, M., Ishisaki, A., Oeda, E., Tamaki, K., Hanai, J., Heldin, C. H., Miyazono, K. & ten Dijke, P. 1997. TGF-beta receptor-mediated signalling through Smad2, Smad3 and Smad4. EMBO J, 16, 5353-62. Nonaka, S., Shiratori, H., Saijoh, Y. & Hamada, H. 2002. Determination of left-right patterning of the mouse embryo by artificial nodal flow. Nature, 418, 96-9. Nonaka, S., Tanaka, Y., Okada, Y., Takeda, S., Harada, A., Kanai, Y., Kido, M. & Hirokawa, N. 1998. Randomization of left-right asymmetry due to loss of nodal cilia generating leftward flow of extraembryonic fluid in mice lacking KIF3B motor protein. Cell, 95, 829-37. Nonaka, S., Yoshiba, S., Watanabe, D., Ikeuchi, S., Goto, T., Marshall, W. F. & Hamada, H. 2005. De novo formation of left-right asymmetry by posterior tilt of nodal cilia. PLoS Biol, 3, e268.

254

Norris, D. P., Brennan, J., Bikoff, E. K. & Robertson, E. J. 2002. The Foxh1- dependent autoregulatory enhancer controls the level of Nodal signals in the mouse embryo. Development, 129, 3455-68. Norris, D. P. & Robertson, E. J. 1999. Asymmetric and node-specific nodal expression patterns are controlled by two distinct cis-acting regulatory elements. Genes Dev, 13, 1575-88. Oh, S. P., Seki, T., Goss, K. A., Imamura, T., Yi, Y., Donahoe, P. K., Li, L., Miyazono, K., ten Dijke, P., Kim, S. & Li, E. 2000. Activin receptor-like kinase 1 modulates transforming growth factor-beta 1 signaling in the regulation of angiogenesis. Proc Natl Acad Sci U S A, 97, 2626-31. Ohlsson, R., Falck, P., Hellstrom, M., Lindahl, P., Bostrom, H., Franklin, G., Ahrlund-Richter, L., Pollard, J., Soriano, P. & Betsholtz, C. 1999. PDGFB regulates the development of the labyrinthine layer of the mouse fetal placenta. Dev Biol, 212, 124-36. Okada, Y., Nonaka, S., Tanaka, Y., Saijoh, Y., Hamada, H. & Hirokawa, N. 1999. Abnormal nodal flow precedes situs inversus in iv and inv mice. Mol Cell, 4, 459-68. Okada, Y., Takeda, S., Tanaka, Y., Belmonte, J. C. & Hirokawa, N. 2005. Mechanism of nodal flow: a conserved symmetry breaking event in left-right axis determination. Cell, 121, 633-44. Okazaki, K. & Maltepe, E. 2006. Oxygen, epigenetics and stem cell fate. Regen Med, 1, 71-83. Oki, S., Hashimoto, R., Okui, Y., Shen, M. M., Mekada, E., Otani, H., Saijoh, Y. & Hamada, H. 2007. Sulfated glycosaminoglycans are necessary for Nodal signal transmission from the node to the left lateral plate in the mouse embryo. Development, 134, 3893-904. Oshima, M., Oshima, H. & Taketo, M. M. 1996. TGF-beta receptor type II deficiency results in defects of yolk sac hematopoiesis and vasculogenesis. Dev Biol, 179, 297-302. Ostman, A., Andersson, M., Betsholtz, C., Westermark, B. & Heldin, C. H. 1991. Identification of a cell retention signal in the B-chain of platelet-derived growth factor and in the long splice version of the A-chain. Cell Regul, 2, 503-12. Ota, T., Fujii, M., Sugizaki, T., Ishii, M., Miyazawa, K., Aburatani, H. & Miyazono, K. 2002. Targets of transcriptional regulation by two distinct type I receptors for transforming growth factor-beta in human umbilical vein endothelial cells. J Cell Physiol, 193, 299-318. Pages, G., Lenormand, P., L'Allemain, G., Chambard, J. C., Meloche, S. & Pouyssegur, J. 1993. Mitogen-activated protein kinases p42mapk and p44mapk are required for fibroblast proliferation. Proc Natl Acad Sci U S A, 90, 8319-23. Papapetropoulos, A., Fulton, D., Mahboubi, K., Kalb, R. G., O'Connor, D. S., Li, F., Altieri, D. C. & Sessa, W. C. 2000. Angiopoietin-1 inhibits endothelial cell apoptosis via the Akt/survivin pathway. J Biol Chem, 275, 9102-5. Park, J. E., Keller, G. A. & Ferrara, N. 1993. The vascular endothelial growth factor (VEGF) isoforms: differential deposition into the subepithelial extracellular 255

matrix and bioactivity of extracellular matrix-bound VEGF. Mol Biol Cell, 4, 1317-26. Patan, S. 1998. TIE1 and TIE2 receptor tyrosine kinases inversely regulate embryonic angiogenesis by the mechanism of intussusceptive microvascular growth. Microvasc Res, 56, 1-21. Peeters, H. & Devriendt, K. 2006. Human laterality disorders. Eur J Med Genet, 49, 349-62. Pescador, N., Villar, D., Cifuentes, D., Garcia-Rocha, M., Ortiz-Barahona, A., Vazquez, S., Ordonez, A., Cuevas, Y., Saez-Morales, D., Garcia-Bermejo, M. L., Landazuri, M. O., Guinovart, J. & del Peso, L. 2010. Hypoxia promotes glycogen accumulation through hypoxia inducible factor (HIF)-mediated induction of glycogen synthase 1. PLoS One, 5, e9644. Petraglia, F., Santuz, M., Florio, P., Simoncini, T., Luisi, S., Plaino, L., Genazzani, A. R., Genazzani, A. D. & Volpe, A. 1998. Paracrine regulation of human placenta: control of hormonogenesis. J Reprod Immunol, 39, 221-33. Pitera, J. E., Woolf, A. S., Gale, N. W., Yancopoulos, G. D. & Yuan, H. T. 2004. Dysmorphogenesis of kidney cortical peritubular capillaries in angiopoietin-2- deficient mice. Am J Pathol, 165, 1895-906. Piwnica, D., Fernandez, I., Binart, N., Touraine, P., Kelly, P. A. & Goffin, V. 2006. A new mechanism for prolactin processing into 16K PRL by secreted cathepsin D. Mol Endocrinol, 20, 3263-78. Piwnica, D., Touraine, P., Struman, I., Tabruyn, S., Bolbach, G., Clapp, C., Martial, J. A., Kelly, P. A. & Goffin, V. 2004. Cathepsin D processes human prolactin into multiple 16K-like N-terminal fragments: study of their antiangiogenic properties and physiological relevance. Mol Endocrinol, 18, 2522-42. Platt, J. S. & Hunt, J. S. 1998. Interferon-gamma gene expression in cycling and pregnant mouse uterus: temporal aspects and cellular localization. J Leukoc Biol, 64, 393-400. Preis, J. I., Wise, N., Solloway, M. J., Harvey, R. P., Sparrow, D. B. & Dunwoodie, S. L. 2006. Generation of conditional Cited2 null alleles. Genesis, 44, 579-83. Pringle, K. G., Kind, K. L., Thompson, J. G. & Roberts, C. T. 2007. Complex interactions between hypoxia inducible factors, insulin-like growth factor-II and oxygen in early murine trophoblasts. Placenta, 28, 1147-57. Przemeck, G. K., Heinzmann, U., Beckers, J. & Hrabe de Angelis, M. 2003. Node and midline defects are associated with left-right development in Delta1 mutant embryos. Development, 130, 3-13. Qu, X., Lam, E., Doughman, Y. Q., Chen, Y., Chou, Y. T., Lam, M., Turakhia, M., Dunwoodie, S. L., Watanabe, M., Xu, B., Duncan, S. A. & Yang, Y. C. 2007. Cited2, a coactivator of HNF4alpha, is essential for liver development. EMBO J, 26, 4445-56. Rankin, C. T., Bunton, T., Lawler, A. M. & Lee, S. J. 2000. Regulation of left-right patterning in mice by growth/differentiation factor-1. Nat Genet, 24, 262-5. Raya, A., Kawakami, Y., Rodriguez-Esteban, C., Buscher, D., Koth, C. M., Itoh, T., Morita, M., Raya, R. M., Dubova, I., Bessa, J. G., de la Pompa, J. L. & Izpisua Belmonte, J. C. 2003. Notch activity induces Nodal expression and

256

mediates the establishment of left-right asymmetry in vertebrate embryos. Genes Dev, 17, 1213-8. Redline, R. W., Chernicky, C. L., Tan, H. Q. & Ilan, J. 1993. Differential expression of insulin-like growth factor-II in specific regions of the late (post day 9.5) murine placenta. Mol Reprod Dev, 36, 121-9. Reese, J., Paria, B. C., Brown, N., Zhao, X., Morrow, J. D. & Dey, S. K. 2000. Coordinated regulation of fetal and maternal prostaglandins directs successful birth and postnatal adaptation in the mouse. Proc Natl Acad Sci U S A, 97, 9759-64. Reissmann, E., Jornvall, H., Blokzijl, A., Andersson, O., Chang, C., Minchiotti, G., Persico, M. G., Ibanez, C. F. & Brivanlou, A. H. 2001. The orphan receptor ALK7 and the Activin receptor ALK4 mediate signaling by Nodal proteins during vertebrate development. Genes Dev, 15, 2010-22. Roberts, R. M., Ealy, A. D., Alexenko, A. P., Han, C. S. & Ezashi, T. 1999. Trophoblast interferons. Placenta, 20, 259-64. Rocklin, R. E., Kitzmiller, J. L. & Kaye, M. D. 1979. Immunobiology of the maternal-fetal relationship. Annu Rev Med, 30, 375-404. Rodriguez, T. A., Sparrow, D. B., Scott, A. N., Withington, S. L., Preis, J. I., Michalicek, J., Clements, M., Tsang, T. E., Shioda, T., Beddington, R. S. & Dunwoodie, S. L. 2004. Cited1 is required in trophoblasts for placental development and for embryo growth and survival. Mol Cell Biol, 24, 228-44. Roovers, K. & Assoian, R. K. 2000. Integrating the MAP kinase signal into the G1 phase cell cycle machinery. Bioessays, 22, 818-26. Rossant, J. & Cross, J. C. 2001. Placental development: lessons from mouse mutants. Nat Rev Genet, 2, 538-48. Rout, U. K., Wang, J., Paria, B. C. & Armant, D. R. 2004. Alpha5beta1, alphaVbeta3 and the platelet-associated integrin alphaIIbbeta3 coordinately regulate adhesion and migration of differentiating mouse trophoblast cells. Dev Biol, 268, 135-51. Roux, P. P. & Blenis, J. 2004. ERK and p38 MAPK-activated protein kinases: a family of protein kinases with diverse biological functions. Microbiol Mol Biol Rev, 68, 320-44. Rubinfeld, H. & Seger, R. 2005. The ERK cascade: a prototype of MAPK signaling. Mol Biotechnol, 31, 151-74. Saba-El-Leil, M. K., Vella, F. D., Vernay, B., Voisin, L., Chen, L., Labrecque, N., Ang, S. L. & Meloche, S. 2003. An essential function of the mitogen- activated protein kinase Erk2 in mouse trophoblast development. EMBO Rep, 4, 964-8. Saga, Y., Miyagawa-Tomita, S., Takagi, A., Kitajima, S., Miyazaki, J. & Inoue, T. 1999. MesP1 is expressed in the heart precursor cells and required for the formation of a single heart tube. Development, 126, 3437-47. Saharinen, P., Eklund, L., Miettinen, J., Wirkkala, R., Anisimov, A., Winderlich, M., Nottebaum, A., Vestweber, D., Deutsch, U., Koh, G. Y., Olsen, B. R. & Alitalo, K. 2008. Angiopoietins assemble distinct Tie2 signalling complexes in endothelial cell-cell and cell-matrix contacts. Nat Cell Biol, 10 , 527-37.

257

Saijoh, Y., Adachi, H., Sakuma, R., Yeo, C. Y., Yashiro, K., Watanabe, M., Hashiguchi, H., Mochida, K., Ohishi, S., Kawabata, M., Miyazono, K., Whitman, M. & Hamada, H. 2000. Left-right asymmetric expression of lefty2 and nodal is induced by a signaling pathway that includes the transcription factor FAST2. Mol Cell, 5, 35-47. Saijoh, Y., Oki, S., Ohishi, S. & Hamada, H. 2003. Left-right patterning of the mouse lateral plate requires nodal produced in the node. Dev Biol, 256, 160-72. Saijoh, Y., Oki, S., Tanaka, C., Nakamura, T., Adachi, H., Yan, Y. T., Shen, M. M. & Hamada, H. 2005. Two nodal-responsive enhancers control left-right asymmetric expression of Nodal. Dev Dyn, 232, 1031-6. Sakuma, R., Ohnishi Yi, Y., Meno, C., Fujii, H., Juan, H., Takeuchi, J., Ogura, T., Li, E., Miyazono, K. & Hamada, H. 2002. Inhibition of Nodal signalling by Lefty mediated through interaction with common receptors and efficient diffusion. Genes Cells, 7, 401-12. Sakurai, Y., Ohgimoto, K., Kataoka, Y., Yoshida, N. & Shibuya, M. 2005. Essential role of Flk-1 (VEGF receptor 2) tyrosine residue 1173 in vasculogenesis in mice. Proc Natl Acad Sci U S A, 102, 1076-81. Sarbassov, D. D., Guertin, D. A., Ali, S. M. & Sabatini, D. M. 2005. Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science, 307, 1098- 101. Sato, T. N., Tozawa, Y., Deutsch, U., Wolburg-Buchholz, K., Fujiwara, Y., Gendron- Maguire, M., Gridley, T., Wolburg, H., Risau, W. & Qin, Y. 1995. Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature, 376, 70-4. Sato, Y., Tsuboi, R., Lyons, R., Moses, H. & Rifkin, D. B. 1990. Characterization of the activation of latent TGF-beta by co-cultures of endothelial cells and pericytes or smooth muscle cells: a self-regulating system. J Cell Biol, 111, 757-63. Schaffer, L., Scheid, A., Spielmann, P., Breymann, C., Zimmermann, R., Meuli, M., Gassmann, M., Marti, H. H. & Wenger, R. H. 2003. Oxygen-regulated expression of TGF-beta 3, a growth factor involved in trophoblast differentiation. Placenta, 24, 941-50. Schlaeger, T. M., Bartunkova, S., Lawitts, J. A., Teichmann, G., Risau, W., Deutsch, U. & Sato, T. N. 1997. Uniform vascular-endothelial-cell-specific gene expression in both embryonic and adult transgenic mice. Proc Natl Acad Sci U S A, 94, 3058-63. Schultz, J. F. & Armant, D. R. 1995. Beta 1- and beta 3-class integrins mediate fibronectin binding activity at the surface of developing mouse peri- implantation blastocysts. Regulation by ligand-induced mobilization of stored receptor. J Biol Chem, 270, 11522-31. Scotland, R. S., Morales-Ruiz, M., Chen, Y., Yu, J., Rudic, R. D., Fulton, D., Gratton, J. P. & Sessa, W. C. 2002. Functional reconstitution of endothelial nitric oxide synthase reveals the importance of serine 1179 in endothelium- dependent vasomotion. Circ Res, 90, 904-10.

258

Scott, I. C., Anson-Cartwright, L., Riley, P., Reda, D. & Cross, J. C. 2000. The HAND1 basic helix-loop-helix transcription factor regulates trophoblast differentiation via multiple mechanisms. Mol Cell Biol, 20, 530-41. Screen, M., Dean, W., Cross, J. C. & Hemberger, M. 2008. Cathepsin proteases have distinct roles in trophoblast function and vascular remodelling. Development, 135, 3311-20. Seger, R. & Krebs, E. G. 1995. The MAPK signaling cascade. FASEB J, 9, 726-35. Shalaby, F., Rossant, J., Yamaguchi, T. P., Gertsenstein, M., Wu, X. F., Breitman, M. L. & Schuh, A. C. 1995. Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature, 376, 62-6. Sharrocks, A. D. 1995. ERK2/p42 MAP kinase stimulates both autonomous and SRF-dependent DNA binding by Elk-1. FEBS Lett, 368, 77-80. Shibuya, M. & Claesson-Welsh, L. 2006. Signal transduction by VEGF receptors in regulation of angiogenesis and lymphangiogenesis. Exp Cell Res, 312, 549- 60. Shida, M. M., Jackson-Grusby, L. L., Ross, S. R. & Linzer, D. I. 1992. Placental- specific expression from the mouse placental lactogen II gene promoter. Proc Natl Acad Sci U S A, 89, 3864-8. Shioda, T., Fenner, M. H. & Isselbacher, K. J. 1997. MSG1 and its related protein MRG1 share a transcription activating domain. Gene, 204, 235-41. Shiratori, H. & Hamada, H. 2006. The left-right axis in the mouse: from origin to morphology. Development, 133, 2095-104. Shore, P., Whitmarsh, A. J., Bhaskaran, R., Davis, R. J., Waltho, J. P. & Sharrocks, A. D. 1996. Determinants of DNA-binding specificity of ETS-domain transcription factors. Mol Cell Biol, 16, 3338-49. Sibley, C. P., Coan, P. M., Ferguson-Smith, A. C., Dean, W., Hughes, J., Smith, P., Reik, W., Burton, G. J., Fowden, A. L. & Constancia, M. 2004. Placental- specific insulin-like growth factor 2 (Igf2) regulates the diffusional exchange characteristics of the mouse placenta. Proc Natl Acad Sci U S A, 101, 8204-8. Simmons, D. G. & Cross, J. C. 2005. Determinants of trophoblast lineage and cell subtype specification in the mouse placenta. Dev Biol, 284, 12-24. Simmons, D. G., Fortier, A. L. & Cross, J. C. 2007. Diverse subtypes and developmental origins of trophoblast giant cells in the mouse placenta. Dev Biol, 304, 567-78. Simmons, D. G., Natale, D. R., Begay, V., Hughes, M., Leutz, A. & Cross, J. C. 2008a. Early patterning of the chorion leads to the trilaminar trophoblast cell structure in the placental labyrinth. Development, 135, 2083-91. Simmons, D. G., Rawn, S., Davies, A., Hughes, M. & Cross, J. C. 2008b. Spatial and temporal expression of the 23 murine Prolactin/Placental Lactogen-related genes is not associated with their position in the locus. BMC Genomics, 9, 352. Soares, M. J., Chapman, B. M., Rasmussen, C. A., Dai, G., Kamei, T. & Orwig, K. E. 1996. Differentiation of trophoblast endocrine cells. Placenta, 17, 277-89. Sorenson, R. L. & Brelje, T. C. 1997. Adaptation of islets of Langerhans to pregnancy: beta-cell growth, enhanced insulin secretion and the role of lactogenic hormones. Horm Metab Res, 29, 301-7. 259

Soriano, P. 1994. Abnormal kidney development and hematological disorders in PDGF beta-receptor mutant mice. Genes Dev, 8, 1888-96. Soriano, P. 1999. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet, 21, 70-1. Sparrow, D. B., Boyle, S. C., Sams, R. S., Mazuruk, B., Zhang, L., Moeckel, G. W., Dunwoodie, S. L. & de Caestecker, M. P. 2009. Placental insufficiency associated with loss of Cited1 causes renal medullary dysplasia. J Am Soc Nephrol, 20, 777-86. Stokoe, D., Stephens, L. R., Copeland, T., Gaffney, P. R., Reese, C. B., Painter, G. F., Holmes, A. B., McCormick, F. & Hawkins, P. T. 1997. Dual role of phosphatidylinositol-3,4,5-trisphosphate in the activation of protein kinase B. Science, 277, 567-70. Strahl, T., Gille, H. & Shaw, P. E. 1996. Selective response of ternary complex factor Sap1a to different mitogen-activated protein kinase subgroups. Proc Natl Acad Sci U S A, 93, 11563-8. Struman, I., Bentzien, F., Lee, H., Mainfroid, V., D'Angelo, G., Goffin, V., Weiner, R. I. & Martial, J. A. 1999. Opposing actions of intact and N-terminal fragments of the human prolactin/growth hormone family members on angiogenesis: an efficient mechanism for the regulation of angiogenesis. Proc Natl Acad Sci U S A, 96, 1246-51. Sundberg, C., Kowanetz, M., Brown, L. F., Detmar, M. & Dvorak, H. F. 2002. Stable expression of angiopoietin-1 and other markers by cultured pericytes: phenotypic similarities to a subpopulation of cells in maturing vessels during later stages of angiogenesis in vivo. Lab Invest, 82, 387-401. Suri, C., Jones, P. F., Patan, S., Bartunkova, S., Maisonpierre, P. C., Davis, S., Sato, T. N. & Yancopoulos, G. D. 1996. Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell, 87, 1171-80. Szekeres-Bartho, J. & Wegmann, T. G. 1996. A progesterone-dependent immunomodulatory protein alters the Th1/Th2 balance. J Reprod Immunol, 31, 81-95. Tabin, C. J. & Vogan, K. J. 2003. A two-cilia model for vertebrate left-right axis specification. Genes Dev, 17, 1-6. Takakura, N., Huang, X. L., Naruse, T., Hamaguchi, I., Dumont, D. J., Yancopoulos, G. D. & Suda, T. 1998. Critical role of the TIE2 endothelial cell receptor in the development of definitive hematopoiesis. Immunity, 9, 677-86. Tanaka, C., Sakuma, R., Nakamura, T., Hamada, H. & Saijoh, Y. 2007. Long-range action of Nodal requires interaction with GDF1. Genes Dev, 21, 3272-82. Tanaka, M., Gertsenstein, M., Rossant, J. & Nagy, A. 1997. Mash2 acts cell autonomously in mouse spongiotrophoblast development. Dev Biol, 190, 55- 65. Tanaka, N., Kamanaka, M., Enslen, H., Dong, C., Wysk, M., Davis, R. J. & Flavell, R. A. 2002. Differential involvement of p38 mitogen-activated protein kinase kinases MKK3 and MKK6 in T-cell apoptosis. EMBO Rep, 3, 785-91. Tanaka, Y., Okada, Y. & Hirokawa, N. 2005. FGF-induced vesicular release of Sonic hedgehog and retinoic acid in leftward nodal flow is critical for left-right determination. Nature, 435, 172-7. 260

Tayade, C., Hilchie, D., He, H., Fang, Y., Moons, L., Carmeliet, P., Foster, R. A. & Croy, B. A. 2007. Genetic deletion of placenta growth factor in mice alters uterine NK cells. J Immunol, 178, 4267-75. Teesalu, T., Blasi, F. & Talarico, D. 1998a. Expression and function of the urokinase type plasminogen activator during mouse hemochorial placental development. Dev Dyn, 213, 27-38. Teesalu, T., Grassi, F. & Guttinger, M. 1998b. Expression pattern of the epithelial v- like antigen (Eva) transcript suggests a possible role in placental morphogenesis. Dev Genet, 23, 317-23. Teesalu, T., Masson, R., Basset, P., Blasi, F. & Talarico, D. 1999. Expression of matrix metalloproteinases during murine chorioallantoic placenta maturation. Dev Dyn, 214, 248-58. Teichert-Kuliszewska, K., Maisonpierre, P. C., Jones, N., Campbell, A. I., Master, Z., Bendeck, M. P., Alitalo, K., Dumont, D. J., Yancopoulos, G. D. & Stewart, D. J. 2001. Biological action of angiopoietin-2 in a fibrin matrix model of angiogenesis is associated with activation of Tie2. Cardiovasc Res, 49, 659- 70. Tien, E. S., Davis, J. W. & Vanden Heuvel, J. P. 2004. Identification of the CREB- binding protein/p300-interacting protein CITED2 as a peroxisome proliferator-activated receptor alpha coregulator. J Biol Chem, 279, 24053-63. Tsukui, T., Capdevila, J., Tamura, K., Ruiz-Lozano, P., Rodriguez-Esteban, C., Yonei-Tamura, S., Magallon, J., Chandraratna, R. A., Chien, K., Blumberg, B., Evans, R. M. & Belmonte, J. C. 1999. Multiple left-right asymmetry defects in Shh(-/-) mutant mice unveil a convergence of the shh and retinoic acid pathways in the control of Lefty-1. Proc Natl Acad Sci U S A, 96, 11376- 81. Urness, L. D., Sorensen, L. K. & Li, D. Y. 2000. Arteriovenous malformations in mice lacking activin receptor-like kinase-1. Nat Genet, 26, 328-31. Ussar, S. & Voss, T. 2004. MEK1 and MEK2, different regulators of the G1/S transition. J Biol Chem, 279, 43861-9. Varanou, A., Withington, S. L., Lakasing, L., Williamson, C., Burton, G. J. & Hemberger, M. 2006. The importance of cysteine cathepsin proteases for placental development. J Mol Med (Berl), 84, 305-17. Vikkula, M., Boon, L. M., Carraway, K. L., 3rd, Calvert, J. T., Diamonti, A. J., Goumnerov, B., Pasyk, K. A., Marchuk, D. A., Warman, M. L., Cantley, L. C., Mulliken, J. B. & Olsen, B. R. 1996. Vascular dysmorphogenesis caused by an activating mutation in the receptor tyrosine kinase TIE2. Cell, 87, 1181- 90. Vincent, S. D., Norris, D. P., Le Good, J. A., Constam, D. B. & Robertson, E. J. 2004. Asymmetric Nodal expression in the mouse is governed by the combinatorial activities of two distinct regulatory elements. Mech Dev, 121, 1403-15. Voss, A. K., Thomas, T. & Gruss, P. 2000. Mice lacking HSP90beta fail to develop a placental labyrinth. Development, 127, 1-11. Wakui, S., Yokoo, K., Muto, T., Suzuki, Y., Takahashi, H., Furusato, M., Hano, H., Endou, H. & Kanai, Y. 2006. Localization of Ang-1, -2, Tie-2, and VEGF 261

expression at endothelial-pericyte interdigitation in rat angiogenesis. Lab Invest, 86, 1172-84. Watson, E. D. & Cross, J. C. 2005. Development of structures and transport functions in the mouse placenta. Physiology (Bethesda), 20, 180-93. Weisberg, E., Winnier, G. E., Chen, X., Farnsworth, C. L., Hogan, B. L. & Whitman, M. 1998. A mouse homologue of FAST-1 transduces TGF beta superfamily signals and is expressed during early embryogenesis. Mech Dev, 79, 17-27. Welsh, A. O. & Enders, A. C. 1987. Trophoblast-decidual cell interactions and establishment of maternal blood circulation in the parietal yolk sac placenta of the rat. Anat Rec, 217, 203-19. Wenger, R. H., Stiehl, D. P. & Camenisch, G. 2005. Integration of oxygen signaling at the consensus HRE. Sci STKE, 2005, re12. Weninger, W. J., Lopes Floro, K., Bennett, M. B., Withington, S. L., Preis, J. I., Barbera, J. P., Mohun, T. J. & Dunwoodie, S. L. 2005. Cited2 is required both for heart morphogenesis and establishment of the left-right axis in mouse development. Development, 132, 1337-48. Whitley, G. S. & Cartwright, J. E. 2010. Cellular and molecular regulation of spiral artery remodelling: lessons from the cardiovascular field. Placenta, 31, 465- 74. Withington, S. L., Scott, A. N., Saunders, D. N., Lopes Floro, K., Preis, J. I., Michalicek, J., Maclean, K., Sparrow, D. B., Barbera, J. P. & Dunwoodie, S. L. 2006. Loss of Cited2 affects trophoblast formation and vascularization of the mouse placenta. Dev Biol, 294, 67-82. Wysk, M., Yang, D. D., Lu, H. T., Flavell, R. A. & Davis, R. J. 1999. Requirement of mitogen-activated protein kinase kinase 3 (MKK3) for tumor necrosis factor- induced cytokine expression. Proc Natl Acad Sci U S A, 96, 3763-8. Xia, X., Lemieux, M. E., Li, W., Carroll, J. S., Brown, M., Liu, X. S. & Kung, A. L. 2009. Integrative analysis of HIF binding and transactivation reveals its role in maintaining histone methylation homeostasis. Proc Natl Acad Sci U S A, 106, 4260-5. Xu, B., Qu, X., Gu, S., Doughman, Y. Q., Watanabe, M., Dunwoodie, S. L. & Yang, Y. C. 2008. Cited2 is required for fetal lung maturation. Dev Biol, 317, 95- 105. Yahata, T., de Caestecker, M. P., Lechleider, R. J., Andriole, S., Roberts, A. B., Isselbacher, K. J. & Shioda, T. 2000. The MSG1 non-DNA-binding transactivator binds to the p300/CBP coactivators, enhancing their functional link to the Smad transcription factors. J Biol Chem, 275, 8825-34. Yahata, T., Shao, W., Endoh, H., Hur, J., Coser, K. R., Sun, H., Ueda, Y., Kato, S., Isselbacher, K. J., Brown, M. & Shioda, T. 2001. Selective coactivation of estrogen-dependent transcription by CITED1 CBP/p300-binding protein. Genes Dev, 15, 2598-612. Yahata, T., Takedatsu, H., Dunwoodie, S. L., Braganca, J., Swingler, T., Withington, S. L., Hur, J., Coser, K. R., Isselbacher, K. J., Bhattacharya, S. & Shioda, T. 2002. Cloning of mouse Cited4, a member of the CITED family p300/CBP- binding transcriptional coactivators: induced expression in mammary epithelial cells. Genomics, 80, 601-13. 262

Yamamoto, M., Mine, N., Mochida, K., Sakai, Y., Saijoh, Y., Meno, C. & Hamada, H. 2003. Nodal signaling induces the midline barrier by activating Nodal expression in the lateral plate. Development, 130, 1795-804. Yamamoto, T., Roby, K. F., Kwok, S. C. & Soares, M. J. 1994. Transcriptional activation of cytochrome P450 side chain cleavage enzyme expression during trophoblast cell differentiation. J Biol Chem, 269, 6517-23. Yan, L., Carr, J., Ashby, P. R., Murry-Tait, V., Thompson, C. & Arthur, J. S. 2003. Knockout of ERK5 causes multiple defects in placental and embryonic development. BMC Dev Biol, 3, 11. Yan, Y. T., Liu, J. J., Luo, Y., E, C., Haltiwanger, R. S., Abate-Shen, C. & Shen, M. M. 2002. Dual roles of Cripto as a ligand and coreceptor in the nodal signaling pathway. Mol Cell Biol, 22, 4439-49. Yang, J., Boerm, M., McCarty, M., Bucana, C., Fidler, I. J., Zhuang, Y. & Su, B. 2000. Mekk3 is essential for early embryonic cardiovascular development. Nat Genet, 24, 309-13. Yang, X., Castilla, L. H., Xu, X., Li, C., Gotay, J., Weinstein, M., Liu, P. P. & Deng, C. X. 1999. Angiogenesis defects and mesenchymal apoptosis in mice lacking SMAD5. Development, 126, 1571-80. Yang, Z. Z., Tschopp, O., Hemmings-Mieszczak, M., Feng, J., Brodbeck, D., Perentes, E. & Hemmings, B. A. 2003. Protein kinase B alpha/Akt1 regulates placental development and fetal growth. J Biol Chem, 278, 32124-31. Yeo, C. & Whitman, M. 2001. Nodal signals to Smads through Cripto-dependent and Cripto-independent mechanisms. Mol Cell, 7, 949-57. Yin, Z., Haynie, J., Yang, X., Han, B., Kiatchoosakun, S., Restivo, J., Yuan, S., Prabhakar, N. R., Herrup, K., Conlon, R. A., Hoit, B. D., Watanabe, M. & Yang, Y. C. 2002. The essential role of Cited2, a negative regulator for HIF- 1alpha, in heart development and neurulation. Proc Natl Acad Sci U S A, 99, 10488-93. Yokota, H., Goldring, M. B. & Sun, H. B. 2003. CITED2-mediated regulation of MMP-1 and MMP-13 in human chondrocytes under flow shear. J Biol Chem, 278, 47275-80. Yoon, M. J., Cho, C. H., Lee, C. S., Jang, I. H., Ryu, S. H. & Koh, G. Y. 2003. Localization of Tie2 and phospholipase D in endothelial caveolae is involved in angiopoietin-1-induced MEK/ERK phosphorylation and migration in endothelial cells. Biochem Biophys Res Commun, 308, 101-5. Yoshioka, H., Meno, C., Koshiba, K., Sugihara, M., Itoh, H., Ishimaru, Y., Inoue, T., Ohuchi, H., Semina, E. V., Murray, J. C., Hamada, H. & Noji, S. 1998. Pitx2, a bicoid-type homeobox gene, is involved in a lefty-signaling pathway in determination of left-right asymmetry. Cell, 94, 299-305. Zhang, J., Zhao, Y. G., Cao, Y. J., Sang, Q. X. & Duan, E. K. 2003. Expression and implications of tissue inhibitor of metalloproteinases-4 in mouse embryo. Mol Hum Reprod, 9, 143-9. Zhang, Y., Feng, X., We, R. & Derynck, R. 1996. Receptor-associated Mad homologues synergize as effectors of the TGF-beta response. Nature, 383, 168-72.

263

Zhang, Y., Musci, T. & Derynck, R. 1997. The tumor suppressor Smad4/DPC 4 as a central mediator of Smad function. Curr Biol, 7, 270-6. Zhou, X., Sasaki, H., Lowe, L., Hogan, B. L. & Kuehn, M. R. 1993. Nodal is a novel TGF-beta-like gene expressed in the mouse node during gastrulation. Nature, 361, 543-7. Zhu, M. J., Du, M., Hess, B. W., Nathanielsz, P. W. & Ford, S. P. 2007. Periconceptional nutrient restriction in the ewe alters MAPK/ERK1/2 and PI3K/Akt growth signaling pathways and vascularity in the placentome. Placenta, 28, 1192-9.

264