The Pennsylvania State University

The Graduate School

College of Medicine

FROM THE RIBOSOME TO THE MEMBRANE:

SUBCELLULAR TRAFFICKING OF THE ROUS SARCOMA VIRUS GAG

POLYPROTEIN

A Thesis in

Cell and Molecular Biology

by

Lisa Z. Scheifele

Submitted in Partial Fulfillment of the Requirements for the Degree of

Doctor of Philosophy

May 2004

The thesis of Lisa Z. Scheifele was reviewed and approved* by the following:

Leslie J. Parent Associate Professor of Medicine, and Microbiology and Immunology Thesis Advisor Chair of Committee

Rebecca C. Craven Associate Professor of Microbiology and Immunology

James E. Hopper Professor of Biochemistry and Molecular Biology

Craig M. Meyers Professor of Microbiology and Immunology

Michael F. Verderame Associate Professor of Medicine, and Assistant Professor of Microbiology and Immunology

Henry J. Donahue Baker Professor and Vice Chair for Research Professor of Cellular and Molecular Physiology Head of the Cell and Molecular Biology Graduate Program

*Signatures are on file in the Graduate School

iii ABSTRACT

Retroviruses such as human immunodeficiency virus (HIV) and human T-cell leukemia virus (HTLV) are the etiological agents of immunodeficiency diseases and cancer.

We have been studying the subcellular targeting of the Gag protein of Rous sarcoma virus

(RSV), one of the first simple retroviruses identified. The Gag protein directs assembly at the plasma membrane and incorporates the viral genome through association with a cis-acting packaging element in the viral RNA. Although functional domains within Gag that mediate the assembly process have been well defined, the activity of these motifs has not been well correlated with the trafficking of Gag throughout the cell during assembly.

We have identified distinct subcellular targeting motifs within the Rous sarcoma virus Gag protein that may influence the retroviral assembly pathway. Within the Gag membrane-binding domain, we have identified an alpha helix that is crucial for plasma membrane targeting of Gag. When this helix is deleted, the Gag protein accumulates at intracellular membranes. Yet membrane affinity is not diminished, indicating that membrane binding and plasma membrane targeting of the RSV Gag polyprotein are genetically separable.

We have also identified both a nuclear targeting signal within the N-terminal MA domain of Gag and a nuclear export signal (NES) within the p10 domain. Expression of dominant-negative nuclear pore proteins redistributes the Gag protein from a cytoplasmic and plasma membrane localization to an almost exclusively nuclear localization, confirming that

Gag both enters and exits the nucleus. We have further identified the soluble receptor that mediates the cytoplasmic localization of Gag; treatment of virus-expressing cells with leptomycin B, a specific inhibitor of the CRM-1 export pathway results in sequestration of iv the Gag protein within the nucleus. Single amino-acid substitutions within a leucine-rich cluster in the p10 domain of Gag result in accumulation of the protein within the nucleus, confirming the localization of the Gag NES within the p10 region. Interestingly, we find that the NES sequence is highly conserved among avian retroviruses; when naturally occurring variations within this sequence are recreated in the RSV Gag protein, NES function is retained, while artificial substitutions predicted to retain NES function do not.

We have sought to identify additional cellular proteins that influence the import and export of Gag from the nucleus by employing the powerful genetic system developed in the yeast Saccharomyces cerevisiae. Expression of Gag linked to a tandem GFP reporter reveals a localization to the cytoplasm of yeast cells with an accumulation in the nucleus not seen at steady-state in avian cells. Not only is the dwell time between the nucleus and cytoplasm altered, but the nuclear export pathway is perturbed as well; yeast cells do not show an enhanced accumulation of Gag proteins within the nucleus following leptomycin B treatment, suggesting that the Crm1 pathway may not be the predominant export pathway utilized by

Gag in yeast cells.

To further investigate the role of Gag nuclear trafficking in retroviral replication, we have studied the replication of viruses containing mutations in the Gag NES. These mutant

Gag proteins are able to direct the budding of virions which contain the normal complement of viral polyproteins and the proper amount of viral genomic RNA. However, the virions that are produced show profound morphological defects, including amorphous and heterogeneously shaped particles, and viral cores that are elongated or granular in appearance. Despite these substantial morphological defects, the particles are able to enter new cells and undergo reverse transcription, producing 2-LTR circles, hallmarks of entry of the synthesized DNA genome into the nucleus. Although the particles are able to complete v reverse transcription, they are non-infectious. Nuclear transport of Gag may therefore crucial not only for the efficient production of viral particles at the plasma membrane, but also for the establishment of a productive infection.

vi TABLE OF CONTENTS

LIST OF FIGURES ...... ix

ACKNOWLEDGEMENTS...... xii

CHAPTER 1: LITERATURE REVIEW...... 1

1.1 THE ROLE OF GAG IN RETROVIRAL ASSEMBLY ...... 2

1.1.1 Identification Of Rous Sarcoma Virus ...... 3 1.1.2 Characterization Of Viral Gene Products...... 4 1.1.3 Isolation Of Reverse Transcriptase ...... 5 1.1.4 Identification Of Human Retroviruses ...... 6 1.2 THE RETROVIRAL LIFE CYCLE...... 7 1.2.1 Classification Of Retroviruses...... 8 1.2.2 Virion Organization...... 11 1.2.3 Entry ...... 14 1.2.4 Reverse Transcription...... 15 1.2.5 Nuclear Transport Of The Genome And Integration ...... 18 1.2.6 Genome Organization And Transcription ...... 20 1.2.7 Retroviral Assembly...... 23 1.2.8 RNA Packaging...... 27 1.2.9 Viral Maturation ...... 29 1.3 INTERACTION OF GAG WITH THE HOST CELL DURING ASSEMBLY...... 30 1.3.1 Transformation By Avian Retroviruses...... 31 1.3.2 Endogenous Retroviruses And Host Cell Restriction ...... 33 1.3.3 Host Cell Interactions Of The HIV Gag Polyprotein ...... 34 1.3.3.1 Host Cell Interactions Of The HIV Gag Polyprotein: Cyclophilin A...... 35 1.3.3.2 Host Cell Interactions Of The HIV Gag Polyprotein: Cytoskeleton...... 36 1.3.3.3 Host Cell Interactions Of The HIV Gag Polyprotein: Endosomal Sorting Proteins...... 37 1.4 SUBCELLULAR TRAFFICKING OF THE RSV GAG POLYPROTEIN...39 1.4.1 Membrane Binding Mechanisms For RSV Gag...... 40 1.4.1.1 Membrane Binding Mechanisms Of Cellular Proteins ...... 41 1.4.1.2 Membrane Binding Of The HIV Gag Polyprotein...... 45 1.4.1.3 Membrane Binding Mechanisms Of Nonmyristoylated Gag Proteins...... 47 1.4.1.4 Identification Of The RSV Membrane Binding Domain ...... 48 1.4.1.5 Characterization of RSV Membrane Binding Mutants ...... 50 1.4.2 Nuclear Transport In Retroviral Replication...... 53 1.4.2.1 Identified Nuclear Shuttling Proteins In HIV Replication ...... 54 vii 1.4.2.2 Nuclear Transport In RSV Replication ...... 55 1.4.2.3 The Nuclear Pore Complex...... 57 1.4.2.4 Nuclear Transport Signals...... 62 1.4.2.5 The Crm-1 Export Pathway...... 64 1.5 OVERVIEW...... 67

CHAPTER 2: SPECIFICITY OF PLASMA MEMBRANE TARGETING BY THE ROUS SARCOMA VIRUS GAG POLYPROTEIN ...... 70

2.1 ABSTRACT ...... 71 2.2 INTRODUCTION ...... 71 2.3 MATERIALS AND METHODS ...... 75 2.4 RESULTS...... 78 2.5 DISCUSSION...... 101

CHAPTER 3: NUCLEAR ENTRY AND CRM1-DEPENDENT NUCLEAR EXPORT OF THE ROUS SARCOMA VIRUS GAG POLYPROTEIN ...... 106

3.1 ABSTRACT ...... 107 3.2 INTRODUCTION ...... 108 3.3 MATERIALS AND METHODS ...... 110 3.4 RESULTS...... 112 3.5 DISCUSSION...... 128

CHAPTER 4: FINE MAPPING OF THE NUCLEAR EXPORT SIGNAL OF THE ROUS SARCOMA VIRUS GAG POLYPROTEIN ...... 133

4.1 ABSTRACT ...... 134 4.2 INTRODUCTION ...... 134 4.3 MATERIALS AND METHODS ...... 138 4.4 RESULTS...... 140 4.5 DISCUSSION...... 158

CHAPTER 5: NUCLEAR TRANSPORT OF THE ROUS SARCOMA VIRUS GAG POLYPROTEIN IN SACCHAROMYCES CEREVISIAE...... 162

5.1 ABSTRACT ...... 163 5.2 INTRODUCTION ...... 164 5.3 MATERIALS AND METHODS ...... 167 5.4 RESULTS...... 171 5.5 DISCUSSION...... 189

viii CHAPTER 6: ROUS SARCOMA VIRUS GAG NES MUTANTS REVEAL POST ENTRY DEFECTS IN VIRAL REPLICATION ...... 195

6.1 ABSTRACT ...... 196 6.2 INTRODUCTION ...... 196 6.3 METHODS...... 201 6.4 RESULTS...... 205 6.5 DISCUSSION...... 224

CHAPTER 7: THESIS DISCUSSION ...... 230

7.1 THE ROLE OF NUCLEAR TRAFFICKING OF THE ROUS SARCOMA VIRUS GAG POLYPROTEIN...... 231

7.1.1 The p10 Nuclear Export Signal And The Structure Of The Gag Protein ...... 232 7.1.2 The p10 NES And Viral RNA Export...... 235 7.1.3 The MA NLS And Viral DNA Import ...... 237 7.2 MEMBRANE TRAFFICKING OF THE ROUS SARCOMA VIRUS GAG PROTEIN...... 238 7.3 TARGETING SIGNALS WITHIN THE RSV MA PROTEIN...... 239

REFERENCE LIST ...... 242

ix LIST OF FIGURES

Figure 1.1: Organization of the retroviral particle...... 13

Figure 1.2: Retroviral entry and DNA synthesis...... 17

Figure 1.3: Genome organization and expression...... 22

Figure 1.4: Model for the assembly of retroviruses...... 25

Figure 1.5: Membrane binding signals...... 43

Figure 1.6: Phenotypes of RSV M domain mutants...... 52

Figure 1.7: The nuclear pore complex...... 58

Figure 1.8:Nuclear transport ...... 61

Figure 2.1:Mutants of the RSV M domain ...... 79

Figure 2.2: Particle assembly and membrane association of the wild-type and mutant Gag.GFP and MA.GFP fusion proteins...... 81

Figure 2.3: Membrane association of wild-type and mutant Gag.GFP and MA.GFP proteins...... 84

Figure 2.4: Subcellular localization of Gag and MA mutant proteins...... 87

Figure 2.5: Subcellular localization of Fyn.MA and Fyn.Gag derivatives...... 90

Figure 2.6: Colocalization of the Myr2.B1c.MA protein with markers of the ER and Golgi...... 93

Figure 2.7: Thin section electron microscopy...... 95

Figure 2.8: Particle assembly of Myr2.T14K.Gag.GFP in the presence of Brefeldin A (BFA)...... 98

Figure 2.9: Leptomycin B treatment of Gag deletion proteins ...... 100

Figure 3.1: The RSV Gag protein and derivatives...... 114

Figure 3.2: Subcellular localization of the RSV MA protein...... 115 x Figure 3.3: Identification of an LMB-sensitive NES within the Gag protein...... 118

Figure 3.4: Effects of p10 deletions on subcellular localization...... 121

Figure 3.5:LMB sensitivity of mutant Gag proteins with defects in RNA packaging and dimerization...... 124

Figure 3.6: Gag localization in virus-expressing cells and particle release in response to LMB treatment...... 126

Figure 3.7: Model for the role of the nuclear localization of Gag during RSV replication ...... 130

Figure 4.1: Identification of hydrophobic residues comprising the RSV Gag NES....142

Figure 4.2: Reduced virus-like particle assembly for NES mutant Gag proteins...... 146

Figure 4.3: NES mutant Gag proteins are released from the cell with delayed kinetics...... 149

Figure 4.4: Conservation of NES function across avian retroviral Gag proteins ...... 152

Figure 4.5: Inhibition of Gag nuclear export by dominant-negative nuclear pore proteins ...... 157

Figure 5.1: Schematic of the pIGin and pIGout vector system...... 172

Figure 5.2: Expression of RSV fusion proteins in yeast cells...... 175

Figure 5.3: Localization of RSV fusion proteins in yeast cells...... 178

Figure 5.4: Immunofluorescence analysis of RSV fusion proteins...... 181

Figure 5.5: LMB sensitivity of pIGin and pIGout fusion proteins...... 185

Figure 5.6: Localization of RSV fusion proteins in yeast cells deleted for importin-β family members...... 187

Figure 6.1: Schematic of NES mutant viruses...... 207

Figure 6.2: Infectivity of viruses with mutations in the Gag NES...... 209 xi Figure 6.3: Viral protein composition...... 212

Figure 6.4: Gag-Pol content of mutant viruses...... 214

Figure 6.5: Env content of mutant viruses...... 215

Figure 6.6: RNA content of wild-type and mutant viruses...... 217

Figure 6.7: Thin section electron microscopy analysis of viral particles ...... 220

Figure 6.8: Analysis of intracellular viral DNA...... 223 xii ACKNOWLEDGEMENTS

My success in graduate school would not have been possible without the support and care of numerous faculty, friends and family. I thank all of the faculty and laboratory members within the Departments of Microbiology and Immunology and of Infectious

Diseases that have all been available to me and provided crucial input and direction to guide my research. Our collaborators, Anita Hopper and Kristin Butterfield-Gerson have introduced me to the world of yeast genetics, and the enthusiasm that Dr. Hopper has for science has rejuvenated my own joy in pursuing science during the latter half of my graduate career.

Thank you to the past and present members of the Parent laboratory: Jessica Albert, Karen

Bone, Jonathan Rhoads, Eileen Ryan, Scott Kenney, and Rachel Garbitt, whose have traveled the road with me and made it an enriching experience. My thesis committee, Drs. Rebecca

Craven, Jim Hopper, Craig Meyers and Michael Verderame always stretched me to focus upon the critical questions within my project and then to be creative in dreaming of new ways to test those central questions. I would like to thank my advisor, Leslie Parent, for allowing me to grow as a scientist, giving me the room to develop my own ideas and ways of thinking and then having the confidence in my abilities to critically test those ideas. This work certainly would not have been possible without the support of my family, whose constant faith that I could achieve any goal that I set my mind to gave me the faith to believe that as well. Thank you to my daughter Madeleine, who spent numerous hours keeping me company in the lab and looking at science with childlike wonder. Finally, this thesis would not have been possible without the support of my husband Nathan who has consistently done all that he has been required to do so that I could do all that I wanted to do; this thesis has only been possible because of that love, and it is to Nathan that this work is dedicated.

CHAPTER 1

LITERATURE REVIEW 2

1.1 THE ROLE OF GAG IN RETROVIRAL ASSEMBLY

Retroviruses are classified as the group of viruses that reverse transcribe their

RNA genome into a cDNA copy and then insert that cDNA into the host cell chromosome. Retroviral research extends to the very origins of virology. Indeed, retroviruses were among the first viruses identified, and early studies identified numerous retroviruses as the etiological agents for both solid tumors and leukemias. With the discovery of the enzyme reverse transcriptase and the development of cell culture techniques for analysis of viruses, research in the 1960’s and 1970’s switched to the elucidation of the viral life cycle and the mechanisms of cellular transformation. With the growth of molecular biology, recent work has centered upon defining the molecular interactions that viral proteins use to accomplish viral replication. Indeed, during the past twenty years the roles of the three conserved viral polyproteins have been well described, with the Env protein mediating viral entry, the Pol protein providing the enzymatic functions of the virus, and the Gag polyprotein serving as the structural core of the virus ensuring the transmission of the viral genome. The Gag polyprotein has also been well defined, with extensive mutational analysis delineating motifs within the polyprotein that coordinate the functions of assembly not only for retroviruses, but for other viral families as well. Much of this work focused upon mapping functional determinants within Gag through studies of viral particle release, in vitro assembly, and viral RNA packaging, yet understanding the mechanism by which these domains mediate retroviral assembly now requires broader understanding of how these sequences direct the Gag polyprotein 3 through the host cell. It is these interactions of Gag with the host cell during viral assembly that will constitute the focus of this thesis.

1.1.1 Identification Of Rous Sarcoma Virus

Identification of viruses as agents capable of transmitting disease has been achieved only within the last century. The first identification of a virus as the causative agent for disease was in 1900, when John Carrol and Walter Reed demonstrated that yellow fever virus was the cause of yellow fever in Cuba through the bite of the Aedes aegypti mosquito. Experimental transmission of a virus was accomplished by Adolf

Mayer in 1880, when he was able to transmit Tobacco mosaic virus (TMV) through extracts from plant leaves. In 1892 and 1898, Dimitri Ivanofsky and Martinus Beijerinck independently demonstrated that the infection could be transmitted by filtered extracts, and that multiple rounds of infection were achievable, requiring the reproduction of the agent in infected cells. The rapid identification of foot-and-mouth disease and yellow fever viruses helped codify the definition of viruses (“slimy liquids” or “poisons”) as filterable infectious agents that replicated within the cell, exemplified in the 1928 book

Filterable Viruses by Thomas Rivers.

Retroviruses did not easily gain access to the growing list of transmissible viruses

because the first studied retroviruses all were oncogenic; more disturbing than the idea of

diseases being spread by invisible agents was the concept of transmissible cancers. In

1908 Wilhelm Ellermann and Olaf Bang described avian erythroleukemias that were

transmissible by filterable virus (84). Because leukemias and lymphomas were not yet 4 recognized as cancers, there results were not as controversial as those of Peyton Rous. In

1911, Rous demonstrated that a solid tumor, a sarcoma of the Plymouth Rock hen, was not only transmissible via transplant between animals, but also through a cell-free filtrate, and the progression and appearance of the disease was identical regardless of the mode of infection (288). The concept of viral oncogenesis was confirmed in other model systems, first by Richard Shope, working with papillomas of the rabbit, and then by John Bittner with Mouse mammary tumor virus (18), and by Sarah Stewart and Bernice Eddy with both mouse polyoma virus and the SV40 virus.

Research into Rous sarcoma virus expanded with the development of an assay more amenable to analysis than infection of whole animals. In 1938, the chick embryo was first employed as a model system, with cell-free virus injected into the chorioallantoic membrane (159). By the 1950’s, RSV could be grown in cell culture, and by 1958, Temin and Rubin adapted the plaque assay of Dulbecco to develop a focus- forming assay to titer Rous sarcoma virus (328).

1.1.2 Characterization Of Viral Gene Products

Early biochemical analysis of purified virions identified three polyproteins from which all virion proteins of RSV were derived, the Gag, Pol and Env polyproteins (7,98).

Activation of the viral protease within the Gag protein cleaves the three polypeptides into their constituent proteins: the MA, CA, NC, and PR proteins derived from Gag, the RT and IN enzymes from Pol, and the SU and TM subunits from Env (351). The development of an assay system to grow and titer Rous sarcoma virus allowed clonal 5 isolation of defective viruses. Locations of the viral proteins on the genomic RNA could then be mapped through RNA fingerprinting and recombination assays with deleted genomes (55,356). It was thereby determined that the positions of the three genes on the viral genome was invariant, occurring in the order 5’-gag-pol-env-3’ in all retroviruses.

Because RNA fingerprinting also identified the limit of the genetic information at 7-12 kb, these studies confirmed that the 70S dimer of Rous sarcoma virus RNA was comprised of two identical plus-stranded RNAs.

1.1.3 Isolation Of Reverse Transcriptase

The ability to study retroviral replication was hampered by the inability to isolate double stranded RNA (presumably the replicative form of the virus) from within infected cells, as well as from the peculiar sensitivity of retroviral replication to DNA synthesis and transcription inhibitors (8,325). Inspired largely by the stability of the transformed state induced by Rous sarcoma virus, Howard Temin proposed the existence of a stable

DNA intermediate synthesized from the viral RNA in transformed cells, the provirus

(326). Confirmation of Temin’s hypothesis would wait six years, until he and David

Baltimore would independently isolate the reverse transcriptase enzyme from RSV particles (9,327).

The isolation of the RT enzyme also uniquely defined retroviruses biochemically and opened the way for the study of the molecular biology of retroviruses. Extensive work could then begin to characterize the primer for DNA synthesis, map the DNA intermediates, characterize the nature of the provirus, and suggest the random nature of 6 insertion into the host cell DNA (139). The isolation of reverse transcriptase forever changed the Central Dogma of biology, that “DNA makes RNA makes protein”.

1.1.4 Identification Of Human Retroviruses

Despite the abundance of retroviruses identified between the isolation of Rous sarcoma virus and the isolation of the RT enzyme, no human retroviruses had been discovered. Identification of the first human retrovirus, a T-cell leukemia virus (263), was therefore met with skepticism. However, the discovery of Human T-cell leukemia virus

1 (HTLV-1) was important for two reasons. First, growth of the virus in culture was coincidental with the first stable growth of T-cells in culture, enabled by the isolation of interleukin-2. Second, HTLV-1 was the first complex retrovirus isolated; the animal retroviruses had all been simple viruses encoding only the gag, pol, and env genes, while

HTLV-1 encoded numerous accessory proteins (See 1.2.1 Classification Of

Retroviruses).

These two developments in the isolation and characterization of HTLV-1 paved the way for the recognition of the Human immunodeficiency virus. Within a few years, the HIV virus was cloned from patients experiencing diseases that we now collectively term AIDS (13,110). Viral pathogenesis was quickly recognized as infection and depletion of CD4+ T lymphocytes, a period of sustained viral latency, and final collapse

and susceptibility to opportunistic infections. Not only has the AIDS epidemic provided

the greatest challenge to modern virology, but it has also required us to return to basic questions of viral pathogenesis and immunity. Despite the great advances in viral control 7 offered by antiviral drugs, eradication of the virus and development of a vaccine have been largely unsuccessful. The great challenge posed by HIV demands that we understand more fully the cell types that are infected immediately upon exposure to the virus and the mechanism by which they disseminate virus to target cells. The rise of the

HIV pandemic has therefore driven the field of virus-cell interactions to discover the mechanisms by which retroviruses interact with the host cell to accomplish each cycle of viral replication.

1.2 THE RETROVIRAL LIFE CYCLE

The Gag polyprotein coordinates the assembly of retroviruses by selecting the viral RNA genome and by driving the formation of the retroviral particle. As such, Gag has had a central role in the stages of viral replication between viral gene expression and release of the virion. Yet proteins derived from Gag are now reported to have roles early in the viral life cycle as well, including reverse transcription and viral DNA entry into the nucleus (37,42). Sequences throughout the Gag protein must therefore be regulated to perform functions during both assembly and entry. Mutations within Gag may therefore disrupt numerous steps of viral replication, and a full understanding of the role of Gag- derived proteins in the retroviral life cycle is necessary for an informed interpretation of the interactions of Gag with the host cell. 8 1.2.1 Classification Of Retroviruses

The retroviruses have recently been classified into seven genera: the Alpha, Beta,

Gamma, Delta, and Epislonretroviruses, the Lentiviruses, and the Spumaviruses

(http://www.ncbi.nlm.nih.gov/ICTVdb/Ictv/index.htm). This classification is based foremost on the pathogenesis of the viruses. The Alpha, Beta, Gamma, Delta and

Epsilonretroviruses are all primarily oncogenic, producing, for example, fibrosarcomas, mammary carcinomas, and leukemias. The lentiviruses, such as Equine infectious anemia virus and the Human and feline immunodeficiency viruses, induce disease by killing or incapacitating cells. The Spumaviruses include the nonpathogenic human and equine foamy viruses.

The retrovirus classification scheme is also based upon the morphogenesis of retroviral particles. Type-A particles are defective endogenous retroviruses that bud into the endoplasmic reticulum and retain an immature viral phenotype. Type-B and type-D particles assemble visible cores within cytoplasm of infected cells, which are then subsequently transported to the plasma membrane. Both type-B and type D viruses are included within the Betaretroviruses, however the type-B particles, for example Mouse mammary tumor virus (MMTV), have spherical cores that are eccentrically located within the mature particle, while the type-D particles, such as Mason-Pfizer monkey virus

(MPMV), contain bar-shaped cores within the virus particle. The type-C viruses, including the Alpha and Gammaretroviruses do not begin to assemble electron-dense structures until they reach the plasma membrane. The viral cores produced by these viruses are spherical and centrally located within the particle. Although the Lentiviruses, 9 Spumaviruses and Deltaretroviruses also follow the type-C assembly pathway, forming budding structures at the plasma membrane, the viral core structures have varied morphologies, with HIV particles containing a characteristic conical structure. Although these assembly pathways are visually distinct, there are common assembly mechanisms; indeed the morphology of the type-D virus MPMV can be converted to that of a type-C virus through mutation of an arginine residue within the gag gene (281), suggesting that these morphogenic pathways are interconvertable and may be controlled by the interaction of viral proteins with host cell factors.

Finally, the retroviruses can be classified by genome organization into the simple and the complex retroviruses. Simple retroviruses encode three invariant genes: gag, pol, and env, as well as possibly a dUTPase and an oncogene. Gag is responsible for the budding and assembly of the virion, Pol encodes the enzymatic functions of the virus, and

Env provides the envelope glycoproteins. The complex retroviruses, in addition to these invariant proteins, encode numerous accessory proteins. The Human and Bovine leukemia viruses encode the Tax and Rex proteins, which act to amplify viral transcription and gene expression (See 1.2.6 Genome Organization and Transcription and

1.2.7 Retroviral Assembly). The HIV virus encodes homologs of Tax and Rex, termed

Tat and Rev, as well as additional proteins: Nef and Vpu which enhance virion release and infectivity and promote downregulation of the CD4 receptor, Vif, which allows the virus to evade host cell editing of the viral RNA, and Vpr, which allows nuclear import of the viral genome (See 1.2.5 Nuclear Transport of the Genome and Integration). In many cases, these accessory proteins simply amplify the pathogenicity of the virus, yet in other cases the proteins are essential for fundamental aspects of retroviral replication. The 10 ability of the simple retroviruses to accomplish a full replication cycle without the transcriptional transactivator Tat or the RNA export factor Rev suggests that the simple retroviruses may have a greater dependence upon host cell machinery. It is these interactions of the retroviruses with the host cell that are just beginning to be elucidated for complex human pathogens such as HIV, yet the greater dependence of the simple retroviruses upon host cell factors has not yet been fully explored.

Rous sarcoma virus is a simple retrovirus and is the prototypical member of the

Avian sarcoma and leukosis virus (ASLV) family, now termed the Alpharetroviruses. As such, RSV follows a type-C morphogenic pathway, forming budding structures at the plasma membrane. Unless otherwise noted, the remainder of this introduction will therefore focus on the life cycle of RSV, although extensive parallels will be made with the replication of HIV (and other retroviruses) for three reasons: (1) While RSV, as one of the most historically relevant retroviruses, has been intensely studied, that place in retrovirology has certainly been supplanted by HIV, upon which most of the retroviral research is currently focused due to its relevance for human health; (2) HIV and RSV share many similarities, such as the mode of viral assembly, and direct implications are certainly reasonable for aspects of the viral life cycle where RSV research is underdeveloped; and (3) RSV is a simple retrovirus and HIV is a complex retrovirus, suggesting that functions encoded by HIV accessory proteins are either assumed in the other RSV genes or by host cell functions, the discovery of which is the ultimate aim of this study.

11 1.2.2 Virion Organization

The retroviral particle is comprised of 1-2% RNA, 35% lipid and 65% protein.

The lipid content of the virus is derived from the host cell bilayer as the host cell membrane is incorporated as the virion envelope during budding. While this process apparently does not exclude plasma membrane proteins from incorporation into the viral particle (123), the composition of membrane lipids is significantly different between the plasma membrane of the infected cell and the viruses that are released. RSV and HIV particles are enriched for phosphatidylserine, sphingomyelin and cholesterol, while showing a decrease in the content of phosphatidylcholine (1,260). These results, as well as the incorporation of specific GPI-anchored proteins into retroviral envelopes (234), the fractionation of viral assembly intermediates with detergent resistant membranes (194), and the ability of cholesterol-depleting drugs to inhibit particle release (242), have led to the hypothesis that retroviral particles are released from localized, ordered regions of the plasma membrane, termed membrane rafts. This presumed specific targeting of assembly to plasma membrane microdomains results in viral particles with unique lipid profiles.

Rous sarcoma virus particles are 127± 10 nm when measured by cryo-EM microscopy (Figure 1.1)(168). Extending 7-9 nm outward from the lipid bilayer are the envelope glycoproteins, SU and TM, encoded by the viral env gene. Immediately underlying the viral membrane in both the immature and mature particles is the MA

(matrix) protein (168,369). The MA protein of HIV contains an alpha helix (α5), which points towards the interior of the virion, filling some of the space between the viral membrane and the core, a latticework created by the CA (capsid) protein (369). Viral 12 cores are nonsymmetrical, and although they appear spherical by low resolution EM analysis, core morphology is variable, and higher resolution studies reveal an irregular polygonal appearance (168). Within this viral capsid resides the vRNP complex, comprised of two copies of the plus-stranded RNA genome, covalently linked at the 5’ end, to which a cellular tRNA is bound as the primer for DNA synthesis. The RNA is coated first by up to 1500 copies of the NC (nucleocapsid) protein that adhere to the RNA nonspecifically, serving to protect and condense the nucleic acid, and also by fewer copies of the RT (reverse transcriptase) and IN (integrase) proteins, which are poised to act upon the viral RNA once the virus enters a new cell. RSV contains additional proteins and peptides within the Gag polyprotein, termed p2a, p2b, p10, and SP which are released from Gag during maturation by proteolysis, of which the p10 protein will be the most relevant for our study. A central role has been assigned to the p10 domain in the morphology of immature viral particles (See 1.2.7 Retroviral Assembly), yet the location of p10 within the particle or a role for p10 in the structure of the mature virion has not previously been described.

13

A. B.

C. D.

Figure 1.1: Organization of the retroviral particle. (A.) Immature virions are comprised of Gag (blue) and Gag-Pol (green) proteins underlying the lipid envelope, within which the Env glycoproteins (orange) are embedded. (C.) Mature virions display a condensed viral core, with a shell of capsid (CA) proteins surrounding the viral genome, which is coated with the viral nucleocapsid (NC) protein. (B. and D.) Thin section electron microscopy of immature and mature particles comprised of RSV Gag.GFP proteins (B.) or the Rous sarcoma virus (D.) 14 1.2.3 Entry

Attachment and entry of retroviruses are mediated by the Env protein. Env is synthesized as a polyprotein which is trimerized in the endoplasmic reticulum, N- glycosylated, and finally processed in the Golgi apparatus to produce SU and TM subunits. The RSV Env subunits are maintained both by noncovalent interactions as well as by disulfide bonds and are retained in the viral lipid envelope by a membrane anchor within TM (gp37). The SU subunit (gp85) recognizes the cellular receptor for the virus and therefore determines the tropism of the virus, which is controlled by sequences within two host-range determining sequences (hr1 and hr2) as well as one variable region

(vr3) within SU (78,337). Binding to the receptor induces conformational changes that expose the fusion peptide within the TM subunit and allows contact with the cell membrane (68). Fusion begins within 5 minutes of receptor binding and is essentially complete within 3 hours (114). The fusion of the viral and cellular membranes to create a pore through which the virus core can enter remains a poorly defined process, although it is initially pH-independent, making the retroviral fusion mechanism different from that used by the influenza hemagglutinin protein (81,225).

Entry of Alpharetroviruses into avian cells is mediated by at least three receptor loci, tv-a, tv-b and tv-c. Infection by RSV confers resistance to superinfection by downregulation of the viral receptor at the cell surface. The viruses can therefore be divided into 6-10 subgroups based upon patterns of receptor interference. The functions of these viral receptor proteins remain undefined within the normal cellular metabolism, although the Tva protein is related to the low-density lipoprotein receptor (14) and the 15 Tvb protein contains a cytoplasmic death domain ((32), for a review, see (12,246)).

ASLV strains show a great variation in their ability to infect different avian species both because the level of each receptor is highly variable among cell types, but also because numerous polymorphisms exist within the receptor genes that render cells not susceptible to infection.

1.2.4 Reverse Transcription

Reverse transcription of the viral genome is mediated by a heterodimer of

RTα and β subunits that must be provided as part of the incoming virion (2). RT uses the tRNATrp annealed to the viral RNA to initiate DNA synthesis (Figure 1.2). Extension

from the primer-binding site produces a short minus-strand DNA (termed strong stop)

that is terminated at the 5’ end of the RNA genome. Following digestion of the RNA-

DNA hybrid by the RNase H activity of RT, RT must jump to the 3’ end of the genome

and use the strong stop DNA to initiate minus strand synthesis from the repeated portion

of the viral RNA (the R sequence) through the primer-binding site. Again, the resulting

RNA-DNA hybrid is digested by RNase H, but this digestion is incomplete, leaving a

RNA primer at the polypurine tract and at additional sites in the viral genome that can be

used to initiate plus-strand synthesis. Plus strand synthesis is therefore discontinuous

(138,343), producing first a plus-stand strong stop DNA, which is used following a

second jump by the RT enzyme for completion of the plus strand. Reverse transcription

therefore produces a double-stranded DNA that is colinear with the viral RNA, but which 16 contains duplications at the ends of the viral RNA resulting in two identical long-terminal repeats comprised of the U3, R and U5 regions (139,304).

17

Integration

2-LTR circles

Preintegration complex (PIC)

Synthesis of minus strand strong stop DNA

PBS PBS Completion of First strand transfer DNA synthesis

Synthesis of plus strand strong stop DNA PPT Second strand transfer

Reverse transcription

Figure 1.2: Retroviral entry and DNA synthesis. The viral core is released into the cytoplasm, the site of viral DNA synthesis. Reverse transcription initiates synthesis of the first strand by using a cellular tRNA annealed to the primer-binding site (PBS) on the viral RNA and initiates the second stand from the partially degraded RNA:DNA hybrid at the polypurine tract (PPT). The cDNA is imported into the nucleus by the viral and cellular proteins that comprise the preintegration complex (PIC). Within the nucleus, viral DNA is either integrated into the host cell chromosome or circularized to form autointegration products, 1-LTR circles and 2-LTR circles, byproducts of retroviral infection. 18 1.2.5 Nuclear Transport Of The Genome And Integration

Since the isolation of reverse transcriptase in 1970, the enzymology of reverse transcription has been carefully delineated, yet the complex of proteins that mediates reverse transcription remains undefined. Following penetration into the cytoplasm, the viral core uncoats, sequentially releasing protein components as the process of reverse transcription is initiated and the newly synthesized DNA makes its way toward the nucleus (89,90). Intermediate protein-DNA complexes can be isolated from newly infected cells, but it is the complex associated with the mature RNA that is termed the preintegration complex (PIC). The ability of proteins to be retained within the complex varies between viruses; Murine leukemia virus (MLV) complexes retain the CA, IN and

RT proteins (89), while HIV complexes retain RT, IN, Vpr and a small amount of CA and phosphorylated MA proteins (37,219).

The HIV virus is capable of translocating its genome into the nucleus of resting cells (38), implying an active transport mechanism for the PIC. This ability to confer active import upon the genome has been attributed to several members of the complex, including IN (26), Vpr (347), MA (36,37) as well as to properties of the synthesized

DNA ((383), for a review see (67)). It is likely that these signals act in a redundant manner to ensure efficient uptake of the PIC into the nucleus of nondividing cells.

Avian sarcoma viruses differ from the retroviruses such as HIV ands MLV for two reasons. First, reverse transcription of RSV DNA is not completed in the cytoplasm, but rather appears to still be occurring in the cell nucleus (190,343). Host cell factors within the nucleus may be necessary for the completion of reverse transcription or 19 fidelity of reverse transcription may be maintained by completing synthesis in a location with abundant nucleotides. As well, RSV is unique because of its ability to infect nondividing cells at low levels. Whereas MLV is completely restricted from the nucleus of quiescent cells and HIV contains active import properties, RSV has an intermediate phenotype, being able to infect metabolically arrested cells at 3% of the level of HIV and almost 10 times the level of MLV (127,154).

Once the genome enters the nucleus, it has two fates: either to become integrated into the host cell DNA where it is maintained as a provirus or to enter a nonproductive pathway, where it is circularized and eventually lost. To be integrated, linear viral DNA is processed to remove the terminal two nucleotides and then inserted into the host chromosome through the action of the viral IN enzyme. The circular DNA forms, termed

1-LTR circles (formed by homologous recombination between the viral LTRs), 2-LTR circles (formed by ligation of the LTRs by the non-homologous end joining proteins

Ku70 and Ku80 to form a “circle junction” (192)), and autointegration products (formed by insertion of the viral DNA into its own sequence) appear to be nonproductive, as they accumulate at the expense of linear viral DNA in IN-deficient cells (77,287). These DNA end products therefore serve as hallmarks for the completion of reverse transcription and the entry of the genome into the nucleus, as they require host cell factors within the nucleus for circularization. 20 1.2.6 Genome Organization And Transcription

Reverse transcription produces an integrated provirus that is flanked by two 330 bp long terminal repeats (LTRs) consisting of the U3, R and U5 regions. Between the

LTRs lie the four RSV genes: gag, pol, env and src. A single RNA species is transcribed from the integrated provirus to produce capped, polyadenylated mRNAs. Transcription by RNA polymerase II initiates from a promoter at the start of the R region of the viral

LTR. The LTR contains a core TATA element and cis-acting regulatory elements within the first 100 nucleotides of the upstream U3 region. Within this enhancer lie regulatory motifs for C/EBP, serum response factor and YY1 binding (27,220). The LTR of RSV is a potent transcriptional activator, with up to 10% of the cellular RNA pool being comprised of viral messages (186). Interestingly, chimeric viruses have revealed a correlation between the strength of the LTR in promoting transcription and the type of tumor produced, consistent with the role of the inserted promoter in activating proto- oncogenes (33). Along with the sequences within the LTR, enhancers are present at other sites within the genome, most notably within the gag gene (4), where three functional

C/EBP binding sites can be found (47). Mutations in these consensus sites reduce transcription by half and decrease the infectivity of the resulting viruses (292). This strong enhancer element may augment basal levels of viral gene expression in the absence of the viral transcriptional transactivator present within the complex retroviruses.

The absence of a trans-acting activator results in consistent levels of gene expression rather than dramatic switches between latent and active transcription states. 21 Although a single RNA is transcribed from the RSV genome, viral protein synthesis requires the creation of three mRNAs by alternative splicing. Synthesis of the

Env polyprotein and the Src oncoprotein proceeds from spliced RNAs utilizing a splice donor site within the gag gene and splice acceptor sites at the beginning of the env and src genes (Figure 1.3). The Gag and Gag-Pol polyproteins, on the other hand, are synthesized from the unspliced viral transcript. The unspliced message persists both by the weakness of the 3’ splice acceptor sites (155) as well as by a cis-acting negative regulator of splicing, again present within the gag gene (218). 22

R

U3 LTR gag pol env src dr1 dr2 vRNA AAAA

AAAA Recruitment of cellular export AAAAAAAA receptors?

Synthesis of Env and Src proteins Synthesis of Gag and Gag-Gag-Pol ol polyproteins

Figure 1.3: Genome organization and expression. The RSV genome is comprised of the gag, pol, env, and src genes located between two identical LTRs containing the U3, R and U5 regions. Following transcription from the viral promoter in the R region, the viral RNA is spliced to produce mRNAs for the Env and Src proteins. The mechanism by which the unspliced viral genome is exported from the nucleus remains unresolved, although the cis-acting direct repeat (dr) elements at the 3’ end of the genome (yellow boxes) are proposed to act as constitutive transport elements. 23 Along with nuclear import of the viral preintegration complex, nuclear export of the unspliced viral RNA message remains one of the least understood steps in the replication of RSV. Because unspliced cellular messages never leave the nucleus, the complex retroviruses have encoded the Rev and Rex proteins to both inhibit splicing directly and to shuttle unspliced mRNAs from the nucleus so that they may be translated in the cytoplasm (169,204). The simple retroviruses encode cis-acting sequences that mediate export of the unspliced viral RNA through the recruitment of cellular RNA export factors such as the Tap protein (122). RSV is proposed to contain an export element in the direct repeat (DR) sequences that flank the src gene (Figure 1.3)(239).

These sequences have alternatively been proposed to function both directly and indirectly in particle assembly and RNA encapsidation (5,311,312), and do not seem to recruit host cell export factors (247), leaving their role in RSV replication ambiguous.

1.2.7 Retroviral Assembly

Once exported into the cytoplasm, the unspliced RNA serves as the template for the synthesis of Gag and Gag-Pol proteins. Because the Pol coding sequence is out-of- frame with the Gag sequence, ribosomal frameshifting allows synthesis of a Gag-Pol fusion protein at an efficiency of 5% of the synthesis of Gag (143). In the absence of all other viral proteins, Gag is able to self-assemble in vitro (45) and form virus-like particles in vivo, indicating that Gag alone is sufficient to drive the formation of viral particles of uniform size and density at the plasma membrane. The functions of Gag in assembly are contained within three assembly domains, termed the interaction (I), 24 membrane-binding (M), and late (L) domains, which, though divergent in sequence, are notable for being functionally exchangeable between retroviral genera (15,251).

Once synthesized, the Gag proteins of RSV likely begin to interact in the cytoplasm, as assembly-incompetent Gag proteins can be rescued in trans by assembly- competent Gag proteins (253). Although contacts occur through the MA and CA domains of Gag, protein-protein interactions are mediated most directly by two I domains within the NC region of Gag. Because they control the number of Gag proteins incorporated into each virion, the I domains also serve to ensure that particles of the appropriate density are produced. The I domains utilize both basic residues as well as Cys-His boxes to catalyze

Gag multimerization (322). Several studies suggest that viral, or in its absence, cellular

RNA serves as the scaffold that brings Gag proteins into contact to multimerize, consistent with the overlapping functions of this region of Gag in RNA-binding and protein-protein interactions (Figure 1.4)(202,226). Dimerization of Gag proteins is a crucial intermediate step in the assembly reaction (202), allowing the formation of subsequent assembly intermediates that can be isolated from infected cells as detergent- resistant complexes (189). Gag interactions also enable incorporation of the Gag-Pol polyprotein. Despite containing all the functional domains of the Gag proteins, the Gag-

Pol fusion proteins are unable to direct particle assembly themselves, but rather are incorporated into virions through interaction with Gag proteins via RNA associations

(160), again at a 1:20 ratio of Gag-Pol to Gag proteins.

25

A p y C Synthesis of Env proteins Synthesis of Gag Plasma membrane and Gag-Pol targeting via M domain polyproteins

CypA Tranport of Gag on the cytoskeleton? Cyp Interaction with A Multimerization cyclophilin A and p y of Gag proteins chaperones? C via I domains

Recruitment of endosomal sorting proteins by retroviral L domains?

A

Endosomes/ p Multivesicular bodies y C

Figure 1.4: Model for the assembly of retroviruses. Spliced mRNAs serve as the template for the synthesis of Env proteins, which are trafficked to the plasma membrane through the secretory pathway. Gag (blue) and Gag-Pol proteins are synthesized in the cytoplasm after which they begin to self-associate in the cytoplasm on an RNA template. Gag proteins then traffic to the plasma membrane, the site of virus budding and release, via an N-teminal membrane-binding domain. The cellular chaperone proteins (CypA, pink rectangles), endosomal sorting proteins (purple wedges), and the cytoskeleton have all been suggested to associate with Gag proteins, yet the location within the cell where they participate in viral assembly remains to be determined. 26 The plasma membrane affinities of Gag proteins is quite low (83), and it is only once sufficient cooperativity is achieved through Gag oligomerization that association of

Gag proteins with the plasma membrane is stable enough to drive the budding process.

Membrane-binding is accomplished through the activity of the N-terminal M domain of

Gag, which targets the Gag protein from the site of synthesis to the plasma membrane.

The mechanism by which the retroviral membrane-binding domains specifically select the plasma membrane as the site of assembly remains elusive (See 1.4.1 Membrane

Binding Mechanisms for RSV Gag), yet these signals function as discrete elements, capable of carrying heterologous proteins to the plasma membrane (344,384). Env proteins are incorporated into the virus after they are released to the cell surface through the secretory pathway and appear to coat the membrane through which Gag proteins bud.

Upon accumulation of Gag proteins at the plasma membrane, the membrane is deformed to create a spherical bud. Gag proteins must recruit the host cell machinery to the forming particle to accomplish the membrane fission event that will release the virion from the host cell. This event is coordinated by the retroviral L domain, a short proline- rich sequence (PPPPY) within the p2b domain of the Gag polyprotein (375). The L domain recruits cellular proteins to the site of viral budding, and is presumed to recruit components of the endosomal budding machinery to accomplish the release of the virion from the host cell (Figure 1.4; for a review, see (102,267)). Inhibition of these host cell proteins arrests viral particles at a late stage of budding, with tethering of HIV particles to the host cell membrane by a stalk structure.

The studies presented here point to an additional, yet central, role for the p10 domain of RSV Gag in retroviral assembly. p10 is a 62 residue phosphoprotein encoded 27 between the MA and CA regions of gag. Indeed, p10 has been described to be a major determinant for the formation of spherical particles that are assembled in vitro. In the absence of the p10 domain, Gag proteins do not polymerize properly, but instead assemble into tubular structures. The final 25 amino acids of p10 are sufficient to restore the morphogenesis of spherical particles (148).

When examined in the context of the crystallized CA protein, the final 25 residues of p10 cause the CA protein to purify as a dimer (230). The N-terminal domain of CA forms a β-hairpin in the absence of the p10 residues; in the presence of p10, the protein forms two α-helices joined by a flexible loop. This amino-terminal p10 extension is in fact ordered, and 17 residues within the α-helices participate in the interface between CA monomers. The C-terminus of p10 is therefore crucial for the structure of Gag, allowing the CA domains of Gag to dimerize and remain in the correct orientation to promote assembly of RSV into spherical particles.

1.2.8 RNA Packaging

Two RNA species must be incorporated into the RSV particle: the plus-stranded

RNA genome and the tRNATrp primer. The tRNA primer is enriched in virions by the RT

domain of the Gag-Pol protein which binds specifically to tRNATrp; although tRNATrp is

not the only tRNA present within the virus particle, this enrichment allows tRNATrp to be present is sufficient concentration to be available to the virus (59,104,250). Once within the virion, the tRNA is annealed to the primer-binding site on the viral RNA by the nucleic acid annealing properties of the Gag NC domain (223). 28 The genomic RNA is recognized by the Gag protein through a cis-acting RNA packaging signal (Ψ) located in the 5’ end of the RNA which allows viral RNA to be recognized and encapsidated with 20-200 fold greater efficiency than cellular RNAs. The minimal Ψ sequence, comprised of a 160-nt highly structured region, allows the incorporation of a heterologous cellular RNA into retroviral particles, although at 10% of the efficiency of the viral genome (10,11). Recognition and incorporation of the RNA genome by Gag is accomplished through both basic residues and Cys-His motifs within the NC domain, although additional regions of Gag have been implicated for other retroviruses (185,189,354). The mechanism of selection appears to be the greater binding stability of Gag to viral, rather than cellular RNA, as RNA association is reversible (94).

One of the least understood steps in Rous sarcoma virus replication is the timing of RNA selection for packaging into virions by the Gag polyprotein. For viruses such as

HIV-1, packaging of the viral genome appears to occur in the cytoplasm, with HIV-1 able to encapsidate not only its own RNA, but also the RNA of HIV-2 (158,215). In contrast,

HIV-2 appears to prefer to package RNA cotranslationally, with newly synthesized Gag proteins incorporating RNA that serves as the template for Gag synthesis from the ribosome (120); the amount of Gag protein present is therefore limiting for the incorporation of viral RNA into particles. Unlike other retroviruses, Rous sarcoma virus faces the obstacle of having the Ψ packaging signal on both unspliced and spliced viral

RNAs, yet RSV is also capable of preferential encapsidation of unspliced RNAs (10).

This question of RNA packaging may therefore be related to the questions of export of the RNA genome from the nucleus, and it is possible that the unspliced viral genome is not simply released into the cytoplasm to find its way to the ribosome or the budding 29 particle. Understanding these events in RSV replication will require elucidation of the location within the cell where Gag begins to make contacts with the viral RNA.

1.2.9 Viral Maturation

The formation of an infectious particle requires the processing of all viral proteins as well as of the genomic RNA by the viral protease. RSV is unlike other retroviruses in that it encodes the protease (PR) as a fusion with the Gag polyprotein, rather than simply as part of Gag-Pol, and therefore contains a much higher concentration of PR within the virion. PR is activated by dimerization and its activity is thereby at least partially restrained until the later stages of particle assembly (191). Once the PR domain is excised from Gag, PR is able to recognize cleavage sites within the viral proteins, producing cleavages in a reproducible, sequential manner (41,376). The Gag and Gag-Pol proteins are processed to release the MA, p2a, p2b, p10, CA, NC and PR proteins from Gag, as well as the additional RT and IN from Gag-Pol.

Processing of Gag leads to a dramatic redistribution of proteins within the virion.

The Gag proteins of the immature virion are radially organized, with the MA domain underlying the viral envelope, the CA domain centrally located, and the NC domain at the virion interior (369). Following processing, the MA domain undergoes conformational changes that dramatically reduce its membrane affinity, yet it is still believed to remain in association with the viral membrane (299). CA condenses to form the shell of the virion, visible within the virus particle as an electron-dense core. Processing decreases the stability of the virion, likely preparing the core for subsequent steps of disassembly. The 30 NC domain, once released from Gag, coats the genomic RNA within the core via nonspecific RNA binding interactions.

The viral genome is also affected either directly or indirectly by the proteolysis of viral proteins. RNA present within the immature particle is maintained in a dimeric state by base-pairing interactions throughout the length of the RNA, but most noticeably at the dimer initiation site within the 5’ end of the genome (17,100). Viral RNA packaged in the absence of PR function is often monomeric (244), and if dimers are incorporated, they are unstable, dissociating to monomers at temperatures several degrees below the melting temperature of mature wild-type RNA (305). Therefore, the release of the RNA-binding protein NC from the Gag precursor likely enables it to compact the RNA into the tight dimer structure necessary to initiate viral infection.

1.3 INTERACTION OF GAG WITH THE HOST CELL DURING ASSEMBLY

Retroviruses are highly virulent pathogens, inducing numerous cancers and immunodeficiency diseases. These diseases are often induced by viral oncogenes or viral insertional mutagenesis. Yet even in their absence, interactions of the virus with the host cell are evidenced both through the cytopathic effect of viral infection and the restriction to retroviral infection seen between cell types. Understanding the interaction of Gag with the host cell therefore requires both understanding the progress of viral infection as well as the natural blocks to viral infection and the mechanism used by exogenous retroviruses to overcome these restrictions to infection, some of which are mediated by the Gag polyprotein itself. Indeed, the Gag protein facilitates viral replication through interaction 31 with host cell proteins both during the assembly and entry phases of replication, using cytoskeletal proteins for intracellular transport, recruiting host cell budding machinery, and overcoming post-entry blocks to viral infection.

1.3.1 Transformation By Avian Retroviruses

The interaction of retroviruses with their animal hosts displays remarkable specificity despite the random nature of proviral integration, with viruses giving rise to specific tumors. Much of this target cell specificity is due to disregulation of oncogenes, thereby arresting a particular cell type at a specific stage of development. Transformation by retroviruses occurs by three mechanisms: transduction of an oncogene, insertional activation of a cellular proto-oncogene, and transactivation by an oncogene of the complex retroviruses such as HTLV-I (for a review, see (358).

The transforming gene of RSV responsible for the induction of sarcomas was identified by deletion strains that were hybridized to short cDNAs derived from RSV.

This allowed the definition of a probe against the viral src gene, which surprisingly could hybridize not only to the viral genome, but to the avian genome as well (318). Retroviral oncogenes were subsequently found to have been captured from host cell proto- oncogenes, with the nomenclature v-onc referring to the viral oncogene, and c-onc to its cellular counterpart; these were the origins of the study of the role of oncogenes in the development of cancer. Because a mutant of the src gene of RSV that was temperature sensitive for transformation in culture could be isolated, the function of the src gene could be defined as separable from viral replication (207,335). RSV is unique in being an 32 oncogenic virus that is replication competent; most transforming retroviruses are replication-defective, because the capture of the oncogene by recombination has replaced sequences necessary for viral replication.

Transduction of a viral oncogene is typically the fastest route to tumorigenesis as the oncogene is dominant-acting. RSV fibrosarcomas become very large within 7-10 days, and the birds succumb due to the mass of the tumor. The other avian sarcoma viruses and avian erythroblastosis viruses usually encode oncogenes, such as Yes, Erb,

Jun and Myc, as fusions with the Gag protein, and are therefore replication-defective

(48,50,85,213,353). Oncogene capture, however, is rare because the severity of the disease prevents the efficient spread of the virus.

Unlike transduction by oncogenes, infection by viruses that do not carry oncogenes, the avian leukosis viruses (ALVs), produces clonal tumors that arise after a long latent period. Insertion of the provirus can lead to aberrant expression of a nearby proto-oncogene, either through insertion of the viral promoter, which then drives oncogene expression, or by influence of the enhancer of the viral LTR to amplify expression of nearby sequences. Indeed, more than 80% of ALV induced bursal lymphomas alter c-myc expression by promoter insertion, using the promoter in the

3’LTR to drive Myc expression (128).

In addition to the sarcomas and leukemias induced by Avian leukosis and sarcoma viruses, these retroviruses induce cytopathic effect even in the absence of the oncogene

(364), often resulting in osteoporosis and wasting diseases that produce anemia and atrophy of the bursa and thymus that can be major causes of morbidity in domestic farm animals. The causation of these phenotypes is unknown, but appears to be independent of 33 viral LTR sequence, pathogenicity or viral titer (284,364), but may as yet reveal unidentified interactions of the virus with the host cell.

1.3.2 Endogenous Retroviruses And Host Cell Restriction

Any investigation into relationships of retroviruses with the host cell occurs against the backdrop of viruses already present within the cell, most notably for this discussion, the avian endogenous retroviruses. Endogenous viruses can influence the outcome of viral infection by producing a state of immune tolerance that delays clearance of the exogenous virus. These endogenous viruses can not only influence the outcome of infection, but can prevent infection entirely by a mechanism akin to receptor interference

(256). Expression of envelope genes on the cell surface ligates the cellular receptor thereby preventing subsequent infection by exogenous subgroup E viruses. Avian cells can be induced to release endogenous virus by irradiation or chemical carcinogenesis

(357,359); these viruses can provide helper functions to defective exogenous viruses. The released virus is termed RAV-0 (Rous-associated virus 0), and loci (termed ev genes) reside throughout the genome of the domestic fowl. Additional, more ancient viruses exist, termed EAV-0, E51, TERV, and ART-CH (29,30,75,235), although they contain substantial deletions within the viral genome.

In addition to the block to infection mediated by endogenous retroviruses, another host cell restriction identified for avian retroviruses is the inability to replicate in mammalian cells. While RSV is fully capable of infecting mammalian cells and establishing a provirus, viral expression of the unspliced RNA template as well as protein 34 expression, processing, and the consequent assembly of virions, is severely attenuated in mammalian cells (157,214,350). However, the ability to efficiently synthesize Gag proteins and produce viral particles can be rescued by overexpression of the Gag protein, revealing a threshold effect of RSV gene expression in mammalian cells (264). The formation of viral particles is further enhanced by the addition of either the Src membrane-binding domain or simply a myristate residue to the N-terminus of Gag (371).

A similar phenotype has been observed for HIV, for which the Gag protein aggregates within the cytoplasm and is incapable of assembly in murine cells until membrane- binding sequences within the MA region of MLV are substituted into the HIV virus

(51,276). These phenotypes suggest that both gene expression and membrane targeting of retroviruses require host cell specific factors, the absence of which can only be overcome by overexpression of Gag.

1.3.3 Host Cell Interactions Of The HIV Gag Polyprotein

Assembly of Gag proteins occurs efficiently in many cell types, including in the

E. coli cell and in vitro. Yet, many host cell blocks have been identified for HIV infection, including a block to replication in both simian and murine cells. These cell- type specific restrictions often reveal host cell factors that must be assumed or counteracted by the virus to accomplish the replication cycle. In the absence of binding partners identified for the RSV Gag protein, we will focus upon three identified interactions between the HIV Gag protein and the host cell that may represent common mechanisms for retroviral infection: the utilization of chaperone proteins to overcome 35 host cell restriction, involvement of the actin cytoskeleton, and recruitment of proteins from the ESCRT complex to the site of viral budding.

1.3.3.1 Host Cell Interactions Of The HIV Gag Polyprotein: Cyclophilin A

Cyclophilin A is a cellular chaperone protein incorporated into HIV virions at one-tenth the amount of Gag via interaction with the CA domain of the immature Gag protein (21,198). Treatment of cells with cyclosporin A to disrupt cyclophilin A binding produces a post-entry block to reverse transcription in human cells, termed Ref1 restriction (332). This block is present only in human cells as cyclosporin treatment does not decrease infectivity in simian cells, and cyclophilin is not incorporated into Simian immunodeficiency virus (SIV) particles (333). Indeed, substitution of a CA protein from a strain that can replicate in simian cells into HIV Gag proteins overcomes the block to infection as the substituted CA protein is insensitive to cyclosporin (173). The block to retroviral infection overcome by cyclophilin A binding occurs at a step prior to reverse transcription as restricted cells display a reduced level of intracellular viral DNA following infection (332). The HIV Gag protein has therefore assumed a cellular protein, incorporating it into the viral particle to overcome restriction factors present in human cells, and thereby facilitating subsequent entry of the virion into the next cell. 36 1.3.3.2 Host Cell Interactions Of The HIV Gag Polyprotein: Cytoskeleton

In addition to cyclophilin, HIV Gag also associates with cellular actin, and actin dynamics have been proposed to affect the localization of the HIV and MLV Gag proteins. Colchicine treatment of infected cells led to creation of membrane pseudopods and microvilli from which HIV virions were directionally released (257). In cells that are polarized by coculture with epithelial cells, viral particles are released at the site of cell- cell contact (25). Although in these experiments the overall release of viral particles is unaltered, several studies have demonstrated both increases and reductions in virion production by treatment of cells with drugs to depolymerize the cytoskeleton, with accumulation of particles within the cell (199,298). For example, stabilization of actin filaments by phallacidin led to a reduced release of Equine infectious anemia virus

(EIAV) particles, while depolymerization with cytochalasin D or latrunculin B led to an increase in virion production (52).

These conflicting requirements for the cytoskeleton would question its role in

Gag-mediated assembly if not supported by evidence that retroviral Gag proteins interact with actin when examined by fluorescent microscopy (52), cellular fractionation

(196,280,368) and co-immunoprecipitation (196). These interactions appear to be mediated by the NC domain of Gag which associates with actin both in the precursor and mature forms of Gag (196,368). In highly purified virions, actin can be found at 10-15% the level of Gag proteins, (245) and is located proximal to the NC protein at the center of the virion when detected by immunolabeling (69,368). It is interesting that much of the actin associated with viral particles is cleaved (245) because the HIV protease is capable 37 of cleaving cytoskeletal proteins (309) and inducing cytoskeletal rearrangement in cells

(135,199).

The ability of actin to modify the site of virus budding, the inverse relationship between virus budding and actin polymerization, and the cleavage of actin within viral particles and infected cells suggest a scenario in which Gag cleaves cytoskeletal components around the site of virus release to facilitate the dramatic membrane perturbations necessary for the formation and release of virus particles (175). Indeed, the requirement for a functional L domain from either EIAV, HIV or RSV to enhance particle release in the presence of cytochalasin lends great support to this hypothesis (52).

However, Gag may utilize the cytoskeleton for multiple steps of viral replication. Gag proteins from numerous retroviruses have also been shown to interact with the microtubule motor protein KIF-4, suggesting a role for the cytoskeleton in intracellular movement of Gag (165,324). Alternatively, the association of actin has been reported to have a role in nuclear dynamics of unspliced viral RNA (166) and translocation of incoming reverse transcription complexes to the nucleus (35). While the regulation of cytoskeletal proteins may certainly play a role in virus budding, the cytoskeleton may not simply be a barrier to escape of virions from cells, but may enable the virus to accomplish many steps in its intracellular transport.

1.3.3.3 Host Cell Interactions Of The HIV Gag Polyprotein: Endosomal Sorting Proteins

The most extensive investigation of Gag interactions centers on the retroviral late

(L) domains (for a review, see (102,267)). Late domains were identified as small peptide 38 motifs present within the p6 domain of HIV Gag and p2b domain of RSV Gag that, when disrupted, lead to a loss of efficient virus release due to a block late in the assembly pathway, sometimes seen as a tethering or clustering of virus particles at the cell surface

(118). The requirement for a late domain, however, is highly dependent upon the cell type and expression level (73,291,316); at high expression levels, particles can be formed from Gag proteins lacking the late domain motif altogether, and, in fact, containing nothing more than the viral MA protein ((355); L. Scheifele and L. Parent, unpublished results).

Late domains are unique assembly domains because the functional motifs are both positionally independent and functionally interchangeable; indeed the function of the p2b

L domain of RSV, which is located near the protein’s N-terminus, can be replaced by a

C-terminal chimera with the EIAV p9 protein containing that virus’s L domain (251).

This attribute was the first indication that L domains function as protein-protein interaction motifs. This suggestion was strengthened when it was demonstrated that the

RSV L domain could interact with the NEDD4 protein, via the WW domain of the

NEDD4 protein, a ubiquitin ligase (162,255).

The identification of a ubiquitin ligase that interacted with Gag brought renewed interest to the finding of ubiquitin in RSV particles (272). Research with HIV Gag further demonstrated that the HIV L domain interacted with TSG101, a protein that resembles the E2 ubiquitin conjugating enzymes (345). TSG101 is part of the ESCRT-I complex, responsible for sorting of ubiquitinated proteins into endosomes or multivesicular bodies

(156). The HIV and RSV Gag proteins may therefore utilize ubiquitination to access the endosomal sorting pathway via discrete adaptors; these pathways may converge, 39 however, as the AIP/ALIX proteins of the ESCRT machinery have recently been described to modulate the budding of several retroviruses (319,352).

The retroviral Gag proteins therefore appear to recruit a protein complex to accomplish the many processes required for the budding and membrane fission events common to endosomal sorting and retroviral particle assembly. While reports have suggested that HIV is capable of, and may prefer, to bud into late endosomes in monocyte-derived macrophages (258,306), it is more likely that for the preponderance of virus budding, which is clearly seen at the plasma membrane, Gag proteins recruit proteins from the endosomes to the plasma membrane (Figure 1.4). These findings cause us to revisit questions about Gag trafficking within the cell, namely whether Gag undergoes a previously unappreciated step of endosomal trafficking to begin to associate with endosome-specific factors. While release of Gag from the cell is not inhibited by drugs that target the secretory pathway, these findings cause us to revisit the mechanism of Gag membrane trafficking and the intermediate stages that the process of viral budding may necessitate.

1.4 SUBCELLULAR TRAFFICKING OF THE RSV GAG POLYPROTEIN

While numerous host cell proteins likely interact with the Gag protein, correlations between the interaction of Gag with host cell proteins and the localization of

Gag within the cell are just beginning to be described (258,306). A complete comprehension of viral replication requires understanding of the sequences within the

Gag protein that allow it to perform replication functions, of the cellular proteins 40 modulated by interaction with the Gag protein, and of the location within the cell where these interactions are occurring. We have therefore focused upon two well-described subcellular targeting events in retroviral replication, targeting to the plasma membrane, the site of viral assembly, and nuclear transport, a requisite step in retroviral replication as the genome is maintained in the nucleus at a site distinct from the assembly of viral particles in the cytoplasm. Our studies have allowed us to correlate signals within the

Gag polyprotein with the intracellular targeting of the Gag protein.

1.4.1 Membrane Binding Mechanisms For RSV Gag

Assembly of type-C retroviruses, including RSV, occurs at the plasma membrane of infected cells. Gag proteins bud selectively from the plasma membrane, bypassing intracellular membranes. The recent interest in membrane microdomains can guide our understanding of plasma membrane targeting specificity. Gag proteins appear not to select the plasma membrane per se, but rather a specific subdomain of the plasma membrane, termed membrane rafts, as the site for assembly of viral particles. This targeting is reflected in the lipid profile of the RSV particle (See 1.2.2 Virion

Organization), which more closely resembles the raft microenvironment than the plasma membrane as a whole. Fractionation of Gag complexes with detergent-resistant membranes and the inhibition of viral particle release after chemical stripping of cholesterol from the plasma membrane (242) lend further support to the hypothesis that

Gag pinpoints membrane subdomains. Analysis of the membrane-binding mechanisms of cellular proteins and of other Gag proteins that also target to raft domains may therefore 41 inform our understanding of the signals used by the RSV Gag protein to achieve plasma membrane specificity.

1.4.1.1 Membrane Binding Mechanisms Of Cellular Proteins

Lipid rafts contain numerous cellular signaling proteins, including integral membrane proteins (such as caveolins), GPI-linked proteins that reside on the cytoplasmic face of the membrane, scavenger receptors, cytoplasmic signaling proteins

(such as the Src family tyrosine kinases, H-Ras and G proteins), as well as transmembrane growth factor receptors (for a review, see (108). Because the sorting signals for transmembrane proteins appear to be encoded within the extracellular and transmembrane regions of the proteins (301,377), membrane targeting of peripheral membrane proteins, such as the Src family tyrosine kinases, is much more akin to the mechanism of retroviral membrane association.

Extrinsic membrane proteins often use acylation to accomplish membrane binding, most commonly N-terminal myristoylation. During translation, the initiator methionine is cleaved and the 14-carbon fatty acid myristate is added through an amide bond to a consensus glycine residue at position 2 (334,367). The myristate is thought to insert into the hydrophobic interior of the lipid bilayer, thereby tethering the myristoylated protein to membrane. Myristate is often not the sole modification, and these proteins can be modified by palmitoyl transferases that catalyze the reversible addition of palmitate at a cysteine residue downstream of the myristoylation site (278).

For example, the Gα subunit Gαz is myristoylated, yet this modification is not sufficient 42 for stable plasma membrane localization, leading instead to association of the myristoylated protein with intracellular membranes. Instead, the protein is stably tethered to the plasma membrane through palmitoylation, and through association with the βγ subunit (Figure 1.5)(221). The Gαz subunit does not transit to the plasma membrane

directly, but rather first samples intracellular membranes, arriving at the plasma

membrane approximately 30 minutes after synthesis (97). A similar phenotype is seen for

the protein tyrosine kinases Hck and Fyn, where myristylation is sufficient for

localization to intracellular membranes, but subsequent palmitoylation specifies

localization to detergent-resistant membranes (49,283,341,374). 43

β G + Kinase SH 3 +++++ G α KK G γ KKKK S SH 2 C

OCH3

P-Tyr

Figure 1.5: Membrane binding signals. The cellular proteins Gαz, Fyn, and K-Ras employ three distinct mechanisms of membrane binding. The Fyn protein (center), consisting of kinase, Src-homolgy 3 (SH3) and tyrosine phosphorylated (p-Tyr) Src-homology-2 (SH2) domains, utilizes myristoylation and palmitoylation (depicted as zigzag lines inserted into the gray membrane bilayer) at the N-terminus for stable membrane association. The G-protein Gαz (left) is tethered to the membrane by not only myristoylation and palmitoylation, but also by association with the Gβ and Gγ subunits. The K-Ras protein (right) employs both C-terminal farnesylation and a cluster of basic residues (plus signs) to anchor the protein at the plasma membrane. Figure adapted from (227,321,6). 44 This common mechanism has led to the “bilayer trapping” model, in which myristoylation is sufficient for transient membrane association, allowing myristoylated proteins to sample intracellular membranes. Palmitoyl-transferase enzymes exist at numerous cellular membranes; modification with palmitate, or another fatty acid “second signal”, traps the protein at the membrane at which it is palmitoylated. The first signal therefore provides weak membrane association while the second signal provides specificity of membrane association and stable membrane binding (170,216,279,341).

Variations on this bilayer trapping mechanism are seen with the Src, Ras and

SNAP-25 proteins. The Src proteins contain not only an N-terminal myristoylation signal, but also a polybasic motif that enhances membrane binding by interacting with acidic membrane phospholipids (228). The Ras proteins are farnesylated in the endoplasmic reticulum, modifying a C-terminal CAAX motif. Their second signal consists of either palmitoylation for N-Ras and H-Ras, or a polybasic motif for K-Ras

(Figure 1.5)(124). These modifications result in altered trafficking pathways, with H-Ras trafficking through the secretory pathway while K-Ras trafficking is insensitive to

Brefeldin A drug treatment (3). Once these proteins reach the plasma membrane, they also appear to localize in different subdomains, with only H-Ras having a preferential raft association (236,270). SNAP-25 uses both palmitoylation and a five amino acid sequence that lies between two alpha helices for membrane-binding specificity (116); this short motif is necessary for palmitoylation and consequent tight membrane binding.

What differs among these proteins, however, is the rate at which they are localized to the plasma membrane; Fyn localizes to membrane fractions within 5 minutes and to detergent-resistant membranes within 20 minutes, whereas and the Gαz subunit 45 and Src do not localize to membrane fractions until 20-60 minutes after synthesis

(97,341). These disparities can be mediated by additional, unidentified, signals or by protein-protein interactions at the membrane. For example, the Fyn protein is modified not only with myristate and palmitate, but also modified with palmitoleate, stearate, and oleate as well as by methylation (193). Association with proteins such as syntaxin and galectin-1 have been postulated to modulate the trafficking of SNAP-25 and Ras, respectively, both into and out of membrane subdomains (270,348).

1.4.1.2 Membrane Binding Of The HIV Gag Polyprotein

The HIV Gag protein has a similar mechanism of membrane-binding to the Src protein, utilizing N-terminal myristoylation and a cluster of basic residues.

Myristoylation is crucial for the formation of virus particles, and a single amino acid change of the myristoyl acceptor glycine drastically reduces the release of virus particles and abolishes viral infectivity (119). This mutant can, however, be rescued in trans by myristoylated Gags, thereby rescuing viral infectivity (34). The ability to rescue assembly-defective myristoylation mutants could be the result either of restoring Gag multimerization or of restoring localization to the proper membrane microdomain.

Myristoylated Gag proteins exist in solution as higher order multimers than their unmyristoylated counterparts (24) consistent with the hypothesis that myristoylated Gag proteins could enable nonmyristylated Gag proteins to associate stably with the plasma membrane through Gag multimerization. On the other hand, the unsaturated 14 carbon fatty acids act as competitive inhibitors of myristate and can redistribute Gag from 46 membrane rafts to detergent-sensitive plasma membrane domains (195); rescue by myristoylated Gag proteins could therefore also represent a shift in localization of unmyristoylated Gag proteins into membrane rafts, the site of viral budding.

As for cellular proteins, myristoylation is not sufficient for plasma membrane localization of Gag, but rather a region of basic amino acids between residues 14 and 31 stabilizes membrane interactions (384). This basic patch is believed to promote membrane binding by forming electrostatic interactions with the plasma membrane

(83,316). In the absence of these basic residues, the Gag protein is still capable of membrane association, but membrane-targeting specificity is lost, with viral particle assembly retargeted to internal membranes, identified as the Golgi and ER cisternae

(88,109,316,381). Many of these diverse constructs form immature and incompletely formed particles, yet mature viral proteins and intermediate budding structures can be seen as well.

Additional regions of MA have been implicated in altering the cellular location of budding, namely residues within the globular core of the MA domain (243). These residues are thought to influence the budding site indirectly, by altering the conformation of the exposed basic residues. This phenotype reinforces, however, that retroviral matrix domains exist in multiple conformations (See 1.4.1.3 Membrane Binding Mechanisms Of

Nonmyristoylated Gag Proteins) which allow tight membrane association of the Gag protein and a much weaker association of the proteolytically processed MA protein, thereby releasing MA from the membrane upon the initiation of infection. This hypothesis has been strengthened by biochemical evidence showing that lipid interactions strengthen Gag multimerization but weaken MA interactions (299) and by the sensitivity 47 of MA, but not Gag, to extraction from membranes in high pH or in 1M salt. This differential membrane association of Gag and MA is thought to be regulated by the conformation of the MA region, with an alpha helix controlling the exposure or sequestration of the N-terminal myristate, thereby finely regulating the strength of membrane association by HIV Gag (248,315,385).

1.4.1.3 Membrane Binding Mechanisms Of Nonmyristoylated Gag Proteins

Much of the flexibility of the HIV MA domain is facilitated by its structure. The five helices of the HIV MA protein are closely packed on top of each other, joined by flexible loops. In addition, two β-strands between the first two helices carry many of the basic residues necessary for plasma membrane targeting (208,210). The structures of many retroviral matrix proteins have now been solved both by NMR analysis of soluble matrix proteins and by X-ray crystallography, including those of the SIV (273), EIAV

(126), MLV (282), Bovine leukemia virus (BLV, (211)) and MPMV (57) matrix proteins.

Surprisingly, these proteins all have a conserved topology, with four or five alpha helices joined by flexible loops. These matrix proteins contain the myristate moiety in a position to be surface exposed, as well as either a basic cluster or a 3-dimensional patch of basic residues proximal to the myristate (for a review, see (58)). Similar mechanisms, therefore, seem to be at play for all retroviral matrix proteins, despite the lack of sequence homology, with membrane-binding information presented in the same way by the diversity of lentiviral and oncoviral matrix proteins. 48 Of the retroviruses, four matrix proteins are not modified with myristic acid:

EIAV, Human foamy virus, Visna-Maedi virus, and RSV. Understanding the mechanism of membrane-binding for these non-myristoylated membrane-binding domains therefore becomes much more complex. Fortunately, the structures have been determined for two of these retroviruses, EIAV and RSV. Remarkably, the non-myristoylated EIAV and

RSV proteins preserve the helical bundle conformation present in all other determined retroviral structures (126,217). The EIAV MA protein is capable of binding to negatively charged bilayers, but without a disruption in the membrane surface. As well, positive residues within the N-terminal alpha helix are protected from proteolysis upon membrane binding (271). The first helix is in fact amphipathic, and it has been suggested that the helix itself may insert into the phospholipid head groups of the membrane (126), functionally replacing the myristate moiety necessary for stable membrane association in a manner that still allows regulation of membrane association and disassociation by alterations in the structure of the membrane-binding domain.

1.4.1.4 Identification Of The RSV Membrane Binding Domain

Although the RSV membrane-binding domain is not myristoylated, myristoylation does not interfere with replication of the virus (87). Indeed, deletions within the RSV membrane-binding domain can be suppressed both in cis and in trans by the membrane-binding domains of Src or of HIV in a manner that is dependent on myristoylation (15,372). The ability of a heterologous plasma membrane binding domain to rescue Gag assembly is surprising because the RSV and MLV Gag proteins are 49 thought to be targeted to plasma membrane microdomains and are unable to be packaged together into virions unless the same membrane-binding domain is added onto both proteins (16). While it is possible that the non-myristoylated and myristoylated Gag proteins may be targeted to different membrane microdomains, the addition of myristate does not abrogate RSV infectivity, although it may alter the localization of Gag on the plasma membrane.

The minimal RSV membrane-binding domain was defined by deletion analysis and gain-of-function approaches. Deletion of the last 69 residues of the MA domain had no effect either on viral particle release or infectivity, suggesting that the functions required for membrane-binding all reside within the first 86 residues of Gag (232). These

86 residues are able to rescue a Src protein that lacks membrane binding activity, restoring the cellular transformation and anchorage-independent growth functions that are dependent upon prior membrane association (344).

Deletions within the first 86 residues of Gag, however, severely diminish particle release (232), so the membrane-binding domain of RSV Gag is much larger than that of

HIV Gag, which is only 31 residues in length. When analyzed by NMR spectroscopy, however, the structure of the RSV membrane-binding domain resembles the structures of the entire matrix domains of other retroviruses, with four overlapping alpha helices and a

310 helix surrounding a globular core (217). Within these 4 alpha helices, dispersed basic

residues are critical for membrane-binding as neutralization of the basic charge prevents

particle assembly. The position of basic residues, however, is variable as basic charges

introduced at novel positions support viral assembly (43). The RSV membrane-binding

domain seems to be unique among retroviruses because of its absence of N-terminal 50 myristoylation, its large size, and its lack of clustered basic residues. The mechanism of membrane targeting specificity for the RSV Gag protein may therefore be unique.

1.4.1.5 Characterization of RSV Membrane Binding Mutants

While deletions within the RSV membrane-binding domain can be rescued by the membrane-binding domains of Src or HIV, they can also be rescued in more subtle ways.

For example, introduction of both a foreign myristoylation signal and either single or multiple basic residues to Gag proteins containing deletions in MA can rescue and even enhance particle assembly. Despite the ability to rescue particle production, the released virions are not infectious (253). In fact, several mutants have now been identified that maintain or enhance plasma membrane targeting, yet produce particles that are noninfectious (Figure 1.6): (1.) Mutant Myr2.T14K.B1c (which contains myristate and an extra basic residue to rescue a membrane-binding domain deletion) produces particles at a level comparable to wild-type, yet contains decreased levels of viral RNA encapsidated into virions ((253), R. Garbitt and L. Parent, unpublished results), and the encapsidated

RNA is monomeric, rather than dimeric, in form (113); (2.) Mutants Myr1E (which contains the Src membrane-binding domain as an N-terminal extension of the wild-type

Gag protein) and E25K, E70K (which contains substitution of two acidic residues with basic residues) display enhanced virion release, with particles produced two to three times as fast as the wild-type Gag protein, but genomic viral RNA is packaged at levels only 10-25% of wild-type and is also monomeric in nature (44,252); (3.) Mutant HB12

(containing myristate and a cluster of basic residues) produces particles at wild-type 51 levels and is also capable of packaging wild-type levels of viral RNA, yet again, the encapsidated RNA is monomeric (113).

52

Particle assembly: Decreased RNA incorporation: Decreased RNA structure: Monomeric

Particle assembly: Increased RNA incorporation: Decreased RNA structure: Monomeric

Particle assembly: Increased RNA incorporation: Wild-type RNA structure: Monomeric

Figure 1.6: Phenotypes of RSV M domain mutants. Amino acid changes are indicated in yellow and are superimposed upon the solution structure of the RSV M domain (217). (A.) Mutant T14K.B1c utilizes a single basic residue (T14K, yellow) and myristate to overcome the deletion of residues 74- 99 (B1c), yet is unable to efficiently assemble particles or package vRNA. (B.) Mutants E25K, E70K and Myr1E (not shown) display enhanced plasma membrane association, but fail to incorporate the RNA genome. (C.) Mutant HB12 efficiently packages vRNA, yet still contains defects in the RNA secondary structure. 53 These viruses all release particles efficiently, yet display defects in RNA packaging and secondary structure. These defects suggest that there is a balance in the strength of Gag membrane affinity; increasing the membrane binding of Gag is deleterious to replication. Yet, it is unclear whether all of these viruses are manifesting different degrees of the same phenotype. Because RNA incorporation and dimerization ability varies among these mutants, understanding the subcellular locations through which these proteins travel may reveal both whether the mutant Gag proteins are all following the same trafficking pathway and also the reason why altering subcellular targeting disrupts viral RNA incorporation. We have therefore studied the subcellular targeting of one of these assembly-competent mutants, Myr2.T14K.B1c, to understand both where the MA deletion protein, B1c, localizes within the cell, as well as the mechanism by which myristylation and basic residues (Myr2.T14K) can rescue particle assembly, but not infectivity.

1.4.2 Nuclear Transport In Retroviral Replication

In addition to membrane-binding specificity, we have also investigated the connection between Gag localization and nuclear transport steps in the viral life cycle.

Retroviruses must access the nuclear compartment for at least two steps of viral replication: import of the genome into the nucleus for integration into the cellular chromatin to establish a stable provirus, and nuclear export of transcribed viral RNAs for translation into Gag and Gag-Pol proteins and for encapsidation into progeny virions.

Gag is the major structural component of viral particles, yet the coordination of Gag 54 trafficking and viral genome trafficking has not been investigated. Because Gag associates with viral RNA to package RNA into viral particles, and coats the encapsidated RNA within the virion, the association of Gag with viral RNA and cDNA during the steps of nuclear transport is a reasonable expectation.

1.4.2.1 Identified Nuclear Shuttling Proteins In HIV Replication

Unspliced RNAs are normally retained within the nucleus (112), as the process of splicing is a prerequisite for proper export of cellular RNAs. Splicing factors at the exon- exon junction complex (EJC) recruit the cellular mRNA export machinery (200,320).

This handing off of RNA from the splicing to the export machinery acts as a form of quality control, ensuring the proper processing of RNA before it is licensed for export into the cytoplasm (146). Unspliced retroviral RNA is therefore excluded from the RNA export pathway.

HIV overcomes this block by encoding an accessory protein termed Rev (or Rex for other lentiviruses). The Rev protein is made from a spliced RNA template early in the replication cycle. Rev then enters the nucleus, where it multimerizes on the unspliced

HIV template through recognition of a cis-acting sequence at the 3’ end of the genome termed the Rev-responsive element (RRE) (for reviews, see (137,265)). The Rev protein and the RRE sequence act as a transferable signal, capable of exporting RNAs that would normally be retained within the cell nucleus (39,96). While Rev may have a direct role to inhibit splicing of the viral RNA, its primary mechanism to enable translation of the unspliced mRNA is the diversion of the viral RNA into the Crm1 nuclear export pathway 55 (See 1.4.2.5 The Crm-1 Export Pathway). Rev directs the export of the RNA from the nucleus despite the lack of intron removal enabling both the translation of structural proteins and the encapsidation of genomic RNA into progeny virions.

In contrast to viral RNA export, which is directed by a single viral gene product, nuclear import of the viral cDNA is much more complex. Several of the mature viral proteins, including matrix (MA), Vpr, and integrase (IN) have karyophilic properties, either possessing identified nuclear localization signals (NLSs) or accumulating in the nucleus under steady-state conditions (26,79,307). Despite genetic evidence implicating these proteins in the early steps of infection, each of these proteins has been shown to be dispensable for the establishment of infection in both cycling and quiescent cells

(36,101,103,161,174,261,277). It therefore seems that HIV encodes numerous proteins capable of nuclear import, which function either in a redundant or cell-type specific manner, thereby ensuring a productive infection in diverse cell types (for reviews, see

(67,115)).

1.4.2.2 Nuclear Transport In RSV Replication

Although the simple retroviruses lack accessory proteins, they must accomplish the same tasks of genome export and import, and many of the same factors have been implicated in nuclear transport of these genomes. In simple retroviruses, the unspliced viral genome contains a constitutive transport element (CTE), which recruits trans-acting factors to promote its nuclear export. First mapped in the RNA of MPMV (31,323), additional CTEs have been mapped for Spleen necrosis virus (71), MLV (167), and 56 murine endogenous retroviruses (373). These elements seem to promote not only the export of viral RNA, but also its association with polysomes, thereby ensuring efficient translation (71,140). An RNA export element has also been mapped within the RSV genome, termed the direct repeat (DR) elements (See 1.2.6 Genome Organization And

Transcription). These DRs are sufficient to promote the export of an unspliced reporter construct independently of the expression of viral proteins (239,378). Remarkable among these CTEs is their diversity, with the HIV Rev, MPMV CTE, and RSV DR pathways all appearing to be independent and in some cases, cell-type specific (247,378). Although a cellular nuclear export protein, termed Tap, interacts with the CTE of MPMV, this does not seem to be the universal exporter for retroviral RNAs as the protein does not interact with the RSV DR elements (247). The factors involved in the nuclear export of the RSV genome must therefore be more clearly delineated.

Nuclear import of the RSV genome remains as mysterious as its export. Many of the same factors involved in HIV import have been implicated in RSV, including the IN protein, which localizes to the nucleus (180,181). The recent discovery that the MA protein of RSV also accumulates in the nucleus of transfected cells (113) prompted us to reexamine the roles of Gag-derived proteins in nuclear transport. Indeed, for MLV, mutations within the p12 protein, a cleavage product of Gag, lead to defects in the early stages of infection, at a step between the synthesis and nuclear import of double-stranded linear DNA (6,380). We have therefore examined both the MA portion of Gag as well as the full-length Gag polyprotein to determine (1) whether Gag-derived proteins were capable of nuclear transport, (2) to identify cellular partners participating in nuclear trafficking in RSV, (3) to understand whether Gag proteins could influence the nuclear 57 transport steps in RSV replication or (4) reveal previously unappreciated nuclear trafficking steps in the RSV life cycle.

1.4.2.3 The Nuclear Pore Complex

Proliferating mammalian cells possess 3-5,000 nuclear pore complexes (NPCs), a

125 MDa complex that mediates the selective transport of macromolecules into and out of the cell nucleus (Figure 1.7). The NPC is comprised of a 200 nm long aqueous channel connected to the nuclear envelope by a spoke-ring complex. Projecting from the nuclear and cytoplasmic sides of the pore are fibrils, which either extend freely into the cytoplasm or are constrained to form a nuclear basket tethered to the nuclear lamina. The entire complex maintains an eight-fold rotational symmetry. 58

Nup 214

Cytoplasmic fibrils Spoke ring complex 200 nm

Nuclear envelope

Central channel

Nup 98 Nuclear basket

Figure 1.7: The nuclear pore complex. The nuclear pore is comprised of a central channel (gray barrel) through which transport cargo is allowed access to the nucleus or cytoplasm through the nuclear envelope. The pore contains 8-fold rotational symmetry, and only one side of the pore is depicted. During import, initial contacts with the pore are made through the cytoplasmic fibrils (pink) that extend into the cytoplasm; Nup 214 (green) is a nuclear pore protein that is asymmetrically located in the pore and resides on the fibrils. The nuclear basket (purple) tethers the NPC to the nuclear lamina and serves as the terminal contact during protein import; it is within the basket that nucleoporin 98 (blue) resides. 59 Because the maximum diameter of the channel is 26 nm (92), cargos greater than

60 kD are restricted from free nuclear access. Much of this selectivity is maintained by the proteins that comprise the NPC, the nucleoporins, or Nups. The complement of nucleoporins present within the yeast and mammalian NPCs has recently been determined (64,289). Two-thirds of the nucleoporin proteins are conserved between yeast and mammalian cells, and surprisingly, mammalian cells display only a greater abundance and relative mass of nucleoporin proteins, not a greater diversity, as only 29 mammalian nucleoporins were identified. Many nucleoporins are characterized by the presence of 200-700 residue peptide repeats that end in the amino acids FG. These nucleoporins are most commonly located symmetrically on both sides of the pore, although some do show a bias toward a nuclear or cytoplasmic location. Indeed, some of these asymmetrically oriented nucleoporins are capable of exchange with soluble nucleoporins present either in the cytoplasm or nucleoplasm. While all NPCs are functionally and structurally identical and can mediate both import and export, distinct associations of nuclear pore proteins do exist, and may be the sub-complexes around which NPCs are re-formed following mitosis (121,339). Most importantly, these sub- complexes are functionally distinct, interacting with only certain transport cargos and receptors, and can therefore be targeted to disrupt specific nuclear transport pathways

(20,268).

Transport through the nuclear pore consist of a series of sequential binding events between nuclear pore proteins and cargo receptors (Figure 1.8; for reviews, see

(117,229)). Cargos containing a nuclear localization signal (NLS) are recognized in the cytoplasm by a soluble transport receptor termed an importin. Upon binding to the cargo, 60 the importin mediates interactions with the FG-repeat containing nucleoporins, thereby allowing translocation across the pore. An analogous process occurs for proteins in the nucleus containing nuclear export signals (NESs), except that the complex between the cargo and exportin is trimeric, also requiring the binding of RanGTP. 61

Ran-GDP Importin RanGEF GTP (RCC1) Cargo GDP

Exportin Ran-GTP Ran-GTP Cargo

Nucleus

Cytoplasm N p 14 up2

Ran-GTP

Cargo Ran-GDP Importin

G RanGAPAP NTF2 Cargo Exportin Ran-GDP

Figure 1.8: Nuclear transport. Directional transport through the NPC is maintained by a gradient of RanGTP (light yellow) between the two compartments. RanGDP (dark yellow) is imported into the nucleus by Nuclear transport factor 2 (NTF2; blue wedge) where it is converted to RanGTP by the Ran guanine-nucleotide exchange factor (RanGEF) protein RCC1. Export cargo (purple) complexes with RanGTP and the export receptor (green) in the nucleoplasm, after which the exportin mediates translocation of the complex across the NPC. Ran GTP hydrolysis to RanGDP by the RanGTPase-activating protein (RanGAP) dissociates the export complex. Import cargo (orange) is recognized by the import receptor (green) in the cytoplasm; following transport into the nucleus, the complex is dissociated by RanGTP.

62 Only one molecule of GTP is needed per transport cycle, and translocation across the pore itself is an energy-independent process for proteins of moderate size (201). The directionality of transport is maintained not by GTP hydrolysis, but by a gradient of

RanGTP and RanGDP across the nuclear envelope, with a nuclear to cytoplasmic

RanGTP ratio of 200-500 fold (149,313). This gradient is established by the specific localization of a RanGAP and its co-activator RanBP1 to the cytoplasm and cytoplasmic

NPC filaments (212) and of a RanGEF to the nucleus (241). The nuclear pool of RanGTP maintains directional transport by dissociating importin-cargo complexes. RanGTP remains associated with the import receptor, thereby being recycled with the receptor back into the cytoplasm, where it is hydrolyzed by the RanGAP to form RanGDP. The

RanGAP and RanBP1 proteins not only dissociate RanGTP from the import receptor, but also the complex of RanGTP, the export receptor and cargo, thereby ensuring the directionality of export from the nucleus. RanGDP accumulating in the cytoplasm is recycled to the nucleus through an import receptor termed Nuclear transport factor 2

(NTF2).

1.4.2.4 Nuclear Transport Signals

Proteins are recognized as cargo for nuclear transport when they carry a nuclear localization or nuclear export signal (for a review, see (203)). Nuclear localization signals were first identified in the nucleoplasmin and SV40 T antigen proteins (76,150) as the peptides PKKKRKV and KRPAATKKAGQAKKKKLD. Following these examples, numerous other NLS signals have been identified that are comprised of 1-2 stretches of 63 basic amino acids; these are termed classical NLSs. Additional non-classical NLSs have been identified that are either longer sequences, that are mediated by the tertiary structure of the protein, or that serve as overlapping import and export signals. The great diversity of these signals has not produced a second consensus motif for NLS function, and these non-classical NLSs can therefore only be identified through functional assays.

A classical nuclear export signal has also been described, and it is enriched for leucine residues. As with NLSs, the consensus motif (LxxxLxxLxL) does not accurately reflect the diversity of functional NESs. The position of the leucine residues is variable between NESs, and can contain 2-7 intervening residues (164). The residues themselves are also variable, and the hydrophobic amino acids methionine, isoleucine, valine, phenylalanine and tryptophan have all been demonstrated to support NES function. As with NLSs, inspection of a sequence for a putative NES is of limited utility; sequences that resemble authentic NESs may not be functional in nuclear export, while signals that do not resemble the consensus motif may be potent nuclear export signals. Identification of nuclear transport signals requires verification both by loss of function (disruption of critical basic or hydrophobic residues that leads to a loss of transport ability) as well as gain of function assays (the ability to confer transport to a heterologous substrate).

Not only is the primary sequence insufficient to predict export function, but it is also insufficient to predict the strength of NES activity. Indeed, the kinetics of export appear to be independent of the amino acid composition of the export signals (129,130), but rather reflect the affinity of the soluble export receptor for the NES sequence.

Although the sequences have different binding affinities for the receptor in vitro (129), the structure of the receptor in complex with an NES-containing substrate has not been 64 determined, so we are unable to draw conclusions about the NES-receptor interaction.

Strong NES signals can efficiently compete with weaker NES signals for transport through the nuclear pore, and both viral and cellular proteins can be found among the efficient and inefficient NES sequences.

1.4.2.5 The Crm-1 Export Pathway

There are several classes of nuclear transport receptors, including: (1) NTF2, the import receptor for RanGDP (See 1.4.2.3 The Nuclear Pore Complex); (2) Tap, the export receptor for the unspliced MPMV genome (See 1.4.2.2 Nuclear Transport In RSV

Replication) as well as for the bulk of mRNA export in the higher eukaryotic cell; and (3) importin-β, a superfamily of import and export receptors. Included within the importin-β superfamily is the import receptor for classical NLS signals (the importin-β protein itself) as well as the export receptor for classical NES signals (the Crm1 receptor) and about 20 structurally similar import and export receptors for which substrates are still being defined. Importin-β proteins are comprised of 10 HEAT repeats that are stacked to form a superhelical crescent structure. The exterior of the structure interacts with the FG- containing nucleoporins. The stacking of the HEAT repeats appears to be crucial for the ability of the protein to twist and adopt different conformations in the RanGTP-bound and unbound states, thereby regulating the binding to either an import or export cargo at the interior concave surface (188,346).

The classical pathway of nuclear import requires not only importin-β but also importin-α, which acts as an adaptor molecule to recognize the NLS on a cargo protein 65 and bridge the association of the cargo with importin-β. There are numerous importin-α proteins (for a review, see (145)) that are all capable of importing numerous cargos, yet they vary widely in their preference for import substrates (171,172). As well, certain import substrates appear to require a specific importin-α protein; import of the HIV vRNP complex into permeabilized nuclei requires importin-α7, and depletion of this protein by siRNA severely inhibits HIV infection (91).

In contrast to nuclear localization signals, leucine-rich nuclear export signals are recognized by the export receptor Crm1. Nuclear export signals were initially mapped in the protein kinase A inhibitor (PKI), the MAP kinase kinase protein, and the HIV Rev protein. The export receptor for these proteins was identified by searching for proteins whose sequence resembled those of importin-β family members. Crm1 was initially characterized as a nuclear shuttling protein that bound both a synthetic NES construct and

Ran (107,317). NES-containing substrates were later demonstrated to accumulate in the nucleus of cells containing mutations of the crm1 gene. The mechanism by which Crm1 exported RNAs remained unknown until the past few years when NES-containing adaptor proteins were identified; the PHAX and NMD3 proteins act as adaptor for U snRNA and rRNA, respectively (240,330).

Crucial to the identification of the Crm1 export receptor was the discovery that leptomycin B (LMB), a drug previously described to inhibit NES-mediated export, was capable of preventing the formation of a Crm1-NES complex (99). LMB, a fungal metabolite, acts to covalently modify cysteine-529 within the cargo-binding domain of the protein, preventing association of Crm1 with the NES. LMB has therefore been a 66 crucial tool in the study of Crm1-mediated export, as treatment of cells with nanomolar concentrations of LMB causes a rapid accumulation of Crm1-dependent cargo in the nucleus.

The efficient transport of NES-containing cargos requires at least two cofactors.

The RanBP3 protein helps overcome both the association of RanGTP with Crm1 in the nucleus in the absence of cargo and the low affinity of Crm1 for its export cargo (0.1-1.0

µM). RanBP3 binds to Crm1 and stabilizes its association with export cargo, possibly by altering the conformation of the Crm1 protein so that it favors NES association (86). In addition to binding RanGTP, cargo and RanBP3, Crm1 appears to interact with the

NXT1 protein. Addition of NXT1 to permeabilized cells reduces the amount of cargo protein present both within the nucleoli and at the cytoplasmic face of the NPC. NXT1 has therefore been postulated to have a role in the release of the trimeric complex from the nuclear pore, making it accessible to dissociation by the RanGAP protein further within the cytoplasm (19).

Crm1 was first identified with the aid of a viral NES sequence, that of the HIV

Rev protein (95). In the few intervening years, numerous viral proteins have been demonstrated to utilize the Crm1 export pathway for the export of both viral proteins and vRNPs. Some of these diverse viral cargos include the Vpr protein of HIV, the adenovirus E1B55kDa and E4orf6 proteins, the influenza virus vRNP, the Epstein-Barr virus Mta protein, the Minute virus of mice NS2 protein, and the Hepatitis B X protein.

While the Crm1 pathway is integral to the replication of many viruses, each virus appears to have co-opted the Crm1 protein to achieve different steps of replication. The retroviruses are not an exception, with at least three proteins of HIV (Rev, Vpr, and MA) 67 having been described to contain LMB-sensitive NESs. As all retroviruses must access the nucleus during at least two steps in the replication cycle, it seems likely that interaction with Crm1 will remain a conserved feature of retroviral replication.

1.5 OVERVIEW

Our studies sought to continue the mapping of signals within the Gag protein with a focus upon targeting of Gag within the cell. The only subcellular targeting domain identified within the Gag polyprotein was the membrane-binding domain within the N-terminal MA region. Although much functional data is available for the assembly determinants within Gag, little is known of the locations within the cell where they begin to exert their functions in assembly. As well, little is understood of the role of the proteolytically processed, mature proteins once they are released into the new cell.

Numerous studies have demonstrated that components of HIV Gag remain associated with the incoming genome, yet the function of any of these RSV proteins and their location within the newly infected cell remain undetermined.

We began our studies with investigation into the membrane-binding domain of

RSV. In chapter 2, we examined mutants of the membrane-binding domain that are unable to release viral particles and revealed that they were improperly targeted to intracellular membranes. These studies defined a novel helix within the membrane- binding domain that was necessary for membrane targeting specificity and revealed that targeting specificity and membrane binding were genetically separable. As well, these studies confirmed previous results that the MA protein of RSV accumulates within the 68 cell nucleus (113). To examine the discrepancy between MA nuclear targeting and Gag membrane targeting, we examined the localization of truncations of the RSV Gag polyprotein. In chapter 3, we report the discovery of a Crm1-dependent nuclear export signal within the p10 domain of the Gag polyprotein. These results profoundly alter our understanding of Gag-mediated assembly as nuclear targeting of Gag is an unexpected step in retroviral replication that may be correlated with the movement of the genome both into and out of the cell nucleus. The discovery of a novel targeting domain led us to more finely map the export signal of Gag, and in Chapter 4, four hydrophobic amino acids within Gag are identified that are crucial for NES function and that are functionally conserved across a range of avian retroviruses. To fully understand the interaction of Gag with the host cell during nuclear transport, we utilized the genetic system of the budding yeast to examine host factors that mediate Gag targeting in chapter 5. Unexpectedly, we find that the RSV Gag protein is inefficiently expressed in yeast and appears not to be restricted to the nucleus by inhibition of the Crm1 receptor. Finally, we wished to correlate the trafficking of Gag through the nucleus with a either a previously defined or novel function of Gag in viral replication. We therefore studied the replication of Gag mutants that were impaired for nuclear export in Chapter 6. These mutants of the p10 domain displayed striking defects in viral particle morphology, yet were capable of performing the early steps of infection. Despite completing DNA synthesis, these viruses are noninfectious, revealing an unexpected role for the p10 domain of Gag in the establishment of a persistent infection. Although other researchers have used fluorescence microscopy to confirm the proper membrane targeting of Gag mutants, the results presented here represent a comprehensive study of the subcellular trafficking 69 signals present within the RSV Gag protein by mutational analysis and fluorescence confocal microscopy. In addition, they define a novel step in the replication of the Rous sarcoma virus and provide a strong correlation between the subcellular targeting of Gag and the replication of the virus.

CHAPTER 2

SPECIFICITY OF PLASMA MEMBRANE TARGETING BY THE ROUS SARCOMA VIRUS GAG POLYPROTEIN

Scheifele LZ, Rhoads JR, Parent LJ. J Virol. 2003 Jan; 77 (1): 470-80.

Copyright 2003 American Society for Microbiology 71 2.1 ABSTRACT

Budding of C-type retroviruses begins when the viral Gag polyprotein is directed to the plasma membrane by an N-terminal membrane-binding (M) domain. While dispersed basic amino acids within the M domain are critical for stable membrane association and consequent particle assembly, additional residues or motifs may be required for specific plasma membrane targeting and binding. We have identified an assembly-defective Rous sarcoma virus (RSV) Gag mutant that retains significant membrane affinity despite having a deletion of the fourth alpha helix of the M domain.

Examination of the mutant protein’s subcellular distribution revealed that it was not localized to the plasma membrane, but instead was mistargeted to intracytoplasmic membranes nonspecifically. Efficient plasma membrane targeting was restored by the addition of myristate plus a single basic residue, by multiple basic residues, or by the heterologous hydrophobic membrane-binding domain from the cellular Fyn protein.

These results suggest that the fourth alpha helix of the RSV M domain promotes specific

targeting of Gag to the plasma membrane, either through a direct interaction with plasma

membrane phospholipids or a membrane-associated cellular factor, or by maintaining the

conformation of Gag to expose specific plasma membrane targeting sequences.

2.2 INTRODUCTION

Retroviruses acquire their lipid envelopes from specific locations along the

cytoplasmic face of the plasma membrane. This partitioning is reflected in the 72 biochemical composition of retroviral envelopes, which is distinct from the overall lipid profile of the host cell membrane (1,260). Specific targeting to the site of budding is directed by the retroviral Gag polyprotein. For Rous sarcoma virus (RSV), Gag is synthesized on free ribosomes and then imported into the nucleus (300). Following active nuclear export, Gag proteins begin to self-associate in the cytoplasm via C-terminal interaction (I) domains to form multimeric assembly intermediates consisting of Gag proteins bound to genomic viral RNA. This ribonucleoprotein complex is subsequently targeted to the inner leaflet of the plasma membrane by the N-terminal membrane- binding (M) domain of Gag. As assembly complexes accumulate under the membrane, they form ordered structures that distort the cell membrane, culminating in the formation of a spherical bud. The late (L) domain of Gag recruits host cell machinery to facilitate the final membrane fusion event, which releases the immature particle from the cell surface. Upon budding, the RSV Gag polyprotein is cleaved by the viral protease (PR), resulting in formation of the mature MA, p2a, p2b, p10, CA, NC and PR proteins (Figure

2.1).

Retroviral morphogenesis follows one of several distinct pathways, characterized by the location of detectable viral capsid structures within the cell [reviewed in (322)].

For viruses that follow the type-C pathway, such as RSV, human immunodeficiency virus

(HIV), and murine leukemia virus (MLV), particles assemble at the plasma membrane.

Assembly intermediates may be detected within the cytoplasm of infected cells using biochemical methods, but visualization of viral core structures by electron microscopy does not occur until after plasma membrane association (125,191,322,336). In contrast, type-B and type-D retroviruses assemble viral cores within the cytoplasm, which are 73 subsequently targeted to the plasma membrane for budding. A third pathway is followed by defective endogenous retroviruses, which form intracytoplasmic A-type particles

(IAPs) that are released into the endoplasmic reticulum (ER). The determinants for each morphogenic pathway reside within the Gag protein, as particle assembly can be redirected from one pathway to another by altering the amino acid sequence of the MA domain (82,88,109,281,363).

The information utilized by Gag proteins for specific membrane binding is contained within a discrete region of MA termed the M domain (63,322,344,384). While little is known about how M domain sequences govern specific membrane-targeting, the sequences required for membrane-binding have been established for many Gag proteins.

For HIV, stable membrane association is accomplished by cotranslational myristoylation of Gag (34,119,303) in concert with a patch of basic residues between amino acids 15 and 31 that form electrostatic interactions with acidic phospholipids enriched at the cytoplasmic face of the plasma membrane (253,384). The biophysical basis of membrane binding for nonmyristoylated Gag proteins, such as those of RSV and Equine infectious anemia virus (EIAV), is less obvious. Indeed, the M domain of RSV is much larger than that of HIV, comprising the first 87 amino acids of Gag (232,344). Yet both the RSV M domain and the EIAV MA protein retain the conserved topology of retroviral matrix proteins, being comprised of four overlapping alpha helices packed around a central hydrophobic core (126,217). The RSV MA protein may exploit this three-dimensional conformation to bring together basic residues; this basic region may serve an analogous function in stabilizing interactions with the membrane phospholipids as the cluster of basic residues in HIV. Indeed, genetic evidence from RSV Gag and biochemical analysis 74 of EIAV MA suggest that basic residues contribute to electrostatic interactions crucial to membrane association and viral assembly (43,253,271). However, it is possible that additional membrane-binding signals that do not rely on electrostatic interactions exist within non-myristoylated Gag proteins. Evidence from studies of the EIAV MA protein support this idea, as EIAV MA binds equally well to electrically neutral bilayers as it does to negatively charged bilayers (271).

The microenvironment of the particular membrane targeted for particle assembly may be as important for budding as are the signals within Gag, since there are specialized regions of the membrane that promote efficient particle release. This has been seen by the localization of Gag proteins at discrete, punctate regions of the plasma membrane by confocal microscopy (132) and by electron microscopic images of clusters of virions that appear to have been released from fixed positions on the membrane (254). Moreover, several investigators have implicated lipid “rafts”, microdomains of the plasma membrane enriched in cholesterol and sphingolipids, as sites of retrovirus particle assembly (194,234,242).

Because the mechanism underlying the targeting of type C retroviruses to specific plasma membrane sites for budding remains elusive, we have undertaken the study of

RSV Gag mutants to identify regions of the M domain that are involved in specific membrane targeting. In the present study, we investigated whether mutants known to be impaired for particle assembly had defects in membrane association or specific membrane localization. We found that deletion of the fourth alpha helix of the RSV M domain resulted in redirection of particle assembly to intracellular membranes and budding through the endoplasmic reticulum via the secretory pathway. Specific plasma 75 membrane targeting was restored by the addition of myristate and basic residues or by the substitution of the heterologous membrane-binding domain from the cellular Fyn protein.

Together these results suggest that membrane-binding and membrane-targeting are genetically separable and that the fourth alpha helix of the M domain is needed for specific plasma membrane targeting of assembling RSV particles.

2.3 MATERIALS AND METHODS

Plasmid construction. Plasmids pMA.GFP (113), pGag.GFP (43), pT10C.GFP

(∆ L domain) (254), pMyr0.BgBs.GFP (∆ I domain) (300) pSV.T14K.B1c (253), pSV.Myr0 (360), and pSV.SPG.D37S (177) were previously described. Plasmids pMyr2.B1c.MA.GFP, pMyr2.HB12.MA.GFP and pMyr2.T14K.B1c.MA.GFP were created by digesting PCR products derived from PARE89 and USP19.263 (113) with

Asp718, treating with Klenow, digesting with SstI and exchanging similarly prepared fragments from pEGFP.N2 (Clontech)

The Fyn sequence was introduced into RSV Gag by using M13 oligonucleotide- directed mutagenesis (182) with primer PARE35 (5’-

GATCAAGCATGGGATGCGTCCAATGCAAGGATAAGGAGGGCCCTAAAACCT

ATTGCGGG), which introduces a diagnostic ApaI site. The Fyn sequence was transferred into the pSV.Myr0 plasmid between SstI and XhoI sites. The B1c deletion was incorporated into pSV.Fyn through exchange of an SstII fragment from pSV.Myr2.B1c

(253). Fyn.myr– and Fyn.palm– derivatives were created by PCR using primers

USP19.263 and PARE48 (5’- 76 CTCCTTATCCTTGCATTGGACGCATGCCATGCTTGATCCA) or PARE49 (5’-

CTCCTTATCCTTGGCTTGGACGGCTCCCATGCTTGATCCA), respectively, introducing SstI and SpeI sites for introduction into the pSV.Gag vector (176). All mutants of the RSV M domain were introduced into pMA.GFP and pGag.GFP by SstI-

BspEI fragment exchange (253). The mutations were confirmed by automated dideoxy sequencing.

Cells, transfections and confocal microscopy. The chemically transformed quail fibroblast cell line (QT6) was maintained as previously described (62,224). Cells were transfected with 1 µg plasmid DNA by the calcium phosphate method and 18 hours post- transfection confocal microscopy was performed as described (113). Cells treated with leptomycin B (LMB) were incubated with a 10 ng/ml (18nM) concentration of the drug for 2 hours prior to observation. Indirect immunofluorescence was performed as described (300) using monoclonal antibodies against β-COP and the Golgi 58K protein

(Sigma), polyclonal antibody against the carboxy terminus of calnexin (Stressgen

Biotechnologies, Victoria BC) and secondary antibodies conjugated to Cy3 (Sigma).

Radioimmunoprecipitation assay. QT6 cells were transfected by the calcium phosphate method. 18 hours after tranfection, cells were lysed, immunoprecipitated, and the budding percentage was calculated by PhosphorImager analysis (Molecular

Dynamics) as described (300,360) COS-1 cells were transfected by the DEAE-dextran

/chloroquine method as previously described (372). 48 hour after transfection, cells were treated with either 0.5 µg/ml Brefeldin A (BFA, Fluka) or with the solvent methanol for 1 hour, after which cells were labeled for 2.5 hours with L-[35S]-methionine (>1000

Ci/mmol; NEN Life Science Products) in the continued presence of BFA. Cell lysis and 77 immunoprecipitation was performed as previously described (360) and analyzed by SDS-

PAGE analysis and autoradiography. A budding ratio for both treated and untreated samples was calculated as the amount of p27CA present in the culture media following 2.5

hour labeling period divided by the amount of Pr76Gag in the cell lysates of a 15 minute

labeling. Budding efficiency in the presence of BFA was then calculated as the fraction

of the budding ratio in the presence and absence of the drug.

Membrane Fractionation. Subcellular fractionation and membrane pelleting was

performed according to published methods (297). Briefly, 16-18 hours post transfection

2.5 x106 QT6 cells transfected with 15 µg of plasmid DNA were washed twice and rinsed from the culture plate in ice-cold NTE (100 mM NaCl, 10 mM Tris [pH 7.5], 1 mM

EDTA). Cells were pelleted at 500 x g, resuspended in 1 ml cold hypotonic lysis buffer

(10 mM Tris [pH 7.5], 1 mM MgCl2, 1 µg/ml leupeptin, 1 µg/ml pepstatin, 100 µg/ml

PMSF) and allowed to swell on ice for 15 minutes. Cells were lysed with 15-20 strokes of a Dounce homogenizer and cell disruption was monitored by trypan blue exclusion until approximately 90% of cells were disrupted. Lysates were adjusted to 150 mM NaCl and nuclei were pelleted at 1000 x g. Membranes were pelleted from post-nuclear supernatants by centrifugation at 100,000 x g and membrane pellets were vigorously vortexed in NTE with 0.5% Triton X-100. Clarified supernatants were adjusted to 0.5%

Triton. Each fraction was analyzed by fluorometry in an Aminco-Bowman Series 2 spectrophotometer with excitation maxima at 456 nm and emission at 508 nm. Membrane association was calculated as the fraction of total fluorescence intensity present in the pelleted fraction [P/(P+S)]. Statistical significance was determined by using the

Student’s t-test. 78 Electron microscopy. QT6 cells were transfected with 15 µg of plasmid DNA in

60-mm Permanox dishes (EM Sciences). The localization patterns of Gag.GFP and its derivatives were verified by fluorescence microscopy, and cells were washed and fixed as previously described (43). Cells were postfixed in 1% osmium tetroxide/1.5% potassium ferrocyanide overnight at 4ºC, washed in 0.1M sodium cacodylate and serially dehydrated in ethanol. Monolayers were embedded in Epon 812, thin sectioned, stained with uranyl acetate and lead citrate and viewed with a Phillips 400 electron microscope.

2.4 RESULTS

We previously characterized an assembly defective mutant of the RSV Gag protein which has a deletion of the fourth alpha helix of the M domain (Myr0.B1c,

Figure 2.1); (253,372). Particle assembly for this mutant can be rescued by the addition of myristic acid plus a cluster of basic residues inserted within the M domain (253) or by the well-characterized membrane-binding domains from the pp60 v-src [Src] oncoprotein

(372) or the HIV-1 Gag M domain (385). To gain insight into the mechanism of membrane-binding for RSV Gag, we tested whether particle assembly could be rescued by addition of a membrane-binding domain that relies solely on hydrophobic interactions

(such as the cellular Fyn protein) rather than the bipartite signal consisting of hydrophobic and electrostatic interactions (i.e., Src and HIV-1 Gag). As well, to determine whether RSV M domain mutants lacking the fourth alpha helical region were defective in membrane binding or whether specific membrane targeting was disrupted, the ability of M domain mutants to associate with membranes in vivo was tested. 79

gag Pr76 MAP10 CA NC PR

WT (Myr0) MEAVIKVISSACKTYCGKTS---- Myr2 Myr2.T14K G------K------G------KKKYKLK------GCVQCDKDKEGGP------ACVQCDKDKEGGP------ASVQSDKDKEGGP------B1c

∆74-98

Figure 2.1: Mutants of the RSV M domain. The arrangement of the cleavage products produced from the wild-type (Myr0) Gag protein is depicted at top. The E2G substitution, termed Myr2, allows cotranslational addition of myristic acid (depicted as a long zigzag line) to the N-terminus of Gag. Mutations Myr2.T14K and Myr2.HB12 insert basic residues from the M domain of HIV either individually or within a cluster in the context of the myristoylated N-terminus. The Fyn substitution replaces the first 10 amino acids of the RSV M domain with that of Fyn; a G2A change within this sequence, termed Fyn.myr–, prevents both the myristoylation of Fyn at position 2 and the reversible palmitoylation at positions 3 and 6 (depicted as a short zigzag line). The Fyn.palm– mutation substitutes alanine for cysteines that are the sites of Fyn palmitoylation. The deletion B1c removes the fourth alpha helix of the M domain between residues 74 and 98.

80 Particle assembly of M domain mutants. In an attempt to separate nonspecific membrane association from specific plasma membrane localization, wild-type and mutant

Gag proteins were fused in frame to the reporter green fluorescent protein (GFP) and tested for particle assembly and in vivo membrane-binding (Figure 2.2, 2.3). To assess the efficiency of budding, Gag proteins were expressed in QT6 cells and the amount of

Gag protein released into the medium during a 2.5-hour labeling period was compared to the level of intracellular Gag proteins, as detected by immunoprecipitation (Figure 2.2).

Addition of myristate alone (Myr2.Gag), myristate plus a single basic residue substitution

(Myr2.T14K.Gag), or myristate plus a cluster of basic residues (Myr2.HB12.Gag) did not significantly alter particle assembly, as expected. In addition, a Gag protein containing a substitution of the RSV M domain with 10 amino acids from the cellular Fyn protein was capable of producing virus-like particles (Fyn.Gag). The Fyn membrane-binding domain is myristoylated at the pentultimate glycine residue and reversibly palmitoylated on cysteines at positions 3 and 6. For the Fyn protein, specific association with caveolae, microdomains of the plasma membrane involved in signal transduction and regulation of lipid metabolism, depends on both myristate and palmitate modifications (216,278,374).

Thus, hydrophobic membrane interactions provided by the Fyn sequence can substitute for the RSV M domain to mediate plasma membrane targeting and particle release. 81

150

100

50

0

g g g g g g g g g g a a a a a a a a a G a . G G G G G G G G G 0 ...... r 2 K 2 n c c c c c y r 4 1 y 1 1 1 1 1 y F M 1 B .B .B .B .B .B M .T H 0 2 K 2 n . r r y 2 2 y y 4 1 r r 1 B F y y M M .T H M M . 2 2 r r y y M M

Figure 2.2: Particle assembly and membrane association of the wild-type and mutant Gag.GFP and MA.GFP fusion proteins. To determine the ability of each Gag derivative to assemble virus-like particles, QT6 cells transfected with indicated Gag.GFP derivatives were labeled for 2.5 hours with 35[S]-methionine, lysed and immunoprecipitated with polyclonal serum against RSV. The relative budding percentage represents the amount of the mutant Gag.GFP fusion protein present in the culture medium compared to the total immunoprecipitated protein in the medium and cell lysates when normalized to Gag.GFP. 82 Disruption of the RSV M domain by deleting the fourth alpha helical region, known as B1c, severely impaired particle production for the Myr0.B1c.Gag.GFP fusion protein (Figure 2.2). Addition of myristate or myristate plus a single lysine substitution did not restore efficient budding (Myr2.B1c and Myr2.T14K.B1c, respectively) in QT6 cells, although there was a mild improvement in particle release. In contrast, we had previously found that Myr2.T14K.B1c was capable of more efficient particle release in

COS-1 cells, reflecting either a cell-type specific factor affecting budding or a difference in intracellular protein levels, which are markedly increased in the COS-1 overexpression system (253). However, adding myristate and a cluster of basic residues derived from the

HIV-1 M domain (Myr2.HB12. B1c) restored budding in QT6 cells as well as in COS cells (253). The membrane-binding domain of Fyn (Fyn.B1c) also suppresses the effects of the B1c deletion, returning particle assembly to levels approaching wild-type assembly efficiency (Figure 2.2).

Membrane Binding of M domain Mutants. We previously presumed that deletion of the B1c sequence from the M domain abolished membrane binding for Gag, and that addition of myristate plus basic residues would promote hydrophobic and electrostatic interactions, thereby recreating a functional membrane-binding domain. To test this idea directly, we analyzed membrane association for wild-type Gag.GFP and derivatives of Gag.GFP in QT6 cells using subcellular fractionation followed by membrane pelleting. Membrane bound and soluble GFP proteins were detected by fluorometry, as shown in Figure 2.3, and normalized to the level of membrane association of wild-type Gag.GFP (Myr0.Gag). As controls, we utilized GFP alone (soluble), a C- terminal deletion of Gag that deletes I domains important for cooperative, stable binding 83 of Gag proteins to the plasma membrane (soluble) and an L domain mutant of Gag that associates efficiently with membrane (membrane-bound). Addition of myristate alone modestly increased membrane association (Myr2.Gag), as did myristate plus basic residues (Myr2.T14K and Myr2.HB12.Gag) and the independent membrane-binding domain of Fyn (Fyn.Gag). Because we had attributed the assembly defect of unmodified

Gag proteins bearing the B1c deletion to a decrease in membrane affinity, we predicted that the membrane association of B1c deletion proteins would parallel the budding efficiency profiles established in Figure 2.2. To our surprise, the Myr0.B1c.Gag,

Myr2.B1c.Gag and Myr2.T14K.B1c.Gag proteins (Figure 2.3) retained significant membrane affinity despite severe defects in particle production. Addition of myristate and a cluster of basic residues (Myr2.HB12.B1c.Gag) or the membrane-binding domain of Fyn (Fyn.B1c.Gag) fully suppressed the mild decrease in membrane affinity associated with the B1c deletion.

84

2.0

1.5

1.0

0.5

0.0

P in g g g g g g g g g g F a a a a a a a a a a a G m .G .G .G .G .G .G .G .G .G .G o 0 2 2 n c c c c c r r K d 4 1 y 1 1 1 1 1 I y y F 1 B .B .B .B .B .B ∆ M M .T H 0 2 K 2 n . r r y 2 2 y y 4 1 r r 1 B F y y M M .T H M M . 2 2 r r y y M M 2.0

1.5

1.0

0.5

0.0

A A A A A A A A A A M .M .M .M .M .M .M .M .M .M 2 K 2 n c c c c c r y 1 1 1 1 1 y 4 1 1 B F B B B B B M ...... T H 0 2 K 2 n . r r y 2 2 y y 4 1 r r 1 B F y y M M .T H M M . 2 2 r r y y M M Figure 2.3: (Top) Membrane association of wild-type and mutant Gag.GFP proteins. Transfected QT6 cells were fractionated by hypotonic lysis and membranes were pelleted by differential centrifugation. Membrane association was determined by quantification of the amount of fluorescence present in the membrane (P100) fraction divided by the amount present in both the membrane and soluble fractions (P100+S100). (Bottom) Membrane association of wild-type and mutant MA.GFP proteins. Membrane association was determined as in panel B. Black bars represent samples that were pretreated with 0.5% Triton X-100 prior to membrane pelleting. Error bars represent the standard deviation of more than three independent experiments.

85 To isolate membrane association due to the M domain from membrane-stabilizing effects contributed by the I domain, we examined the ability of each mutant to promote membrane association in the context of the mature MA protein (Figure 2.3, bottom).

Membrane association in Figure 2.3 was normalized to that of wild-type Gag (Myr0.Gag) shown in Figure 2.3 and is displayed by cross-hatched bars. The MA.GFP fusion protein is highly soluble when compared to full-length Gag because it lacks downstream sequences that provide cooperative interactions that promote membrane-binding; therefore its membrane affinity parallels that of the I domain mutant shown in Figure 2.3

(360). In the context of MA, the addition of myristate (Myr2.MA) or myristate plus basic residues, either singly or in a cluster (Myr2.T14K.MA and Myr2.HB12.MA) substantially increases membrane binding (p=0.01, p=0.05 and p<0.0001, respectively).

Strikingly, substitution of the membrane-binding domain of Fyn for the RSV M domain in MA increases membrane affinity beyond the myristate and basic residue substitutions

(p<0.0001), achieving the level obtained for Fyn.Gag. Thus, the strong hydrophobic interactions provided by the Fyn domain surpass the contribution of downstream I domains within Gag to promote very stable membrane association of the MA protein.

To ensure that the increase in the amount of viral protein in the pelleted fraction is the result of membrane association and is not simply due to formation of large pelletable protein complexes, cell lysates were treated with Triton X-100 prior to membrane pelleting, as indicated by the solid black bars in Figure 2.3. In each case, there was a dramatic reduction in the amount of viral protein pelleted after detergent treatment, confirming that pelleted protein is stably bound to membranes. 86 Subcellular Localization of M domain Mutants. The degree of membrane association retained by Gag proteins in the presence of the B1c deletion was unexpected, given that this deletion severely impairs particle production (compare Figure 2.2 and 2.3 for Myr0.B1c, Myr2.B1c, and Myr2.T14K.B1c). This discrepancy suggested that the block to budding was not accounted for by a simple defect in global membrane affinity, but instead might reflect targeting to a membrane population that could properly support particle assembly. The membrane-pelleting assay does not provide information about the site on the membrane at which Gag is accumulating, nor does it verify that Gag is associating with the plasma membrane rather than with intracellular membranes. We therefore took advantage of the GFP marker on our fusion proteins to examine the intracellular distribution of wild-type and mutant Gag and MA proteins by confocal microscopy (Figure 2.4). As expected, the wild-type Gag protein localizes to the cell cytoplasm and to punctate stretches along the plasma membrane (43,300). Introduction of myristate (Myr2.Gag), plus a single basic residue (Myr2.T14K.Gag) or multiple basic residues (Myr2.HB12.Gag) does not alter the plasma membrane localization of Gag. The wild-type MA protein, on the other hand, is present throughout the cell with accumulation within the nucleus of transfected cells [Figure 2.4A, (113,300)].

Introduction of myristate alone (Myr2.MA) slightly reduces the amount of MA in the nucleus while myristate in combination with a single basic residue (Myr2.T14K.MA) can slightly enhance nuclear localization. More dramatic is the recruitment of MA to extended patches along the plasma membrane mediated by the addition of myristate and a charged patch of basic residues (Myr2.HB12.MA). 87

A. Gag Gag Gag Myr2.Gag Myr2.T14K. Myr2.HB12. MA MA MA Myr2.MA Myr2.T14K. Myr2.HB12. B. Gag Gag B1c.Gag B1c.Gag Myr0.B1c. Myr2.B1c. Myr2.T14K. Myr2.HB12. MA MA B1c.MA B1c.MA Myr0.B1c. Myr2.B1c. Myr2.T14K. Myr2.HB12.

Figure 2.4: Subcellular localization of Gag and MA mutant proteins. QT6 cells transfected with full-length (A) and B1c deletion (B) GFP fusion proteins were examined by confocal microscopy 16-20 hours post-transfection as indicated. Representative images are shown for each construct.

88 Examination of the localization of B1c-deleted proteins confirmed the results of the membrane-pelleting assay; these proteins remained associated with cellular membranes, but were mistargeted within the cell, accumulating at intracellular membranes (Figure 2.4B). The Myr0.B1c.Gag protein adopted a reticulated pattern within the cell that excluded both the nucleus and the plasma membrane. Addition of myristate (Myr2.B1c.Gag) conferred a more regular pattern of association with intracellular membranes. While both the Myr2.T14K.B1c.Gag and the

Myr2.HB12.B1c.Gag proteins retained an accumulation at intracellular membranes, the addition of basic residues was able to rescue a portion of the protein to the plasma membrane at extended patches. The targeting of a subpopulation of the

Myr2.HB12.B1c.Gag protein to the plasma membrane is consistent with the ability of this construct to efficiently form virus-like particles (Figure 2.2). However, the discrepancy between the partial restoration of the Myr2.T14K.B1c.Gag protein to plasma membrane localization and the failure of this construct to efficiently release extracellular particles in QT6 cells (Figure 2.2) suggests that the addition of a single basic residue does not promote sufficient plasma membrane association to drive budding in QT6 cells.

The B1c deletion not only mislocalized the Gag protein to intracellular membranes, but also resulted in redistribution of the previously soluble MA protein to intracellular membranes (Figure 2.4B). The relocalization of MA.B1c is preserved following the addition of myristate either alone (Myr2.B1c.MA) or in combination with a single basic residue (Myr2.T14K.B1c.MA). Addition of myristate plus multiple basic residues (Myr2.HB12.B1c.MA) restored the association of the mutant protein with the plasma membrane. The localization of B1c-deleted proteins with intracellular membranes 89 suggests either that the deletion creates a new membrane-binding domain specific for intracellular membranes or that the deletion impairs the ability of Gag to properly select the plasma membrane. Because the contributions of single or clustered basic residues to membrane-binding are subtle but their effects on subcellular distribution are dramatic, this suggests that the re-establishment of plasma membrane targeting by

Myr2.T14K.B1c.Gag, Myr2.HB12.B1c.Gag and Myr2.HB12.B1c.MA is the result of restoring proper membrane selectivity to the deleted Gag protein.

Intracellular Distribution of Fyn Substitution Mutants. Because the extent of plasma membrane rescue varies with the addition of single or multiple basic residues to the Myr2.B1c.Gag and Myr2.B1c.MA proteins, we examined the effect of hydrophobic membrane-binding properties of the Fyn domain on subcellular localization of Gag. The

Fyn membrane-binding domain has been shown to confer plasma membrane localization to a heterologous protein (342), and we found that the Fyn-substituted Gag and MA proteins are strongly associated with membranes (Figure 2.3). When examined by confocal microscopy, Fyn.Gag.GFP accumulated almost exclusively at the plasma membrane (Figure 2.5). The Fyn.MA-GFP protein also localized to the plasma membrane, indicating the reduced dependence on I domain contributions to membrane binding. The Fyn substitution also restored plasma membrane targeting of the

Myr0.B1c.Gag and MA.B1c proteins, as demonstrated by a pattern of continuous plasma membrane accumulation (Fyn.B1c.Gag and Fyn.MA.B1c). 90

Fyn.MA Fyn.Gag MA Fyn.myr-. MA Gag Fyn.B1c. Fyn.B1c. B1c.MA B1c.Gag Fyn.palm-. Fyn.palm-.

Figure 2.5: Subcellular localization of Fyn.MA and Fyn.Gag derivatives. The intracellular distribution of Fyn.Gag.GFP and Fyn.MA.GFP chimeric proteins was determined by confocal microscopy of transfected QT6 cells. The localization of the Fyn.Gag and Fyn.MA proteins was also examined in the absence of proper palmitoylation (Fyn.palm–.B1c) and the absence of both myristoylation and palmitoylation of Fyn (Fyn.myr–).

91 The ability of the Fyn sequence to promote plasma membrane association is dependent entirely upon fatty acid modifications; a G2A mutation that abolishes myristoylation also prevents subsequent palmitoylation (Fyn.myr–.Gag) and resulted in the formation of protein aggregated within the cell (Figure 2.5). However, the nuclear transport of MA was not affected by the loss of acylation (Fyn.myr–.MA). Disruption of

Fyn palmitoylation independently of myristoylation (Fyn.palm–), prevented the ability of

Fyn to restore plasma membrane targeting specificity; the Fyn.palm–.B1c.Gag and

Fyn.palm–.B1c.MA proteins revealed the intracellular membrane localization characteristic of proteins with the B1c deletion. Failure of both the Fyn.palm–.B1c.Gag

(Figure 2.5) and the Myr2.B1c.Gag (Figure 2.4) proteins to localize to the plasma membrane suggests that myristoylation alone is not a sufficient signal for plasma membrane localization of Gag.

Colocalization of M Domain Mutants with Intracellular Membranes. If deletion of the B1c sequence prevents the ability of Gag to select the plasma membrane, then we would predict that the association of the mutant protein with intracellular membranes should reflect nonspecific membrane association rather than specific targeting to a particular membrane. To determine whether Gag proteins bearing the B1c deletion accumulated at specific intracellular membrane locations, we employed indirect immunofluorescence with markers of the ER and Golgi complex to look for colocalization of Gag protein derivatives with these subcellular organelles. The wild- type MA-GFP protein localizes to the cytoplasm and nucleus following fixation, and there is no specific colocalization of staining with markers of the ER membrane

(calnexin, Figure 2.6A), ER COP-1 vesicle component (β-COP, Figure 2.6B) or Golgi 92 complex (58K, Figure 2.6C). In contrast, there is partial overlap of the pattern of epifluorescence seen with the Myr2.B1c.MA-GFP protein and the fluorescence seen by staining with all three antibodies. Indeed, the fluorescence pattern of Myr2.B1c.MA-GFP encompasses a greater area of the intracellular space than any of these individual organelle markers, further suggesting that the B1c deletion has not introduced a targeting signal, but rather that the protein simply accumulates at the most accessible intracellular membrane sites.

93 A. GFP α-calnexin MA Myr2.B1c.MA

B. GFP α−βCOP MA

C. GFP α-58K MA Myr2.B1c.MA Myr2.B1c.MA

Figure 2.6: Colocalization of the Myr2.B1c.MA protein with markers of the ER and Golgi. Cells transfected with the MA or the Myr2.B1c.MA.GFP fusion protein were fixed in 3:1 acetone:methanol and stained with antibodies against calnexin (A), β-COP (B) or the 58K Golgi protein (C) and a secondary antibody conjugated to Cy3 and viewed by confocal microscopy. Localization of the MA and Myr2.B1c.MA proteins is displayed as GFP epifluorescence in the left-hand columns while the subcellular distribution of endogenous marker proteins is displayed in corresponding fields in the right-hand panels.

94 Electron microscopic examination of wild-type and B1c deletion mutants.

Thin section electron microscopy was used to examine both the membrane localization and the ability to direct particle formation for proteins containing the wild-type M domain, the mutant M domain associated with nonspecific intracellular membranes

(Myr2.B1c.Gag), and the mutant M domain that partially restored targeting to the plasma membrane (Myr2.T14K.B1c). The wild-type Gag.GFP protein accumulates at numerous sites along the plasma membrane, where budding structures can be seen emerging from the membrane (Figure 2.7, panel A). The released particles have an appearance typical of immature virions, with an electron dense ring enclosed within a lipid envelope, although the size of the particles is somewhat heterogeneous (panel B). In contrast,

Myr2.B1c.Gag.GFP accumulates along intracellular membranes and dark protein aggregates can be seen lining membranes derived from the ER, the Golgi and the mitochondria and electron dense material can also be seen within membrane-enclosed vesicles in the cytoplasm (panel D). Cells expressing the Myr2.T14K.B1c.Gag construct display protein accumulation at discrete patches along all intracellular membranes (panel

E) as well as darkening of stretches along the plasma membrane (panel F). These findings for Myr2.T14K.B1c.Gag are consistent with results seen by confocal microscopy where much of the protein accumulates at intracellular membranes but a portion of relocalizes to the plasma membrane. Despite localization to membranes of the

ER, Golgi, and the plasma membrane, budding structures were not observed for this mutant Gag protein. 95

A. B. C.

100 nm

Gag.GFP Gag.GFP Gag.GFP D. E. F.

Myr2.T14K.B1c.Gag.GFP Myr2.B1c.Gag.GFP Myr2.T14K.B1c.Gag.GFP

Figure 2.7: Thin section electron microscopy. Transiently transfected QT6 cells were fixed and examined by electron microscopy for the localization of Gag proteins and for the formation of virus-like particles. Bars in the lower left corners represent a distance of 100 nm. Cells expressing Gag.GFP display budding structures at the plasma membrane (A) and release immature virions (B). In contrast, cells expressing B1c deletion proteins display an accumulation of protein within membrane-enclosed vesicles (D) and at intracellular membranes (D and E) compared to the cells expressing the wild-type protein (C). Although no budding structures are seen, addition of a single basic residue (T14K) to the Myr2.B1c.Gag.GFP protein results in accumulation of dense patches of the protein at the plasma membrane (F). (Electron microscopy performed by Roland Myers, Penn State College of Medicine Core Facilities).

96 Assembly Pathway of B1c Deletion Proteins. Although Myr2.T14K.B1c.Gag accumulates primarily at intracellular membranes, this mutant Gag protein can be immunoprecipitated from transfected cell culture supernatants to a limited extent.

Because no visible budding structures were visible at the plasma membrane or within the cytoplasm of transfected cells by electron microscopy, we wondered whether the small amount of budding occurred from the plasma membrane or through bulk secretory flow resulting from its association with ER and Golgi membranes. To address this question, we expressed Myr2.T14K.B1c.Gag in COS-1 cells since budding is more readily detectable for this mutant than when it is expressed in QT6 cells [Figure 2. 8;(253)]. We examined the effect of Brefeldin A (BFA), a drug which disrupts the structure of the

Golgi complex (106), on the release of wild-type and Myr2.T14K.B1c Gag proteins.

Transfected COS-1 cells and were pretreated with 0.05 µg/ml BFA for one hour prior to labeling with 35S-methionine for 2.5 hours and immunoprecipitation of Gag proteins from the cell lysates and culture medium. As published previously, release of an Env-Gag fusion protein (SPG.D37S) that is known to follow the secretory pathway was severely inhibited by BFA (177), with protein levels in the medium reduced to 23% compared to the untreated control (Figure 2.8). While particle release for the wild-type Gag protein is insensitive to BFA, detection of Myr2.T14K.B1c protein in the medium is significantly reduced upon drug treatment (65% of the untreated control, p=0.027). Release of the

Myr2.T14K.B1c.Gag protein into the extracellular media can therefore be divided into two pathways: the BFA-resistant pathway, which may reflect the inefficient targeting to and budding from the plasma membrane, and the BFA-sensitive pathway, which 97 confirms the association of the mutant protein with those intracellular membranes that serve as the precursors for secretory vesicles. 98

c c A. 1 1 .B .B K S K S 4 7 4 7 1 3 1 3 T T . .D . .D 2 0 2 0 r r G r r G y y P y y P M M S M M S

BFA: - + - + - + - + - + - +

Pr76 SPG

SPG

CA MA

PR 1 2 3 4 5 6 7 8 9 10 11 12

Lysates Media

Figure 2.8: Particle assembly of Myr2.T14K.Gag.GFP in the presence of Brefeldin A (BFA). COS-1 cells transiently transfected with SV40 promoter-based expression vectors were pretreated with either methanol alone (–) or with BFA (+) for 1 hour. (A) SDS- PAGE analysis of immunoprecipitated wild-type and mutant Gag.GFP constructs treated with BFA. The Env-Gag fusion (SPG) contains a point mutation in PR (D37S) and appears as two protein bands within the cell and a highly glycosylated form in the media (177). Bands corresponding to the Gag precursor Pr76gag, the cleavage proteins CA, MA and PR, and the SPG.D37S chimera are indicated.

99 Nuclear trafficking pathway of RSV M domain mutants. The B1c deletion and its resulting removal of the fourth alpha helix of the M domain may affect additional subcellular pathways other than the plasma membrane targeting of Gag. Indeed, we have observed that the RSV Gag protein enters and exits the nucleus, and that the fourth alpha helix is necessary for the localization of the RSV MA domain to the nucleus (Chapter 3,

(300). Because nuclear export of the RSV Gag protein is inhibited by treatment with

Leptomycin B (LMB) (300), Gag proteins that are capable of nuclear entry should accumulate within the nucleus when treated with LMB. To determine whether deletion of the fourth alpha helix of the M domain disrupts nuclear entry of Gag, cells expressing

Gag.GFP and B1c derivatives were treated with LMB for 2 hours and examined by confocal microscopy (Figure 2.9). Each of the Gag proteins containing deletion of the fourth alpha helix are capable of nuclear entry and demonstrate an accumulation of the

Gag protein in the nucleus upon LMB treatment. While a portion of the Myr2.B1c.Gag and Myr2.T14K.B1c.Gag proteins remain associated with intracellular membranes following treatment, the majority of the protein is trapped in the nucleus. The efficient nuclear entry of B1c-deleted Gag proteins suggests that while the fourth alpha helix is necessary for nuclear entry of MA, there are additional sequences downstream of MA that also contribute to nuclear targeting of Gag. Furthermore, these results imply that deletion of the fourth alpha helix of the M domain alters the terminal subcellular targeting step of assembly––the specific transport of Gag to the plasma membrane. 100

Gag.GFP Myr0.B1c. Myr2.B1c. Gag.GFP Gag.GFP

Myr2.T14K.B1c. Myr2.HB12.B1c. Fyn.B1c. Gag.GFP Gag.GFP Gag.GFP

Figure 2.9: Leptomycin B treatment of Gag deletion proteins. To determine the ability of Gag proteins containing the B1c deletion to transit through the nucleus, live cells were treated for 2 hours with 10 ng/ml LMB and then examined by confocal microscopy. Treatment revealed that while a portion of the Myr2.B1c.Gag and Myr2.T14K.Gag proteins remain associated with intracellular membranes, this does not abrogate their ability to enter the nucleus.

101

2.5 DISCUSSION

The mechanism of RSV membrane targeting has remained elusive, as RSV Gag contains none of the membrane-targeting determinants typical of cellular proteins, including amino-terminal fatty acid modifications or clustered basic residues, which are mimicked by other retroviral Gag proteins. Association of cellular signal transduction proteins with the plasma membrane often involves modification of the penultimate glycine with a covalently attached myristate moiety added cotranslationally (367).

Although myristatic acid is thought to insert into the lipid bilayer, this interaction appears to be transitory as myristolyation is not sufficient for stable membrane association (227).

Tight membrane association therefore requires an additional membrane-binding determinant [reviewed in (216,279)]. For proteins such as Fyn, Yes and Lck, this signal is palmitate, a second fatty acid added post-translationally in a reversible manner. Other proteins, such as Src, employ a polybasic stretch downstream of the myristate modification. These basic residues allow for electrostatic association with the negative phospholipids of the inner leaflet of the cell membrane.

This “second signal” for membrane binding, either palmitoylation or a polybasic cluster, not only stabilizes the association with the membrane, but also provides specificity in plasma membrane targeting. Numerous examples demonstrate that elimination of this second signal results in relocation of the protein to intracellular sites.

For example, mutations that prevent the palmitoylation of GαZ result in relocalization of

the mutant protein to intracellular membranes (97,221), while the lack of palmitoylation

results in the accumulation of p59Hck in lysosomes (49,283). Mutation of the lysines 102 which comprise the K-Ras(B) polybasic stretch redistributes the protein to the endoplasmic reticulum and Golgi apparatus (3,53).

In a similar manner, membrane binding and the specificity of membrane targeting are separable in the HIV M domain. Numerous mutations and deletions affecting the polybasic stretch between amino acids 15-31 of the HIV M domain result in relocalization of the Gag precursor to intracellular membranes (88,109,132,243,316,381).

In some cases, rare budding structures of both immature (88,316) and mature (243) viral particles can be observed at perinuclear, ER and Golgi membranes. A similar phenotype has been observed for MLV, where mutations within the N-terminus of MA redirect Gag to intracellular membranes (125); intracellular aggregation of Gag proteins can be seen at the ER as well as the formation of incomplete budding structures within the cytoplasm

(314).

In this study, we report a similar phenotype for mutants of RSV Gag, a non- myristoylated oncoviral Gag protein. Deletion of the fourth alpha helix of the membrane- binding domain (∆B1c) results in accumulation of the Gag precursor at intracellular membranes. Particle assembly is severely reduced in the B1c construct, yet overall membrane association is not impaired. Proper plasma membrane targeting is restored by stabilizing specific interactions with the plasma membrane either through the addition of basic residues or by the addition of a heterologous plasma membrane targeting signal.

The ability of the fourth alpha helix to promote specific plasma membrane targeting requires communication between the helix and the remainder of Gag; expression of the fourth alpha helix as a fusion with GFP is not sufficient for plasma membrane targeting, but results in a diffuse cytoplasmic distribution of the protein (data not shown). 103 Our results suggest that Gag is able to associate nonspecifically with intracellular membranes until plasma membrane specificity is achieved. Many cellular proteins achieve membrane specificity as a late event in membrane binding (374). Proteins containing a single signal for membrane binding sample both intracellular and plasma membranes through reversible associations. Addition of the second modification, often palmitoylation at a specific subcellular location, increases the membrane affinity, thereby tethering the protein at the site of modification. RSV Gag may also separate membrane binding and specific plasma membrane association temporally; the fourth alpha helix of the M domain may enable Gag to achieve the appropriate conformation for plasma membrane association after sampling intracellular membranes. Alternatively, the fourth alpha helix may lock RSV Gag into the final conformation for specific plasma membrane targeting, thereby bypassing prior association of Gag with intracellular membranes.

However, rather than affecting the conformation of Gag, the fourth alpha helix of the M domain may encode sequence determinants that promote stable association with the plasma membrane. It is possible that the Myr0.B1c.Gag protein does not contain enough basic residues to be stably maintained at the plasma membrane; the additional three basic residues in the fourth alpha helix could therefore enable Gag to achieve the threshold for interaction with the acidic cytoplasmic face of the plasma membrane. Yet the membrane targeting information in the fourth alpha helix of RSV Gag may not associate directly with membrane phospholipids, but may instead comprise a protein interaction domain which would anchor RSV Gag to another plasma membrane associated protein. 104 Our results are also consistent with a model whereby the MA domain contains different conformations in the mature form and in the context of the Gag polyprotein. It has been proposed that HIV Gag binds to the plasma membrane through a myristyl switch mechanism (248,385). HIV Gag employs the myristate moiety and the polybasic stretch to facilitate association with the plasma membrane; upon proteolysis of Gag, the mature MA protein sequesters the myristate moiety and thereby becomes more soluble and more available to participate in the early events of infection within the cytoplasm.

This hypothesis is supported by biochemical data that the association of MA with membranes is much weaker than the association of Gag (132,243,315,385) and that MA and Gag bind to the membrane in distinct conformations (83,299). We found that the mature MA protein of RSV also binds membranes much more weakly than does the full- length Gag protein. Deletion of the fourth alpha helix increases nonspecific membrane association of MA, perhaps by altering the conformation of MA to resemble that present in the context of the Gag polyprotein. In an analogous fashion, the last alpha helix of

HIV-1 MA is postulated to regulate the switch between the conformations of the mature, soluble MA protein and the immature membrane-bound form (131).

Both the association of Gag with intracellular membranes, which prevents the efficient release of viral particles, and the association of the mature MA protein with improper cellular membranes may be deleterious to viral replication. Viruses containing the Myr2.T14K.B1c and Myr2.HB12 Gag mutants manifest post-assembly blocks in the viral life cycle (113,252). Despite efficient particle assembly, these viruses contain monomeric genomic RNA. This finding suggests that while an altered membrane-binding domain may allow Gag to transit to the plasma membrane and release particles, formation 105 of an infectious virion appears to be more complex than simply achieving plasma membrane localization. The wild-type membrane-targeting domain of Gag may be necessary for specific association of Gag with a plasma membrane microenvironment, a cellular cofactor, or a subcellular trafficking pathway that is required for genomic RNA dimerization. In addition, these viral mutants show defects during entry, suggesting that alteration of the M domain might have additional effects on the mature MA protein required early in the establishment of infection. Thus, the signals present in Gag that confer specific plasma membrane targeting may provide additional essential functions in the viral life cycle.

CHAPTER 3

NUCLEAR ENTRY AND CRM1-DEPENDENT NUCLEAR EXPORT OF THE ROUS SARCOMA VIRUS GAG POLYPROTEIN

Scheifele LZ, Garbitt RA, Rhoads JD, Parent LJ. Proc Natl Acad Sci U S A. 2002 Mar 19;99(6):3944-9.

Copyright 2002 National Academy of Sciences, USA. 107 3.1 ABSTRACT

The retroviral Gag polyprotein directs budding from the plasma membrane of infected cells. Until now it was believed that Gag proteins of type C retroviruses, including the prototypic oncoretrovirus Rous sarcoma virus (RSV), were synthesized on cytosolic ribosomes and targeted directly to the plasma membrane. Here we reveal a previously unknown step in the subcellular trafficking of the Gag protein, that of transient nuclear localization. We have identified a targeting signal within the N-terminal MA domain that facilitates active nuclear import of the Gag polyprotein. We also found that

Gag is transported out of the nucleus through the CRM1 nuclear export pathway, based on observations that treatment of virus-expressing cells with leptomycin B (LMB) resulted in the redistribution of Gag proteins from the cytoplasm to the nucleus. Internal deletion of the C-terminal portion of the Gag p10 region resulted in the nuclear sequestration of Gag and markedly diminished budding, suggesting that the NES might reside within p10. Finally, we observed that a previously described MA mutant, Myr1E, was insensitive to the effects of LMB, apparently bypassing the nuclear compartment during virus assembly. Myr1E has a defect in genomic RNA packaging, implying that nuclear localization of Gag might be involved in viral RNA interactions. Taken together, these findings provide evidence that nuclear entry and egress of the Gag polyprotein are intrinsic components of the RSV assembly pathway. 108 3.2 INTRODUCTION

Retroviruses must gain access to the nucleus to replicate. Following receptor binding, entry, and reverse transcription, the integration-competent nucleoprotein complex (called the preintegration complex or PIC) enters the nucleus. For oncoretroviruses like Rous sarcoma virus (RSV) that primarily infect dividing cells, the

PIC awaits breakdown of the nuclear envelope during mitosis for nuclear entry.

Lentiviruses including the human immunodeficiency virus type 1 (HIV-1) infect nondividing cells, and PICs are transported through intact nuclear envelopes. HIV-1 nuclear entry is complex, and redundant signals have been identified in the viral matrix

(MA), integrase, and Vpr proteins [reviewed in (366)]. The recent report that RSV can replicate at low levels in quiescent cells does raise the possibility that a viral protein might mediate active nuclear targeting of the RSV PIC (127).

Following nuclear entry of the PIC and proviral integration, viral RNA is transcribed, and unspliced genome-length viral mRNAs must exit the nucleus for translation into viral structural proteins and encapsidation into virions. The nuclear export of intron-containing mRNAs is normally inhibited by cellular mechanisms, so retroviruses must circumvent this obstacle. Lentiviruses encode trans-acting factors such as the HIV-1 Rev protein to mediate nuclear export of intron-containing viral RNAs (66).

Oncoretroviruses including RSV lack Rev-like transport factors and instead have cis- acting constitutive transport elements to facilitate the export of unspliced viral RNA

(238). 109 The regulation of nuclear transport is mediated by components of the nuclear pore complex (NPC) and the superfamily of nuclear transport receptors called importins.

While passive diffusion of small molecules can occur through NPCs, nucleocytoplasmic transport of nearly all proteins and RNAs is mediated by an active mechanism with directionality provided by the Ran-GTPase system [reviewed in (209) and (66)].

Facilitated nuclear import of cytosolic proteins relies on specific interactions between importins and nuclear localization signals (NLSs). Classical examples of NLSs are the highly basic motifs of Simian virus 40 T antigen and nucleoplasmin, although many additional nonclassical sequences have been shown to function as NLSs (54,209,366).

The nuclear export of proteins and RNAs is also a signal-dependent process mediated by soluble receptors called exportins (66,209). The best-characterized nuclear export signals

(NESs) were initially identified in the HIV-1 Rev protein (95) and the cAMP-dependent protein kinase inhibitor (365). These leucine-rich NESs consist of short peptide sequences with four closely spaced hydrophobic residues, a motif recognized by the

CRM1 nuclear export receptor (99,107). Leptomycin B (LMB) attaches to the central domain of CRM1 to disrupt its interaction with the NES, making LMB a specific tool for studying CRM1-mediated nuclear export (107,179).

Following nuclear export of full-length viral mRNAs, Gag and Gag-Pol proteins are synthesized on free ribosomes. Initial Gag-Gag contacts occur between I (interaction) domains found within the NC region (28,322,361). RNA is essential early in assembly as scaffolding for the assembly of Gag multimers (45,226). Gag-RNA interactions also mediate selective encapsidation of the viral genome, a noncovalently-linked RNA dimer, through association of NC and the cis-acting packaging element Ψ (308,349). Assembly 110 intermediates are directed to the plasma membrane via the M (membrane-binding) domain in the N-terminal MA sequence of Gag (232,344). Since the RSV M domain has suboptimal membrane-binding activity, I domains provide cooperative protein-protein interactions to stabilize membrane association (322). Final release of the virus particle is controlled by the L (late) domain (251,370). After budding, the RSV Gag polyprotein precursor is proteolytically cleaved into the structural proteins MA, p2a, p2b, p10, CA,

NC and PR.

In this report, we describe the unexpected finding that the RSV Gag protein enters the nucleus via a nuclear targeting sequence in the MA domain. We show that Gag is subsequently transported into the cytoplasm using a CRM1-mediated nuclear export pathway. Elimination of this nuclear step correlates with a defect in RNA packaging.

These findings demonstrate a previously unknown step in the assembly pathway of RSV.

3.3 MATERIALS AND METHODS

Viruses, cells and plasmids. Proviral constructs were derived from pRCV8 containing the RSV Prague C gag gene of pATV8 (61,252). Plasmids pRC.Myr1E, p.RC.Myr1E–, pRC.Myr2.HB12, pMA-GFP (113), pGag-GFP (43), and pSV.Myr0.BgBs

(361) were described previously. QT6 cells, chemically transformed quail fibroblasts, were maintained as described (62,224).

Plasmids encoding C-terminal truncations of the RSV Gag protein fused to GFP

(Figure 3.1) were made by PCR amplification of pRCV8 using primer USP19.263 (113) and a set of downstream primers each containing an ApaI site, for cloning into SacI-ApaI 111 sites of pEGFP.N2 (Clontech). MA truncations included amino acids 1-24, 1-43, 1-66, 1-

88, 1-119, and 1-140. Gag truncations consisted of MA-p2a (aa 1-155), MA-p2 (aa 1-

177) and MA-p2-p10 (aa 1-239). Deletions involving p10 were derived from pRC.∆p10.31, pRC.∆p10.52 and pRC.∆QM1 [(176), kind gifts of Rebecca Craven and

John Wills] by PCR using primers USP19.263 and 5’-

TCAGTATAGGGGCCCCGAGTCGGCAGGTGGCTCA.

pMA-FLAG was made by ligating fragments from pMA-GFP (ApaI-Klenow/

BglII) with pCMV.FLAG5b (Sigma) (EcoRV-Klenow/BglII). Mutations of the gag sequence (myr2.HB12, myr1e and myr1e–) were cloned into pGag-GFP by SstI-BspEI fragment exchange.

Confocal Microscopy. QT6 cells were examined 18 h after transfection using a

Zeiss LSM 10 BioMed confocal microscope (113). In indicated experiments, cells were grown in medium augmented with LMB at a final concentration of 10 ng/ml (18 nM) for

2 h prior to imaging. For indirect immunofluorescence, cells were seeded in LabTek chamber slides (Nunc), transfected, fixed in 2% paraformaldeyde or in 3:1 methanol:acetone at –20º C. Cells were rehydrated in PBS, blocked with 1.5% BSA, incubated with polyclonal anti-RSV or anti-MA (62,252), washed, stained with goat anti- rabbit IgG-FITC (Sigma) or sheep anti-rabbit IgG-Cy3 (Sigma), mounted with SlowFade

(Molecular Probes) and analyzed by confocal microscopy.

Viral protein detection and budding assay. For immunoblotting, transfected cells were lysed in RIPA buffer (50 mM Tris [pH 7.5], 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS), proteins were separated by electrophoresis, transferred to nitrocellulose, probed with anti-GFP Living Colors Peptide antibody (Clontech) and 112 anti-mouse IgG-conjugated HRP (Sigma), and detected by chemiluminescence.

Radioimmunoprecipitation assays were performed as described (253,362). To calculate particle release, Gag protein bands were quantitated by using a PhosphoImager

(Molecular Dynamics) and the amount of Gag protein in the medium was divided by the total Gag protein in lysates and medium. Statistical analysis was performed using a two- tailed Student’s t-test.

3.4 RESULTS

We have described mutants of the RSV MA sequence that interfere with viral

RNA packaging and dimerization (113,252). One such mutant, Myr1E (Fig. 3.1), contains the Src membrane-binding domain as an N-terminal extension of the Gag protein. While Myr1E produces viral particles more efficiently than wild type, it has undetectable infectivity and packages only 40% of wild type levels of viral RNA. The

Myr1E.MA protein is mislocalized, demonstrating greatly enhanced plasma membrane accumulation compared to the wild type MA protein (113). We hypothesized that the defect in genomic RNA incorporation results from transporting the Myr1E.Gag protein too quickly to the plasma membrane, omitting a cellular compartment or a trafficking pathway required for Gag-RNA interactions. This idea led us to further examine the subcellular localization of wild type and mutant RSV MA and Gag proteins to dissect the targeting determinants within their sequences.

Subcellular distribution of the MA protein. To study the subcellular localizations of MA and Gag in living cells, C-terminal fusions were made with GFP 113 (Figure 3.1); (43,113). As analyzed by confocal microscopy, MA-GFP was observed throughout the cytosol with strong accumulation inside the nucleus (Figure 3.2A) (113).

In contrast, the distribution of unconjugated GFP was diffuse through the cell. To determine whether the presence of the foreign GFP protein altered the cellular distribution of MA, the FLAG epitope was fused to the C-terminus of MA and cells were examined using indirect immunofluorescence with an anti-MA antibody. Similarly to

MA-GFP, MA-FLAG also exhibited nuclear staining. Even a small sequence like FLAG could affect protein localization, so wild type MA was expressed in the absence of other viral proteins using a proviral vector, and cells were analyzed by indirect immunofluorescence. In these fixed cells, MA appeared within nuclei, confirming our previous results (Figure 3.2A, RC.Myr0). 114

RSV Gag Polyprotein Pr76gag MA p2 p10 CA NC PR p2a p2b MA Constructs RC.Myr0 MA-FLAG FLAG Gag-GFP Fusion Proteins Gag (∆ PR) MA p2 p10 CA NC GFP MA MA 1-24 MA 1-43 MA 1-66 MA 1-88 MA 1-119 MA 1-140 MA-p2a MA-p2 MA-p2-p10 MA-p2-p10-CA Mutant Gag-GFP Proteins Bgl II

Myr2.HB12 KKKYKLK GFP Myr1E Src Myr1E– Src

Figure 3.1: The RSV Gag protein and derivatives. The RSV Gag protein (Pr76) is depicted at the top, with cleavage proteins MA, p2a, p2b, p10, CA and NC indicated. RC.Myr0 is a derivative of pRCV8 and expresses the wild-type Prague C MA protein (372). Gag-GFP fusion proteins and truncations of MA fused to GFP are depicted below. Note that GFP replaces the PR sequence in Gag-GFP (∆PR). Gag-GFP substitution mutants are shown in the bottom panel. The box labeled as Src contains the N-terminal 10 residues of the Src oncoprotein. Myristic acid is shown as a zigzag line.

115

A GFP MA-GFP Gag-GFP RC.Myr0 MA-FLAG

9 0 24 43 66 88 11 14 B P 1- 1- 1- 1- 1- 1- F A A A A A A A EG M M M M M M M

44

32

Propidium Propidium C GFPIodide GFP Iodide MA 1-24 MA MA 1-43 MA MA 1-119 MA MA 1-66MA MA 1-140MA 1-88 MA

Figure 3.2: Subcellular localization of the RSV MA protein. (A) Top panels: Subcellular localizations of GFP, MA-GFP and Gag-GFP fusion proteins were analyzed in live cells using confocal microscopy 18 h post transfection. Lower panels: Transfected QT6 cells were fixed, incubated with polyclonal anti-MA antibody and Cy3-conjugated secondary antibody. (B) Immunoblot analysis of intracellular expression levels of indicated proteins from lysates of transfected cells using an anti-GFP antibody. Molecular weight markers are indicated to the left. (C) Mapping a nuclear targeting sequence within the MA domain. Plasmids encoding truncations of the MA sequence fused to GFP were transfected, cells were fixed, and epifluorescence was detected. The cells were stained with propidium iodide to visualize nuclear DNA and identical fields are shown. 116 Because MA and MA-FLAG are small proteins, they could enter the nucleus by passive diffusion, since in theory proteins up to ~40-60 kDa can diffuse through the NPC.

In reality, few proteins actually traverse the NPC passively because the directional active transport system maintains strict compartmentalization (66,209). However, even if MA and MA-FLAG entered by diffusion, they would be unlikely to accumulate in the nucleus under steady-state conditions. Furthermore, MA-GFP was concentrated in the nucleus despite its larger molecular mass (52 kDa) compared to GFP (33 kDa), which was distributed uniformly.

The nuclear concentration of MA-GFP is distinct from the localization of Gag-

GFP, which excludes the nucleus and accumulates at focal patches along the plasma membrane (43); (Figure 3.2A). A priori, we expected the MA protein to be localized at the plasma membrane given that MA and Gag share identical N-terminal sequences and therefore contain the same M domain. The unexpected difference in subcellular localization suggested that there must be additional targeting information located either within MA or Gag to account for their distinctive distributions. A conformational change resulting from cleavage of the Gag precursor during maturation might reveal new targeting information within MA, similar in principle to the myristyl-switch mechanism proposed to explain different conformations of the HIV-1 MA and Gag proteins

(131,248,315). Alternatively, cleavage of the MA protein might remove downstream targeting signals that are dominant over nuclear targeting in the context of the Gag polyprotein.

Nuclear localization of MA requires the presence of the four-alpha-helix domain. The localization of MA within the nucleus suggested the presence of an NLS, 117 but sequences resembling a classical motif could not be identified by database searches

(56,134). However, MA is lysine and arginine-rich, so perhaps the basic residues form an

NLS in the three-dimensional conformation of the protein. To ascertain whether a simple nuclear targeting sequence could be found, deletions were made based on the NMR structure of the N-terminal half of the MA protein, which consists of four overlapping alpha helices and a 310 helix joined by flexible loops (217). C-terminal truncations of MA

were fused to GFP (Figure 3.1). Immunoblot analysis revealed that each fusion protein

was stably expressed, and there was no detectable free GFP except in the MA 1-88

construct (Figure 3.2B). Examination by confocal microscopy revealed that addition of

the first alpha helix (MA 1-24), the first two alpha helices (MA 1-43), or the first three

alpha helices (MA 1-66) to GFP resulted in accumulation of the proteins in the cytoplasm

(Figure 3.2C). Fusion of the first 88 residues of MA (all four alpha helixes) to GFP

restored nuclear concentration of the protein, and further extension into the second half of

MA maintained nuclear localization (MA 1-119 and MA 1-140).

Identification of a CRM1-dependent NES within the Gag sequence. To

identify the sequence required for the change from nuclear to plasma membrane

localization, GFP fusion proteins including the p2a, p2 (p2a plus p2b), p10 and CA

domains of Gag were examined (Figure 3.1). MA-p2a-GFP (data not shown) and MA-p2-

GFP fusion proteins displayed the same subcellular localization as MA-GFP with nuclear

accumulation (Figure 3.3). However, extending through the p10 and CA domains of Gag

produced a dramatic alteration in localization: MA-p2-p10-GFP and MA-p2-p10-CA-

GFP were present exclusively in the cytoplasm. 118

UntreatedLMB Untreated LMB Κα− IB GFP MAp2.GFP GFP MA-GFP MAp2p10CA E F

Figure 3.3: Identification of an LMB-sensitive NES within the Gag protein. Live cells transfected with plasmids encoding C-terminal truncations of Gag fused to GFP were examined by confocal microscopy. LMB-treated cells were incubated with 10 ng/ml LMB for 2 hours prior to imaging. 119 The nuclear exclusion of Gag-GFP fusion proteins including p10 and CA could be explained by either increased molecular mass, precluding passive nuclear entry, or by a nuclear export activity. To determine whether there is a CRM1-dependent NES in Gag, cells expressing GFP fusion proteins were treated with LMB (107,179). As a control for

LMB activity in QT6 cells, IκBα, a cellular protein containing a known NES (147), was expressed as a GFP fusion protein, and the minimal concentration of LMB (10 ng/ml) that blocked its nuclear export was used in subsequent experiments (Figure 3.3). The distributions of GFP, MA-GFP and MA-p2-GFP were unaffected by LMB. Strikingly, both GFP fusion proteins that contain p10 showed marked sensitivity to LMB, with retention of the MA-p2-10-GFP and MA-p2-p10-CA-GFP proteins in the nucleus.

Besides demonstrating the presence of a CRM1-dependent NES within the MA-p2-p10 region, this finding also confirmed that the nuclear targeting activity within MA acts through an active process since it mediates nuclear entry of the ~81 kDa MA-p2-p10-CA-

GFP protein.

CRM1-dependent NESs are typically leucine-rich sequences, although other large hydrophobic amino acids may be substituted (117,137). Two clusters of hydrophobic residues in p10 were potential candidates for an NES, as shown in Figure 3.4A. To map the putative export signal, Gag-GFP mutants with deletions involving p10 were studied.

Deletion of the N-terminal region of p10 did not alter the typical plasma membrane localization observed for Gag-GFP (∆QM1, Figure 3.4B). In contrast, an internal deletion that removes six hydrophobic residues was completely trapped in the nucleus, indicating that removal of this sequence interferes with nuclear export of Gag (∆p10.52). A smaller deletion that eliminates residues including L219 and W222 from the C-terminal portion 120 of p10 also abrogates nuclear export (∆p10.31). These results suggest that the NES is likely to be located in the second half of p10, although it remains possible that addition of the p10 sequence reveals a conformation-dependent NES within the MA or p2 sequences.

Additionally, despite the existence of an LMB sensitive NES in this region of Gag, there might also be a cellular factor that mediates nuclear export of the protein. 121

A p10 SGLLV YPS AG GEQQGQGGDTPPGAEQSRAEPGHAGQAPGGPA LWVL TD AR REE ASTGPP VV AMP ∆QM1 ∆p10.52 ∆p10.31 B GFP PI GFP PI GFP PI

∆QM1.Gag.GFP ∆p10.52.Gag.GFP ∆p10.31.Gag.GFP

Figure 3.4: Effects of p10 deletions on subcellular localization. (A) Schematic diagram of the p10 sequence with hydrophobic residues that could function as an NES highlighted in red. Gag mutants with p10 deletions are shown below with heavy black lines indicating residues present in the mutant protein. (B) Confocal micrographs of cells expressing Gag-GFP p10 mutants reveal a putative NES. At 18 h post transfection, cells were fixed in paraformaldehyde. Left-sided panels show GFP epifluorescence and right-sided panels show propidium iodide-stained nuclei.

122 LMB sensitivity of Gag and mutants with altered MA sequences. We next examined the effect of LMB on localization of the full-length Gag protein, since previous constructs extended only through CA. We found that Gag was trapped in the nucleus after treatment with LMB, indicating that the trafficking pathway of Gag includes a nuclear phase (Figure 3.5). We reasoned that Gag mutants with strong membrane-binding domains might be targeted so rapidly to the plasma membrane that they fail to enter the nucleus. For example, Myr1E (Figure 3.1) has the Src membrane-binding domain extended from the N terminus of Gag and efficiently associates with the plasma membrane, even without the contribution of I domains (113). In the presence of LMB,

Myr1E.Gag remained localized to the plasma membrane with no evidence of nuclear retention (Figure 3.5). This is intriguing, since Myr1E is noninfectious due to a defect in genomic RNA packaging and dimerization (252). In Myr1E, the Src membrane-targeting activity might override the NLS/NES activity normally found in Gag, bypassing the nuclear compartment. Thus, elimination of nuclear transport might explain the RNA packaging defect of Myr1E if nuclear localization of Gag is involved in genomic RNA incorporation. In support of this idea, we found that Myr1E–, which is identical to Myr1E except for a G2A substitution that eliminates Src myristylation, demonstrated nuclear localization in the presence of LMB. Myr1E– has normal infectivity and packages wild type levels of RNA (252). A third mutant, Myr2.HB12, also remained in the nucleus with

LMB treatment, and it packages nearly normal levels of genomic RNA (86% of wild type levels, R. Garbitt and L. Parent, unpublished observations), although it is noninfectious.

This mutant contains a myristic acid addition site at the Gag N terminus (designated

Myr2) and a cluster of basic residues substituted for amino acids 12-18 in MA (252). 123 Interestingly, Myr2.HB12 packages only monomers of RNA (113), suggesting that packaging and dimerization of viral RNA are not directly linked, and dimer formation might occur in a post-nuclear compartment. Thus, there is a correlation between the nuclear localization of Gag proteins in response to LMB treatment and genomic RNA incorporation. 124

F Untreated LMB Untreated LMB P GFP Gag-GF Myr1E.Gag GFP GFP B12.Gag H

Myr1E–.Gag

Figure 3.5: LMB sensitivity of mutant Gag proteins with defects in RNA packaging and dimerization. Live cells expressing the indicated Gag-GFP proteins were visualized without (left-sided panels) and with (right-sided panels) LMB treatment, revealing that wild type Gag and mutants Myr2.HB12 and Myr1E– become trapped in the nucleus after treatment while Myr1E is insensitive to the effects of the drug.

125 Effect of LMB treatment on Gag localization on virus-expressing cells. The subcellular trafficking of Gag proteins and their derivatives in response to LMB treatment was tested in cells expressing wild type or mutant proviruses to determine whether GFP might have influenced localization. In cells expressing the wild type RSV genome, Gag proteins were seen in the cytoplasm with focal concentration at the plasma membrane when analyzed by indirect immunofluorescence (Figure 3.6). When cells were incubated with LMB, Gag proteins became sequestered in the nucleus. Thus, during infection Gag undergoes nuclear entry and export independently of GFP and localization is not altered by the expression of other viral gene products. In cells expressing the myr1e genome,

Myr1E Gag was seen at the plasma membrane both in untreated and treated cells, indicating that the nuclear compartment was bypassed. 126

Untreated Untreated LMB 10 ng/ml LMB 75

50 Uninfected

25 Budding Percentage (wild-type) 0 Myr1E RC.V8

Figure 3.6: (Left) Gag localization in virus-expressing cells. Gag localization was analyzed in cells stably expressing wild type or mutant RSV proviral genomes by indirect immunofluorescence in fixed cells either untreated or treated with LMB. Note that patterns of subcellular localization were the same as in Figure 3.5, indicating that GFP had not influenced the distribution of Gag. (Right) Particle release in response to LMB treatment. The amount of immunoprecipitated Gag protein released from transfected cells during a 2.5 h labeling period was divided by the total Gag protein detected in cells and medium to calculate percent particle release. Percent particle release from untreated (hatched bars) and treated (solid gray bars) cells was compared. Treated cells were incubated with LMB for 1-2 h followed by metabolic radiolabeling for 2.5 h in the presence of LMB. Each bar represents the average of three independent experiments with standard deviations indicated. Inhibition of particle assembly with LMB treatment was determined by a two-sample t-test; *p-value = 0.0049 and **p-value = 0.014.

127 Particle assembly in the presence of LMB. Because LMB treatment of infected cells resulted in nuclear accumulation of Gag proteins, we expected that fewer Gag molecules would be available for transport to the plasma membrane, and virus budding might be diminished. Cells were transfected with wild type or mutant Gag-GFP constructs, pretreated with LMB for 1-2 hours, metabolically labeled for 2.5 hours in the presence of LMB, and RSV Gag proteins were immunoprecipitated from cell lysates and medium. Budding directed by Gag-GFP was significantly inhibited in the presence of

LMB (p=0.0049; mean of 49% reduction, 95% confidence interval 26.8 to 77.4; Figure

3.6). While the budding assay reveals a large variation in the budding of Gag proteins between experiments, the decrease in particle assembly directed by the Gag polyprotein in the presence of LMB is consistent with the accumulation of Gag proteins within the nucleus of treated cells. Myr2.HB12.Gag-GFP, which showed LMB-dependent nuclear localization, also had a significant reduction in extracellular particle release (p=0.014; mean of 49% reduction, 95% confidence interval 17.7 to 83.4). In contrast, budding of

Myr1E.Gag-GFP was not significantly altered with LMB treatment (p=0.28).

Analysis of budding for the p10 deletion mutants revealed that ∆QM1.Gag-GFP, which had a subcellular localization similar to wild type Gag, showed a trend toward reduction in budding due to LMB, but the effect was not statistically significant

(p=0.097, 45% reduction; data not shown). Mutants with deletions affecting hydrophobic residues in the C-terminal portion of p10 released particles at a much lower rate that wild type (∆p10.31.Gag-GFP, 69% reduced and ∆p10.52.Gag-GFP, 64% reduced, Figure 4.2).

Budding efficiency was not further diminished with LMB treatment (p=0.22 and 0.43, respectively). Taken together, these results indicate that inhibition of nuclear export, 128 either pharmacologically or by mutagenesis of p10, limits the amount of Gag in the cytoplasm, thereby interfering with the normal trafficking pathway required for particle assembly.

3.5 DISCUSSION

In this report, we describe the discovery of a novel and unexpected step in the

RSV assembly pathway. Previously, Gag proteins were believed to be located exclusively within the cytoplasm after synthesis, with subsequent targeting directly to the plasma membrane. Now we demonstrate that RSV Gag has a nuclear phase that is mediated by two targeting signals: one for nuclear import and the other for CRM1-dependent nuclear export.

Although the reason for the transient nuclear localization of the RSV Gag protein is unknown, we propose two main hypotheses (Figure 3.7). First, we suggest that the

NES in Gag counteracts the nuclear import signal in MA to keep Gag out of the nucleus.

In this scenario, RSV MA plays a role early in infection to facilitate nuclear entry of the viral PIC. Although a requirement for facilitated nuclear targeting of the PIC has not been demonstrated for RSV, the report that RSV can infect growth-arrested cells makes it possible that the nuclear targeting sequence in MA might be involved (127). Since the nuclear import signal in MA is also present on the Gag polyprotein, Gag too would be transported into the nucleus, but this would certainly be detrimental to virus assembly. To counteract nuclear import, the NES would return Gag to the cytoplasm for virus particle production. Besides import of the PIC, other roles could be imagined for the MA protein 129 in the nucleus, including regulation of reverse transcription, integration, or viral transcription, although mutants of MA that affect these processes have not yet been found. Whatever the function of MA might be in the nucleus, clearly its N-terminal alpha helical domain is sufficient for nuclear import of the MA and Gag proteins. The MA nuclear targeting signal is large and complex compared to classical NLSs, and further experiments may reveal specific residues critical for interaction with nuclear import machinery or with a host factor that mediates the nuclear entry of MA and Gag. 130

MA Entry PIC 1 7

5

2 ψ 6

ψ 3 4

Gag Assembly

Hypothesis 1 Hypothesis 2

Figure 3.7: Model for the role of the nuclear localization of Gag during RSV replication. Hypothesis 1 (steps 1-4): The nuclear targeting signal within MA delivers the cleaved MA protein to the nucleus during viral entry. Nuclear Gag proteins are exported via the CRM1-dependent NES so they are available in the cytoplasm to direct particle assembly. Hypothesis 2: (steps 5-7) The nuclear targeting signal carries the Gag protein into the nucleus where Gag might interact with unspliced viral RNA to begin the packaging process. Cytoplasmic relocalization of Gag occurs via the NES, Gag-RNA complexes provide a nucleation point for Gag multimerization, and assembly intermediates are transported to the plasma membrane where budding occurs. Notably, hypotheses 1 and 2 are not mutually exclusive.

131 In the second model, we propose that Gag enters and exits the nucleus to fulfill a role during virion assembly (Figure 3.7). After proviral integration, unspliced viral RNA transcripts are synthesized and exported out of the nucleus for translation into structural and enzymatic proteins. Export of unspliced viral transcripts must elude cellular mechanisms designed to retain intron-containing mRNA in the nucleus. For RSV, it was shown that cytoplasmic accumulation of unspliced viral RNA is mediated by cis-acting

DR elements in a CRM1-independent fashion, although neither Gag proteins nor the RSV genome was present in those experiments (239,247) It is possible that the fraction of unspliced RNA exported for translation is distinct from the fraction used for genome encapsidation. In our model, Gag proteins enter the nucleus where they might interact with unspliced viral RNA transcripts. The Gag-RNA nucleoprotein complex is then transported through the NPC via the CRM1 export pathway. In the cytoplasm, the Gag-

RNA complex would be a nucleation point for the multimerization of additional Gag proteins that are then targeted to the plasma membrane. Importantly, these two models are not mutually exclusive, as MA might have a nuclear role early in infection and Gag might also enter the nucleus during assembly. It is also possible that Gag might have some other as yet unknown function in the nucleus unrelated to genomic RNA encapsidation.

While the nuclear entry of oncoviral Gag proteins is novel, other viruses have well-described replication strategies that take advantage of nuclear machinery to transport viral genomes, structural proteins and regulatory proteins [reviewed in (366)]. For example, HIV-1 utilizes multiple signals to deliver the PIC to the nucleus of nondividing 132 cells (366), and a CRM1-dependent NES in MA influences the nuclear export of full- length viral RNAs (79). Alteration of the NES results in accumulation of HIV-1 Gag in the nucleus, although Gag itself was not shown to be sensitive to LMB treatment.

Whether there are functional correlates between nuclear transport signals in RSV and

HIV-1 Gag remains to be determined. As well, it is intriguing to consider possible parallels between the RSV Gag and influenza M1 proteins, since both proteins are present in the nucleus and direct particle assembly at the plasma membrane. Influenza M1 associates with viral ribonucleoprotein complexes in the nucleus, and the viral genome is exported in a CRM1-dependent fashion (202,366).

In this report, we demonstrated that the MA domain contains an NLS that may be involved in import of the Gag polyprotein into the nucleus and that an NES in Gag mediates its cytoplasmic relocalization to facilitate virus assembly. We found that Gag mutants that package normal amounts of genomic RNA also have nuclear entry and export phases (Myr2.HB12 and Myr1E–) while a mutant with a reduced level of viral

RNA incorporation does not enter the nucleus (Myr1E). The observation that RSV replication includes transient nuclear localization of the Gag protein raises intriguing questions about early Gag-RNA interactions and the intracellular trafficking pathways taken by assembling virions.

CHAPTER 4

FINE MAPPING OF THE NUCLEAR EXPORT SIGNAL OF THE ROUS SARCOMA VIRUS GAG POLYPROTEIN 134 4.1 ABSTRACT

The Rous sarcoma virus Gag protein directs the assembly of viral particles at the plasma membrane following transient nuclear localization. Nuclear export is crucial for the efficient production of viral particles and is accomplished through the action of a leptomycin B (LMB)-dependent nuclear export signal (NES) in the p10 domain of Gag

(300). We have now mapped the nuclear export signal to the C-terminal portion of the p10 domain and identified the four hydrophobic residues within this region that comprise a leucine-rich NES. The result of mutating these hydrophobic residues is a strong accumulation of Gag proteins within the nucleus and a budding defect greater than that obtained when treating cells expressing the wild-type Gag protein with LMB (300). As well, export from the nucleus becomes rate-limiting as the rate of release of virus-like particles from the cell is severely diminished. Consistent with a role for the NES in viral replication, we find that the crucial residues for Gag export are conserved across a wide range of avian retroviruses, and that naturally occurring substitutions within this region do not abrogate nuclear export or LMB sensitivity. The export pathway for Gag is further defined by the ability of select nuclear pore inhibitors to prevent the export of Gag from the nucleus, thereby identifying crucial cellular mediators of retroviral replication.

4.2 INTRODUCTION

The Gag polyprotein coordinates the assembly of retroviral particles by serving as the precursor to the structural components of the virion, by selecting the RNA genome for incorporation into the assembling particle, and, for some retroviruses, by directing the 135 incorporation of the envelope glycoproteins. The Gag proteins of Rous sarcoma virus

(RSV) are synthesized on cytosolic ribosomes and then traffic through the cell nucleus

(300). Within the cytoplasm, retroviral assembly intermediates can be isolated which are comprised of Gag proteins multimerized upon an RNA scaffold (189,226,310,336).

These Gag multimers then specifically select and cooperatively bind to the plasma membrane of infected cells, which serves as the site for higher order viral assembly.

Approximately 1500 Gag proteins associate at the plasma membrane, where they can be seen as electron dense aggregates driving the formation of a spherical bud. Following release of the virion, the immature virion is processed by the viral protease, cleaving the

RSV Gag protein into the structural proteins matrix (MA), capsid (CA) and nucleocapsid

(NC), the enzyme protease (PR), and the peptides p2a, p2b, p10 and SP.

Coordination of retroviral assembly is directed by three functional domains within the Gag polyprotein: the membrane-binding (M) domain allows Gag to selectively target to and stably bind the plasma membrane, the interaction (I) domains allow multimerization of Gag proteins and RNA binding, and the late (L) domain recruits host cell machinery to separate the nascent virion from the membrane. What remains unclear, however, is the precise location within the cell at which each assembly process occurs, and subcellular targeting signals within Gag remain undefined. However, several nuclear localization signals (NLSs) have been identified within Gag polyproteins. An NLS has been identified in the Gag protein of the Schizosaccharomyces pombe Tf1 element (70) and the HeT-A and TART retrotransposons of Drosophila (274). Several additional Gag proteins localize partially to the nucleus under steady-state conditions, including the Gag proteins of both the human and equine foamy viruses (184,379) and perhaps of Moloney 136 murine leukemia virus Gag as well (231), although no NLS has been mapped within the

MLV Gag protein. As well, nuclear import signals have been mapped throughout the

HIV genome, most notably within the MA region of the Gag polyprotein (37,79).

The Rous sarcoma virus Gag protein also undergoes nuclear translocation during viral replication. We have identified a non-classical NLS within the MA region of the

RSV Gag protein (300). The NLS within MA is not comprised of a concise canonical basic motif, rather the first 88 amino acids have been demonstrated to be sufficient for nuclear accumulation. Nuclear localization appears to be transient as the Gag protein localizes exclusively to the cytoplasm under steady-state conditions. Trafficking of Gag through the nucleus can be inhibited by treatment of cells with leptomycin B (LMB), a selective inhibitor of the Crm1 nuclear export pathway. This drug treatment results in retention of Gag proteins within the nucleus and consequently a significant decrease in the release of virus-like particles, suggesting the importance of the nuclear transport step for productive retroviral replication (300).

Crm1 is a member of the importin-β superfamily of soluble nuclear transport receptors, where it serves as the export receptor specific for hydrophobic nuclear export signals present within its export cargos. Although these signals are often comprised of several closely spaced leucine residues, other hydrophobic amino acids, such as methionine, isoleucine, valine, phenylalanine and tryptophan, may comprise the recognition motif as well (for a review see (117,129,203)). Examination of the RSV Gag protein for Crm1-dependent, leucine-rich nuclear export signals (NESs), suggested the presence of an NES within the p10 region. Deletions within this region mimicked the 137 phenotype of LMB-treated cells, with an accumulation of Gag proteins within the nucleus

(300).

The function of the p10 domain of Gag remains poorly defined. The region contains numerous proline residues, and is therefore likely a major structural determinant for the polyprotein. This role of p10 is reflected in the ability of the p10 region, and specifically the last 25 amino acids of the p10 domain, to affect the morphology of virus- like particles assembled in vitro. Gag proteins containing deletions of the p10 domain assemble into tubular structures when assembled in vitro on an RNA template (46); however, when the last 25 amino acids of the p10 domain are restored, the particles instead assume a spherical appearance and a density resembling those of authentic RSV virions (148). Finally, the p10 region appears to be required not only for proper structure of the Gag protein, but also for additional aspects of retroviral replication; deletions within the p10 region produce particles which are normally processed and assembled, but which fail to establish infection at non-permissive temperatures (80). Whether these defects reflect a structural alteration that manifests during the late stages of assembly or a more fundamental interruption of the early steps of infection remains to be identified.

Because we have identified the C-terminal region of p10 as crucial for NES function of the Gag protein, we sought to identify the precise residues within p10 that interact with the Crm1 export receptor. Mapping of the RSV nuclear export signal will allow the more precise definition of the role of the p10 domain in viral assembly and of the nuclear export signal of Gag in the RSV replication cycle. 138 4.3 MATERIALS AND METHODS

Plasmids. Plasmids pGag.GFP, ∆p10.31.Gag.GFP, ∆p10.52.Gag.GFP and

∆QM1.Gag.GFP were described previously (43,176).pGag.GFP.FL which restores the last 7 residues of the NC domain to Gag.GFP was created by PCR amplification of pSV.Myr0 with primers Pare 199 and Pare 179, digestion with ScaI and ApaI and ligation into plasmid MA.p2.p10.GFP (300). pCMV.Gag was created by deletion of the GFP gene from pGag.GFP with ApaI and NotI, digestion with Klenow fragment and re- ligation of the vector. Mutations were introduced into the pCMV.Gag vector by SstI-

BspEI fragment exchange from pGag.GFP mutant plasmids. Mutations of the Gag.GFP sequence were created by oligonucleotide-directed mutagenesis using the Quickchange site-directed mutagenesis protocol according to manufacturer’s specifications

(Stratagene). Mutagenic oligonucleotides (only the sense strand is denoted) were as follows, with diagnostic restriction enzyme sites underlined: L219A (PstI)

(GGTCAGGCTCCTGGGCCTGCAGCGACTGACTGGGCAAGG); W222A (BssHII)

(CCGGCCCTGACTGACGCGGCGCGCGTCAGGGAGGAGCTT);V225A (XhoI)

(GCCCTGACTGACTGGGCAAGGGCTCGAGAGGAGCTTGCG); L229A (mutation

of ScaI site) (AGGGTCAGGGAGGAGGCTGCGAGGCACTGGTCCGCCCGTG);

L180,184,V187A (SstII and NarI)

(GCTGCTCTCCGGCGCCCGCCGCGGAAGGATACGCACCACTCCCCAC); V225I,

L229V and L229V (mutation of ScaI site, BamHI)

(CTTGGCAAGGRTCCGGGAGGAGGTTGCGAGCACTGGTCCGC); W222L,V225L

(BssHII) (GCCCTGACTGACTTGGCGCGCCTCAGGGAGGAGCTTGCG); V225L 139 (BssHII) (CTGACTGACTGGGCGCGCAGGGAGGAGCTTGCG); V225I (BssHII)

(CTGACTGACTGGGCGCGCATCAGGGAGGAGCTTGCG). Plasmids NP214-DsRed,

NP98-DsRed and NP214-DsRed were created by PCR amplification of codons 1864-

2090 of Nup214, codons 2-494 of Nup98 and codons 894-1475 of Nup 153 from

plasmids ∆CAN (kindly provided by Tom Hope), NP98 and HA-NP153 ((386), kindly

provided by Barbara Felber). PCR was used to introduce a Kozak consensus sequence

and the tripeptide MAS (386) before each NP domain, and products were introduced into

the pDsRed.N1vector (Clontech) between XhoI and SstII sites.

Cell lines and Confocal Microscopy. All experiments were carried out in the

chemically transformed quail fibroblast line QT6, maintained as previously described

(62,224). Plasmid DNA was introduced by transient transfection using the calcium phosphate method, and subcellular localization of GFP fusion proteins was examined 16-

24 hours later by washing cells in Tris-buffered saline and viewing cells with a Zeiss

laser-scanning microscope (LSM10) at an excitation wavelength of 488nm. Coexpression of DsRed constructs was performed by transfection of equal amounts (1 µg each) of

DNA, followed by imaging with both argon (488) and He-Ne lasers (643 nm).

Virus-like particle assembly and pulse-chase analysis.

Radioimmunoprecipitation assays were performed as described previously (253,362) with polyclonal antisera against RSV (62,252). Budding efficiency was determined by phosphorimager analysis (Molecular Dynamics), quantitating the amount of either wild- type or mutant Gag.GFP or CMV.Gag in the media fraction divided by the total amount of expressed protein in the cell lysates and culture media. Wild-type values for each construct were normalized to 100% release. p-values were determined using a Student’s 140 t-test. Pulse chase analysis was performed by labeling cells for 15 minutes with 35S-

methionine and cysteine (NEN, >1000 Ci/mmol), washing extensively in cold media, and

lysing cells every 15 minutes thereafter for 2.5 hours. The percent release was calculated

by dividing the amount of protein in the media at each time point by the amount of

protein synthesized (lysates + media) at the initial time point.

Retroviral sequence analysis. Accession numbers of published avian retroviral

sequences obtained from GenBank were: NC_001407; AAQ55054; AAA46299; A48613;

TVFVMI; P03323; P06444; CAA68260; P06936; P06937; AAA42377; P03326;

CAC28508. Sequence alignment was performed based upon progressive pairwise

alignments using MultAlin software (60).

4.4 RESULTS

Following synthesis in the cytoplasm, the Gag polyprotein of RSV undergoes

transient nuclear localization. Export of Gag from the nucleus depends upon the Crm1

export pathway as treatment of Gag-expressing cells with leptomycin B (LMB)

significantly reduces the production of virus-like particles and leads to an accumulation

of Gag proteins within the nucleus (300). LMB, however, is a limited tool with which to

study the effects of nuclear trafficking in the viral life cycle because toxicity limits the

available interval of drug treatment. The role of nuclear transport of Gag in RSV

replication can be better studied either by disruption of the nuclear targeting signals

within Gag or by more complete disruption of specific cellular nuclear transport

pathways. We have therefore extended our studies to more precisely map the nuclear 141 export signal of the RSV Gag protein and to begin to elucidate the host cell factors that are involved in Gag export.

We have previously mapped a nuclear localization signal (NLS) to the first 88 residues of the MA region of Gag; this sequence is sufficient to direct the import of the heterologous reporter protein GFP into the nucleus. As well, we determined that the nuclear export signal of Gag resides within the p10 domain as deletions within the second half of the p10 protein prevent the efficient export of Gag from the nucleus. However, these large deletions may simply reflect structural alterations within the Gag protein which prevent the proper association of an authentic NES elsewhere within the protein with the host cell export machinery. To more precisely define the residues responsible for the export of Gag from the nucleus, hydrophobic amino acids within p10 were individually disrupted by alanine substitution in the context of the Gag.GFP protein. We predicted hydrophobic residues in the first half of p10 would be dispensable for nuclear export, as a large deletion encompassing the beginning of the p10 domain did not interfere with Gag export (300). To test this idea, we mutated three hydrophobic residues within this upstream region (leucine 180, leucine 184 and valine 187) to alanine. The triple mutation did not prevent the export of Gag from the nucleus, and the protein is localized throughout the cytoplasm and at the plasma membrane in all cells examined

(Figure 4.1 A and B). 142

L180A.L184A. L219A. W222A. V225A. L229A. V187A. Gag.GFP Gag.GFP Gag.GFP Gag.GFP Gag.GFP Gag.GFPV225A.

A C E G I

I

B D F H J

Figure 4.1: Identification of hydrophobic residues comprising the RSV Gag NES. The subcellular localization of mutant Gag.GFP fusion proteins was determined by confocal microscopy following transient transfection of quail cells. Top panels are low magnification images of Gag.GFP expressing cells while lower panels are higher magnification images of adjacent fields.

143 We next focused within the predicted NES region (217-

PALTDWARVREELAST-232) and changed each hydrophobic residue individually to alanine. Mutation of leucines at positions 219 or 229 and mutations of tryptophan 222 and valine 225 led to a dramatic redistribution of the Gag polyprotein (Figure 4.1 C-J).

Each of the four mutations prevents the export of Gag from the nucleus and leads to an accumulation of the vast majority of Gag proteins within the nucleus under steady-state conditions in all cells examined, thereby mimicking the phenotype of Gag proteins containing NES deletions, ∆p10.31.Gag.GFP and ∆p10.52.Gag.GFP described previously

(300). Unlike these larger deletions, the single amino acid alterations likely represent a direct crippling of the NES because the mutations are conservative amino acids changes that are unlikely to perturb the overall structure of the Gag proteins, the mutations are specific to hydrophobic residues which resemble a classical Crm1-dependent NES, and, in a small proportion of cells transfected with each construct, Gag proteins can be seen at the plasma membrane (see Figure 4.1F), indicating that if the Gag proteins can escape from or bypass the nucleus, they are competent for plasma membrane targeting and binding.

Treatment of Gag-expressing cells with leptomycin B not only sequesters Gag proteins within the nucleus, but consequently reduces the amount of Gag protein released from the cell, despite the limitations of a 3-hour drug treatment window. To determine whether deletion or mutation of the Gag NES would have a similar, or perhaps more profound, effect on the release of Gag, wild-type and mutant Gag proteins were transfected into quail cells, labeled with 35S-methionine and cysteine for 2.5 hours and

immunoprecipitated from the cell lysates and culture medium with polyclonal serum 144 against RSV (252). The amount of each Gag construct released from the cell relative to the total synthesized Gag protein was expressed relative to the release of the wild-type protein, which was normalized to 100% (The CMV.Gag.GFP and CMV.Gag constructs released 24.6 ± 11.7% and 29.2 ± 7.2% of the synthesized protein into the medium over a

2.5 hour labeling period.) Assays were performed using both CMV.Gag.GFP constructs, to allow correlation with confocal microscopy data, and also with CMV.Gag constructs, to remove effects of the C-terminal GFP sequence on particle release (Figure 4.2).

Mutant ∆QM1, which removes the end of the p2 domain and the beginning of the p10 region from Gag (residues 176-200), displays a modestly reduced particle release in the context of CMV.Gag.GFP (64.8 ± 16.3% of WT); in contrast, budding efficiency is somewhat enhanced in the context of the CMV.Gag protein (121.2 ± 26.5% of WT).

However, neither value differs significantly from the wild-type particle production

(p=0.0971 and 0.4681, respectively), and the discrepancy may reflect the ability of the mutant protein to assume different conformations in the two contexts. In contrast, the deletions which encompass the NES within the C-terminus of the p10 region produce a dramatic decrease in the production of virus-like particles both in the context of

CMV.Gag.GFP and CMV.Gag (p-values are <0.0001 and 0.0090 for ∆p10.31 and 0.0028 and 0.0052 for ∆p10.52). Therefore, the budding of these constructs is consistent with the localization of the mutant proteins within the nucleus and presents a more dramatic block than that which we have previously reported to result from treatment of Gag.GFP expressing cells with LMB (compare the relative particle release of 27.5 ± 3.0% for

∆p10.31.Gag.GFP and 33.5 ± 10.1% for ∆p10.52.Gag.GFP and to the relative release of 145 50.8 ± 5.9% for LMB-treated Gag.GFP cells relative to wild-type (300)). Similarly, single amino acid substitutions within the hydrophobic residues of the p10 NES produce a dramatic decrease in particle production (range from 18.9%-27.7% and p-values from

<0.0001-0.0037 for Gag.GFP constructs), indicating that these single mutations have individual effects as dramatic as deletion of the entire NES, and that each mutation can individually prevent NES function entirely. 146

Gag.GFP CMV.Gag

150

125

100

75

50 Relative percent release

25

0 Gag ∆QM1 ∆p10.31 ∆p10.52 L219A W222A V225A L229A

Figure 4.2: Reduced virus-like particle assembly for NES mutant Gag proteins. Transfected cells were labeled for 2.5 hours, lysed and immunoprecipitated with polyclonal antisera against RSV. The amount of Gag protein released into the culture media was calculated by phosphorimager analysis, expressing the amount of labeled Gag protein in the media as a percentage of the total labeled Gag protein in the media and cell lysates. Values were normalized to the wild-type Gag.GFP or CMV.Gag protein, which was set to 100% release. Each bar represents the average of at least three independent experiments.

147 Despite the reduction in viral particle release, Gag proteins containing NES mutations were still able to be released from the cell, suggesting either that the block to nuclear export is incomplete, that Gag proteins can escape the nucleus through a non-

Crm1 mediated pathway, or that a population of Gag proteins bypasses the nuclear compartment, traveling instead directly to the plasma membrane following synthesis in the cytoplasm. Expanding upon our experiments measuring the steady-state accumulation of proteins within the cell culture media, we also studied the rate of virus-like particle release by labeling cells for 15 minutes with 35S-methionine and cysteine, washing with

cold media, and then assaying every 15 minutes for particle release. We predicted that

mutant Gag proteins which bypassed the nuclear compartment or utilized a non-Crm1

mediated export pathway would be released from the cell with wild-type kinetics, while

any Gag proteins which transit through the nucleus and exit via the Crm1-dependent NES within p10 should show a drastic reduction in the rate of release from the cell as nuclear

export becomes the rate-limiting step in the assembly process. The wild-type CMV.Gag

protein is rapidly released from the cell, with half-maximal release of the protein after 30

minutes (Figure 4.3). Particle production peaks at 1.5 hours, and budding plateaus with approximately 40% of synthesized protein being released from the cell and the remaining protein likely being degraded by intracellular proteases. For each experiment, the amount of CMV.Gag protein released at the final time point was normalized to 100% release.

Mutant CMV.∆QM1.Gag, which deletes portions of the p2 and p10 domains, is released with kinetics that are only slightly reduced when compared to the wild-type protein, consistent with the preservation of a functional NES within this protein. In contrast, the two proteins with NES mutations, CMV.∆p10.52.Gag and CMV.L219A.Gag, release far 148 fewer viral particles, and the rate of release is severely decreased. Because the rate of release for the NES mutant Gag proteins is diminished, these data are consistent with the hypothesis that there is a single population of Gag proteins, all of which are released from the cell after trafficking through the same NES-dependent export pathway. 149

Gag L219A ∆p10.52 ∆QM1

100

75

50 Relative percent release percent Relative

25

25 50 75 100 125 150 175 Time (min)

Figure 4.3: NES mutant Gag proteins are released from the cell with delayed kinetics. Transfected cells were pulse labeled for 15 minutes and then chased with cold media. Samples were taken every 15 minutes, and the amount of Gag protein present within the culture media was expressed relative to the amount of Gag protein synthesized in the 15-minute labeling. The amount of wild-type Gag protein released after 2.5 hours was standardized to 100% for each assay. Curves represent the average of 4-5 independent experiments, with standard deviations denoted.

150 If the export signal of the Gag polyprotein is required for the life cycle of Rous sarcoma virus, we assumed that the NES would be conserved through evolution across a wide variety of avian retroviruses. Avian sarcoma and leukosis viruses (ASLVs) are stable within the genome of a broad range of avian species, revealing an ancient infection and subsequent vertical transmission of the endogenous provirus. When sequenced, these endogenous retroviruses revealed a remarkable conservation of the gag coding sequence.

Indeed, highly conserved regions within Gag correspond to the membrane-binding domain, the late domain, and the nuclear export signal (74). Based on the conservation of the p10 NES sequence among endogenous ASLVs, we sought to determine both whether the same signal was preserved through a diverse group of exogenous avian retroviruses and also whether amino acid substitutions in this region that were selected by evolution would preserve the activity of the Crm1-dependent NES.

Examination of available gag genes from the Alpharetrovirusese reveals that the

C-terminal p10 region from amino acids 216-240 is highly conserved (Figure 4.4A), although the gag genes from the Avian spleen necrosis virus, Lymphoproliferative disease virus and Avian leukemia virus e26 showed no overall homology throughout the gag region and are not depicted. Half of the viruses examined contained perfect identity with the amino acid sequence of Rous sarcoma virus. As well, many viruses contained a substitution of an isoleucine residue at position 225 for the valine residue present in RSV.

Because isoleucine is a residue that can also serve within a classical leucine-rich NES, these export signals could still retain full function in nuclear export. We therefore tested the ability of this sequence to function as an NES by converting the valine residue at position 225 in the Rous sarcoma virus Gag protein to an isoleucine residue. Sequence 151 analysis also revealed a surprising absence of selection for a leucine residue at position

225. Because we have demonstrated that substitution of an alanine at position 225 disrupts the nuclear export of Gag (Figure 4.1, G and H), we wished to determine whether a leucine residue at this position would also retain appropriate export function and therefore created a mutation of valine 225 to leucine within RSV Gag. 152

A. Rous sarcoma virus Avian leukosis virus LR-9 Myeloblastosis-associated virus 1/2 Avian myeloblastosis virus Avian retrovirus IC10 Avian myelocytomatosis virus 29 Avian myelocytomatosis virus hbi Avian erythroblastosis virus Avian endogenous virus ev-1 Rous-associated virus type 0 Fujinami sarcoma virus Musculoaponeurotic fibrosarcoma virus Avian endogenous retrovirus EAV-HP

B. Untreated LMB Untreated LMB Gag L229V.Gag V225I, V225I.Gag L229V.Gag W222L, W222L,

V225L.Gag V225L.Gag

Figure 4.4: Conservation of NES function across avian retroviral Gag proteins. (A) Sequence alignment of the C-terminal portion of the p10 domain of Alpharetroviruses using MultAlin analysis. The consensus sequence represents residues of >70% sequence identity. (B) Subcellular localization of wild-type and mutant Gag.GFP proteins transfected into quail fibroblasts in the absence (left panels) or presence (right panels) of 18 nM LMB.

153 Upon transfection into quail cells, we found that the V225I Gag mutant was able to be exported from the nucleus and localized predominantly to the cytoplasm (Figure

4.4B). As well, export of this mutant Gag protein from the nucleus was inhibited by treatment of cells with 18nM leptomycin B; the accumulation of a large proportion of the

V225I.Gag proteins within the cell nucleus following treatment indicates that the new export signal was still Crm1 dependent. Conversion of the valine at position 225 to leucine (V225L.Gag) did not abrogate NES function or LMB sensitivity, indicating that this valine residue, while critical for NES function, is tolerant of conversion to other hydrophobic amino acids that can serve within leucine-rich export sequences.

While most avian viruses examined contained the substitution at valine 225 as the only polymorphism within the export signal, the Avian endogenous retrovirus EAV-HP contained a substitution of both valine 225 to isoleucine and also of leucine 229 to valine.

Despite the lack of overall sequence conservation between this viral sequence and the other avian viruses examined, it remained possible that this altered sequence would still operate in nuclear export. We therefore changed the Rous sarcoma virus Gag sequence to substitute either the leucine at position 229 individually to valine (L229V.Gag) or to alter this residue in combination with the substitution of isoleucine at position 225 (V225I,

L229V.Gag) as is found in the Avian endogenous retrovirus EAV-HP sequence.

Because substitution of a leucine residue at position 225 was tolerated, we reasoned that conversion of both the tryptophan residue at position 222 and of the valine residue at position 225 to leucine (W222L, V225L.Gag), thereby creating a more canonical export signal comprised entirely of leucine residues, might also function in nuclear export. Localization of the mutant Gag proteins in transfected cells revealed that 154 substitution of the leucine residue at amino acid 229, either alone or in combination with the substitution of the valine residue at position 225, abolished the ability of this region of the p10 domain to confer nuclear export activity, and both the L229V.Gag and

V225I,L229V.Gag proteins were localized primarily to the nuclear compartment (Figure

4.4B). Addition of leptomycin B did not enhance nuclear localization, indicating that the mutant proteins have lost sensitivity to the drug. It therefore seems that the sequence present within the Avian endogenous retrovirus EAV-HP protein is not functional for nuclear export, although we cannot rule out the possibility that this protein employs additional hydrophobic amino acids within the p10 region to promote Gag nuclear export.

While we assumed that conversion of the native export signal to the more classical signal comprised entirely of leucine residues would still function in nuclear export, we found that the W22L,V225L.Gag protein was instead trapped within the nucleus (Figure 5B).

Taken together, these results indicate that both residues leucine-229 and tryptophan-222 are sensitive even to substitutions that should preserve NES function, and suggest a crucial role for these residues either in maintaining the structural conformation of the Gag polyprotein precursor, or in maintaining the structure specifically of the NES motif, thereby allowing it to be recognized by the Crm1 receptor.

Although we have demonstrated that hydrophobic residues are crucial for the function of the NES, there are an increasing number of NES sequences that have been identified which operate independently of the Crm1 pathway, despite containing classical

NES sequences (117). We would therefore prefer to study the nuclear trafficking of Gag both by altering the Gag export signal as well as by modulating the cellular export pathway. The discovery of this novel step in the life cycle of RSV allows us to begin to 155 probe for a new set of host proteins which interact with the Gag precursor and which are assumed by the virus to facilitate the assembly process. Crm1 is a soluble export receptor which associates with export cargo in the nucleus in complex with the small GTPase Ran.

Crm1 serves as an adaptor, mediating the docking to and transport through the nuclear pore. To date, many cofactors for Crm1-dependent export have been suggested. We began our studies with three nucleoporin proteins, components of the nuclear pore.

Nucleoporins 98 and 214 have been demonstrated to have an important role in the export of the HIV Rev protein, which also depends on Crm1 for nuclear export, while nucleoporin 153 has a more negligible role in Rev export. Previous studies have expressed the cargo binding motifs, the FG repeat regions, of these nucleoporins as dominant negative inhibitors and have thereby restricted the ability of Rev to export from the nucleus and promote HIV gene expression. In a similar manner, we wished to determine whether the RSV Gag protein required nucleoporins 98 and 214 for export from the nucleus, a finding that would broaden our understanding of the full complement of proteins mediating Gag trafficking.

We have introduced these FG repeat regions into the pDsRed.N1 vector

(Clontech) and expressed them with a wild-type Gag.GFP.FL protein (Figure 4.5A), which restores the C-terminus of the NC domain missing in the Gag.GFP construct and which localizes similarly to the cytosol and the plasma membrane. Co-expression of the

NP domains of nucleoporins 98 or 214 leads to a dramatic accumulation of the Gag protein in the nucleus (Figure 4.5, B and C), a similar, but more profound, phenotype as is seen with LMB treatment. In contrast, no alteration in Gag localization is seen upon co-expression of the NP domain of nucleoporin 153, indicating that this domain of 156 Nup153 does not affect the export of Gag. To quantitate the change in localization, cells expressing either the NP domains fused to DsRed or the DsRed vector alone were scored for localization of Gag.GFP.FL to either the cytosol exclusively (thin hatched bars), to both the nucleus and cytosol (black bars), or to a predominant localization to the nucleus

(thick hatched bars) (Figure 4.5E). The wild-type Gag protein shows a distribution that is

72.7 ± 5.9% localized to the cytosol, 27.4 ± 5.8 throughout the cell, and 0% concentrated in the nucleus. Upon expression of NP214 DsRed or NP98 DsRed, localization is dramatically altered, with 76.4 ± 1.5% and 43.3 ± 3.8% of the Gag.GFP.FL protein now predominantly localized to the nucleus. In contrast, expression of NP153.DsRed does not change Gag localization. These results suggest that in addition to Crm1, nucleoporins 98 and 214 are important cofactors for the export of the RSV Gag protein from the nucleus.

157

Gag.GFP + NP 214+ NP 98 +NP 153

AB CD

E 100% 80%

60%

40%

20%

0% DsRed NP214 NP98 NP153

Nuclear Cytoplasmic Nuc + Cy to

Figure 4.5: Inhibition of Gag nuclear export by dominant-negative nuclear pore proteins. Cells were co-transfected with Gag.GFP.FL and either pDsRed.N1 or the DsRed vector expressing the isolated NP domains from nucleoporins 98, 214 and 153 (386). (Panels A-D) Subcellular localization of the wild-type Gag.GFP.FL protein. Expression of the dominant negative forms of nucleoporins 98 and 214 relocalizes Gag to the cytoplasm, while the NP domain of nucleoporin 153 or the DsRed vector do not alter the steady-state distribution of Gag. (E) Cells expressing both Gag.GFP.FL and the DsRed protein either unconjugated or conjugated to the isolated NP domains were scored for the distribution of Gag.GFP to the cytoplasm exclusively (thin hatched bars), and equal distribution through both the nucleus and cytosol (black bars) or a predominant accumulation within the nucleus (thick hatched bars). Bars represent at least 200 cells from 3 independent experiments.

158 4.5 DISCUSSION

We have previously described the transit of the Rous sarcoma Gag polyprotein through the nucleus of infected cells (300). Following synthesis in the cytoplasm, the Gag polyprotein is imported into the nucleus, likely through the use of a nuclear import signal within the MA domain of Gag. We showed that deletions within the p10 region of Gag prevent the nuclear export of the protein, leading to accumulation of Gag in the nucleus and demonstrating that the presence of a functional p10 domain is crucial for export of

Gag. However, those results did not discriminate between whether the p10 domain was able to confer export activity to Gag, or simply interfered with proper Gag export by perturbing the overall structure of the protein. Here we have refined our studies to demonstrate that hydrophobic residues within this NES sequence of the p10 domain are important for nuclear export, as mutation of four hydrophobic residues between codons

219 and 229 of p10 prevent the export of the full-length Gag polyprotein.

Not only have we identified the NES within the Gag protein, but we have begun to define the cellular pathway required for NES function. Dominant-negative forms of nucleoporins 98 and 214 prevent the export of Gag from the nucleus. These two nuclear pore proteins have been demonstrated to affect the function of the HIV Rev protein, which is also Crm1 dependent, suggesting that both proteins use not only the same soluble export receptor, but likely use that receptor to make similar contacts with components of the nuclear pore. Because nucleoporin 98 is likely involved in the early interactions of export, and nucleoporin 214 is involved in the terminal dissociation of the cargo-receptor complex from the nuclear pore, the requirement of both these FG repeat 159 domains in export of HIV Rev and RSV Gag suggests a conserved pathway exploited by both retroviruses. The FG repeat region of nucleoporin 153 had no effect on Gag export, yet a slight effect on HIV Rev function, and also had a modest effect on the release of

RSV viral particles (data not shown). These discrepancies suggest either that our assay was less sensitive to indirect effects of pore structure on the export process, that nucleoporin 153 may be involved in Gag import into the nucleus, or that a domain of nucleoporin 153 other that the FG region tested may modulate Gag trafficking. Further experiments with purified nuclear transport proteins and with more informative genetic systems will be needed to further define the full spectrum of interactions that Gag makes both directly and indirectly with the nuclear pore.

Our results have led us to an important pathway used by the cell for export of specific RNA species; Crm1 has been defined as the export receptor for ribosomal RNA,

5S RNA and U snRNA. Crm1 interacts directly with numerous protein cargos, yet many proteins also serve as adaptors between Crm1 and the export substrate. The 60S ribosomal subunit is exported through the Crm1 pathway indirectly, through its association with the adaptor NMD3 (330). As well, the heat shock mRNAs are exported through the Crm1 pathway upon viral stimulation when the HuR protein binds the AU- rich elements of the heat shock mRNAs. HuR is not exported directly through the Crm1 pathway, but instead uses protein ligands, the adaptor proteins p32 and APRIL, which use their Crm1-dependent NESs to link HuR to the Crm1 receptor (111).

The Crm1 pathway has also been demonstrated to be assumed by numerous viruses to enhance viral replication. Again, the viral proteins that interact with the Crm1 160 receptor are often adaptor proteins that employ the Crm1 pathway for the export of genomic and sub-genomic RNAs that would normally be restricted from leaving the nucleus by the host cell. The first described ligand of the Crm1 receptor was the HIV Rev protein, which serves as the adaptor for the export of the unspliced RNA genome by binding to a cis-acting export element in the viral RNA. A similar Crm1-dependent post- transcriptional regulatory element (PRE) has been described for the unspliced transcripts of the Woodchuck hepatitis virus (266). Finally, the influenza viruses utilize the Crm1- dependent nuclear export signal of the M1 and NS2 proteins for the export of viral RNPs

(65).

The use of the Crm1 pathway extensively in the export of unspliced viral RNAs suggests that a similar mechanism may exist for RSV. Because we know that the Gag protein specifically recognizes the unspliced genome and selects it for packaging into assembling virions, it is reasonable to assume that the RSV Gag protein may also serve as a Crm1 adaptor protein. Rather than serving simply as a substrate for Crm1-dependent export, Gag therefore could serve to bridge the association of the unspliced viral RNA with the export receptor and thereby with components of the nuclear pore complex. The high degree of sequence conservation and of Crm1-dependent NES signal function among varied avian retroviruses suggests that export through this pathway is crucial for the propagation of infectious viruses. Indeed our results confirm that the C-terminal portion of the p10 domain has dual functions both in export of the Gag polyprotein for assembly and in maintaining the overall structure of the Gag protein, as only two Gag proteins containing NES mutations (V225L and V225I) predicted to retain NES function 161 were able to be exported from the nucleus. Analysis of these viral mutants as well as genetic dissection of the Gag export pathway will therefore be highly informative in understanding the role of the Crm1-dependent export of Gag in the RSV replication cycle.

162

CHAPTER 5

NUCLEAR TRANSPORT OF THE ROUS SARCOMA VIRUS GAG POLYPROTEIN IN SACCHAROMYCES CEREVISIAE 163 5.1 ABSTRACT

The Gag polyprotein serves as the structural precursor of retroviral particles.

During the replication cycle of Rous sarcoma virus, the Gag protein transits through the cell nucleus (300). Progress has been made toward identifying some cellular factors responsible for the nuclear transport of Gag; treatment of cells with the Crm1 inhibitor leptomycin B (LMB) or mutation of a leucine-rich NES within the Gag protein leads to a dramatic redistribution of the Gag protein from the cytoplasm to the nucleus of infected cells ((300), Chapter 4). Yet the nuclear import signal, the nuclear import receptor, and the full complement of cellular proteins mediating Gag nuclear export remain to be discovered. We have therefore used the genetic system of the budding yeast

Saccharomyces cerevisiae to begin to define the cellular partners for Gag during entrance into and exit from the nucleus. The expression level of the Gag protein relative to other ectopically-expressed proteins is very low in yeast cells, with Gag-expressing cells displaying altered cellular morphologies. As well as displaying expression problems in yeast cells, we find that both the Gag protein and a shorter derivative containing the MA, p2 and p10 domains of Gag do not show the same trafficking behavior as in avian cells.

While Gag localizes to the cytoplasm and plasma membrane in avian cells (300), we find that in yeast cells the Gag protein does not localize to the plasma membrane, but rather localizes throughout the cytoplasm, and in some cells, accumulates within the nucleus.

Surprisingly, the Gag protein appears to be insensitive to LMB in yeast cells, although the isolated NES fragment retains LMB sensitivity. Analysis of Gag localization in yeast strains containing deletions of the exportin genes msn5 and kap120, does not show an 164 accumulation of Gag proteins in the nucleus, suggesting that Gag trafficking is also independent of these export receptors. Although the adaptors for Gag nuclear translocation remain to be defined in yeast, these results suggest that this model system will be profitable for analyzing the proteins mediating transport of both the full-length

Gag protein as well as of the discrete targeting domains within Gag.

5.2 INTRODUCTION

Viruses, as obligate intracellular parasites, live in a dynamic relationship with the host cell. Viruses co-opt many host cell devices to facilitate gene expression, viral protein synthesis, virion assembly, and egress from the host cell. These interactions are often revealed through mutations within the virus or within the cell that prevent the proper replication of the virus. Attempts to use reverse genetics to investigate virus-host cell relationships therefore necessitates a genetic system amenable to analysis. With the completion of the Saccharomyces cerevisiae Genome Deletion Project, the budding yeast serves as the ideal candidate system as all 6000 yeast genes have now been systematically deleted, thereby allowing the function of any cellular gene product in viral replication to be easily assayed. Indeed, within the past year alone, the yeast system has been used to study the circularization of viral DNA (163), the role of defective interfering RNA in the viral life cycle (249), the ability of viral oncoproteins to influence the cell cycle and produce chromosomal instability (197), the processing and translation of viral mRNAs

(23,237,294,321), the partitioning of viral episomes (152), and the glycosylation of secreted viral proteins (185), as well as for the production of viral proteins for diagnostic 165 and immunological assays (296,338). Analysis of viral replication in yeast is feasible as entire replication cycles (269) and assembly of viral capsids (178,340) have been achieved in yeast cells.

The Rous sarcoma virus (RSV) encodes three polyproteins: the structural Gag protein, the replicative enzymes within the Pol protein, and the surface glycoprotein Env.

Viral assembly is directed by the Gag polyprotein, which is synthesized on cytosolic ribosomes, translocates through the nucleus, and then is targeted to the plasma membrane. At the membrane, Gag drives the formation of a spherical bud, which is severed from the cell through a membrane fission event. Host cell factors that the virus requires to accomplish each of these steps remain to be defined. For example, the release of the virion from the cell seems to involve components of the endosomal sorting machinery that is recruited from multi-vesicular bodies to the plasma membrane (267).

The most important players in this process, however, are just beginning to be elucidated.

Several laboratories have expressed the Gag polyprotein in yeast cells in attempts to understand the host cell machinery used for viral budding. Expression of the HIV Gag protein leads to the formation of electron dense aggregates below the plasma membrane

(295). Indeed, Gag proteins can be immunoblotted from the supernatants of yeast spheroplasts; the released virus-like particles (VLPs) resemble the authentic virus in both size and density, and gradient purified VLPs had the morphological features of immature

HIV particles, with an electron dense ring underneath the host-derived lipid bilayer (295).

Rous sarcoma virus can be expressed in Saccharomyces cervisiae as well, with detection of the Pr76gag precursor in cell lysates. The RSV Gag protein may be less stable than the

HIV Gag protein in yeast cells, however, with substantial amounts of processing 166 intermediates detectable in cell lysates. Mutation of the viral protease active site results in extensive proteolysis of the Gag protein by cellular proteases (22). While the Gag protein fractionated with the plasma membrane of yeast cells, the viral CA (capsid) protein, a cleavage product of Gag, was found in the cell cytosol, indicating that Gag can properly traffic to the plasma membrane in yeast cells where it is proteolytically processed.

However, no virus particles were released from yeast cells, likely because the yeast cell wall was not removed.

In addition to trafficking to the plasma membrane, the RSV Gag polyprotein transits through the nucleus of infected avian cells (300). Transport through the nuclear pore is accomplished through recognition of either a nuclear localization signal (NLS) or nuclear export signal (NES) on a cargo protein. The classical pathway of nuclear import involves recognition of the NLS sequence by the importin α receptor. Importin α serves as an adaptor for the association of the import substrate with importin β. Importin β contacts the nuclear pore complex (NPC), thereby translocating the cargo across the nuclear pore in association with accessory factors, such as Ran and p10. Importin α recognizes classical, basic nuclear localization signals present within import substrates, such as the SV40 T antigen and the nucleoplasmin protein. However, many proteins contain non-classical nuclear import sequences; the diversity of these signals is still being elaborated, and therefore no additional canonical consensus motifs can be defined. These non-classical NLSs are recognized by additional members of the importin β superfamily; there are currently 14 soluble import receptors related to importin β. Most of these receptors have only one or two defined import cargos, and indeed, they may serve to import specialized cargos across the pore. It is known that these soluble receptors make 167 contacts with specific components of the nuclear pore complex, the nucleoporin proteins.

The import receptor used by each import cargo may determine the mechanism of transport through the pore and therefore the fate of the transported protein once it is released from the pore complex. It is therefore crucial to understand the mechanism of import of non-classical proteins, the import signal used, and the diversity of import cargos recognized by each soluble receptor, thereby allowing us to understand the mechanisms and reasons for non-classical protein import.

We have identified a non-classical nuclear localization signal within the MA region of the RSV Gag polyprotein. The first 88 amino acids of the MA region are sufficient to direct the GFP reporter protein into the nucleus (300). However, the MA region does not contain a patch of basic residues, and mutation of several dispersed basic residues within the first 88 amino acids of Gag has no effect on the ability of the Gag protein to enter the nucleus (E. Ryan, L. Scheifele, E. Callahan, J. Wills and L. Parent, unpublished results). Mapping of this non-classical NLS may be facilitated by understanding the pathway of Gag protein import and thereby the mechanism of nuclear translocation.

5.3 MATERIALS AND METHODS

Plasmids. Plasmids pIGinA and pIGoutA (Figure 5.1) contain the Gal1 promoter between EagI and MunI sites, either the first 7 or 67 codons of the histone 2B protein between MunI and BamHI sites, and two copies of the GFP gene in frame between EcoRI 168 and HindIII, and HindIII and XhoI sites of the pRS426 plasmid (New England Biolabs;

Beverly MA). Control inserts contained the NLS signals from the SV40 T antigen or the

Mod5 protein (331) or NES signals from the Gle1 and Rna1 (93) proteins inserted between BamHI and EcoRI cloning sites. The MA-p2-10 insert was PCR amplified from the wild-type Prague C genome of Rous sarcoma virus with primers Pare 228

(CGATTGAAGAGATCTTTCTGGTCGCCCGGTGGATCA) and Pare 278

(GCTAACTGAGAATTCTACGTAAGGCATGGACACCACGGGC) introducing BglII

and EcoRI sites (underlined); following digestion with these enzymes, the fragment was ligated into the complimentary ends of the pIGinA and pIGoutA vectors digested with

BamHI and EcoRI. The avian expression vectors pGag.GFP.FL and pGag.PR(D37S).GFP were created by PCR amplification of the RSV genome and ligation into the pGag.GFP vector (43) between SdaI and ApaI sites. pIGinA.Gag and pIGinA.Gag.PR(D37S) were created by digestion of the avian expression vectors with

ApaI, digestion with 10U DNA polymerase I (New England Biolabs, Beverly MA) and digestion with BspEI; fragments were ligated into pIGinA.Map2p10 cut with EcoRI,

extended with 10U DNA polymerase I (NEB) and digested with BspEI.

Fluorescence microscopy. Plasmids were transformed into yeast strain W303

(MATα, ade2-1 ura3-1 his3-11, 15 trp1-1, leu 2-3, 112) by the lithium acetate method

(142) and selected on synthetic complete media lacking uracil. Single colonies were subsequently grown on Ura- plates and induced on plates containing 2% galactose as the

carbon source for 4-6 hours, at which time 10-50% of cells were expressing the

detectable fluorescent protein. To determine Crm1 dependence, plasmids were 169 transformed into strain MNY8 (233) (MATa ∆CRM1::KANr leu2- his3- trp1- ura3- pDC-

CRM1T539C) and selected on synthetic complete media lacking both uracil and leucine.

Cells were grown to log phase, induced for 6 hours in 2% galactose and treated for 30 minutes with 100 ng/mL LMB (Sigma). Live cells were imaged with a Nikon

Microphot-FX microscope using a SenSys charge-coupled camera (Photometrics, Tucson

AZ) and QED imaging software (QED Imaging, Pittsburgh PA).

Indirect Immunofluorescence. Cells were grown to mid-log phase, induced to express the pIGin and pIGout vectors for 6 hours at 23ºC and fixed in 4% formaldehyde.

Cell walls were removed by digestion with 5% glusulase and 0.1 mg/ml zymolyase 20T

(ICN Biomedicals, Costa Mesa CA) in the presence of 1% β-mercaptoethanol. Cells were washed extensively in solution B (40 mM K2HP04-KH2P04 (pH 6.5), 0.5 mM MgCl2,

1.2M sorbitol), seeded onto poly-L-lysine coated slides, blocked in solution F (0.57 mM

KH2P04 (pH 7.4), 145 mM NaCl, 2% BSA, 15 mM NaN3), stained with antibody against

GFP (1:250; Roche) and secondary antibody conjugated to Cy3 (Jackson

ImmunoResearch Laboratories, West Grove PA). Nuclei were counterstained with DAPI

and slides were mounted in p-phenylenediamine in glycerol and sealed with nail polish.

Western blotting. Transformed W303 cells were grown to log phase, induced for

6 hours in medium containing 2% galactose at 23˚C until 10-15% of cells were

expressing detectable GFP fusion proteins and then collected by centrifugation at 3000

rpm for 5 minutes at 4˚C. Cells were washed in ice-cold glass distilled water and resuspended in 200 µl breaking buffer (40 mM Tris-Cl (pH 7.4), 20 mM EDTA, 2 mM 170 DTT) containing protease inhibitor cocktail (Sigma). Cells were lysed in 15 ml Corex tubes by extensive vortexing with 300 µl of glass beads at 4˚C. Supernatants were clarified by centrifugation at 10,000g for 10 minutes at 4˚C. Protein concentrations were determined by a BCA protein assay according to manufacturer’s specifications (Pierce

Biotechnology, Rockford IL), and 25 µg of yeast cell lysates were loaded onto a 10%

SDS-PAGE gel. Samples were transferred to nitrocellulose, probed with antibody against

GFP (1:2500; Abcam) and secondary antibody conjugated to HRP (Sigma), and viewed by chemiluminescence using the Super Signal West Pico substrate solution (Pierce).

Transformations in 96-well plates. Strains containing deletions in the unessential karyopherin genes were obtained from the Saccharomyces Genome Deletion

Project (http://sequence-

www.stanford.edu/group/yeast_deletion_project/deletions3.html). 250 µl samples from

saturated cultures grown in YEPD (yeast extract/peptone dextrose) medium were seeded

into 96 well plates. Cells were pelleted by centrifugation at 2500 rpm for 10 minutes and

resuspended in 100µl transformation mix (0.2M LiAc, 40% PEG, 0.1M DTT, 4% single

stranded salmon sperm DNA). 500 ng of DNA was added per well with gentle pipetting

and cells were incubated for 1 hour at 45˚C. 3 µl of the cell suspension was then added to a new plate containing 200 µl of synthetic complete media lacking uracil and incubated at

23˚C for 3 days. A portion of the transformed cells were pelleted by centrifugation,

washed once and then resuspended in synthetic complete media lacking uracil and 171 containing 2% galactose. Following a 6-hour incubation, cells were imaged by live cell fluorescent microscopy.

5.4 RESULTS

Expression of the Gag polyproteins of both HIV and RSV in yeast cells has been accomplished through the use of both inducible and constitutive expression systems, leading to the accumulation of Gag proteins detectable either by immunoblotting or by immunoprecipitation following metabolic labeling of cells (22,295). We wished to develop an expression system for the RSV Gag polyprotein that would allow both for inducible expression of the Gag polyprotein as well as for the visualization of Gag by fluorescent microscopy in living cells. We therefore used a new inducible expression system termed the pIGin/out vectors (Figure 5.1). The pIGin/out vectors exist as multi- copy replicons controlled by the 2µ origin of replication. Expression of the target gene is driven by the Gal1 promoter. When yeast cells are maintained in media containing glucose as the carbon source, no detectable expression of the GFP reporter is seen; however, when cells are switched to media containing galactose, the Gal1 promoter is induced, driving expression from the promoter greater than 1000-fold over the basal levels. 172

Gal 1 Test NLS sequence promoter BamHI EcoRI

pIG in vector GFP GFP

Gal 1 Test NES sequence promoter BamHI EcoRI

pIG out vector NLS GFP GFP

Figure 5.1: Schematic of the pIGin and pIGout vector system. Vectors are derived from the pRS426 plasmid (NEB) and contain the 2µ origin of replication and an ampicillin resistance gene. Test proteins are introduced between unique BamHI and EcoRI cloning sites in frame with either the first 7 or 67 amino acids of the histone 2B protein and two copies of the GFP gene. Gene expression is controlled by the Gal1 promoter.

173 These vectors allow visualization of a target protein which is cloned as a fusion with GFP; tandem, in-frame copies of GFP are used both to amplify the fluorescent signal as well as to restrict the fusion protein from passive diffusion through the nuclear pore complex. The inserted protein sequence is not initiated from its own translation start site, but rather is cloned as a fusion with the yeast histone 2B protein as has been previously described (222). The pIGin vector contains the N-terminal 7 amino acids of the histone protein, while the pIGout vector contains the first 67 amino acids, within which lies the NLS of the histone protein. These expression vectors therefore allow us to test whether the inserted sequence is capable of functioning as an NLS (pIGin vector, containing 7 residues of histone 2B), or whether the sequence is able to act as an NES

(pIGout vector, containing 67 residues of histone 2B), counteracting the histone NLS and transporting the fusion protein into the cytoplasm.

As has been described previously, expression of RSV Gag can be detected in yeast cell lysates following induction (22). To verify that RSV Gag could be expressed by the pIGin and pIGout vectors, yeast cells were lysed with glass beads and expression of GFP fusion proteins was examined by Western blot 6 hours after galactose induction

(Figure 5.2). Throughout all samples, a background band of 55-56 kD is routinely seen with the α-GFP antibody employed. The parental vector pIGin was detected as a full- length band consistent with the expected size of 54 kD. Introduction of a canonical NLS from the Mod5 cellular protein into the pIGin vector produced a product close to the expected 62 kD size with no detectable free GFP (27 kD) released. As well, insertion of the region encompassing the MA, p2 and p10 regions of Gag into the pIGin vector

(pIGin.MA.p2.p10) produced an abundant protein between 82 and 90 kD in size, with no 174 degradation evident, confirming that a protein containing both the NLS present in MA and the NES present in p10 can be stably expressed within yeast cells. In contrast, the

Gag protein could not be detected in 25 µg of induced cell lysates, suggesting either that synthesis of the full-length Gag polyprotein is less efficient than of the MA.p2.p10 fragment, that the Gag protein is less stable and is rapidly degraded, or that expression of the Gag protein is toxic to the sub-population of cells which express the protein. In contrast, the Gag.PR (D37S) protein, which contains the Gag protein through the catalytically inactive protease, is better expressed in yeast cells, with a faint band appearing between 108 and 128 kD. Western blotting also reveals the stable expression of the pIGout vector, which is larger than the pIGin vector due to the presence of the histone

NLS sequence. As well, introduction of the previously defined NESs of the Gle1 or Rna1 proteins produces detectable levels of the fusion proteins in yeast cells (approximate sizes

78 and 67 kD) with no release of unconjugated GFP. Finally, the MA.p2.p10 region is also expressed to high levels in the pIGout vector. Therefore, the fragment MA.p2.p10 fragment is the most highly expressed RSV protein tested that contains both an NLS and

NES viral sequence. 175

0 0 S S 1 S 1 E E p L p N 2. N 2. R N p 5 p P 1 a1 . d . g . le n A o A a ag G R M t t M M G G ut u u ut in in in in in o o o o IG IG IG IG G IG IG IG IG p p p p pI p p p p

128.8 kD 90 kD

82.6 kD

50.7 kD

43.0 kD 35.5 kD

Figure 5.2: Expression of RSV fusion proteins in yeast cells. Yeast cells transformed with pIGin and pIGout vector constructs were induced with 2% galactose, lysed with glass beads, and blotted with antibody against GFP. Fusion proteins are stably expressed with no release of either tandem (54 kD) or single (27 kD) copies of the GFP protein that would contribute to the observed pattern of fluorescence.

176 The RSV Gag protein localizes to the cytoplasm and plasma membrane in quail fibroblasts (43,300). Expression of only the MA.p2.p10 region of Gag reduces the amount of protein present at the plasma membrane, yet does not alter the diffuse distribution of Gag in the cytoplasm ((300); L. Scheifele and L. Parent, unpublished results). Gag proteins are only detectable in the nucleus of avian cells when the Gag export pathway is interrupted, such as following treatment of cells with the drug leptomycin B (300). Before beginning genetic analysis of the Gag protein in yeast cells, it was therefore necessary to determine both whether the distribution of Gag to the cytoplasm would be replicated in the yeast expression system and whether the p10 domain was a functional export signal in the yeast system. We therefore induced yeast cells transformed with viral expression constructs with galactose for 6 hours and examined localization of the synthesized GFP fusion proteins in more than 100 cells expressing each construct by live cell fluorescent microscopy. The pIGout vector, which contains the histone 2B NLS as a fusion with two copies of the GFP protein localizes strongly to the nucleus in all cells, with very little accumulation of the protein within the cytoplasm (Figure 5.3 A). Addition of the NES from the Gle1 protein leads to a partial redistribution of the signal from the nucleus into the cytoplasm, although the nuclear pool is still maintained (Figure 5.3B), indicating that the Gle1 NES is not strong enough to fully counteract the import activity of the histone NLS. In contrast, the NES from the

Rna1 protein is able to compete with the NLS of the pIGout vector, leading to a more dramatic distribution of the pIGout.Rna1 protein into the cytoplasm of all cells observed

(Figure 5.3C). The pIGout.MA.p2.p10 protein has a localization reminiscent of the pIGout.Gle1 construct, with a variation in the amount of fluorescent signal in the 177 cytoplasm, but with a significant nuclear pool retained (Figure 5.3D). Although the NES present within the p10 region is functional in yeast cells, as seen in its ability to partially distribute the protein into the cytoplasm, it is not able to fully counteract the NLSs present within both the histone 2B portion and the MA region of the pIGout.MA.p2.p10 fusion. 178

pIGout pIGout.Gle1 NES pIGout.Rna1 NES pIGout.MAp2p10 Gag.GFPV225A.

C B E G I

pIGin pIGin.Mod5 NLS pIGin.MAp2p10 pIGin.GagA. pIGin.Gag.PR.

I

D F H J

Figure 5.3: Localization of RSV fusion proteins in yeast cells. Transformed cells expressing either pIGout (A-D) or pIGin fusion proteins (E-I) were induced in 2% galactose and viewed under a fluorescent microscope. The pIGout protein localizes strongly to the nucleus (A), and localization can be partially or fully redistributed to the cytoplasm by the NES signals of the Gle1 (B) or Rna1 (C) proteins, respectively. The pIGin.MA.p2.p10 sequence produces a localization to both the nucleus and the cytoplasm (D). The pIGin construct localizes to the nucleus (E) until an NLS, such as that from the Mod5 protein (F) is introduced. The pIGin.MA.p2.p10 protein (G) is found within the cytoplasm while the pIGin.Gag (H) and pIGin.Gag.PR (I) proteins have a more heterogeneous localization to both the cell nucleus and the cytoplasm.

179 The pIGin vector, which contains tandem copies of the GFP gene without a heterologous NLS, was expressed throughout the cell, with an even distribution between the nucleus and the cytoplasm (Figure 5.3E). When the previously defined NLS from the cellular Mod5 protein is introduced into the pIGin vector, the fusion protein now localizes strongly to the cell nucleus of all yeast cells examined, visible in dividing cells as the streaming of the nucleus from the mother to the daughter cell (Figure 5.3F). In contrast, expression of the pIGin.MA.p2.p10 protein reveals a localization that is diffuse throughout the cytoplasm but seems to exclude the nucleus, visible as a dark spot at the site of cell-cell contact (Figure 5.3G). This distribution is identical to that seen in avian cells, with localization exclusively to the cytoplasm. Expression of the Gag polyprotein through either the NC region (pIGin.Gag, Figure 5.3H) or through the PR domain

(pIGin.Gag.PR (D37S), Figure 5.3I) reveals fluorescence throughout the nucleus and the cytoplasm, without the apparent nuclear exclusion of pIGin.MA.p2.p10. However, the expression level of both the pIGin.Gag and pIGin.Gag.PR (D37S) proteins appears to be much below that of the pIGin.MA.p2.p10 protein, with a much lower overall fluorescence intensity, consistent with the lower expression level visible by Western blot analysis (Figure 5.2). As well, expression of these longer forms of the Gag protein appears to affect the overall morphology of the yeast cells, with extension of the normally round cells into oval or bullet shapes. This phenotype may suggest that the Gag protein is properly targeting to the plasma membrane in yeast cells, as has been previously suggested (22), but that without the ability to bud through the cell wall, rather than making viral particles, Gag proteins are aggregating under the plasma membrane and interrupting normal cellular morphology or metabolism. These data suggest that the Gag 180 protein can be stably expressed in yeast cells, but that expression levels are low compared to other sequences. Expression of the full-length Gag protein in yeast does not fully recapitulate the localization in avian cells because Gag does not exclude the yeast cell nucleus. Although Gag displays an altered partitioning between the nuclear and cytoplasmic compartments, the transport mechanism and pathways may yet be conserved.

While localization within live cells suggests that the pIGin.MA.p2.p10 protein excludes the nucleus while the pIGin.Gag and pIGin.Gag.PR proteins localize to both the nucleus and cytoplasm in at least some cells, the partial phenotypes make these conclusions tenuous without confirmation of the location of the nucleus in observed cells.

As well, due to the low expression levels of the pIGin.Gag and pIGin.Gag.PR constructs, we wished to assay protein localization by indirect immunofluorescence to increase the fluorescent signal. Indirect immunofluorescence with antibody against GFP confirms localization of the pIGout vector to the nucleus in a pattern overlapping the DAPI fluorescent DNA stain (Figure 5.4A and B). As well, the localization of the pIGout.Gle1 and pIGout.Rna1 proteins is unaltered when compared with live cell fluorescence, with the pIGout.Gle1 protein predominantly in the nucleus with some cytoplasmic signal and the pIGout.Rna1 protein exclusively in the cytoplasm (Figure 5.4C-F). Addition of viral sequences to the pIGout vector (pIGout.MA.p2.p10, Figure 5.4G and H) reveals a localization to the nucleus and a weak staining of the cytoplasm, again confirming that the NES within the p10 region is only partially able to counteract the NLS activities present within the pIGout vector sequence and the MA region. 181

pIGout pIGout.Gle1 NES pIGout.Rna1 NES pIGout.MAp2p10 B E G I Gag.GFPV225A.

I

D F H J

pIGin pIGin.Mod5H NLSH pIGin.MAp2p10 pIGin.GagJ A. pIGin.Gag.PR.

Figure 5.4: Immunofluorescence analysis of RSV fusion proteins. Cells expressing GFP fusion proteins were stained with antibody to GFP and secondary antibody conjugated to Cy3 (top panels) and with DAPI (bottom panels). Localization recapitulated that seen in live cells, with the pIGout vector localized to the nucleus (A and B), the pIGout.Gle1 (C and D) and pIGout.Rna1(E and F) proteins staining either the nucleus and cytoplasm or the cytoplasm exclusively. The pIGout.MA.p2.p10 protein localizes to the nucleus and cytoplasm (G and H) The pIGin protein excludes the nucleus as visualized by DAPI staining (I and J). Addition of the Mod5 NLS leads to a primarily nuclear accumulation (K and L). While the pIGin.MA.p2.p10 protein displays no staining of the nucleus (M and N), the pIGin.Gag (O and P) and pIGin.Gag.PR (Q and R) proteins show distributions that both include and exclude the nucleus.

182 Whereas the pIGin tandem GFP fusion protein localized diffusely throughout the cell when viewed by live cell microscopy (Figure 5.3E), when examined by indirect immunofluorescence, the protein seems to exclude the nucleus (Figure 5.4I and J). The size restriction on nuclear transport that should prevent nuclear import of this protein is not seen in live cells, possibly because the intensity of the fluorescence obscures the lack of signal from the nucleus. Again, introduction of the NLS from the Mod5 protein strongly introduces the fusion protein into the nucleus (Figure 5.4K and L). However, the pIGin.MA.p2.p10 protein seems to exclude the nucleus, with no overlap of fluorescence with the DAPI nuclear stain (Figure 5.4 M and N). In contrast, the pIGin.Gag and pIGin.Gag.PR proteins show a variety of distributions; some cells exclude the nucleus

(Figure 5.4 Q and R), others show a localization that is equal throughout the cytoplasm and nucleus, and others show an accumulation within the yeast cell nucleus (Figure 5.4 O and P). Again, the localization of Gag in yeast cells seems to differ from that in avian cells, where an exclusively cytoplasmic and plasma membrane localization is seen.

The altered localization of the Gag protein suggested either that the import signal is more efficiently recognized in yeast cells or that the Crm1-dependent export signal is utilized more weakly. While the Crm1 protein has a yeast homolog (Xpo1), this protein is not sensitive to LMB, as a threonine replaces the cysteine residue targeted by the drug.

Alteration of this threonine to a cysteine residue (T539C) renders cells susceptible to

LMB treatment, leading to an accumulation of Crm1-dependent cargo in the cell nucleus

(233). We have therefore transformed strains carrying the LMB-sensitive allele with our vectors expressing parts of the RSV Gag protein to determine whether Gag remains LMB sensitive in yeast cells. 183 The pIGin and pIGout vectors localize to the cytoplasm and nucleus, respectively, and their localization is not altered by treatment of cells with LMB (Figure 5.5 A-D). In contrast, the pIGout.Rna1 protein localizes to the cytoplasm, but accumulates strongly in the nucleus following 30 minutes of LMB treatment (Figure 5.5 E-F). Surprisingly, the pIGin.MA.p2.p10, pIGin.Gag and pIGin.GagPR proteins do not accumulate in the nucleus following LMB treatment, with the localization to the cytoplasm and throughout the cell preserved in LMB treated cells (Figure 5.5 G-L). These results cannot distinguish whether the NES within p10 is operating independently of Crm1 or whether the import signal in the MA domain is unable to mediate Gag import. We therefore assayed the pIGoutMA.p2.p10 protein, which we assumed would be shuttling between the nucleus and cytoplasm via the heterologous NLS of the histone 2B protein. Treatment of cells expressing the pIGout.MA.p2.p10 protein with LMB did not result in reduction of the cytoplasmic pool, suggesting that despite the strong NLS present within the histone sequence, the fusion protein was still unable to localize exclusively to the nucleus following LMB treatment (data not shown). Because these results suggested that the NES within the p10 domain was either nonfunctional or else utilized a different export pathway in yeast cells, we tested the ability of the p10 domain both to confer export to a nuclear protein and subsequently to be inhibited by LMB treatment. The pIGout.p10.NES protein contains residues 217-233 of the p10 domain of Gag fused to the histone 2B NLS and two copies of the GFP protein. This protein did localize exclusively to the cytoplasm in untreated cells (Figure 5.5M), suggesting that the Gag NES is functional in yeast cells and is strong enough to counteract the NLS of the pIGout vector. As well, the protein was 184 redistributed from the cytoplasm to the nucleus following 30 minutes of LMB treatment

(Figure 5.5 N), indicating that, as in avian cells, the p10 NES is Crm1-dependent.

185

pIGinpIGout pIGout.Rna1 NES pIGin.MAp2p10

pIGin.GagA. pIGin.Gag.PR. pIGout.p10 NES

Figure 5.5: LMB sensitivity of pIGin and pIGout fusion proteins. Plasmids were transfomed into the LMB-sensitive yeast strain MNY8, induced to express GFP fusion proteins and either treated (lower panels) or not treated (top panels) with 100 ng/ml LMB for 30 minutes. The localization of the pIGin (A and B) and pIGout proteins (C and D) is unchanged by LMB, while the pIGout.Rna1 (E and F) and pIGout.p10 NES (O and P) proteins become trapped within the nucleus upon LMB treatment. In contrast, the pIGin.MA.p2.p10 (G and H), pIGin.Gag (I and J), pIGin.Gag.PR (K and L), and pIGout.MA.p2.p10 proteins (M and N) are unaffected by the presence of LMB.

186 Because we observed this discrepancy between the isolated p10 NES, which was

Crm1 dependent, and the longer proteins MA.p2.p10, Gag and Gag.PR, which were insensitive to Crm1 inhibition in yeast cells, we considered that another export pathway might be the predominant pathway used by the Gag polyprotein in yeast cells, thereby explaining the predominant localization of these proteins to the cytoplasm. We investigated the possibility that other importin-β family members might mediate Gag trafficking by transforming the pIGin.MA.p2.p10, pIGin.Gag and pIGin.Gag.PR proteins into strains of yeast containing deletions in the importin-β family members. There are 14 importin-β family members in yeast, of which nine genes are unessential and were employed in this study. Of the nine, seven have been identified as import receptors and two as export receptors. When transformed into three of the seven strains deleted for an import receptor, the pIGin protein does not show an altered localization, but remains in the cytoplasm (Figure 5.6). Likewise, the pIGout protein is unaffected by the deletion of any of the seven import receptors tested, remaining localized predominantly to the nucleus; this is consistent with the utilization of the Karyopherin 95 (importin-β) import receptor by the histone 2B protein. 187

A. pIGinpIGout pIGin.MAp2p10 pIGin.Gag.PR.

nmd5∆

sxm1∆

∆

kap123∆

∆ B.

kap120∆

∆

msn5∆

Figure 5.6: Localization of RSV fusion proteins in yeast cells deleted for importin-β family members. Cells were transformed with pIGin and pIGout fusion proteins, selected in medium lacking uracil for 3 days and then induced to express test protein with 2% galactose. Localization of fusion proteins was examined in live cells. While localization of RSV proteins is perturbed in importin mutants (Panel A) with aggregation of many proteins within distinct cytoplasmic foci, localization is unaltered in the two exportin mutant strains employed, kap120∆ and msn5∆ (Panel B).

188 When viral proteins are introduced into these mutant stains, however, gross alterations to the localization of the fusion proteins are seen. Indeed, the pIGin.MA.p2.p10 and pIGin.Gag.PR proteins show large spots of fluorescence within the cell. These areas seem to be distinct from the cell nucleus as they often face away from the site of budding of the daughter away from the mother cell, are smaller than the volume of the nucleus, and exist in multiple copies per cell. Instead, these accumulations could represent degradation of the viral proteins in the yeast vacuole; it is interesting that these indirect effects produced by inhibiting nuclear transport affect only the fusion proteins expressing viral sequences. These data may shed light on the altered subcellular targeting of Gag in yeast cells and might suggest that the Gag protein can induce gross morphological changes when not properly targeted through the nucleus and to the plasma membrane for budding.

While the importin-β family members that act as import receptors appear to influence Gag trafficking nonspecifically, we also tested the ability of the importin-β export receptors to mediate Gag transport, thereby leading to an accumulation of the viral proteins in the nucleus of the cognate deletion strain. Expression of the pIGin and pIGout proteins revealed no alteration in subcellular localization in either the kap120∆ or msn5∆ strains. Similarly, the pIGin.MA.p2.p10 and pIGin.Gag.PR proteins retained their localization to the cytoplasm in the kap120∆ or msn5∆ strains, indicating that these two export receptors do not act as the dominant Gag export receptors in yeast cells. Therefore, although Gag localizes predominantly to the cytoplasm in yeast cells, the export receptor 189 for Gag in yeast and the ability of the Gag protein to transit through the yeast cell nucleus remains to be confirmed.

5.5 DISCUSSION

Yeast cells serve as a model system for the nuclear transport of proteins as the nuclear transport pathways are highly conserved from lower eukaryotes through man. We therefore sought to express the Rous sarcoma virus Gag polyprotein in yeast cells to study the cellular mediators of RSV Gag nuclear trafficking. The Gag polyprotein has been expressed in yeast cells previously, with stable, high-level expression following induction of protein expression. Not only is the protein expressed within cells, but it is properly processed into the mature forms of the polyprotein following membrane targeting (22).

We have expressed the RSV Gag protein in yeast cells as a fusion with the GFP reporter gene to determine the protein’s subcellular localization. While expression of

Gag is detectable in cells following induction, the number of cells expressing the pIGin.Gag protein, and the intensity of fluorescence obtained from those cells is minimal.

As well, there is minimal expression of both the pIGin.Gag and pIGin.Gag.PR proteins in induced cells by immunoblotting (Figure 5.2). Although the GFP antibody used may not produce a signal as intense as the RSV antiserum employed by Bonnet et.al., the expression of the pIGin.Gag and pIGin.Gag.PR proteins is far lower than seen for the pIGin and pIGout proteins either alone or fused to test NES and NLS sequences. In contrast, expression of the pIGin.MA.p2.p10 and pIGout.MA.p2.p10 proteins is robust. 190 These results suggest either that the RSV Gag protein is unstable in yeast cells and is rapidly degraded, or that it is inefficiently synthesized due to the altered codon preferences between yeast and avian cells; the greater size of the Gag and Gag.PR proteins (64 and 76kD) compared to the MA.p2.p10 (31 kD) section of Gag may account for the discrepancy in expression levels.

Previous reports have indicated that, when expressed in yeast cells, the Gag protein of RSV fractionates with markers of the plasma membrane in sucrose gradients while the mature CA protein migrates with the cytoplasmic fractions (22). When examining the localization of the Gag protein in yeast, we found no fluorescent staining of the yeast cell membrane, although it is possible that the fluorescence at the plasma membrane is obscured by the yeast cell wall. We did, however, observe changes in cellular morphology upon expression of the Gag protein. In cells expressing the Gag protein, fewer cells were undergoing cell division, with mostly mature cells observed

(Figure 5.3), and very few budding structures visible. As well, observed cells were oblong and bullet shaped, with an overall size seemingly larger than cells expressing the vectors alone. These alterations could be attributed to targeting of the Gag protein to the plasma membrane, with accumulation of protein between the plasma membrane and the yeast cell wall causing morphological defects. Although no release of RSV Gag proteins from yeast cells has yet been observed, the ability of our pIGin.Gag and pIGin.Gag.PR constructs to bud from yeast spheroplasts should still be determined.

Not only does plasma membrane localization seem to be altered in yeast cells expressing RSV Gag, but the dynamics of nuclear transport seem to be altered as well.

While the MA.p2.p10.GFP, Gag.GFP and Gag.PR.GFP proteins all exclude the cell 191 nucleus under steady-state conditions in avian cells (300), only the pIGin.MA.p2.p10 protein seems to completely exclude the nucleus in yeast cells. Indeed, there is a heterogeneity in the distribution of the Gag and Gag.PR proteins, with some cells showing an exclusion of the nucleus, some displaying an increased concentration in the nucleus, and most cells showing an equal distribution between the nucleus and the cytoplasm. The enhanced nuclear accumulation is the likely result of an additional NLS in the NC domain of Gag not present in the MA.p2.p10 protein (K. Butterfield-Gerson, L.

Scheifele, A. Hopper and L. Parent, unpublished results). This altered distribution of Gag between avian and yeast cells may reflect a different relative affinity in yeast cells for the nuclear export and nuclear localization signals within the Gag protein, with the nuclear localization signals in the MA or NC domains utilized to a greater extent, or the nuclear export signal in the p10 domain utilized less efficiently in yeast cells.

The altered distribution of the Gag protein in yeast cells could also reflect a difference in the cellular factors or pathways required for nuclear transport between the cell types. Indeed, this possibility seems likely because the Gag protein utilizes the Crm1 export pathway differently in yeast and avian cells. In avian cells, treatment of cells with

LMB leads to a dramatic relocalization of the Gag protein from the cytoplasm to the nucleus, while in yeast cells, Gag localizes equally to the nucleus and cytoplasm both in the presence and the absence of the drug. While LMB is specific for the Crm1 export receptor, this result can be verified by examining Gag localization in cells carrying a temperature-sensitive Crm1 allele.

However, these results could be explained either by a failure of the Gag protein to transit through the nucleus altogether in yeast cells, or a failure of the NES within the p10 192 domain to be efficiently utilized by the Crm1 protein in yeast cells. It seems unlikely that the Gag protein is not entering and exiting the nucleus in yeast cells both because the Gag protein localizes partially to the nucleus under steady-state conditions and because the

NLS signals from the MA and NC domains of Gag can be efficiently imported into the yeast nucleus when expressed as fusions in the pIGin vector system (K. Butterfield-

Gerson, L. Scheifele, A. Hopper and L. Parent, unpublished results). It seems more likely that the defect is in Crm1-dependent export because the pIGout.MA.p2.p10 protein, which contains a strong, heterologous NLS, also is insensitive to the drug; the fusion protein localizes mainly to the nucleus in the presence and absence of the drug, yet the cytoplasmic pool is not reduced upon drug treatment. The ability of the NES within the p10 domain to be utilized by the Crm1 receptor therefore seems to be context dependent, as the isolated NES fragment is able to efficiently mediate nuclear export in an LMB- sensitive manner (Figure 5.5). The ability of the NES to be recognized in an unnatural context, the pIGin vector, but not in the native context, the MA.p2.p10 fragment, suggests either that a cellular factor may exist that mediates the association of the NES with Crm1 or that the Gag protein may exist in an improper conformation in yeast cells, thereby rendering the NES less accessible to the export machinery.

The inability of the Gag protein to be retained in the nucleus following LMB treatment further suggested that the Gag protein might contain more than one NES; while the Crm1-dependent NES in p10 might be recognized and utilized most efficiently in avian cells, another NES might exist that allows Gag export from the nucleus even in the presence of LMB. We therefore assayed the Gag protein for nuclear or cytoplasmic localization in strains containing deletions in importin-β family members. In strains 193 containing deletions of importin genes, proteins containing RSV sequences, but not containing heterologous cellular sequences, display accumulation of fluorescent proteins at distinct subcellular locations (Figure 5.6). While many of these locations could be the cell nucleus and could reflect a defect in the export of the Gag proteins from the nucleus, the size and location of these fluorescent centers suggest that this is unlikely. As well, the random pattern of localizations seen between strains and expressed proteins suggests that this phenotype is the indirect result of gross alterations in nuclear transport. It will, however, be important to determine whether these viral proteins are specifically degraded in the yeast vacuole, targeted to a specific cellular organelle, or aggregate randomly in the cytoplasm.

The Gag protein does not seem to utilize two other export pathways, the karyopherin 120 and Msn5 export pathways (Figure 5.6). While these exportins have been previously described to export only ribosomal subunits and the phosphorylated transcription factor Pho4, the full range of transport cargos for these proteins has probably not been defined. Additional exportins exist in yeast, namely the Los1 and Cse1 proteins. Again, these exportins have been described to be specific for tRNA and for the importin-α adaptor protein, yet they should be tested for the ability to modulate Gag export given the apparent failure of Crm1-mediated Gag export in yeast cells. While the

Gag protein of RSV appears to transit through the nucleus in yeast cells as it does in avian cells, it may not be possible to study the full nuclear transport cycle in yeast cells.

Instead, the yeast system has confirmed the existence of an export signal within the p10 domain that is transferable to a heterologous protein and that is LMB dependent (Figure

5.5); introduction of this construct, pIGout.p10 NES, into additional yeast deletion 194 strains may yet serve to identify additional cellular proteins modulating the transport of the isolated NES fragment from the Gag protein.

CHAPTER 6

ROUS SARCOMA VIRUS GAG NES MUTANTS REVEAL POST ENTRY DEFECTS IN VIRAL REPLICATION 196 6.1 ABSTRACT

We have previously described mutants of the Rous sarcoma virus Gag protein which localize to the cell nucleus rather than the cytoplasm under steady-state conditions

((300), Chapter 4). These mutants contain both large deletions and single amino acid substitutions within of a putative leucine-rich NES within the p10 domain of Gag. To determine the role of Gag nuclear trafficking in the replication of RSV, we studied the phenotype of viruses carrying these NES mutant Gag proteins. Surprisingly, the viruses were noninfectious in both transformed quail and primary turkey cells. While the number of viral particles released from the cell is somewhat reduced, the virions contain the normal composition of viral proteins and of viral RNA. Despite the proper processing of viral proteins, the mutant virions have severe defects in particle morphology; virions are elongated and heterogeneous in size, and viral cores are extended or granular and acentric. In spite of the severe structural alterations, the virions are capable of entering cells, reverse transcribing the viral RNA and transporting the viral DNA into the nucleus.

These results suggest that the p10 domain of Gag has dual roles in RSV replication: maintaining the structure of the viral core, and an as yet undefined role between the completion of DNA synthesis and the establishment of a persistent infection.

6.2 INTRODUCTION

Retroviral assembly is directed by the viral Gag polyprotein. Despite containing almost no overall sequence homology, all Gag proteins share three domains: the MA 197 (matrix), CA (capsid) and NC (nucleocapsid) domains, which are released from the polyprotein by proteolysis shortly after or during the process of budding. In addition to the cleavage products of Gag, Gag proteins can also be organized into three assembly domains that coordinate the process of virion formation: the membrane-binding (M) domain that targets Gag to the site of assembly at the plasma membrane, the late (L) domain that recruits host cell proteins to release the nascent virion from the cell, and the interaction (I) domain(s) that facilitate multimerization of Gag. Two of these functional domains, the M and I domain(s) are always found within the N-terminal portion of the

MA region and within the NC region, respectively. In addition to the MA, CA, and NC regions, Gag proteins often contain additional proteins or peptides that are cleaved from the polyprotein during viral maturation. Some of these additional peptides, for example the p6 region of Human immunodeficiency virus (HIV), the p2b region of Rous sarcoma virus (RSV), and the p12 region of Murine leukemia virus (MLV), contain the late domain function of the Gag polyprotein. Aside from the late domain functions identified within some of these peptides, no common function has been attributed to these regions, and the p12 and p4 peptides of MPMV, the p4 peptide of BLV, the p21, p3 and p8 peptides of MMTV and the p2a and p10 peptides of RSV are examples of peptides of unknown function that lie between the Gag MA and CA domains (for a review, see

(322)).

The Gag protein must coordinate the process of assembly at distinct locations within the cell. While the domains that mediate particle assembly have been defined, no correlation has been established between the function of the assembly domains and the transport of Gag throughout the cell. While it was once believed that Gag proteins transit 198 directly to the plasma membrane following synthesis in the cytoplasm, we now know that

Gag encodes extensive subcellular targeting information. Gag proteins of different retroviruses follow several different morphogenic pathways, with the emergence of electron dense viral aggregates either within the cytoplasm or at the plasma membrane; the pathways taken by Gag proteins during assembly can be interconverted by mutation of subcellular targeting domains (281). As well, Gag likely makes extensive contacts with the secretory pathway before directing plasma membrane assembly; components of the endosomal sorting machinery are recruited to the site of viral budding to facilitate the fission of the host and viral membranes, and budding of Gag proteins into multi-vesicular bodies has been detected by electron microscopy (258,306).

Much of this subcellular targeting information may reside within these regions of

Gag for which functions are not yet described. Mutagenesis and genetic footprinting have revealed a potential role for the p12 domain of MLV in nuclear import of the viral genome (6,382). We have also identified a nuclear trafficking sequence present in the p10 peptide of RSV. The p10 region contains a nuclear export signal (NES) that renders the protein sensitive to the Crm1 export inhibitor leptomycin B (LMB). LMB treatment or mutation of the NES reduces the number of virus-like particles released from the cell

((300), Chapter 4). We have further mapped the NES, identifying four hydrophobic residues within the second half of the p10 region (leucine 219, tryptophan 222, valine 225 and leucine 229) that are crucial for NES function (Chapter 4).

The p10 region of RSV is crucial both for conformation of the Gag polyprotein and for replication of the virus, yet almost nothing is known of how p10 contributes to retroviral replication. Deletion of the first half of the p10 domain (mutant ∆QM1) does 199 not affect the size of virus-like particles, yet deletions of comparable size within the second half of the protein (mutants ∆p10.31 and ∆p10.52) produce particles of slightly smaller size by rate-zonal sedimentation gradients, although particle density is not affected (176). Particle production was also significantly reduced for the mutants containing deletions in the second half of p10 (64% and 69% reductions, Figure 4.2), arguing that the p10 region can influence the assembly of RSV particles.

The second half of the p10 region has also been implicated in the structure of retroviral particles. Deletion of the entire p10 domain from Gag converts the morphology of particles produced either in vitro or in E. coli from spheres into tubes (46), suggesting that p10 either provides necessary protein-protein interactions for the morphogenesis of the particle or that p10 restricts the Gag polyprotein into the proper conformation for assembly. Restoration of the last twenty-five amino acids of the p10 domain restored the assembly of Gag proteins into spheres (148). However, a corresponding region from the p12 region of the MLV Gag protein, which is also rich in glycine and proline, fails to rescue the dp10 mutant (148), suggesting that it is the sequence of the p10 domain, and not the conformation induced by the presence of glycines and prolines per se that is important for p10’s role in particle formation. Substitutions within p10 revealed no obvious motifs that were crucial for spherical shape. Conservative substitutions throughout this area were sufficient to cause the change from spheres to induce tubular particle formation while more aggressive mutations throughout this region were tolerated

(148). Interestingly, some substitutions produced tubular particles when assembled in E. coli, but spherical particles when assembled in vitro, suggesting that p10 finely modulates the ability of the protein to follow one of two assembly pathways. 200 The role of p10 in viral replication has been investigated by cloning linker insertions and deletions into the p10 region of RSV (80). Viruses with deletions in p10 all showed a reduction in particle assembly of 20-50 fold, and the viral particles released were all non-infectious despite containing wild-type levels of viral RNA (80). In contrast, insertions within the p10 region produced viruses that were released with wild-type efficiency. At the non-permissive temperature of 41ºC, however, particle production was reduced to 1-5% of wild-type and viral infectivity was abrogated. One of these temperature-sensitive mutations lies within the 25 amino acid region identified as important for spherical particle formation in vitro (148), suggesting again that there are alternate mechanisms of assembly of RSV particles that can be modulated by the p10 domain.

The identification of an NES within the RSV Gag protein allows us to study the role of p10 in RSV replication in a targeted way. We have identified four hydrophobic amino acids that are crucial for the function of the NES (L219, W222, V225 and L229), and we can therefore study the effect of mutation of these residues on RSV replication.

Several of these amino acids have been previously studied by in vitro assembly assays

(148); mutation of the leucine at position 219 of Gag to methionine did not affect the formation of spherical particles, suggesting that substitutions within this region may be tolerated. In contrast, mutation of another amino acid of the NES, the leucine at position

229 of Gag did lead to the formation of tubular particles (148). In the context of the viral clones, mutations that disrupted the NES tended to release fewer particles, and these particles were non-infectious (80). Interestingly, insertion of a Thr-Arg spacer in the middle of the nuclear export signal (mutant ML4) did not affect viral particle production 201 or infectivity, suggesting that the spacing between the hydrophobic amino acids of the nuclear export signal is variable as has been described for other Crm1-dependent NESs

(164).

We have therefore sought to study the role of nuclear export of Gag in the replication of the virus by mutating the nuclear export signal within p10. In this way, we can determine the steps of RSV replication affected by elimination of both the Gag NES and possibly the structural determinant within the p10 domain. Examination of the morphology of particles produced from NES mutant viruses will also be informative to determine whether the role of p10 in promoting Gag nuclear export is distinguishable from the role of p10 in particle morphogenesis, or whether nuclear transport and Gag protein polymerization are linked in vivo. These studies may therefore determine the magnitude of both large deletions and single amino acid changes within the p10 domain on the replication of RSV.

6.3 METHODS

Proviral expression vectors and cells. The viral vector pRC.V8 containing

Prague C gag sequence from the pATV8 genome has been described previously (62,252).

Plasmid pRC.Myr1E has been previously described (252). Deletions within the p10 region were introduced by SstI-HpaI fragment exchange from SV40 based expression vectors (176), while point mutations in the p10 region were introduced by SstI-SdaI fragment exchange from pGag.GFP constructs (Chapter 4). All experiments were performed in either the chemically transformed QT6 cell line or in primary turkey 202 embryo fibroblasts (TEFs), each maintained as previously described (62). Transfections were performed by the calcium phosphate method.

Radioimmunoprecipitation assays. Budding assays were performed as previously decribed (253,362). Briefly, transfected cells expressing proviral genomes were labeled with L-[35S]-methionine and cysteine (0.1 µCi/µl, >1000 Ci/mmol) in

DMEM lacking these amino acids for 2.5 hours. Cell culture media was removed and cells were lysed in radioimmunoprecipitation buffer (362). Viral proteins were immunoprecipitated with polyclonanl antisera against RSV, resolved by SDS-PAGE analysis and visualized by autoradiography.

Analysis of intracellular viral DNA. Intracellular DNA was isolated and analyzed as described previously (252,41). Briefly, virions were collected for 40 hrs from the supernatants of transfected cells, concentrated by pelleting through 25% sucrose for

80 min at 27,000rpm at 4˚C and quantitated by RT assay. Virions were treated with 20U

RQ1 DNase (Promega) in the presence of 10mM MgCl2 for 1 hr at 37˚C. One sample of wild-type virus was heat inactivated at 80˚C for 30 min. Equal amounts of virus, normalized by RT counts, were added to fresh TEF cells in 60 mm culture dishes. After

16 hrs, cells were lysed and low molecular weight DNA was isolated by the Hirt method

(133). 3 µl of the 10 µl of DNA isolated was analyzed for the formation of 2-LTR circles

(215 bp product) by PCR analysis with primers #8 (GGATTGGACGAACCACTGAA) and #9 (CAAGAGTATTGCATAAGACTAC) in the U3 region of the genome. PCR was

performed under conditions of: 97˚C for 5 min, and 25 cycles of 94˚C, 56˚C and 72˚C for

30 sec each. PCR products were visualized by UV transillumination following

electrophoresis on 3% NuSieve agarose gels. 203 Virus infectivity analysis. Virions were obtained from the supernatants of QT6 cells transfected with proviral constructs after 40 hours. A portion of the supernatant was analyzed by RT analysis and normalized amounts of virions were then added to fresh

QT6 or TEF cells for 2 hours at 37˚C, after which fresh media was added. Cell supernatants were collected every 3 days, pelleted through 25% sucrose at either 55,000 rpm for 40 min in a Beckman TLA100.4 rotor or at 18,500 rpm for 90 min in a Sorvall

SL-50T rotor, resuspended in PBS and stored at -70˚C. After all samples were collected, they were subjected to RT analysis as described previously (62).

Analysis of viral RNA content. RNA packaging assays were performed as described previously (113). Briefly, virions obtained from cell culture supernatants following transient transfection of QT6 cells were concentrated by ultracentrifugation (1 hr 20 min, 27,000 rpm in a Beckman SW28 rotor, 4ºC), resuspended in TNE buffer (10 mM Tris-Cl (pH 7.5), 100 mM NaCl, 1 mM EDTA), and the relative number of viral particles was assayed by RT assay. Virions were lysed in RNA lysis buffer (100 mM

Tris-Cl (pH 7.5), 200 mM NaCl, 20 mM EDTA, 2% SDS, 200 mg/ml Proteinase K), for

30 min at room temperature (105). RNA was extracted from lysed virions with phenol:chloroform and precipitated with ethanol. RNA from equivalent numbers of virions was hybridized to an in vitro transcribed riboprobe spanning the 3’ splice site junction of the RSV genome (nt 4998-5257) using the RPA III protocol according to manufacturer’s specifications (Ambion). Following treatment with RNases A and T1, undigested and digested RNAs were separated on 5% acrylamide- 8M urea gels and analyzed by PhosphorImager analysis (Molecular Dynamics). The relative RNA content 204 was determined by expressing the intensity of signal generated by the protected fragment for each mutant relative to the signal for the wild-type sample.

Electron microscopy analysis. QT6 cells were transfected with 15 µg of plasmid

DNA in 60-mm Permanox dishes (EM Sciences). Cells were washed in 0.1 M sodium cacodylate (pH 7.4) and fixed in 4% paraformaldehyde/0.5% glutaraldehyde for 1 hour at

4ºC. Cells were postfixed in 1% osmium tetroxide/1.5% potassium ferrocyanide overnight at 4ºC, washed in 0.1M sodium cacodylate and serially dehydrated in ethanol.

Monolayers were embedded in Epon 812, thin sectioned, stained with uranyl acetate and lead citrate and viewed with a Phillips 400 electron microscope.

Protein composition of mutant virions. Virions were collected from QT6 cells transfected with proviral vectors, pelleted through 25% sucrose (1 hr 20 min, 27,000 rpm in a Beckman SW28 rotor, 4ºC), and resuspended in PBS. Virions were quantitated by

RT assay using exogenous templates, and samples volumes corresponding to equal RT counts were resolved on 12% SDS-PAGE gels. Samples were transferred to nitrocellulose and blotted with polyclonal antisera against RSV (62,252), which detects epitopes within the Gag polyprotein, or polyclonal antisera against the TM subunit of the

Env polyprotein (72). Proteins were visualized by chemiluminescence using secondary anti-rabbit antibodies conjugated to horseradish peroxidase and the SuperSignal West

Pico substrate (Pierce Biotechnology, Rockford IL). 205 6.4 RESULTS

The p10 domain of RSV lies between the MA and CA regions of the Gag polyprotein and is crucial both for maintaining the conformation of the polyprotein and for nuclear export of Gag. We have previously mapped a nuclear export sequence to the

C-terminal portion of the p10 region of the Gag polyprotein (300). The location of the

NES was refined by mutation of four hydrophobic amino acids within this C-terminal p10 region. Mutation of leucine 219, tryptophan 222, valine 225 or leucine 229 within the

Gag.GFP protein leads to a dramatic accumulation of the fusion protein within the nucleus and reduces the number of Gag.GFP virus-like particles released from QT6 cells to 25-40% of wild-type levels (Chapter 4). As well, the particles that are produced are released with reduced kinetics, suggesting that nuclear export has become the rate- limiting step for the release of all Gag proteins from the cell. The role nuclear trafficking of the Gag polyprotein could be studied by mutation of a nuclear localization signal within the protein. This approach has been unsuccessful both because the NLS within the

MA region overlaps the membrane-binding domain of Gag and also because an additional NLS may be present within the Gag polyprotein (E. Ryan, L. Scheifele and L.

Parent, unpublished results). We have therefore taken the complementary approach, mutating the Gag NES to explore the role of mutations within the NES sequence on viral replication. We have employed large deletions within p10 encompassing the NES

(∆p10.31 and ∆p10.52, removing 31 and 52 amino acids from Gag, respectively) (176), a deletion within p10 that retains NES sequence and function as a control for structural 206 effects on viral replication (∆QM1) (176), as well as single amino acid substitutions that disrupt the function of the Gag NES (L219A, W222A, V225A, and L229A) (Figure 6.1 ). 207

MA (p19) p2 p10 CA (p27) NC (p12) PR (p15)

SGLYPSLAGVGEQQGQGGDTPPGAEQSRAEPG HAGQAPGGPA LTDWARVREELASTGPPVVAMP 219 222 225 229

QM1 p10.31 p10.52 L219A A---W---V---L W222A L----A---V---L V225A L---W---A---L L229A L---W---V---A

Figure 6.1: Schematic of NES mutant viruses. The wild-type RSV Gag polyprotein is depicted on top with the MA, p2a, p2b, p10, CA, SP, NC and PR domains indicated. Also indicated below in red are the four hydrophobic amino acids comprising the Gag NES. Deletion ∆QM1 removes codons 176-200, but preserves the Gag NES. Mutants ∆p10.52 and ∆p10.31 remove codons 183-234 and 193-223, respectively, including all or part of the export sequence. Substitutions L219A, W222A, V225A and V225A are single alanine substitutions for each of the hydrophobic residues crucial for NES function (Chapter 4).

208 These mutations were introduced into the infectious clone pRC.V8 (252), and resultant plasmids were used to create virions by transient transfection of quail fibroblasts. To assay whether substitution within the NES would affect the ability of the virus to replicate in permissive cells, virions produced by transient transfection were normalized by RT assay and then used to infect fresh QT6 cells. While the wild-type virus RC.V8 is capable of spreading throughout the culture, as evidenced by the rise in

RT activity in the infected cell culture during serial passage of the cells, the mutant

∆QM1 replicates somewhat more slowly (Figure 6.2A). The RT activity of this mutant, however, remains within 10-fold of wild-type values, and the slower replicating phenotype likely reflects structural alterations within the Gag polyprotein that prevent the efficient production of viral particles. Our control virus, mutant Myr1E, contains an N- terminal extension of the Src membrane-binding domain, and is non-infectious, as previously described (252). Similarly, the deletions within p10 and the single amino acid substitions that affect the NES function are deleterious to viral replication; none of the mutant viruses are able to produce detectable RT activity in cells challenged with an equivalent number of virions (Figure 6.2B).

209

Figure 6.2: Infectivity of viruses with mutations in the Gag NES. Viral particles were normalized by RT activity and then were added to either QT6 (Panels A and B) or TEF cells (Panel C). The ability of the viruses to spread throughout culture was assayed by the reverse transcription activity present in cell culture supernatants collected every 3 days. While the wild-type virus spreads rapidly throughout the culture, mutant ∆QM1 replicated more slowly (A). In contrast, deletion viruses ∆p10.52 and ∆p10.31 (A) and substitutions L219A, W222A, V225A and L229A (B and C) fail to replicate, with no detectable RT activity after infection.

210 We also tested the ability of the NES mutant viruses to infect a primary cell line, turkey embryo fibroblasts; indeed, the same sample of wild-type virus used to infect QT6 cells spread throughout the culture much more rapidly and to much higher levels in TEF cells (Figure 6.2C). However, the viruses containing single amino acid changes in the

Gag NES were unable to spread in this cell type (Figure 6.2C), indicating that these viruses are incapable of cell-free transmission.

Despite the inability of the virus to propagate in cell culture, virions were produced from transfected cells and could be detected by RT assay. The lack of infectivity of these viruses could be due either to an inability to properly assemble, an inability to bind to and enter target cells, or an inability to establish infection once inside a new cell. We first wished to determine whether the virions were properly assembled by examining the efficiency of viral particle production, the processing and incorporation of viral proteins, and the incorporation of viral RNA into virions. Viral proteins were first examined by metabolic labeling of transfected cells and immunoprecipitation of Gag- derived proteins from the cell lysates and the cell culture media. The wild-type virus

RC.V8 and the control Myr1E efficiently synthesized the Gag precursor Pr76gag within

the cell lysate, with some processing within the cell to the CA, MA and PR proteins

(Figure 6.3). Virions are efficiently released from cells expressing these constructs, as

evidenced by the accumulation of the 27 kD CA protein in the culture media. The mutant

∆QM1, which retains the NES sequence despite an upstream deletion within p10, is also efficiently synthesized and released from the cell; however, and additional processing intermediate of 30-35 kD is seen in the released virions, likely reflecting the deletion of the p2-p10 cleavage site within this protein. The viral constructs containing deletions of 211 the p10 NES are efficiently synthesized and processed, although the ∆p10.31 and

∆p10.52 Gag proteins migrate more quickly on the gel. Surprisingly, these Gag proteins are released from the cell with an efficiency comparable to the wild-type protein. As well,

Gag proteins containing point mutations in the NES are released to a similar extent. The release of viral particles cannot be quantitated from a steady-state assay of viral particle assembly due to the multiple Gag-derived proteins (predominantly MA, CA and PR) that are visible in smples from both the cell lysates and the culture media, thereby preventing a direct comparison with the release of Gag.GFP NES mutants (Figure 4.2). The release of a substantial number of virions by the viral mutants, however, does allow us to study the subsequent replication of those viruses when introduced to uninfected cells. 212

1 2 A 1 2 A 8 E A A A 8 E A A A 3 5 2 3 5 2 k V 1 . . 9 5 9 k V 1 . . 9 5 9 c . 1 2 c . 1 2 r 0 0 1 2 2 r 0 0 1 2 2 o y 2 o y 2 C M 1 1 2 2 2 C M 1 1 2 2 2 M R M Q p p L W V L M R M Q p p L W V L

Pr76gag

CA MA

PR

Cell lysates Media

Figure 6.3: Viral protein composition. (A) Transfected cells were labeled for 2.5 hours and cell lysates (left panel) and culture media (right panel) were immunoprecipitated with anti- RSV antibody. The migration of the viral Pr76gag, CA, MA, and PR proteins is indicated. The wild-type construct releases viruses into the media that are properly processed to release the viral CA (p27) protein (right panel). Mutant Myr1E also releases viral particles efficiently. ∆QM1 efficiently releases virions, yet an additional cleavage product migrating above the CA protein is also seen. The NES mutant Gag proteins all release comparatively fewer viral particles.

213 While the Gag protein is efficiently synthesized and processed in transfected cells, synthesis of the Gag-Pol precursor (Pr160gag-pol) is much harder to quantify by

immunoprecipitation. The Gag-Pol protein is created by ribosomal frameshifting at the end of the gag gene; to verify that this process was occurring at the same frequency as in

wild-type cells, the ratio of RT (a product of the pol gene) to CA protein (a product of the

gag gene) was assayed by immunoblotting of virions for CA protein after normalization

by RT activity. The relative CA protein composition of the mutant virions was similar to

the wild-type virus (Figure 6.4). Serial dilutions reveal no disparities greater than 5-fold,

and any differences were not reproducible between experiments. As well,

immunoblotting revealed no differences greater than 5-fold in the amount of the Env

protein incorporated into wild-type and mutant virions (Figure 6.5), suggesting that the

inability of the virions to infect new cells is not simply due to the absence of envelope

glycoproteins. 214

WT L219A W222A V225A L229A

:5 0 :5 0 :5 0 :5 0 :5 0 1 :1 1 :1 1 :1 1 :1 1 :1 1 1 1 1 1 32.8 kD

28.6 kD

∆ QM1 ∆ p10.31 ∆ p10.52 Myr1E

:5 0 :5 0 :5 0 :5 0 1 :1 1 :1 1 :1 1 :1 1 1 1 1

32.8 kD

28.6 kD

Figure 6.4: Gag-Pol content of mutant viruses. Serial dilutions of equal numbers of viral particles, as determined by reverse transcriptase assay, were resolved by SDS- PAGE analysis and blotted with antiserum against RSV. All viruses analyzed contain an approximately equivalent amount of CA proteins compared to RT activity.

215

L219A W222A V225A

:5 0 :5 0 :5 0 1 :1 1 :1 1 :1 1 1 1 SU-TM 82.6 kD

43.1 kD

TM 32.8 kD

WT ∆ QM1 ∆ p10.31 ∆ p10.52 Myr1E

:5 0 :5 0 :5 0 :5 0 :5 0 1 :1 1 :1 1 :1 1 :1 1 :1 1 1 1 1 1 82.6 SU-TM

43.1

TM 32.8

Figure 6.5: Env content of mutant viruses. Serial dilutions of equal numbers of viral particles, as determined by reverse transcriptase assay, were resolved by SDS-PAGE analysis and blotted with antiserum against the TM subunit of the Env glycoprotein All viruses analyzed contain an approximately equivalent amount of Env proteins compared to RT activity.

216 In addition to the protein components of the virion, retroviruses also incorporate two copies of the unspliced viral RNA as a dimeric genome. Although the virions examined contained normal ratios of viral proteins, we wished to determine whether the mutant Gag proteins were capable of recognizing and incorporating the viral RNA into the assembling particle. Viral RNA was isolated from equivalent numbers of particles, as determined by RT activity, and quantitated by ribonuclease protection assay, normalizing the amount of RNA present within wild-type particles to 1.0. The Myr1E virus packages viral RNA at levels 30% of the wild-type virus (113). Both the mutant containing a functional NES (∆QM1) and the two deletions that remove the NES within Gag (∆p10.31 and ∆p10.52) do not alter the relative RNA content present within viral particles

(Figure 6.6), indicating that the mutant Gag proteins do not have defects in RNA recognition, binding and encapsidation. 217

2.0

1.5

1.0

0.5 Relative vRNA packaging +/- SEM

0.0

RC.V8 RC.Myr1E RC.QM1 RC.p10.31 RC.p10.52

Figure 6.6: RNA content of wild-type and mutant viruses. An equal number of viral particles were lysed, and viral RNA was quantified by ribonuclease protection assay with a labeled probe spanning the 3’splice site of the viral RNA (nucleotides 4998-5257). The amount of RNA detected for each mutant construct (relative RNA content) was normalized to that of the wild type (set to 1.0). An average of at least three independent experiments with standard deviation is shown.

218 The proper incorporation of viral proteins and RNA into progeny virions suggested that abrogation of Gag nuclear trafficking might not affect the pathway of Gag assembly. Indeed, the alterations in the structure predicted in the immature Gag protein due to alterations within p10 might be expected to extend into the structure of the mature viral core. To examine whether the p10 mutations employed in our study might affect the morphology of viral particles by affecting the shape-determining properties of the p10 domain, virions were examined by thin-section electron microscopy. Mature Rous sarcoma virus particles contain a spherical, electron dense core and a more lucent region between the core and the viral envelope (Figure 6.7A). Particles produced by the ∆QM1 virus retain a morphology similar to wild-type particles, with a well condensed central core (Figure 6.7B), despite the processing defects visible by immunoprecipitation of viral proteins (Figure 6.7A). In contrast, particles produced by viruses containing deletions in the Gag NES, ∆p10.31 and ∆p10.52, display profound defects. Cores often are elongated in shape rather than spherical (Figure 6.7D, arrow), acentrically located within the particle, or are present in multiple copies (Figure 6.7C, arrow). Particles containing single amino acid substitutions within the NES of the Gag protein also display substantial assembly defects. Virions are much more heterogeneous in size and are amorphous rather than geometric in shape (Figure 6.7E-H). While many particles also contain elongated cores, some have granular cores and a less complete condensation of the core, thereby producing a denser region between the core and the viral envelope (Figure 6.7E, arrow).

As well, several particles appear to have stalks attached to the virion, as if the final release of the virion from the cell membrane was not properly completed (Figure 6.7F, arrow). The defects in viral particle formation therefore persist even after the p10 domain 219 has been proteolytically cleaved from Gag, defining a role for the p10 domain in the morphogenesis of both the immature and the mature viral particle. The ability of the p10 domain to affect the structure of the viral capsid may simply reflect the inability of these mutant Gag proteins to properly oligomerize during assembly or it may suggest that the p10 peptide or cellular factors associating with the p10 NES has a more fundamental role in viral morphogenesis.

220

A. B.C. D.

E. F. G. H.

Figure 6.7: Thin section electron microscopy analysis of viral particles. Cells expressing the wild-type virus (A), or mutants ∆QM1 (B), ∆p10.31 (C), ∆p10.52 (D), L219A (E), W222A (F), V225S (G) or L229A (H) were fixed, stained, thin sectioned and visualized by transmission electron microscopy. Images were taken at 12,500X magnification. Arrows in panel C indicate a virion with two cores, in panel D an elongated core, in panel F an elongated particle, and in panel E a particle with a stalk protruding from the virion. (Electron microscopy performed by Roland Myers, Penn State College of Medicine Core Facilities).

221 The substantial alterations in the assembly of viral particles suggested to us that the virions would be impaired in the early stages of the viral life cycle, and that the mutant virions were noninfectious because they were unable either to enter cells, to uncoat the genome or to perform reverse transcription once inside the newly infected cell.

To confirm this hypothesis, we assayed cells challenged with wild-type and mutant virions for the production of 2-LTR circles. 2-LTR circles are late products of reverse transcription, and represent defective DNA genomes which enter the nucleus but which fail to be integrated into the host cell chromosome and are therefore ligated by host cell enzymes. We assayed for 2-LTR circle production by isolating intracellular viral DNA 16 hours after infection and subjecting the viral DNA to PCR amplification with primers complementary to the viral LTR as previously described (252,42). These primers amplify a product only following circularization of the genome. As expected, the Myr1E virus, which has defects in viral RNA incorporation, dimerization, and reverse transcription

(252) fails to produce 2-LTR circles in cells challenged with the virus. Surprisingly, the wild-type and ∆QM1 viruses were capable of synthesizing detectable 2-LTR DNA within newly infected cells as were the viruses carrying mutation in the Gag NES (Figure 6.8).

Because our results are preliminary and were not controlled for the recovery of low molecular weight DNA from the cell, and because our PCR assay is not quantitative, we cannot compare the intensity of PCR signals between samples; interpretation of the efficiency of viral DNA synthesis therefore awaits the more precise quantitation of the

DNA products synthesized at each step of reverse transcription. However, despite the severe disruptions in viral core morphology, the mutant viruses are capable of some level 222 of synthesis of 2-LTR DNA, indicating that the NES mutant viruses are capable of entering cells, uncoating and completing reverse transcription. 223

WT ∆ QM1 ∆ p10.31 ∆ p10.52 L219A

0 0 0 0 0 :1 :1 :1 :1 :1 1 1 1 1 1

215 bp

W222A V225A L229A Myr1E Plasmid

0 0 0 0 :1 :1 :1 :1 1 1 1 1

215 bp

Figure 6.8: Analysis of intracellular viral DNA. 16 hours after transfection, infected cells were lysed and DNA purified by the Hirt method (133). DNA was used as a template for PCR with primers specific for the U3 region of the viral genome. DNA samples were used in PCR reactions undiluted or at 10-fold dilution. The primers amplify a product of approximately 215 bp from the wild-type, ∆QM1, and NES mutant viruses but not from the control virus Myr1E or the imput plasmid DNA.

224

6.5 DISCUSSION

The Rous sarcoma virus Gag polyprotein undergoes nuclear trafficking during retroviral assembly. An import signal within the MA region allows Gag to enter the nucleus while a nuclear export signal in the p10 domain mediates cytoplasmic localization (300). The nuclear export signal appears to be strong enough to counteract the NLS as the Gag protein has a steady-state distribution within the cytoplasm, with punctate foci at the plasma membrane that are presumed to represent the sites of viral assembly. Although Gag nuclear trafficking appears to be transitory, with no protein residing in the nucleus of infected cells long enough to be visible by immunofluorescence analysis (300), a significant portion, if not all, of the Gag proteins expressed are capable of transit through the nucleus. The majority of fluorescence is relocated from the cytoplasm to the nucleus when Gag.GFP expressing cells are treated with leptomycin B to inhibit nuclear export. As well, when nuclear export is retarded by mutation of the Gag

NES, the rate of viral budding is dramatically reduced; no Gag proteins are released with wild-type kinetics which would reveal their ability to bypass the nuclear compartment

(Figure 4.3).

While most or all of the synthesized Gag proteins appear to transit through the nucleus, the reason for this step of the viral life cycle remains unclear. Determining the reason for Gag nuclear transport is crucial to understanding whether nuclear trafficking of

Gag is a common feature of retroviral assembly, or rather reflects a peculiarity of RSV replication. It is easy to imagine that Gag nuclear transport would be a common retroviral trafficking event as nuclear transport of Gag appears to be an obligate step for the 225 replication of retrotransposons, and of the spumaviruses, a distant relative of the retroviruses. On the other hand, many retroviral Gag proteins do not utilize the Crm1 export receptor, including those of murine leukemia virus (L. Scheifele and L. Parent, unpublished results) and bovine leukemia virus, although these Gag proteins may simply employ other transport pathways.

One can imagine numerous reasons why RSV and not other retroviral Gag proteins would need to enter the nucleus. Retroviral genomes contain a cis-acting packaging element within the viral RNA, termed ψ, which serves as the recognition and binding site for the NC domain of the Gag polyprotein on the viral RNA. Rous sarcoma virus is among the minority of retroviruses for which the ψ element is present on both the spliced mRNAs and the unspliced genome. We have previously suggested that Gag nuclear trafficking may serve to select the unspliced RNA by recognizing this species of

RNA within a specific compartment of the nucleus (300). This hypothesis was suggested by a Gag mutant that bypasses the nuclear compartment and which also fails to incorporate sufficient viral RNA into assembled particles (252). In this study, we have found that Gag mutants with NES defects do not have defects in RNA incorporation into viral particles (Figure 6.6). These results do not disprove our hypothesis, but rather suggest that an increase in the amount of time spent within the nucleus due to delayed nuclear export of Gag does not interfere with the ability to package RNA. If genome recognition occurs in the nucleus, it is not simply a kinetic process because increasing the amount of time that Gag spends in the nucleus does not increase the incorporation of viral

RNA into viral particles. While nuclear import of Gag may be required for RNA encapsidation, proper nuclear export is dispensable. 226 In addition to selecting the unspliced RNA genome, Gag nuclear trafficking could serve to modulate splicing directly. As for all retroviruses, the Gag protein of RSV is synthesized from an unspliced viral RNA template in the cytoplasm. Complex retroviruses, such as HIV, encode an accessory protein termed Rev which recognizes unspliced viral RNAs in the nucleus and promotes their export into the cytoplasm. In contrast, the simple retroviruses do not encode these accessory proteins, but rather are presumed to use cis-acting RNA elements to promote their export to the cytoplasm, although no protein ligands have been identified that mediate the cytoplasmic accumulation of RSV RNA. The Gag protein could enter the nucleus either to directly inhibit the splicing machinery or to promote the cytoplasmic localization of unspliced

RNAs. We have found, however, that in cell expressing NES mutant Gag proteins there is no defect in the export of the unspliced viral RNA from the nucleus as measured by the incorporation of viral RNA into retroviral particles or the synthesis of Gag proteins as measured by immunoprecipitation of the Pr76gag protein from cell lysates (Figure 6.3).

Therefore, the inhibition of Gag nuclear export does not seem to affect the export of viral

RNA or synthesis of viral proteins.

Rous sarcoma virus is also unique among the retroviruses in its ability to infect resting cells at low efficiency. Viruses such as HIV employ active nuclear import signals that allow the complex of viral RNP, termed the preintegration complex (PIC), to enter the nucleus of nondividing cells efficiently (for a review, see (67)). Oncoviruses such as

Murine leukemia virus (MLV) are incapable of infecting nondividing cells, requiring instead the onset of mitosis to establish infection (231). RSV, on the other hand, is capable of infecting nondividing cells, although at levels only 3% of the efficiency of 227 HIV, suggesting that the mechanism of PIC nuclear import in RSV is distinct from the mechanism utilized by either MLV or HIV (127,154). We have postulated that the NLS within the MA region of Gag might be employed to facilitate this entry of the PIC into the nucleus. In the viruses we examined, nuclear translocation of the PIC appeared to be unaffected as the viruses were able to form 2-LTR circles, which are formed through the action of nuclear enzymes upon the viral DNA. Either disruption of the nuclear export of the Gag protein does not interfere with the subsequent round of nuclear import of the viral genome, or disruption of the Gag NES perturbs the reverse transcription process so as to enable the formation of 2-LTR circles earlier in the viral life cycle, prior to nuclear targeting.

Unexpectedly in our study, perturbation of Gag nuclear transport had no effect on the composition of viral proteins or RNA in the virion. Despite the ability of these constructs to release viruses into the culture medium, the virions that were produced are noninfectious, with no detectable RT activity in cell culture supernatants following serial passage (Figure 6.2). This result could be easily attributable to the structural defects of the mutant virions; although the particles contain processed viral proteins, the virions show severe morphological defects, with heterogeneous sizes, acentric and misformed cores, and elongated and misshapen viral particles (Figure 6.7). However, the ability of these mutant particles to undergo all the steps of reverse transcription and then to subsequently translocate the viral genome into the nucleus refutes such a simple explanation for the defect in viral infectivity. Although the structural defects of these virions is likely the result of the immature Gag polyproteins being unable to properly oligomerize and assemble, yet these defects do not prevent completely block the steps of 228 entry and reverse transcription, a phenotype that is unique among retroviruses with alterations in core structure.

The subsequent inability to utilize the synthesized viral DNA to establish an infection represents a novel phenotype not previously described for RSV Gag mutants.

Mutations within the p12 domain of MLV lead to a defect in the formation of 2-LTR circles despite the synthesis of full-length linear viral DNA, suggesting a possible defect in nuclear import (381,6). Yet the defect we have described presumably exists at a later step in the viral life cycle, following nuclear import. The ability of the virions to synthesize 2-LTR DNA suggests a defect either in the integration of the viral DNA into the host cell genome or a defect in the expression of the viral mRNA from the integrated provirus. Should these mutant viruses fail to integrate the synthesized viral DNA into the host cell chromosome, it would suggest a role for either the p10 domain or a cellular factor interacting with Gag during its nuclear transport step in the subsequent integration of the viral genome. In contrast, the establishment of a provirus without the ability to propagate an infection might suggest a role for Gag nuclear trafficking in viral gene expression. Indeed, complex retroviruses encode transcriptional transactivators, the Tat and Tax proteins, which contain no functional homologs in the simple retroviruses; a similar role might by accomplished through the RSV Gag protein acting through a positive feedback loop to amplify RNA synthesis.

While our studies leave the role of Gag nuclear trafficking undecided, they reveal a powerful role for the p10 domain in viral infectivity. The role of p10 in the structural conformation of Gag had been appreciated, consistent with our finding that the p10 domain has a modest effect on viral budding. Yet, the effect of p10 on viral assembly is 229 much more pronounced, with aberrant particles produced from Gag proteins containing both point mutations and deletions in the p10 domain. Rather than simply affecting viral structure by affecting the packing of Gag proteins during assembly, p10 may exert an effect in its mature form; indeed, we have found defects that persist after the release of the p10 domain from Gag and the condensation of the capsid core, perhaps pointing to a role for p10 in the structure of the capsid.

These studies suggest that there may be a role for p10 in the establishment of infection. RSV may require the mature p10 protein to integrate the DNA following synthesis, to transcribe the DNA, or to create a permissive cellular environment for infection. Alternatively, the p10 domain may recruit a host cell factor into the virion during viral assembly that is required for these steps of infection. While the reason for

Gag nuclear trafficking therefore remains elusive, it is clear that not only is bypassing the nucleus detrimental to viral replication (252,300), but altering the nuclear export signal is similarly lethal for the virus. Although the Gag NES may not be separable from the role of p10 as a structural deteminant, the integrity of the NES is crucial to viral infectivity.

The Gag nuclear transport signals therefore must be finely tuned to accomplish both the assembly of the virion and the subsequent entry of the virus into the next cell.

CHAPTER 7

THESIS DISCUSSION

231 7.1 THE ROLE OF NUCLEAR TRAFFICKING OF THE RSV GAG POLYPROTEIN

The unexpected finding that the Gag polyprotein transits through the cell nucleus raises new dimensions in the understanding of the virus-cell interactions necessary for the replication of Rous sarcoma virus. Nuclear transport of the Gag protein defines a new step in the RSV replication cycle, yet this trafficking step is not surprising as the MA protein of HIV and the Gag proteins of the spumaviruses have been previously reported to both enter and exit the cell nucleus (79,184,379). This finding does, however, allow us to envisage potential connections between Gag trafficking and the steps in viral replication that require access to or export from the cell nucleus, namely nuclear import of the preintegration complex and nuclear export of the unspliced viral RNA.

What is immediately noticeable is the strength of nuclear targeting directed by

NLS signal within Gag. Single amino acid substitutions within the Gag NES lead to a redistribution of almost all of the Gag proteins from the cytoplasm to the nucleus (Figure

4.1). As well, treatment of cells expressing the Gag.GFP protein with leptomycin B leads to a rapid accumulation of Gag proteins in the nucleus (300), and within two hours most of the expressed Gag proteins are present within the nucleus (Figure 3.5). The concentrations required to achieve this accumulation are low, in the nanomolar range, rather than the micromolar concentrations required to inhibit proteins with more complex export signals. Although we cannot conclude that all Gag proteins transit through the nucleus during RSV assembly, the strength of this phenotype in combination with the reduced rate of virus-like particle release for NES mutant Gag proteins (Figure 4.3) suggests that all Gag proteins are competent for nuclear transport. Understanding whether 232 all Gag proteins are required to transit through the nucleus will help formulate hypotheses for the reason for Gag transport. For example, the transit of all Gag proteins through the nucleus would be consistent with modification of Gag in the nucleus as a necessary step for viral assembly, while the entry of few Gag molecules into the nucleus would suggest a role for Gag in viral RNA selection, as there are 1500 Gag proteins per viral particle compared with only two viral RNAs.

7.1.1 The p10 Nuclear Export Signal And The Structure Of The Gag Protein

We have attempted to decipher the reason for Gag nuclear targeting more directly by studying mutants that disrupt the NES sequence within the p10 domain. Deletion of the NLS sequence within the MA domain is uninformative, because this construct,

Myr0.B1c, still undergoes nuclear trafficking (Figure 2.9). This suggests that the NLS within MA is not the only import signal within the Gag polyprotein, and we are continuing to map additional sequences that mediate the nuclear import of Gag.

Alternatively, we mutated the nuclear export signal within Gag, assuming that disrupting nuclear transport in this way would reveal a specific defect in the viral replication cycle.

Disruption of the Gag export signal, however, led to a defect in viral particle assembly

(Figure 6.3). While particles were released from the cell, the virions contained dramatic defects in the overall morphology of the viral particle. Viruses were produced that contained elongated virions, and acentric and elongated cores (Figure 6.7).

Several studies have focused upon the role of the p10 domain in retroviral assembly. Both large deletions and point mutations within p10 produce defects in the 233 assembly of Gag proteins into spheres in vitro. These studies, however, have focused upon the formation of the immature viral particle, and were never extended to visualize the mature virions. One might expect that release of p10 from Gag by proteolytic processing would allow the CA domain to condense properly into a core structure, but this appears not to be the case. The crystal structure of the last 25 amino acids of the p10 region and the N-terminal domain of CA suggests that the end of p10 provides an interface between two CA domains of Gag (230). Dimerization has been proposed to be a crucial step for assembly of Gag proteins both in vitro and in vivo (202). Our mutations in the dimer interface domain include large deletions within p10 that certainly remove almost all of the residues present within this interface. The ability of these Gag proteins to form viral particles suggests that dimerization may be an assembly step that can be bypassed. Because these Gag proteins accumulate within the nucleus yet presumably do not form Gag dimers, these results suggest that nuclear transport of Gag occurs independently of Gag dimerization and that nuclear transport may occur prior to self- association of Gag proteins.

If the particles are able to bypass dimerization of Gag molecules during assembly, why is this step crucial for infectivity in vivo? Is the defect in the infectivity of viruses with NES mutations due to the structure adopted by Gag proteins during assembly, due to the abnormal morphology of the viral core, or is it attributable to the modulation of Gag nuclear export? The most striking feature of the Gag proteins with NES mutations is their ability to undergo the early steps in viral infection, namely entry into the host cell, uncoating of the genome, reverse transcription, and entry into the nucleus. All of these steps can be accomplished despite the defective structure of the incoming viral core, 234 suggesting that only a few Gag-derived proteins are required during the early phase of infection rather than complexes of Gag proteins retaining higher orders of virion organization.

Because each of the crucial residues comprising the Gag NES is also involved in the dimer interface structure of the immature Gag precursor (230), it seems unlikely that we will be unable to tease apart the nuclear export and structural roles of Gag by mutagenesis of the Gag NES alone. Analysis of the role of Gag nuclear targeting will therefore likely require the analysis of cellular factors that mediate Gag nuclear transport.

Because Crm1 participates in the export of numerous cellular cargos, simple deletion of the Crm1 gene is not possible. Yet, all interactions of cargo with the Crm1 receptor do not seem to be identical, as reflected in the altered affinities of proteins for the receptor, the variations in the rate of export for different cargos, and the use of varied adaptor proteins to mediate the interaction with Crm1. Once the protein complex mediating Gag export is more fully defined, it may be possible to target the Crm1 receptor indirectly, thereby assessing the role of Gag export in retroviral replication. It may be more straightforward to target the import receptor for the Gag protein, as most of the import receptors are nonessential genes in yeast. For example, the importin-α7 protein has been identified as the import receptor for the HIV preintegration complex, and abolishing its expression through siRNA targeting reduces the ability of the virus to infect cells (91).

Definition of the full complement of proteins that modulate Gag nuclear trafficking in yeast is still crucial so that viral replication can be studied after manipulation of avian homologs. 235 7.1.2 The p10 NES And Viral RNA Export

We have postulated that Gag nuclear trafficking may be coordinated with the export of the genome from the nucleus (300). Indeed, the block to RSV replication in mammalian cells may reflect this defect in genome export. Host cell restrictions against genome export have been described for the genomes of HIV and MPMV, for which the

RNA export pathways are not functional in rat and avian cells, respectively (151,206).

The p10 mutant viruses do not display defects in RNA export, so delaying Gag export does not prevent genome packaging. However, two mutations have been created in the

Gag protein that cause Gag to be targeted more strongly to the plasma membrane and which decrease nuclear transport (44,299). Although these mutants do not seem to cause a global defect in the export of unspliced mRNA, reflected in the abundant synthesis of

Gag proteins within the cell from an unspliced template, they do result in a specific defect in viral genome packaging.

This discrepancy between unspliced RNA export and genome packaging suggests that RSV regulates the fate of unspliced viral RNA. The 5’UTRs of several simple retroviruses contain translational enhancement elements (71,140), promoting the synthesis of viral proteins from exported unspliced mRNAs. As well, genome export in

HIV utilizes both the viral Rev protein and the Sam68 cellular protein for nuclear export and translational control. Sam68 is a member of the STAR (signal transduction and activation of RNA) family of proteins that link RNA metabolism and signal transduction pathways. STAR proteins contain KH domains (hnPNP K homology domain) and potentially SH3-binding domains, proline-rich domains and WW-binding sites (183). 236 STAR proteins act to both enhance as well as repress translation of cytoplasmic RNAs.

Sam68 enhances the translation of the HIV unspliced RNA or the MPMV genomic RNA containing a CTE element. In fact, Sam68 can functionally replace Rev in the export of unspliced RNA from the nucleus and a dominant negative form of Sam68 prevents Rev function (275). Sam68 is a predominantly nuclear protein, and its enhancement of cytoplasmic utilization of unspliced retroviral RNA probably occurs via marking of the

RNA within the nucleus.

Unlike Sam68, other STAR family repress the translation of RNA species. The C. elegans protein GLD-1 binds to translational control elements in the 3’ and 5’UTRs of several cellular RNAs, including the sex determination gene tra-2, the Notch receptor glp-1, and the yolk receptor rme-1 (144,187,205). Interaction of GLD-1 with these RNAs represses their translation, thereby leading to the spatially and developmentally controlled expression of the protein products. In addition to GLD-1, the STAR protein QKI-6 can also inhibit the translation of reporter constructs carrying cis-acting elements (293).

Translational control may in fact be mediated by the nuclear export pathway as both

Sam68 and TRA-1 utilize the Crm1 pathway, rather than the dominant Tap mRNA export pathway, to export RNA to the cytoplasm. It is possible that Gag may utilize the Crm1 pathway in a similar manner, marking the RNA in the nucleus for either translation or packaging. Translational control of retroviral mRNAs may function not only to enhance translation, but to repress it as well, allowing incorporation of retroviral RNAs into virions. 237 7.1.3 The MA NLS And Viral DNA Import

The discovery of an NLS within the MA domain raises the possibility that this transport sequence facilitates nuclear import of the viral genome during the early steps of infection. Adding to the complexities of RSV nuclear import is the role of mitosis in nuclear uptake. RSV has recently been demonstrated to be capable of infecting cells at a low level in the absence of mitosis (127,154). While active transport through the nuclear pore may play a role in RSV assembly, mitosis may still be the point of efficient vDNA entry into the nucleus. For many retroviruses, access to the cellular chromatin for viral integration clearly requires breakdown of the nuclear envelope at mitosis (285) when the nuclear contents are highly accessible. During mitosis, NPCs are completely removed from the nuclear envelope during the first phase of nuclear envelope degradation, with ruffling, indistinctness, and visible collapse of the nuclear envelope occurring only later with the onset of prometaphase and phosphorylation of nuclear lamins (for a review, see

(40). Monitoring the uptake of fluorescent dextran into mitotic starfish oocyte nuclei,

Terasaki et. al. observed two periods of uptake: a slow phase of increasing permeability attributed to disassembly of the nuclear pores and a second phase of rapid uptake attributed to collapse of the membrane barrier (329). It seems simplistic, however, to imagine that retroviruses that gain access to the nucleus do so in an unregulated manner.

Even if access to the nuclear components is unrestricted during nuclear envelope collapse, certainly not all proteins and RNAs are retained within the re-formed nucleus.

The process by which the nuclear and cytoplasmic compartments are resegregated must allow the viral genome to remain within the nucleus and in proximity to the chromatin. 238 Indeed, both the MA and NES mutant Gag proteins are strongly retained within the nucleus during cell division (Figure 4.1G). The RSV MA protein may therefore serve as a powerful tool to understand both the mechanism by which retroviral proteins achieve nuclear import and also to the cellular pathways of mitotic entry into the nucleus.

7.2 MEMBRANE TRAFFICKING OF THE ROUS SARCOMA VIRUS GAG PROTEIN

We have identified a crucial motif within the Gag protein that influences its targeting to the plasma membrane. When the fourth alpha helix of the membrane-binding domain is deleted, the Gag protein accumulates at intracellular membranes rather than at the plasma membrane. The question remains whether the localization to intracellular membranes resulting from disruption of the membrane-binding domain is simply an accumulation of Gag proteins at the most abundant membranes within the cell, or whether transit through intracellular membranes is an integral part of Gag trafficking.

The ability of a single amino acid change (T14K) to rescue plasma membrane targeting to the Gag deletion protein (B1c) suggests that the switch between plasma membrane and intracellular membrane targeting involves subtle alterations in the overall conformation of the Gag protein. In the absence of the fourth helix, Gag is locked within the conformation that allows it to bind intracellular membranes only, rather than being capable of both intracellular and plasma membrane targeting.

On the other hand, rather than using a conformational change as the “second signal” to specify plasma membrane targeting, Gag could use a cellular partner to direct it to the plasma membrane. Gag could therefore transit to intracellular membranes and 239 begin to associate with components of the endosomal sorting machinery that are required for budding. When the complex is properly formed, a protein component could either expose plasma membrane targeting information within Gag or could contain its own plasma membrane targeting motif that it uses to redirect the complex to the plasma membrane for viral particle assembly. The use of a common set of endosomal sorting proteins by numerous retroviruses for budding and the similar localization of RSV and

HIV membrane-binding mutants to intracellular membranes make this hypothesis plausible.

7.3 TARGETING SIGNALS WITHIN THE RSV MA PROTEIN

The ability of the first half of the MA protein to provide not only membrane- binding affinify, but also to control membrane-targeting specificity calls into question the role of the second half of the MA protein in retroviral replication. Not only is membrane- targeting specificity contained within the first half of MA, but nuclear targeting is as well.

The first 88 amino acids of the membrane-binding domain contain a nuclear targeting motif; in fact, the accumulation of this protein in the nucleus is at least as great, if not greater than the accumulation of the full-length MA domain (300). The second half of

MA may be necessary, therefore, for modulating the nuclear transport of MA. In the same way that the myristyl switch mechanism may control the amount of the Gag protein present at the plasma membrane, the second half of MA may control the access of the

MA protein to the nucleus; this would explain why the accumulation of the Gag protein within the nucleus following LMB treatment is greater than the steady-state accumulation 240 of the MA protein. Indeed, not all deletions in the second half of MA are tolerated; deletion ∆MA-6 requires the addition of a spacer peptide to restore replication potential, suggesting that it may not be the primary amino acid sequence per se, but rather the length or structure of MA that is required for efficient replication (232). The second half of the MA protein may also be necessary to maintain either the spacing between the membrane and nuclear targeting regions in MA and the late domain sequence in p2 or the nuclear export sequence in p10. While no function has been ascribed to the C-terminus of the MLV MA protein either, genetic footprinting has revealed three regions that were intolerant of changes (6). Genetic mapping targeted at the second half of the RSV MA protein may further define regions that are important in the RSV sequence as well.

Understanding the subcellular trafficking pathway of RSV Gag requires identification of host cell factors that influence the localization of Gag, mapping of transport signals within the Gag protein, and investigation of the roles of post- translational modifications of Gag. The Gag protein of RSV is acetylated, phosphorylated, and likely ubiquitinated. Recent techniques enable the full spectrum of post-translational modifications to be defined; previously unknown modifications, including the heterogeneity of fatty acid modifications on a single residue, have been identified on the Fyn protein (193), increasing the complexity of regulation possible in the subcellular trafficking and binding to host cell factors. A broader understading of all of the post-translational modifications of the RSV Gag protein would be informative; indeed, the p10 protein was identified as a phosphoprotein (262), yet no reports address the requirement for phosphorylation of p10 either in nuclear export or in maintaining Gag structure. The nonclassical plasma membrane targeting and nuclear import signals on 241 Gag will require investigation of both trans-acting cellular factors and cis-acting viral sequences, and may reveal important mechanisms of host cell transport pathways.

REFERENCE LIST

243

1. Aloia, R. C., H. Tian, and F. C. Jensen. 1993. Lipid composition and fluidity of the human immunodeficiency virus envelope and host cell plasma membranes. Proc.Natl.Acad.Sci. 90:5181-5185.

2. Ansari-Lari, M. A. and R. A. Gibbs. 1996. Expression of human immunodeficiency virus type 1 reverse transcriptase in trans during virion release and after infection. J.Virol. 70:3870-3875.

3. Apolloni, A., I. A. Prior, M. Lindsay, R. G. Parton, and J. F. Hancock. 2000. H-Ras but not K-Ras traffics to the plasma membrane through the exocytic pathway. Mol.Cell.Biol. 20:2475-2487.

4. Arrigo, S., M. Yun, and K. Beemon. 1987. cis-acting regulatory elements within gag genes of avian retroviruses. Mol.Cell Biol. 7:388-397.

5. Aschoff, J. M., D. Foster, and J. M. Coffin. 1999. Point mutations in the avian sarcoma/leukosis virus 3' untranslated region result in a packaging defect. J.Virol. 73:7421-7429.

6. Auerbach, M. R., C. Shu, A. Kaplan, and I. R. Singh. 2003. Functional characterization of a portion of the Moloney murine leukemia virus gag gene by genetic footprinting. Proc.Natl.Acad.Sci.U.S.A 100:11678-11683.

7. August, J. T., D. P. Bolognesi, E. Fleissner, R. V. Gilden, and R. C. Nowinski. 1974. A proposed nomenclature for the virion proteins of oncogenic RNA viruses. Virology 60:595-600.

8. BADER, J. P. 1965. TRANSFORMATION OF ROUS SARCOMA VIRUS: A REQUIREMENT OF DNA SYNTHESIS. Science 149:757-758.

9. Baltimore, D. 1970. RNA-dependent DNA polymerase in virions of RNA tumour viruses. Nature 226:1209-1211.

10. Banks, J. D., B. O. Kealoha, and M. L. Linial. 1999. An Mpsi-containing heterologous RNA, but not env mRNA, is efficiently packaged into avian retroviral particles. J.Virol. 73:8926-8933.

11. Banks, J. D., A. Yeo, K. Green, F. Cepeda, and M. L. Linial. 1998. A minimal avian retroviral packaging sequence has a complex structure. J.Virol. 72:6190-6194.

12. Barnard, R. J. and J. A. Young. 2003. Alpharetrovirus envelope-receptor interactions. Curr.Top.Microbiol.Immunol. 281:107-136. 244 13. Barre-Sinoussi, F., J. C. Chermann, F. Rey, M. T. Nugeyre, S. Chamaret, J. Gruest, C. Dauguet, C. Axler-Blin, F. Vezinet-Brun, C. Rouzioux, W. Rozenbaum, and L. Montagnier. 1983. Isolation of a T-lymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). Science 220:868-871.

14. Bates, P., J. A. Young, and H. E. Varmus. 1993. A receptor for subgroup A Rous sarcoma virus is related to the low density lipoprotein receptor. Cell 74:1043-1051.

15. Bennett, R. P., T. D. Nelle, and J. W. Wills. 1993. Functional chimeras of the Rous sarcoma virus and human immunodeficiency virus gag proteins. J.Virol. 67:6487-6498.

16. Bennett, R. P. and J. W. Wills. 1999. Conditions for copackaging rous sarcoma virus and murine leukemia virus Gag proteins during retroviral budding. J.Virol. 73:2045-2051.

17. Bieth, E., C. Gabus, and J. L. Darlix. 1990. A study of the dimer formation of Rous sarcoma virus RNA and of its effect on viral protein synthesis in vitro. Nucleic Acids Res. 18:119-127.

18. Bittner, J. J. 1936. Some possible effects of nursing on the mammary gland tumour incidence in mice. Science 84:162.

19. Black, B. E., J. M. Holaska, L. Levesque, B. Ossareh-Nazari, C. Gwizdek, C. Dargemont, and B. M. Paschal. 2001. NXT1 is necessary for the terminal step of Crm1-mediated nuclear export. J.Cell Biol. 152:141-155.

20. Bogerd, H. P., A. Echarri, T. M. Ross, and B. R. Cullen. 1998. Inhibition of human immunodeficiency virus Rev and human T-cell leukemia virus Rex function, but not Mason-Pfizer monkey virus constitutive transport element activity, by a mutant human nucleoporin targeted to Crm1. J.Virol. 72:8627-8635.

21. BonHomme, M., S. Wong, C. Carter, and S. Scarlata. 2003. The pH dependence of HIV-1 capsid assembly and its interaction with cyclophilin A. Biophys.Chem. 105:67-77.

22. Bonnet, D. and P. F. Spahr. 1990. Rous sarcoma virus expression in Saccharomyces cerevisiae: processing and membrane targeting of the gag gene product. J.Virol. 64:5628-5632.

23. Borchani-Chabchoub, I., R. Mokdad-Gargouri, and A. Gargouri. 2003. Glucose dependent [correction of dependant] negative translational control of the heterologous expression of the preS2 HBV antigen in yeast. Gene 311:165-170. 245 24. Bouamr, F., S. Scarlata, and C. Carter. 2003. Role of myristylation in HIV-1 Gag assembly. Biochemistry 42:6408-6417.

25. Bourinbaiar, A. S. and D. M. Phillips. 1991. Transmission of human immunodeficiency virus from monocytes to epithelia. J.Acquir.Immune.Defic.Syndr. 4:56-63.

26. Bouyac-Bertoia, M., J. D. Dvorin, R. A. Fouchier, Y. Jenkins, B. E. Meyer, L. I. Wu, M. Emerman, and M. H. Malim. 2001. HIV-1 infection requires a functional integrase NLS. Mol.Cell 7:1025-1035.

27. Bowers, W. J., L. A. Baglia, and A. Ruddel. 1996. Regulation of avian leukosis virus long terminal repeat-enhanced transcription by C/EBP-Rel interactions. J.Virol. 70:3051-3059.

28. Bowzard, J. B., R. P. Bennett, N. K. Krishna, S. M. Ernst, A. Rein, and J. W. Wills. 1998. Importance of basic residues in the nucleocapsid sequence for retrovirus Gag assembly and complementation rescue. J.Virol. 72:9034-9044.

29. Boyce-Jacino, M. T., K. O'Donoghue, and A. J. Faras. 1992. Multiple complex families of endogenous retroviruses are highly conserved in the genus Gallus. J.Virol. 66:4919-4929.

30. Boyce-Jacino, M. T., R. Resnick, and A. J. Faras. 1989. Structural and functional characterization of the unusually short long terminal repeats and their adjacent regions of a novel endogenous avian retrovirus. Virology 173:157-166.

31. Bray, M., S. Prasad, J. W. Dubay, E. Hunter, K. T. Jeang, D. Rekosh, and M. L. Hammarskjold. 1994. A small element from the Mason-Pfizer monkey virus genome makes human immunodeficiency virus type 1 expression and replication Rev-independent. Proc.Natl.Acad.Sci.U.S.A 91:1256-1260.

32. Brojatsch, J., J. Naughton, M. M. Rolls, K. Zingler, and J. A. Young. 1996. CAR1, a TNFR-related protein, is a cellular receptor for cytopathic avian leukosis-sarcoma viruses and mediates apoptosis. Cell 87:845-855.

33. Brown, D. W., B. P. Blais, and H. L. Robinson. 1988. Long terminal repeat (LTR) sequences, env, and a region near the 5' LTR influence the pathogenic potential of recombinants between Rous-associated virus types 0 and 1. J.Virol. 62:3431-3437.

34. Bryant, M. and L. Ratner. 1990. Myristoylation-dependent replication and assembly of human immunodeficiency virus 1. Proc.Natl.Acad.Sci. 87:523-527. 246 35. Bukrinskaya, A., B. Brichacek, A. Mann, and M. Stevenson. 1998. Establishment of a functional human immunodeficiency virus type 1 (HIV-1) reverse transcription complex involves the cytoskeleton. J.Exp.Med. 188:2113-2125.

36. Bukrinskaya, A. G., A. Ghorpade, N. K. Heinzinger, T. E. Smithgall, R. E. Lewis, and M. Stevenson. 1996. Phosphorylation-dependent human immunodeficiency virus type 1 infection and nuclear targeting of viral DNA. Proc.Natl.Acad.Sci.U.S.A 93:367-371.

37. Bukrinsky, M. I., S. Haggerty, M. P. Dempsey, N. Sharova, A. Adzhubel, L. Spitz, P. Lewis, D. Goldfarb, M. Emerman, and M. Stevenson. 1993. A nuclear localization signal within HIV-1 matrix protein that governs infection of non-dividing cells. Nature 365:666-669.

38. Bukrinsky, M. I., N. Sharova, M. P. Dempsey, T. L. Stanwick, A. G. Bukrinskaya, S. Haggerty, and M. Stevenson. 1992. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc.Natl.Acad.Sci.U.S.A 89:6580-6584.

39. Buonomo, S. B., A. Michienzi, F. G. De Angelis, and I. Bozzoni. 1999. The Rev protein is able to transport to the cytoplasm small nucleolar RNAs containing a Rev binding element. RNA. 5:993-1002.

40. Burke, B. and J. Ellenberg. 2002. Remodelling the walls of the nucleus. Nat.Rev.Mol.Cell Biol. 3:487-497.

41. Burstein, H., D. Bizub, M. Kotler, G. Schatz, V. M. Vogt, and A. M. Skalka. 1992. Processing of avian retroviral gag polyprotein precursors is blocked by a mutation at the NC-PR cleavage site. J.Virol. 66:1781-1785.

42. Cairns, T. M. and R. C. Craven. 2001. Viral DNA synthesis defects in assembly-competent Rous sarcoma virus CA mutants. J.Virol. 75:242- 250.

43. Callahan, E. M. and J. W. Wills. 2000. Repositioning basic residues in the M domain of the Rous sarcoma virus Gag protein. J.Vir. 74:11222-11229.

44. Callahan, E. M. and J. W. Wills. 2003. Link between genome packaging and rate of budding for Rous sarcoma virus. J.Virol. 77:9388-9398.

45. Campbell, S. and V. M. Vogt. 1995. Self-assembly in vitro of purified CA- NC proteins from Rous sarcoma virus and human immunodeficiency virus type 1. J.Virol. 69:6487-6497.

46. Campbell, S. and V. M. Vogt. 1997. In vitro assembly of virus-like particles with Rous sarcoma virus Gag deletion mutants: identification of the p10 247 domain as a morphological determinant in the formation of spherical particles. J.Virol. 71:4425-4435.

47. Carlberg, K., T. A. Ryden, and K. Beemon. 1988. Localization and footprinting of an enhancer within the avian sarcoma virus gag gene. J.Virol. 62:1617-1624.

48. CARR, J. G. and J. G. CAMPBELL. 1958. Three new virus-induced fowl sarcomata. Br.J.Cancer 12:631-635.

49. Carreno, S., M.-E. Gouze, S. Schaak, L. J. Emorine, and I. Maridonneau- Parini. 2000. Lack of palmitoylation redirects p59Hck from the plasma membrane to p61Hck-positive lysosomes. J.Biol.chem. 275:36223-36229.

50. Cavalieri, F., T. Ruscio, R. Tinoco, S. Benedict, C. Davis, and P. K. Vogt. 1985. Isolation of three new avian sarcoma viruses: ASV 9, ASV 17, and ASV 25. Virology 143:680-683.

51. Chen, B. K., I. Rousso, S. Shim, and P. S. Kim. 2001. Efficient assembly of an HIV-1/MLV Gag-chimeric virus in murine cells. Proc.Natl.Acad.Sci.U.S.A 98:15239-15244.

52. Chen, C., O. A. Weisz, D. B. Stolz, S. C. Watkins, and R. C. Montelaro. 2004. Differential effects of actin cytoskeleton dynamics on equine infectious anemia virus particle production. J.Virol. 78:882-891.

53. Choy, E., V. K. Chiu, J. Silletti, M. Feoktistov, T. Morimoto, D. Michaelson, I. E. Ivanov, and M. R. Philips. 1999. Endomembrane trafficking of Ras: the CAAX motif targets proteins to the ER and Golgi. Cell 98:69-80.

54. Christophe, D., C. Christophe-Hobertus, and B. Pichon. 2000. Nuclear targeting of proteins: how many different signals? Cell Signal. 12:337- 341.

55. Coffin, J. M. and M. A. Billeter. 1976. A physical map of the Rous sarcoma virus genome. J.Mol.Biol. 100:293-318.

56. Cokol, M., R. Nair, and B. Rost. 2000. Finding nuclear localization signals. EMBO Rep. 1:411-415.

57. Conte, M. R., M. Klikova, E. Hunter, T. Ruml, and S. Matthews. 1997. The three-dimensional solution structure of the matrix protein from the type D retrovirus, the Mason-Pfizer monkey virus, and implications for the morphology of retroviral assembly. EMBO J. 16:5819-5826. 248 58. Conte, M. R. and S. Matthews. 1998. Retroviral matrix proteins: a structural perspective. Virology 246:191-198.

59. Cordell, B., R. Swanstrom, H. M. Goodman, and J. M. Bishop. 1979. tRNATrp as primer for RNA-directed DNA polymerase: structural determinants of function. J.Biol.chem. 254:1866-1874.

60. Corpet, F. 1988. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 16:10881-10890.

61. Craven, R. C., A. E. Leure-duPree, C. R. Erdie, C. B. Wilson, and J. W. Wills. 1993. Necessity of the spacer peptide between CA and NC in the Rous sarcoma virus gag protein. J.Virol. 67:6246-6252.

62. Craven, R. C., A. E. Leure-duPree, R. A. Weldon Jr, and J. W. Wills. 1995. Genetic analysis of the major homology region of the Rous sarcoma virus Gag protein. J.Vir. 69:4213-4227.

63. Craven, R. C. and L. J. Parent. 1996. Dynamic interactions of the Gag polyprotein. Curr.Top.Microbiol.Immunol. 214:65-94.

64. Cronshaw, J. M., A. N. Krutchinsky, W. Zhang, B. T. Chait, and M. J. Matunis. 2002. Proteomic analysis of the mammalian nuclear pore complex. J.Cell Biol. 158:915-927.

65. Cros, J. F. and P. Palese. 2003. Trafficking of viral genomic RNA into and out of the nucleus: influenza, Thogoto and Borna disease viruses. Virus Res. 95:3-12.

66. Cullen, B. R. 2000. Nuclear RNA export pathways. Mol.Cell Biol. 20:4181- 4187.

67. Cullen, B. R. 2001. Journey to the center of the cell. Cell 105:697-700.

68. Damico, R. L., J. Crane, and P. Bates. 1998. Receptor-triggered membrane association of a model retroviral glycoprotein. Proc.Natl.Acad.Sci.U.S.A 95:2580-2585.

69. Damsky, C. H., J. B. Sheffield, G. P. Tuszynski, and L. Warren. 1977. Is there a role for actin in virus budding? J.Cell Biol. 75:593-605.

70. Dang, V. D. and H. L. Levin. 2000. Nuclear import of the retrotransposon Tf1 is governed by a nuclear localization signal that possesses a unique requirement for the FXFG nuclear pore factor Nup124p. Mol.Cell Biol. 20:7798-7812. 249 71. Dangel, A. W., S. Hull, T. M. Roberts, and K. Boris-Lawrie. 2002. Nuclear interactions are necessary for translational enhancement by spleen necrosis virus RU5. J.Virol. 76:3292-3300.

72. Delos, S. E. and J. M. White. 2000. Critical role for the cysteines flanking the internal fusion peptide of avian sarcoma/leukosis virus envelope glycoprotein. J.Virol. 74:9738-9741.

73. Demirov, D. G., J. M. Orenstein, and E. O. Freed. 2002. The late domain of human immunodeficiency virus type 1 p6 promotes virus release in a cell type-dependent manner. J.Virol. 76:105-117.

74. Dimcheff, D. E., S. V. Drovetski, M. Krishnan, and D. P. Mindell. 2000. Cospeciation and horizontal transmission of avian sarcoma and leukosis virus gag genes in galliform birds. J.Virol. 74:3984-3995.

75. Dimcheff, D. E., M. Krishnan, and D. P. Mindell. 2001. Evolution and characterization of tetraonine endogenous retrovirus: a new virus related to avian sarcoma and leukosis viruses. J.Virol. 75:2002-2009.

76. Dingwall, C., S. V. Sharnick, and R. A. Laskey. 1982. A polypeptide domain that specifies migration of nucleoplasmin into the nucleus. Cell 30:449-458.

77. Donehower, L. A. and H. E. Varmus. 1984. A mutant murine leukemia virus with a single missense codon in pol is defective in a function affecting integration. Proc.Natl.Acad.Sci.U.S.A 81:6461-6465.

78. Dorner, A. J. and J. M. Coffin. 1986. Determinants for receptor interaction and cell killing on the avian retrovirus glycoprotein gp85. Cell 45:365- 374.

79. Dupont, S., N. Sharova, C. DeHoratius, C. M. Virbasius, X. Zhu, A. G. Bukrinskaya, M. Stevenson, and M. R. Green. 1999. A novel nuclear export activity in HIV-1 matrix protein required for viral replication. Nature 402:681-685.

80. Dupraz, P. and P. F. Spahr. 1993. Analysis of deletions and thermosensitive mutations in Rous sarcoma virus gag protein p10. J.Virol. 67:3826-3834.

81. Earp, L. J., S. E. Delos, R. C. Netter, P. Bates, and J. M. White. 2003. The avian retrovirus avian sarcoma/leukosis virus subtype A reaches the lipid mixing stage of fusion at neutral pH. J.Virol. 77:3058-3066.

82. Eastman, S. W. and M. L. Linial. 2001. Identification of a conserved residue of foamy virus Gag required for intracellular capsid assembly. J.Vir. 75:6857-6864. 250 83. Ehrlich, L. S., S. Fong, S. Scarlata, G. Zybarth, and C. Carter. 1996. Partitioning of HIV-1 Gag and Gag-related proteins to membranes. Biochemistry 35:3933-3943.

84. Ellerman, V. a. B. O. 1908. Experimentalle Leukämie bei Hühnern. Zentralbl.Bakteriol.Parasitenkd.Infectionskr.Hyg.Abt.Orig. 46:595-609.

85. Engelbreth-Holm, J. and A. Rother Meyer. 1935. On the connection between erythroblastosis (haemocytoblastosis), myelosis, and sarcoma in the chicken. Acta Pathol.Microbiol.Scand. 12:352-365.

86. Englmeier, L., M. Fornerod, F. R. Bischoff, C. Petosa, I. W. Mattaj, and U. Kutay. 2001. RanBP3 influences interactions between CRM1 and its nuclear protein export substrates. EMBO Rep. 2:926-932.

87. Erdie, C. R. and J. W. Wills. 1990. Myristylation of Rous sarcoma virus Gag protein does not prevent replication in avian cells. J.Virol. 64:5204-5208.

88. Facke, M., A. Janetzko, R. L. Shoeman, and H.-G. Krausslich. 1993. A large deletion in the Matrix domain of the Human immunodeficiency virus gag gene redirects virus particle assembly from the plasma membrane to the endoplasmic reticulum. J.Vir. 67:4972-4980.

89. Fassati, A. and S. P. Goff. 1999. Characterization of intracellular reverse transcription complexes of Moloney murine leukemia virus. J.Virol. 73:8919-8925.

90. Fassati, A. and S. P. Goff. 2001. Characterization of intracellular reverse transcription complexes of human immunodeficiency virus type 1. J.Virol. 75:3626-3635.

91. Fassati, A., D. Gorlich, I. Harrison, L. Zaytseva, and J. M. Mingot. 2003. Nuclear import of HIV-1 intracellular reverse transcription complexes is mediated by importin 7. EMBO J. 22:3675-3685.

92. Feldherr, C. M. and D. Akin. 1993. Regulation of nuclear transport in proliferating and quiescent cells. Exp.Cell Res. 205:179-186.

93. Feng, W., A. L. Benko, J. H. Lee, D. R. Stanford, and A. K. Hopper. 1999. Antagonistic effects of NES and NLS motifs determine S. cerevisiae Rna1p subcellular distribution. J.Cell Sci. 112 ( Pt 3):339-347.

94. Feng, Y. X., T. Li, S. Campbell, and A. Rein. 2002. Reversible binding of recombinant human immunodeficiency virus type 1 gag protein to nucleic acids in virus-like particle assembly in vitro. J.Virol. 76:11757-11762. 251 95. Fischer, U., J. Huber, W. C. Boelens, I. W. Mattaj, and R. Luhrmann. 1995. The HIV-1 Rev activation domain is a nuclear export signal that accesses an export pathway used by specific cellular RNAs. Cell 82:475-483.

96. Fischer, U., V. W. Pollard, R. Luhrmann, M. Teufel, M. W. Michael, G. Dreyfuss, and M. H. Malim. 1999. Rev-mediated nuclear export of RNA is dominant over nuclear retention and is coupled to the Ran-GTPase cycle. Nucleic Acids Res. 27:4128-4134.

97. Fishburn, C. S., P. Herzmark, J. Morales, and H. R. Bourne. 1999. Gβγ and palmitate target newly synthesized Gαz to the plasma membrane. J.Biol.chem. 274:18793-18800.

98. Fleissner, E. 1971. Chromatographic separation and antigenic analysis of proteins of the oncornaviruses. I. Avian leukemia-sarcoma viruses. J.Virol. 8:778-785.

99. Fornerod, M., M. Ohno, M. Yoshida, and I. W. Mattaj. 1997. CRM1 is an export receptor for leucine-rich nuclear export signals. Cell 90:1051-1060.

100. Fosse, P., N. Motte, A. Roumier, C. Gabus, D. Muriaux, J. L. Darlix, and J. Paoletti. 1996. A short autocomplementary sequence plays an essential role in avian sarcoma-leukosis virus RNA dimerization. Biochemistry 35:16601-16609.

101. Fouchier, R. A., B. E. Meyer, J. H. Simon, U. Fischer, and M. H. Malim. 1997. HIV-1 infection of non-dividing cells: evidence that the amino- terminal basic region of the viral matrix protein is important for Gag processing but not for post-entry nuclear import. EMBO J. 16:4531-4539.

102. Freed, E. O. 2002. Viral late domains. J.Virol. 76:4679-4687.

103. Freed, E. O., G. Englund, F. Maldarelli, and M. A. Martin. 1997. Phosphorylation of residue 131 of HIV-1 matrix is not required for macrophage infection. Cell 88:171-173.

104. Fu, W., B. A. Ortiz-Conde, R. J. Gorelick, S. H. Hughes, and A. Rein. 1997. Placement of tRNA primer on the primer-binding site requires pol gene expression in avian but not murine retroviruses. J.Virol. 71:6940- 6946.

105. Fu, W. and A. Rein. 1993. Maturation of dimeric viral RNA of Moloney murine leukemia virus. J.Virol. 67:5443-5449.

106. Fujiwara, T., K. Oda, S. Yokota, A. Takatsuki, and Y. Ikehara. 1988. Brefeldin A causes disassembly of the Golgi complex and accumulation of 252 secretory proteins in the endoplasmic reticulum. J.Biol.chem. 263:18545- 18552.

107. Fukuda, M., S. Asano, T. Nakamura, M. Adachi, M. Yoshida, M. Yanagida, and E. Nishida. 1997. CRM1 is responsible for intracellular transport mediated by the nuclear export signal. Nature 390:308-311.

108. Galbiati, F., B. Razani, and M. P. Lisanti. 2001. Emerging themes in lipid rafts and caveolae. Cell 106:403-411.

109. Gallina, A., G. Mantoan, G. Rindi, and G. Milanesi. 1994. Influence of MA internal sequences, but not of the myristylated N-terminus sequence, on the budding site of HIV-1 Gag protein. Biochem.Biophys.Res.Comm. 204:1031-1038.

110. Gallo, R. C., S. Z. Salahuddin, M. Popovic, G. M. Shearer, M. Kaplan, B. F. Haynes, T. J. Palker, R. Redfield, J. Oleske, B. Safai, and . 1984. Frequent detection and isolation of cytopathic retroviruses (HTLV-III) from patients with AIDS and at risk for AIDS. Science 224:500-503.

111. Gallouzi, I. E., C. M. Brennan, and J. A. Steitz. 2001. Protein ligands mediate the CRM1-dependent export of HuR in response to heat shock. RNA. 7:1348-1361.

112. Galy, V., O. Gadal, M. Fromont-Racine, A. Romano, A. Jacquier, and U. Nehrbass. 2004. Nuclear retention of unspliced mRNAs in yeast is mediated by perinuclear Mlp1. Cell 116:63-73.

113. Garbitt, R. A., J. A. Albert, M. D. Kessler, and L. J. Parent. 2001. trans- acting inhibition of genomic RNA dimerization by Rous sarcoma virus matrix mutants. J.Vir. 75:260-268.

114. Gilbert, J. M., D. Mason, and J. M. White. 1990. Fusion of Rous sarcoma virus with host cells does not require exposure to low pH. J.Virol. 64:5106-5113.

115. Goff, S. P. 2001. Intracellular trafficking of retroviral genomes during the early phase of infection: viral exploitation of cellular pathways. J.Gene Med. 3:517-528.

116. Gonzalo, S., W. K. Greentree, and M. E. Linder. 1999. SNAP-25 is targeted to the plasma membrane through a novel membrane-binding domain. J.Biol.chem. 274:21313-21318.

117. Gorlich, D. and U. Kutay. 1999. Transport between the cell nucleus and the cytoplasm. Annu.Rev.Cell Dev.Biol. 15:607-660. 253 118. Gottlinger, H. G., T. Dorfman, J. G. Sodroski, and W. A. Haseltine. 1991. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proc.Natl.Acad.Sci.U.S.A 88:3195-3199.

119. Gottlinger, H. G., J. G. Sodroski, and W. A. Haseltine. 1989. Role of capsid precursor processing and myristoylation in morphogenesis and infectivity of human immunodeficiency virus type 1. Proc.Natl.Acad.Sci. 86:5781-5785.

120. Griffin, S. D., J. F. Allen, and A. M. Lever. 2001. The major human immunodeficiency virus type 2 (HIV-2) packaging signal is present on all HIV-2 RNA species: cotranslational RNA encapsidation and limitation of Gag protein confer specificity. J.Virol. 75:12058-12069.

121. Griffis, E. R., S. Xu, and M. A. Powers. 2003. Nup98 localizes to both nuclear and cytoplasmic sides of the nuclear pore and binds to two distinct nucleoporin subcomplexes. Mol.Biol.Cell 14:600-610.

122. Gruter, P., C. Tabernero, C. von Kobbe, C. Schmitt, C. Saavedra, A. Bachi, M. Wilm, B. K. Felber, and E. Izaurralde. 1998. TAP, the human homolog of Mex67p, mediates CTE-dependent RNA export from the nucleus. Mol.Cell 1:649-659.

123. Hammarstedt, M., K. Wallengren, K. W. Pedersen, N. Roos, and H. Garoff. 2000. Minimal exclusion of plasma membrane proteins during retroviral envelope formation. Proc.Natl.Acad.Sci.U.S.A 97:7527-7532.

124. Hancock, J. F., H. Paterson, and C. J. Marshall. 1990. A polybasic domain or palmitoylation is required in addition to the CAAX motif to localize p21ras to the plasma membrane. Cell 63:133-139.

125. Hansen, M., L. Jelinek, S. Whiting, and E. Barklis. 1990. Transport and assembly of gag proteins into Moloney murine leukemia virus. J.Vir. 64:5306-5316.

126. Hatanaka, H., O. Iourin, Z. Rao, E. Fry, A. Kingsman, and D. I. Stuart. 2002. Structure of Equine infectious anemia virus Matrix protein. J.Vir. 76:1876-1883.

127. Hatziioannou, T. and S. P. Goff. 2001. Infection of nondividing cells by Rous sarcoma virus. J.Virol. 75:9526-9531.

128. Hayward, W. S., B. G. Neel, and S. M. Astrin. 1981. Activation of a cellular onc gene by promoter insertion in ALV-induced lymphoid leukosis. Nature 290:475-480. 254 129. Heger, P., J. Lohmaier, G. Schneider, K. Schweimer, and R. H. Stauber. 2001. Qualitative highly divergent nuclear export signals can regulate export by the competition for transport cofactors in vivo. Traffic. 2:544- 555.

130. Henderson, B. R. and A. Eleftheriou. 2000. A comparison of the activity, sequence specificity, and CRM1-dependence of different nuclear export signals. Exp.Cell Res. 256:213-224.

131. Hermida-Matsumoto, L. and M. D. Resh. 1999. Human immunodeficiency virus type 1 protease triggers a myristoyl switch that modulates membrane binding of Pr55gag and p17MA. J.Vir. 73:1902-1908.

132. Hermida-Matsumoto, L. and M. D. Resh. 2000. Localization of human immunodeficiency virus type 1 Gag and Env at the plasma membrane by confocal imaging. J.Vir. 74:8670-8679.

133. Hirt, B. 1967. Selective extraction of polyoma DNA from infected mouse cell cultures. J.Mol.Biol. 26:365-369.

134. Hofmann, K., P. Bucher, L. Falquet, and A. Bairoch. 1999. The PROSITE database, its status in 1999. Nucleic Acids Res. 27:215-219.

135. Honer, B., R. L. Shoeman, and P. Traub. 1991. Human immunodeficiency virus type 1 protease microinjected into cultured human skin fibroblasts cleaves vimentin and affects cytoskeletal and nuclear architecture. J.Cell Sci. 100 ( Pt 4):799-807.

136. Hong, S., G. Choi, S. Park, A. S. Chung, E. Hunter, and S. S. Rhee. 2001. Type D retrovirus Gag polyprotein interacts with the cytosolic chaperonin TRiC. J.Virol. 75:2526-2534.

137. Hope, T. J. 1999. The ins and outs of HIV Rev. Arch.Biochem.Biophys. 365:186-191.

138. Hsu, T. W. and J. M. Taylor. 1982. Single-stranded regions on unintegrated avian retrovirus DNA. J.Virol. 44:47-53.

139. Hughes, S. H., P. R. Shank, D. H. Spector, H. J. Kung, J. M. Bishop, H. E. Varmus, P. K. Vogt, and M. L. Breitman. 1978. Proviruses of avian sarcoma virus are terminally redundant, co-extensive with unintegrated linear DNA and integrated at many sites. Cell 15:1397-1410.

140. Hull, S. and K. Boris-Lawrie. 2002. RU5 of Mason-Pfizer monkey virus 5' long terminal repeat enhances cytoplasmic expression of human immunodeficiency virus type 1 gag-pol and nonviral reporter RNA. J.Virol. 76:10211-10218. 255 141. Isoyama, T., S. Kuge, and A. Nomoto. 2002. The core protein of hepatitis C virus is imported into the nucleus by transport receptor Kap123p but inhibits Kap121p-dependent nuclear import of yeast AP1-like transcription factor in yeast cells. J.Biol.chem. 277:39634-39641.

142. Ito, H., Y. Fukuda, K. Murata, and A. Kimura. 1983. Transformation of intact yeast cells treated with alkali cations. J.Bacteriol. 153:163-168.

143. Jacks, T., H. D. Madhani, F. R. Masiarz, and H. E. Varmus. 1988. Signals for ribosomal frameshifting in the Rous sarcoma virus gag-pol region. Cell 55:447-458.

144. Jan, E., C. K. Motzny, L. E. Graves, and E. B. Goodwin. 1999. The STAR protein, GLD-1, is a translational regulator of sexual identity in Caenorhabditis elegans. EMBO J. 18:258-269.

145. Jans, D. A., C. Y. Xiao, and M. H. Lam. 2000. Nuclear targeting signal recognition: a key control point in nuclear transport? Bioessays 22:532- 544.

146. Jensen, T. H., K. Dower, D. Libri, and M. Rosbash. 2003. Early formation of mRNP: license for export or quality control? Mol.Cell 11:1129-1138.

147. Johnson, C., D. Van Antwerp, and T. J. Hope. 1999. An N-terminal nuclear export signal is required for the nucleocytoplasmic shuttling of IkappaBalpha. EMBO J. 18:6682-6693.

148. Joshi, S. M. and V. M. Vogt. 2000. Role of the Rous sarcoma virus p10 domain in shape determination of gag virus-like particles assembled in vitro and within Escherichia coli. J.Virol. 74:10260-10268.

149. Kalab, P., K. Weis, and R. Heald. 2002. Visualization of a Ran-GTP gradient in interphase and mitotic Xenopus egg extracts. Science 295:2452-2456.

150. Kalderon, D., B. L. Roberts, W. D. Richardson, and A. E. Smith. 1984. A short amino acid sequence able to specify nuclear location. Cell 39:499- 509.

151. Kang, Y. and B. R. Cullen. 1999. The human Tap protein is a nuclear mRNA export factor that contains novel RNA-binding and nucleocytoplasmic transport sequences. Genes Dev. 13:1126-1139.

152. Kapoor, P. and L. Frappier. 2003. EBNA1 partitions Epstein-Barr virus plasmids in yeast cells by attaching to human EBNA1-binding protein 2 on mitotic chromosomes. J.Virol. 77:6946-6956. 256 153. Kates, J. R. and B. R. McAuslan. 1967. Poxvirus DNA-dependent RNA polymerase. Proc.Natl.Acad.Sci.U.S.A 58:134-141.

154. Katz, R. A., J. G. Greger, K. Darby, P. Boimel, G. F. Rall, and A. M. Skalka. 2002. Transduction of interphase cells by avian sarcoma virus. J.Virol. 76:5422-5434.

155. Katz, R. A., M. Kotler, and A. M. Skalka. 1988. cis-acting intron mutations that affect the efficiency of avian retroviral RNA splicing: implication for mechanisms of control. J.Virol. 62:2686-2695.

156. Katzmann, D. J., C. J. Stefan, M. Babst, and S. D. Emr. 2003. Vps27 recruits ESCRT machinery to endosomes during MVB sorting. J.Cell Biol. 162:413-423.

157. Kawai, S. 1980. Transformation of rat cells by fusion-infection with Rous sarcoma virus. J.Virol. 34:772-776.

158. Kaye, J. F. and A. M. Lever. 1998. Nonreciprocal packaging of human immunodeficiency virus type 1 and type 2 RNA: a possible role for the p2 domain of Gag in RNA encapsidation. J.Virol. 72:5877-5885.

159. Keogh, E. V. 1938. Ectodermal lesions produced by the virus of Rous sarcoma. Br.J.Exp.Pathol. 19:1-9.

160. Khorchid, A., R. Halwani, M. A. Wainberg, and L. Kleiman. 2002. Role of RNA in facilitating Gag/Gag-Pol interaction. J.Virol. 76:4131-4137.

161. Kiernan, R. E., A. Ono, G. Englund, and E. O. Freed. 1998. Role of matrix in an early postentry step in the human immunodeficiency virus type 1 life cycle. J.Virol. 72:4116-4126.

162. Kikonyogo, A., F. Bouamr, M. L. Vana, Y. Xiang, A. Aiyar, C. Carter, and J. Leis. 2001. Proteins related to the Nedd4 family of ubiquitin protein ligases interact with the L domain of Rous sarcoma virus and are required for gag budding from cells. Proc.Natl.Acad.Sci.U.S.A 98:11199- 11204.

163. Kilzer, J. M., T. Stracker, B. Beitzel, K. Meek, M. Weitzman, and F. D. Bushman. 2003. Roles of host cell factors in circularization of retroviral DNA. Virology 314:460-467.

164. Kim, F. J., A. A. Beeche, J. J. Hunter, D. J. Chin, and T. J. Hope. 1996. Characterization of the nuclear export signal of human T-cell lymphotropic virus type 1 Rex reveals that nuclear export is mediated by position-variable hydrophobic interactions. Mol.Cell Biol. 16:5147-5155. 257 165. Kim, W., Y. Tang, Y. Okada, T. A. Torrey, S. K. Chattopadhyay, M. Pfleiderer, F. G. Falkner, F. Dorner, W. Choi, N. Hirokawa, and H. C. Morse, III. 1998. Binding of murine leukemia virus Gag polyproteins to KIF4, a microtubule-based motor protein. J.Virol. 72:6898-6901.

166. Kimura, T., I. Hashimoto, A. Yamamoto, M. Nishikawa, and J. I. Fujisawa. 2000. Rev-dependent association of the intron-containing HIV- 1 gag mRNA with the nuclear actin bundles and the inhibition of its nucleocytoplasmic transport by latrunculin-B. Genes Cells 5:289-307.

167. King, J. A., J. M. Bridger, F. Gounari, P. Lichter, T. F. Schulz, V. Schirrmacher, and K. Khazaie. 1998. The extended packaging sequence of MoMLV contains a constitutive mRNA nuclear export function. FEBS Lett. 434:367-371.

168. Kingston, R. L., N. H. Olson, and V. M. Vogt. 2001. The organization of mature Rous sarcoma virus as studied by cryoelectron microscopy. J.Struct.Biol. 136:67-80.

169. Kjems, J. and P. A. Sharp. 1993. The basic domain of Rev from human immunodeficiency virus type 1 specifically blocks the entry of U4/U6.U5 small nuclear ribonucleoprotein in spliceosome assembly. J.Virol. 67:4769-4776.

170. Koegl, M., P. Zlatkine, S. C. Ley, S. A. Courtneidge, and A. I. Magee. 1994. Palmitoylation of multiple Src-family kinases at a homologous N- terminal motif. Biochem.J. 303 ( Pt 3):749-753.

171. Kohler, M., D. Gorlich, E. Hartmann, and J. Franke. 2001. Adenoviral E1A protein nuclear import is preferentially mediated by importin alpha3 in vitro. Virology 289:186-191.

172. Kohler, M., H. Haller, and E. Hartmann. 1999. Nuclear protein transport pathways. Exp.Nephrol. 7:290-294.

173. Kootstra, N. A., C. Munk, N. Tonnu, N. R. Landau, and I. M. Verma. 2003. Abrogation of postentry restriction of HIV-1-based lentiviral vector transduction in simian cells. Proc.Natl.Acad.Sci.U.S.A 100:1298-1303.

174. Kootstra, N. A. and H. Schuitemaker. 1999. Phenotype of HIV-1 lacking a functional nuclear localization signal in matrix protein of gag and Vpr is comparable to wild-type HIV-1 in primary macrophages. Virology 253:170-180.

175. Krausslich, H. G. and R. Welker. 1996. Intracellular transport of retroviral capsid components. Curr.Top.Microbiol.Immunol. 214:25-63. 258 176. Krishna, N. K., S. Campbell, V. M. Vogt, and J. W. Wills. 1998. Genetic determinants of Rous sarcoma virus particle size. J.Vir. 72:564-577.

177. Krishna, N. K., R. A. Weldon Jr, and J. W. Wills. 1996. Transport and processing of the Rous sarcoma virus Gag protein in the endoplasmic reticulum. J.Vir. 70:1570-1579.

178. Krol, M. A., N. H. Olson, J. Tate, J. E. Johnson, T. S. Baker, and P. Ahlquist. 1999. RNA-controlled polymorphism in the in vivo assembly of 180-subunit and 120-subunit virions from a single capsid protein. Proc.Natl.Acad.Sci.U.S.A 96:13650-13655.

179. Kudo, N., N. Matsumori, H. Taoka, D. Fujiwara, E. P. Schreiner, B. Wolff, M. Yoshida, and S. Horinouchi. 1999. Leptomycin B inactivates CRM1/exportin 1 by covalent modification at a cysteine residue in the central conserved region. Proc.Natl.Acad.Sci.U.S.A 96:9112-9117.

180. Kukolj, G., K. S. Jones, and A. M. Skalka. 1997. Subcellular localization of avian sarcoma virus and human immunodeficiency virus type 1 integrases. J.Virol. 71:843-847.

181. Kukolj, G., R. A. Katz, and A. M. Skalka. 1998. Characterization of the nuclear localization signal in the avian sarcoma virus integrase. Gene 223:157-163.

182. Kunkel, T. A., J. D. Roberts, and R. A. Zakour. 1987. Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154:367-382.

183. Lasko, P. 2003. Gene regulation at the RNA layer: RNA binding proteins in intercellular signaling networks. Sci.STKE. 2003:RE6.

184. Lecellier, C. H., M. Neves, M. L. Giron, J. Tobaly-Tapiero, and A. Saib. 2002. Further characterization of equine foamy virus reveals unusual features among the foamy viruses. J.Virol. 76:7220-7227.

185. Lee, J., J. S. Park, J. Y. Moon, K. Y. Kim, and H. M. Moon. 2003. The influence of glycosylation on secretion, stability, and immunogenicity of recombinant HBV pre-S antigen synthesized in Saccharomyces cerevisiae. Biochem.Biophys.Res.Commun. 303:427-432.

186. Lee, J. S., H. E. Varmus, and J. M. Bishop. 1979. Virus-specific messenger RNAs in permissive cells infected by avian sarcoma virus. J.Biol.chem. 254:8015-8022. 259 187. Lee, M. H. and T. Schedl. 2001. Identification of in vivo mRNA targets of GLD-1, a maxi-KH motif containing protein required for C. elegans germ cell development. Genes Dev. 15:2408-2420.

188. Lee, S. J., N. Imamoto, H. Sakai, A. Nakagawa, S. Kose, M. Koike, M. Yamamoto, T. Kumasaka, Y. Yoneda, and T. Tsukihara. 2000. The adoption of a twisted structure of importin-beta is essential for the protein- protein interaction required for nuclear transport. J.Mol.Biol. 302:251-264.

189. Lee, Y.-M., B. Liu, and Yu X-F. 1999. Formation of virus assembly intermediate complexes in the cytoplasm by wild-type and assembly- defective mutant Human immunodeficiency virus type 1 and their association with membranes. J.Vir. 73:5654-5662.

190. Lee, Y. M. and J. M. Coffin. 1991. Relationship of avian retrovirus DNA synthesis to integration in vitro. Mol.Cell Biol. 11:1419-1430.

191. Lee, Y. M., C. J. Tian, and X. F. Yu. 1998. A bipartite membrane-binding signal in the human immunodeficiency virus type 1 matrix protein is required for the proteolytic processing of Gag precursors in a cell type- dependent manner. J.Virol. 72:9061-9068.

192. Li, L., J. M. Olvera, K. E. Yoder, R. S. Mitchell, S. L. Butler, M. Lieber, S. L. Martin, and F. D. Bushman. 2001. Role of the non-homologous DNA end joining pathway in the early steps of retroviral infection. EMBO J. 20:3272-3281.

193. Liang, X., Y. Lu, M. Wilkes, T. A. Neubert, and M. D. Resh. 2003. The N-terminal SH4 region of the Src family kinase Fyn is modified by methylation and heterogeneous fatty acylation: Role in membrane targeting, cell adhesion and spreading. J.Biol.chem.

194. Lindwasser, O. W. and M. D. Resh. 2001. Multimerization of Human immunodeficiency type 1 Gag promotes its localization to barges, raft-like membrane microdomains. J.Vir. 75:7913-7924.

195. Lindwasser, O. W. and M. D. Resh. 2002. Myristoylation as a target for inhibiting HIV assembly: unsaturated fatty acids block viral budding. Proc.Natl.Acad.Sci.U.S.A 99:13037-13042.

196. Liu, B., R. Dai, C. J. Tian, L. Dawson, R. Gorelick, and X. F. Yu. 1999. Interaction of the human immunodeficiency virus type 1 nucleocapsid with actin. J.Virol. 73:2901-2908.

197. Liu, B., M. H. Liang, Y. L. Kuo, W. Liao, I. Boros, T. Kleinberger, J. Blancato, and C. Z. Giam. 2003. Human T-lymphotropic virus type 1 oncoprotein tax promotes unscheduled degradation of Pds1p/securin and 260 Clb2p/cyclin B1 and causes chromosomal instability. Mol.Cell Biol. 23:5269- 5281.

198. Luban, J., K. L. Bossolt, E. K. Franke, G. V. Kalpana, and S. P. Goff. 1993. Human immunodeficiency virus type 1 Gag protein binds to cyclophilins A and B. Cell 73:1067-1078.

199. Luftig, R. B. and L. D. Lupo. 1994. Viral interactions with the host-cell cytoskeleton: the role of retroviral proteases. Trends Microbiol. 2:178- 182.

200. Luo, M. J. and R. Reed. 1999. Splicing is required for rapid and efficient mRNA export in metazoans. Proc.Natl.Acad.Sci.U.S.A 96:14937-14942.

201. Lyman, S. K., T. Guan, J. Bednenko, H. Wodrich, and L. Gerace. 2002. Influence of cargo size on Ran and energy requirements for nuclear protein import. J.Cell Biol. 159:55-67.

202. Ma, Y. M. and V. M. Vogt. 2002. Rous sarcoma virus Gag protein- oligonucleotide interaction suggests a critical role for protein dimer formation in assembly. J.Virol. 76:5452-5462.

203. Macara, I. G. 2001. Transport into and out of the nucleus. Microbiol.Mol.Biol.Rev. 65:570-94, table.

204. Malim, M. H., D. F. McCarn, L. S. Tiley, and B. R. Cullen. 1991. Mutational definition of the human immunodeficiency virus type 1 Rev activation domain. J.Virol. 65:4248-4254.

205. Marin, V. A. and T. C. Evans. 2003. Translational repression of a C. elegans Notch mRNA by the STAR/KH domain protein GLD-1. Development 130:2623-2632.

206. Marques, S. M., J. L. Veyrune, R. R. Shukla, and A. Kumar. 2003. Restriction of human immunodeficiency virus type 1 Rev function in murine A9 cells involves the Rev C-terminal domain. J.Virol. 77:3084- 3090.

207. Martin, G. S. 1970. Rous sarcoma virus: a function required for the maintenance of the transformed state. Nature 227:1021-1023.

208. Massiah, M. A., M. R. Staricg, C. Paschall, M. F. Summers, A. M. Christensen, and W. I. Sundquist. 1994. The three-dimensional structure of the human immunodeficiency virus type 1 matrix protein. J.Mol.Biol. 244:198-223. 261 209. Mattaj, I. W. and L. Englmeier. 1998. Nucleocytoplasmic transport: the soluble phase. Annu.Rev.Biochem. 67:265-306.

210. Matthews, S., P. Barlow, J. Boyd, G. Barton, R. Russell, H. Mills, M. Cunningham, N. Meyers, N. Burns, N. Clark, S. Kingsman, A. Kingsman, and I. Campbell. 1994. Structural similarity between the p17 matrix protein of HIV-1 and interferon-γ. Nature 370:666-668.

211. Matthews, S., M. Mikhailov, A. Burny, and P. Roy. 1996. The solution structure of the bovine leukaemia virus matrix protein and similarity with lentiviral matrix proteins. EMBO J. 15:3267-3274.

212. Matunis, M. J., J. Wu, and G. Blobel. 1998. SUMO-1 modification and its role in targeting the Ran GTPase-activating protein, RanGAP1, to the nuclear pore complex. J.Cell Biol. 140:499-509.

213. Mayer, B. J., M. Hamaguchi, and H. Hanafusa. 1988. A novel viral oncogene with structural similarity to phospholipase C. Nature 332:272- 275.

214. Mazurenko, N., A. Asanova, J. Svoboda, and F. L. Kisseljov. 1984. Expression of RSV-specific proteins in RSV-transformed mammalian cells. Folia Biol.(Praha) 30:259-266.

215. McBride, M. S., M. D. Schwartz, and A. T. Panganiban. 1997. Efficient encapsidation of human immunodeficiency virus type 1 vectors and further characterization of cis elements required for encapsidation. J.Virol. 71:4544-4554.

216. McCabe, J. B. and L. G. Berthiaume. 1999. Functional roles for fatty acylated amino-terminal domains in subcellular localization. Mol.Biol.Cell 10:3771-3786.

217. McDonnell, J. M., D. Fushman, S. M. Cahill, W. Zhou, A. wolven, C. B. Wilson, T. D. Nelle, M. D. Resh, J. Wills, and D. Cowburn. 1998. Solution structure and dynamics of the bioactive retroviral M domain from Rous sarcoma virus. J.Mol.Biol. 279:921-928.

218. McNally, M. T., R. R. Gontarek, and K. Beemon. 1991. Characterization of Rous sarcoma virus intronic sequences that negatively regulate splicing. Virology 185:99-108.

219. Miller, M. D., C. M. Farnet, and F. D. Bushman. 1997. Human immunodeficiency virus type 1 preintegration complexes: studies of organization and composition. J.Virol. 71:5382-5390. 262 220. Mobley, C. M. and L. Sealy. 2000. The Rous sarcoma virus long terminal repeat promoter is regulated by TFII-I. J.Virol. 74:6511-6519.

221. Morales, J., C. S. Fishburn, P. T. Wilson, and P. T. Bourne. 1998. Plasma membrane localization of Gαz requires two signals. Mol.Biol.Cell 9:1-14.

222. Moreland, R. B., G. L. Langevin, R. H. Singer, R. L. Garcea, and L. M. Hereford. 1987. Amino acid sequences that determine the nuclear localization of yeast histone 2B. Mol.Cell Biol. 7:4048-4057.

223. Morris, S., M. Johnson, E. Stavnezer, and J. Leis. 2002. Replication of avian sarcoma virus in vivo requires an interaction between the viral RNA and the TpsiC loop of the tRNA(Trp) primer. J.Virol. 76:7571-7577.

224. Moscovici, C., M. G. Moscovici, J. Jimenez, M. M. C. Lai, M. J. Hayman, and P. K. Vogt. 1977. Continuous tissue culture cell lines derived from chemically induced tumors of Japanese quail. Cell 11:95- 103.

225. Mothes, W., A. L. Boerger, S. Narayan, J. M. Cunningham, and J. A. Young. 2000. Retroviral entry mediated by receptor priming and low pH triggering of an envelope glycoprotein. Cell 103:679-689.

226. Muriaux, D., J. Mirro, D. Harvin, and A. Rein. 2001. RNA is a structural element in retrovirus particles. Proc.Natl.Acad.Sci.U.S.A 98:5246-5251.

227. Murray, D., N. Ben-Tal, B. Honig, and S. McLaughlin. 1997. Electrostatic interaction of myristoylated proteins with membranes:simple physics, compliated biology. Structure 5:985-989.

228. Murray, D., L. Hermida-Matsumoto, C. A. Buser, J. Tsang, C. T. Sigal, N. Ben Tal, B. Honig, M. D. Resh, and S. McLaughlin. 1998. Electrostatics and the membrane association of Src: theory and experiment. Biochemistry 37:2145-2159.

229. Nakielny, S. and G. Dreyfuss. 1999. Transport of proteins and RNAs in and out of the nucleus. Cell 99:677-690.

230. Nandhagopal, N., A. A. Simpson, M. C. Johnson, A. B. Francisco, G. W. Schatz, M. G. Rossmann, and V. M. Vogt. 2004. Dimeric rous sarcoma virus capsid protein structure relevant to immature Gag assembly. J.Mol.Biol. 335:275-282.

231. Nash, M. A., M. K. Meyer, G. L. Decker, and R. B. Arlinghaus. 1993. A subset of Pr65gag is nucleus associated in murine leukemia virus-infected cells. J.Virol. 67:1350-1356. 263 232. Nelle, T. D. and J. W. Wills. 1996. A large region within the Rous sarcoma virus Matrix protein is dispensiable for budding and infectivity. J.Vir. 70:2269-2276.

233. Neville, M. and M. Rosbash. 1999. The NES-Crm1p export pathway is not a major mRNA export route in Saccharomyces cerevisiae. EMBO J. 18:3746-3756.

234. Nguyen, D. H. and J. E. K. Hildreth. 2000. Evidence for budding of Human immunodeficiency virus type 1 selectively from glycolipid- enriched membrane lipid rafts. J.Vir. 74:3264-3272.

235. Nikiforov, M. A. and A. V. Gudkov. 1994. ART-CH: a VL30 in chickens? J.Virol. 68:846-853.

236. Niv, H., O. Gutman, Y. Kloog, and Y. I. Henis. 2002. Activated K-Ras and H-Ras display different interactions with saturable nonraft sites at the surface of live cells. J.Cell Biol. 157:865-872.

237. Noueiry, A. O., J. Diez, S. P. Falk, J. Chen, and P. Ahlquist. 2003. Yeast Lsm1p-7p/Pat1p deadenylation-dependent mRNA-decapping factors are required for brome mosaic virus genomic RNA translation. Mol.Cell Biol. 23:4094-4106.

238. Ogert, R. A. and K. L. Beemon. 1998. Mutational analysis of the rous sarcoma virus DR posttranscriptional control element. J.Virol. 72:3407- 3411.

239. Ogert, R. A., L. H. Lee, and K. L. Beemon. 1996. Avian retroviral RNA element promotes unspliced RNA accumulation in the cytoplasm. J.Virol. 70:3834-3843.

240. Ohno, M., A. Segref, A. Bachi, M. Wilm, and I. W. Mattaj. 2000. PHAX, a mediator of U snRNA nuclear export whose activity is regulated by phosphorylation. Cell 101:187-198.

241. Ohtsubo, M., H. Okazaki, and T. Nishimoto. 1989. The RCC1 protein, a regulator for the onset of chromosome condensation locates in the nucleus and binds to DNA. J.Cell Biol. 109:1389-1397.

242. Ono, A. and E. O. Freed. 2001. Plasma membrane rafts play a critical role in HIV-1 assembly and release. Proc.Natl.Acad.Sci. 98:13925-13930.

243. Ono, A., J. M. Orenstein, and E. O. Freed. 2000. Role of the Gag matrix domain in targeting Human immunodeficiency virus type 1 assembly. J.Vir. 74:2855-2866. 264 244. Ortiz-Conde, B. A. and S. H. Hughes. 1999. Studies of the genomic RNA of leukosis viruses: implications for RNA dimerization. J.Virol. 73:7165- 7174.

245. Ott, D. E., L. V. Coren, B. P. Kane, L. K. Busch, D. G. Johnson, R. C. Sowder, E. N. Chertova, L. O. Arthur, and L. E. Henderson. 1996. Cytoskeletal proteins inside human immunodeficiency virus type 1 virions. J.Virol. 70:7734-7743.

246. Overbaugh, J., A. D. Miller, and M. V. Eiden. 2001. Receptors and entry cofactors for retroviruses include single and multiple transmembrane- spanning proteins as well as newly described glycophosphatidylinositol- anchored and secreted proteins. Microbiol.Mol.Biol.Rev. 65:371-89, table.

247. Paca, R. E., R. A. Ogert, C. S. Hibbert, E. Izaurralde, and K. L. Beemon. 2000. Rous sarcoma virus DR posttranscriptional elements use a novel RNA export pathway. J.Virol. 74:9507-9514.

248. Paillart, J.-C. and H. G. Gottlinger. 1999. Opposing effects of human immunodeficency virus type 1 matrix mutations support a myristyl switch model of Gag membrane targeting. J.Vir. 73:2604-2612.

249. Panavas, T. and P. D. Nagy. 2003. Yeast as a model host to study replication and recombination of defective interfering RNA of Tomato bushy stunt virus. Virology 314:315-325.

250. Panet, A., W. A. Haseltine, D. Baltimore, G. Peters, F. Harada, and J. E. Dahlberg. 1975. Specific binding of tryptophan transfer RNA to avian myeloblastosis virus RNA-dependent DNA polymerase (reverse transcriptase). Proc.Natl.Acad.Sci.U.S.A 72:2535-2539.

251. Parent, L. J., R. P. Bennett, R. C. Craven, T. D. Nelle, N. K. Krishna, J. B. Bowzard, C. B. Wilson, B. A. Puffer, R. C. Montelaro, and J. W. Wills. 1995. Positionally independent and exchangeable late budding functions of the Rous sarcoma virus and human immunodeficiency virus Gag proteins. J.Virol. 69:5455-5460.

252. Parent, L. J., T. M. Cairns, J. A. Albert, C. B. Wilson, J. W. Wills, and R. C. Craven. 2000. RNA dimerization defect in a Rous sarcoma virus Matrix mutant. J.Vir. 74:164-172.

253. Parent, L. J., C. B. Wilson, M. D. Resh, and J. W. Wills. 1996. Evidence for a second function of the MA sequence in the Rous sarcoma virus Gag protein. J.Vir. 70:1016-1026.

254. Patnaik, A., V. Chau, and J. W. Wills. 2000. Ubiquitin is part of the retrovirus budding machinery. Proc.Natl.Acad.Sci. 97:13069-13074. 265 255. Patnaik, A. and J. W. Wills. 2002. In vivo interference of Rous sarcoma virus budding by cis expression of a WW domain. J.Virol. 76:2789-2795.

256. Payne, L. N., P. K. Pani, and R. A. Weiss. 1971. A dominant epistatic gene which inhibits cellular susceptibility to RSV(RAV-O). J.Gen.Virol. 13:455-462.

257. Pearce-Pratt, R., D. Malamud, and D. M. Phillips. 1994. Role of the cytoskeleton in cell-to-cell transmission of human immunodeficiency virus. J.Virol. 68:2898-2905.

258. Pelchen-Matthews, A., B. Kramer, and M. Marsh. 2003. Infectious HIV-1 assembles in late endosomes in primary macrophages. J.Cell Biol. 162:443-455.

259. Pepinsky, R. B., I. A. Papayannopoulos, E. P. Chow, N. K. Krishna, R. C. Craven, and V. M. Vogt. 1995. Differential proteolytic processing leads to multiple forms of the CA protein in avian sarcoma and leukemia viruses. J.Virol. 69:6430-6438.

260. Pessin, J. E. and M. Glaser. 1980. Budding of Rous sarcoma virus and Vesicular stomatitis virus from localized lipid regions in the plasma membrane of chicken embryo fibroblasts. J.Biol.chem. 255:9044-9050.

261. Petit, C., O. Schwartz, and F. Mammano. 2000. The karyophilic properties of human immunodeficiency virus type 1 integrase are not required for nuclear import of proviral DNA. J.Virol. 74:7119-7126.

262. Petropoulos, C. J. 1997. Retroviral Taxonomy, Protein Structures, Sequences, and Genetic Maps In J. M. Coffin, S. H. Hughes, and H. E. Varmus (ed.), Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, N.Y.

263. Poiesz, B. J., F. W. Ruscetti, A. F. Gazdar, P. A. Bunn, J. D. Minna, and R. C. Gallo. 1980. Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc.Natl.Acad.Sci.U.S.A 77:7415-7419.

264. Polianova, M., M. Alexandrov, V. Sovova, K. Simeonov, R. Roussev, D. Beshkov, and T. G. Todorov. 1999. A threshold level of gag expression is required for particle formation in rat cells transformed by avian retroviruses. Folia Biol.(Praha) 45:233-241.

265. Pollard, V. W. and M. H. Malim. 1998. The HIV-1 Rev protein. Annu.Rev.Microbiol. 52:491-532. 266 266. Popa, I., M. E. Harris, J. E. Donello, and T. J. Hope. 2002. CRM1-dependent function of a cis-acting RNA export element. Mol.Cell Biol. 22:2057- 2067.

267. Pornillos, O., J. E. Garrus, and W. I. Sundquist. 2002. Mechanisms of enveloped RNA virus budding. Trends Cell Biol. 12:569-579.

268. Powers, M. A., D. J. Forbes, J. E. Dahlberg, and E. Lund. 1997. The vertebrate GLFG nucleoporin, Nup98, is an essential component of multiple RNA export pathways. J.Cell Biol. 136:241-250.

269. Price, B. D., R. R. Rueckert, and P. Ahlouist. 1996. Complete replication of an animal virus and maintenance of expression vectors derived from it in Saccharomyces cerevisiae. Proc.Natl.Acad.Sci.U.S.A 93:9465-9470.

270. Prior, I. A., C. Muncke, R. G. Parton, and J. F. Hancock. 2003. Direct visualization of Ras proteins in spatially distinct cell surface microdomains. J.Cell Biol. 160:165-170.

271. Provitera, P., F. Bouamr, D. Murray, C. Carter, and S. Scarlata. 2000. Binding of Equine infectious anemia virus Matrix protein to membrane bilayers involves multiple interactions. J.Mol.Biol. 296:887-898.

272. Putterman, D., R. B. Pepinsky, and V. M. Vogt. 1990. Ubiquitin in avian leukosis virus particles. Virology 176:633-637.

273. Rao, Z. H., A. S. Beyaev, E. Fry, P. Roy, I. M. Jones, and D. I. Stuart. 1995. Crystal structure of SIV matrix antigen and its implications for virus assembly. Nature 378:743-747.

274. Rashkova, S., A. Athanasiadis, and M. L. Pardue. 2003. Intracellular targeting of Gag proteins of the Drosophila telomeric retrotransposons. J.Virol. 77:6376-6384.

275. Reddy, T. R., W. Xu, J. K. Mau, C. D. Goodwin, M. Suhasini, H. Tang, K. Frimpong, D. W. Rose, and F. Wong-Staal. 1999. Inhibition of HIV replication by dominant negative mutants of Sam68, a functional homolog of HIV-1 Rev. Nat.Med. 5:635-642.

276. Reed, M., R. Mariani, L. Sheppard, K. Pekrun, N. R. Landau, and N. W. Soong. 2002. Chimeric human immunodeficiency virus type 1 containing murine leukemia virus matrix assembles in murine cells. J.Virol. 76:436- 443.

277. Reil, H., A. A. Bukovsky, H. R. Gelderblom, and H. G. Gottlinger. 1998. Efficient HIV-1 replication can occur in the absence of the viral matrix protein. EMBO J. 17:2699-2708. 267 278. Resh, M. D. 1994. Myristoylation and palmitoylation ofSrc family members: the fats of the matter. Cell 76:411-413.

279. Resh, M. D. 1999. Fatty acylation of proteins: new insights into membrane targeting of myristoylated and palmitoylated proteins. Biochem.Biophys.Acta 1451:1-16.

280. Rey, O., J. Canon, and P. Krogstad. 1996. HIV-1 Gag protein associates with F-actin present in microfilaments. Virology 220:530-534.

281. Rhee, S. R. and E. Hunter. 1990. A sinlge amino acid substitution within the matrix protein of a type d retrovirus converts its morphogenesis to that of a type C retrovirus. Cell 63:77-86.

282. Riffel, N., K. Harlos, O. Iourin, Z. Rao, A. Kingsman, D. Stuart, and E. Fry. 2002. Atomic resolution structure of Moloney murine leukemia virus matrix protein and its relationship to other retroviral matrix proteins. Structure.(Camb.) 10:1627-1636.

283. Robbins, S. M., N. A. Quintrell, and J. M. Bishop. 1995. Myristoylation and differential palmitoylation of the HCK protein-tyrosine kinases govern their attachment to membranes and their association with caveolae. Mol.Cell.Biol. 15:3507-3515.

284. Robinson, H. L., S. S. Reinsch, and P. R. Shank. 1986. Sequences near the 5' long terminal repeat of avian leukosis viruses determine the ability to induce osteopetrosis. J.Virol. 59:45-49.

285. Roe, T., T. C. Reynolds, G. Yu, and P. O. Brown. 1993. Integration of murine leukemia virus DNA depends on mitosis. EMBO J. 12:2099-2108.

286. Rogel, M. E., L. I. Wu, and M. Emerman. 1995. The human immunodeficiency virus type 1 vpr gene prevents cell proliferation during chronic infection. J.Virol. 69:882-888.

287. Roth, M. J., P. Schwartzberg, N. Tanese, and S. P. Goff. 1990. Analysis of mutations in the integration function of Moloney murine leukemia virus: effects on DNA binding and cutting. J.Virol. 64:4709-4717.

288. Rous, P. 1911. A sarcoma of the fowl transmissible by an agent seperable from the tumour cells. J.Exp.Med. 13:397-411.

289. Rout, M. P., J. D. Aitchison, A. Suprapto, K. Hjertaas, Y. Zhao, and B. T. Chait. 2000. The yeast nuclear pore complex: composition, architecture, and transport mechanism. J.Cell Biol. 148:635-651. 268 290. Rout, M. P., G. Blobel, and J. D. Aitchison. 1997. A distinct nuclear import pathway used by ribosomal proteins. Cell 89:715-725.

291. Royer, M., M. Cerutti, B. Gay, S. S. Hong, G. Devauchelle, and P. Boulanger. 1991. Functional domains of HIV-1 gag-polyprotein expressed in baculovirus-infected cells. Virology 184:417-422.

292. Ryden, T. A., M. de Mars, and K. Beemon. 1993. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers. J.Virol. 67:2862-2870.

293. Saccomanno, L., C. Loushin, E. Jan, E. Punkay, K. Artzt, and E. B. Goodwin. 1999. The STAR protein QKI-6 is a translational repressor. Proc.Natl.Acad.Sci.U.S.A 96:12605-12610.

294. Saha, N., S. Shuman, and B. Schwer. 2003. Yeast-based genetic system for functional analysis of poxvirus mRNA cap methyltransferase. J.Virol. 77:7300-7307.

295. Sakuragi, S., T. Goto, K. Sano, and Y. Morikawa. 2002. HIV type 1 Gag virus-like particle budding from spheroplasts of Saccharomyces cerevisiae. Proc.Natl.Acad.Sci.U.S.A 99:7956-7961.

296. Samuel, D., K. Sasnauskas, L. Jin, A. Gedvilaite, R. Slibinskas, S. Beard, A. Zvirbliene, S. A. Oliveira, J. Staniulis, B. Cohen, and D. Brown. 2003. Development of a measles specific IgM ELISA for use with serum and oral fluid samples using recombinant measles nucleoprotein produced in Saccharomyces cerevisiae. J.Clin.Virol. 28:121-129.

297. Sandefur, S., V. Varthakavi, and P. Spearman. 1998. The I domain is required for efficient plasma membrane binding of Human immunodeficiency virus type 1 Pr55Gag. J.Vir. 72:2723-2732.

298. Satake, M. and R. B. Luftig. 1982. Microtubule-depolymerizing agents inhibit Moloney murine leukaemia virus production. J.Gen.Virol. 58:339- 349.

299. Scarlata, S., L. S. Ehrlich, and C. A. Carter. 1998. Membrane-induced alterations in HIV-1 Gag and Matrix protein-protein interactions. J.Mol.Biol. 277:161-169.

300. Scheifele, L. Z., R. A. Garbitt, J. D. Rhoads, and L. J. Parent. 2002. Nuclear entry and CRM-1 dependent nuclear export of the Rous sarcoma virus Gag polyprotein. Proc.Natl.Acad.Sci. 99:3944-3949. 269 301. Scheiffele, P., M. G. Roth, and K. Simons. 1997. Interaction of influenza virus haemagglutinin with sphingolipid-cholesterol membrane domains via its transmembrane domain. EMBO J. 16:5501-5508.

302. Schlenstedt, G., E. Smirnova, R. Deane, J. Solsbacher, U. Kutay, D. Gorlich, H. Ponstingl, and F. R. Bischoff. 1997. Yrb4p, a yeast ran- GTP-binding protein involved in import of ribosomal protein L25 into the nucleus. EMBO J. 16:6237-6249.

303. Schultz, A. M. and A. Rein. 1989. Unmyristoylated Moloney murine leukemia virus Pr65gag is excluded from virus assembly and maturation events. J.Vir. 63:2370-2373.

304. Shank, P. R., S. H. Hughes, H. J. Kung, J. E. Majors, N. Quintrell, R. V. Guntaka, J. M. Bishop, and H. E. Varmus. 1978. Mapping unintegrated avian sarcoma virus DNA: termini of linear DNA bear 300 nucleotides present once or twice in two species of circular DNA. Cell 15:1383-1395.

305. Shehu-Xhilaga, M., M. Hill, J. A. Marshall, J. Kappes, S. M. Crowe, and J. Mak. 2002. The conformation of the mature dimeric human immunodeficiency virus type 1 RNA genome requires packaging of pol protein. J.Virol. 76:4331-4340.

306. Sherer, N. M., M. J. Lehmann, L. F. Jimenez-Soto, A. Ingmundson, S. M. Horner, G. Cicchetti, P. G. Allen, M. Pypaert, J. M. Cunningham, and W. Mothes. 2003. Visualization of retroviral replication in living cells reveals budding into multivesicular bodies. Traffic. 4:785-801.

307. Sherman, M. P., C. M. de Noronha, M. I. Heusch, S. Greene, and W. C. Greene. 2001. Nucleocytoplasmic shuttling by human immunodeficiency virus type 1 Vpr. J.Virol. 75:1522-1532.

308. Shields, A., W. N. Witte, E. Rothenberg, and D. Baltimore. 1978. High frequency of aberrant expression of Moloney murine leukemia virus in clonal infections. Cell 14:601-609.

309. Shoeman, R. L., B. Honer, T. J. Stoller, C. Kesselmeier, M. C. Miedel, P. Traub, and M. C. Graves. 1990. Human immunodeficiency virus type 1 protease cleaves the intermediate filament proteins vimentin, desmin, and glial fibrillary acidic protein. Proc.Natl.Acad.Sci.U.S.A 87:6336-6340.

310. Simon, J. H., E. A. Carpenter, R. A. Fouchier, and M. H. Malim. 1999. Vif and the p55(Gag) polyprotein of human immunodeficiency virus type 1 are present in colocalizing membrane-free cytoplasmic complexes. J.Virol. 73:2667-2674. 270 311. Simpson, S. B., W. Guo, S. C. Winistorfer, R. C. Craven, and C. M. Stoltzfus. 1998. The upstream, direct repeat sequence of Prague A Rous sarcoma virus is deficient in mediating efficient Gag assembly and particle release. Virology 247:86-96.

312. Simpson, S. B., L. Zhang, R. C. Craven, and C. M. Stoltzfus. 1997. Rous sarcoma virus direct repeat cis elements exert effects at several points in the virus life cycle. J.Virol. 71:9150-9156.

313. Smith, A. E., B. M. Slepchenko, J. C. Schaff, L. M. Loew, and I. G. Macara. 2002. Systems analysis of Ran transport. Science 295:488-491.

314. Soneoka, Y., S. M. Kingsman, and A. J. Kingsman. 1997. Mutagenesis analysis of the Murine leukemia virus Matrix protein: identification of regions important for membrane localization and intracellular transport. J.Vir. 71:5549-5559.

315. Spearman, P., R. Horton, L. Ratner, and I. Kuli-Zade. 1997. Membrane binding of Human immunodeficiency virus type 1 Matrix protein in vivo supports a conformational myristyl switch mechanism. J.Vir. 71:6582- 6592.

316. Spearman, P., J. J. Wang, N. Vander Heyden, and L. Ratner. 1994. Identification of human immunodeficiency virus type 1 Gag protein domains essential to membrane binding and particle assembly. J.Vir. 68:3232-3242.

317. Stade, K., C. S. Ford, C. Guthrie, and K. Weis. 1997. Exportin 1 (Crm1p) is an essential nuclear export factor. Cell 90:1041-1050.

318. Stehelin, D., H. E. Varmus, J. M. Bishop, and P. K. Vogt. 1976. DNA related to the transforming gene(s) of avian sarcoma viruses is present in normal avian DNA. Nature 260:170-173.

319. Strack, B., A. Calistri, S. Craig, E. Popova, and H. G. Gottlinger. 2003. AIP1/ALIX is a binding partner for HIV-1 p6 and EIAV p9 functioning in virus budding. Cell 114:689-699.

320. Strasser, K., S. Masuda, P. Mason, J. Pfannstiel, M. Oppizzi, S. Rodriguez-Navarro, A. G. Rondon, A. Aguilera, K. Struhl, R. Reed, and E. Hurt. 2002. TREX is a conserved complex coupling transcription with messenger RNA export. Nature 417:304-308.

321. Sung, D. and H. Kang. 2003. Prokaryotic and eukaryotic translational machineries respond differently to the frameshifting RNA signal from plant or animal virus. Virus Res. 92:165-170. 271 322. Swanstrom, R. and J. W. Wills. 1997. Synthesis, assembly, and processing of retroviral proteins., p. 263-334. In J. M. Coffin, S. H. Hughes, and H. E. Varmus (ed.), Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.

323. Tang, H., Y. Xu, and F. Wong-Staal. 1997. Identification and purification of cellular proteins that specifically interact with the RNA constitutive transport elements from retrovirus D. Virology 228:333-339.

324. Tang, Y., U. Winkler, E. O. Freed, T. A. Torrey, W. Kim, H. Li, S. P. Goff, and H. C. Morse, III. 1999. Cellular motor protein KIF-4 associates with retroviral Gag. J.Virol. 73:10508-10513.

325. TEMIN, H. M. 1963. THE EFFECTS OF ACTINOMYCIN D ON GROWTH OF ROUS SARCOMA VIRUS IN VITRO. Virology 20:577- 582.

326. TEMIN, H. M. 1964. Nature of the provirus of Rous sarcoma. Natl.Cancer Inst.Monogr. 17:557-570.

327. TEMIN, H. M. and S. Mizutani. 1970. RNA-dependent DNA polymerase in virions of Rous sarcoma virus. Nature 226:1211-1213.

328. TEMIN, H. M. and H. RUBIN. 1958. Characteristics of an assay for Rous sarcoma virus and Rous sarcoma cells in tissue culture. Virology 6:669- 688.

329. Terasaki, M., P. Campagnola, M. M. Rolls, P. A. Stein, J. Ellenberg, B. Hinkle, and B. Slepchenko. 2001. A new model for nuclear envelope breakdown. Mol.Biol.Cell 12:503-510.

330. Thomas, F. and U. Kutay. 2003. Biogenesis and nuclear export of ribosomal subunits in higher eukaryotes depend on the CRM1 export pathway. J.Cell Sci. 116:2409-2419.

331. Tolerico, L. H., A. L. Benko, J. P. Aris, D. R. Stanford, N. C. Martin, and A. K. Hopper. 1999. Saccharomyces cerevisiae Mod5p-II contains sequences antagonistic for nuclear and cytosolic locations. Genetics 151:57-75.

332. Towers, G., M. Bock, S. Martin, Y. Takeuchi, J. P. Stoye, and O. Danos. 2000. A conserved mechanism of retrovirus restriction in mammals. Proc.Natl.Acad.Sci.U.S.A 97:12295-12299.

333. Towers, G. J., T. Hatziioannou, S. Cowan, S. P. Goff, J. Luban, and P. D. Bieniasz. 2003. Cyclophilin A modulates the sensitivity of HIV-1 to host restriction factors. Nat.Med. 9:1138-1143. 272 334. Towler, D. A., J. I. Gordon, S. P. Adams, and L. Glaser. 1988. The biology and enzymology of eukaryotic protein acylation. Annu.Rev.Biochem. 57:69-99.

335. Toyoshima, K. and P. K. Vogt. 1969. Temperature sensitive mutants of an avian sarcoma virus. Virology 39:930-931.

336. Tritel, M. and M. D. Resh. 2000. Kinetic analysis of Human immunodeficiency virus type 1 assembly reveals the presence of sequential intermediates. J.Vir. 74:5845-5855.

337. Tsichlis, P. N., K. F. Conklin, and J. M. Coffin. 1980. Mutant and recombinant avian retroviruses with extended host range. Proc.Natl.Acad.Sci.U.S.A 77:536-540.

338. Tsunetsugu-Yokota, Y., Y. Morikawa, M. Isogai, A. Kawana- Tachikawa, T. Odawara, T. Nakamura, F. Grassi, B. Autran, and A. Iwamoto. 2003. Yeast-derived human immunodeficiency virus type 1 p55(gag) virus-like particles activate dendritic cells (DCs) and induce perforin expression in Gag-specific CD8(+) T cells by cross-presentation of DCs. J.Virol. 77:10250-10259.

339. Ullman, K. S., S. Shah, M. A. Powers, and D. J. Forbes. 1999. The nucleoporin nup153 plays a critical role in multiple types of nuclear export. Mol.Biol.Cell 10:649-664.

340. Valenzuela, P., A. Medina, W. J. Rutter, G. Ammerer, and B. D. Hall. 1982. Synthesis and assembly of hepatitis B virus surface antigen particles in yeast. Nature 298:347-350.

341. van't Hof, W. and M. D. Resh. 1997. Rapid plasma membrane anchoring of newly synthesized p59fyn: selective requirement for NH2-terminal myristoylation and palmitoylation at cysteine-3. J.Cell Biol. 136:1023- 1035.

342. van't Hof, W. and M. D. Resh. 2000. Targeting proteins to the plasma membrane and membrane microdomains by n-terminal myristoylation and palmitoylation. Methods Enzymol. 327:317-330.

343. Varmus, H. E., S. Heasley, H. J. Kung, H. Oppermann, V. C. Smith, J. M. Bishop, and P. R. Shank. 1978. Kinetics of synthesis, structure and purification of avian sarcoma virus-specific DNA made in the cytoplasm of acutely infected cells. J.Mol.Biol. 120:55-82.

344. Verderame, M. F., T. D. Nelle, and J. W. Wills. 1996. The membrane- binding domain of the Rous sarcoma virus Gag protein. J.Vir. 70:2664- 2668. 273 345. VerPlank, L., F. Bouamr, T. J. LaGrassa, B. Agresta, A. Kikonyogo, J. Leis, and C. A. Carter. 2001. Tsg101, a homologue of ubiquitin-conjugating (E2) enzymes, binds the L domain in HIV type 1 Pr55(Gag). Proc.Natl.Acad.Sci.U.S.A 98:7724-7729.

346. Vetter, I. R., A. Arndt, U. Kutay, D. Gorlich, and A. Wittinghofer. 1999. Structural view of the Ran-Importin beta interaction at 2.3 A resolution. Cell 97:635-646.

347. Vodicka, M. A., D. M. Koepp, P. A. Silver, and M. Emerman. 1998. HIV- 1 Vpr interacts with the nuclear transport pathway to promote macrophage infection. Genes Dev. 12:175-185.

348. Vogel, K., J. P. Cabaniols, and P. A. Roche. 2000. Targeting of SNAP-25 to membranes is mediated by its association with the target SNARE syntaxin. J.Biol.chem. 275:2959-2965.

349. Vogt, V. M. 1997. Retroviral virions and genomes, p. 27-70. In J. M. Coffin, S. H. Hughes, and H. E. Varmus (ed.), Retroviruses. CCold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

350. Vogt, V. M., D. A. Bruckenstein, and A. P. Bell. 1982. Avian sarcoma virus gag precursor polypeptide is not processed in mammalian cells. J.Virol. 44:725-730.

351. von der, H. K. 1977. Cleavage of Rous sarcoma viral polypeptide precursor into internal structural proteins in vitro involves viral protein p15. Proc.Natl.Acad.Sci.U.S.A 74:911-915.

352. von Schwedler, U. K., M. Stuchell, B. Muller, D. M. Ward, H. Y. Chung, E. Morita, H. E. Wang, T. Davis, G. P. He, D. M. Cimbora, A. Scott, H. G. Krausslich, J. Kaplan, S. G. Morham, and W. I. Sundquist. 2003. The protein network of HIV budding. Cell 114:701-713.

353. Wallbank, A. M., F. G. Sperling, K. Hubben, and E. L. Stubbs. 1966. Isolation of a tumour virus from a chicken submitted to a poultry diagnostic laboratory--Esh sarcoma virus. Nature 209:1265.

354. Wang, H., K. M. Norris, and L. M. Mansky. 2003. Involvement of the matrix and nucleocapsid domains of the bovine leukemia virus Gag polyprotein precursor in viral RNA packaging. J.Virol. 77:9431-9438.

355. Wang, J. J., R. Horton, V. Varthakavi, P. Spearman, and L. Ratner. 1999. Formation and release of virus-like particles by HIV-1 matrix protein. AIDS 13:281-283. 274 356. Wang, L. H., P. H. Duesberg, S. Kawai, and H. Hanafusa. 1975. Location of envelope-specific and other sequences on the RNA of Schmidt-Ruppin Rous sarcoma virus. Bibl.Haematol.542-548.

357. Weiss, R. A. 1967. Spontaneous virus production from "non-virus producing" Rous sarcoma cells. Virology 32:719-723.

358. Weiss, R. A. 2001. Retroviruses and cancer. Current Science. 81:521-534.

359. Weiss, R. A., R. R. Friis, E. Katz, and P. K. Vogt. 1971. Induction of avian tumor viruses in normal cells by physical and chemical carcinogens. Virology 46:920-938.

360. Weldon Jr, R. A., C. R. Erdie, M. G. Oliver, and J. W. Wills. 1990. Incorporation of chimeric Gag protein into retroviral particles. J.Vir. 64:4169-4179.

361. Weldon Jr, R. A. and J. W. Wills. 1993. Characterization of a small (25- kilodalton) derivative of the Rous sarcoma virus Gag protein competent for particle release. J.Vir. 67:5550-5561.

362. Weldon, R. A., Jr., C. R. Erdie, M. G. Oliver, and J. W. Wills. 1990. Incorporation of chimeric gag protein into retroviral particles. J.Virol. 64:4169-4179.

363. Welker, R., A. Janetzko, and H.-G. Krausslich. 1997. Plasma membrane targeting of chimeric intracisternal A-type particle proteins leads to particle release and specific activation of the viral proteinase. J.Vir. 71:5209-5217.

364. Weller, S. K. and H. M. TEMIN. 1981. Cell killing by avian leukosis viruses. J.Virol. 39:713-721.

365. Wen, W., J. L. Meinkoth, R. Y. Tsien, and S. S. Taylor. 1995. Identification of a signal for rapid export of proteins from the nucleus. Cell 82:463-473.

366. Whittaker, G. R. and A. Helenius. 1998. Nuclear import and export of viruses and virus genomes. Virology 246:1-23.

367. Wilcox, C., J.-S. Hu, and E. N. Olson. 1987. Acylation of proteins with myristic acid occurs cotranslationally. Science 238:1275-1278.

368. Wilk, T., B. Gowen, and S. D. Fuller. 1999. Actin associates with the nucleocapsid domain of the human immunodeficiency virus Gag polyprotein. J.Virol. 73:1931-1940. 275 369. Wilk, T., I. Gross, B. E. Gowen, T. Rutten, F. de Haas, R. Welker, H. G. Krausslich, P. Boulanger, and S. D. Fuller. 2001. Organization of immature human immunodeficiency virus type 1. J.Virol. 75:759-771.

370. Wills, J. W., C. E. Cameron, C. B. Wilson, Y. Xiang, R. P. Bennett, and J. Leis. 1994. An assembly domain of the Rous sarcoma virus Gag protein required late in budding. J.Virol. 68:6605-6618.

371. Wills, J. W., R. C. Craven, and J. A. Achacoso. 1989. Creation and expression of myristylated forms of Rous sarcoma virus gag protein in mammalian cells. J.Virol. 63:4331-4343.

372. Wills, J. W., R. C. Craven, R. A. Weldon Jr, T. D. Nelle, and C. R. Erdie. 1991. Suppression of retroviral MA deletions by the amino- terminal membrane-binding domain of p60src. J.Vir. 65:3804-3812.

373. Wodrich, H., J. Bohne, E. Gumz, R. Welker, and H. G. Krausslich. 2001. A new RNA element located in the coding region of a murine endogenous retrovirus can functionally replace the Rev/Rev-responsive element system in human immunodeficiency virus type 1 Gag expression. J.Virol. 75:10670-10682.

374. wolven, A., H. Okamura, Y. Rosenblatt, and M. D. Resh. 1997. Palmitoylation of p59fyn is reversible and sufficient for plasma membrane association. Mol.Biol.Cell 8:1159-1173.

375. Xiang, Y., C. E. Cameron, J. W. Wills, and J. Leis. 1996. Fine mapping and characterization of the Rous sarcoma virus Pr76gag late assembly domain. J.Virol. 70:5695-5700.

376. Xiang, Y., T. W. Ridky, N. K. Krishna, and J. Leis. 1997. Altered Rous sarcoma virus Gag polyprotein processing and its effects on particle formation. J.Virol. 71:2083-2091.

377. Yamabhai, M. and R. G. Anderson. 2002. Second cysteine-rich region of epidermal growth factor receptor contains targeting information for caveolae/rafts. J.Biol.chem. 277:24843-24846.

378. Yang, J. and B. R. Cullen. 1999. Structural and functional analysis of the avian leukemia virus constitutive transport element. RNA. 5:1645-1655.

379. Yu, S. F., K. Edelmann, R. K. Strong, A. Moebes, A. Rethwilm, and M. L. Linial. 1996. The carboxyl terminus of the human foamy virus Gag protein contains separable nucleic acid binding and nuclear transport domains. J.Virol. 70:8255-8262. 276 380. Yuan, B., A. Fassati, A. Yueh, and S. P. Goff. 2002. Characterization of Moloney murine leukemia virus p12 mutants blocked during early events of infection. J.Virol. 76:10801-10810.

381. Yuan, X., X. Yu, T.-H. Lee, and M. Essex. 1993. Mutations in the N- terminal region of Human immunodeficiency virus type 1 Matrix block intracellular transport of the Gag precursor. J.Vir. 67:6387-6394.

382. Yueh, A. and S. P. Goff. 2003. Phosphorylated serine residues and an arginine-rich domain of the moloney murine leukemia virus p12 protein are required for early events of viral infection. J.Virol. 77:1820-1829.

383. Zennou, V., C. Petit, D. Guetard, U. Nerhbass, L. Montagnier, and P. Charneau. 2000. HIV-1 genome nuclear import is mediated by a central DNA flap. Cell 101:173-185.

384. Zhou, W., L. J. Parent, J. W. Wills, and M. D. Resh. 1994. Identification of a membrane-binding domain within the amino-terminal region of Human immunodeficiency virus type 1 Gag protein which interacts with acidic phospholipids. J.Vir. 68:2556-2569.

385. Zhou, W. and M. D. Resh. 1996. Differential membrane binding of the Human immunodeficiency type 1 Matrix protein. J.Vir. 70:8540-8548.

386. Zolotukhin, A. S. and B. K. Felber. 1999. Nucleoporins nup98 and nup214 participate in nuclear export of human immunodeficiency virus type 1 Rev. J.Virol. 73:120-127.

VITA

Lisa Z. Scheifele

EDUCATION 1994-1995 Columbia University New York, NY

1997-1999 Messiah College Grantham, PA BS Biochemistry, Summa cum laude

1999-2004 Pennsylvania State University College of Medicine Hershey, PA PhD, Cell and Molecular Biology

AWARDS RECEIVED Graduate Research Fellowship 2000, National Science Foundation Life Sciences Consortium Fellowship, Pennsylvania State University University Graduate Fellowship, Pennsylvania State University Whitaker Foundation Scholarship, Penn State College of Medicine, Hershey PA

PUBLICATIONS Scheifele LZ, Garbitt RA, Rhoads JD and Parent LJ. (2002) Nuclear entry and CRM 1 dependent nuclear export of the Rous sarcoma virus Gag polyprotein. Proc. Natl.Acad. Sci. 99(6): 3944-3949.

Scheifele LZ, Rhoads JD and Parent LJ. (2003) Specificity of plasma membrane targeting by the Rous sarcoma virus Gag protein. J. Virol. 77(1): 470-80.

Scheifele LZ and Parent LJ. Fine mapping of the CRM1-dependent nuclear export Signal of the Rous sarcoma virus Gag polyprotein. In preparation.

Butterfield-Gerson K, Scheifele LZ, Hopper AK and Parent LJ.Nuclear transport of the Rous sarcoma virus Gag polyprotein in Saccharomyces cerevisiae. In preparation.

Scheifele LZ and Parent LJ. Rous sarcoma virus Gag NES mutants reveal post entry defects in viral replication. In preparation.

SELECTED ABSTRACTS Scheifele LZ and Parent LJ. (2003). Nucleocytoplasmic transport of the RSV Gag polyprotein. Platform presentation. American Society for Virology.

Scheifele LZ and Parent LJ. (2002) Nucleocytoplasmic transport of the RSV Gag poylyprotein. Platform presentation. Cold Spring Harbor Laboratory meeting on Retroviruses.