DOCSLIB.ORG

Identification and Cloning of a Protein Kinase-Encoding Mouse Gene, Plk, Related to the Polo Gene Ofdrosophila (Serine-Threonine Kinase/Polo-Like Kinase) FIONA J

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification and Cloning of a Protein Kinase-Encoding Mouse Gene, Plk, Related to the Polo Gene Ofdrosophila (Serine-Threonine Kinase/Polo-Like Kinase) FIONA J Proc. Natl. Acad. Sci. USA Vol. 90, pp. 4882-4886, June 1993 Biochemistry Identification and cloning of a protein kinase-encoding mouse gene, Plk, related to the polo gene ofDrosophila (serine-threonine kinase/polo-like kinase) FIONA J. CLAY*, STEPHEN J. MCEWEN*, IVAN BERTONCELLOt, ANDREW F. WILKS*, AND ASHLEY R. DUNN*t *Melbourne Tumour Biology Branch, Ludwig Institute for Cancer Research, PO Royal Melbourne Hospital, Victoria 3050, Australia; and tPeter MacCallum Cancer Institute, 481 Little Lonsdale Street, Melbourne, Victoria 3001, Australia Communicated by G. J. V. Nossal, January 14, 1993 (received for review November 23, 1992) ABSTRACT We have determined the nucleotide sequence to emerge from this study encodes a protein kinase that of a cDNA encoding a protein kinase that is closely related to shares extensive homology with the enzyme encoded by the the enzyme encoded by the Drosophila melanogaster mutant Drosophila melanogaster mutant polo (11).§ polo and that we have designated Plk (polo-like kinase). Plk is also related to the products of the Saccharomyces cerevisiae cell MATERIALS AND METHODS cycle gene MSD2 (CDC5) and the recently described early growth response gene Snk. Together, Plk, polo, Snk, and DNA Amplification. Poly(A)+ mRNA prepared from puri- MSD2 define a subfamily of serine/threonine protein kinases. fied primitive hemopoietic cells isolated from the bone mar- Plk is expressed at high levels in a number offetal and newborn rows of C57BL/6 mice (12-14) was used to generate cDNA, in the corresponding adult using a cDNA Synthesis System Plus kit (Amersham). PCR mouse tissues but is not expressed was performed with the degenerate oligonucleotide primers organs. With the exception of adult hemopoietic tissues, the PTK1 and PTKll (10). PCR and the cloning ofPCR products only adult tissues in which we could detect Plk expression were were performed as described (10). ovaries and testes. Taken together, the patterns ofPlk expres- Molecular Cloning and Sequence Analysis. A mouse sion suggest an association with proliferating cells. Since polo BALB/c bone marrow cDNA library in Agtll (Clontech) was is required for mitosis in Drosophila it is possible that Pik is screened with the radiolabeled PCR-generated product (see involved in some aspect of cell cycle regulation in mammalian Results), using standard hybridization conditions at high cells. stringency (15). The insert of clone BM-1 was used to screen a murine ICR-CD1 anemic spleen cDNA library in Agtll The coordinated control of cell growth and differentiation in (Clontech). We isolated two overlapping cDNA clones, S15 eukaryotes is achieved, in part, through the activation of and S13, which encompassed the catalytic domain and the 3' intracellular biochemical networks in response to external untranslated region, respectively. To isolate a cDNA corre- stimuli. Protein kinases are known to represent integral sponding to the 5' end ofPlk, a mouse neuroepithelial cDNA components of many signal transduction pathways; not only library (strain DBA) in Agtl0 (16) was screened with a do they serve to phosphorylate their normal physiological radiolabeled Bgl II fragment (nt 675-771) recovered from the their enzymatic activity is, in turn, regulated 5' end of S15. One clone, NE4, contained a 1.5-kb insert. substrates, Inspection of the nucleotide sequences of cDNA clones S15 through interaction with other protein kinases and phos- (strain ICR-CD1) and NE4 (strain DBA) in the regions of phatases (1-3). Homologues of a large number of protein overlap revealed a number of sequence polymorphisms, kinases have been identified from a range of eukaryotic some of which were conservative, while others resulted in species including mammals, budding and fission yeast, and amino acid substitutions. Since we were unable to isolate Drosophila, suggesting that at least some of the processes further cDNAs that encompassed the N terminus of Plk we that govern cell growth and differentiation in this diverse performed PCR on liver DNA from random-bred ICR-CD1 range of organisms are achieved by using similar principles mice, using 5' sense (5'-CCCAAAGCTTGTGTCTGAC-3') (2-5). and 3' antisense (5'-CTGCGAACACCTCTTTTG-3') oligo- In general, eukaryotic protein kinases are classified on the nucleotides based on the nucleotide sequence of NE4. Nu- basis of substrate specificity (4). Recently a number of cleotide sequence analysis ofboth strands was carried out by protein kinases have been identified which have the dual using the dideoxynucleotide chain-termination procedure capacity to phosphorylate serine/threonine and tyrosine res- (17) either manually or with an Applied Biosystems auto- idues (3, 6, 7). Inspection ofthe primary sequences ofprotein mated sequencer. The DNA sequence and deduced protein kinases reveals the presence ofparticular sets ofresidues that sequence were compared with the GenBank data bases by are invariant features of molecules with the capacity to using the FASTA programs (18). phosphorylate specific substrates (8). Interspersed among Northern (RNA) Analysis. Total cellular RNA was isolated the motifs that signify serine/threonine or tyrosine specificity as described (19), fractionated on 1% agarose/formaldehyde are shorter stretches of amino acids that are characteristic of gels, and transferred to GeneScreenPlus membrane (DuPont) subgroups of protein kinases and which presumably contrib- according to manufacturer's protocols. ute to the substrate specificity and/or the manner in which individual protein kinases are regulated (4, 9). We have employed a PCR-based strategy (10) to isolate RESULTS sequences corresponding to protein kinases expressed in Isolation of Clones Encoding Plk. To isolate protein kinases primitive murine hemopoietic progenitor cells. One sequence that may play a role in the regulation of hemopoiesis, we The publication costs of this article were defrayed in part by page charge iTo whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" §The sequence reported in this paper has been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession no. L06144). 4882 Downloaded by guest on September 28, 2021 Biochemistry: Clay et al. Proc. Nati. Acad. Sci. USA 90 (1993) 4883 isolated a highly enriched population of primitive hemopoi- deduced amino acid sequence of P1k are shown in Fig. 1 etic progenitor cells from mouse bone marrow (12-14). Se- Lower. quences corresponding to putative protein kinases were Sequence of Plk. The nucleotide sequence of Plk contains amplified by PCR using the degenerate oligonucleotide prim- a single open reading frame extending over 1809 nt -and ers PT7K1 and PTK2 on cDNA reverse transcribed from encoding a p'rotein of 603 aa (Mr, 68,409). The nucleotides mRNA isolated from these cells (10). PTK1 and PTK2 flanking those encoding the methionine residue at position correspond to the conserved subdomains Vl and IX in the 470-472 conform to the Kozak consensus sequence for the catalytic domain of protein kinases as defined by Hanks et al. initiation of protein translation (20). Furthermore, an in- (4). The products of this reaction were subcloned in frame termination codon is located 105 nt upstream of the M13mp18 and the nucleotide sequences of randomly chosen proposed AUG. clones were determined. A number of previously described Relationship ofPlk to Other Protein Kinases. Comparison of protein tyrosine kinases were identified, as well as one novel the deduced amino acid sequence of P1k with other published sequence that on the basis of amino acid sequence encoded sequences revealed a close relationship between P1k and a protein with features of a serine/threonine protein kinase. three serine/threonine protein kinases. The catalytic domain A number of overlapping cDNA clones (SiS and S13) as well of P1k is most closely related to the polo gene product (65% as a genomic fragment (PCR-A) (Fig. 1 Upper) corresponding identity), a protein kinase required for mitosis in Drosophila to the novel sequence were isolated according to the strategy (11,21) (Fig. 2). Plk and polo encode proteins of a similar size outlined in Materials and Methods. The composite nucleo- and have a similar overall structure, with their catalytic tide sequence [S15, S13, and PCR-A (Fig. 1 Upper)] and domains being located in the N-terminal region. P1k is also ATG TAG WV Kinase Domain 0i BGLII TAG S15 I II IWlw S13 v I HINDuI ATG BGLII I I V i NE4 LU HINDHI ATG BGLII 100 bp PCR-A IV II 1 AGCTGTOAGTCTGAAAGTTOCCTOGCTGAOCTTGAAO ATCTAGACATOOOTOTOGOCTOCAACAAOOOOCCTCATCTCATCACTCATTGGTCTTATA 101 TOMrrATTTTTACCAGCCTGTTCTOGAOTOTO3OCAOOOOCATOOCCTOGCTTCCCATCAGGAGAAATCAGCAGAAGTOGACAGOGOTACCTOTATC 201 CACAOOTGCCAGCTOOCCTGTOOGTTAGOTACAAGOGCOTGOOCACAOCTCCTTCCTCAGOCTACCTC173CTGAG&CCTCAGCCCTAOGCTATACCTTOA 301 AGCAGCCJGAGOAGAOTCTOOGCATAAAGGCCCAGCAAAATTATOTTOTCCTACTOTTOTGCTCTGAGCCCCCATTTCTOvCCATTTrOCTOCATATCAAA A V A K A 0 K L A 11 401 0c2AAAAGAAACCATCGCACGAOGACCCTCTCCACCGACTCAGCCAGGTTCGTOOAOCAACTTCQOCATCATOAALTOCATGGCCAAAOCTOGAAAAOCTO R AP TDLOGKOOGV LOGD A AP SA PV A AP L AKE I L EV L 44 501 aTCGAGCACCAACCGACCTCOGGAAAOGTOGOGTCCTOOGAG&TOGCAOCTCCCAOTOCCCCCAGTOOCTOCCCCCACTOGCGAAAAGAATTrCTOGAOOTCCT V D P R S R RQ I R R F L K F A K C F E I S D A D T K E 77 601 AGTOGACCCACOCAGCCOGCOOCAGTATATACGGOOCCGCTTTCTOOGTAAAOOAOOCTTCGCCAAATOGCTTCGAGATCTCAGACOCAGACACAAAAGAG V F A G K I V P K S L L L K P H Q K E K H S H E I S I H R S L A H Q 111 FIG. 1. (Upper) Schematic 701 TOTCGCAOOCAAGATCGTGCCTAAGTCTTTGCTOCTCAAOCCCCACCAGAAGGAGAAGATOTCTATOGAGATCTCAATTCACCGCAOCCTAGCACACC
Load more

Recommended publications
  • Structures of Yeast 80S Ribosome-Trna Complexes in the Rotated and Nonrotated Conformations
    Structure Short Article Structures of Yeast 80S Ribosome-tRNA Complexes in the Rotated and Nonrotated Conformations Egor Svidritskiy,1,4 Axel F. Brilot,2,4 Cha San Koh,1 Nikolaus Grigorieff,2,3,5,* and Andrei A. Korostelev1,5,* 1RNA Therapeutics Institute, Department of Biochemistry and Molecular Pharmacology, University of Massachusetts Medical School, 368 Plantation Street, Worcester, MA 01605, USA 2Department of Biochemistry, Rosenstiel Basic Medical Sciences Research Center, Brandeis University, Waltham, MA 02454, USA 3Janelia Farm Research Campus, Howard Hughes Medical Institute, 19700 Helix Drive, Ashburn, VA 20147, USA 4Co-first author 5Co-senior author *Correspondence: [email protected] (N.G.), [email protected] (A.A.K.) http://dx.doi.org/10.1016/j.str.2014.06.003 SUMMARY upstream of the open reading frame (Dalgarno and Shine, 1973) forms base-pairing interactions with the complimentary The structural understanding of eukaryotic translation anti-Shine-Dalgarno region of the ribosomal 16S RNA. The for- lags behind that of translation on bacterial ribosomes. mation of this specific contact results in positioning of the down- Here, we present two subnanometer resolution struc- stream AUG start codon in the P site of the small 30S subunit, tures of S. cerevisiae 80S ribosome complexes thus determining the open reading frame of the mRNA for trans- formed with either one or two tRNAs and bound in lation (Kaminishi et al., 2007; Korostelev et al., 2007; Yusupova response to an mRNA fragment containing the Kozak et al., 2006). By contrast, initiation in eukaryotes depends on at least a dozen initiation factors (Aitken and Lorsch, 2012).
    [Show full text]
  • Ribosome and Translational Control in Stem Cells
    cells Review Ribosome and Translational Control in Stem Cells Mathieu Gabut 1,2 , Fleur Bourdelais 1,2 and Sébastien Durand 1,2,* 1 Equipe ‘Transcriptome Diversity in Stem Cells’, Cancer Cell Plasticity Department, INSERM 1052, CNRS 5286, Cancer Research Center of Lyon, Centre Léon Bérard, 69008 Lyon, France; [email protected] (M.G.); fl[email protected] (F.B.) 2 Université Claude Bernard Lyon 1, 69100 Villeurbanne, France * Correspondence: [email protected]; Tel.: +33-469-856-092 Received: 15 January 2020; Accepted: 17 February 2020; Published: 21 February 2020 Abstract: Embryonic stem cells (ESCs) and adult stem cells (ASCs) possess the remarkable capacity to self-renew while remaining poised to differentiate into multiple progenies in the context of a rapidly developing embryo or in steady-state tissues, respectively. This ability is controlled by complex genetic programs, which are dynamically orchestrated at different steps of gene expression, including chromatin remodeling, mRNA transcription, processing, and stability. In addition to maintaining stem cell homeostasis, these molecular processes need to be rapidly rewired to coordinate complex physiological modifications required to redirect cell fate in response to environmental clues, such as differentiation signals or tissue injuries. Although chromatin remodeling and mRNA expression have been extensively studied in stem cells, accumulating evidence suggests that stem cell transcriptomes and proteomes are poorly correlated and that stem cell properties require finely tuned protein synthesis. In addition, many studies have shown that the biogenesis of the translation machinery, the ribosome, is decisive for sustaining ESC and ASC properties. Therefore, these observations emphasize the importance of translational control in stem cell homeostasis and fate decisions.
    [Show full text]
  • Eif1 Discriminates Against Suboptimal Initiation Sites to Prevent Excessive Uorf Translation Genome-Wide
    Downloaded from rnajournal.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press eIF1 discriminates against suboptimal initiation sites to prevent excessive uORF translation genome-wide FUJUN ZHOU, HONGEN ZHANG, SHARDUL D. KULKARNI, JON R. LORSCH, and ALAN G. HINNEBUSCH Division of Molecular and Cellular Biology, Eunice Kennedy Shriver National Institute of Child Health and Development, National Institutes of Health, Bethesda, Maryland 20892, USA ABSTRACT The translation preinitiation complex (PIC) scans the mRNA for an AUG codon in a favorable context. Previous findings sug- gest that the factor eIF1 discriminates against non-AUG start codons by impeding full accommodation of Met-tRNAi in the P site of the 40S ribosomal subunit, necessitating eIF1 dissociation for start codon selection. Consistent with this, yeast eIF1 substitutions that weaken its binding to the PIC increase initiation at UUG codons on a mutant his4 mRNA and par- ticular synthetic mRNA reporters; and also at the AUG start codon of the mRNA for eIF1 itself owing to its poor Kozak con- text. It was not known however whether such eIF1 mutants increase initiation at suboptimal start codons genome-wide. By ribosome profiling, we show that the eIF1-L96P variant confers increased translation of numerous upstream open reading frames (uORFs) initiating with either near-cognate codons (NCCs) or AUGs in poor context. The increased uORF translation is frequently associated with the reduced translation of the downstream main coding sequences (CDS). Initiation is also elevated at certain NCCs initiating amino-terminal extensions, including those that direct mitochondrial localization of the GRS1 and ALA1 products, and at a small set of main CDS AUG codons with especially poor context, including that of eIF1 itself.
    [Show full text]
  • Trans-Splicing Enhances Translational Efficiency in C. Elegans
    Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Trans-splicing enhances translational efficiency in C. elegans Yu-Fei Yang1, 3, 5, 6, Xiaoqing Zhang1, 3, 5, 6, Xuehua Ma2, 3, 6, Taolan Zhao1, 3, 6, Qiushi Sun1, 3, 4, Qing Huan1, 3, Shaohuan Wu1, 3, 5, Zhuo Du2, 3, 7, and Wenfeng Qian1, 3, 5, 7 1 State Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China 2 State Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China 3 Key Laboratory of Genetic Network Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China 4 Beijing Key Laboratory of Traffic Data Analysis and Mining, School of Computer and Information Technology, Beijing Jiaotong University, Beijing 100044, China 5 University of Chinese Academy of Sciences, Beijing 100049, China 6 These authors contribute equally to this work 7 Correspondence to: Wenfeng Qian Institute of Genetics and Developmental Biology Chinese Academy of Sciences Phone: 86-10-64806550 Email: [email protected] Or Zhuo Du Institute of Genetics and Developmental Biology Chinese Academy of Sciences Phone: 86-10-64801699 Email: [email protected] Running title: Trans-splicing enhances translational efficiency Keywords: translational efficiency, trans-splicing 1 Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press ABSTRACT Translational efficiency is subject to extensive regulation. However, the factors influencing such regulation are poorly understood. In Caenorhabditis elegans, ~62% genes are trans-spliced to a specific spliced leader (SL1), which replaces part of the native 5’ untranslated region (5’ UTR).
    [Show full text]
  • Codon Context Controls Translation Initiation in the Fungal Kingdom
    bioRxiv preprint doi: https://doi.org/10.1101/654046; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Start codon context controls translation initiation in the fungal kingdom Edward Wallace2*, Corinne Maufrais1,3, Jade Sales-Lee4, Laura Tuck2, Luciana de Oliveira1, Frank Feuerbach6, Frédérique Moyrand1, Prashanthi Natarajan4, Hiten D. Madhani4,5*, Guilhem Janbon1* 1. Institut Pasteur, Unité Biologie des ARN des Pathogènes Fongiques, Département de Mycologie, F-75015, Paris, France 2. Institute for Cell Biology and SynthSys, School of Biological Sciences, University of Edinburgh, UK 3. Institut Pasteur, HUB Bioinformatique et Biostatistique, C3BI, USR 3756 IP CNRS, F-75015, Paris, France 4. Department of Biochemistry and Biophysics, University of California at San Francisco, San Francisco, California 94158, USA 5. Chan-Zuckerberg Biohub, San Francisco, CA 94158, USA 6 Institut Pasteur, Unité Génétique des Interactions Macromoléculaire, Département Génome et Génétique, F-75015, Paris, France * Corresponding authors these authors contribute equality to this work and should be considered as co-first authors 1 bioRxiv preprint doi: https://doi.org/10.1101/654046; this version posted May 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Eukaryotic protein synthesis initiates at a start codon defined by an AUG and its surrounding Kozak sequence context, but studies of S.
    [Show full text]
  • A Novel Translational Repressor Mrna Is Edited Extensively in Livers Containing Tumors Caused by the Transgene Expression of the Apob Mrna-Editing Enzyme
    Downloaded from genesdev.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press A novel translational repressor mRNA is edited extensively in livers containing tumors caused by the transgene expression of the apoB mRNA-editing enzyme Shinya Yamanaka/ Karen S. Poksay,^ Kay S. Arnold/ and Thomas L. Innerarity 2-5 ^Gladstone Institute of Cardiovascular Disease, -^Cardiovascular Research Institute, and "^Department of Pathology, University of California, San Francisco, California 94141-9100 USA Transgene expression of the apoUpoprotein B mRNA-editing enzyme (APOBEC-1) causes dysplasia and carcinoma in mouse and rabbit livers. Using a modified differential display technique, we identified a novel mRNA (NATl for novel APOBEC-1 target no. 1) that is extensively edited at multiple sites in these livers. The aberrant editing alters encoded amino acids, creates stop codons, and results in markedly reduced levels of the NATl protein in transgenic mouse livers. NATl is expressed ubiquitously and is extraordinarily conserved among species. It has homology to the carboxy-terminal portion of the eukaryotic translation initiation factor (elF) 4G that binds eIF4A and eIF4E to form eIF4F. NATl binds eIF4A but not eIF4E and inhibits both cap-dependent and cap-independent translation. NATl is likely to be a fundamental translational repressor, and its aberrant editing could contribute to the potent oncogenesis induced by overexpression of APOBEC-1. [Key Words: APOBEC-1; RNA editing; translation repressor; transgenic mice] Received October 28, 1996; revised version accepted December 18, 1996. ApoUpoprotein B (apoB) mRNA editing is the deamination and tissues (Driscoll and Zhang 1994; Giannoni et al. of a specific cytidine (nucleotide 6666) to form uridine in 1994; Yamanaka et al.
    [Show full text]
  • Pe2-Crimson-N1 Vector Information PT5070-5 Catalog No
    pE2-Crimson-N1 Vector Information PT5070-5 Catalog No. 632554 pUC19 PCMV IE ori MCS BglII (610) Vector Information Information Vector HSV TK polyA E2-Crimson signals pE2-Crimson-N1 4689 bp NotI (1358) SV40 early polyA signals Kanr/Neor f1 ori SV40 pE2-Crimson-N1 ori MCS SacI NheI XhoI AfeI BglII HindIII EcoRI 589 CCG CTA GCG CTA CCG GAC TCA GAT CTC GAG CTC AAG CTT CGA ATT GGC GAT CGC GAT GGC CTG AGT CTA GAG CTC GAG TTC GAA GCT TAA Acc65I/KpnI SalI SacII SmaI/XmaI Kozak Sequence EcoRI AccI ApaI/Bsp120I BamHI SpeI 634 CTG CAG TCG ACG GTA CCG CGG GCC CGG GAT CCA CTA GTC GCC ACC GAC GTC AGC TGC CAT GGC GCC CGG GCC CTA GGT GAT CAG CGG TGG Kozak Sequence Start of E2-Crimson 679 ATG GAT AGC TAC CTA TCG pE2-Crimson-N1 Vector Map and Multiple Cloning Sites (MCS). Description pE2-Crimson-N1 is a mammalian expression vector designed to express a protein of interest fused to the N-terminus of E2-Crimson, a far-red fluorescent protein derived from the tetrameric red fluorescent protein DsRed-Express2 (1, 2). E2-Crimson retains the reduced cyto- and phototoxicity, increased solubility, fast maturation, and high photostability characteristic of DsRed-Express2. Unlike other far-red fluorescent proteins, E2-Crimson is not cytotoxic in bacterial and mammalian cells, making it well-suited for United States/Canada in vivo applications involving sensitive cells, such as primary or stem cells. E2-Crimson 800.662.2566 has an emission maximum at 646 nm, and absorbance and excitation maxima at 611 nm, Asia Pacific +1.650.919.7300 giving it the furthest red-shifted excitation spectrum of any available fluorescent protein Europe (1).
    [Show full text]
  • Trans-Splicing Enhances Translational Efficiency in C. Elegans
    Downloaded from genome.cshlp.org on April 14, 2018 - Published by Cold Spring Harbor Laboratory Press Research Trans-splicing enhances translational efficiency in C. elegans Yu-Fei Yang,1,2,3,6 Xiaoqing Zhang,1,2,3,6 Xuehua Ma,2,4,6 Taolan Zhao,1,2,6 Qiushi Sun,1,2,5 Qing Huan,1,2 Shaohuan Wu,1,2,3 Zhuo Du,4 and Wenfeng Qian1,2,3 1State Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China; 2Key Laboratory of Genetic Network Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China; 3University of Chinese Academy of Sciences, Beijing 100049, China; 4State Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China; 5Beijing Key Laboratory of Traffic Data Analysis and Mining, School of Computer and Information Technology, Beijing Jiaotong University, Beijing 100044, China Translational efficiency is subject to extensive regulation. However, the factors influencing such regulation are poorly un- derstood. In Caenorhabditis elegans, 62% of genes are trans-spliced to a specific spliced leader (SL1), which replaces part of the native 5′ untranslated region (5′ UTR). Given the pivotal role the 5′ UTR plays in the regulation of translational efficiency, we hypothesized that SL1 trans-splicing functions to regulate translational efficiency. With genome-wide analysis on Ribo-seq data, polysome profiling experiments, and CRISPR-Cas9–based genetic manipulation of trans-splicing sites, we found four lines of evidence in support of this hypothesis. First, SL1 trans-spliced genes have higher translational efficiencies than non- trans-spliced genes.
    [Show full text]
  • Upstream Open Reading Frames Differentially Regulate Gene
    UPSTREAM OPEN READING FRAMES DIFFERENTIALLY REGULATE GENE- SPECIFIC TRANSLATION IN THE INTEGRATED STRESS RESPONSE Sara Kathryn Young Submitted to the faculty of the University Graduate School in partial fulfillment of the requirements for the degree Doctor of Philosophy in the Department of Biochemistry and Molecular Biology Indiana University July 2016 Accepted by the Graduate Faculty, Indiana University, in partial fulfillment of the requirements for the degree of Doctor of Philosophy. ____________________________________ Ronald C. Wek, Ph.D., Chair ____________________________________ Murray Korc, M.D. Doctoral Committee ____________________________________ Amber L. Mosley, Ph.D. May 13, 2016 ____________________________________ John J. Turchi, Ph.D. ii © 2016 Sara Kathryn Young iii ACKNOWLEDGEMENTS I am foremost indebted to Dr. Ronald C. Wek for being an extraordinary mentor who has worked to mold me into a capable research scientist. I appreciate the time and dedication of my research committee: Dr. Murray Korc, Dr. Amber L. Mosley, and Dr. John J. Turchi. Past and current members of the Wek lab were paramount to the work presented in this thesis, particularly Dr. Thomas D. Baird with his invaluable contribution to the EPRS project and overall support. I would also like to the thank the faculty and staff of the Department of Biochemistry for their generous support and guidance. This work was supported by National Institutes of Health Grant GM049164 to R.C.W. iv Sara Kathryn Young UPSTREAM OPEN READING FRAMES DIFFERENTIALLY REGULATE GENE- SPECIFIC TRANSLATION IN THE INTEGRATED STRESS RESPONSE Gene expression is a highly coordinated process that relies upon appropriate regulation of translation for protein homeostasis. Regulation of protein synthesis largely occurs at the initiation step in which the translational start site is selected by ribosomes and associated initiating factors.
    [Show full text]
  • Translational Efficiency of Casein Transcripts in the Mammary Tissue Of
    Translational efficiency of casein transcripts in the mammary tissue of lactating ruminants Claudia Bevilacqua, Jean Helbling, Guy Miranda, Patrice Martin To cite this version: Claudia Bevilacqua, Jean Helbling, Guy Miranda, Patrice Martin. Translational efficiency of casein transcripts in the mammary tissue of lactating ruminants. Reproduction Nutrition Development, EDP Sciences, 2006, 46 (5), pp.567-578. 10.1051/rnd:2006028. hal-00900632 HAL Id: hal-00900632 https://hal.archives-ouvertes.fr/hal-00900632 Submitted on 1 Jan 2006 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Reprod. Nutr. Dev. 5 (2006) 567–578 567 c INRA, EDP Sciences, 2006 DOI: 10.1051/rnd:2006028 Original article Translational efficiency of casein transcripts in the mammary tissue of lactating ruminants Claudia B, Jean Christophe H,GuyM, Patrice M* INRA, Unité Génomique et Physiologie de la Lactation, Équipe Gel-Pict, 78352 Jouy-en-Josas Cedex, France Abstract – Caseins are essentially concentrated in the colloidal fraction of ruminant milks as highly hydrated and mineralized spherical particles, termed casein micelles. They form a group of four peptide chains (αs1, β, αs2 and κ), encoded by four structural genes (CSN1S1, CSN2, CSN1S2 and CSN3, respectively) of which the expression is regulated by lactogenic hormones.
    [Show full text]
  • University of Groningen Post-Transcriptional Control of C/Ebpα and C/Ebpβ Proteins Zaini, Mohamad
    University of Groningen Post-transcriptional control of C/EBPα and C/EBPβ proteins Zaini, Mohamad Amr IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 2017 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): Zaini, M. A. (2017). Post-transcriptional control of C/EBPα and C/EBPβ proteins: Insights into their role in energy homeostasis and diseases. University of Groningen. Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license. More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne- amendment. Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum. Download date: 04-10-2021 Post-transcriptional Control of C/EBPα and C/EBPβ Proteins Insights into their role in energy homeostasis and diseases PhD thesis by Mohamad Amr Zaini Post-transcriptional Control of C/EBPα and C/EBPβ Proteins.
    [Show full text]
  • Global Mapping of Translation Initiation Sites in Mammalian Cells at Single
    Global mapping of translation initiation sites in PNAS PLUS mammalian cells at single-nucleotide resolution Sooncheol Leea,1,2, Botao Liub,1, Soohyun Leec,1,3, Sheng-Xiong Huangd, Ben Shend,e, and Shu-Bing Qiana,b,4 aDivision of Nutritional Sciences and bGraduate Field of Genetics, Genomics and Development, Cornell University, Ithaca, NY 14853; cProboco Informatics, Ithaca, NY 14850; dDepartment of Chemistry and eDepartment of Molecular Therapeutics, The Scripps Research Institute, Jupiter, FL 33458 Edited* by Jonathan S. Weissman, University of California, San Francisco, CA, and approved July 24, 2012 (received for review May 9, 2012) Understanding translational control in gene expression relies on (uORF) (11, 12). Intriguingly, many non-AUG triplets have been precise and comprehensive determination of translation initiation reported to act as alternative start codons for initiating uORF sites (TIS) across the entire transcriptome. The recently developed translation (13). Because there is no reliable way to predict non- ribosome-profiling technique enables global translation analysis, AUG codons as potential initiators from in silico sequence analysis, providing a wealth of information about both the position and there is an urgent need to develop experimental approaches for the density of ribosomes on mRNAs. Here we present an approach, genome-wide TIS identification. global translation initiation sequencing, applying in parallel the Ribosome profiling, based on deep sequencing of ribosome- ribosome E-site translation inhibitors lactimidomycin and cyclo- protected mRNA fragments (RPF), has proven to be powerful in heximide to achieve simultaneous detection of both initiation and defining ribosome positions on the entire transcriptome (14, 15). elongation events on a genome-wide scale.
    [Show full text]