Page 1 of 46 Diabetes
Clec16a, Nrdp1, and USP8 form a ubiquitin dependent tripartite complex that regulates beta cell mitophagy
Gemma Pearson1; Biaoxin Chai1; Tracy Vozheiko1; Xueying Liu1; Malathi Kandarpa2; 3 1,4* Robert C. Piper ; and Scott A. Soleimanpour
1Division of Metabolism, Endocrinology & Diabetes, Department of Internal Medicine, University of Michigan Medical School, Ann Arbor, MI 48105, USA. 2Division of Hematology and Oncology, Department of Internal Medicine, University of Michigan Medical School, Ann Arbor, MI 48105, USA. 3Department of Molecular Physiology and Biophysics, University of Iowa Carver College of Medicine, Iowa City, IA 52242, USA 4Veterans Affairs Ann Arbor Health Care System, Ann Arbor, MI 48105, USA.
*Corresponding Author
Scott A. Soleimanpour, M.D., 1000 Wall Street, 5317 Brehm Tower, Ann Arbor, MI 48105. Phone: (734) 763 0528 Fax: (734) 232 8162 E mail: [email protected]
Running Title: β cell mitophagy requires ubiquitin signaling
Word Count: 4448
Figures: 7
Diabetes Publish Ahead of Print, published online November 27, 2017 Diabetes Page 2 of 46
ABSTRACT
Mitophagy is a cellular quality control pathway, which is essential to eliminate unhealthy mitochondria. While mitophagy is critical to pancreatic β cell function, the post translational signals governing β cell mitochondrial turnover are unknown. Here we report that ubiquitination is essential for the assembly of a mitophagy regulatory complex, comprised of the E3 ligase Nrdp1, the deubiquitinase enzyme USP8, and Clec16a, a mediator of β cell mitophagy with unclear function. We discover that the diabetes gene Clec16a encodes an E3 ligase, which promotes non degradative ubiquitin conjugates to direct its mitophagy effectors and stabilize the Clec16a Nrdp1 USP8 complex. Inhibition of the Clec16a pathway by the chemotherapeutic lenalidomide, a selective ubiquitin ligase inhibitor associated with new onset diabetes, impairs β cell mitophagy, oxygen consumption, and insulin secretion. Indeed, patients treated with lenalidomide develop compromised β cell function. Moreover, the β cell
Clec16a Nrdp1 USP8 mitophagy complex is destabilized and dysfunctional following lenalidomide treatment as well as following glucolipotoxic stress. Thus, the Clec16a Nrdp1
USP8 complex relies on ubiquitin signals to promote mitophagy and maintain mitochondrial quality control necessary for optimal β cell function.
2 Page 3 of 46 Diabetes
Pancreatic β cells rely on mitochondrial bioenergetics to fuel glucose stimulated insulin
secretion (GSIS), which is essential for normal glucose homeostasis and is impaired in all
forms of diabetes (1). Beyond respiratory function, the mass of healthy mitochondria,
regulated by a balance of mitochondrial biogenesis and turnover, is vital to maintain energy
demands for proper stimulus secretion coupling. Mitochondrial autophagy (mitophagy) is a
quality control mechanism necessary for the selective elimination of dysfunctional
mitochondria to maintain optimal mitochondrial respiration in many cell types, including β
cells (2; 3). Despite the importance of mitophagy to β cell function (4 7), the molecular
signals dictating mitophagy and their significance to mitochondrial health remain largely
undefined.
Ubiquitination of protein substrates, catalyzed by the linkage of activated ubiquitin by
three distinct enzymes (E1, E2, E3), leads to diverse responses, including substrate
degradation by the ubiquitin proteasome system, protein trafficking, complex assembly, and
cellular signaling (8). Post translational modification of downstream mitophagy effectors,
including the E3 ligase Parkin, by ubiquitination is necessary for efficient mitochondrial
turnover (9); however, evidence of post translational control of proximal mitophagy
regulators has not been identified. The E3 ubiquitin ligase neuregulin receptor degradation
protein 1 (Nrdp1) and the deubiquitination enzyme ubiquitin specific protease 8 (USP8)
counterbalance ubiquitin dynamics to direct Parkin action or its proteasomal degradation (10;
11). Nrdp1 controls Parkin mediated mitophagy in β cells through its interaction with, and
regulation by, the diabetes gene C-type lectin domain family 16, member A (Clec16a) (4; 5);
however, the precise action of Clec16a in mitophagy remains poorly understood. While these
factors (Nrdp1, USP8, Clec16a) act upstream as sentinels to ensure mitophagy is utilized
appropriately, the role of ubiquitination as a control mechanism for their actions is unknown.
3 Diabetes Page 4 of 46
Here we discover that formation of a ubiquitin dependent Clec16a Nrdp1 USP8 complex is necessary for control of mitophagy in β cells. We identify that inhibition of
Clec16a mediated Nrdp1 ubiquitination by the chemotherapeutic agent lenalidomide impairs
Clec16a mediated mitophagy and, ultimately, reduces β cell function. We demonstrate that
Clec16a is an E3 ubiquitin ligase, which ubiquitinates Nrdp1 to promote assembly of the
Clec16a Nrdp1 USP8 mitophagy complex. Lastly, we determine that mobilization and function of the β cell Clec16a Nrdp1 USP8 mitophagy complex is disrupted by glucolipotoxicity.
4 Page 5 of 46 Diabetes
RESEARCH DESIGN AND METHODS
Patient samples Samples were provided from de identified non diabetic multiple myeloma
patients by the University of Michigan Hematologic Malignancies Tissue Bank and in
compliance with the University of Michigan IRB. Fasting samples were collected prior to
chemotherapy and again 12 weeks later. Patients received a combination of Perifosine,
bortezomib, liposomal doxorubicin, Bexxar and/or carfilzomib in the presence/absence of
lenalidomide (25 mg PO daily for 28 days x 4 cycles). All patients received corticosteroids
(dexamethasone 40 mg PO daily x 12 doses/cycle). C peptide and glucose concentrations
were measured by chemiluminescence and the glucose oxidase method, respectively, by the
University of Michigan DRC Clinical Core. Homeostatic model assessment of β cell function
and insulin resistance were calculated by HOMA2 (12).
Animals- Animal studies were approved by the University of Michigan IACUC. Clec16aloxP
mice (5) were mated to MIP CreERT2 mice (13) to generate experimental groups.
Recombination was induced with 3 IP injections of 150µg/g BW tamoxifen (Cayman
Chemical) every other day over 5 days. 10 week old C57BL/6 mice were injected daily with
50mg/kg of lenalidomide IP or vehicle control for 3 weeks. Mice were left to recover for one
week before undergoing glucose tolerance testing. Animals were housed on a standard 12 h
light/12 h dark cycle with ad libitum access to food and water unless fasted prior to testing.
Antibodies A full listing of antibodies is provided in Supplementary Table 1.
Proximity ligation Studies were performed with a commercially available kit (Duolink;
Sigma) per manufacturers’ protocols utilizing Nrdp1 (Bethyl Labs) and USP8 (Sigma)
specific antisera. Counter staining to identify β cells was performed in dissociated human
5 Diabetes Page 6 of 46
islets utilizing PDX 1 antisera (Santa Cruz). Proximity ligation events were quantified via
ImageJ similar to published approaches (14). Imaging was performed with an IX81 microscope (Olympus). Z stack images were captured using an ORCA Flash4 CMOS digital camera (Hamamatsu) and then subjected to deconvolution (CellSens; Olympus). Co localization analysis was performed as previously described (5).
Islet isolation and tissue culture - Primary dermal fibroblasts from WT and Ubc
CreERT;Clec16alox/lox mice were treated ex vivo with tamoxifen as previously described (5).
Stably expressing Flag Clec16a NIH3T3 cells, and Min6 cells (a gift from Dr. Doris Stoffers) were maintained as previously described (5). Mouse islets were isolated and cultured as previously described (15). Cell treatments included dimethylsulfoxide (DMSO; Fisher), lenalidomide (Ark Pharm), chloroquine (Santa Cruz Biotechnology), FCCP (Sigma), bafilomycin A1, MG132, and cycloheximide (all from EMD Millipore). Palmitate/BSA couplings were generated as previously described (16).
Human islets– Studies performed on human islets procured from the Integrated Islet
Distribution Program (IIDP) were approved by the University of Michigan IRB. Donor information is provided in Supplementary Table 2. Human islets were cultured in PIM(S)
(Prodo Laboratories) supplemented with 10% FBS, 1% antibiotic/antimycotic (Life
Technologies), and 1% PIM(G) (Prodo Laboratories). Following culture and treatments, islets were dissociated into single cells using trypsin, cytocentrifuged to glass slides, and prepared for immunostaining.
Transfections Transfection of HEK293T, HeLa, and NIH3T3 cells (Lipofectamine 2000;
Life Technologies) and Min6 cells (Amaxa Nucleofector) was performed as previously
6 Page 7 of 46 Diabetes
described (5). A detailed list of plasmids utilized or generated for this study is found in online
supplementary material.
Protein expression/purification Recombinant Clec16a and Nrdp1 was expressed in
NiCo21 (DE3) strain E.coli (NEB) following culture in auto induction media as described
(17). GST tagged and 6xHis tagged proteins were purified utilizing glutathione matrix or
nickel charged resin (HiCap and Ni NTA agarose; Qiagen) per manufacturers’ protocols. In
vitro transcribed/translated Clec16a and Nrdp1 were expressed in T7 driven mammalian
expression systems (Promega) per manufacturers’ protocols. Clec16a and Nrdp1 protein
expression/purification was confirmed by silver staining (BioRad) and/or Western blotting.
Ubiquitination assays Detection of protein ubiquitination in vivo was performed in cell
lines similar to previously described approaches (18). Detection of protein ubiquitination in
vitro was performed following incubation of 1µM GST Clec16a Flag or Clec16a 6xHis Flag
with a commercially available kit (E2 Select; Bio Techne). Ubiquitin conjugation assays
were performed with 1µM GST Clec16a Flag/Clec16a 6xHis Flag, 2.5µM GST Nrdp1
CSHQ, 50nM E1, 5µM Ube2d3/Ube2c, 50µM HA ubiquitin, Mg ATP, and conjugation
reaction buffers (Bio Techne). Conjugation assays were performed in solution for 60 minutes
at 37°C. Ubiquitination and protein interaction assays from in vitro transcribed/translated
Flag Clec16a and HA Nrdp1 were incubated in 40mM Tris HCl (pH 7.6), 5mM MgCl2,
2mM DTT with/without the addition of 75µM PYR 41 (EMD Millipore) for 3 hours at 37°C
similar to previously published approaches (19).
7 Diabetes Page 8 of 46
Glucose/insulin measurements, respirometry, gene expression, immunoprecipitation, immunofluorescence, and Western blotting assays All assays were performed as previously described (5).
Statistics Data are presented as mean ± SEM, and error bars denote SEM. Statistical comparisons were performed using one or two tailed Student’s t test or two way ANOVA as appropriate (Prism GraphPad). A P value < 0.05 was considered significant.
8 Page 9 of 46 Diabetes
RESULTS
Inhibition of Nrdp1 ubiquitination impairs human β cell function and mitophagy.
We hypothesized that ubiquitination of upstream mitophagy regulators regulates β cell
mitochondrial quality control to preserve the well functioning mitochondria necessary for
proper stimulus secretion coupling and GSIS. To this end, we assayed β cell function in
multiple myeloma patients who received lenalidomide, a chemotherapeutic agent and
selective ubiquitin ligase inhibitor (20), which, along with its parent compound thalidomide,
is associated with new onset glucose intolerance (21; 22). Lenalidomide has also been shown
to impair ubiquitination of the E3 ligase Nrdp1 (23), an essential regulator of β cell
mitophagy (4; 5). To evaluate the effect of lenalidomide in vivo, we estimated β cell function
by HOMA β in patients treated with or without lenalidomide for 12 weeks (Fig 1A and
Supplementary Table 3). Although all patients received glucocorticoids as part of their
treatment regimen (see methods), none had prior documented diabetes or glucose intolerance.
Interestingly, we observed decreased HOMA β (Fig 1A) in lenalidomide treated patients.
Impaired β cell function was not secondary to advanced age or increased insulin resistance,
as lenalidomide treated patients were younger and had no differences in HOMA IR
compared to controls (Supplementary Table 3 and data not shown). We also observed that
short term intraperitoneal lenalidomide treatment (3 weeks) induced modest glucose
intolerance in mice (Fig S1A B); however, the milder effects of lenalidomide in mice could
be attributed to the rapid clearance of intraperitoneal lenalidomide (versus oral) as well as a
shorter duration of exposure (24). We also confirmed that lenalidomide impaired
ubiquitination of Nrdp1 in Min6 β cells (Fig S1C). Further, lenalidomide significantly
reduced both GSIS and oxygen consumption in isolated islets (Fig 1B C).
Given the importance of Nrdp1 to mitophagy and maintenance of insulin secretion,
we hypothesized that lenalidomide would lead to dysfunctional mitophagy in β cells. Indeed,
9 Diabetes Page 10 of 46
the β cells of lenalidomide treated mice developed an accumulation of autophagosomes containing mitochondria, as shown by increased co localization of the autophagosome marker LC3 with the mitochondrial protein succinate dehydrogenase A (SDHA; Fig 1D E).
Additionally, lenalidomide treated islets developed an increase in the total number of LC3+ puncta (Fig 1E) without overt changes in LC3 I/II protein levels (Fig 1F), suggesting lenalidomide disrupts selective rather than bulk autophagy. As a complementary approach, we investigated the effects of lenalidomide on mitophagic flux by assessing the co localization of mitochondria with autophagosomes using fluorescent labeled markers
(mitochondria mito dsRed; autophagosomes – LC3 GFP) in Min6 β cells, at baseline and following mitochondrial damage by the uncoupler FCCP (5). Concordantly, lenalidomide treatment led to increased co localization of LC3 GFP and mito DsRed (Fig 1G H). It is unlikely that lenalidomide enhances mitophagic flux however, as the increased co localization of mito dsRed and LC3 GFP at baseline is not maintained after FCCP treatment
(Fig 1G H), suggesting that dysfunctional mitochondria are not efficiently removed. Taken together, we observe that lenalidomide impairs glucose homeostasis, GSIS, mitochondrial respiration, and Nrdp1 ubiquitination, and our results implicate the importance of Nrdp1 ubiquitination to maintain mitophagy and β cell function.
Clec16a promotes ubiquitination of Nrdp1.
Protein ubiquitination leads to several post translational effects, including targeting for proteasomal degradation, trafficking, or the activation of downstream signaling cascades.
Our observation of a lenalidomide sensitive effect on Nrdp1 ubiquitination and β cell mitophagy led us to assess the role of Nrdp1 interaction partners that have downstream consequences on mitophagy. Nrdp1 interacts with two upstream regulators of mitophagy:
Clec16a and the deubiquitinase (DUB) enzyme USP8 (5; 25). Specifically, Clec16a prevents
10 Page 11 of 46 Diabetes
the proteasomal degradation of Nrdp1 to control downstream events in β cell mitophagy (5);
therefore, we investigated the role of Clec16a on Nrdp1 stability and ubiquitination. Clec16a
deficiency decreased Nrdp1 levels and protein stability (Figs S2A, C) while Clec16a
overexpression increased Nrdp1 protein accumulation, consistent with previous reports in β
cells (4). Surprisingly, we observed that Clec16a overexpression resulted in enhanced Nrdp1
ubiquitination, while Clec16aKO primary fibroblasts exhibited reduced Nrdp1 ubiquitination
(Figs 2A C, Fig S2B).
Clec16a mediated enhancement of Nrdp1 ubiquitination and stability is in contrast to
the effects of USP8, a DUB enzyme which stabilizes Nrdp1 by opposing its auto
ubiquitination and preventing proteasomal degradation (Fig 2A and (25)). We tested the
importance of USP8 to Clec16a mediated Nrdp1 stability by both gain and loss of function
approaches. We reproduced published findings of enhanced Nrdp1 levels following USP8
overexpression (Fig S2D) (25). We observed no changes in basal Nrdp1 levels with USP8
shRNA (Fig S2E), consistent with previous studies (26), possibly suggesting other factors
stabilize Nrdp1 following USP8 loss of function. Clec16a increased Nrdp1 levels
independent of USP8 levels (Fig S2D E), suggesting that USP8 and Clec16a act via distinct,
yet complementary means to promote Nrdp1 protein accumulation. While Clec16a is an
endolysosomal protein, it also appears to promote Nrdp1 levels independent of lysosomal
degradation (Fig S2F). To investigate whether Clec16a promotes Nrdp1 ubiquitination by
enhancing the auto ubiquitination activity of Nrdp1, we generated an Nrdp1 RING domain
mutant (C34S H36Q, also known as Nrdp1 CSHQ) lacking E3 ligase activity (27). In the
presence of Clec16a, both Nrdp1 WT and Nrdp1 CSHQ exhibited enhanced ubiquitination
(Fig 2D), suggesting that Clec16a promotes Nrdp1 ubiquitination independent of Nrdp1 self
ubiquitination.
11 Diabetes Page 12 of 46
The similar effects of Clec16a loss of function and lenalidomide treatment on Nrdp1 ubiquitination led us to hypothesize that lenalidomide may act through Clec16a to impact β cell function. Indeed, lenalidomide abrogated Clec16a mediated Nrdp1 ubiquitination (Fig
2E). To investigate how Clec16a mediated Nrdp1 ubiquitination affects β cell function, we studied tamoxifen inducible and β cell specific Clec16a knock out mice (MIP CreERT2;
Clec16aloxP/loxP, hereafter known as β Clec16aKO). β Clec16aKO mice exhibited reduced
Clec16a mRNA levels and impaired glucose tolerance similar to previous reports (Fig S3A
C; (5)). As expected, lenalidomide treatment or Clec16a deficiency resulted in decreased
GSIS compared to vehicle treated MIP CreERT2 controls (Fig 2F). Importantly, we did not observe any additive impairment of lenalidomide on β Clec16aKO islets (Fig 2F), suggesting that lenalidomide acts through the Clec16a pathway to regulate Nrdp1 ubiquitination and β cell function. Notably, lenalidomide treatment did not affect Clec16a mRNA and protein levels (Fig 2E and S3D). These results suggest that lenalidomide inhibits Clec16a ubiquitination of Nrdp1, and that this activity is essential for downstream maintenance of maximal glucose stimulated insulin release from β cells.
Clec16a is an E3 ubiquitin ligase.
Despite the connection between Clec16a and mitophagy/autophagy (5; 28; 29), the direct molecular/enzymatic function for Clec16a has remained elusive. We questioned whether
Clec16a possesses intrinsic ubiquitin ligase activity and investigated its capacity to induce ubiquitination in vitro. A vital characteristic of E3 ubiquitin ligases is their ability to auto ubiquitinate (30), and thus we screened 26 independent E2 conjugation enzymes for their ability to participate in Clec16a auto ubiquitination. Recombinant Clec16a protein was incubated with each E2 enzyme, and evaluated for the presence of an increased molecular weight shift by SDS PAGE, which would be suggestive of ubiquitinated Clec16a.
12 Page 13 of 46 Diabetes
Interestingly, we observed that both Ube2C and Ube2D3 were able to promote high MW
Clec16a protein (Fig 3A). Concordantly, we observed that recombinant Clec16a (Fig 3B C)
was sufficient to promote auto ubiquitination in an ATP , Ube2C/Ube2D3 , and ubiquitin
dependent manner. Moreover, addition of Clec16a to an auto ubiquitination deficient Nrdp1
mutant (Nrdp1 CSHQ) led to enhanced Nrdp1 ubiquitination, suggesting that Clec16a
directly ubiquitinates Nrdp1 (Fig 3D).
Ubiquitination leads to diverse cellular effects, dependent in part upon the linkages in
the ubiquitin chain. Linkages can occur on one of seven distinct ubiquitin lysine residues and
proteasomal degradation generally only follows K48 linked ubiquitination (8). Furthermore,
K48 independent ubiquitination plays crucial signaling roles in mitophagy (10; 31; 32).
Given that Clec16a promotes Nrdp1 protein accumulation, we postulated that Clec16a might
link non degradative ubiquitin moieties to Nrdp1. Clec16a potentiated wild type (WT)
ubiquitin linkages on Nrdp1, which was lost following the addition of a ubiquitin mutant
rendered incapable of ubiquitin laddering by mutagenesis of all 7 lysine residues to arginine
(KO; Fig 3E). Furthermore, Clec16a potentiated Nrdp1 ubiquitination in the presence of a
ubiquitin mutant incapable of K48 degradative linkages (K48R), but not in the presence of
mutants capable of K48 and K63 linkages only (K48 and K63; Fig 3E). This suggests that
Clec16a relies upon K48 and K63 independent non degradative ubiquitin linkages to post
translationally regulate Nrdp1. Taken altogether, Clec16a is an E3 ligase, which directly
ubiquitinates its mitophagy partner and substrate Nrdp1 with non degradative conjugates.
Clec16a, USP8, and Nrdp1 interact in a ubiquitin dependent complex.
The convergence of Clec16a and USP8 in the regulation of Nrdp1 and control of mitophagy,
led us to question whether Clec16a, Nrdp1, and USP8 occupy the same subcellular
compartment to participate in a tripartite complex. Clec16a is an endolysosomal protein and
13 Diabetes Page 14 of 46
may co localize with Nrdp1 and USP8, which have been previously observed within the endosomal compartment (33). Indeed, we observed that Clec16a as well as Nrdp1 and USP8 were isolated within the membrane protein fraction (which contains endolysosomal proteins) following differential centrifugation (Fig 4A). Furthermore, we observed Clec16a, Nrdp1, and USP8 co localization by immunostaining, (Fig 4B), indicating they do indeed occupy a common compartment.
To determine the role of ubiquitination on complex assembly, we studied the interaction of in vitro transcribed/translated Clec16a and Nrdp1 expressed in reticulocyte lysates and verified their interaction in this system (Fig 4C). We next co incubated in vitro derived Clec16a and Nrdp1 with the E1 initiation inhibitor PYR41 to test the role of ubiquitination independent of its cytotoxic effects observed in vivo (19). PYR41 treatment reduced the interaction between Clec16a and Nrdp1 (Fig 4D), implicating that ubiquitination maintains the Clec16a Nrdp1 complex. We next determined the role of ubiquitination and
Clec16a in stabilization of Nrdp1 USP8 binding utilizing wild type and mutant ubiquitin.
While Clec16a enhanced Nrdp1 USP8 complex assembly, addition of the ubiquitin KO mutant reduced Nrdp1 levels as well as Nrdp1 interaction with both Clec16a and USP8 (Fig
4E). To clarify if impaired ubiquitination affected the Clec16a Nrdp1 USP8 complex due to reduced levels of constituents or by impaired complex assembly, we also doubled the amount of Flag Clec16a plasmid in the presence of KO ubiquitin, resulting in increased levels of
Clec16a, USP8 and Nrdp1 (Fig 4E, lane ++). While levels of constituent proteins were rescued, interactions with Nrdp1 were only partially restored with Clec16a, yet not with
USP8. Collectively, these findings suggest that functional ubiquitination is necessary for maintaining levels of the constituents of the Clec16a Nrdp1 USP8 complex as well as providing vital signals for complex assembly.
14 Page 15 of 46 Diabetes
USP8 shares functional overlap with Clec16a/Nrdp1 in the regulation of mitophagic
flux, coinciding in their opposing regulation of the E3 ligase Parkin, a critical effector in
mitophagy (34). While Clec16a and Nrdp1 limit excessive Parkin activity to ensure healthy
mitochondria are not degraded (5), USP8 promotes Parkin translocation to the mitochondrial
outer membrane by removal of K6 linked ubiquitin conjugates (10). Therefore, we
investigated whether Clec16a influences the K6 linked ubiquitination state of Parkin.
Utilizing a mutant ubiquitin only capable of K6 linked conjugates, we observed the expected
reduction of K6 linked Parkin ubiquitination by USP8 (Fig 4F). Conversely, Clec16a
promotes K6 linked Parkin ubiquitination independent of USP8 (Fig 4F) indicating that
Clec16a opposes USP8 mediated K6 deubiquitination of Parkin. Consequently, we conclude
that Clec16a Nrdp1 USP8 assemble in a tripartite ubiquitin dependent mitophagy complex to
promote maintenance of Parkin.
Nrdp1 ubiquitination is pivotal for complex formation and β cell function
Given the importance of ubiquitination to Clec16a Nrdp1 USP8 complex assembly, we
hypothesized that specific ubiquitination of Nrdp1 may influence formation of the Clec16a
Nrdp1 USP8 complex. To investigate how Nrdp1 ubiquitination could influence Clec16a
mediated processes, we generated an Nrdp1 mutant (Nrdp1 K R), in which all 11 lysine
residues were mutated to arginine, thereby rendering it incapable of ubiquitination. As
expected, ubiquitin laddering was not observed on the Nrdp1 K R mutant despite Clec16a
overexpression (Fig. 5A). Not surprisingly, overall levels of the Nrdp1 K R mutant protein
were higher that WT Nrdp1, potentially due to a loss of degradative Nrdp1 auto
ubiquitination (Fig. 5A; (25)). Furthermore, Clec16a was incapable of increasing Nrdp1
levels in the presence of the K R mutant, reinforcing the importance of Clec16a mediated
Nrdp1 ubiquitination to enhance Nrdp1 stability (Fig. 5A). We next assessed the role of
15 Diabetes Page 16 of 46
Nrdp1 ubiquitination on formation of the Clec16a Nrdp1 USP8 complex. Interestingly,
Clec16a interacts with endogenous USP8 and this interaction is maintained in the presence or absence of Nrdp1 ubiquitin ligase activity (Fig. 5B). However, Clec16a USP8 binding as well as USP8 levels are reduced following overexpression of the Nrdp1 K R mutant (Fig.
5B). These results suggest, again, that Clec16a drives assembly of the Clec16a Nrdp1 USP8 complex by providing essential ubiquitin signals and stabilizing its component proteins.
To determine whether the Clec16a Nrdp1 USP8 axis regulates β cell function, we assessed the role of Clec16a mediated ubiquitination on GSIS in Min6 β cells. We found that shRNA mediated reduction of Clec16a decreased GSIS (Figure S3E F). Clec16a shRNA treatment also led to reduced WT Nrdp1 levels, whereas Clec16a does not modulate levels of the ubiquitin deficient Nrdp1 K R mutant (Fig. 5C). Overexpression of WT Nrdp1, but not
Nrdp1 K R, restored GSIS in shClec16a treated Min6 β cells (Fig. 5D), suggesting that
Clec16a mediated ubiquitination of Nrdp1 is necessary for optimal β cell function. To assess the role of Clec16a mediated ubiquitination on formation of the β cell mitophagy complex, we utilized a proximity ligation assay (PLA) to visualize Nrdp1 USP8 association in situ following lenalidomide treatment (35). Lenalidomide impaired Nrdp1 USP8 interaction in
Min6 β cells (Fig. 5E) suggesting Clec16a mediated ubiquitination maintains the Clec16a
Nrdp1 USP8 complex as well as β cell function.
The Clec16a Nrdp1 USP8 complex is perturbed by glucolipotoxicity
Defects in β cell mitochondrial structure and function have been observed under conditions of diabetogenic stimuli, notably glucolipotoxicity (36; 37). To determine if the combination of reduced Clec16a expression and/or glucolipotoxicity impairs the upstream mitophagy complex, we assessed Nrdp1 USP8 interaction by PLA. As expected, Clec16a specific shRNA reduced Nrdp1 USP8 binding in situ (Fig. 6A). Nrdp1 USP8 binding was
16 Page 17 of 46 Diabetes
also decreased following palmitate treatment, indicating that glucolipotoxicity destabilizes
upstream mitophagy regulators (Fig 6A). However, palmitate treatment did not additively
reduce Nrdp1 USP8 binding in shClec16a treated Min6 β cells (Fig 6A), suggesting that
palmitate acts to destabilize the Nrdp1 USP8 complex through effects on the Clec16a
pathway. We next investigated the impact of glucolipotoxicity on the Clec16 Nrdp USP8
complex in human islets. Similarly, glucolipotoxicity decreased Nrdp1 USP8 interaction in
primary human β cells (Fig 6B). Given our findings suggesting that both Nrdp1 stability and
ubiquitination regulates formation of the Clec16a Nrdp1 USP8 complex, we next measured
Nrdp1 levels following palmitate treatment in primary islets. Indeed, we observed a
significant reduction in Nrdp1 levels during glucolipotoxic conditions (Fig 6C). Furthermore,
we observed that both Nrdp1 stability and ubiquitination was reduced in Min6 β cells
following palmitate treatment (Fig 6D), thus demonstrating effects consistent with impact on
the Clec16a pathway to maintain the upstream mitophagy complex.
To determine if glucolipotoxicity affects Clec16a to impact formation of the Clec16a
Nrdp1 USP8 complex, we overexpressed Clec16a in palmitate treated Min6 β cells.
Importantly, Clec16a overexpression in palmitate treated cells raised Nrdp1 levels, Nrdp1
ubiquitination, and Nrdp1 USP8 binding back to baseline levels (BSA alone; Fig. 6D E).
While palmitate treated Clec16a overexpressing cells did not rescue the above parameters
completely to the same degree as Clec16a overexpression alone, it is noteworthy that
palmitate treatment itself reduced levels of Clec16a (Fig. 6D E), suggestive of an effect of
palmitate on Clec16a.
Beyond mitochondrial functional defects, chronic glucolipotoxicity can ultimately
promote β cell apoptosis (1; 36). To determine the importance of maintenance of the
Clec16a Nrdp1 USP8 complex to β cell survival during glucolipotoxicity, we assessed β cell
apoptosis by cleaved caspase 3 levels following Clec16a overexpression. As expected,
17 Diabetes Page 18 of 46
palmitate significantly induced β cell apoptosis in Min6 β cells (Fig. 6F). Interestingly,
Clec16a overexpression reduced cleaved caspase 3 levels following palmitate treatment (Fig.
6F), suggesting that restoration of the Clec16a pathway partially ameliorates the negative effects of glucolipotoxicity on β cell survival. Taken altogether, these results indicate that glucolipotoxic insults destabilize the ubiquitin dependent Clec16 Nrdp1 USP8 mitophagy complex, which could ultimately impact the ability of β cells to withstand noxious stimuli.
DISCUSSION
Here we describe that ubiquitination is essential for the function and assembly of upstream mitophagy regulators in their maintenance of β cell function. Pharmacologic impairment of
Clec16a mediated ubiquitination by the chemotherapeutic agent lenalidomide impairs mitophagy and insulin release. We identify that the diabetes gene Clec16a encodes an E3 ligase that promotes Nrdp1 ubiquitination. Furthermore, Clec16a mediated Nrdp1 ubiquitination is essential for assembly of the Clec16a Nrdp1 USP8 complex and preservation of β cell function (Fig 7). We observe that glucolipotoxicity perturbs the assembly and function of this complex in β cells. Thus, Clec16a Nrdp1 USP8 function in a ubiquitin dependent protein complex to regulate β cell mitophagy.
Post translational control of Parkin by ubiquitination and phosphorylation is necessary for the execution of mitophagy (38). However, the direct convergence of Clec16a,
Nrdp1, and USP8, and the dependence on ubiquitination for upstream control of mitophagy have not been previously appreciated. The tripartite Clec16a Nrdp1 USP8 complex we identify coordinates mitophagy in part through their integrated actions on Parkin and cohesively harmonizes the effects of these mitophagy regulators (5; 10; 25). Several DUB enzymes, including USP8, regulate Parkin action during mitophagy (39 41). While Parkin auto inhibition and K6 ubiquitination are relieved by USP8 to promote its mitochondrial
18 Page 19 of 46 Diabetes
localization, it is unclear how Clec16a opposes USP8 mediated deubiquitination of Parkin.
Nrdp1 binds and opposes USP8 action on cytokine receptor signaling (42), and Clec16a
could function through Nrdp1 to counter USP8 effects on Parkin. Clec16a may also directly
(or indirectly through other E3 ligases) promote K6 linked conjugates on Parkin. While the
dynamics of the Clec16a Nrdp1 USP8 complex are still a mystery, it is clear that Clec16a
mediated ubiquitination orchestrates mitophagic flux in β cells.
Our discovery of Clec16a as an E3 ligase, whose function is inhibited by
lenalidomide, expands our insight into its functional role in mitophagy. Initial prediction of
Clec16a function was challenging due to a lack of recognizable conserved motifs, including
the misidentified predicted C lectin domain, suggesting Clec16a is a misnomer (5; 43). While
it is clear that Clec16a has E3 ligase activity, we could not identify a consensus domain
consistent with known ubiquitin ligases. Indeed, future studies of Clec16a domains coupled
to structural prediction of lenalidomide Clec16a binding sites may reveal a potential ubiquitin
ligase domain. Additionally, lenalidomide inhibits other E3 ligases, notably Cereblon (20).
Cereblon function in β cells is unknown, therefore additional study is needed to determine
the contribution of Cereblon and/or Clec16a inhibition to β cell dysfunction caused by
lenalidomide in humans.
Clec16a ubiquitinates its principal partner Nrdp1, leading to ubiquitin laddering of
unknown composition, which could occur at one or several lysine residues. Clec16a mediated
Nrdp1 ubiquitin conjugates may also be modified by the cooperative actions of USP8 to
favor non degradative linkages while removing K48 linkages. Alternatively, there may be
Clec16a independent effects to Nrdp1 activity that regulate β cell function. Notably, the ER
structural protein Reticulon 4A (Rtn4a or Nogo A) as well as retinoic acid derivatives
modulate Nrdp1 activity (44; 45) in non β cells, and they do not intersect with the Clec16a
pathway in our previous interactome studies (5). Rtn4a has also been implicated in the
19 Diabetes Page 20 of 46
regulation of GSIS (46). Therefore, elucidating Clec16a/USP8 dependent and independent effects on Nrdp1 function will provide insight into shared and unique pathways that could be evaluated for their contribution to β cell function.
Single nucleotide polymorphisms (SNPs) within the CLEC16A locus on chromosome
16 are associated with diabetes as well as several human diseases of both autoimmune and non autoimmune origin (47; 48). We previously described that a diabetogenic SNP within the
CLEC16A locus correlated with impaired β cell function, diminished glycemic control, and functioned as an expression quantitative trait locus for human islet CLEC16A levels, while not affecting levels of other nearby genes ((5) and data not shown). While a diabetogenic
CLEC16A SNP does correlate with abnormal β cell function, we can only speculate that these
SNPs directly lead to abnormalities within the CLEC16A mitophagy pathway in human β cells. Clec16a is also a ubiquitously expressed gene with functions in other cell types, including immune cells and neurons (5; 28; 49). The effect of disease related CLEC16A
SNPs to influence CLEC16A expression or the expression of nearby related genes in immune cells still remains to be controversial (48). While Clec16a and Nrdp1 both play vital roles within immune cells (28; 50), the function of CLEC16A SNPs (on mitophagy or other processes) within other human cell types requires future investigation.
These studies clarify a role for ubiquitin dependent mitophagy complex assembly in the maintenance of β cell function. Mitochondrial competence is essential for β cell function, and deficient mitochondrial quality control could exacerbate β cell dysfunction by diabetogenic insults. Previous observations of defective mitochondrial integrity following glucolipotoxicity (7; 36), coupled to our findings here of glucolipotoxicity mediated destabilization of the Clec16a Nrdp1 USP8 complex could inspire future in vivo studies to evaluate the importance of dysfunctional mitophagy to β cell failure in diabetes. Additional examination will be required to determine if nutrient excess, insulin resistance, and/or
20 Page 21 of 46 Diabetes
inflammation (among other diabetogenic stressors) interfere with the mitophagy machinery,
but may prove to illuminate a more profound understanding of diabetes pathogenesis.
21 Diabetes Page 22 of 46
ACKNOWLEDGEMENTS
We acknowledge Dr. D. Giacherio and J. Whalen of the Chemistry Laboratory Core of the
University of Michigan DRC (P30DK020572) for assistance with human hormone studies.
We thank Drs. K. Claiborn, J. Spaeth, P. Arvan, L. Satin, L. Qi, M. Myers, R. Stein, and members of the Soleimanpour laboratory for helpful advice. G.P. conceived of, designed and performed experiments, interpreted results, drafted and reviewed the manuscript. B.C., T.V.,
X.L. designed and performed experiments and interpreted results. M.K. provided human samples from the UM Hematologic Malignancies Tissue Bank. R.C.P. designed ubiquitination studies, interpreted results and reviewed the manuscript. S.A.S. conceived of and designed the studies, interpreted results, edited and reviewed the manuscript. S.A.S. is the guarantor of this work and takes responsibility for the contents of this article. All authors declare that they have no conflicts of interest. We acknowledge funding support from the
JDRF (CDA 2016 189, SRA 2018 539), the NIH (K08 DK089117, R03 DK106304, and
R01 DK108921), the Central Society for Clinical and Translational Research, the Brehm family, and the Anthony family. The JDRF Career Development Award to S.A.S. is partly supported by the Danish Diabetes Academy supported by the Novo Nordisk Foundation.
22 Page 23 of 46 Diabetes
REFERENCES
1. Supale S, Li N, Brun T, Maechler P: Mitochondrial dysfunction in pancreatic β cells. Trends in Endocrinology & Metabolism 2012;23:477 487 2. Jin SM, Youle RJ: PINK1 and Parkin mediated mitophagy at a glance. Journal of Cell Science 2012;125:795 799 3. Kaufman BA, Li C, Soleimanpour SA: Mitochondrial regulation of β cell function: Maintaining the momentum for insulin release. Molecular Aspects of Medicine 2015; 4. Soleimanpour SA, Ferrari AM, Raum JC, Groff DN, Yang J, Kaufman BA, Stoffers DA: Diabetes Susceptibility Genes Pdx1 and Clec16a Function in a Pathway Regulating Mitophagy in β Cells. Diabetes 2015;64:3475 3484 5. Soleimanpour Scott A, Gupta A, Bakay M, Ferrari Alana M, Groff David N, Fadista J, Spruce Lynn A, Kushner Jake A, Groop L, Seeholzer Steven H, Kaufman Brett A, Hakonarson H, Stoffers Doris A: The Diabetes Susceptibility Gene Clec16a Regulates Mitophagy. Cell 2014;157:1577 1590 6. Hoshino A, Ariyoshi M, Okawa Y, Kaimoto S, Uchihashi M, Fukai K, Iwai Kanai E, Ikeda K, Ueyama T, Ogata T, Matoba S: Inhibition of p53 preserves Parkin mediated mitophagy and pancreatic β cell function in diabetes. Proceedings of the National Academy of Sciences 2014;111:3116 3121 7. Twig G, Elorza A, Molina AJA, Mohamed H, Wikstrom JD, Walzer G, Stiles L, Haigh SE, Katz S, Las G, Alroy J, Wu M, Py BF, Yuan J, Deeney JT, Corkey BE, Shirihai OS: Fission and selective fusion govern mitochondrial segregation and elimination by autophagy. The EMBO Journal 2008;27:433 446 8. Wong E, Cuervo AM: Integration of Clearance Mechanisms: The Proteasome and Autophagy. Cold Spring Harbor Perspectives in Biology 2010;2 9. Durcan TM, Fon EA: The three ‘P’s of mitophagy: PARKIN, PINK1, and post translational modifications. Genes Dev 2015;29:989 999 10. Durcan TM, Tang MY, Pérusse JR, Dashti EA, Aguileta MA, McLelland GL, Gros P, Shaler TA, Faubert D, Coulombe B, Fon EA: USP8 regulates mitophagy by removing K6 linked ubiquitin conjugates from parkin. The EMBO Journal 2014;33:2473 2491 11. Zhong L, Tan Y, Zhou A, Yu Q, Zhou J: RING finger ubiquitin protein isopeptide ligase Nrdp1/FLRF regulates parkin stability and activity. Journal of Biological Chemistry 2005;280:9425 9430 12. Wallace TM, Levy JC, Matthews DR: Use and Abuse of HOMA Modeling. Diabetes Care 2004;27:1487 1495 13. Tamarina NA, Roe MW, Philipson LH: Characterization of mice expressing Ins1 gene promoter driven CreERT recombinase for conditional gene deletion in pancreatic β cells. Islets 2014;6:e27685 14. McKenna B, Guo M, Reynolds A, Hara M, Stein R: Dynamic Recruitment of Functionally Distinct Swi/Snf Chromatin Remodeling Complexes Modulates Pdx1 Activity in Islet β Cells. Cell Reports 2015;10:2032 2042 15. Pearson GL, Mellett N, Chu KY, Cantley J, Davenport A, Bourbon P, Cosner CC, Helquist P, Meikle PJ, Biden TJ: Lysosomal acid lipase and lipophagy are constitutive negative regulators of glucose stimulated insulin secretion from pancreatic beta cells. Diabetologia 2014;57:129 139 16. Busch AK, Cordery D, Denyer GS, Biden TJ: Expression Profiling of Palmitate and Oleate Regulated Genes Provides Novel Insights Into the Effects of Chronic Lipid Exposure on Pancreatic b Cell Function. Diabetes 2002;51:977 987
23 Diabetes Page 24 of 46
17. Studier FW: Stable Expression Clones and Auto Induction for Protein Production in E. coli. In Structural Genomics: General Applications Chen YW, Ed. Totowa, NJ, Humana Press, 2014, p. 17 32 18. Choo YS, Zhang Z: Detection of Protein Ubiquitination. Journal of Visualized Experiments : JoVE 2009:1293 19. Yang Y, Kitagaki J, Dai R M, Tsai YC, Lorick KL, Ludwig RL, Pierre SA, Jensen JP, Davydov IV, Oberoi P, Li C CH, Kenten JH, Beutler JA, Vousden KH, Weissman AM: Inhibitors of Ubiquitin Activating Enzyme (E1), a New Class of Potential Cancer Therapeutics. Cancer Research 2007;67:9472 9481 20. Krönke J, Udeshi ND, Narla A, Grauman P, Hurst SN, McConkey M, Svinkina T, Heckl D, Comer E, Li X, Ciarlo C, Hartman E, Munshi N, Schenone M, Schreiber SL, Carr SA, Ebert BL: Lenalidomide Causes Selective Degradation of IKZF1 and IKZF3 in Multiple Myeloma Cells. Science 2014;343:301 305 21. Issa ZA, Zantout MS, Azar ST: Multiple Myeloma and Diabetes. ISRN Endocrinology 2011;2011:6 22. Iqbal N, Zayed M, Boden G: Thalidomide impairs insulin action on glucose uptake and glycogen synthesis in patients with type 2 diabetes. Diabetes Care 2000;23:1172 1176 23. Basiorka AA, McGraw KL, De Ceuninck L, Griner LN, Zhang L, Clark JA, Caceres G, Sokol L, Komrokji RS, Reuther GW, Wei S, Tavernier J, List AF: Lenalidomide Stabilizes the Erythropoietin Receptor by Inhibiting the E3 Ubiquitin Ligase RNF41. Cancer Res 2016;76:3531 3540 24. Rozewski DM, Herman SEM, Towns WH, Mahoney E, Stefanovski MR, Shin JD, Yang X, Gao Y, Li X, Jarjoura D, Byrd JC, Johnson AJ, Phelps MA: Pharmacokinetics and Tissue Disposition of Lenalidomide in Mice. The AAPS Journal 2012;14:872 882 25. Wu X, Yen L, Irwin L, Sweeney C, Carraway KL: Stabilization of the E3 Ubiquitin Ligase Nrdp1 by the Deubiquitinating Enzyme USP8. Mol Cell Biol 2004;24:7748 7757 26. Cao Z, Wu X, Yen L, Sweeney C, Carraway KL: Neuregulin Induced ErbB3 Downregulation Is Mediated by a Protein Stability Cascade Involving the E3 Ubiquitin Ligase Nrdp1. Mol Cell Biol 2007;27:2180 2188 27. Qiu X B, Goldberg AL: Nrdp1/FLRF is a ubiquitin ligase promoting ubiquitination and degradation of the epidermal growth factor receptor family member, ErbB3. Proceedings of the National Academy of Sciences 2002;99:14843 14848 28. Schuster C, Gerold KD, Schober K, Probst L, Boerner K, Kim M J, Ruckdeschel A, Serwold T, Kissler S: The autoimmunity associated gene CLEC16A modulates thymic epithelial cell autophagy and alters T cell selection. Immunity 2015;42:942 952 29. Kim S, Naylor SA, DiAntonio A: Drosophila Golgi membrane protein Ema promotes autophagosomal growth and function. Proceedings of the National Academy of Sciences 2012;109:E1072–E1081 30. Ardley HC, Robinson PA: E3 ubiquitin ligases. Essays Biochem 2005;41:15 30 31. Birsa N, Norkett R, Wauer T, Mevissen TET, Wu H C, Foltynie T, Bhatia K, Hirst WD, Komander D, Plun Favreau H, Kittler JT: Lysine 27 Ubiquitination of the Mitochondrial Transport Protein Miro Is Dependent on Serine 65 of the Parkin Ubiquitin Ligase. Journal of Biological Chemistry 2014;289:14569 14582 32. Fu M, St Pierre P, Shankar J, Wang PT, Joshi B, Nabi IR: Regulation of mitophagy by the Gp78 E3 ubiquitin ligase. Molecular biology of the cell 2013;24:1153 1162 33. Mizuno E, Iura T, Mukai A, Yoshimori T, Kitamura N, Komada M: Regulation of Epidermal Growth Factor Receptor Down Regulation by UBPY mediated Deubiquitination at Endosomes. Mol Biol Cell 2005;16:5163 5174 34. Narendra D, Tanaka A, Suen D F, Youle RJ: Parkin is recruited selectively to impaired mitochondria and promotes their autophagy. The Journal of Cell Biology 2008;183:795 803
24 Page 25 of 46 Diabetes
35. Soderberg O, Gullberg M, Jarvius M, Ridderstrale K, Leuchowius K J, Jarvius J, Wester K, Hydbring P, Bahram F, Larsson L G, Landegren U: Direct observation of individual endogenous protein complexes in situ by proximity ligation. Nat Meth 2006;3:995 1000 36. Molina AJA, Wikstrom JD, Stiles L, Las G, Mohamed H, Elorza A, Walzer G, Twig G, Katz S, Corkey BE, Shirihai OS: Mitochondrial Networking Protects β Cells From Nutrient Induced Apoptosis. Diabetes 2009;58:2303 2315 37. Poitout V, Robertson RP: Glucolipotoxicity: Fuel Excess and β Cell Dysfunction. Endocr Rev 2008;29:351 366 38. Shiba Fukushima K, Imai Y, Yoshida S, Ishihama Y, Kanao T, Sato S, Hattori N: PINK1 mediated phosphorylation of the Parkin ubiquitin like domain primes mitochondrial translocation of Parkin and regulates mitophagy. Scientific Reports 2012;2:1002 39. Cornelissen T, Haddad D, Wauters F, Van Humbeeck C, Mandemakers W, Koentjoro B, Sue C, Gevaert K, De Strooper B, Verstreken P, Vandenberghe W: The deubiquitinase USP15 antagonizes Parkin mediated mitochondrial ubiquitination and mitophagy. Human Molecular Genetics 2014;23:5227 5242 40. Cunningham CN, Baughman JM, Phu L, Tea JS, Yu C, Coons M, Kirkpatrick DS, Bingol B, Corn JE: USP30 and parkin homeostatically regulate atypical ubiquitin chains on mitochondria. Nat Cell Biol 2015;17:160 169 41. Bingol B, Tea JS, Phu L, Reichelt M, Bakalarski CE, Song Q, Foreman O, Kirkpatrick DS, Sheng M: The mitochondrial deubiquitinase USP30 opposes parkin mediated mitophagy. Nature 2014;510:370 375 42. De Ceuninck L, Wauman J, Masschaele D, Peelman F, Tavernier J: Reciprocal cross regulation between RNF41 and USP8 controls cytokine receptor sorting and processing. Journal of Cell Science 2013;126:3770 3781 43. Finn RD, Bateman A, Clements J, Coggill P, Eberhardt RY, Eddy SR, Heger A, Hetherington K, Holm L, Mistry J, Sonnhammer ELL, Tate J, Punta M: Pfam: the protein families database. Nucleic Acids Res 2014;42:D222 D230 44. Hatakeyama J, Wald JH, Rafidi H, Cuevas A, Sweeney C, Carraway KL: The ER structural protein Rtn4A stabilizes and enhances signaling through the receptor tyrosine kinase ErbB3. Science Signaling 2016;9:ra65 ra65 45. Byun S, Shin SH, Lee E, Lee J, Lee S Y, Farrand L, Jung SK, Cho Y Y, Um S J, Sin H S, Kwon Y J, Zhang C, Tsang BK, Bode AM, Lee HJ, Lee KW, Dong Z: The retinoic acid derivative, ABPN, inhibits pancreatic cancer through induction of Nrdp1. Carcinogenesis 2015;36:1580 1589 46. Bonal CB, Baronnier DE, Pot C, Benkhoucha M, Schwab ME, Lalive PH, Herrera PL: Nogo A Downregulation Improves Insulin Secretion in Mice. Diabetes 2013;62:1443 1452 47. Fujimaki T, Kato K, Yokoi K, Oguri M, Yoshida T, Watanabe S, Metoki N, Yoshida H, Satoh K, Aoyagi Y, Nozawa Y, Kimura G, Yamada Y: Association of genetic variants in SEMA3F, CLEC16A, LAMA3, and PCSK2 with myocardial infarction in Japanese individuals. Atherosclerosis 2010;210:468 473 48. Berge T, Leikfoss I, Harbo H: From Identification to Characterization of the Multiple Sclerosis Susceptibility Gene CLEC16A. International Journal of Molecular Sciences 2013;14:4476 49. Redmann V, Lamb CA, Hwang S, Orchard RC, Kim S, Razi M, Milam A, Park S, Yokoyama CC, Kambal A, Kreamalmeyer D, Bosch MK, Xiao M, Green K, Kim J, Pruett Miller SM, Ornitz DM, Allen PM, Beatty WL, Schmidt RE, DiAntonio A, Tooze SA, Virgin HW: Clec16a is Critical for Autolysosome Function and Purkinje Cell Survival. Scientific Reports 2016;6:23326
25 Diabetes Page 26 of 46
50. Yang M, Chen T, Li X, Yu Z, Tang S, Wang C, Gu Y, Liu Y, Xu S, Li W, Zhang X, Wang J, Cao X: K33 linked polyubiquitination of Zap70 by Nrdp1 controls CD8+ T cell activation. 2015;16:1253
26 Page 27 of 46 Diabetes
FIGURE LEGENDS
Figure 1. The selective ubiquitin ligase inhibitor lenalidomide impairs β cell function,
Nrdp1 ubiquitination, and mitophagy.
(A) Calculated HOMA β measured in multiple myeloma patients pre and 12 weeks post
initiation of chemotherapy (n=11/control, 14/lenalidomide). (B) Glucose stimulated insulin
secretion following static incubations in 1.67mM and 16.7mM glucose performed in isolated
CD1 islets pre treated with vehicle (DMSO) or 10 µM lenalidomide for 24hr (n=4/group).
(C) Fold oxygen consumption rates (OCR) in isolated islets pre treated with vehicle or 10
µM lenalidomide for 24hr prior to dispersion to single cells for analysis as adherent
monolayers on Seahorse flux analyzer (n=10/group). (D) Representative images of pancreas
sections from C57BL/6 mice treated for 3 weeks in vivo with 50mg/kg lenalidomide or
vehicle alone, stained for insulin (cyan), LC3 (green) and SHDA (red). Nuclei are
demarcated with DAPI (blue). n=4/group (E) Quantification of LC3/SDHA co localization
and total LC3+ puncta in islets from C57BL/6 mice treated in vivo with (black bars) or
without (white bars) 50mg/kg Lenalidomide (n=4/group, ~900 β cells and ~25,000 total
LC3/SDHA structures quantified/group). (F) Representative Western blot (WB) of LC3
levels in isolated islets treated with vehicle or 10 µM lenalidomide for 24hr with
quantification (by densitometry) of LC3 II levels normalized to cyclophilin B. n=4/group.
(G) Representative deconvolution images of Min6 β cells (transfected with LC3 GFP and
mito dsRed plasmids), then treated with vehicle or 10 µM lenalidomide for 24hr.with
addition of 5µM FCCP for the final 4hrs. n=4/group. (H) Quantification of LC3 GFP/mito
dsRed and mito dsRed co localization and total LC3 GFP puncta in Min6 β cells treated with
vehicle or 10 µM lenalidomide for 24hr with addition of 5µM FCCP for the final 4hrs.
(n=4/group, ~1500 total GFP and dsRed puncta quantified per experiment). *p<0.05,
27 Diabetes Page 28 of 46
**p<0.01, ***p<0.001 by non paired student’s t test, $$p<0.01 by paired student’s t test, respectively.
2. Clec16a promotes the ubiquitination of Nrdp1.
(A) Representative WB of in vivo ubiquitination assay of overexpressed HA tagged Nrdp1 performed in HEK293T cells transfected with Myc Ubiquitin, Flag tagged empty vector
(EV), Clec16a or USP8 (as well as whole cell lysate HA Nrdp1, Flag Clec16a, and Flag
USP8 levels) treated with DMSO ( ) or 20 µM MG132 (+) overnight. n=3/group. (B)
Representative WB of in vivo ubiquitination assay of endogenous Nrdp1 performed in 293T cells transfected with Myc Ubiquitin and Flag EV or Flag Clec16a (as well as whole cell lysate Nrdp1 and Flag Clec16a levels). n=3/group. (C) Representative WB of in vivo endogenous ubiquitination assay of endogenous Nrdp1 ubiquitination performed in primary dermal fibroblasts derived from WT and Clec16a deficient mice (as well as whole cell lysate
Nrdp1 levels). n=3/group (D) Representative WB of in vivo ubiquitination assay of overexpressed HA tagged wild type (WT) or C34S H36Q mutant (CSHQ) Nrdp1 performed in HEK293T cells transfected with Myc Ubiquitin and Flag EV or Flag Clec16a (as well as whole cell lysate HA Nrdp1 and Flag Clec16a levels). n=3/group. (E) Representative WB of in vivo ubiquitination assay of overexpressed HA tagged Nrdp1 performed in HEK293T cells transfected with Myc Ubiquitin and Flag EV or Flag Clec16a (as well as whole cell lysate
HA Nrdp1 and Flag Clec16a levels) treated with DMSO ( ) or 10 µM lenalidomide (+) for
24 hr. n=3/group. (F) Glucose stimulated insulin secretion following static incubations in
1.67mM and 16.7mM glucose performed in isolated MIP CreERT2 control or β Clec16aKO islets pre treated with vehicle (DMSO) or 10 µM lenalidomide for 24hr (n=4/group). *p<0.05 non paired student’s t test.
28 Page 29 of 46 Diabetes
3. Clec16a possesses E3 ligase activity and directly ubiquitinates Nrdp1 via a non K48
linkage.
(A) Representative α Flag WB from purified Clec16a 6xHis Flag protein following
incubation in vitro with ATP, Ubiquitin, E1, and 26 unique E2 conjugating enzymes at 37°C
for 1 hour. Arrows demarcate both the expected and novel high molecular weight Clec16a
proteins identified by WB. n=3/group. (B C) Representative WB of in vitro ubiquitination
assay of recombinant GST Clec16a Flag (B) or Clec16a 6xHis Flag protein (C) following
incubation with ATP, HA Ub, E1, in the presence or absence of E2 conjugation enzymes
UbE2D3 and/or UbE2c at 37°C for 1 hour. n=3/group. (D) Representative WB of in vitro
ubiquitination assay of recombinant GST Nrdp1 CSHQ following incubation with ATP, HA
Ub, E1, in the presence or absence of UbE2D3 and recombinant Clec16a 6xHis Flag at 37°C
for 1 hour. n=3/group. (E) Representative WB of in vivo ubiquitination assay of
overexpressed myc tagged Nrdp1 performed in HEK293T cells transfected with Flag EV or
Flag Clec16a in the presence of HA tagged wild type (WT) ubiquitin as well as ubiquitin
mutants with all lysines converted to arginines (KO), ubiquitin only capable of K48 linked
ubiquitination (K48), ubiquitin incapable of K48 linked ubiquitination (K48R), or ubiquitin
only capable of K63 linked ubiquitination (K63) (as well as whole cell lysate myc Nrdp1 and
Flag Clec16a levels). n=3/group.
4. Ubiquitination is necessary to maintain the Clec16a Nrdp1 USP8 protein complex.
(A) Representative WB following cell fractionation and centrifugation of stably expressing
Flag Clec16a NIH3T3 cells probed for Flag (Clec16a), endogenous Nrdp1, endogenous
USP8 as well as porin (mitochondria), Creb (nuclei), and Rab5 (endosomal/soluble small
GTPase) as markers of cell compartments. n=3/group. (B) Representative deconvolution
image of NIH3T3 fibroblasts following transfection with GFP Clec16a, Flag USP8, and HA
29 Diabetes Page 30 of 46
Nrdp1 plasmids with indirect immunofluorescence staining for GFP Clec16a (green), Flag
USP8 (red), and HA Nrdp1 (blue). Inset – triple co localized structures (white) highlighted with yellow arrows. n=3/group. (C) Representative WB of reticulocyte lysates following in vitro transcription/translation of Flag Clec16a and HA Nrdp1 with anti HA (left) or anti Flag
(right) IP. n=3/group. (D) Representative WB of reticulocyte lysates, following in vitro transcription/translation of Flag Clec16a and HA Nrdp1 protein treated in solution with 75
µM PYR41 at 37°C for 3 hours, following anti Flag IP. n=3/group. (E) Representative WB following anti myc IP in HEK293T cells transfected with Myc Nrdp1, Flag USP8 and either
GFP EV or –Clec16a, along with WT or KO Ubiquitin vectors. n=3/group. (F)
Representative WB of in vivo K6 linkage specific ubiquitination assay of overexpressed
Parkin performed in HEK293T cells transfected with HA K6 Ubiquitin, Flag EV or USP8, and GFP EV or Clec16a (as well as whole cell lysate GFP Nrdp1, Flag USP8, and Parkin levels). n=3/group.
5. Specific Nrdp1 ubiquitination is vital for β cell function.
(A) Representative WB of in vivo ubiquitination assay of overexpressed HA tagged wild type
(WT) or pan K to R mutant (K R) Nrdp1 performed in HEK293T cells transfected with Myc
Ubiquitin and Flag EV or Flag Clec16a (as well as whole cell lysate HA Nrdp1 and Flag
Clec16a levels). n=3/group. (B) Representative WB of endogenous USP8 following anti
Flag Clec16a IP in HeLa cells transfected with Flag EV or Flag Clec16a and HA EV or HA
Nrdp1 expression vectors (WT, CSHQ, or K R). n=3/group. (C) Representative WB of HA
Nrdp1 levels in Min6 β cells, 72 hours after transfection with non targeting (NT) or Clec16a
specific shRNA plasmids, as well as HA EV, HA Nrdp1 WT, or HA Nrdp1 K R.
(n=5/group). (D) Glucose stimulated insulin secretion following static incubations in 2 mM and 20 mM glucose performed in Min6 β cells, 72 hours after transfection with non
30 Page 31 of 46 Diabetes
targeting (NT) or Clec16a specific shRNA plasmids, as well as HA EV, HA Nrdp1 WT, or
HA Nrdp1 K R. (n=5/group). (E) Top – Representative deconvolution image of Nrdp1:USP8
proximity ligation assay (PLA – red, DAPI blue) in Min6 β cells, 24 hours after treatment
with vehicle (DMSO) or 10 μ M lenalidomide. Bottom quantification of relative
Nrdp1:USP8 PLA events in Min6 β cells (fold change vs. vehicle controls) following
treatment conditions as noted. (n=3/group; ~2900 PLA events quantified/group per
experiment).
6. The Clec16a Nrdp1 USP8 complex is perturbed by glucolipotoxicity.
(A) Top – Representative deconvolution image of Nrdp1:USP8 proximity ligation assay
(PLA – red, DAPI blue) in Min6 β cells, 72 hours after transfection with non targeting
(NT) or Clec16a specific shRNA plasmids, following treatment with BSA control or 0.4 mM
palmitate for 48 hr. Bottom quantification of relative Nrdp1:USP8 PLA events in Min6 β
cells (fold change vs. shNT BSA controls) following treatment conditions as noted.
(n=4/group; ~1200 PLA events quantified/group per experiment). (B) Top – Representative
deconvolution image of Nrdp1:USP8 proximity ligation assay (PLA – red, PDX1 – green,
DAPI blue) in β cells of dissociated human islets following 48 hr treatment with BSA
control (BSA) or 0.4mM palmitate/0.92% BSA + 20mM glucose (palmitate). Bottom –
quantification of relative Nrdp1:USP8 PLA events in β cells of dissociated human islets
after control BSA (white bar) or 0.4mM palmitate/0.92% BSA + 20mM glucose (grey bar)
treatment for 48 hr. (n=3 donors; ~900 β cell PLA events quantified/group per donor). (C)
Top – Representative WB of Nrdp1 levels in isolated mouse islets treated for 48 hr with or
without 0.4mM palmitate+20mM glucose. Bottom relative quantification (by densitometry)
of Nrdp1 levels by WB in isolated islets from mice treated for 48 hr with (grey bars) or
31 Diabetes Page 32 of 46
without (white bars) 0.4mM palmitate/0.92% BSA + 20mM glucose. n=3/group. (D)
Representative WB of in vivo ubiquitination assay of HA tagged Nrdp1 in MIN6 cells transfected with HA Nrdp1, Myc Ub and Flag EV or Flag Clec16a plasmids, and treated for
48 hr with or without 0.4mM palmitate/BSA coupling. n=3/group (E) Representative WB following Flag IP in MIN6 cells transfected with HA Nrdp1, Flag USP8, and either GFP EV or GFP Clec16a plasmids and treated for 48 hr with or without 0.4mM palmitate. n=4/group.
(F) Top – Representative WB of Cleaved Caspase 3 levels in MIN6 cells transfected with or without GFP Clec16a, and 48hr BSA or Palmitate treatment. Bottom – relative quantification
(by densitometry) of Cleaved Caspase 3 levels (normalized to Actin loading control) by WB in MIN6 cells transfected with or without GFP Clec16a and treated for 48hr with BSA (white bars) or Palmitate (grey bars) couplings. n=5/group. #p<0.05 paired student’s t test. *p<0.05,
**p<0.01 ***p<0.001 non paired student’s t test.
7. Schematic model of the Clec16a Nrdp1 USP8 mitophagy complex.
(A) Under physiological conditions, Clec16a promotes non degradative ubiquitination of the
E3 ligase Nrdp1 to facilitate complex formation between Clec16a USP8 Nrdp1. This complex functions to promote normal mitophagy initiation and balance mitochondrial quality control, which in turn leads to normal β cell function and regulated insulin release. (B)
However, under conditions of impaired Clec16a function, such as pharmacologic inhibition by the chemotherapeutic lenalidomide or glucolipotoxicity, Clec16a mediated Nrdp1 ubiquitination is inhibited and the Clec16a USP8 Nrdp1 complex is destabilized. This leads to dysfunctional mitophagy, loss of mitophagic quality control, and dysregulated mitochondrial respiration, ultimately leading to compromised β cell insulin release.
32 FIGUREPage 33 of1 46 Diabetes A. B. Vehicle C. Vehicle Control Lenalidomide Lenalidomide Lenalidomide §§ * ** *** Fold OCR HOMA-ß (%)
1.67mM16.7mM 5μM PRE POST PRE POST 1.67mM 16.7mM glucose glucose FCCP
Insulin secretion (pg/ng insulin content/hr) glucose glucose D. E. Vehicle Lenalidomide INSULIN LC3 SDHA MERGE * Vehicle
Co-localization (%LC3/SDHA) * Lenalidomide LC3 puncta/cell
F. G. H. Vehicle Lenalidomide Vehicle FCCP Vehicle Lenalidomide Vehicle Lenalidomide Lenalidomide - + - + * LC3 CyclophilinB GFP-LC3 GFP-LC3 GFP-LC3 GFP-LC3 Vehicle Lenalidomide Vehicle FCCP Co-localization (%LC3-GFP/mito-dsRed)
mito-dsRed mito-dsRed mito-dsRed mito-dsRed * LC3-II (Fold change Vehicle) LC3-GFP LC3-GFP puncta/cell
MERGE MERGE MERGE MERGE Vehicle FCCP FIGURE 2 Diabetes Page 34 of 46 A.A. B. C. KO MG132 - +-- + +
WT Clec16a IP: HA-Nrdp1 IP: Myc-Ub WB: Myc-Ub WB: Nrdp1 IP: Nrdp1 WB: Ub
WB: Flag WB:Flag-Clec16a WB:HA-Nrdp1 WB:Nrdp1 INPUT
INPUT WB:Nrdp1 WB:Cyclophilin B WB:Cyclophilin B WB:Cyclophilin B Flag-Clec16a - + - - + - Flag-Clec16a - + INPUT Flag-USP8 -- + - - +
D. E. F. MIP-CreERT2 Vehicle Lenalidomide - +- + MIP-CreERT2 Lenalidomide ß-Clec16aKO Vehicle IP: Myc-Ub ß-Clec16aKO Lenalidomide WB: HA-Nrdp1 IP: HA-Nrdp1 WB: Myc-Ub * WB:HA-Nrdp1 WB:Flag-Clec16a
INPUT WB:Cyclophilin B WB:Flag-Clec16a Flag-Clec16a - + - + WB:HA-Nrdp1 HA-Nrdp1 WT + + -- HA-Nrdp1 CSHQ -- + + INPUT WB:CyclophilinB Insulin secretion (pg/ng insulin content/hr) 1.67mM 16.7mM glucose glucose FIGURE 3 A.Page 35 of 46 Diabetes B. E2 enzyme: A B C D1 D2 D3 D4 E1E2 WB: 170kDa GST-Clec16a-Flag + + + Clec16a-His-Flag 130kDa HA-Ub - + + UbE2D3 - ++ E2 enzyme: F G1 H J2 K L3 170kDa WB: 2J1 2V/2V12V/2V2 170kDa IP:Flag-Clec16a Clec16a-His-Flag 130kDa 130kDa WB: HA-Ub
E2 enzyme: Z W2 T S R2 R1 Q2-1Q1-2 WB: 170kDa WB: Flag-Clec16a
Clec16a-His-Flag 130kDa INPUT
C. UbE2C UbE2D3 D. Clec16a-His-Flag + + + + + + Clec16a-His-Flag - + - + ATP + + - + + - UbE2D3 -- + + E2 + - + + - + GST-Nrdp1 CSHQ + + + +
100kDa IP:Nrdp1 75kDa IP: Flag-Clec16a WB: HA-Ub WB: HA-Ub 170kDa 50kDa 130kDa 37kDa 100kDa WB: Flag-Clec16a 70kDa
INPUT WB: HA-Nrdp1 WB: Flag-Clec16a INPUT E.
Ubiquitin: WT WT KO K48 K48R K63
IP: Myc-Nrdp1 WB: HA-Ub
WB:Flag-Clec16a
WB: Myc-Nrdp1 INPUT WB:Cyclophilin B Flag-Clec16a - + + + + + FIGURE 4 Diabetes Page 36 of 46 A. B. C.
600g 8000g 100000g WC S P S P S
WB:Flag-Clec16a Flag-USP8 WB:USP8 GFP-Clec16a IP:IgG IP:IgG IP:Flag INPUT IP:HA INPUT WB:Nrdp1 WB:Flag-Clec16a WB:Porin WB: HA-Nrdp1 WB:Creb Merge WB:Rab5 HA-Nrdp1
D. E. F.
Ubiquitin WT WT KO KO KO PYR41 - + IP: Myc-Nrdp1 WB: HA-Nrdp1 WB: Flag-USP8 IP:Parkin WB: Flag-Clec16a WB: HA-K6-Ub IP:Flag IP: Myc-Nrdp1 WB: GFP-Clec16a WB:HA-Nrdp1 WB:Flag-Clec16a WB:Flag-USP8 WB:GFP-Clec16a WB:GFP-Clec16a WB: Flag-USP8 INPUT Ponceau Red INPUT WB:Myc-Nrdp1 WB:Parkin INPUT WB:Cyclophilin B WB:Cyclophilin B GFP-Clec16a - + - + ++ GFP-Clec16a - +- + Flag-USP8 - + - + FIGUREPage 37 of 5 46 Diabetes A. B. C. IP: Flag-Clec16a WB: USP8 WB: HA-Nrdp1 IP: HA-Nrdp1 WB:Cyclophillin B WB: Myc-Ub WB: USP8 NT shRNA +-++ - - WB:Flag-Clec16a Clec16a shRNA - - - + + + HA-Nrdp1 WT WB: HA-Nrdp1 - -+ - -+ WB: HA-Nrdp1 INPUT HA-Nrdp1 K-R - - + - - + WB: CyclophilinB WB: Flag-Clec16a
INPUT Flag-Clec16a - + + + + WB: Cyclophilin B HA-Nrdp1 WT - - -+ - Flag-Clec16a - +- + HA-Nrdp1 K-R - - - + - HA-Nrdp1 WT + -+ - HA-Nrdp1 CSHQ - --- + HA-Nrdp1 K-R -- + + D. E. Vehicle Lenalidomide
2mM glucose # 20mM glucose # #
DAPI Nrdp1:USP8 PLA Vehicle Lenalidomide Insulin Secretion (Fold change 2mM glucose) ** NT shRNA -+- -++ + + + - -- Clec16a shRNA --- + + + --- + + + HA-Nrdp1 WT - -+- -+ - -+- -+
HA-Nrdp1 K-R --+--+ --+--+ Fold PLA Nrdp1:USP8 FIGURE 6 Diabetes Page 38 of 46 A. B. PDX-1/ BSA Palmitate Nrdp1:USP8 PLA PLA PLA DAPI DAPI NT BSA shRNA
Clec16a Palmitate shRNA PDX-1 *** Nrdp1:USP8 PLA * BSA Palmitate * BSA Palmitate Fold PLA Fold PLA Nrdp1:USP8 Fold PLA Fold PLA Nrdp1:USP8 NT Clec16a shRNA shRNA C. D. Palmitate - + - + Palmitate - +- + Nrdp-1 IP: Myc-Ub Cyclophilin B WB: HA-Nrdp1
BSA Palmitate WB:HA-Nrdp1 WB:Flag-Clec16a INPUT *** WB:Cyclophilin B Flag-Clec16a - + - + Nrdp1 (Fold change BSA)
E. F. Palmitate - - + + Cleaved Caspase-3 BSA Palmitate GFP-Clec16a IP: Flag-USP8 WB: HA-Nrdp1 Actin
WB:HA-Nrdp1 *** * WB:GFP-Clec16a
INPUT WB:Flag-USP8 ns WB:Cyclophilin B
GFP-Clec16a - + - + Cleaved Caspase-3 (Fold change EV-BSA) GFP-Clec16a - + - + FIGUREPage 39 of7 46 Diabetes A. Degradative Ub B. Non-degradative Ub
Clec16a Clec16a Lenalidomide Nrdp1 Palmitate USP8 Nrdp1 USP8
Regulated mitophagy: Abberant mitophagy: Healthy mitochondria Accumulation of unhealthy mitochondria
Normal ß-cell function Impaired ß-cell function Diabetes Page 40 of 46
Supplementary Table 1. List of antibodies.
Antibody Company Catalog number/clone number (if applicable) CREB Cell Signaling Technology 9197 (clone 48H2) Cyclophilin B Pierce PA1 027 FLAG Sigma Aldrich F1804 (clone M2) GFP Abcam ab6673 HA Santa Cruz Biotechnology sc 805 (clone Y 11) HA HRP Roche 12 013 819 001 (clone 3F10) Insulin Abcam ab7842 LC3 Sigma Aldrich L8918 Myc Developmental Studies clone 9E10 Hybridoma Bank Nrdp1 Santa Cruz Biotechnology sc 79996 (clone E 14) Nrdp1 Bethyl Laboratories Inc A300 049A (FLRF/RNF41) Parkin EMD Millipore 05 882 (clone PRK8) Pdx 1 Santa Cruz sc14664 (clone A 17) Rab5 Cell Signaling Technology 3547 (clone C8B1) SDHA Abcam ab14715 (clone 2E3GC12FB2AE2) Ubiquitin Enzo Life Sciences BML PW8810 0500 (clone FK2) USP8 Sigma Aldrich SAB4200527 (clone US872)
Supplementary Table 2. Donor Demographics for human islets.
Donor Age Sex Ethnicity BMI Cause of Death #1 32 Female Latino 27.9 Anoxia #2 54 Male White 35.6 Cerebrovascular/stroke #3 56 Female Latino 22.7 Cerebrovascular/stroke
Supplementary Table 3. Patient demographics for control or Lenalidomide treatment groups.
CONTROL LENALIDOMIDE p value n 11 14 NA Age (yrs) 66.3±2.1 55.9±3.6 * 0.021 Gender 7M 4F 10M 4F NA Weight (kg) 91.3±6.9 83.3±6.1 0.399
Page 41 of 46 Diabetes
Supplementary Figure 1. Lenalidomide treatment in mice in vivo impairs glucose
tolerance. (a) Blood glucose concentrations during IPGTT of C57B6 mice treated for 3
weeks with 50mg/kg I.P. Lenalidomide (white circles) or vehicle control (black circles). (n=7
8/group) (b) Blood glucose area under the curve (AUC) from IPGTT of C57B6 mice treated
for 3 weeks with 50mg/kg I.P. Lenalidomide (white bar) or vehicle control (black bar). (n=7
8/group). (c) Representative Western blot of in vivo endogenous ubiquitination assay of
endogenous Nrdp1 (with whole cell lysate Nrdp1 levels) in Min6 β cells treated with vehicle
or 10 M lenalidomide for 24hr. Cyclophilin B serves as a loading control. (n=3/group). ##
p<0.01 two way ANOVA, with Sidak’s multiple comparison post test. * p<0.05 non paired
student’s t test. Diabetes Page 42 of 46
SUPPLEMENTARY FIGURE 2 A. B. C. flox NT lec16aNA WT Clec16a C iR siRNA s Nrdp1 Cyclophilin B CHX (hr) 02 4 6 024 6
** ***
** Fold Clec16a/HPRT mRNA flox WT Clec16a WT flox NT Clec16a Clec16a FoldClec16a/HPRT mRNA siRNA siRNA Nrdp1expression (% baseline) Time (hr)
D. MG132 + +++ E. F. Nrdp1 Nrdp1 DMSO CQ BA Clec16a Nrdp1 Clec16a USP8 Clec16a USP8 Cyclophilin B Cyclophilin B Flag Clec16a + + + Flag Clec16a + + + Cyclophilin B shUSP8 1 + + GFP Clec16a + + + + shUSP8 2 + + Flag USP8 + + + +
Supplementary Figure 2. Clec16a stabilizes Nrdp1 independent of USP8 or lysosomal function. (a) Endogenous Nrdp1 levels by representative WB (top) and Clec16a mRNA levels by qRT PCR (bottom) measured in Min6 β cells, 72 hours after transfection with non targeting (NT) or Clec16a specific siRNA. (b) Clec16a mRNA levels by qRT PCR from RNA isolated from WT or UbE creERT2;Clec16aflox/flox KO primary dermal fibroblasts. n=3/group.
(c) Representative WB of endogenous Nrdp1 levels (with densitometry of % change from basal levels) from WT or Clec16aflox KO primary dermal fibroblasts following treatment with cycloheximide (CHX) for 0 6 hrs. n=3/group. (d) Representative WB of HA Nrdp1, GFP
Clec16a and Flag USP8 levels in HEK293T cells, 48 hours after transfection with GFP EV or
GFP Clec16a and Flag EV or Flag USP8, following overnight treatment with vehicle (DMSO) or 20 M MG132. n=3/group. (e) Representative WB of HA Nrdp1, Flag Clec16a and endogenous USP8 levels in HeLa cells, 48 hours after transfection with Flag EV or Flag
Clec16a and/or 2 independent USP8 shRNA vectors (or NT controls). n=3/group. (f)
Representative WB of HA Nrdp1 and Flag Clec16a protein levels in HEK293T cells, 48 hours after transfection with Flag EV or Flag Clec16a, following treatment with vehicle Page 43 of 46 Diabetes
(DMSO), chloroquine (CQ; 10 M) or Bafilomycin A1 (BA; 150nM) for 6 hours. n=3/group.
*p<0.05 two way ANOVA with Sidak’s multiple comparison post test. **p<0.01 non paired
student’s t test.
Diabetes Page 44 of 46
Supplementary Figure 3. Inhibition of Clec16a function in β cells by pharmacologic or genetic approaches. (a) Clec16a mRNA levels by qRT PCR from RNA isolated from 2 month old MIP CreERT2 or β Clec16aKO mice. (n=4/group). (b) Blood glucose concentrations during IPGTT of 5 month old MIP CreERT2 or β Clec16aKO mice.
(n=4/group) p<0.01 two way ANOVA. (c) Blood glucose area under the curve (AUC) from
IPGTT of 5 month old MIP CreERT2 or β Clec16aKO mice. (n=4/group) (d) Clec16a mRNA levels by qRT PCR from RNA isolated from isolated islets treated for 24hr with vehicle
(DMSO) or 10 M Lenalidomide. (n=4/group). (e) Clec16a mRNA levels by qRT PCR from
RNA isolated from Min6 cells, 72 hours after transfection with non targeting (NT) or one of two independent Clec16a specific shRNA (Clec16a 1, Clec16a 2). (n=4/group). (f) Glucose stimulated insulin secretion following static incubations in 2.5 mM and 25 mM glucose performed in Min6 β cells, 72 hours after transfection with non targeting or Clec16a specific shRNA plasmids. (n=4/group). ##p<0.01, ###p<0.001 two way ANOVA, Tukey’s multiple comparison post test. ***p<0.001 one way ANOVA, Tukey’s multiple comparison post test.**p<0.01 non paired student’s t test.
Page 45 of 46 Diabetes
Plasmids
Plasmids used for transfections included pFLAG CMV 5a Clec16a, pcDNA3.1 3x HA Nrdp1,
Myc Ubiquitin, pBABEpuro LC3 GFP (Addgene plasmid 22405, from the lab of Dr. Jayanta
Debnath), mCherry Parkin (Addgene plasmid 23956, from the lab of Dr. Richard Youle), and
pDsRed2 mito (Clontech), all of which were previously described (1). pFLAG CMV 5a
Clec16a 6xHis was generated by insertion of annealed oligos bearing the sequences (5’
TCGACCACCACCACCACCACCACGGTAC 3’ and 5’ CGTGGTGGTGGTGGTGGTGG 3’)
into a SalI KpnI restriction site of the pFLAG CMV 5a Clec16a vector. Clec16a EGFP was
generated by ligation of the Clec16a ORF insert (derived from the pFLAG CMV 5a Clec16a
vector) into the mEGFP N1 vector (Addgene #54767, a gift from Dr. Michael Davidson).
pGSTag Clec16a Flag and pGSTag Nrdp1 were generated by ligation of the Clec16a ORF
Flag fusion protein or the Nrdp1 cDNA into the pGSTag vector (Addgene #21877, a gift from
Dr. David Ron). pcDNA3.1 Myc Nrdp1 was generated by insertion of annealed oligos
bearing the sequences (5’
AGCTTGCCACCATGGAACAAAAACTCATCTCAGAAGAGGATCTGG 3’ and 5’
GATCCCAGATCCTCTTCTGAGATGAGTTTTTGTTCCATGGTGGCA 3’) into a HindIII
BamHI restriction site of the pcDNA3.1 3xHA Nrdp1 vector, thereby eliminating the 3x HA
tag sequence. pcDNA3.1 3xHA Nrdp1 C34S H36Q (CSHQ) was generated by site directed
mutagenesis of DNA sequences encoding the amino acids of interest utilizing the
QuikChange II Site directed mutagenesis kit per the manufacturer’s protocols (Agilent).
Primers used for Nrdp1 CSHQ site directed mutagenesis included 5’
TTGCAGAAGGCCTGCTCACTATGAGGCGCCTGCAC 3’ and 5’
GTGCAGGCGCCTCATAGTGAGCAGGCCTTCTGCAA 3’. The pcDNA3.1 3xHA Nrdp1 K
R vector (pan lysine to arginine mutant) was generated by gene synthesis approaches to
generate the 3xHA Nrdp1 sequence bearing modification DNA encoding all 11 lysine
residues to mutated to arginine residues (Life Technologies). This insert was subsequently
subcloned into the pcDNA3.1 vector (Life Technologies). The full sequence of this gene Diabetes Page 46 of 46
synthesis insert is available upon request. pcDNA Dest40 Clec16a Flag was generated by
Gateway cloning recombination of the Clec16a Flag insert from the previously described pBABE puro Dest Clec16a Flag vector (1) into the pcDNA Dest40 destination vector (Life
Technologies) using the manufacturer’s protocols. An expression vector for USP8 was generated by PCR amplification of cDNA isolated from Min6 mouse insulinoma cells. PCR primers to amplify USP8 included restriction enzyme sites to subclone coding sequences in expression plasmids. USP8 was subcloned into pFLAG CMV 5a (Sigma). Primer sequences were as follows, 5’ AGATCTGCCACCATGCCTGCTGTAGCTTCAGTTCCTAAA 3’ and 5’
GTCGACTGTGGCTACATCAGTTATGCGTGGTCCCAGGGA 3’. Additional plasmids included pRK5 HA Ubiquitin WT, pRK5 HA Ubiquitin KO, pRK5 HA Ubiquitin K48R, pRK5
HA Ubiquitin K48, and pRK5 HA Ubiquitin K63 (Addgene plasmids 17603 17608, a gift from the lab of Dr. Ted Dawson) as well as pRK5 HA Ubiquitin K6 (Addgene plasmids 22900, a gift from the lab of Dr. Sandra Weller). USP8 shRNA sequences included:
5’CCGGTCAAGCAACAGCAGGATTATTCTCGAGAATAATCCTGCTGTTGCTTGATTTTTG
3’
5’CCGGGCTGTGTTACTAGCACTATATCTCGAGATATAGTGCTAGTAACACAGCTTTTTG
3’. Non targeting and Clec16a siRNA and shRNA sequences were previously published (1).
Plasmid sequences were confirmed by DNA sequencing.
REFERENCES
1. Soleimanpour Scott A, Gupta A, Bakay M, Ferrari Alana M, Groff David N, Fadista J, Spruce Lynn A, Kushner Jake A, Groop L, Seeholzer Steven H, Kaufman Brett A, Hakonarson H, Stoffers Doris A: The Diabetes Susceptibility Gene Clec16a Regulates Mitophagy. Cell 2014;157:1577 1590