Complete Nucleotide Sequence and Infectious Cdna Clone of the RNA1 of a Chinese Isolate of Broad Bean Wilt Virus 2

______www.paper.edu.cn

Virus Genes 20:3, 201±207, 2000 # 2000 Kluwer Academic Publishers. Manufactured in The Netherlands.

Complete Nucleotide Sequence and Infectious cDNA Clone of the RNA1 of a Chinese Isolate of Broad Bean Wilt Virus 2

YIJUN QI, XUEPING ZHOU* & DEBAO LI Institute of Biotechnology, Zhejiang University, Huajiachi, Hangzhou 310029, People's Republic of China

Received July 2, 1999; Accepted October 25, 1999

Abstract. The nucleotide sequence of the RNA1 of broad bean wilt virus 2 (BBWV2) isolate B935 has been determined from overlapping cDNA clones. It contains 5956 nucleotides in length excluding the 30 terminal poly(A) tail and contains a single long open reading frame (ORF) of 5613 nucleotides extending from nucleotide 234 to 5846. A repeated motif has been found in the 50 non-coding region. The predicted polyprotein encoded by the long ORF is 1870 amino acid in length with a molecular weight of 210 K. Amino acid sequence comparisons between portions of the BBWV2 RNA1-encoded polyprotein and proteins encoded by several species in Comoviridae revealed the putative functions of BBWV2 RNA1-encoded proteins and the same general genetic organization as that of comoviruses and nepoviruses. Based on the determined sequence, full-length cDNA clone of RNA1 designated as pU1FL was constructed. Together with transcripts from full-length cDNA clone of RNA2 ( pU2FL), transcripts from pU1FL infected Chenopodium quinoa successfully.

Key words: BBWV2, RNA1, infectious cDNA, nucleotide sequence

Introduction investigated, while the genetic structures of the two RNA species of fabaviruses have not been well Broad bean wilt virus (BBWV) is the type member of studied (6). Recently, Nakamra et al. reported the the genus Fabavirus. It has a wide host range among nucleotide sequences of genomic RNAs of BBWV2 dicotyledons and some families of monocotyledons MB7 isolate, and the genome organization has been (1), and is an economically important virus in China presumed brie¯y (7). We present here the complete (2). BBWV has a bipartite genome, consisting of two nucleotide sequence of RNA1 of BBWV B935 positive-strand RNA molecules designated as RNA1 isolate, and amino acid sequence comparisons (Mr2:0±2:66106) and RNA2 (Mr1:3±1:76106) (3). between portions of the B935 RNA1-encoded The protein shell of BBWV is built of apparently polyprotein and proteins encoded by RNA1 of equimolar amounts of two distinct polypeptides, BBWV2 MB7 isolate (7), cowpea mosaic virus estimated to be 42.5 K and 21.0 K in size (3,4). (CPMV) (8), cowpea severe mosaic virus (CPSMV) BBWV isolates were divided by Uyemoto and (9), red clover mosaic virus (RCMV) (10), tomato Provvidenti into two serotypes (I and II) (5), which black ring virus (TBRV) (11), Hungarian grapevine have recently been classi®ed into two species mosaic virus (GCMV) (12), and tomato ringspot virus BBWV1 and BBWV2 (6). (ToRSV) (13). The genus Fabavirus is now included within the family Comoviridae together with the genera Materials and Methods Comovirus and Nepovirus. Both the genome structures of comoviruses and nepoviruses have been well Virus Propagation and Puri®cation *Corresponding author. Fax: 865716961525. E-mail: xzhou@- mail.hz.zj.cn The GenBank accession number of the sequence The B935 isolate of BBWV2 collected from broad reported in this paper is AF149425. bean (Vicia faba) showing mosaic symptom in ______中国科技论文在线 www.paper.edu.cn

202 Qi, Zhou and Li

Hangzhou, China, was propagated in Chenopodium Construction of Full-Length cDNA Clone of RNA1 quinoa. Virus particles were puri®ed as previously for Production of Infectious Transcripts described (2). Full-length cDNA clone of RNA1, designated as pU1FL was constructed as described in Fig. 3. cDNA Synthesis and Cloning Recombinant plasmid pG1pL was derived from two overlapping cDNA clones designated as A8 and T13, RNA was extracted from virus particles by treatment which contain cDNA of 50-terminal region of RNA1 with Trizol1reagent, and cDNA was prepared from it (nucleotides 53 to 3292) and cDNA of the 30-end by reverse transcription essentially as described (14). region of RNA1(nucleotides 3125 to 5956), respec- Primers used for reverse transcription were oligo(dT) tively. KspI-SalI fragment of T13 was inserted in A8 and primer A (50-ATGCTGGAATCCATCTTC, com- digested with KspI and SalI (KspI locates in the plementary to nucleotides 3275 to 3292). The cDNA overlapping region at position 3262 and SalI in MCS was ligated into SmaI-cut pGEM3zf( ) and cloned of cloning vector pGEM3zf( )), resulting in plasmid in Escherichia coli JM109 as described (14). Clones pG1pL containing cDNA of most RNA1 sequence derived using the primer oligo(dT) was con®rmed as (nucleotide 53 to 5956). The 50end of RNA1 was originating from RNA1 by probing Northern blots of obtained by RT-PCR, using primer D(50- puri®ed BBWV2 RNA with labeled cloned cDNA. AACTGGCAGTTCCTGACTCTCCT, complementary The 50 end of RNA1 was cloned by rapid to nucleotides 580 to 602) and primer E bearing ampli®cation of cDNA ends kit (Boehringer Mann- T7 promoter (underlined), SacI site (in bold) heim), using the prime B (50-TCTCGTGCCATCTCA- and sequence identical to 50end nucleotides 1 to 17 TTGGCAT, complementary to nucleotides 373 to of RNA1(CACGAGCTCTAATACGACTCACTATA- 394) and the primer C(50-GGTTCTTTCCAAAGTCA- GTGTTTTAATTTTTTATT). After con®rmed by CGCAG, complementary to nucleotides 132 to 153). sequencing, the PCR product was digested with SacI The ®rst strand cDNA synthesized by primer B was and HpaI, and then inserted in pG1pL digested with tailed by either oligo(dC) or oligo(dA). The tailed SacI and HpaI, to give pG1FL, which contains full- cDNA was then ampli®ed by 30 cycles of the length cDNA insert bearing a T7 promoter fused polymerase chain reaction, with the 50 primer directly to the 50 nucleotide sequence. The cDNA oligo(dG) or oligo(dT) and the primer C. The insert with T7 promoter was then cut off from pG1FL ampli®ed DNA was puri®ed and ligated with by SacI and SalI, and ligated into SacI&SalI-cut pGEM-T vector (Promega) before transformation of pUC18 (a plasmid not bearing T7 promoter), resulting E. coli JM109. in pU1FL.

Infectivity Assay of In Vitro Transcripts Nucleotide Sequencing and Sequence Analysis Plasmids clones of BBWV2 RNA1 ( pU1FL) and Plasmids were puri®ed using a QIAprep1 spin RNA2 ( pU2FL, unpublished data) were linearized at plasmid kit (Qiagen). All the clones and subclones the 30end of the inserted sequence using restriction generated by restriction enzyme or exonuclease III endonuclease SalI and EcoRI, respectively. In vitro digestion were sequenced using ABI377 DNA transcription was in presence of the cap analogue sequencer (Perkin Elmer) or ALFexpress DNA m7G(50)ppp(50)G. Standard reactions of 100 ml con- sequencer (Pharmacia). All residues in the sequence tained 5 mg of linearized template DNA, 40 u T7 RNA were con®rmed by sequencing in both directions of at polymerase and 50 u RNAsin1 ribonuclease inhibitor

least two different clones. Sequence data were in 40 mM Tris-HCl, 6 mM MgCl2, 2 mM spermidine, assembled and analyzed with the aid of the 10 mM NaCl, 10 mM DTT, 1 mM cap analogue and Wisconsin Package Version 8.1 Programs. 1 mM each of rATP, rCTP and rUTP with 0.2 mM Alignments of homologous sequences (of nucleo- rGTP. Reactions were performed at 37C for 60 min, tides or amino acids) were obtained with the and proceeded with DNaseI treatment to remove the CLUSTAL W Multiple Sequence Alignment template. RNA products were precipitated with Program (Version 1.70). ethanol and dissolved in nuclease-free water to the ______中国科技论文在线 www.paper.edu.cn

Nucleotide Sequence of BBWV2 RNA1 203

desired stock solution concentration. Two groups of 5 (AUG384, TGAGATGG) are all in favorable context 2-week-old seedlings of Chenopodium quinoa were and may initiate translation. Further work is required rubbed with solutions of nucleic acids from transcrip- to address the question which AUG(s) act as the site tion reaction mixture of RNA1 and RNA2 or water for initiation of translation. alone on leaves that had been dusted with carbor- The 50 non-coding region (50-NCR) consists of 233 undum powder. Plants were observed for a period of nucleotides and the 30 non-coding region (30-NCR) ten days for development of symptoms. Infection by comprises 110 nucleotides. Like those of comoviruses BBWV2 was con®rmed by TAS-ELISA using poly- and nepoviruses, they contain relatively few GC and monocolonal antibody against BBWV2. residues (31.3% for 50-NCR and 29.1% for 30-NCR) and abundant U residues (33.9% for 50-NCR and 42.7% for 30-NCR). A nucleotide motif Results and Discussion (AAACAGCUUUC), which repeated at position 23± 33, 41±51, 59±69, 79±89 and 96±106, is present in the Primary Structure of RNA1 of BBWV2 B935 Isolate 50-NCR. This repeated motif is also found in the 50- NCR of B935 RNA-2. Repeated motifs were also Two overlapping cDNA clones designated T13 and found in the 50-NCRs of some nepoviruses, such as A8 were used to determine most of the nucleotide TBRV and GCMV (17). The possible signi®cance of sequence of BBWV2 RNA1. Clone T13, which these repeated motifs is unknown. corresponds to 2832 nucleotides at the 30 end of RNA1 was derived using the primer oligo(dT). Clone Sequence Homologies between RNA1 and RNA2 of A8, which corresponds to the 50-terminal region of BBWV2 Isolate B935 BBWV2 RNA1 (nucleotides 53 to 3292), was derived using the synthetic oligonucleotide primer A. Five Comparison of the nucleotide sequence of RNA1 with dA-tailed 50-end cDNA clones and six dG-tailed that of RNA2(AJ132844) revealed extensive simi- cDNA clones were obtained to determine the 50-end larity in the 50-NCRs. The 50-NCR of RNA1 is 3 sequence of RNA1 with primer B and primer C using nucleotides longer than that of RNA2, assuming that 50/30 RACE kit. both RNA1 and RNA2 employ the ®rst AUG (AUG The BBWV2 RNA1 contains 5956 nucleotides 234 and AUG230 respectively) as the initiation excluding the poly(A) sequence of unknown length at codon. The global identity between these two the 30end, which is similar to the Mr value determined sequences is about 56.6% with the highest degree of by denatured gel electrophoresis (4). The base homology within the ®rst 95 nucleotides (89%) and composition of RNA1 is 28.3%A, 16.9%C, 26.3%G nucleotides from 149 to 192 (97%) (corresponding to and 28.5%T, which is similar to that of BBWV2 RNA- the 50-NCR of RNA1). No signi®cant homology was 2 (AJ132844). observed in the 30-NCRs of RNA1 and RNA2. A single long ORF, which accounts for 94.2% of Extensive sequence homologies in the terminal the RNA1 sequence, has been identi®ed in the regions of RNA1 and RNA2 of the same virus are positive sense. No other ORF exceeding 486 very common in comoviruses and nepoviruses. For nucleotides in length was found either in the positive tomato ringspot virus (ToRSV), it has been predicted or the negative sense RNA. The long ORF begins at that the similar sequences at both ends of ToRSV position 234 (AUG234) and terminates at a TGA stop RNA1 and RNA2 were a result of recombination codon at position 5844. The predicted translation between these two genomic RNA components (18). product contains 1870 amino acids (aa) and has a calculated molecular mass of 210063 (210 K). RNA1 Sequence Comparison of BBWV2 Isolate AUG234 (TAAAATGG), the ®rst potential initiation B935 and Isolate MB7 codon of the sequence, is in a optimal context known to enhance translation on eucaryotic cells with As in Recently, Nakama et al. (17) have reported the position 1 and 3, and a G in position 4 (15,16). RNA1 nucleotide sequence of BBWV2 isolate Several other in-frame AUGs occurring at position MB7(AB013616). The RNA1 of isolate B935 is one 249 (AUG249, TACGATGC), at position 282 nucleotide shorter than that of isolate MB7 due to one (AUG282, CTCGATGG), and at position 384 nucleotide deletion at position 43. The nucleotide ______中国科技论文在线 www.paper.edu.cn

204 Qi, Zhou and Li

sequence homology between the two isolates is about 87%. Higher degrees of homologies were found in the 50-NCRs (96%) and 30-NCRs (92%). The repeated motif (AAACAGCUUUC) is also present in the 50- NCR of the MB7 RNA1. Both RNA1 of B935 and MB7 contain a single long ORF, which encodes a large polyprotein with Mr of about 210 K. Comparison of the deduced amino acid sequences of RNA1-encoded polyprotein of B935 and that of MB7 showed 94% identity, which suggests a close relationship between these two isolate.

Comparison of the 210 K Polyprotein with other Viral Proteins and Search for Signi®cant Motifs in the Amino Acid Sequence

BBWV2, shows many similarities to comoviruses and nepoviruses, including having a single-stranded positive-sense RNA genome, ending with a poly(A) tail. The location of coat proteins on RNA2-encoded polyprotein suggested that BBWV2, as comoviruses and nepoviruses, employ a ``polyprotein processing'' translation strategy (Y.J. Qi et al., unpublished). Thus the 210 K protein potentially encoded by BBWV2 RNA1 is probably a polyprotein. This has been partially con®rmed by an in vitro translation experiment showing the existence of a large polypep- tide with Mr of approximately 200 K (7). To map the mature proteins on the precursor, we align the 210 K RNA1-encoded polyprotein with that encoded by Fig. 1. Alignment of portions of the BBWV2 isolate B935 and BBWV2 isolate MB7, CPMV, CPSMV, RCMV, MB7 RNA1-encoded polyproteins with motifs identifying the TBRV, GCMV and ToRSV using the CLUSTAL W RdRp (a), cysteine protease (b), NTBM (c), protease co-factor (d) and Vpg (e) of several members of family Comoviridae. & Multiple Sequence Alignment Program (Version indicates residues thought to belong to the consensus sequence of 1.70). RdRp (a), cysteine protease (b) or NTBM (c); * indicates residues The conserved residues T/SGXXXTXXXNT/S identical in all sequence; indicates residues identical in more (where X may be any amino acid residue) and the than half of the sequences; Xn refers to the number of amino GDD sequence ¯anked by hydrophobic residues at acids separating the conserved residues or sites; numbers to the left of the sequence refer to amino acid residue position in each both sides found in all RNA-dependent RNA viral polyprotein. polymerase(RdRp) (19,20) are present in the C- terminus of 210 K protein at position 1512 to 1522 and 1557 to 1559. Among the viruses in family 1450 to 1457, TDGXDK at position 1589 to 1594 and Comoviridae, the blocks of conserved amino acid are FLKRXF at position 1609 to 1614. much longer (Fig. 1(a)). In all seven viruses studied, Viruses which use ``polyprotein processing'' the GDD sequence is preceded by a Y residue and translation strategy encode (a) protease(s) required followed by a N residue. Besides these two blocks, for the cleavage of the polyprotein. A motif there exist several other blocks of conserved amino characteristic of viral cysteine protease (H-Xn-E/D- acid residues including TSP/EGY/FP located at Xn-C-G-Xn-G-Xn-G-Xn-H-Xn-G (Xn refers to the position 1313 to 1318, CDYS/KXFDG at position number of amino acids between two residues) (13) in ______中国科技论文在线 www.paper.edu.cn

Nucleotide Sequence of BBWV2 RNA1 205

which the H (in bold), E and C residues are thought to been isolated or characterized, the exact sizes and the form the catalytic triad of the enzyme (21). This precise locations of the viral proteins remain conserved motif was found at the region of N-terminal unknown. to the putative BBWV2 RdRp between residue 1003 The protease of comoviruses commonly cleave at a and 1149 (Fig. 1(b)). Besides this motif, several limited number of dipeptide: Q/S, Q/M, Q/G for conserved sites are present in protease region of CPMV (8,29), Q/S, Q/M, Q/A for CPSMV (9,30), comoviruses, nepoviruses and the equivalent region of Q/G, Q/S, Q/M, Q/T for RCMV (10,31), Q/F, Q/S, BBWV2. Q/M for bean pod mottle virus (32), Q/S, Q/M, Q/F The purine NTP-binding domain (NTBM) con- for Andean potato mottle virus (33,34) and Q/N, Q/S sisting of two separate motifs, the N-terminal ``A'' for squash mosaic virus (35), which may be due to the site(consensus sequence: h hydrophobic stretch i G/ conserved active sites and similar substrate-binding AXXGXGKS/T, where X may be any amino acid pocket among these viruses. The presumed protease residue) and the C-terminal ``B'' site(consensus of BBWV2 has a similar structure to that of sequence: h hydrophobic stretch i DE/D) as described comoviruses, and it has been con®rmed that RNA2- by (22,23) were found in the BBWV2 210 K encoded polyprotein cleaves at Q/G and Q/A polyprotein at position 515 to 522 and 565 to 566. dipeptide (Y.J. Qi et al., unpublished), which suggests Homologies between this region of membrane- that BBWV2 might share cleavage sites with binding protein of CPMV, CPSMV, RCMV, TBRV, comoviruses. Consequently, assignment of cleavage GCMV, ToRSV and the equivalent region of BBWV2 sites for polyprotein processing was based on the are shown in Fig. 1(c). This domain has been found in known cleavage sites commonly used for maturation non- structure proteins encoded by a wide range of of comovirus polyprotein. positive-strand RNAviruses and in the dsDNAviruses A Q/G dipeptide at amino acid position 1171/1172 sequenced so far (22). It has been suggested that is the most probable cleavage site between the NTBM-containing viral proteins might be in fact at putative protease and the RdRp. This site aligns NTPase are involved in processes such as duplex with the Q/G cleavage site of CPMV and RCMV unwinding during RNA replication, transcription, (8,10). Three possible cleavage sites, at position 936/ mRNA translation, signal transduction, and membrane 937(Q/S), 960/961(Q/G) and 962/963(Q/S), are found transport (22,24). The NTP-binding motif in CPMV B between protease and the protein including NTP- polyprotein has been proved essential for viral binding domain. It is not known whether these RNA replication (25). molecules, like that of comoviruses and nepoviruses, 0 A conserved amino acid sequence, F-X27-W- possess a genome-linked protein (Vpg) at their 5 X11-L-X21-LX1E (Xn refers to the number of amino termini. Assuming that, as for como-and nepoviruses, acids between conserved residues), has been identi®ed BBWV2 genome-linked protein (Vpg), if exists, is in nepo- and comovirus ployprotein sequences located between these two proteins, Q/S at position (13,26). This consensus sequence is located in the 936/937 and Q/G or Q/S at position 962/963 should be N-terminal region of the BBWV2 210 K poly involved in cleavages to give Vpg with Mr of about -protein with one residue modi®cation (the F residue 3 K. Alignment of the presumed Vpg of BBWV2 with is replaced by an M)(Fig. 1(d)). The CPMV 30 K Vpgs of three comoviruses (CPMV, CPSMV and protein containing this sequence has been shown to RCMV) is shown in Fig. 1(e). The presumed BBWV2

act as a cofactor for the viral protease (27,28), a Vpg shares a consensus sequence SX2PNRX879 similar function has been proposed for the analogous NX5R with Vpgs of CPMV, CPSMV and RCMV. In part of the nepovirus polyprotein (13,26). the internal between the putative protein cofactor and the NTP-binding domain, we found two potential Potential Cleavage Sites and Genetic Organization cleavage sites, Q/N at position 335/336 and Q/F at of the 210 K RNA1-encoded Polyprotein position 346/347. Although both Q/N and Q/F are included in known cleavage sites used for como- The homology study, as well as the search for viruses, Q/F was preferable to Q/N, because it consensus sequeces, reveals the probable functions corresponds closely with the Q/G site of RCMV and of each domain in the polyprotein. However, since the Q/S sites of CPMV and CPSMV in the similar none of the BBWV2 RNA1-encoded proteins, has positions (8±10). ______中国科技论文在线 www.paper.edu.cn

206 Qi, Zhou and Li

Assuming the cleavage sites within the BBWV2 RNA1-encoded polyprotein have been correctly identi®ed, the size of the individual proteins can be calculated. The Mr calculated for proteins generated by cleavages at the hypothetical sites and the presumed functions of these proteins are shown in Fig. 2. Since none of the proteins has been isolated or characterized, further in vivo and in vitro studies should be done to con®rm the exact sizes and functions of the viral proteins.

Construction of Full-Length cDNA Clone of RNA1 for Production of Infectious Transcripts

Full-length cDNA clone of RNA1, designated as pU1FL, was constructed as described in Fig. 3. The 0 sequence of T7 promoter was introduced to the 5 end Fig. 3. Methodology for construction of full-length cDNA clone of RNA1 by PCR, which will direct transcription to of RNA1 for production of infectious transcripts. (A) Starting obtain transcripts without non-viral sequence. plasmids A8 and T13 contain cDNA of 50-terminal region of Considering pG1FL as template for transcription, the BBWV2 RNA1 (nucleotides 53 to 3292) and cDNA of 30- preexisting T7 promoter in cloning vector terminal region (nucleotides 3125 to 5956), respectively; unique sites KspI in the overlapping region and SalI in the MCS of pGEM3zf( ) would also direct transcription, leading cloning vector pGEM3zf( ) allow A8 and T13 to be assembled. to the existence of vector-derived sequences at the (B) KspI-SalI fragment of T13 was inserted in A8 digested with 50end of transcripts, which may deteriorate or even KspI and SalI, resulting in plasmid pG1pL containing cDNA of abolish the infectivity of transcripts (36). Thus, the most RNA1 sequence (nucleotides 53 to 5956); the 50end of cDNA insert with the introduced T7 promoter was RNA1 (nucleotides 1 to 602) directly fused to a T7 promoter and SacI site was obtained by RT-PCR, unique site HpaI at position transferred from pG1FL to pUC18, to give pU1FL. 545 and SacI were employed to introduce the 50end fragment to The group of 5 seedlings of Chenopodium quinoa pG1pL. (C) 50end fragment was digested with SacI and HpaI and inoculated with mixture of transcripts of pU1FL and then inserted in pG1pL digested with the same restriction pU2FL, chlorosis was found in inoculated leaves 5 endonuclease, to give pG1FL. (D) The cDNA insert fused with days post-inoculation (d.p.i.), and systemic symptoms T7 promoter was cut from pG1pL using SacI and SalI, and then ligated with pUC18 digested with SacI and SalI, resulting in were developed 8 d.p.i. TAS-ELISA results con®rmed pU1FL. Abbreviations used: T7, T7 promoter; S1, SacI; S2, SalI; that these seedlings were infected with BBWV2. It H, HpaI; K, KpnI. suggested that transcripts from pU1FL and pU2FL have infectivity. Infectious cDNA clone pU1FL was constructed by assembly of A8, T13 and 50end fragment. The sequence of 50end fragment was identical to the determined sequence of RNA1 50-terminal region obtained by 50-RACE. So, the sequence of the full- length cDNA inserted in pU1FL was identical to the established RNA1 sequence. This suggested that the established RNA1 sequence was complete and reliable. Fig. 2. Proposed genetic organization of BBWV2 RNA1 and As described above, the genetic organization and comparison with that of CPMV B RNA. Line indicates non- functions of BBWV2 RNA1 were presumed by coding sequence and bar represents the polyprotein encoded by comparisons with some species in Comoviridae.The the long ORF. Vertical lines through the bars indicate known (for construction of infectious clones will greatly facilitate CPMV) and putative (for BBWV2) protease cleavage sites. The position of the consensus sequences for RdRp(), protease(&), the study of genetic expression and function con- NTBM () and protease co-factor(&) are marked with symbols. ®rmation of genomic RNAs by the use of ______中国科技论文在线 www.paper.edu.cn

Nucleotide Sequence of BBWV2 RNA1 207

mutagenesis, deletion, insertion, and by complemen- 17. Le Gall O., Lanneau M., Candresse T., and Dunez J., J Gen tation experiments. Virol 76, 1279±1283, 1995. 18. Rott M.E., Tremaine J.H., and Rochon D.M., Virology 185, 468±472, 1991. 19. Kamer G. and Argos P., Nucleic Acids Res 12, 7269±7282, References 1984. 20. Goldback R.W., Ann Rev Phytopath 24, 289±310, 1986. 1. Deol T.R., J Gen Virol 26, 95±108, 1975. 21. Gorbalenya A.E., Donchenko A.P., Blinov V.M., and Koomin 2. Zhou X.P., Qian X.H., Zhang L.C., Xu P., and Li D.B., E.V., FEBS letter 243, 103, 1989. J Zhejiang Univ (Natural Science) 28, 271±277, 1994. 22. Gorbalenya A.E. and Koomin E.V., Nucleic Acids Res 17, 3. Lisa V.and Boccardo G. in Harrison B.D., and Murant A.F (eds). 8413±8440, 1989. The Plant Viruses, Plenum Press, New York, 1996, pp. 229±251. 23. Gorbalrnya A.E. Donchenko A.P., Blinov V.M., and Koomin 4. Zhou X.P. and Li D.B., Chin J Virol 12, 364±370, 1996. E.V., J Mol Evol 24, 256±268, 1989. 5. Uyemoto J.K. and Provvidenti R., Phytopathology 64, 1547, 24. Lain S., Riechmann J.L., and Garcia J.A., Nucleic Acids Res 1974. 18, 7003±7006, 1990. 6. Goldbach R., Martelli G.P., and Milne R.G. in Francki R.I.B., 25. Peter S.A., Verver J., Nollen E.A., vanLent W.M., Wellink J., Fauquet C.M., Knuasen D.L., and Brown F., (eds), and van Kammen A., J Gen Virol 75, 3167±3176, 1994. Classi®cation and Nomenclature of Viruses. Fifth Report of 26. Ritzenthaler C., Viry M., Pinck M., Margic R., Fuchs M., and the International Committee for the Taxonomy of Viruses, Pinck L., J Gen Virol 72, 2357±2365, 1991. Springer Verlag, New York, 1991, pp. 341±347. 27. Vos P., Verver J., Jaegle M., Wellink P., and Goldbach R., 7. Nakamura S., Iwai T., and Honkura R., Ann Phytopathol Soc Nucleic Acids Res 16, 1967±1985, 1988. Jpn 64, 565±568, 1998. 28. Peter S.A., Voorhorst W.G.B., Wery J., Wellink J., and van 8. Lomonossoff G.P. and Shanks M., EMBO J 2, 2253±2258, 1983. Kammen A., Virology 191, 81±89, 1992. 9. Chen X. and Bruening G., Virology 191, 607±618, 1992. 29. van Wezenbeek P., Verver J., Harmsen J., Vos P., and van 10. Shanks M. and Lomonossoff G.P., J Gen Virol 73, 2473±2477, Kammen A., EMBO J 2, 941±946, 1983. 1992. 30. Chen X. and Bruening G., Virology 187, 682±692, 1992. 11. Greif C., Hemmer O., and Fritsch C., J Gen Virol 69, 1517± 31. Shanks M. and Lomonossoff G.P., J Gen Virol 73, 2473±2477, 1529, 1998. 1992. 12. Le Gall O., Candresse T., Brault V., and Dunez J., Nucleic acids 32. MacFarlane S.A., Shanks M., Davies J.W., Zlotnick A., and Res 17, 7795±7807, 1989. Lomonossoff G.P., Virology 183, 405±409, 1991. 13. Rott M.E., Gilchrist A., Lee L., and Rochon D.A., J Gen Virol 33. Shindo N., Vincente A.C., Krengiel R., and de Olireira D.E., 76, 465±473, 1995. Intervirology 36, 169±180, 1993. 14. Sambrook J., Fritsch E.F., and Maniatis T., Molecular Cloning: 34. Krengiel R., Vincente A.C., Weyne M., Shindo N., Brioso P.S., A Laboratory Mannual, Cold Spring Harbor Laboratory, New Felix D.B., Villaroel R., de Olireira D.E., and Timmerman B., York, 1989. J Gen Virol 74, 315±318, 1993. 15. Kazak M., Cell 44, 283±292, 1986. 35. Hu J.S., Pang S.Z., Nagpala P.G., Siemieniak D.R., Sliglltom 16. LuÈtcke H.A., Chow K.C., Mickel F.C., Mossk A., Kern H.F., J.L., and Gonsalves D., Arch Virol 130, 17±31, 1993. and Sceele G.A., EMBO J 6, 43±48, 1987. 36. Boyer J.C. and Haenni A.L., Virology 198, 415±426, 1994.