Molecular interactions of brown marmorated stink bug, Halyomorpha halys with its

bacterial endosymbiont, Pantoea carbekii and their role in nutrient provisioning

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

By

Priyanka Mittapelly, M.S.

Graduate Program in Entomology

The Ohio State University

2018

Dissertation Committee:

Dr. Andrew P. Michel, Advisor

Dr. Peter M. Piermarini

Dr. Zakee L. Sabree

Dr. David L. Denlinger

Copyrighted by

Priyanka Mittapelly

2018

Abstract

Phytophagous insects of Hemiptera exclusively feed on the plant sap and cause

severe yield loss to many important agricultural commodities. Since the last decade, there

has been a significant increase in application of targeted insecticides to manage these

hemipteran pests. Halyomorpha halys, (brown marmorated stink bug, BMSB) is a notorious, polyphagous Hemipteran pest that causes severe feeding damage to more than

100 agricultural and ornamental plants. Since its invasion in 1996, it has spread to 44 states in the U.S. and four Canadian provinces. Soybean (Glycine max) is one of the

major agricultural crops in U.S. and BMSB causes severe injury to reproductive tissues

resulting in a significant yield loss. BMSB feeds on the plant sap that is nutritionally

imbalanced; however, some nutrients are potentially provided by its bacterial

endosymbiont, Pantoea carbekii. My research focused on feeding preferences and

damage caused to soybean by BMSB and also investigated the molecular coordination of

the BMSB-P. carbekii association.

Specialty soybean is a major focus for Ohio, and there are several varieties of

soybean grown as dietary staple for human and animal feed. I was interested to test for

any preference of BMSB on these varieties. BMSB caused severe feeding damage all

soybean varieties and no feeding preference was observed among soybean varieties.

There was a significant negative impact on the seed weight and damage incidence of all

ii

soybean varieties. Results suggested that scouting should be intensified during soybean

growth stages that are susceptible to BMSB infestation and should be treated similar to

conventional soybean if the infestation exceeds the economic threshold. Chapter three

revealed the importance of P450 enzymes belonging to the CYP6 sub-family that are well

known for detoxification and metabolism of plant secondary metabolites encountered in

the diet of many generalist insects. I characterized and analyzed the expression of three

HhCYP6 genes in different tissues, sexes and when BMSB was exposed to different

diets. The results showed differential expression of HhCYP6 genes in tissues suggesting

their role in diverse and important physiological functions related to the gut, fat body and

Malpighian tubules. To further study the functions of genes potentially important to

BMSB, I have successfully developed an RNAi injection technique in chapter 4. The

gene expression of three BMSB target genes (cytochrome P450 reductase (HhCPR),

catalase (HhCAT) and vacuolar-type ATPase (HhvATP)) was significantly decreased. In addition, knocking down the expression of HhvATP negatively impacted the survival of

BMSB. Establishing a standard method of dsRNA delivery via microinjection in BMSB will help in documenting essential functions of several important candidate genes.

Chapters five and six revealed the importance of the BMSB-P. carbekii interaction, providing insights on the molecular and physiological functions as well as the nutrient provisioning role of P. carbekii. Chapter 5 determined the impact of P. carbekii on free amino acid abundance in BMSB. The absence of P. carbekii resulted in significant decrease in the essential and non-essential amino acid concentrations, except for lysine and alanine, which were significantly higher in aposymbiotic BMSB. By

iii

sequencing metatranscriptomes in chapter six, we characterized the interactions between

BMSB and P. carbekii that help in the biosynthesis of several nutrients. Results from

both metabolomic and metatranscriptomic studies provide insights on molecular and

physiological collaborations of BMSB and P. carbekii in biosynthesis and metabolism of

nutrients including amino acids. A total of 9 BMSB transcripts from the

metatranscriptome differentially expressed among symbiotic and aposymbiotic BMSB,

including D-aspartate oxidase, succcinylornithine/ acetylornithine transaminase, thiazole

synthase and two proteins (histone H3 and protein pelota). The findings of chapter six

suggested that the association of P. carbekii with BMSB is essential in the synthesis of nutrients such as arginine, lysine and thiamine. The information on differentially expressed genes in this study can be exploited to target specific genes/enzymes that affect the BMSB-P. carbekii association and potentially help in developing novel pest

management strategies.

To conclude, my research revealed the basic biology of BMSB, also molecular and

physiological coordination of BMSB-P. carbekii association. Results from this work contributed to the fundamental biology and molecular physiology of insect-symbiont interactions that sheds light on detoxification and nutrient providing mechanisms.

Successful use of RNAi to target differentially expressed genes that affect the BMSB-P.

carbekii association may provide possible RNAi-based pest management.

iv

I dedicate this dissertation to three most important people in my life:

My parents, Laxmikantha and Venkateshwarlu Mittapelli and

my husband, Ganeshbabu Kone.

v

Acknowledgments

I would like to take this opportunity to express my deep gratitude to all those who have supported and assisted me throughout my graduate school and made it possible for me to succeed. First, I would like to thank my wonderful advisor Dr. Andy Michel for giving me an opportunity to pursue my Ph.D. and for his constant support, patience and excellent advice. A heartfelt thank you to my committee members, Dr. Peter Piermarini,

Dr. Zakee Sabree and Dr. David Denlinger for their time, effort and support over these last five years. I would also like to thank Dr. Larry Phelan for his unending support, constant questioning that helped me to think out of the box.

I am also indebted to the previous and current members of Michel lab, especially

Cindy Wallace, for maintaining the insect colony, helping with the field experiments for more than 3 years and for her constant support. I would like to thank Natalie Gietgey and

Ana Trabanino for taking their valuable time to help me assess the soybean seed damage.

A heartfelt thank you to Ashley Yates and Priya Rajarapu for not just being great friends, but also for their endless support at all times and for their mentorship. Special thanks to

Carlos Esquivel, Liu Yang, Erin O’Brien, Doug Sponsler, Kayla Perry, Travis Calkins,

Nuris Acosta, Lori Jones and Brenda Franks for all their support, friendship and help throughout my time in grad school. I would also like to thank Priya’s family including

Naresh Rajarapu, Vanshika and new addition Swanika for the amazing times we had since I came to U.S., seven years ago. My friends in Wooster and everyone in the

Entomology Department have helped me one way or the other to grow as a person and a

vi great researcher. I hope this is the right opportunity to at least say, “Thank you all so very much”.

I thank all my family members living in India and U.S. including my parents, in- laws, my sister, Pravallika Mittapelly and everyone else for being there at all times throughout this journey. I thank Dr. Shyam Sunder Gajula for motivating me to pursue higher studies and for his constant support. Last, but never the least, I thank two most important people in my life, my wonderful husband, Ganesh Kone and my 30-month old loving toddler, Vihaan Kone, who were with me in every step of this journey. Their patience, love and support during the tough times helped me to keep pushing and stay focused to complete my studies. Finally, none of this would have been possible without the help, support and love I received from everyone. I am very grateful to have you all in my life.

vii

Vita

2006 ...... B.S. Biotechnology, Kakatiya University

2008...... M.S. Microbiology, Kakatiya University

2014 - present ...... Graduate Research Associate, 2014-2015,

Graduate Teaching Associate, 2016-2017

Graduate Research Associate, 2017-2018

Department of Entomology, The Ohio State

University, OARDC, Wooster, OH

Publications

Mittapelly, P., Bansal, R., Michel, A. (2018) Differential expression of cytochrome P450 CYP6 genes in the brown marmorated stink bug, Halyomorpha halys. Journal of Economic Entomology. (In review)

Bansal, R., Mittapelly, P., Chen, Y., Mamidala, P., Zhao, C., Michel, A. (2016) Quantitative RT PCR Gene Evaluation and RNA Interference in the Brown Marmorated Stink Bug. PLoS One, 11(5): e0152730.

Bansal, R., Mittapelly, P., Cassone, J. B., Mamidala, P., Redinbaugh, G. M., Michel, A. (2015) Recommended reference genes for quantitative PCR analysis in soybean have variable stabilities during diverse biotic stresses. PLoS One, 10(8): e0134890.

Fields of Study

Major Field: Entomology viii

Table of Contents

Abstract ...... ii Dedication ...... v Acknowledgments...... vi Vita ...... viii Table of Contents ...... ix List of Figures ...... xi List of Tables ...... xv

Chapters

1. Introduction ...... 1 1.1 Introduction ...... 1 1.2 References ...... 8

2. Feeding preferences of brown marmorated stink bug, Halyomorpha halys on high and low protein varieties of soybean (Glycine max) ...... 15 2.1 Abstract ...... 15 2.2 Introduction ...... 16 2.3 Materials and Methods ...... 20 2.4 Results ...... 23 2.5 Discussion ...... 25 2.6 References: ...... 28 2.7 Tables and figures: ...... 35

3. Differential expression of cytochrome P450 CYP6 genes in the brown marmorated stink bug, Halyomorpha halys...... 50 3.1 Abstract ...... 50 3.2 Introduction ...... 51 3.3 Material and methods: ...... 55 3.4 Results ...... 59 3.5 Discussion ...... 63 3.6 References: ...... 67 3.7 Tables and figures ...... 78

ix

4. RNAi mediated silencing of catalase, vacuolar ATPase and cytochrome p450 reductase genes in Halyomorpha halys ...... 90 4.1 Abstract ...... 90 4.2 Introduction ...... 91 4.3 Materials and methods ...... 95 4.4 Results ...... 99 4.5 Discussion ...... 100 4.6 References: ...... 104 4.7 Tables and figures: ...... 112

5. Removing an obligate bacterial endosymbiont changes free amino acid levels in brown marmorated stink bug, Halyomorpha halys ...... 119 5.1 Abstract ...... 119 5.2 Introduction ...... 120 5.3 Materials and Methods ...... 123 5.4 Results ...... 125 5.5 Discussion ...... 128 5.6 References: ...... 134 5.7 Figures: ...... 143

6. Metatranscriptomic analysis reveals importance of host-symbiont association and their nutrient-provisioning role in brown marmorated stink bug, Halyomorpha halys ...... 148 6.1 Abstract ...... 148 6.2 Introduction ...... 149 6.3 Materials and methods ...... 152 6.4 Results ...... 155 6.5 Discussion ...... 158 6.6 References ...... 164 6.7 Tables and figures ...... 175

7. Summary and future work ...... 184 7.1 Summary and future work...... 184 7.2 References ...... 190

8. References ...... 192

x

List of Figures

Figure 1.1: Working model of brown marmorated stink bug with research questions including BMSB feeding preferences on soybean, role of BMSB tissues in metabolism of plant toxins. Which specific nutrients are supplemented by the P. carbekii and is BMSB- P. carbekii association important in providing these nutrients...... 7 Figure 2.1: Cages used for choice and no choice tests with soybean varieties. A) The bold line represents 4x6 feet cage with three high protein variety (H1, H2, H3) and three low protein variety (L1, L2, L3) soybean plants. B) The bold lines represent 2x4 feet cage with 3 high protein variety (H1, H2, H3) and 3 low protein variety (L1, L2, L3) soybean plants ...... 34

Figure 2.2: Rating the damage of tetrazolium stained soybean seeds. A scale of 0-10 was used, where 0 had no damage and 10 had the worst damage ...... 35

Figure 3.1: Heat map showing expression of 13 HhCYP6 genes in the guts of male and female adults fed on different hosts. Hosts studied include apple, corn, and soybean, starved being our control. The scale on the right indicates the intensity of expression (low to high). The genes used for our study, HhCYP6BQ27, HhCYP6BK13 and HhCYP6BK24, are highlighted with blue arrows ...... 79

Figure 3.2: Heat map showing expression of 13 HhCYP6 genes in the fat body of male and female adults fed on different hosts. Hosts studied include apple, corn, and soybean, starved being our control. The scale on the right indicates the intensity of expression (low to high) ...... 80

Figure 3.3: Heat map showing expression of 13 HhCYP6 genes in the Malpighian tubules of male and female adults fed on different hosts. Hosts studied include apple, corn, and soybean, starved being our control. The scale on the right indicates the intensity of expression (low to high) ...... 81

Figure 3.4: Melting curves from the qRT-PCR analysis of HhCYP6BQ27, HhCYP6BK24, HhCYP6BK13 and HhEF1α ...... 82-83

Figure 3.5: Multiple sequence alignment of H. halys HhCYP6BQ27, HhCYP6BK13 and HhCYP6BK24 protein sequences. Amino acid conservations are: “*” single, fully conserved residue; “:”conservation of strong groups; “.”conservation of weak groups; “no label” represents no consensus. Substrate recognition sites (SRS) (black colored box), heme-binding signature motif (PFxxGxxxCxG) (red box), helix C motif (WxxxR) (blue box), helix I-oxygen binding motif (A/GGxE/DTT/S) (purple box), helix K motif (ExLR) (green box), are highlighted in boxes ...... 84

xi

Figure 3.6: The mRNA expression of HhCYP6BQ27, HhCYP6BK13 and HhCYP6BK24 in male and female adults of H. halys fed on mixed diet. Bars represent the mean of three biological replicates with ± standard error. No significant differences were observed ...... 85

Figure 3.7: The relative mRNA expression of HhCYP6BQ27 (Fig. 3A), HhCYP6BK13 (Fig. 3B), HhCYP6BK24 (Fig. 3C), in gut, fat body and Malpighian tubules of male and female H. halys. Bars represent the mean of three biological replicates with ± standard error. Bars labeled with a different letter indicate significant difference ...... 86

Figure 3.8: The mRNA expression of HhCYP6BQ27, HhCYP6BK13 and HhCYP6BK24 in different tissues of male and female H. halys fed on different hosts. Bars represent the mean of three biological replicates with ± standard error. No significant differences were observed among the diets ...... 87

Figure 4.1: Double stranded RNA injection site (metathoracic region) in H. halys ....112

Figure 4.2: Effect of RNAi induced gene silencing on HhCAT expression in H. halys. Column graph showing the distribution of HhCAT expression (black bars) measured through the qRT-PCR analysis in insects injected with HhCAT dsRNA (dsCAT) in comparison with those injected with GFP dsRNA (grey bars) are shown. Following the dsRNA injections, the HhCAT expression levels were significantly different (P<0.05) compared to control at all three time points. Asterisk sign indicate significance ...... 113

Figure 4.3: Effect of RNAi induced gene silencing on HhvATP expression in H. halys. Column graph showing the distribution of HhvATP expression (black bars) measured through the qRT-PCR analysis in insects injected with HhvATP dsRNA (dsvATP) in comparison with those injected with GFP dsRNA (grey bars) are shown. Following the dsRNA injections, the HhvATP expression levels were significantly different (P<0.05) compared to control at all three time points. Asterisk sign indicate significance ...... 114

Figure 4.4: Effect of RNAi induced gene silencing on HhCPR expression in H. halys. Column graph showing the percent fold change of HhCPR expression (black bars) measured through the qRT-PCR analysis in insects injected with HhCPR dsRNA (dsCPR) in comparison with those injected with GFP dsRNA (grey bars) are shown. Following the dsRNA injections, the HhCPR expression levels were significantly different (P<0.05) compared to control at all three time points. Asterisk sign indicate significance ...... 115

Figure 4.5: Mortality and fecundity of H. halys recorded for ten days after the injections with dsCAT and dsvATP. A) Cumulative mortality in dsCAT and dsvATP injected insects compared to the control GFP. Following the dsRNA injections, the HhvATP cumulative mortality was significantly different (P<0.05) compared to control. Asterisk xii

sign indicate significance. B) Total number of eggs (fecundity) recorded in dsCAT and dsvATP injected insects compared to the control GFP ...... 116

Figure 4.6: Effect of RNAi nebulization induced gene silencing on HhCPR expression in H. halys. Column graph showing the percent fold change of HhCPR expression (black bars) measured through the qRT-PCR analysis in insects nebulized with HhCPR-siRNA in comparison with those nebulized with water (grey bars) are shown. Standard errors were not calculated as the data is from one replicate. A) Percent fold change of HhCPR- siRNA expression in the 3rd instar nymphs of H. halys. B) Percent fold change of HhCPR-siRNA expression in H. halys adults ...... 117

Figure 5.1: Agarose gel showing the symbiont clearance in the treated DNA samples of 2nd and 3rd instar nymphs. Tested with 16S universal bacterial (600bp) and P. carbekii specific (500bp) primers. Used 1kb DNA ladder. BMSB nymph with ‘+’ indicates the presence of P.carbekii and ‘-’ indicates absence of P.carbekii ...... 143

Figure 5.2: Box and whisker plot of the concentration (nmol/mg) of total free amino acids in symbiotic BMSB, aposymbiotic BMSB and green beans tissue. The horizontal line within the box indicates the median, boundaries of the box indicate the 25th- and 75th -percentile, and the whiskers indicate the highest and lowest values. Data points that fall outside the highest and lowest values (upper and lower quartiles) are plotted as open circles. The diamond symbol marked in the plot indicates the mean. Different letters over the bars indicate significant difference among treatments (p<0.05) ...... 144

Figure 5.3: The proportional composition of free amino acids based on the arcsine square root transformed values in A) symbiotic BMSB, B) aposymbiotic BMSB, and C) green bean ...... 145

Figure 5.4: Box and whisker plot of essential amino acids concentration (nmol/bug) in symbiotic and aposymbiotic BMSB. The horizontal line within the box indicates the median, boundaries of the box indicate the 25th- and 75th -percentile, and the whiskers indicate the highest and lowest values. Data points that fall outside the highest and lowest values (upper and lower quartiles) are plotted as open circles. The diamond symbol indicates the mean. Significant difference among treatments is indicated with an asterisk (p<0.05) ...... 146

Figure 5.5: Box and whisker plot of non-essential amino acids concentration (nmol/bug) in symbiotic and aposymbiotic BMSB. The horizontal line within the box indicates the median, boundaries of the box indicate the 25th- and 75th -percentile, and the whiskers indicate the highest and lowest values of the results. Data points that fall outside the highest and lowest values (upper and lower quartiles) are plotted as open circles. The diamond symbol indicates the mean. Significant difference among treatments is indicated with an asterisk (p<0.05) ...... 147 xiii

Figure 6.1: Total hits and top blast hits against non-redundant database. A) e-value distribution and C) Top-hit blast species distribution ...... 177

Figure 6.2: Top ten-gene ontology (GO) terms represented by the BMSB transcripts, categorized into the biological process, molecular function and cellular component ..178

Figure 6.3: Enzymes involved in the biosynthetic pathway of A) Oxaloacetate and B) Arginine amino acid. The enzymes in red color are encoded by host BMSB and in blue color are encoded by symbiont P. carbekii. The BMSB enzymes in red bold are differentially expressed in the DeSeq2 analysis ...... 181

Figure 6.4: Enzymes involved in the biosynthetic pathway of A) L-lysine from 2- oxoglutarate and B) L-lysine from L-aspartate. The enzymes in red color are encoded by host BMSB and in blue color are encoded by symbiont P. carbekii. The BMSB enzyme in red bold is differentially expressed in the DeSeq2 analysis ...... 182

Figure 6.5: Enzymes involved in the biosynthetic pathway of vitamin thiamine. The enzymes in red color are encoded by host BMSB and in blue color are encoded by symbiont P. carbekii. The BMSB enzymes in red bold are differentially expressed in the DeSeq2 analysis ...... 183

Figure 7.1: Working model of BMSB revealing answers to the research questions. BMSB has no feeding preferences and caused damage to both high and low protein soybean varieties. Cytochrome P450s present in the tissues of BMSB play an important role in detoxification and metabolism of plant toxins encountered in the plant diet. Endosymbiont, P. carbekii supplements nutrients potentially lacking in the diet of BMSB and the host symbiont association is required to synthesize these essential nutrients such as amino acids, lysine, arginine and vitamin-thiamine...... 189

xiv

List of Tables

Table 2.1: Composition of protein and oil content of different soybean PIs used in the study (data obtained from Dr. Rouf Mian) ...... 33

Table 2.2: Mean and SEM of total number of seeds produced per replicate in choice and no-choice tests ……………………...... 36-37

Table 2.3: Mean and SEM of percentage of seeds damaged in choice and no-choice tests ...... 38-39

Table 2.4: Mean and SEM of weight per seed (milligrams) in choice and no-choice tests. Significance is represented by alphabets. Means that do not share a letter are significantly different ...... 40-41

Table 2.5: Mean and SEM of weight per seed (milligrams) of healthy and damaged seeds. Significance is represented by alphabets. Means that do not share a letter are significantly different ...... 42-43

Table 2.6: Mean and SEM of severity and damage incidence in infested and un-infested cages of choice tests. Significance is represented by alphabets. Means that do not share a letter are significantly different ...... 44-45

Table 2.7: Mean and SEM of severity and damage incidence in infested and un-infested cages of no-choice tests. Significance is represented by alphabets. Means that do not share a letter are significantly different ...... 46-47

Table 3.1: Primer sequences of 13 HhCYP6 genes and housekeeping gene (elongation factor-1 α, EF1α) ...... 77

Table 3.2: Expression stability of HhEF1α across treatments. Standard deviation and P- value was calculated using non-parametric tests for HhEF1α gene across and within the treatments using the averaged Ct values generated from qRT-PCR ...... 78

Table 4.1: Primer sequences, annealing temperatures, size and efficiencies of transcripts HhCAT, HhvATPase, HhCPR, dsGFP (control) and HhEF1α (reference gene for qRT- PCR study) ...... 111

Table 6.1: Summary of sequencing statistics ...... 175

Table 6.2: Summary of de novo Trinity assembly: statistics and quality assessment ...176

Table 6.3: Specifically, enriched functions of 11 BMSB down regulated transcripts with xv p<0.001 (FDR p <0.05) ...... 179

Table 6.4: Functional annotation of P. carbekii transcripts against prokaryotic database in BlastKOALA ...... 180

xvi

CHAPTER 1

Introduction

1.1 Introduction

Phytophagous insects in the order of Hemiptera with piercing sucking mouthparts feed exclusively on plant sap. Most of the hemipterans are phytophagous insects and have a negative impact on agricultural economy. Of these, the most notable phytophagous pests include aphids, stink bugs, planthoppers, and psyllids, which cause substantial yield loss in crops such as corn and soybean. In the U. S., soybean (Glycine max) is a major agricultural crop. In 2017, the U.S. had the highest soybean production in the world with

4.39 billion bushels (https://www.nass.usda.gov). However, the increasing numbers of phytophagous insects causing significant damage and are a serious threat to several agricultural and natural systems (Clavero & Berthou, 2005; Olson, 2006). To control these pests farmers primarily rely on insecticides and, in the last decade, there has been a significant increase in targeted insecticide applications to manage pests including soybean aphids and stink bugs (Leskey et al. 2012; Ragsdale et al. 2011).

Stink bugs of Pentatomidae family (order Hemiptera) are important pests of soybean in various parts of the world (Panizzi and Slansky 1985; Erejomovich 1980;

Turnipseed and Kogan 1976). In North America, the common stink bug pests of soybean of substantial economic importance include the southern green stink bug, Nezara viridula L.; the green stink bug, Chinavia hilaris Say; the brown stink bug, Euschistus servus Say; and the brown marmorated stink bug, Halyomorpha halys (Stål) (McPherson et al. 1993; Rice et al. 2014). The extent of damage caused by stink bugs depends on the

1

population level and the growth stage of plants. In soybean fields, full pod to fully

developed seed (R4-R6) plant growth stages are most susceptible to stink bug damage

(Rice et al. 2014). Of all stink bugs, H. halys (BMSB-brown marmorated stink bug) is a notorious polyphagous pest that causes severe feeding damage to more than 100 plant species including ornamentals and agricultural commodities. BMSB is native to Eastern

Asia and was first detected in the United States near Allentown, Pennsylvania in 1996

(Hoebeke and Carter 2003). BMSB has three developmental stages; egg, nymph (five nymphal instar stages) and adult. Females lay as many as 400 eggs in a lifetime. First instar nymphs emerge from the eggs four to five days after oviposition. First instar nymphs are solitary feeders and mostly feed on the egg casing. Each nymphal instar stage lasts approximately one week, depending upon temperature. BMSB adults are sexually mature for two weeks after their emergence and are very active and drop from plants or fly when disturbed (Hoebeke and Carter 2003).

Feeding damage caused by BMSB to agricultural commodities result in large

economic losses. BMSB causes injury to reproductive tissues of soybean resulting in a

significant yield loss (Joseph et al. 2014; Owens et al. 2013) and do show some preferences for certain varieties (De et al. 2013; La Mantia et al. 2018). Chapter 2 of this dissertation focused on the feeding preferences of BMSB and the extent of damage caused to different soybeans, including high and low protein PIs. I performed choice and no choice tests in the field and hypothesized that BMSB may have a preference for higher protein content and cause more damage to these PIs compared to the low protein PIs.

As a generalist herbivore, BMSB might have well-developed detoxification mechanisms

to overcome the plant defenses and thus have a wide host range. Cytochrome P450

2

monoxygenases (P450s) are well known for detoxification and metabolism of plant

secondary metabolites encountered in the diet of many generalist insects (Feyereisen

2015, 2006, 1999; Guengerich 2001; Scott and Wen 2001). Generalist herbivores have

significantly higher number of P450s compared to a specialist, and is thought to be

advantageous for overcoming diverse host challenges (Mao et al. 2007). BMSB has over

163 total P450s, and P450s belonging to the CYP6 (HhCYP6) sub-family are known for

detoxification of plant-allelochemicals. There is lack of knowledge on the gene

expression of HhCYP6 members and their potential role in BMSB adaptation at the

physiological level. Physiological processes of insects are often specialized based on the

biology and anatomy of the insect. Sexes, diet exposure and tissues have different

demands, which often leads to differential expression of P450s, especially CYP6s. In

Chapter 3, I characterized and analyzed the tissue, sex and diet-specific expression of

three HhCYP6 genes. This fundamental study advanced our understanding of detoxification enzymes in BMSB and provided a baseline for functional studies. This work was submitted to the journal Insects.

In Chapter 4, I used RNA interference (RNAi) as a functional tool to study the role of specific genes including NADPH-dependent cytochrome P450 reductase

(HhCPR), catalase (HhCAT) and vacuolar-type ATPase subunit-a (HhvATP). Catalase is an important antioxidant enzyme that protects against oxidative stress by converting hydrogen peroxide to water and oxygen (Ahmad 1992). Vacuolar-type ATPase enzyme is known to hydrolyze ATP, maintain membrane ion balance and help in uptake of nutrients

(Jefferies et al. 2008; Wieczorek et al. 2000). NADPH-dependent cytochrome P450 reductase is required by all living organisms as it catalyzes many biological reactions and

3

provides electrons for P450s and other oxygenases present in the endoplasmic reticulum

(Nishino and Ishibashi 2000; Feyereisen 1999). I targeted these candidate genes in

BMSB as they are known to play vital role and are effective RNAi targets in several other

insects (Albiter et al. 2011; Baum et al. 2007; Yao et al. 2013; Zhao et al. 2013; Zhu et al.

2012). This study has established a standard method of dsRNA delivery via injection in

BMSB, which helps in documenting essential functions of important candidate genes.

Part of this work was published in PLoS One journal (Bansal et al. 2016).

Most insects improve their fitness through cooperation with bacterial symbionts.

Bacterial symbionts can be either obligatory or facultative in their association with the

host. Facultative symbionts are not essential for host survival and are not found in all

individuals of host populations. Alternatively, obligate symbionts are essential for the

host’s survival and often provide nutrients that are lacking or in suboptimal levels in an

insect’s diet. This symbiosis allows the insect to feed on a wider range of nutritionally

diverse hosts (Akman et al. 2002, Bansal et al. 2014, Douglas 2014, Bennett and Moran

2015, Skidmore & Hansen, 2017). Obligate symbionts are known to increase the fitness

of the host, facilitating adaptation and persistence in the environment. Many studies on

Hemipteran insects have used in vitro sterilization techniques to prevent the nymphs from

acquiring the symbionts in order to study the effects of symbiont removal (Fukatsu &

Hosokawa, 2002; Kikuchi et al. 2007; Prado et al. 2006). Experimental removal of symbionts resulted in reduced fitness and development, higher mortality in several hemipteran hosts including plataspid stink bug (Fukatsu and Hosokawa 2002) and other pentatomid species such as stink bugs (Abe et al. 1995, Kikuchi et al. 2007, Prado and

Almeida 2009, Taylor et al. 2014).

4

BMSB harbors an obligate bacterial symbiont, Candidatus Pantoea carbekii (P. carbekii) (Bansal et al. 2014) which is hypothesized to provide essential nutrients and vitamins (Kenyon et al. 2015). The P. carbekii genome encodes biosynthetic pathways for the production of several amino acids (phenylalanine, tryptophan, methionine, lysine, threonine and histidine), vitamins/co-factors (folate, riboflavin, pyridoxal-5’phosphate)

(Kenyon et al. 2015). Based on the genome of P. carbekii, this symbiont likely provides

BMSB with these important nutrients and amino acids. To test these hypotheses, I investigated the importance of BMSB- P. carbekii association and the nutrient- provisioning role in Chapters 5 and 6. I hypothesized that BMSB-P. carbekii closely cooperates in the synthesis and metabolism of nutrients that are lacking in BMSB’s diet.

Chapter 5 specifically determined the impact of P. carbekii on free amino acid levels in

BMSB, comparing levels in 3rd instar nymphs with (symbiotic) and without

(aposymbiotic) P. carbekii. I predicted that, upon removing P. carbekii from BMSB, the levels of free amino acids would be lowered. In Chapter 6, to further understand the molecular and physiological collaborations of BMSB and P. carbekii, I developed a metatranscriptome for the first time in Hemiptera. I hypothesized that BMSB-P. carbekii closely cooperate in synthesis and metabolism of nutrients that are lacking in BMSB’s diet. I predicted that genes involved in the production of amino acids or vitamins to be downregulated in aposymbiotic BMSB and how these results could potentially be exploited in developing novel pest management strategies. The working model shown in

Figure 1.1 presents all the research questions of my dissertation, including BMSB feeding preferences on soybean, role of BMSB tissues in metabolism of plant toxins. Which specific nutrients are supplemented by the P. carbekii and is BMSB- P. carbekii

5 association important in providing these specific nutrients. In summary, my research revealed the feeding damage caused by BMSB, role of detoxification enzymes and physiology and nutrient-provisioning role of BMSB-P. carbekii association.

6

Figure 1.1: Working model of brown marmorated stink bug with research questions including BMSB feeding preferences on soybean, role of BMSB tissues in metabolism of plant toxins. Which specific nutrients are supplemented by the P. carbekii and is BMSB-

P. carbekii association important in providing these nutrients.

7

1.2 References

Abe, Yoshihiko, Koji Mishiro, and Masaaki Takanashi. 1995. “Symbiont of Brown-

Winged Green Bug, Plautia Stali Scott.” Japanese Journal of Applied Entomology

and Zoology 39 (2): 109–15. https://doi.org/10.1303/jjaez.39.109.

Ahmad, Sami. 1992. “Biochemical Defence of Pro-Oxidant Plant Allelochemicals by

Herbivorous Insects.” Biochemical Systematics and Ecology 20 (4): 269–96.

Akman, Leyla, Atsushi Yamashita, Hidemi Watanabe, Kenshiro Oshima, Tadayoshi

Shiba, Masahira Hattori, and Serap Aksoy. 2002. “Genome Sequence of the

Endocellular Obligate Symbiont of Tsetse Flies, Wigglesworthia Glossinidia.”

Nature Genetics 32 (3): 402–7. https://doi.org/10.1038/ng986.

Bansal, Raman, Andrew P Michel, and Zakee L Sabree. 2014. “The Crypt-Dwelling

Primary Bacterial Symbiont of the Polyphagous Pentatomid Pest Halyomorpha

Halys (Hemiptera: Pentatomidae).” Environmental Entomology 43 (3): 617–25.

http://ee.oxfordjournals.org/content/43/3/617.abstract.

Bansal, Raman, Priyanka Mittapelly, Yuting Chen, Praveen Mamidala, Chaoyang Zhao,

and Andy Michel. 2016. “Quantitative RT-PCR Gene Evaluation and RNA

Interference in the Brown Marmorated Stink Bug.” Plos One 11 (5): e0152730.

https://doi.org/10.1371/journal.pone.0152730.

Bennett, Gordon M., and Nancy A. Moran. 2015. “Heritable Symbiosis: The Advantages

and Perils of an Evolutionary Rabbit Hole.” Proceedings of the National Academy of

Sciences 112 (33): 10169–76. https://doi.org/10.1073/pnas.1421388112.

8

Clavero, Miguel, and Emili García-Berthou. 2005. “Invasive Species Are a Leading

Cause of Animal Extinctions.” Trends in Ecology & Evolution 20 (3): 110.

https://doi.org/10.1016/j.tree.2005.01.003.

De, Efrain, Santana Souza, Edson Luiz, Lopes Baldin, José Paulo, Gonçalves Franco Da

Silva, and André Luiz Lourenção. 2013. “Feeding Preference of Nezara Viridula

(Hemiptera: Pentatomidae) and Attractiveness of Soybean Genotypes.” Chilean

Journal of Agricultural Research 73 (4). https://doi.org/10.4067/S0718-

58392013000400004.

Diaz-Albiter, Hector, Roanna Mitford, Fernando A. Genta, Mauricio R. V. Sant’Anna,

and Rod J. Dillon. 2011. “Reactive Oxygen Species Scavenging by Catalase Is

Important for Female Lutzomyia Longipalpis Fecundity and Mortality.” PLoS ONE

6 (3): e17486. https://doi.org/10.1371/journal.pone.0017486.

Douglas, Angela E. 2014. “Molecular Dissection of Nutrient Exchange at the Insect-

Microbial Interface.” Current Opinion in Insect Science 4 (October): 23–28.

https://doi.org/10.1016/j.cois.2014.08.007.

Erejomovich, J A. 1980. “El Vaneo De Frutos; Como Limitante Para El Cultivo De La

Soja.” Rev. Facultad de Agronomía. Vol. 1.

http://sedici.unlp.edu.ar/bitstream/handle/10915/29258/Documento_completo.pdf?se

quence=1.

Feyereisen, René. 1999. “Insect P450 Enzymes.” Annual Review of Entomology 44: 507–

33.

9

Feyereisen, René. 2006. “Evolution of Insect P450” 34: 1252–55.

Feyereisen, René. 2015. “Insect P450 Inhibitors and Insecticides: Challenges and

Opportunities.” Pest Management Science 71 (6): 793–800.

https://doi.org/10.1002/ps.3895.

Fukatsu, Takema, and Takahiro Hosokawa. 2002. “Capsule-Transmitted Gut Symbiotic

Bacterium of the Japanese Common Plataspid Stinkbug, Megacopta Punctatissima.”

Applied and Environmental Microbiology 68 (1): 389–96.

https://doi.org/10.1128/AEM.68.1.389-396.2002.

Guengerich, F P. 2001. “Common and Uncommon Cytochrome P450 Reactions Related

to Metabolism and Chemical Toxicity.” Chemical Research in Toxicology 14 (6):

611–50. http://www.ncbi.nlm.nih.gov/pubmed/11409933.

Hoebeke, E. R., and M. E. Carter. 2003. “Halyomorpha Halys (Stål) (Heteroptera:

Pentatomidae): A Polyphagous Plant Pest from Asia Newly Detected in North

America.” Proceedings of the Entomological Society of Washington 105 (1): 225–

37.

JA, Baum, T Bogaert, W Clinton, Heck GR, P Feldmann, O Ilagan, S Johnson, et al.

2007. “Control of Coleopteran Insect Pests through RNA Interference.” Nature

Biotechnology 25 (11): 1322–26.

Jefferies, Kevin C., Daniel J. Cipriano, and Michael Forgac. 2008. “Function, Structure

and Regulation of the Vacuolar (H+)-ATPases.” Archives of Biochemistry and

Biophysics 476 (1): 33–42. https://doi.org/10.1016/j.abb.2008.03.025.

10

Joseph, Shimat V, Jonathan W Stallings, Tracy C Leskey, Greg Krawczyk, Dean Polk,

Bryan Butler, and J Christopher Bergh. 2014. “Spatial Distribution of Brown

Marmorated Stink Bug (Hemiptera: Pentatomidae) Injury at Harvest in Mid-Atlantic

Apple Orchards.” Journal of Economic Entomology 107 (5): 1839–48.

https://doi.org/10.1603/EC14154.

Kenyon, Laura J, Tea Meulia, and Zakee Sabree. 2015. “Habitat Visualization and

Genomic Analysis of ‘Candidatus Pantoea Carbekii,’ the Primary Symbiont of the

Brown Marmorated Stink Bug.” Genome Biology and Evolution 7 (2): 620–35.

Kikuchi, Y., T. Hosokawa, and T. Fukatsu. 2007. “Insect-Microbe Mutualism without

Vertical Transmission: A Stinkbug Acquires a Beneficial Gut Symbiont from the

Environment Every Generation.” Applied and Environmental Microbiology 73 (13):

4308–16. https://doi.org/10.1128/AEM.00067-07.

Leskey, Tracy C., Brent D. Short, Bryan R. Butler, and Starker E. Wright. 2012. “Impact

of the Invasive Brown Marmorated Stink Bug, Halyomorpha Halys (Stål), in Mid-

Atlantic Tree Fruit Orchards in the United States: Case Studies of Commercial

Management.” Psyche: A Journal of Entomology 2012 (July): 1–14.

https://doi.org/10.1155/2012/535062.

Mantia, Jonathan M La, M A Rouf Mian, and Margaret G Redinbaugh. 2018.

“Identification of Soybean Host Plant Resistance to Brown Marmorated Stink Bugs

in Maturity Group III Plant Introductions.” Journal of Economic Entomology 111

(1): 428–34. https://doi.org/10.1093/jee/tox295.

Mao, W, M A Schuler, and M R Berenbaum. 2007. “Cytochrome P450s in Papilio

11

Multicaudatus and the Transition from Oligophagy to Polyphagy in the

Papilionidae.” Insect Molecular Biology 16 (4): 481–90.

https://doi.org/10.1111/j.1365-2583.2007.00741.x.

McPherson, R. M., G. K. Douce, and R. D. Hudson. 1993. “Annual Variation in Stink

Bug (Heteroptera: Pentatomidae) Seasonal Abundance and Species Composition in

Georgia Soybean and Its Impact on Yield and Quality.” Journal of Entomological

Science 28 (1): 61–72. https://doi.org/10.18474/0749-8004-28.1.61.

Nishino, Hideaki, and Teruo Ishibashi. 2000. “Evidence for Requirement of NADPH-

Cytochrome P450 Oxidoreductase in the Microsomal NADPH-Sterol Δ7-Reductase

System.” Archives of Biochemistry and Biophysics 374 (2): 293–98.

https://doi.org/10.1006/abbi.1999.1602.

Olson, Lars J. 2006. “The Economics of Terrestrial Invasive Species: A Review of the

Literature.” Agricultural and Resource Economics Review. Vol. 35.

http://entnemdept.ufl.edu/Hodges/als4161/Secure/PDF

Files/Articles/Olson2006.pdf.

Owens, D R, Jr. Herbert D. A., G P Dively, D D Reisig, and T P Kuhar. 2013. “Does

Feeding by Halyomorpha Halys (Hemiptera: Pentatomidae) Reduce Soybean Seed

Quality and Yield?” Ecen Journal of Economic Entomology 106 (3): 1317–23.

Panizzi, A. R., and F. Slansky. 1985. “Review of Phytophagous Pentatomids (Hemiptera:

Pentatomidae) Associated with Soybean in the Americas.” The Florida

Entomologist 68 (1): 184. https://doi.org/10.2307/3494344.

12

Prado, Simone S., and Rodrigo P. P. Almeida. 2009. “Role of Symbiotic Gut Bacteria in

the Development of Acrosternum Hilare and Murgantia Histrionica.” Entomologia

Experimentalis et Applicata 132 (1): 21–29. https://doi.org/10.1111/j.1570-

7458.2009.00863.x.

Prado, Simone S., Daniel Rubinoff, and Rodrigo P. P. Almeida. 2006. “Vertical

Transmission of a Pentatomid Caeca-Associated Symbiont.” Annals of the

Entomological Society of America 99 (3): 577–85. https://doi.org/10.1603/0013-

8746(2006)99[577:vtoapc]2.0.co;2.

Ragsdale, David W., Douglas A. Landis, Jacques Brodeur, George E. Heimpel, and

Nicolas Desneux. 2011. “Ecology and Management of the Soybean Aphid in North

America.” Annual Review of Entomology 56 (1): 375–99.

https://doi.org/10.1146/annurev-ento-120709-144755.

Rice, Kevin B, Chris J Bergh, Erik J Bergmann, Dave J Biddinger, Christine Dieckhoff,

Galen Dively, Tara Gariepy, et al. 2014. “Biology , Ecology , and Management of

Brown Marmorated Stink Bug (Hemiptera : Pentatomidae)” 5 (3): 1–13.

Scott, J G, and Z Wen. 2001. “Cytochromes P450 of Insects: The Tip of the Iceberg.”

Pest Management Science 57 (10): 958–67. https://doi.org/10.1002/ps.354.

Taylor, Christopher M., Peter L. Coffey, Bridget D. DeLay, and Galen P. Dively. 2014.

“The Importance of Gut Symbionts in the Development of the Brown Marmorated

Stink Bug, Halyomorpha Halys (Stål).” PLoS ONE 9 (3): e90312.

https://doi.org/10.1371/journal.pone.0090312.

13

Turnipseed, S G, and M Kogan. 1976. “Soybean Entomology.” Annual Review of

Entomology 21 (1): 247–82. https://doi.org/10.1146/annurev.en.21.010176.001335.

Wieczorek, H, G Grber, W R Harvey, M Huss, H Merzendorfer, and W Zeiske. 2000.

“Structure and Regulation of Insect Plasma Membrane H(+)V-ATPase.” The

Journal of Experimental Biology 203 (Pt 1): 127–35.

http://www.ncbi.nlm.nih.gov/pubmed/10600681.

Yao, J, D Rotenberg, A Afsharifar, K Barandoc-Alviar, and Whitfield AE. 2013.

“Development of RNAi Methods for Peregrinus Maidis, the Corn Planthopper.”

PloS One 8 (8).

Zhao, Haiming, Xin Yi, Zhen Hu, Meiying Hu, Shaohua Chen, Rizwan-ul-Haq

Muhammad, Xiaolin Dong, and Liang Gong. 2013. “RNAi-Mediated Knockdown of

Catalase Causes Cell Cycle Arrest in SL-1 Cells and Results in Low Survival Rate

of Spodoptera Litura (Fabricius).” PLoS ONE 8 (3): e59527.

https://doi.org/10.1371/journal.pone.0059527.

Zhu, Fang, Sarah Sams, Tim Moural, Kenneth F. Haynes, Michael F. Potter, and Subba

R. Palli. 2012. “RNA Interference of NADPH-Cytochrome P450 Reductase Results

in Reduced Insecticide Resistance in the Bed Bug, Cimex Lectularius.” PLoS ONE 7

(2): e31037. https://doi.org/10.1371/journal.pone.0031037.

14

CHAPTER 2

Feeding preferences of brown marmorated stink bug, Halyomorpha halys on high

and low protein varieties of soybean (Glycine max)

2.1 Abstract

Soybean, Glycine max, is one of the most widely produced crops in the United

States. Since 2000, there has been a significant increase of insecticide use to control

various soybean pests, including Halyomorpha halys (brown marmorated stink bug-

BMSB). This stink bug is an invasive, polyphagous pest that feeds on more than 170

plant species, causing severe feeding damage to important agricultural commodities

in addition to soybean (e.g. corn, apples, and other fruits). BMSB was first detected in

North America in 1996 and is currently found in 44 states, resulting in substantial

economic losses. Farmers rely primarily on the application of broad-spectrum

insecticides to manage BMSB populations; however, excess use of insecticides will

negatively impact beneficial insects, increase secondary pest outbreaks and facilitate

insecticide resistance. The objective of this study was to measure the feeding

preferences of BMSB and the extent of damage caused to different high and low

protein soybean varieties using choice and no-choice tests. Our results showed that

BMSB causes significant feeding damage among all soybean varieties without any

evidence of feeding preferences. BMSB infestation also had a significant negative

impact on the seed weight and damage incidence. Intensified scouting during R4-R6

growth stages and application of insecticide to the field edges at the right time can be

15

effective in managing BMSB populations. Results of this study on assessing the

BMSB damage caused to soybean varieties will potentially be important in

developing efficient integrated pest management strategies.

2.2 Introduction

In the United States, soybean (Glycine max) is a major agricultural crop. In 2017,

U.S. had the highest soybean production in the world with 4.39 billion bushels

(https://www.nass.usda.gov). However, there has been a dramatic increase in the number of insect species attacking soybean as well as the damage that they cause. For the most part, these insects are invasive, which are a serious threat to several agricultural and natural systems (Olson 2006; Clavero and García-Berthou 2005). The most common invasive pests of soybean include soybean aphids and stink bugs which cause substantial economic losses and increase the reliance on insecticides

(Kamminga et al. 2012; Leskey et al. 2012; Kim et al. 2008). In the last decade, there has been a significant increase in targeted insecticide applications to manage soybean aphid and stink bug infestations (Ragsdale et al. 2011; Leskey et al. 2012).

Stink bugs belong to the Pentatomidae family (order Hemiptera) and are

important pests of soybean in various parts of the world (Panizzi and Slansky 1985;

Erejomovich 1980; Turnipseed and Kogan 1976). In North America, the common

stink bug pests of soybean of substantial economic importance include the southern

green stink bug, Nezara viridula L.; the green stink bug, Chinavia hilaris Say; the

brown stink bug, Euschistus servus Say; and the brown marmorated stink bug,

16

Halyomorpha halys (Stål) (McPherson et al. 1993; Rice et al. 2014). Several studies have shown that stink bug feeding has a negative impact on soybean yield, quality and germination potential (Koch et al. 2017; La Mantia et al. 2018; Lee et al. 2013;

Panizzi & Slansky, 1985; Rice et al. 2014; Silva et al. 2012; Vyavhare et al. 2015). In addition, while feeding on developing seed, stink bugs are also known to transmit yeast, Eremothecium coryli, causing yeast spot disease (Miyao et al. 2000). The extent of damage caused by stink bugs depends on the population level and the growth stage of plants. In soybean fields, full pod to fully developed seed (R4-R6) plant growth stages are most susceptible to stink bug damage (Rice et al. 2014).

Soybean pods infested by several stink bug species usually develop necrotic spots and the seeds have a chalky appearance resulting in seed abortion, or can be darkened and shriveled (McPherson et al. 2000, Miner 1961).

Halyomorpha halys (BMSB-brown marmorated stink bug) is a notoroius polyphagous pest that causes severe feeding damage to more than 100 plant species including ornamentals and important agricultural crops such as soybean and corn

(http://www.stopbmsb.org). BMSB is native to Eastern Asia and was first detected in the United States near Allentown, Pennsylvania in 1996 (Hoebeke and Carter 2003).

Feeding damage caused by BMSB to agricultural commodities result in large economic losses. In 2010, apple production in the mid-Atlantic region had an estimated loss of $37 million due to feeding damage caused by BMSB (Joseph et al.

2014). Farmers have limited options to control BMSB except for insecticides (Owens et al. 2013). Excessive use of broad-spectrum insecticides to control BMSB will negatively affect the populations of beneficial insects and potentially increase

17

secondary pest outbreaks. With these consequential impacts, controlling BMSB has

become a major challenge, yet some management options are available. For example,

BMSB populations in soybean fields are more abundant in the edges of the field and

therefore can be effectively managed by single field edge-only insecticide treatment

(Cissel et al. 2015, Aigner et al. 2017). This strategy not only reduces the amount of insecticides used but also reduces the damage caused to natural enemies. This strategy was also effective in controlling BMSB in the peaches of mid-Atlantic USA

(Blaauw et al. 2015).

There are several varieties of soybean grown worldwide and is a dietary staple for human and animal feed. Soybean is an important source of protein and vegetable oil and is used in a variety of high protein processed foods like, cheese, yogurt and soymilk. Soybean oil is used in producing vegetable oil and also has industrial applications in making soaps, plastic, paints and cosmetics (Raza et al. 2017).

Depending on two abiotic factors, temperature and photoperiod for flowering, soybeans are divided into different maturity groups (Cober and Voldeng 2001;

Summerfield et al. 1998; Wilkerson et al. 1989) and selective breeding produces different soybean varieties or cultivars. Plants differ in the protein, carbohydrate and oil content which have an impact on insect herbivory (Clissold et al. 2006) Stink bugs cause significant feeding damage to these soybean varieties (McPherson et al. 2008;

Rao et al. 2002) and prefer one soybean variety over the other (La Mantia et al. 2018;

De et al. 2013). Although, previous studies on stink bug preference is attributed to resistance (La Mantia et al. 2018; De et al. 2013), it may also depend on the nutrient composition of the soybeans. A study have shown that insect’s behavior is affected by

18 the chemical composition of the plants especially nutrients including nitrogen, amino acids, semio-chemicals, etc (Fischer and Fiedler 2000). Nitrogen is abundant in plants, but is a major limiting factor in insects and is required to synthesize proteins

(Sterner and Elser 2002; Lu et al. 2004). Hence, insects might potentially prefer plants with high protein compared to other nutrients.

In this study, using choice and no-choice tests, we measured the feeding preferences of BMSB and the extent of damage caused to different soybean plant introductions (PIs, introduced from other countries) including high and low protein soybean varieties in a multi-year field study. We used six soybean PIs belonging to maturity group III: HR12 2539, HR12 2544 and HR12 2548 are high protein-content

PIs and HR12 2550, HR12 2570 and HR12 2586 are low protein/high oil PIs. We recorded the total number of seeds (yield), percent of seeds damaged, weight per seed, severity and incidence of damage. We hypothesized that BMSB may have a preference for higher protein content and cause more damage to these PIs compared to the low protein PIs. Indeed, BMSB caused severe feeding damage all soybean PIs in choice and no choice tests and had a significant negative impact on the seed weight and damage incidence, but we did not observe evidence of a feeding preference among our PIs. To reduce the population of BMSB and the damage caused to the soybeans, intensified scouting during R4-R6 stages can help in early detection of

BMSB. Results from this study provide insights on BMSB feeding preferences and extent of damage caused to different soybean PIs among choice and no-choice tests.

19

2.3 Materials and Methods

Insects:

A laboratory colony of BMSB was established in 2012 with nymphs and adults

collected from a soybean field in Wooster, Ohio (GPS: 40.764, -81.910) and

supplemented every summer from various locations around Wooster. Colonies are

maintained in a walk-in growth chamber with 16:8 (light:dark) photoperiod, 28±2°C

temperature and 60-70% relative humidity. The insects had access to a varied diet

including different fruits and vegetables (soybeans, corncobs, green beans, celery,

carrots, apples and grapes). For this study, male and female adults were collected

from the adult cages in the laboratory colony and used for choice and no-choice tests in the field.

Soybean plants:

Six PIs of soybean (Table 2.1) consisting of three high protein and three low protein varieties belonging to maturity group III used in this study were obtained from USDA soybean germplasm collection in Urbana-Champaign, IL. These six PIs were planted in a randomized complete block design in a field (30x60 feet) at the

Ohio Agricultural Research and Development Center (OARDC) in Wooster, OH

(GPS: 40.782, -81.927). The experimental plots were planted on May 29th, 2015; June

1st, 2016 and June 21st, 2017. Plants were grown in 6 rows, with each row including 3

high protein varieties or 3 low protein varieties. Within each row we had 10 replicates

of each variety. The plants within the rows were spaced 30.25 cm with 152.4 cm

between the rows. Plant growth was observed weekly from vegetative to reproductive

stages using the soybean development guide (Fehr and Caviness 1977).

20

Choice test:

To avoid damage caused by other pests and animals, the plants were caged at R1

(beginning flower) stage. For the choice test, we made 4x6 feet cages using pvc pipes,

covered with a 0.49 mm size mesh (Redwood Empire Awning Co., Santa Rosa, CA).

We used a total 10 cages each year (from 2015 to 2017) for choice test, each cage

included three high protein variety and three low protein variety soybean plants

(Figure 2.1A). Each year, a total of 60 plants including all six PIs were used for

choice tests. When the plants reached R4 – R5 stage, we infested five cages each with

six male and six female BMSB adults. The remaining five cages remained un-infested as a control treatment.

No-choice test:

Similar to the choice test, the plants were caged at the R1 stage. The no-choice cages were smaller (2x4 feet), but made of the same materials as the choice test cages. In each year, we used a total of 20 cages for no-choice test. The high and low protein varieties were caged separately and each cage either included three high protein varieties or three low protein variety PIs (Figure 2.1B). A total of 60 plants including all six PIs were used each year for no-choice tests. When the plants reached the R4 – R5 stage, ten cages were infested with 3 male and 3 female BMSB adults, whereas the remaining ten cages remained un-infested as our control treatment.

Sample collection and damage assessment of soybean seeds:

Thirty days after infestation, BMSB were removed from the infested cages. At the

R8 stage, the pods were hand harvested and hand threshed. Seeds collected from both the infested and control cages were visually rated as healthy, damaged (any visible

21 discoloration or wrinkling) or flat (i.e. aborted seed). Healthy and damaged seed (per

PI) were massed separately. The total number of seeds, total seed weight and weight per seed (milligrams) was calculated for each category. The weight per seed was calculated by dividing total number of seeds by total seed weight. The feeding preference in choice and no-choice tests was measured by subtracting the total weight of damaged seeds from expected weight of damaged seeds. Damage incidence was also calculated using the mean score of all the seeds within each plot. To assess the severity of seed damage, we used a staining solution called tetrazolium (Franca et al.

1998). Tetrazolium can differentiate living/metabolically active tissue by reducing to red 1,3,5-triphenyformazan and remains unreacted or white in the necrotic areas where the tissue is metabolically inactive. The seeds presoaked in water are treated with a solution of 0.075% tetrazolium chloride for at least three hours at 35-40oC.

Later, the seed coat is removed and based on the discolorations on the seed, feeding damage caused by stink bugs is assessed. A scale of 0-10 was used, where 0 scale had no damage, 1-5 scale had 50% surface damage and a scale of 10 had completely damaged, flat and unstained seeds (Figure 2.2).

Statistical analysis:

In choice and no-choice tests, mean differences for yield, percent of seeds damaged, weight per seed, severity and damage incidence were compared using

ANOVA, general linear mixed model and Tukey’s tests in Minitab 18. Missing replicates were removed from the analysis. The data used for ANOVA was tested for normality (Anderson-Darling test) and homogeneity of variance (Levene’s test) and were transformed using square root of the mean, if normality was violated. The

22

differences between and among the treatments were considered statistically

significant at P<0.05.

2.4 Results

We hypothesized to observe feeding preferences and significant damage might be caused to high protein PIs compared to the low protein PIs. We recorded the total number of seeds (yield), percent of seeds damaged, weight per seed, severity and incidence of damage each year (2015, 2016 and 2017). As there was a significant difference among the three years, the data for all the years were analyzed separately for each measurement.

Total yield and percent of seeds damaged in choice and no-choice tests:

In both choice and no-choice tests, total number of seeds produced from the six soybean PIs of infested and un-infested cages were calculated and analyzed for all the years respectively. From this total, we calculated the percentage of damaged seeds among the soybean PIs. No significant differences were observed in either the total number of seeds (Table 2.2) or percentage of seeds damaged (Table 2.3) in choice and no-choice tests (P>0.05). However, we observed significant differences in overall seed production among the three years. Compared to the year 2015, the seed production had drastically reduced in 2017 followed by 2016.

Analysis of seed weight in choice and no-choice tests:

Weight per seed was calculated from the total seeds produced from soybean PIs in infested and un-infested cages in choice and no-choice tests respectively for three years (Table 2.4). No significant differences were observed in choice and no-choice

23

tests for all years except for year 2016. In the 2016 choice test, the high 1-HR12 2539

had more mass per seed (16.02 milligrams) than the low 2-HR12 2570 (7.99

milligrams, F= 2.62; df=5; P=0.036) in infested cages. In 2016 no-choice tests, infested cages had significantly higher weight per seed compared to un-infested (F=

9.42; df=1; P=0.004) in all varieties. Among infested soybean PIs, low 3-HR12 2586, had significantly higher weight per seed (22.56 milligrams) than low 2- HR12 2570

(11.23 milligrams, F= 3.00; df=5; P=0.020). Similar differences of these PIs were also observed in infested and un-infested cages (F= 2.42; df=5; P=0.049).

We also compared seed mass between healthy and damaged seeds among all soybean PIs in choice and no-choice tests (Table 2.5). Not surprisingly, the mass of healthy seed was significantly higher than damaged seeds in the choice tests of years

2015 (F= 14.19; df=1; P<0.001), 2016 (F= 57.27; df=1; P<0.001), and no-choice test of 2017 (F= 6.15; df=1; P=0.017). In 2016 choice test, we found weight per seed was significantly higher in low 2- HR12 2570 PI (147.45 milligrams) while, high 1-HR12

2539 had the least weight per seed (105.40 milligrams, F= 3.24; df=5; P=0.014).

Assessment of severity and damage incidence in choice and no-choice tests:

Severity of damage and damage incidence was measured by tetrazolium staining with a scale (0-10 worst) in choice (Table 2.6) and no-choice tests (Table 2.7) of all

PIs in infested and un-infested cages. Among choice tests, only the year 2015 showed significantly higher differences in severity (F= 4.92; df=1; P=0.031) and incidence

(F= 9.33; df=1; P=0.004), compared to the un-infested cages. For no-choice tests, we saw significantly higher damage in infested compared to un-infested cages in all three years (2015, F= 9.23; df=1; P=0.004; 2016, F= 26.02; df=1; P<0.001; 2017, F=

24

32.23; df=1; P<0.001); however severity was significantly higher in 2016 (F= 29.08; df=1) and 2017 (F= 9.16; df=1, P<0.004). We did not find any differences among the soybean PIs except in 2015 no choice test, where low 1-HR12 2550 had higher damage incidence while high 2-HR12 2544 had the least (F= 2.79; df=5; P=0.027).

2.5 Discussion

Studies have shown that BMSB causes injury to soybean reproductive tissues resulting in a significant yield loss (Joseph et al. 2014; Owens et al. 2013). The soybean reproductive stages of R3-R5 are more vulnerable to stink bug damage and pods fed by stink bugs, including BMSB, develop necrotic spots and eventually dry

(McPherson 2000). In our study, BMSB fed and heavily damaged all of our different soybean PIs in choice and no choice tests, increasing damage incidence and decreasing seed weight. Results from this study will provide insights on BMSB feeding preferences and the extent of damage caused to different soybean PIs among choice and no-choice tests.

We did not find evidence of preference by BMSB, rather all soybean PIs in this study appeared to be equally attractive despite differences in protein composition.

The PIs used in this study belong to same maturity group (III) and may have a similar plant profile of volatiles, or, at least do not appear to have any repellency. Olfactory cues are important for insects to locate its host plants and the cues produced by the

PIs might not be significantly difference as they belong to same maturity group.

Soybeans PIs of maturity III also have similar yield potential due to their similar agronomic composition and maturation rates (Felipe et al. 2016). This could explain

25 why we did not observe significant differences in the total yield among these PIs.

However there was a significant difference in the total yield production among the years, where 2017 had the least seed production followed by 2016 and 2015. This can be due to several biotic and abiotic factors and our data showed that average scalar wind and soil temperature were significantly higher in 2017 compared to other years potentially impacting the seed production. Temperature stress and planting date can have a major impact on the quality and yield of soybean (Tuzar et al. 2010). In this study, in addition to the difference in soil temperature, the planting date in 2017 was also delayed compared to 2016 and 2015. This potentially explains why the seed production was drastically reduced in 2017.

In only one case (2016) did we see a significant difference in weight per seed among high protein and low protein varieties (high 1 and low 2, Table 2.5), suggesting that low 2 may be more susceptible to BMSB infestation. Since this difference only occurred in 2016, the difference may be more related to the impact of environmental conditions affecting volatiles or the physical qualities of low 2 to cause more damage. Alternatively, environmental conditions may have influenced this particular soybean PIs maturation, growth or defense against stink bug feeding.

Although there was no feeding preference among the six soybean PIs, BMSB caused severe feeding damage to the seeds and negatively affected the seed quality.

This was evident as the weight per seed was significantly reduced in damaged seeds compared to the healthy seeds (Table 2.5). The damage severity was also higher in infested compared to the un-infested PIs (2015 choice tests; Table 2.6). The current economic threshold of BMSB is 5 BMSB per 15 sweeps, visual count of 5.4 BMSB

26

in 2 minutes or one or two BMSB per row foot (Aigner et al. 2016); our infestation

rate was approximately two BMSB per row foot. Our data reaffirms that significant

and economic damage occurs at these BMSB infestation levels.

As BMSB appeared to infest all PIs, we were interested to measure the extent of

damage caused in no-choice tests to understand how each individual soybean PI

would respond to BMSB feeding. We did not see significant differences among PIs in

either the low protein or high protein categories in no-choice tests except for the low

1 PI in 2015 and the low 2 PI in 2016 (both cases had significantly higher damage incidence and lower seed weight, Tables 2.4 and 2.7). Irrespective of the quantitative differences in the protein content, the defense mechanisms of the soybean PIs might be similar between the varieties, at least in their response to stink bug feeding.

However, a significant loss in the seed weight was observed in damaged compared to the healthy seeds produced from infested plants (2015 and 2017 no-choice tests,

Table 2.5). For all the no-choice tests, the severity and incidence of damage in was significantly higher in infested cages compared to un-infested cages for all three year

(except incidence in 2015, where there was no difference, Table 2.7). Consistent with previous studies with BMSB feeding, our data show that BMSB can cause significant reduction in the seed quality making them unviable.

In summary, our results show that BMSB does not have any feeding preferences among high and low protein PIs. However, it causes significant feeding damage on these specialty soybeans, negatively affecting the seed weight and quality of the soybeans specifically. Our infestations occurred at the R4-R5 stage, so intensive scouting for BMSB according to integrated pest management protocols (Koch et al.

27

2017) during this time could help limit the damage. Furthermore, our data suggests

that these specialty soybeans should be treated similar to conventional soybean;

however, additional specialty soybean varieties should be evaluated for any

preferences or differences in susceptibility.

2.6 References:

Miner, F. D. (1961). Stink bug damage to soybeans. Arkansas Agricultural Experiment

Station. Farm Research. 10: 12.

Cissel, B. J., Whalen, Dively, G., Hooks, C. T., Patton Venogopal, D., Aigner, B.,

Herbert, B. A., Kuhar, T., Malone, S., Seymore. E. (2015). Brown marmorated stink

bug biology and management in Mid-Atlantic soybeans. Virginia Cooperation

Extension Publication No. Ento – 168NP.

Aigner, B. L., D. A. Herbert, G. P. Dively, D. Venugopal, J. Whalen, B. Cissel, T. P.

Kuhar, C. C. Brewster, J. W. Hogue, and E. Seymore. 2016. “Comparison of Two

Sampling Methods for Assessing Halyomorpha Halys (Hemiptera: Pentatomidae)

Numbers in Soybean Fields.” Journal of Economic Entomology 109 (6): 2586–89.

https://doi.org/10.1093/jee/tow230.

Aigner, B. L., T. P. Kuhar, D. A. Herbert, C. C. Brewster, J. W. Hogue, and J. D. Aigner.

2017. “Brown Marmorated Stink Bug (Hemiptera: Pentatomidae) Infestations in

Tree Borders and Subsequent Patterns of Abundance in Soybean Fields.” Journal of

Economic Entomology 110 (2): 487–90. https://doi.org/10.1093/jee/tox047.

Blaauw, Brett R, Dean Polk, and Anne L Nielsen. 2015. “IPM-CPR for Peaches:

Incorporating Behaviorally-Based Methods to Manage Halyomorpha Halys and Key

28

Pests in Peach.” Pest Management Science 71 (11): 1513–22.

https://doi.org/10.1002/ps.3955.

Clavero, Miguel, and Emili García-Berthou. 2005. “Invasive Species Are a Leading

Cause of Animal Extinctions.” Trends in Ecology & Evolution 20 (3): 110.

https://doi.org/10.1016/j.tree.2005.01.003.

Clissold, F. J., G. D. Sanson, and J. Read. 2006. “The Paradoxical Effects of Nutrient

Ratios and Supply Rates on an Outbreaking Insect Herbivore, the Australian Plague

Locust.” Journal of Animal Ecology 75 (4): 1000–1013.

https://doi.org/10.1111/j.1365-2656.2006.01122.x.

Cober, Elroy R., and Harvey D. Voldeng. 2001. “A New Soybean Maturity and

Photoperiod-Sensitivity Locus Linked to E1 and T.” Crop Science 41 (3): 698–698.

http://go.galegroup.com/ps/i.do?id=GALE%7CA76629353&sid=googleScholar&v=

2.1&it=r&linkaccess=fulltext&issn=0011183X&p=AONE&sw=w&userGroupNam

e=cens39029.

De, Efrain, Santana Souza, Edson Luiz, Lopes Baldin, José Paulo, Gonçalves Franco Da

Silva, and André Luiz Lourenção. 2013. “Feeding Preference of Nezara Viridula

(Hemiptera: Pentatomidae) and Attractiveness of Soybean Genotypes.” Chilean

Journal Of Agricultural Research 73 (4). https://doi.org/10.4067/S0718-

58392013000400004.

Erejomovich, J A. 1980. “El Vaneo De Frutos; Como Limitante Para El Cultivo De La

Soja.” Rev. Facultad de Agronomía. Vol. 1.

http://sedici.unlp.edu.ar/bitstream/handle/10915/29258/Documento_completo.pdf?se

quence=1.

29

Fehr, Walter R, and Charles E Caviness. 1977. “Stages of Soybean Development.” Iowa

Coop. Ext. Serv. Spec. Rep. 80. Iowa State Univ., Ames, IA.

http://lib.dr.iastate.edu/specialreports.

Felipe, Matías de, José A. Gerde, and José L. Rotundo. 2016. “Soybean Genetic Gain in

Maturity Groups III to V in Argentina from 1980 to 2015.” Crop Science 56 (6):

3066. https://doi.org/10.2135/cropsci2016.04.0214.

Fischer, K., and K. Fiedler. 2000. “Response of the Copper Butterfly Lycaena Tityrus to

Increased Leaf Nitrogen in Natural Food Plants: Evidence against the Nitrogen

Limitation Hypothesis.” Oecologia 124 (2): 235–41.

https://doi.org/10.1007/s004420000365.

Franca Neto, J. B., F. C. Krzyzanowski, and N. P. Da Costa. 1998. “The Tetrazolium Test

for Soybean Seeds.” EMBRAPA-CNPSo, Londrina, Brazil. Documentos, 115, 71p,

September, 71p.

https://www.infoteca.cnptia.embrapa.br/infoteca/handle/doc/460029.

Hoebeke, E. R., and M. E. Carter. 2003. “Halyomorpha Halys (Stål) (Heteroptera:

Pentatomidae): A Polyphagous Plant Pest from Asia Newly Detected in North

America.” Proceedings of the Entomological Society of Washington 105 (1): 225–

37.

Joseph, Shimat V, Jonathan W Stallings, Tracy C Leskey, Greg Krawczyk, Dean Polk,

Bryan Butler, and J Christopher Bergh. 2014. “Spatial Distribution of Brown

Marmorated Stink Bug (Hemiptera: Pentatomidae) Injury at Harvest in Mid-Atlantic

Apple Orchards.” Journal of Economic Entomology 107 (5): 1839–48.

https://doi.org/10.1603/EC14154.

30

Kamminga, K. L., A. L. Koppel, D. A. Herbert, and T. P. Kuhar. 2012. “Biology and

Management of the Green Stink Bug.” Journal of Integrated Pest Management 3

(3): C1–8. https://doi.org/10.1603/IPM12006.

Kim, C S, Glenn Schaible, Lynn Garrett, Ruben Lubowski, and Donna Lee. 2008.

“Economic Impacts of the U.S. Soybean Aphid Infestation: A Multi-Regional

Competitive Dynamic Analysis.” Agricultural and Resource Economics Review.

Vol. 37. http://sbrusa.net.

Koch, Robert L., Daniela T. Pezzini, Andrew P. Michel, and Thomas E. Hunt. 2017.

“Identification, Biology, Impacts, and Management of Stink Bugs (Hemiptera:

Heteroptera: Pentatomidae) of Soybean and Corn in the Midwestern United States.”

Journal of Integrated Pest Management 8 (1). https://doi.org/10.1093/jipm/pmx004.

Lee, Doo-Hyung, Brent D Short, Shimat V Joseph, J Christopher Bergh, and Tracy C

Leskey. 2013. “Review of the Biology, Ecology, and Management of Halyomorpha

Halys (Hemiptera: Pentatomidae) in China, Japan, and the Republic of Korea.”

Environmental Entomology 42 (4): 627–41. https://doi.org/10.1603/EN13006.

Leskey, Tracy C., Brent D. Short, Bryan R. Butler, and Starker E. Wright. 2012. “Impact

of the Invasive Brown Marmorated Stink Bug, Halyomorpha Halys (Stål), in Mid-

Atlantic Tree Fruit Orchards in the United States: Case Studies of Commercial

Management.” Psyche: A Journal of Entomology 2012 (July): 1–14.

https://doi.org/10.1155/2012/535062.

Lu, Zhong-Xian, Kong-Luen Heong, Xiao-Ping Yu, and Cui Hu. 2004. “Effects of Plant

Nitrogen on Ecological Fitness of the Brown Planthopper, Nilaparvata Lugens Stal.

in Rice.” Journal of Asia-Pacific Entomology 7 (1): 97–104.

31

https://doi.org/10.1016/S1226-8615(08)60204-6.

Mantia, Jonathan M La, M A Rouf Mian, and Margaret G Redinbaugh. 2018.

“Identification of Soybean Host Plant Resistance to Brown Marmorated Stink Bugs

in Maturity Group III Plant Introductions.” Journal of Economic Entomology 111

(1): 428–34. https://doi.org/10.1093/jee/tox295.

McPherson, R. M., G. K. Douce, and R. D. Hudson. 1993. “Annual Variation in Stink

Bug (Heteroptera: Pentatomidae) Seasonal Abundance and Species Composition in

Georgia Soybean and Its Impact on Yield and Quality.” Journal of Entomological

Science 28 (1): 61–72. https://doi.org/10.18474/0749-8004-28.1.61.

McPherson, R. M., W. C. Johnson, E. G. Fonsah, and P. M. Roberts. 2008. “Insect Pests

and Yield Potential of Vegetable Soybean (Edamame) Produced in Georgia.”

Journal of Entomological Science 43 (2): 225–40. https://doi.org/10.18474/0749-

8004-43.2.225.

McPherson, R, J McPherson, and Robert McPherson. 2000. Stink Bugs of Economic

Importance in America North of Mexico. CRC Press.

https://doi.org/10.1201/9781420042429.

Miyao, G. M., R. M. Davis, and H. J. Phaff. 2000. “Outbreak of Eremothecium Coryli

Fruit Rot of Tomato in California.” Plant Disease 84 (5): 594–594.

https://doi.org/10.1094/PDIS.2000.84.5.594C.

Olson, Lars J. 2006. “The Economics of Terrestrial Invasive Species: A Review of the

Literature.” Agricultural and Resource Economics Review. Vol. 35.

http://entnemdept.ufl.edu/Hodges/als4161/Secure/PDF

Files/Articles/Olson2006.pdf.

32

Owens, D R, Jr. Herbert D. A., G P Dively, D D Reisig, and T P Kuhar. 2013. “Does

Feeding by Halyomorpha Halys (Hemiptera: Pentatomidae) Reduce Soybean Seed

Quality and Yield?” Ecen Journal of Economic Entomology 106 (3): 1317–23.

Panizzi, A. R., and F. Slansky. 1985. “Review of Phytophagous Pentatomids (Hemiptera:

Pentatomidae) Associated with Soybean in the Americas.” The Florida

Entomologist 68 (1): 184. https://doi.org/10.2307/3494344.

Ragsdale, David W., Douglas A. Landis, Jacques Brodeur, George E. Heimpel, and

Nicolas Desneux. 2011. “Ecology and Management of the Soybean Aphid in North

America.” Annual Review of Entomology 56 (1): 375–99.

https://doi.org/10.1146/annurev-ento-120709-144755.

Rao, M. S. S., A. S. Bhagsari, and A. I. Mohamed. 2002. “Fresh Green Seed Yield and

Seed Nutritional Traits of Vegetable Soybean Genotypes.” Crop Science 42 (6):

1950. https://doi.org/10.2135/cropsci2002.1950.

Raza, Ghulam, Mohan B Singh, and Prem L Bhalla. 2017. “In Vitro Plant Regeneration

from Commercial Cultivars of Soybean.” BioMed Research International 2017:

7379693. https://doi.org/10.1155/2017/7379693.

Rice, Kevin B, Chris J Bergh, Erik J Bergmann, Dave J Biddinger, Christine Dieckhoff,

Galen Dively, Tara Gariepy, et al. 2014. “Biology , Ecology , and Management of

Brown Marmorated Stink Bug (Hemiptera : Pentatomidae)” 5 (3): 1–13.

Silva, F A C, J J da Silva, R A Depieri, and Antônio Ricardo Panizzi. 2012. “Feeding

Activity, Salivary Amylase Activity, and Superficial Damage to Soybean Seed by

Adult Edessa Meditabunda (F.) and Euschistus Heros (F.) (Hemiptera:

Pentatomidae).” Neotropical Entomology 41 (5): 386–90.

33

https://doi.org/10.1007/s13744-012-0061-9.

Sterner, Robert Warner., and James J. Elser. 2002. Ecological Stoichiometry : The

Biology of Elements from Molecules to the Biosphere. Princeton University Press.

https://www.jstor.org/stable/j.ctt1jktrp3.

Summerfield, R.J., H. Asumadu, R.H. Ellis, and A. Qi. 1998. “Characterization of the

Photoperiodic Response of Post-Flowering Development in Maturity Isolines of

Soyabean [Glycine Max(L.) Merrill] ‘Clark.’” Annals of Botany 82 (6): 765–71.

https://doi.org/10.1006/ANBO.1998.0755.

Turnipseed, S G, and M Kogan. 1976. “Soybean Entomology.” Annual Review of

Entomology 21 (1): 247–82. https://doi.org/10.1146/annurev.en.21.010176.001335.

Tuzar M, Abdullah N A P, Mohd Lassim M B, Kamaruzaman Jusoff, and Puteh A B.

2010. “The Effects of Temperature Stress on the Quality and Yield of Soya Bean

[(Glycine Max L.) Merrill.].” Journal of Agricultural Science. Vol. 2.

http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.665.2078&rep=rep1&typ

e=pdf.

Vyavhare, Suhas S., Michael O. Way, and Raul F. Medina. 2015. “Determination of

Growth Stage-Specific Response of Soybean to Redbanded Stink Bug (Hemiptera:

Pentatomidae) and Its Relationship to the Development of Flat Pods.” Journal of

Economic Entomology 108 (4): 1770–78. https://doi.org/10.1093/jee/tov145.

Wilkerson, G. G., J. W. Jones, K. J. Boote, and G. S. Buol. 1989. “Photoperiodically

Sensitive Interval in Time to Flower of Soybean.” Crop Science 29 (3): 721.

https://doi.org/10.2135/cropsci1989.0011183X002900030037x.

34

2.7 Tables and figures:

Category Soybean PI Average Protein (%) Average Oil (%)

High 1 HR12 2539 47.4 18.4

High 2 HR12 2544 48.1 17.7

High 3 HR12 2548 46.6 19.5

Low 1 HR12 2550 41.7 21.3

Low 2 HR12 2570 42.5 21.7

Low 3 HR12 2586 41.7 21.6

Table 2.1: Composition of protein and oil content of different soybean PIs used in the study (data obtained from Dr. Rouf Mian)

35

Figure 2.1: Cages used for choice and no choice tests with soybean varieties. A) The bold line represents 4x6 feet cage with three high protein variety (H1, H2, H3) and three low protein variety (L1, L2, L3) soybean plants. B) The bold lines represent 2x4 feet cage with 3 high protein variety (H1, H2, H3) and 3 low protein variety (L1, L2, L3) soybean plants.

36

Figure 2.2: Rating the damage of tetrazolium stained soybean seeds. A scale of 0-10 was used, where 0 had no damage and 10 had the worst damage.

37

Year 2015

Choice Test No-choice Test Soybean PI Infested Un-infested Infested Un-infested

High 1 270.20 ± 61.30 234.40 ± 60.19 488.80 ± 48.84 395.20 ± 102.97

High 2 140.60 ± 46.57 179.60 ± 56.16 299.40 ± 107.79 420.20 ± 60.71

High 3 258.20 ± 64.89 75.40 ± 20.85 562.00 ± 85.42 420.20 ± 82.78

Low 1 237.00 ± 64.01 119.25 ± 24.70 344.40 ± 97.14 409.20 ± 52.85

Low 2 96.40 ± 34.66 151.00 ± 31.71 215.00 ± 54.73 504.80 ± 66.24

Low 3 236.00 ± 72.94 266.40 ± 64.24 381.75 ± 39.90 424.00 ± 59.58

Year 2016

Soybean PI Infested Un-infested Infested Un-infested

High 1 152.60 ± 24.63 127.00 ± 28.09 97.60 ± 23.79 58.60 ± 25.52

High 2 61.4 ± 12.30 68.20 ± 22.45 62.00 ± 20.86 19.80 ± 6.61

High 3 161.00 ± 74.73 113.8 ± 61.71 106.20 ± 31.86 57.80 ± 20.40

Low 1 132.00 ± 42.46 130.6 ± 38.93 47.40 ± 28.28 118.00 ± 46.50

Low 2 109.80 ± 34.23 44.40 ± 22.03 71.40 ± 13.03 66.20 ± 20.16

Low 3 232.8 ± 78.84 83.80 ± 31.04 58.60 ± 18.31 177.75 ± 26.69

Table 2.2: Mean and SEM of total number of seeds produced per replicate in choice and no-choice tests. (Note: table continued on next page).

38

Year 2017

Soybean PI Infested Un-infested Infested Un-infested

High 1 33.8 ± 9.36 32.8 ± 12.5 31.20 ± 8.38 64.00 ± 20.83

High 2 22.4 ± 4.79 16.8 ± 3.38 55.80 ± 15.50 69.60 ± 13.28

High 3 19.8 ± 7.00 27.8 ± 10.67 61.60 ± 13.76 25.60 ± 3.97

Low 1 40.6 ± 6.96 48.6 ± 12.41 50.20 ± 17.36 41.60 ± 16.17

Low 2 38.8 ± 9.49 38.8 ± 11.41 62.40 ± 10.33 37.40 ± 7.65

Low 3 34.8 ± 6.14 37.6 ± 6.66 45.40 ± 9.79 36.80 ± 10.65

39

Year 2015

Choice Test No-choice Test Soybean PI Infested Un-infested Infested Un-infested

High 1 12.46 ± 5.67 7.41 ± 4.44 30.46 ± 17.80 38.32 ± 21.87

High 2 15.39 ± 5.75 8.04 ± 4.30 31.19 ± 18.35 13.99 ± 5.91

High 3 10.65 ± 3.34 27.36 ± 9.88 54.47 ± 38.70 29.75 ± 18.44

Low 1 16.69 ± 9.75 4.31 ± 2.54 76.15 ± 43.03 12.70 ± 5.91

Low 2 30.88 ± 14.05 12.39 ± 3.33 20.65 ± 8.19 31.69 ± 18.20

Low 3 16.81 ± 9.03 8.38 ± 4.58 31.10 ± 10.08 26.44 ± 18.55

Year 2016

Soybean PI Infested Un-infested Infested Un-infested

High 1 22.88 ± 6.69 21.79 ± 7.26 23.71 ± 19.13 47.57 ± 21.95

High 2 34.96 ± 8.49 34.38 ± 13.97 14.39 ± 9.08 5.29 ± 2.49

High 3 8.77 ± 4.09 37.51 ± 11.64 34.41 ± 16.16 15.15 ± 8.31

Low 1 19.13 ± 6.27 15.77 ± 3.03 6.12 ± 2.51 8.87 ± 4.93

Low 2 25.04 ± 8.32 45.18 ± 10.30 39.24 ± 14.40 20.16 ± 7.27

Low 3 20.06 ± 6.81 23.84 ± 2.39 26.53 ± 11.72 161.57 ± 129.58

Table 2.3: Mean and SEM of percentage of seeds damaged in choice and no-choice tests.

(Note: table continued on next page).

40

Year 2017

Soybean PI Infested Un-infested Infested Un-infested

High 1 15.64 ± 7.05 6.67 ± 4.08 12.48 ± 4.91 1.70 ± 0.93

High 2 11.28 ± 4.77 16.71 ± 10.04 90.64 ± 53.55 3.94 ± 2.00

High 3 9.43 ± 6.34 17.24 ± 12.30 52.98 ± 31.00 2.92 ± 1.66

Low 1 20.69 ± 13.12 3.67 ± 2.44 13.48 ± 7.08 0.26 ± 0.26

Low 2 25.52 ± 9.89 1.42 ± 0.61 26.30 ± 13.56 6.30 ± 4.09

Low 3 16.06 ± 8.28 7.95 ± 3.17 31.72 ± 18.07 1.34 ± 1.34

41

Year 2015

Choice Test No-choice Test Soybean PI Infested Un-infested Infested Un-infested

High 1 6.74 ± 0.25 7.31 ± 0.82 7.63 ± 0.17 6.15 ± 1.62

High 2 6.00 ± 0.44 5.87 ± 0.76 5.13 ± 1.30 6.50 ± 0.52

High 3 7.67 ± 1.01 8.03 ± 1.31 7.22 ± 0.21 7.98 ± 0.40

Low 1 7.55 ± 0.34 4.94 ± 1.37 6.88 ± 2.01 6.15 ± 0.37

Low 2 6.78 ± 0.85 6.49 ± 0.69 7.02 ± 0.52 6.95 ± 0.36

Low 3 7.89 ± 0.21 7.78 ± 0.84 6.87 ± 1.98 7.06 ± 0.77

Year 2016

Soybean PI Infesteda Un-infestedb Infesteda Un-infestedb

High 1 16.02 ± 2.88 12.94 ± 1.11 10.68 ± 1.12b 12.69 ± 1.14ab

High 2 11.69 ± 1.73 11.94 ± 1.20 11.88 ± 1.75b 10.23 ± 1.03b

High 3 12.12 ± 1.55 11.97 ± 1.50 12.46 ± 0.97ab 9.60 ± 2.87b

Low 1 11.08 ± 1.03 9.74 ± 1.29 15.93 ± 3.62ab 7.72 ± 2.06b

Low 2 7.99 ± 1.26 11.42 ± 1.66 11.23 ± 0.91b 12.04 ± 1.69b

Low 3 12.14 ± 2.59 13.55 ± 1.08 22.56 ± 2.64a 11.40 ± 3.12b

Table 2.4: Mean and SEM of weight per seed (milligrams) in choice and no-choice tests.

Significance is represented by alphabets. Means that do not share a letter are significantly different. (Note: table continued on next page).

42

Year 2017

Soybean PI Infested Un-infested Infested Un-infested

High 1 8.35 ± 0.79 7.65 ± 0.40 6.09 ± 1.58 7.64 ± 0.22

High 2 9.47 ± 2.36 6.59 ± 1.41 8.08 ± 0.47 7.20 ± 0.41

High 3 7.31 ± 2.12 7.58 ± 0.19 6.44 ± 1.63 9.03 ± 0.62

Low 1 7.01 ± 0.28 7.56 ± 0.29 6.04 ± 1.61 7.14 ± 0.35

Low 2 8.11 ±2.04 7.75 ± 0.55 7.82 ± 0.36 7.75 ± 0.43

Low 3 6.84 ± 1.13 6.51 ± 0.63 6.71 ± 0.25 7.66 ± 0.52

43

Year 2015

Choice Test No-choice Test Soybean PI Healthya Damagedb Healthya Damagedb

High 1 171.44 ± 15.62 136.38 ± 10.62 128.32 ± 28.44 122.55 ± 11.05

High 2 185.23 ± 23.98 157.48 ± 11.44 164.96 ± 14.15 112.55 ± 11.05

High 3 158.58 ± 20.91 116.99 ± 11.92 147.54 ± 28.62 120.36 ± 9.56

Low 1 182.67 ± 8.24 142.67 ± 5.19 161.22 ± 3.86 121.62 ± 18.57

Low 2 171.63 ± 43.32 129.20 ± 10.78 178.14 ± 9.60 128.08 ± 11.94

Low 3 164.74 ± 8.20 143.83 ± 20.01 160.33 ± 6.21 121.13 ± 8.10

Year 2016

Soybean PI Healthya Damagedb Healthy Damaged

High 1 137.67 ± 19.25ab 73.13 ± 10.68c 162.81 ± 21.49 118.43 ± 5.03

High 2 133.96 ± 8.88ab 82.17 ± 7.08bc 149.49 ± 12.14 122.01 ± 7.75

High 3 154.09 ± 18.78a 89.48 ± 13.42bc 152.83 ± 9.37 126.34 ± 5.21

Low 1 132.66 ± 12.36ab 130.14 ± 20.26bc 89.31 ± 37.02 136.49 ± 10.63

Low 2 164.77 ± 23.93a 82.21 ± 20.28abc 152.92 ± 12.32 126.91 ± 6.10

Low 3 140.40 ± 15.94ab 87.56 ± 18.91bc 89.31 ± 39.62 112.50 ± 22.73

Table 2.5: Mean and SEM of weight per seed (milligrams) of healthy and damaged seeds. Significance is represented by alphabets. Means that do not share a letter are significantly different. (Note: table continued on next page).

44

Year 2017

Soybean PI Healthy Damaged Healthya Damagedb

High 1 135.48 ± 9.22 359.58 ± 200.72 110.92 ± 28.43 102.24 ± 26.66

High 2 102.25 ± 14.56 56.43 ± 31.10 130.44 ± 6.86 89.76 ± 23.72

High 3 137.16 ± 22.62 73.73 ± 30.50 107.39 ± 29.91 103.00 ± 26.67

Low 1 141.78 ± 6.09 48.50 ± 29.83 112.11 ± 30.37 92.52 ± 23.24

Low 2 176.68 ± 25.04 115.90 ± 7.68 131.20 ± 5.91 74.76 ± 21.92

Low 3 166.87 ± 36.53 109.00 ± 21.80 154.87 ± 6.13 130.35 ± 5.76

45

Year 2015

Severity Incidence (%) Soybean PI Infesteda Un-infestedb Infesteda Un-infestedb

High 1 3.34 ± 0.61 3.31 ± 1.02 48.84 ± 5.43 42.71 ± 11.53

High 2 2.01 ± 0.31 2.41 ± 0.76 41.25 ± 10.95 33.49 ± 8.29

High 3 3.94 ± 0.96 2.49 ± 0.77 55.14 ± 11.12 41.49 ± 10.47

Low 1 4.44 ± 0.49 1.92 ± 0.79 67.38 ± 2.90 46.23 ± 8.72

Low 2 3.30 ± 0.60 3.05 ± 1.41 61.97 ± 10.13 36.17 ± 15.35

Low 3 4.14 ± 0.57 2.90 ± 1.00 67.76 ± 3.59 41.04 ± 10.73

Year 2016

Soybean PI Infested Un-infested Infested Un-infested

High 1 5.54 ± 0.68 4.70 ± 0.57 80.52 ± 10.72 67.52 ± 4.94

High 2 3.17 ± 0.72 3.35 ± 0.75 62.50 ± 11.34 65.30 ± 9.90

High 3 5.30 ± 1.05 3.99 ± 0.43 63.79 ± 10.40 69.87 ± 8.62

Low 1 4.45 ± 1.03 5.14 ± 0.70 67.46 ± 11.93 79.88 ± 6.68

Low 2 2.61 ± 0.36 3.43 ± 0.89 55.71 ± 5.60 54.22 ± 9.31

Low 3 5.53 ± 0.84 4.82 ± 0.58 83.13 ± 7.95 68.62 ± 7.44

Table 2.6: Mean and SEM of severity and damage incidence in infested and un-infested cages of choice tests. Significance is represented by alphabets. Means that do not share a letter are significantly different. (Note: table continued on next page).

46

Year 2017

Soybean PI Infested Un-infested Infested Un-infested

High 1 1.53 ± 0.33 1.52 ± 0.57 24.82 ± 6.76 18.15 ± 6.02

High 2 1.82 ± 0.45 1.22 ± 0.27 26.46 ± 6.33 26.90 ± 10.77

High 3 2.57 ± 0.76 2.09 ± 0.31 29.30 ± 8.21 27.03 ± 3.69

Low 1 2.42 ± 1.11 2.32 ± 0.77 34.71 ± 14.29 29.07 ± 10.60

Low 2 1.16 ± 0.36 0.63 ± 0.26 26.63 ± 9.79 10.82 ± 3.37

Low 3 1.56 ± 0.53 0.63 ± 0.32 25.23 ± 9.69 10.82 ± 3.65

47

Year 2015

Severity Incidence (%) Soybean PI Infested Un-infested Infesteda Un-infestedb

High 1 4.91 ± 1.16 4.19 ± 1.07 57.73 ± 10.86 46.54 ± 12.34

High 2 2.70 ± 0.82 2.99 ± 0.81 41.92 ± 8.49 34.62 ± 9.31

High 3 5.57 ± 1.05 4.41 ± 0.82 65.89 ± 7.87 49.62 ± 9.19

Low 1 5.55 ± 0.64 4.70 ± 0.23 75.41 ± 2.09 55.68 ± 3.35

Low 2 4.10 ± 1.10 3.14 ± 0.51 46.95 ± 11.09 36.38 ± 5.14

Low 3 5.98 ± 0.47 3.37 ± 0.77 71.91 ± 2.03 39.20 ± 7.61

Year 2016

Soybean PI Infesteda Un-infestedb Infesteda Un-infestedb

High 1 4.69 ± 0.72abc 2.72 ± 0.56bc 61.97 ± 9.67 46.93 ± 13.62

High 2 5.39 ± 0.32abc 2.89 ± 0.41bc 78.89 ± 6.60 47.34 ± 7.63

High 3 6.05 ± 1.04ab 2.12 ± 0.89c 80.51 ± 11.06 30.56 ± 12.03

Low 1 4.86 ± 0.55abc 3.57 ± 0.99abc 73.88 ± 5.47 46.19 ± 12.38

Low 2 6.99 ± 0.73a 4.57 ± 1.36abc 91.09 ± 4.39 57.04 ± 16.19

Low 3 5.13 ± 0.60abc 2.50 ± 0.68bc 61.65 ± 7.47 38.72 ± 9.69

Table 2.7: Mean and SEM of severity and damage incidence in infested and un- infested cages of no-choice tests. Significance is represented by alphabets. Means that do not share a letter are significantly different. (Note: table continued on next page).

48

Year 2017

Soybean PI Infesteda Un-infestedb Infesteda Un-infestedb

High 1 1.91 ± 0.24 0.71 ± 0.18 40.85 ± 7.35 11.04 ± 3.40

High 2 1.76 ± 0.73 1.08 ± 0.21 40.52 ± 10.83 15.18 ± 3.96

High 3 1.03 ± 0.34 0.83 ± 0.20 34.20 ± 9.95 8.58 ± 2.18

Low 1 1.27 ± 0.27 0.28 ± 0.21 31.89 ± 7.79 3.94 ± 3.24

Low 2 1.05 ± 0.16 1.46 ± 1.10 30.27 ± 6.30 21.12 ± 11.14

Low 3 2.13 ± 0.79 1.05 ± 0.45 42.87 ± 15.08 12.28 ± 5.42

49

CHAPTER 3

Differential expression of cytochrome P450 CYP6 genes in the brown marmorated

stink bug, Halyomorpha halys

This chapter is submitted in October of 2018 and is under review in Insects

journal under the same title.

3.1 Abstract

Cytochrome (CYP) P450s are a superfamily of enzymes that detoxify xenobiotics

and regulate numerous physiological processes in insects. The genomes of

phytophagous insects usually contain large numbers of P450s, especially within the

CYP3 clan. Within this clan, CYP6 subfamily members help detoxify plant host

secondary metabolites. In this study, we analyzed three CYP6 genes in the highly

polyphagous invasive pest, Halyomorpha halys, commonly known as brown

marmorated stink bug. We characterized and validated the expression of

HhCYP6BQ27, HhCYP6BK13 and HhCYP6BK24 among sexes, tissues (gut, fat

body and Malpighian tubules) and hosts (apple, corn, soybean). Sequence

characterization by amino acid alignments confirmed the presence of conserved

motifs typical of the P450 superfamily. No significant differences existed in gene

expression among sexes or hosts, suggesting that these transcripts might have broad

substrate specificities. However, significant differences in gene expression were

observed among the tissues studied, and were gene-dependent. Collectively, the

results show that H. halys differentially expressed CYP6 genes among tissues, which

50

may be related to important physiological functions specific to these tissues. This

study has increased our understanding of H. halys biology that can be useful for

functional studies and can potentially be exploited in developing sustainable pest

management strategies.

3.2 Introduction

The cytochrome P450 monoxygenases (P450s) are a diverse superfamily of haem-

thiolate enzymes that are widely abundant among eukaryotic genomes (Reichhart and

Feyereisen 2000; Lamb and Waterman 2013). P450s are well known for their role in insecticide resistance as well as adaptation to host plants (Bagchi et al. 2016;

Dermauw et al. 2013; Zhu et al. 2016). Insects use these enzymes to metabolize the vast array of xenobiotic substrates including plant secondary metabolites and endogenous compounds (e.g. fatty acids), converting them from a toxic insoluble

form to a water soluble form (Guengerich 2001; Claudianos et al. 2006; Bass and

Field 2011; Gutierrez et al. 2007). Specifically, P450s help with detoxification and metabolism of plant secondary metabolites encountered in the diet of many generalist insects (Feyereisen 2015, 2006, 1999; Guengerich 2001; Scott and Wen 2001). In

phytophagous insects, important processes such as metabolism, detoxification and

host adaptation have led to a diversification of P450 genes (Feyereisen 2006).

P450s are classified into four clans: CYP2, mitochondrial, CYP3 and CYP4.

Among these enzymes, the CYP3 clan plays an important role in the metabolism and

detoxification of plant allelochemicals and insecticides in many phytophagous insects

(Feyereisen 1999). Several studies suggest that the CYP6 subfamily genes within the

51

CYP3 clan are important for detoxifying xenobiotic compounds such as insecticides

(Feyereisen 2012). However, additional studies have identified an increasing number

of CYP6 genes metabolizing endogenous compounds during growth and development

as well as plant-insect interactions (Helvig et al. 2004, Xu et al. 2009, Jones et al.

2011). For example, in the generalist Helicoverpa zea, CYP6B enzymes facilitate

adaptation to host plants by detoxifying several plant allelochemicals and overcoming

plant defense (Rupasinghe et al. 2007; X. Li et al. 2004). Similarly, in the

polyphagous species Papilio glaucus and Papilio multicaudatus, CYP6B enzymes help detoxify furanocoumarins produced by plants as a defense response in their hosts

(Wen et al. 2003; Li et al. 2003; Hung et al. 1997). Therefore, CYP6 genes play an important role in mediating plant-insect interactions (Li et al. 2007), especially in polyphagous pests.

The brown marmorated stink bug, Halyomorpha halys (Stål) is a notorious polyphagous pest that is native to East Asian countries like China, Japan, and Korea

(Lee et al. 2018). It was first detected in the U.S. near Allentown, Pennsylvania in

1996 (Hoebeke and Carter 2003). Since then, H. halys has spread rapidly and is

currently found in 44 states in the U.S. and 4 Canadian provinces

(www.stopbmsb.org). H. halys feeds on more than 169 plant species including

important agricultural crops like corn, soybean, as well as many fruits and vegetables

(Lee et al. 2013). The sucking mouthparts of H. halys cause damage to the plant pods

and other reproductive tissues (e.g. fruits) and make them unmarketable (Peiffer and

Felton 2014). Currently, insecticides are the principal tool for controlling stink bugs

52

(Snodgrass et al. 2005; Gomez et al. 2009), but constant exposure could select for

resistant insects.

In some taxa, generalist herbivores have significantly higher number of P450s

compared to a specialist, and is thought to be advantageous for overcoming diverse

host challenges (Mao et al. 2007). H. halys has over 163 total P450s, and 105 of these

belong to the CYP3 clan. This clan contains 72 CYP6B type, including CYP6BQ (37

genes) and CYP6BK (27 genes) gene families (Bansal and Michel 2018). In H. halys

and other generalist insects, CYP6B enzymes are over represented compared to other

members of the CYP3 clan, and might have expanded in response to host

diversification (Hung et al. 1997, Li et al. 2003). Some HhCYP6 genes appear to have

diverse expression in the tissues of H. halys (Bansal & Michel, 2018), but there is

lack of knowledge on the gene expression of other CYP6B members and their

potential role in H. halys adaptation at the physiological level.

Physiological processes of insects are often specialized based on the biology and anatomy of the insect. Sexes, diet exposure and tissues have different demands, which often leads to differential expression of P450s, especially CYP6s. For example,

CYP6L1 is highly expressed in testes and accessory glands of Blattella germanica

males, indicating a potential role in reproduction (Wen and Scott 2001). Several other

studies also showed differential expression of CYPs among sexes (Yu et al. 2015;

Zuo and Chen 2014; Musasia et al. 2013; Huber et al. 2007). P450s also have diet-

specific expression; for example, expression of CYP6B1 is induced by xanthotoxin

present in the diet of Papilio polyxenes (Scott and Wen 2001; Cohen et al. 1992).

Different tissues have different physiological roles, which can lead to differential

53

P450 expression. During digestion, the insect gut is exposed to microbes, pesticides

and toxins from their diet which require CYP6s for proper detoxification and

metabolism (Tzou et al. 2000; Yang et al. 2011). The insect fat body is mainly

involved in energy metabolism, regulation and nutrient storage; it stores energy in the

form of glycogen and triglycerides and releases necessary nutrients in response to the

energy demands of the insect (Hoshizaki 2005). The Malpighian tubules are the

primary organs of excretion and osmoregulation in insects and they also play a role in

metabolism and detoxification of xenobiotics (Dow and Davies 2006; Yang et al.

2007).

In this study, we characterized and analyzed the tissue, sex and diet-specific

expression of CYP6 genes. Due to the large number of CYP6s, we first generated

preliminary data of gene expression using semi-quantitative PCR and chose three

CYP6 genes with differential expression (HhCYP6BQ27, HhCYP6BK13 and

HhCYP6BK24). In a previous phylogeny (Bansal & Michel 2018), HhCYPBK13 was present in a unique, H. halys specific cluster, and did not group with P450s from other insects. On the other hand, HhCYP6BK24 did not group with any H. halys P450s and was more closely related to a unique Rhodnius prolixus cluster. (Note: the phylogeny did not contain HhCYP6BQ27, but was included in this study). To further understand the role of these three genes in H. halys molecular biology, we used the more robust

technique of reverse transcriptase quantitative PCR (RT-qPCR) and compared gene

expression among sexes, diets and tissues. As H. halys has a wide host range and

causes damage to several agricultural crops, we chose diverse diets including apple

(fruit), corncob (vegetable) and soybean seeds (legume). We also chose three tissues

54 where P450 expression is common: gut, fat body and Malpighian tubules. Results from this study will provide useful insights on the role of CYP6B for detoxification and potential mechanisms of generalist herbivory in H. halys. Further, our results will increase our understanding of H. halys biology that can be useful for functional studies or exploited in developing sustainable pest management strategies for agricultural crops.

3.3 Material and methods:

Insects:

The Michel laboratory maintains H. halys colonies in an environmental growth chamber with 16:8 (light:dark) photoperiod, 28±2°C temperature and 60-70% relative humidity. The colony was originally established from a collection in an Ohio

Agricultural Research and Development Center (OARDC) soybean field in 2012

(GPS: 40.764, -81.910), and has been replenished every summer from various hosts

(soybeans, green beans, crabapples, homes) within a 5 km range of the original collection site. In our colonies, we provided H. halys with a varied diet including soybean, corncobs, green beans, celery, carrots, apples and grapes simultaneously.

Sequence analysis:

In a preliminary, semi-quantitative PCR study of several P450 genes, we selected three, full-length candidate P450 genes of the HhCYP6B clade (HhCYP6BQ27,

HhCYP6BK13 and HhCYP6BK24) that showed differential expression in guts, fat bodies and Malphigian tubules among other CYP6 genes. The genes were confirmed

55

as full-length as they have a complete open reading frame (see Figure 3.5) and were

also compared to the genome sequences of other model insects (Bansal & Michel

2018). (Note: full details on the preliminary study, including methods, full-length

sequences with start and stop codons of the genes studied are provided in the

supplementary information). The sequences, HhCYP6BQ27 (accession #

GEDY01006638.1), HhCYP6BK13 (accession # GEDY01000581.1) and

HhCYP6BK24 (accession # GEDY01005718.1) were obtained from the H. halys genome available at GenBank (accession no. GCA_000696795.2). A comprehensive phylogenetic tree, including these three genes, is provided in Bansal & Michel

(2018). However, we further compared and characterized these genes based on available information from P450 sequences of other insects. The deduced amino acid sequences were compared with other similar P450 sequences deposited in the

GenBank database using the BLASTp algorithm in NCBI

(https://blast.ncbi.nlm.nih.gov/), and structures of the sequences were predicted using the PSIPRED software (http://bioinf.cs.ucl.ac.uk/psipred/). We created a multiple

sequence alignment, aligning the amino acid sequences using ClustalW2 software

(www.ebi.ac.uk/Tools/msa/clustalw2/) with default parameters. We also calculated the molecular weight (http://www.bioinformatics.org/sms2/dna_mw.html) and

isoelectric point (http://isoelectric.ovh.org/) of the P450 genes.

Differential expression of HhCYP6B genes among diets, sex and tissues:

We provided different diets to H. halys to study the expression of three

HhCYP6B genes. Prior to the experiment, male and female H. halys were separated

56 and starved for 24 hours; we only provided water with a soaked cotton wick. After this starvation period, ten H. halys adults (equal number of males and females) were fed either apples, corn or soybean seeds in separate cages for five consecutive days; a cotton wick in all treatments also provided water. For the starved treatment (i.e. the control), H. halys only had access to water for five days. At the end of day five, three male and three female adults from each treatment, including controls, were collected in RNA later (Ambion, Applied Biosystems, TX, USA) and stored at -80°C until further processing.

We also compared HhCYP6B expression in different sexes and different tissues

(gut, fat body and Malpighian tubules). For these samples, a similar protocol was followed, except that H. halys were fed a mixed diet (apple, corn, sweet peas, green beans, celery, grapes and carrots). A total of 20 male and 20 female adults in the same cage were allowed to feed on the mixed diet for five days. At the end of day five, we collected three male and three female adults separately per replicate to measure the expression of HhCYP6B genes in different sexes. For expression in different tissues, we dissected the gut, fat body and Malpighian tubules from three adult males and females separately per replicate in 0.1M phosphate buffer saline (pH 7.0). The buffer was removed from all the dissected tissues prior to freezing at -80°C for RNA extraction. We included three biological replicates per treatment for comparisons among the sexes and the tissues.

RNA isolation, cDNA synthesis:

57

We isolated RNA from whole bodies (individual male and female separately)

and from the three tissues for each sex. We used the PureLink RNA kit (Ambion,

Applied Biosystems, TX, USA) for total RNA isolation following the manufacturer’s

instructions, including a PureLink DNase treatment to remove any DNA

contaminants. The concentration and purity of the total RNA were estimated by

Nanodrop 2000 spectrophotometer (Thermo Scientific, MA, USA). Using 1µg of

total RNA as the initial template, the first strand of cDNA was synthesized using the

iScript cDNA synthesis kit (Bio-Rad, CA, USA) following the manufacturer’s

protocol (catalog number -1708890) and stored at -20°C until using real time

quantitative polymerase chain reactions (RT-qPCR).

RT-qPCR analysis:

Using a Bio-Rad CFX96 real time thermocycler, mRNA of the three HhCYP6B genes was quantified using the following conditions: one cycle at 95°C for 3 min

(initial denaturation), 40 cycles at 95°C for 10 sec, 60°C for 30 sec and 65°C for 5 sec

(denaturation, annealing and extension) followed by final extension at 95°C for 50 sec. Primer sequences (with efficiencies) of the three P450 genes can be found in

Table 3.1 and melting curves can be found in Figure 3.4. Gene expression was normalized to the expression of an internal control, HhEF1α (elongation factor)

(Bansal et al. 2016). We chose to use this single reference gene since it had highly stable expression across all the treatments used in this study (Note: the standard deviation and P-values for HhEF1α gene across the treatments are given in Table 3.2, see also Bansal & Michel (2018) for additional stability assessment). For expression

58 analysis, mRNA of all the samples with three technical replicates was quantified by calculating the relative expression value using the delta delta Ct method (Schmittgen and Livak, 2001).

Statistical analysis:

For statistical analysis we used ANOVAs on the delta Ct values to determine significance. We used a four-way ANOVA for the host-specific treatment, a two-way

ANOVA for the sex-specific treatment and a three-way ANOVA for the tissue- specific treatment in Minitab 18. Independent experimental replicates included insects from different cages from different generations. Non-parametric, Kruskal-Wallis tests were used to measure the stability of reference gene, EF1. Differences between the treatments were considered statistically significant at P<0.05. The mean relative expression value and standard errors were calculated for each treatment based on three biological experimental replicates.

3.4 Results

Given the large number of P450s in the H. halys genome and transcriptome

(Bansal & Michel 2018), we first characterized gene expression by a more rapid and high-throughput semi- quantitative PCR. Our goal was to identify genes with consistent differential expression for a more robust characterization with RT-qPCR.

Based on this analysis (Figures 3.1-3.4), we chose three genes of interest

(HhCYP6BQ27, HhCYP6BK13 and HhCYP6BK24) to fully characterize in this study. These three genes were members of the CYPBQ and CYPBK groups, which

59

represented more than half the 75 CYP6 transcripts, in the H. halys transcriptome (37

and 27 genes, respectively).

Sequence characterization of three H. halys CYP6B genes

The three HhCYP6Bs shared similarities to several other members of the CYP6

family, based on comparisons of predicted amino acid sequences. Not surprisingly, all

three genes had the highest similarities to other P450s found within Hemipterans:

HhCYP6BQ27 exhibited the greatest similarity (50%) with a CYP6 from the bean

bug, Riptortus pedestris (GenBank BAN21142.1); HhCYP6BK13 showed the highest

identity to CYP6a14 from the bed bug, Cimex lectularius (34%; GenBank

XP_014250792.1); and HhCYP6BK24 had the greatest similarity with a P450 from

the small brown planthopper, Laodelphax striatella (43%; GenBank AGN52754.1).

Other sequence characteristics were relatively similar among all three HhCYP6B

genes. HhCYP6BQ27 contained an open reading frame (ORF) of 1560 bp (520 amino

acids) with a molecular weight of 512.05 kDa and isoelectric point of 7.27;

HhCYP6BK13 contained an ORF of 1509 bp (503 amino acids) with a molecular

weight of 551.01 kDa and isoelectric point of 7.28; and HhCYP6BK24 contained an

ORF of 1518 bp (506 amino acids) with a molecular weight of 513.04 kDa and

isoelectric point of 7.9. All three CYP6B genes contained a number of domains that

are highly conserved in P450 enzymes (Figure 3.5). These included the heme-binding signature motif (PFxxGxxxCxG) (Ranasinghe and Hobbs 1998; He et al. 2002) and 6 predicted substrate recognition sites (SRS). Other conserved motifs included the helix

C motif (WxxxR) that is present in most of the eukaryotic P450s (Jiang et al. 2008)

60

and the helix I-oxygen binding motif (A/GGxE/DTT/S) which is involved in substrate oxidation (Tripathi et al. 2013). The helix K motif (ExLR) acts as salt bridge in all

P450 proteins and the PxRF motif that follows the helix K is involved in heme- binding (Graham-Lorence and Peterson 1996; Kariakin et al. 2002). Strong similarities in sequence characteristics suggest that these three CYP6Bs have related functions within H. halys.

Sex-specific expression:

Expression of P450’s are known to differ among sexes in insects, and may be related to different physiological needs such as reproductive maturation or embryo development. To better understand the role of our three HhCYP6B genes among

sexes, we measured their expression in male and female whole bodies of H. halys

using RT-qPCR. Analysis revealed no significant differences in the mRNA expression of HhCYP6BQ27, HhCYP6BK13 or HhCYP6BK24 between male and female adults (F=2.22, P=0.162, Figure 3.6). We also did not observe any differences among the genes (F=2.57, P=0.118) and in tissue specific expression among males and females (Figure 3.7), supporting the whole body measurements.

Tissue-specific expression of HhCYP6 genes:

P450s, including the CYP6B’s, can be expressed in a wide array of tissues, and show tissue-specific expression. Understanding this specificity may help determine the molecular and physiological roles of each HhCYP6B. We quantified mRNA expression of our three HhCYP6B genes in different tissues. These tissues included

61

the gut, fat body and Malpighian tubules of male and female adults fed separately on

a mixed diet (apple, corn, sweet peas, green beans, celery, grapes and carrots). The

three HhCYP6B genes showed significant differential expression among tissues

(F=17.07, P<0.0001). HhCYP6BQ27 was significantly expressed higher (F=12.35,

P<0.001) in the fat body and Malpighian tubules of both males and females compared to gut (Figure 3.7A). The expression of HhCYP6BK13 was significantly higher

(F=21.18, P<0.000) in Malpighian tubules compared to gut and fat body of both males and females (Figure 3.7B). HhCYP6BK24 was differentially expressed among all tissues, with the highest expression in the fat bodies, followed by the Malpighian tubules, and then the least in the gut (all comparisons were significantly different,

F=69.40, P<0.0001, Figure 3.7C).

Host-specific expression:

We hypothesized that, if these CYP6Bs have roles in plant secondary metabolite

detoxification or in host feeding in general, that they would be differentially

expressed when H. halys was fed different diets. We quantified the expression of

HhCYP6BQ27, HhCYP6BK13 and HhCYP6BK24 using RT-qPCR when fed a single host typically encountered by H. halys. Our expression data showed that none of the three HhCYP6B genes was differentially expressed among H. halys fed different plant hosts (F=2.26, P=0.083) tissues (F=0.45, P=0.842), sex (F=0.07,

P=0.974), and their interaction (F=0.30, P=0.939) (Figure 3.8). Surprisingly, we did not see significant differences in expression when comparing fed H. halys to our

62

starved treatments; expression remained high despite that our starved insects only had

access to water for 5 days (Figure 3.8).

3.5 Discussion

H. halys has an expanded number of CYP450s, especially within the CYP6 clade

(Bansal & Michel, 2018). The role of CYP6 role in plant-insect interactions have

been reported in other insect species (Poupardin et al. 2010; Xie et al. 2018), but the

role of CYP6s in H. halys is unknown. We first used semi-quantitative PCR to obtain an overview of P450 gene expression (Figures 3.1-3.4). Then, we chose three

HhCYP6B genes (HhCYP6BQ27, HhCYP6BK13 and HhCYP6BK24) based on the

preliminary gene expression data as well as their evolutionary history (Bansal &

Michel 2018). To more confidently test our hypotheses of differential expression, we

comprehensively characterized these three P450’s using RT-qPCR gene expression comparisons.

In insects, CYPs can be differentially regulated among sexes, with specific roles such as xenobiotic metabolism and insecticide resistance (Yu et al. 2015; Zuo and

Chen 2014; Musasia et al. 2013). However, the expression of the three HhCYP6B genes was not significantly different among male and female adults fed on a mixed diet (Figure 3.6), among specific diets (Figure 3.8), nor specific tissues (Figure 3.7).

The role of these three CYP6B genes does not appear to be sex specific. We did choose three tissues that are common between males and females, and other tissues

(e.g. ovaries) may have differential expression. Yet our expression measurements on whole bodies (Figure 3.6) would not support this hypothesis. One factor not included

63

in our study was a comparison between mated and unmated females. In Drosophila

melanogaster, as embryos develop, several CYP6 genes are downregulated

presumably because mated females allocate resources towards reproduction rather

than detoxification (McGraw et al. 2004).

Our data showed that H. halys does not regulate the expression of these three

CYP6B genes based on host diet (Figure 3.8). As a polyphagous insect, H. halys might use a cocktail of broad-spectrum detoxification enzymes that interact with a variety of compounds encountered in their diets and these three CYP6Bs may be part of that cocktail. In this case, it may be more advantageous to constitutively express these genes than to selectively turn them on or off depending on the host. Indeed, the similar expression level present in starved insects (Figure 3.8) would support constitutive expression. Similar results were observed in the generalist butterfly,

Polygonia c-album, where none of the P450s was differentially expressed in the

midgut among insects fed different host plants (Fischer et al. 2009). Although we

provided H. halys plant hosts known to be acceptable, we do not know what, if any,

secondary metabolites may be present in the host plants used in our study that would

cause an adverse impact on H. halys biology and where specific detoxification may

be needed. Indeed, one limitation with our study is that we only provided three

different hosts, and H. halys is known to feed on over 169 hosts. Additional

experiments with other hosts, non-preferred hosts, H. halys resistant hosts or by

RNA-interference gene knockdown could help explain the role, if any, of these three

HhCYP6B genes on plant-insect interactions. Nonetheless, the relatively high

64

expression of the three HhCYP6B genes in starved insects may suggest different or

additional roles.

CYP6B genes may have functions unrelated to host metabolism or sex-specific

physiologies. For example, the beetle Dastarcus helophoroides had significantly

higher expression of CYP6BK18 in fat bodies and Malpighian tubules; this particular

CYP6B was hypothesized to play a role in regulating development and aging (Li et

al. 2014). Similarly, we observed differential expression at the tissue level among the

three HhCYP6B genes evaluated in this study (Figure 3.7). Like CYP6BK18 in D. helophoroides, the expression of HhCYP6BQ27 was significantly higher in the fat

body and Malpighian tubules compared to the gut. A similar expression pattern was

observed in the rice leaf-folder Cnaphalocrocis medinalis, where CYP6 genes

(CYP6AB62 and CYP6AE76) were highly expressed in the fat body and Malpighian

tubules (Liu et al. 2015). Both of these tissues can potentially play a role in energy

metabolism and detoxification of host toxins and compounds. The expression of

HhCYP6BK13 was highest in Malpighian tubules compared to the gut or fat body.

Malpighian tubules are known for the excretion, metabolism and detoxification of

xenobiotic compounds (Dow and Davies 2006; J. Yang et al. 2007). Previous studies

have shown that CYP6 members had high expression in Malpighian tubules and

potentially play a role in osmoregulation and detoxification (Wang et al. 2004;

Socolowski et al. 2016; Bansal and Michel 2018). HhCYP6BK24 showed the most

differential expression, with significant differences among all three tissues. D.

helophoroides also differentially regulated CYP6BK genes in different tissues

including the midgut, fat body and Malpighian tubules (Li et al. 2014). The diverse

65

involvement of CYP6 genes in physiological processes of insects suggests additional

roles such as hormone biosynthesis and degradation might exist for these three

CYP6B genes in H. halys (Warren et al. 2002; Petersen et al. 2004).

In summary, we characterized and validated sex-specific, tissue-specific and host-specific expression of three HhCYP6 genes. The results showed differential transcription profiles in tissues suggesting their role in diverse and important physiological functions related to the gut, fat body and Malpighian tubules. Although we did not find evidence that these CYP6 genes play a role in mediating plant-insect interactions or sex-specific processes, these genes were constitutively expressed, with differential expression among tissues. It would be important to understand, however, if the expression patterns observed in our study also apply to non-invasive populations, or if the constitutive expression is part of invasion adaptation.

Additionally, using functional tools like RNA interference can further identify their role and specific regulation mechanisms in metabolism and detoxification.

66

3.6 References:

Bagchi, Vikram A., Joel P. Siegel, Mark R. Demkovich, Luke N. Zehr, and May R.

Berenbaum. 2016. “Impact of Pesticide Resistance on Toxicity and Tolerance of

Hostplant Phytochemicals in Amyelois Transitella (Lepidoptera: Pyralidae).”

Journal of Insect Science 16 (1): iew063. https://doi.org/10.1093/jisesa/iew063.

Bansal, Raman, and Andy Michel. 2018. “Expansion of Cytochrome P450 and Cathepsin

Genes in the Generalist Herbivore Brown Marmorated Stink Bug.” BMC Genomics

19 (1): 60. https://doi.org/10.1186/s12864-017-4281-6.

Bansal, Raman, Priyanka Mittapelly, Yuting Chen, Praveen Mamidala, Chaoyang Zhao,

and Andy Michel. 2016. “Quantitative RT-PCR Gene Evaluation and RNA

Interference in the Brown Marmorated Stink Bug.” Plos One 11 (5): e0152730.

https://doi.org/10.1371/journal.pone.0152730.

Bass, Chris, and Linda M Field. 2011. “Gene Amplification and Insecticide Resistance.”

Pest Management Science 67 (8): 886–90. https://doi.org/10.1002/ps.2189.

Cintra-Socolowski, Priscila, Roberta Nocelli, Thaisa Roat, Elaine Silva-Zacarin, and

Osmar Malaspina. 2016. “Comparative Physiology of Malpighian Tubules: Form

and Function.” Open Access Insect Physiology 6 (April): 13.

https://doi.org/10.2147/OAIP.S72060.

Claudianos, C, H Ranson, R M Johnson, S Biswas, M A Schuler, M R Berenbaum, R

Feyereisen, and J G Oakeshott. 2006. “A Deficit of Detoxification Enzymes:

Pesticide Sensitivity and Environmental Response in the Honeybee.” Insect

Molecular Biology 15 (5): 615–36. https://doi.org/10.1111/j.1365-

67

2583.2006.00672.x.

Cohen, M B, M A Schuler, and M R Berenbaum. 1992. “A Host-Inducible Cytochrome

P-450 from a Host-Specific Caterpillar: Molecular Cloning and Evolution.”

Proceedings of the National Academy of Sciences of the United States of America 89

(22): 10920–24. https://doi.org/10.1073/PNAS.89.22.10920.

D.G. Hoshizaki, L.I. Gilbert, K. Iatrou, S.S. Gill. 2005. Fat-Cell Development:

Comprehensive Molecular Insect Science. Amsterdam: Elsevier.

Dermauw, Wannes, Nicky Wybouw, Stephane Rombauts, Bjorn Menten, John Vontas,

Miodrag Grbic, Richard M Clark, Rene Feyereisen, and Thomas Van Leeuwen.

2013. “A Link between Host Plant Adaptation and Pesticide Resistance in the

Polyphagous Spider Mite Tetranychus Urticae.” Proceedings of the National

Academy of Sciences of the United States of America 110 (2): E113-22.

https://doi.org/10.1073/pnas.1213214110.

Dow, Julian A T, and Shireen A Davies. 2006. “The Malpighian Tubule: Rapid Insights

from Post-Genomic Biology.” Journal of Insect Physiology 52 (4): 365–78.

https://doi.org/10.1016/j.jinsphys.2005.10.007.

Feyereisen, René. 1999. “Insect P450 Enzymes.” Annual Review of Entomology 44: 507–

33.

Feyereisen, René. 2006. “Evolution of Insect P450” 34: 1252–55.

Feyereisen, René. 2012. “Insect CYP Genes and P450 Enzymes.” In Insect Molecular

Biology and Biochemistry, 236–316. Elsevier. https://doi.org/10.1016/B978-0-12-

68

384747-8.10008-X.

Graham-Lorence, S E, and J A Peterson. 1996. “Structural Alignments of P450s and

Extrapolations to the Unknown.” Methods in Enzymology 272: 315–26.

Guengerich, F P. 2001. “Common and Uncommon Cytochrome P450 Reactions Related

to Metabolism and Chemical Toxicity.” Chemical Research in Toxicology 14 (6):

611–50. http://www.ncbi.nlm.nih.gov/pubmed/11409933.

Gutierrez, Eugenio, David Wiggins, Barbara Fielding, and Alex P Gould. 2007.

“Specialized Hepatocyte-like Cells Regulate Drosophila Lipid Metabolism.” Nature

445 (7125): 275–80. https://doi.org/10.1038/nature05382.

He, H, A C Chen, R B Davey, and G W Ivie. 2002. “Molecular Cloning and Nucleotide

Sequence of a New P450 Gene, CYP319A1, from the Cattle Tick, Boophilus

Microplus.” Insect Biochemistry and Molecular Biology 32 (3): 303–9.

Heidel-Fischer, Hanna M, Dalial Freitak, Niklas Janz, Lina Söderlind, Heiko Vogel, and

Sören Nylin. 2009. “Phylogenetic Relatedness and Host Plant Growth Form

Influence Gene Expression of the Polyphagous Comma Butterfly (Polygonia c-

Album).” BMC Genomics 10 (1): 506. https://doi.org/10.1186/1471-2164-10-506.

Helvig, Christian, Nathalie Tijet, René Feyereisen, F Ann Walker, and Linda L Restifo.

2004. “Drosophila Melanogaster CYP6A8, an Insect P450 That Catalyzes Lauric

Acid (Omega-1)-Hydroxylation.” Biochemical and Biophysical Research

Communications 325 (4): 1495–1502. https://doi.org/10.1016/j.bbrc.2004.10.194.

Hoebeke, E. R., and M. E. Carter. 2003. “Halyomorpha Halys (Stål) (Heteroptera:

69

Pentatomidae): A Polyphagous Plant Pest from Asia Newly Detected in North

America.” Proceedings of the Entomological Society of Washington 105 (1): 225–

37.

Huber, D. P. W., M. L. Erickson, C. M. Leutenegger, J. Bohlmann, and S. J. Seybold.

2007. “Isolation and Extreme Sex-Specific Expression of Cytochrome P450 Genes

in the Bark Beetle, Ips Paraconfusus, Following Feeding on the Phloem of Host

Ponderosa Pine, Pinus Ponderosa.” Insect Molecular Biology 16 (3): 335–49.

https://doi.org/10.1111/j.1365-2583.2007.00731.x.

Hung, C F, M R Berenbaum, and M A Schuler. 1997. “Isolation and Characterization of

CYP6B4, a Furanocoumarin-Inducible Cytochrome P450 from a Polyphagous

Caterpillar (Lepidoptera:Papilionidae).” Insect Biochemistry and Molecular Biology

27 (5): 377–85. http://www.ncbi.nlm.nih.gov/pubmed/9219364.

Jiang, Hong-Bo, Jin-Jun Wang, Guo-Ying Liu, and Wei Dou. 2008. “Molecular Cloning

and Sequence Analysis of a Novel P450 Gene Encoding CYP345D3 from the Red

Flour Beetle, Tribolium Castaneum.” Journal of Insect Science (Online) 8: 1–7.

https://doi.org/10.1673/031.008.5501.

Jones, Christopher M., Miriam Daniels, Melanie Andrews, Russell Slater, Robert J. Lind,

Kevin Gorman, Martin S. Williamson, and Ian Denholm. 2011. “Age-Specific

Expression of a P450 Monooxygenase (CYP6CM1) Correlates with Neonicotinoid

Resistance in Bemisia Tabaci.” Pesticide Biochemistry and Physiology 101 (1): 53–

58. https://doi.org/10.1016/J.PESTBP.2011.07.004.

Kariakin, Andrei, Dimitri Davydov, Julian A Peterson, and Christiane Jung. 2002. “A

70

New Approach to the Study of Protein-Protein Interaction by FTIR: Complex

Formation between Cytochrome P450BM-3 Heme Domain and FMN Reductase

Domain.” Biochemistry 41 (46): 13514–25.

Lamb, David C, and Michael R Waterman. 2013. “Unusual Properties of the Cytochrome

P450 Superfamily.” Philosophical Transactions of the Royal Society of London.

Series B, Biological Sciences 368 (1612): 20120434.

https://doi.org/10.1098/rstb.2012.0434.

Lee, Doo-Hyung, Brent D Short, Shimat V Joseph, J Christopher Bergh, and Tracy C

Leskey. 2013. “Review of the Biology, Ecology, and Management of Halyomorpha

Halys (Hemiptera: Pentatomidae) in China, Japan, and the Republic of Korea.”

Environmental Entomology 42 (4): 627–41. https://doi.org/10.1603/EN13006.

Lee, Wonhoon, Roberto Guidetti, Michele Cesari, T.D. Gariepy, Yong-Lak Park, and

Chang-Gyu Park. 2018. “Genetic Diversity of Halyomorpha Halys (Hemiptera,

Pentatomidae) in Korea and Comparison with COI Sequence Datasets from East

Asia, Europe, and North America.” Florida Entomologist 101 (1): 49–54.

https://doi.org/10.1653/024.101.0110.

Li, Fei Fei, Hai Dong Wang, Wang Song, Jun Cui, and Meng Lou Li. 2014. “Molecular

Cloning and Characterization of a Novel P450 Gene Encoding CYP6BK18 from

Dastarcus Helophoroides (Coleoptera: Bothrideridae).” Journal of Insect Science 14

(February): 1–8. https://doi.org/10.1093/jisesa/ieu105.

Li, W., M. A. Schuler, and M. R. Berenbaum. 2003. “Diversification of Furanocoumarin-

Metabolizing Cytochrome P450 Monooxygenases in Two Papilionids: Specificity

71

and Substrate Encounter Rate.” Proceedings of the National Academy of Sciences

100 (Supplement 2): 14593–98. https://doi.org/10.1073/pnas.1934643100.

Li, X., J. Baudry, M. R. Berenbaum, and M. A. Schuler. 2004. “Structural and Functional

Divergence of Insect CYP6B Proteins: From Specialist to Generalist Cytochrome

P450.” Proceedings of the National Academy of Sciences 101 (9): 2939–44.

https://doi.org/10.1073/pnas.0308691101.

Li, Xianchun, Mary A Schuler, and May R Berenbaum. 2007. “Molecular Mechanisms of

Metabolic Resistance to Synthetic and Natural Xenobiotics.” Annual Review of

Entomology 52: 231–53. https://doi.org/10.1146/annurev.ento.51.110104.151104.

Liu, Su, Xiang Jun Rao, Mao Ye Li, and Shi Guang Li. 2015. “Identification and

Expression Profiles of Putative Cytochrome P450 Monooxygenase Genes from

Cnaphalocrocis Medinalis (Lepidoptera: Pyralidae).” Entomological Research 45

(3): 141–49. https://doi.org/10.1111/1748-5967.12106.

Mao, W, M A Schuler, and M R Berenbaum. 2007. “Cytochrome P450s in Papilio

Multicaudatus and the Transition from Oligophagy to Polyphagy in the

Papilionidae.” Insect Molecular Biology 16 (4): 481–90.

https://doi.org/10.1111/j.1365-2583.2007.00741.x.

McGraw, Lisa A., Greg Gibson, Andrew G. Clark, and Mariana F. Wolfner. 2004.

“Genes Regulated by Mating, Sperm, or Seminal Proteins in Mated Female

Drosophila Melanogaster.” Current Biology 14 (16): 1509–14.

https://doi.org/10.1016/J.CUB.2004.08.028.

72

Musasia, Fauzia K, Alfred O Isaac, Daniel K Masiga, Irene A Omedo, Ramadhan

Mwakubambanya, Richard Ochieng, and Paul O Mireji. 2013. “Sex-Specific

Induction of CYP6 Cytochrome P450 Genes in Cadmium and Lead Tolerant

Anopheles Gambiae.” Malaria Journal 12 (March): 97.

https://doi.org/10.1186/1475-2875-12-97.

Peiffer, Michelle, and Gary W. Felton. 2014. “Insights into the Saliva of the Brown

Marmorated Stink Bug Halyomorpha Halys (Hemiptera: Pentatomidae).” PLoS

ONE 9 (2): e88483. https://doi.org/10.1371/journal.pone.0088483.

Petersen Brown, R., M. R. Berenbaum, and M. A. Schuler. 2004. “Transcription of a

Lepidopteran Cytochrome P450 Promoter Is Modulated by Multiple Elements in Its

5′ UTR and Repressed by 20-Hydroxyecdysone.” Insect Molecular Biology 13 (4):

337–47. https://doi.org/10.1111/j.0962-1075.2004.00486.x.

Poupardin, R., M. A. Riaz, J. Vontas, J. P. David, and S. Reynaud. 2010. “Transcription

Profiling of Eleven Cytochrome P450s Potentially Involved in Xenobiotic

Metabolism in the Mosquito Aedes Aegypti.” Insect Molecular Biology 19 (2): 185–

93. https://doi.org/10.1111/j.1365-2583.2009.00967.x.

Ranasinghe, C, and A A Hobbs. 1998. “Isolation and Characterization of Two

Cytochrome P450 CDNA Clones for CYP6B6 and CYP6B7 from Helicoverpa

Armigera (Hubner): Possible Involvement of CYP6B7 in Pyrethroid Resistance.”

Insect Biochemistry and Molecular Biology 28 (8): 571–80.

Rupasinghe, S. G., Z. Wen, T.-L. Chiu, and M. A. Schuler. 2007. “Helicoverpa Zea

CYP6B8 and CYP321A1: Different Molecular Solutions to the Problem of

73

Metabolizing Plant Toxins and Insecticides.” Protein Engineering Design and

Selection 20 (12): 615–24. https://doi.org/10.1093/protein/gzm063.

Scott, J G, and Z Wen. 2001. “Cytochromes P450 of Insects: The Tip of the Iceberg.”

Pest Management Science 57 (10): 958–67. https://doi.org/10.1002/ps.354.

Snodgrass, G L, J J Jr Adamczyk, and J Gore. 2005. “Toxicity of Insecticides in a Glass-

Vial Bioassay to Adult Brown, Green, and Southern Green Stink Bugs (Heteroptera:

Pentatomidae).” Journal of Economic Entomology 98 (1): 177–81.

Sosa-Gomez, Daniel R, Jovenil J Da Silva, Ivani de Oliveira Negrao Lopes, Ivan C

Corso, Alvaro M R Almeida, Giorla C Piubelli De Moraes, and Matrhew E Baur.

2009. “Insecticide Susceptibility of Euschistus Heros (Heteroptera: Pentatomidae) in

Brazil.” Journal of Economic Entomology 102 (3): 1209–16.

“Stop BMSB: Biology, Ecology, and Management of Brown Marmorated Stink Bug in

Specialty Crops.” 2014. 2014. http://www.stopbmsb.org.

Tripathi, Sarvind, Huiying Li, and Thomas L Poulos. 2013. “Structural Basis for Effector

Control and Redox Partner Recognition in Cytochrome P450.” Science (New York,

N.Y.) 340 (6137): 1227–30. https://doi.org/10.1126/science.1235797.

Tzou, P, S Ohresser, D Ferrandon, M Capovilla, J M Reichhart, B Lemaitre, J A

Hoffmann, and J L Imler. 2000. “Tissue-Specific Inducible Expression of

Antimicrobial Peptide Genes in Drosophila Surface Epithelia.” Immunity 13 (5):

737–48.

Wang, Jing, Laura Kean, Jingli Yang, Adrian K Allan, Shireen A Davies, Pawel Herzyk,

74

and Julian AT Dow. 2004. “Function-Informed Transcriptome Analysis of

Drosophila Renal Tubule.” Genome Biology 5 (9): R69. https://doi.org/10.1186/gb-

2004-5-9-r69.

Warren, James T, Anna Petryk, Guillermo Marques, Michael Jarcho, Jean-Philippe

Parvy, Chantal Dauphin-Villemant, Michael B O’Connor, and Lawrence I Gilbert.

2002. “Molecular and Biochemical Characterization of Two P450 Enzymes in the

Ecdysteroidogenic Pathway of Drosophila Melanogaster.” Proceedings of the

National Academy of Sciences of the United States of America 99 (17): 11043–48.

https://doi.org/10.1073/pnas.162375799.

Wen, Zhimou, Liping Pan, May R Berenbaum, and Mary A Schuler. 2003. “Metabolism

of Linear and Angular Furanocoumarins by Papilio Polyxenes CYP6B1 Co-

Expressed with NADPH Cytochrome P450 Reductase.” Insect Biochemistry and

Molecular Biology 33 (9): 937–47. http://www.ncbi.nlm.nih.gov/pubmed/12915185.

Wen, Zhimou, and Jeffrey G Scott. 2001. “Cytochrome P450 CYP6L1 Is Specifically

Expressed in the Reproductive Tissues of Adult Male German Cockroaches,

Blattella Germanica (L.).” Insect Biochemistry and Molecular Biology 31 (2): 179–

87. https://doi.org/10.1016/S0965-1748(00)00116-8.

Werck-Reichhart, Danièle, and René Feyereisen. 2000. “Cytochromes P450: A Success

Story.” Genome Biology 1 (6): reviews3003.1. https://doi.org/10.1186/gb-2000-1-6-

reviews3003.

Xie, Wen, Xin Yang, Chunhai Chen, Zezhong Yang, Litao Guo, Dan Wang, Jinqun

Huang, et al. 2018. “The Invasive MED/Q Bemisia Tabaci Genome: A Tale of Gene

75

Loss and Gene Gain.” BMC Genomics. https://doi.org/10.1186/s12864-018-4448-9.

Xu, Yong-qiang, Jin-jun Wang, Hong-bo Jiang, Wei Dou, Pei-an Tang, and Feng-ming

An. 2009. “Identification, Characterization, and Expression of P450 Gene Encoding

CYP6BQ13v2 from the Red Flour Beetle, Tribolium Castaneum (Herbst)

(Coleoptera: Tenebrionidae).” Agricultural Sciences in China 8 (10): 1210–18.

https://doi.org/10.1016/S1671-2927(08)60331-4.

Yang, Jingli, Caroline McCart, Debra J Woods, Selim Terhzaz, Karen G Greenwood,

Richard H ffrench-Constant, and Julian A T Dow. 2007. “A Drosophila Systems

Approach to Xenobiotic Metabolism.” Physiological Genomics 30 (3): 223–31.

https://doi.org/10.1152/physiolgenomics.00018.2007.

Yang, Z, Y Zhang, X Liu, and X Wang. 2011. “Two Novel Cytochrome P450 Genes

CYP6CS1 and CYP6CW1 from Nilaparvata Lugens (Hemiptera: Delphacidae):

CDNA Cloning and Induction by Host Resistant Rice.” Bulletin of Entomological

Research 101 (1): 73–80. https://doi.org/10.1017/S0007485310000192.

Yu, Liying, Weiqi Tang, Xiaoli Ma, Liette Vasseur, W. Simon Baxter, Guang Yang,

Shiguo Huang, Fengqin Song, and Minsheng You. 2015. “Characterization and

Expression of the Cytochrome P450 Gene Family in Diamondback Moth, Plutella

Xylostella (L.),” 1–9. https://doi.org/10.1038/srep08952.

Zhu, Fang, Timothy W Moural, David R Nelson, and Subba R Palli. 2016. “A Specialist

Herbivore Pest Adaptation to Xenobiotics through Up-Regulation of Multiple

Cytochrome P450s.” Scientific Reports 6 (February): 20421.

https://doi.org/10.1038/srep20421.

76

Zuo, Yu-Han, and Mei-Er Chen. 2014. “Differential Gene Expression in Male and

Female Fat Body in the Oriental Fruit Fly, Bactrocera Dorsalis.” Archives of Insect

Biochemistry and Physiology 85 (1): 48–59. https://doi.org/10.1002/arch.21142.

77

3.7 Tables and figures

Expression analysis of 13 HhCYP6 genes using semi-quantitative-PCR (sq-PCR):

All the primers used in this study (S1) were synthesized using IDT PrimerQuest tool and were obtained from IDT technologies (Coralville, IA). For the sq-PCR, we quantified the mRNA expression of 13 HhCYP6 genes using PCR master cycler ep gradient (Eppendorf, Hamburg, Germany). The total volume of each PCR reaction was 20µl, consisting 1µl cDNA, 1µM of forward and reverse primers, 10µl of GoTaq green master mix (Promega, WI) and nuclease free water. The cycling conditions for

PCR amplifications were one cycle of initial denaturation at 95°C (5 min), followed by 30 cycles of denaturation (94°C for 30sec), annealing and extension (48-50°C and

72°C for 30sec). One cycle of final extension was at 72°C for 5min.

The amplified PCR samples were electrophoresed on a 2% agarose gel using 4µl of 10mg/ml ethidium bromide solution (Thermo Scientific, MA) and visualized in the gel imaging system (Thermo Scientific, MyECL Imager, NY). All the gel images were analyzed using the open source image-processing ImageJ (imagej.nih.gov/ij/).

The band intensity values generated from ImageJ were used to produce heat maps using data visualization tool, Plotly (plot.ly, version 2.0). The sq-PCR study was performed on one biological replicate and validation of gene expression patterns using RT-qPCR had three biological replicates. Each biological replicate had four samples including starved, apple, corn and soybean fed H. halys adults. Each sample had tissues gut, fat body and Malpighian tubules dissected from 6 H. halys males and females adults separately.

78

Primer Tm Size Effa Forward Sequence Reverse Sequence Name (0C) (bp) % HhCYP6BQ17 GAAGACGGTACAGGTATTGG GTGGACTTGAGGCAGAATAG 50 97 HhCYP6BQ27 GCTATTCTCCCGCTCCTTATG GCCACCTGTTACCTCTCAATAG 50 154 93 HhCYP6BQ39 CCAAACATCCTCTCAGTTACC CACCTTCTGCAGCATCAA 50 101 HhCYP6BQ40 CCATAACAGCCTTGGCTTAC GGCCTGGTAGACACTTTATTC 48 87 HhCYP6BK11 CACCAGAGAATGAAGGGAACA TTAGTCTGCAGGAGTCCAAATC 50 100 HhCYP6BK13 GACCATGGACCGTTCTTGATAG TTCTCACTGCCCTCCATTTG 48 94 103 HhCYP6BK21 GTTATGCAGGCTGTTCTCTC CACTCAGTCGATGTTGAAGG 48 95 HhCYP6BK24 GGGTCAGTTAGTGTGTTCAG CGGGACAACCCTTTGATAC 50 100 111 HhCYP6BK7 GTCCTGTCAGATTCGGTTATAG CTTCTGCTCACTGGTTTCA 50 129 HhCYP6BR2 GAGCCCAAAGGAGCATTAC ATTCCGGGTCTCGAATCA 50 133 HhCYP6BN1 GTCGAAGAAGTGGTCGAATG ACCGATTGGAGGCTACTT 48 103 HhCYP6A14 ATGCTGGTCGAAGTTTGG GAGGACTGTGCTCTGATTTG 48 99 HhCYP6BS2 TCCAGGGTACTGCTTCAT GGTCGCTTATGCCTTCTATC 52 133 HhEF1α GCTGATTGTGCTGTGTTA ACGAGTCTGTCCATTCTT 55 78 98 aPrimer efficiency (note: only primers used for qRT-PCR are included)

Table 3.1: Primer sequences of 13 HhCYP6 genes and housekeeping gene (elongation factor-1 α, EF1α)

79

Treatment - Standard Statistic Median P-value Sex Deviation Test Male 19.5291 0.662 Mann- 0.383 Female 22.9999 2.619 Whitney

Treatment - Standard Statistic Median P-value Tissue Deviation Test Gut 18.9935 1.418

Fat body 17.9193 2.253 Kruskal- 0.717 Malpighian 1.463 Wallis tubules 19.3465

Treatment - Standard Statistic Median P-value Diet Deviation Test Apple 0.771 18.4092 Corn 20.0339 1.684 0.076 Soybean 19.4535 1.009 Kruskal- Wallis Starved 19.0151 1.445

Standard Statistic Treatment Median P-value deviation test Sex 19.59699531 2.219

Tissue 18.99347465 1.652 Kruskal- 0.389 Diet 19.14542913 1.446 Wallis

Table 3.2: Expression stability of HhEF1α across treatments

Standard deviation and P-value was calculated using non-parametric tests for HhEF1α gene across and within the treatments using the averaged Ct values generated from qRT-

PCR.

80

Figure 3.1: Heat map showing expression of 13 HhCYP6 genes in the guts of male

and female adults fed on different hosts. Hosts studied include apple, corn, and

soybean, starved being our control. The scale on the right indicates the intensity of

expression (low to high). The genes used for our study, HhCYP6BQ27,

HhCYP6BK13 and HhCYP6BK24, are highlighted with blue arrows.

The heat map shows lower expression of HhCYP6BQ27, HhCYP6BQ39,

HhCYP6BK11, HhCYP6BK13 and HhCYP6BK24 genes in male guts compared to female guts that were starved or apple or corn fed. In soybean fed, they either had same expression or were higher in males compared to female guts.

81

Figure 3.2: Heat map showing expression of 13 HhCYP6 genes in the fat body of

male and female adults fed on different hosts. Hosts studied include apple, corn, and

soybean, starved being our control. The scale on the right indicates the intensity of

expression (low to high).

The heat map shows 6 HhCYP6 genes (HhCYP6BQ17, HhCYP6BQ27,

HhCYP6BQ39, HhCYP6BK11, HhCYP6BK13 and HhCYP6BK24) out of 13 had lower expression in males compared to females that were starved or apple or corn fed.

In soybean fed, the expression was higher in males compared to female fat body

82

Figure 3.3: Heat map showing expression of 13 HhCYP6 genes in the Malpighian

tubules of male and female adults fed on different hosts. Hosts studied include apple,

corn, and soybean, starved being our control. The scale on the right indicates the

intensity of expression (low to high).

The heat map shows 7 HhCYP6 genes (HhCYP6BQ27, HhCYP6BK13,

HhCYP6BK24, HhCYP6BK7, HhCYP6A14, HhCYP6BN1 and HhCYP6BS2) were up regulated in Malpighian tubules of males compared to females across all diets.

The results from preliminary study showed 3 full-length genes (HhCYP6BQ27,

HhCYP6BK13 and HhCYP6BK24) differentially expressed in all the tissues studied

(gut, fat body and Malpighian tubules).

83

HhCYP6BQ27

HhCYP6BK13

Figure 3.4: Melting curves from the qRT-PCR analysis of HhCYP6BQ27,

HhCYP6BK24, HhCYP6BK13 and HhEF1α.

84

HhCYP6BK24

EF1

85

Figure 3.5: Multiple sequence alignment of H. halys HhCYP6BQ27, HhCYP6BK13 and HhCYP6BK24 protein sequences. Amino acid conservations are: “*”single, fully conserved residue; “:”conservation of strong groups; “.”conservation of weak groups;

“no label” represents no consensus. Substrate recognition sites (SRS) (black colored box), heme-binding signature motif (PFxxGxxxCxG) (red box), helix C motif

(WxxxR) (blue box), helix I-oxygen binding motif (A/GGxE/DTT/S) (purple box), helix K motif (ExLR) (green box), are highlighted in boxes.

86

Figure 3.6: The mRNA expression of HhCYP6BQ27, HhCYP6BK13 and

HhCYP6BK24 in male and female adults of H. halys fed on mixed diet. Bars represent the mean of three biological replicates with ± standard error. No significant differences were observed.

87

Figure 3.7: The relative mRNA expression of HhCYP6BQ27 (Fig. 3A),

HhCYP6BK13 (Fig. 3B), HhCYP6BK24 (Fig. 3C), in gut, fat body and Malpighian tubules of male and female H. halys. Bars represent the mean of three biological replicates with ± standard error. Bars labeled with a different letter indicate significant difference.

88

Figure 3.8: The mRNA expression of HhCYP6BQ27, HhCYP6BK13 and

HhCYP6BK24 in different tissues of male and female H. halys fed on different hosts.

Bars represent the mean of three biological replicates with ± standard error. No significant differences were observed among the diets.

89

CHAPTER 4

RNAi mediated silencing of catalase, vacuolar ATPase and cytochrome p450

reductase genes in Halyomorpha halys

Part of the work from this chapter was published in PloS One under the title

'Quantitative RT PCR Gene Evaluation and RNA Interference in the Brown

Marmorated Stink Bug' (Bansal et al. 2016).

4.1 Abstract

The mechanism of RNA interference (RNAi) has emerged as an efficient functional tool to explore gene functions and as a potential insect control measure.

RNAi is a process in which the introduction of double-stranded RNA (dsRNA) or small interfering RNA (siRNA) inhibits gene expression by degrading the target specific mRNA sequence. Since the discovery of RNAi, numerous studies have successfully introduced synthetic dsRNA or siRNA into several insect species triggering the RNAi pathway. Delivering dsRNA by microinjection and siRNA by nebulization can be a functional and potential management tool in notorious agricultural pests such as the brown marmorated stink bug, Halyomorpha halys. H. halys is an invasive polyphagous pest that causes severe damage to >170 plant species including important agricultural crops. In this study, we have successfully silenced the expression of catalase (HhCAT), vacuolar-type ATPase subunit-a

(HhvATP) and NADPH-dependent cytochrome P450 reductase (HhCPR) of H. halys by RNAi injection. These genes are previously known to be effective RNAi targets

90

with vital physiological roles in several other insects. In addition to reduced

expression, introduction of dsvATP also has negative impact on the survival of H.

halys adults compared to the dsGFP treated control. Preliminary results of RNAi

using nebulization also showed significant gene reduction in HhCPR-siRNA treated

H. halys nymphs. This successful development of RNAi technique in H. halys has considerable potential to evaluate gene functions and pursue potential RNAi based pest management tactics.

4.2 Introduction

RNA interference (RNAi) is an effective tool to study gene functions by silencing the expression of genes and assessing the phenotypic impacts (Li et al. 2013). This mechanism was first discovered in Caenorhabditis elegans that resulted sequence- specific gene knockdown (Fire et al. 1998). Since then, RNAi has been developed in different ways and has many applications. RNAi results in the reduction of sequence specific gene expression at the post-transcriptional level, as introduced double stranded RNA (dsRNA) causes the degradation of identical mRNAs (Hannon 2002).

There are different ways to deliver dsRNA in insects, including microinjection, ingestion and soaking (Yu et al. 2013). Injection and feeding or ingestion are the most common ways to deliver dsRNA to activate the RNAi pathway in insects.

Nebulization is another novel method to silence the expression of target genes, where small interfering RNA (siRNA) particles are released in the form of a mist or fine air spray into a container where insects are placed (Li et al. 2013). The nebulized siRNAs enter the insect spiracles, pass to the insect tracheae and to the target gene to

91

silence its expression in a quick and non-invasive manner. Nebulization method in insects has been recently emerged and its applicability in the field is yet to be known.

RNAi has been demonstrated in several insect orders including Coleoptera,

Diptera, Hemiptera, Hymenoptera, Isoptera and Lepidoptera (Zha et al. 2011; Mutti et al. 2008; Baum and Roberts 2014). The efficiency of RNAi substantially varies among different insect orders (Terenius et al. 2011; Yu et al. 2013). The delivery mode of dsRNA greatly impacts the RNAi efficiency. Several studies on insects including Blattella germanica (Huang et al. 2013) and Schistocerca gregaria

(Wynant et al. 2014) showed that introducing dsRNA by injection is the most successful method of delivery. RNAi by injection and other methods are developed specifically for functional genomic studies in numerous hemipteran and dipteran insects (Jaubert et al. 2007; Araujo et al. 2006; Piermarini et al. 2017. A study on brown marmorated stink bug (Halyomorpha halys) showed an increased level of immune-related genes following non-sterile punctures (Sparks et al. 2014).

Brown marmorated stink bug (H. halys) is an invasive polyphagous pest that causes severe feeding damage to at least 170 plant species including important agricultural commodities (http://www.stopbmsb.org). H. halys is native to Eastern

Asian countries including China, Taiwan and was first detected in the United States near Allentown, Pennsylvania in 1996 (Hoebeke and Carter 2003). It has now spread to 44 states in the United States and also found in four Canadian provinces

(http://www.stopbmsb.org). H. halys is also considered as a nuisance pest as it invades indoor spaces such as houses and schools for overwintering (Leskey et al.

2012). Farmers have limited options to control feeding damage caused by H. halys to

92

agricultural crops except for using insecticides (Owens et al. 2013). As RNAi via

microinjection has proved to be effective in studying gene functions, the mechanism

of RNAi can be used initially as a functional tool to identify target genes that play an

important role in developemnt and fitness of BMSB. A recent study showed RNAi as a potential pest management strategy via ingestion in H. halys (Ghosh et al. 2017;

Mogilicherla et al. 2018). The delivery of dsRNA via injection and ingestion in H. halys provides effective ways to study gene functions and develop potential pest management tactics. To evaluate gene silencing, measuring gene expression is critical, as it validates decreased expression of the target gene.

In this study, our objective was to explore gene silencing through RNAi injection

technique by precise quantification of mRNA transcripts in H. halys. We hypothesized that introducing gene specific dsRNA will elicit the RNAi mechanism and reduce the target gene expression, causing a negative impact on the fitness of H. halys. The genes targeted in this study were catalase (HhCAT), vacuolar-type ATPase subunit-a (HhvATP) and NADPH-dependent cytochrome P450 reductase (HhCPR).

Catalase is an antioxidant enzyme that protects against oxidative stress by converting hydrogen peroxide to water and oxygen (Ahmad 1992). Vacuolar-type ATPase is an ion-transporter or ion-motive ATPase. It pumps protons out of cells or into vesicles against concentration gradients, and can establish electrochemical potentials across membranes to drive the secondary active transport of nutrients and ions (Wieczorek et al. 2000; Jefferies et al. 2008). NADPH-dependent cytochrome P450 reductase is required by all living organisms as it catalyzes many biological reactions and provides electrons for p450s and other oxygenases present in the endoplasmic

93

reticulum (Nishino and Ishibashi 2000; Feyereisen 1999). We targeted these

candidate genes in H. halys as they are proven to be effective RNAi targets in several

other insects (Zhu et al. 2012; Yao et al. 2013; JA et al. 2007; Diaz et al. 2011; Zhao

et al. 2013).

As the RNAi injection method is effective for functional studies and not feasible

as a pest control strategy, we also evaluated RNAi by the nebulization method. We

targeted HhCPR by nebulization method in adults and nymphs of H. halys. We chose different life stages including nymphs and adults for nebulization due to the difference in cuticle thickness. The cuticle or the exoskeleton of nymphs is thin and sensitive compared to the adults, which has thick and hard exoskeleton. We were interested to observe if the nymphs or adults of H. halys were sensitive to nebulization method.

Our results show that all the transcripts targeted in this study had a significant knockdown in gene expression when compared to the control population using RNAi injection method. The RNAi response was also systemic explaining that this approach can be used as a functional tool to study the functions of various genes in H. halys.

Reduction in the expression of HhvATP has negatively impacted the survival of H. halys. This study has established a standard method of dsRNA delivery via injection in H. halys, which helps in documenting essential functions of important candidate genes. Preliminary results on delivering siRNA by nebulization have a promising future if successfully developed and can be potentially be utilized in pest management.

94

4.3 Materials and methods

Insect colony:

The laboratory colonies of H. halys were maintained in a growth chamber with 16

hour light and 8 hour dark photoperiod, 28±2°C temperature and 60-70% relative

humidity. The colony was initially established in 2012 from H. halys (adults and

nymphs) collected from a soybean field in Wooster (GPS: 40.764, - 81.910). To

reduce genetic bottlenecks, the colony has been replenished every summer from

various hosts (soybeans, green beans, crabapples, homes) within a 5 km range of the

original collection site.

Synthesis of dsRNA and injections:

To explore RNAi in H. halys, we selected catalase (HhCAT, 1529 bp), vacuolar

ATPase (HhvATPase, 2964 bp) and cytochrome P450 reductase (HhCPR, 2085 bp) as target genes. All the three transcripts were obtained from H. halys transcriptome

(Bansal and Michel 2018). Sense and antisense primers (Table 4.1) tailed with T7-

promoter sequence (TAATACGACTCACTATAGGG) at the 5’ region were designed

for HhCAT, HhvATPase, and HhCPR using Primer Quest tool (IDT technologies,

Coralville, IA). For a control treatment, the green fluorescent protein (GFP)-fragment

was amplified from a plasmid containing a GFP insert (plasmid 3787). The amplified

fragments were purified using QIAprep Spin Miniprep Kit (Qiagen, Germantown,

MD). The dsRNAs were synthesized using MEGAscript RNAi kit (Life Technologies

Corporation, Carlsbad, CA) following the manufacturer’s protocol. The dsRNA

95

purity was checked via agarose gel electrophoresis. The dsRNA was quantified using

Nanodrop 2000c (Thermo Scientific, Hudson, NH) spectrophotometer.

To silence the expression of HhCAT, HhvATPase, and HhCPR, three biological

replicates were used for each transcript. For silencing HhCAT, HhvATPase, and

HhCPR expression, 36 individuals were used in each replicate (72 total individuals

for each target gene and the GFP control). Each transcript had three biological

replicates. For all the target genes, approximately 500ng dsRNA was injected into

each insect, using a micro-injector (Nanoject II, Drummond Scientific Company,

Broomall, PA). The injection site was the ventral metathoracic region near the hind

leg coxa (Figure 4.1). After injections, stink bugs were rested for 1 hour before being

moved to rearing cages for observation. For molecular analysis, H. halys adults were

collected at 2, 4, and 6 days after injections. At each time point, 2 male and 2

female H. halys adults were collected and stored at -80°C until further processing.

Mortality and fecundity assay:

To measure mortality due to HhCAT and HhvATPase expression silencing, we

compared the survival and fecundity among HhCAT, HhvATPase, and dsGFP injected individuals using 36 adults (72 total minus the 36 removed for measuring gene expression). Mortality and the number of eggs laid were recorded daily from day

1 to 10. We chose this experimental design as opposed to three different groups

(mortality, fecundity and gene expression) based on space limitations and for preliminarily analysis of HhCAT and HhvATPase expression silencing. Statistical

differences in mortality and fecundity were evaluated using t-test with average

96

mortalities. Cumulative mortality and fecundity was compared using Kaplan-Meier

survival curves and the log-rank test (Bewick, Cheek, and Ball 2004).

Synthesis of Dicer-substrate siRNAs (DsiRNAs) and nebilization:

For preliminary RNAi experiments using nebulization method, we designed

27mer dicer-substrate siRNAs (DsiRNAs) for HhCPR using IDT DNA Technologies

(Coralville, IA). These 27mer siRNAs are designed for optimal processing by dicer,

which mediates entry of siRNA duplex into the RISC increasing the potency. The

siRNA primers have both sense (25 bases,

GAUAUUUUCUUACAAGAACCAAAAA) and antisense strand (27 bases,

UCCUAUAAAAGAAUGUUCUUGGUUUUU) sequences. We had only one

biological replicate where both adults and nymphs were nebulized separately and

collected on day 4 for measure the gene expression. Two male and 2 female (pooled)

adults and four 3rd instar nymphs were used in this study. Using a nebulizer

compressor (Rite-Neb3, Probasics, Marlboro, NJ), H. halys adults and nymphs were nebulized with 50 nM (in 3000μl) CPR siRNA solution for a period of 10 min. For control, 300μl of nuclease free water was used for nebulization. Post-nebulization the insects were moved to rearing cages for observation. Four adults and nymphs were collected separately from treated and control samples on day 4 post-treatment and stored at -80°C until further processing.

RNA extraction, cDNA synthesis, and qRT-PCR analysis:

97

Frozen samples from each treatment of all experiments were processed for total

RNA extraction using the PureLink® RNA Mini Kit (Life Technologies Corporation,

Carlsbad, CA), as per the manufacturer’s protocol. To remove DNA contamination, samples were treated with PureLink®DNase (Life Technologies Corporation,

Carlsbad, CA, US). RNA quality was checked using a Nanodrop 2000c (Thermo

Scientific, Hudson, NH, US). The first-strand cDNA was prepared using iScript™ advanced cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA).

The RT-qPCR reactions were performed with iQ SYBR green super mix on a

CFX-96 thermocycler system (Bio-Rad, Hercules, CA, USA). Each qRT-PCR

reaction was performed with 2 μl (100 ng/μl) of cDNA template, 0.5 μl (100 μM) of

each primer and 5 μl of iQ SYBR green super mix (Bio-Rad, Hercules, CA, USA) in

10 μl total volume. Each reaction had three technical replicates, in a 96-well optical-

grade PCR plate and sealed with optical sealing tape (Bio-Rad Laboratories,

Hercules, CA). PCR amplifications included the following cycling conditions: one

cycle at 95°C (3 min), followed by 40 cycles of denaturation at 95°C (30 seconds),

annealing and extension at 55°C for 45 sec. Finally, melt curve analyses occurred by

slowly heating the PCR mixtures from 65°C to 95°C in increments of 0.5°C every 5 s

with simultaneous measurements of the SYBR green. Relative expression values of

genes in biological samples were calculated using the delta Ct method (Schmittgen

and Livak 2008).

Statistical analysis:

98

The relative expression values were analyzed using general linear model and

ANOVA in Minitab17 software. Significant differences among the groups were

verified and P<0.05 were considered statistically significant. The mean relative

expression ± standard errors were calculated for each time point based on three

independent experimental replicates. No statistics were performed on HhCPR

nebulization data as it only had one biological replicate.

4.4 Results

Effect of RNAi injection of HhCAT, HhvATPase and HhCPR genes in H. halys adults:

To determine the gene expression levels of HhCAT, HhvATPase and HhCPR

genes using qRT-PCR, dsRNA injected samples were collected at different time

points. Expression of all the transcripts was significantly suppressed at day 2, 4 and 6

time points. HhCAT transcript levels were reduced by 98 % in H. halys adults

compared to the dsGFP-injected control at all the time points (P<0.001, Figure 4.2).

HhvATPase expression was also significantly reduced by 91 % on day 2 and by

almost 86 % on day 4 and 6 after dsRNA introduction (P<0.001, Figure 4.3). The

expression of HhCPR was reduced by more than 92 % at all time points in H. halys

(P<0.001, Figure 4.4) compared to the dsGFP-injected control.

Effect of HhCAT and HhvATPase RNAi (injection) on mortality and fecundity of adult

H. halys:

The number of dead H. halys adults and number of eggs laid were recorded daily

from day 1 to day 10 post-injection and compared to the control (GFP). There was no

99

significant difference in the cumulative mortality in dsCAT injected H. halys (both

males and females) compared to dsGFP-injected H. halys (P=0.461). However, the cumulative mortality was significantly higher in dsvATP injected H. halys compared

to dsGFP-injected (P=0.040). Although the number of eggs was lower for both target

gene injected treatments when compared to the control, no significant differences were

observed (P=0.944).

Effect of RNAi nebulization of HhCPR genes in the adults and nymphs of H. halys:

Although this experiment included only one biological replicate, we were

interested to determine the gene expression levels of HhCPR gene after nebulization

compared to the injection method using qRT-PCR. We hypothesized that there will be a significant reduction in the transcript levels of HhCPR in both nymphs and adults. Although statistics were not performed, the expression of HhCPR was suppressed in HhCPR-siRNA nebulized nymphs (Figure 4.6A) and adults (Figure

4.6B) compared to the control (water). The transcript levels were reduced by 94 % in

H. halys nymphs by 61 % in adults compared to the water-nebulized control.

4.5 Discussion

The major finding of this study is that RNAi injection method is effective in H. halys and can be used for functional studies by knocking down the expression of target genes. All the transcripts targeted in this study had a significant knockdown in gene expression when compared to the control treatment. Preliminary results of

100 nebulization study also showed promising results and can be exploited in developing a control strategy if the technique is made successful by further studies in H. halys.

The response of RNAi injection showed significant effect on the gene expression of all the transcripts (HhCAT, HhvATPase and HhCPR) in the adults of H. halys. The expression of HhCAT was reduced by 98 % compared to the GFP control.

Interestingly, the silencing of HhCAT did not result in significant mortality which is in contrast to results seen in other species where catalase silencing has resulted in significant mortality (Diaz et al. 2011; Zhao et al. 2013; Deng and Zhao

2014). Catalase is an important gene, which responds to oxidative stress, and, indeed, H. halys increases catalase expression upon immune stimulation (i.e. tissue puncture, which would be similar to dsRNA injection) (Sparks et al. 2014). We ended our observations at 11 days, with 5 HhCAT-silenced individuals dying at 10 days. It is possible that, given additional time, more HhCAT-silenced individuals would have died, consistent with the importance of this gene seen in other insects.

Vacuolar ATPase in insects is an effective RNAi target in insects and several studies have successfully silenced vATPase expression, which usually results in increased mortality (Baum et al. 2007; Yao et al. 2013; Palli 2014; Zhu et al. 2011;

Whyard et al. 2009). In insects, the vATPase is an ion-transporter that helps in uptake of nutrients, and maintains the membrane ion balance (Wieczorek et al. 2000;

Jefferies et al. 2008). Significant reduction in the expression and increased mortality of dsvATPase injected H. halys suggests that vATPase could be playing an essential role in nutrient uptake and membrane ion balance in H. halys adults.

101

Injection of dsCPR also resulted in a 92% reduction in gene expression.

Cytochrome P450 reductase in insects are known to be involved in metabolic

resistance to insecticides (Feyereisen 2006). Several studies have also shown that

over expression of P450 enzymes is associated with insecticide resistance (Yang et al.

2006; Riga et al. 2014; Demaeght et al. 2013). Cytochrome P450 reductase (CPR)

gene silencing in insects has also resulted in reduced resistance to insecticides

including abamectin, fenpropathrin, deltamethrin (Huang et al. 2015; Zhu et al. 2012;

Shi et al. 2015; Jing et al. 2018). CPR is required in many animals and plants, as it

catalyzes many biological reactions (Feyereisen 1999). CPR also provides electrons

for p450s and other oxygenases present in the endoplasmic reticulum of eukaryotes

(Nishino and Ishibashi 2000). In this study, although HhCPR was successfully

silenced, the major limitation of our study was not evaluating if knockdown led to

decreased susceptibility to insecticides due to a decrease in colony size. Given the

significant reduction in gene expression in H. halys, additional studies testing the

phenotypic effects would provide substantial evidence on metabolic resistance to

insecticides in H. halys.

We observed a robust RNAi response in H. halys adults by injection method.

Introducing dsRNA by injection method in insects has been proved effective for

functional genomic studies, but not feasible to use as a pest management strategy (Gu

and Knipple 2013; Joga et al. 2016). The nebulization method, where nebulized siRNA particles enter the insect spiracles, can silence gene expression in a quick and non-invasive manner (Li et al. 2013). Hence, we performed preliminary RNAi study using nebulization method in adults and nymphs of H. halys. Preliminary data

102 obtained from HhCPR-siRNA nebulization also showed promising results, where the expression of CPR-siRNA treated nymphs and adults was successfully silenced.

These results are based on only one replicate, adding more biological replicates and assessing the phenotype will have strong evidence on the role of CPR in H. halys.

Nonetheless, gene silencing by nebulization method can be non-invasive and potentially exploited in developing novel effective management strategies against pests.

In summary, this study has established a standard method of dsRNA delivery via injection in H. halys, which helps in documenting essential functions of important candidate genes. Preliminary results on delivering siRNA by nebulization have a promising future if successfully developed and can be potentially be utilized in pest management.

103

4.6 References:

Ahmad, Sami. 1992. “Biochemical Defence of Pro-Oxidant Plant Allelochemicals by

Herbivorous Insects.” Biochemical Systematics and Ecology 20 (4): 269–96.

Araujo, R.N., A. Santos, F.S. Pinto, N.F. Gontijo, M.J. Lehane, and M.H. Pereira. 2006.

“RNA Interference of the Salivary Gland Nitrophorin 2 in the Triatomine Bug

Rhodnius Prolixus (Hemiptera: Reduviidae) by DsRNA Ingestion or Injection.”

Insect Biochemistry and Molecular Biology 36 (9): 683–93.

https://doi.org/10.1016/j.ibmb.2006.05.012.

Bansal, Raman, and Andy Michel. 2018. “Expansion of Cytochrome P450 and Cathepsin

Genes in the Generalist Herbivore Brown Marmorated Stink Bug.” BMC Genomics

19 (1): 60. https://doi.org/10.1186/s12864-017-4281-6.

Baum, James A., and James K. Roberts. 2014. Progress towards RNAi-Mediated Insect

Pest Management. Advances in Insect Physiology. 1st ed. Vol. 47. Elsevier Ltd.

https://doi.org/10.1016/B978-0-12-800197-4.00005-1.

Baum, James A, Thierry Bogaert, William Clinton, Gregory R Heck, Pascale Feldmann,

Oliver Ilagan, Scott Johnson, et al. 2007. “Control of Coleopteran Insect Pests

through RNA Interference.” Nat Biotech 25 (11): 1322–26.

http://dx.doi.org/10.1038/nbt1359.

Bewick, Viv, Liz Cheek, and Jonathan Ball. 2004. “Statistics Review 12: Survival

Analysis.” Critical Care 8 (5): 389. https://doi.org/10.1186/cc2955.

Demaeght, Peter, Wannes Dermauw, Dimitra Tsakireli, Jahangir Khajehali, Ralf Nauen,

Luc Tirry, John Vontas, Peter Lümmen, and Thomas Van Leeuwen. 2013.

“Molecular Analysis of Resistance to Acaricidal Spirocyclic Tetronic Acids in

104

Tetranychus Urticae: CYP392E10 Metabolizes Spirodiclofen, but Not Its

Corresponding Enol.” Insect Biochemistry and Molecular Biology 43 (6): 544–54.

https://doi.org/10.1016/j.ibmb.2013.03.007.

Deng, Fei, and Zhangwu Zhao. 2014. “Influence of Catalase Gene Silencing on the

Survivability of Sitobion Avenae.” Archives of Insect Biochemistry and Physiology

86 (1): n/a-n/a. https://doi.org/10.1002/arch.21161.

Diaz-Albiter, Hector, Roanna Mitford, Fernando A. Genta, Mauricio R. V. Sant’Anna,

and Rod J. Dillon. 2011. “Reactive Oxygen Species Scavenging by Catalase Is

Important for Female Lutzomyia Longipalpis Fecundity and Mortality.” PLoS ONE

6 (3): e17486. https://doi.org/10.1371/journal.pone.0017486.

Feyereisen, René. 1999. “Insect P450 Enzymes.” Annual Review of Entomology 44: 507–

33.

Feyereisen, René. 2006. “Evolution of Insect P450” 34: 1252–55.

Fire, Andrew, SiQun Xu, Mary K Montgomery, Steven A Kostas, Samuel E Driver, and

Craig C Mello. 1998. “Potent and Specific Genetic Interference by Double-Stranded

RNA in Caenorhabditis Elegans.” Nature 391 (6669): 806–11.

http://dx.doi.org/10.1038/35888.

Ghosh, Saikat Kumar B., Wayne B. Hunter, Alexis L. Park, and Dawn E. Gundersen-

Rindal. 2017. “Double Strand RNA Delivery System for Plant-Sap-Feeding

Insects.” PLOS ONE 12 (2): e0171861.

https://doi.org/10.1371/journal.pone.0171861.

Gu, Liuqi, and Douglas C. Knipple. 2013. “Recent Advances in RNA Interference

Research in Insects: Implications for Future Insect Pest Management Strategies.”

105

Crop Protection 45 (March): 36–40.

https://doi.org/10.1016/J.CROPRO.2012.10.004.

Hannon, Gregory J. 2002. “RNA Interference.” Nature 418 (6894): 244–51.

https://doi.org/10.1038/418244a.

Hoebeke, E. R., and M. E. Carter. 2003. “Halyomorpha Halys (Stål) (Heteroptera:

Pentatomidae): A Polyphagous Plant Pest from Asia Newly Detected in North

America.” Proceedings of the Entomological Society of Washington 105 (1): 225–

37.

Huang, Jia-Hsin, Jesus Lozano, and Xavier Belles. 2013. “Broad-Complex Functions in

Postembryonic Development of the Cockroach Blattella Germanica Shed New

Light on the Evolution of Insect Metamorphosis.” Biochimica et Biophysica Acta

(BBA) - General Subjects 1830 (1): 2178–87.

https://doi.org/10.1016/j.bbagen.2012.09.025.

Huang, Yong, Xue-Ping Lu, Luo-Luo Wang, Dong Wei, Zi-Jiao Feng, Qi Zhang, Lin-

Fan Xiao, Wei Dou, and Jin-Jun Wang. 2015. “Functional Characterization of

NADPH-Cytochrome P450 Reductase from Bactrocera Dorsalis: Possible

Involvement in Susceptibility to Malathion.” Scientific Reports 5 (December):

18394. https://doi.org/10.1038/srep18394.

JA, Baum, T Bogaert, W Clinton, Heck GR, P Feldmann, O Ilagan, S Johnson, et al.

2007. “Control of Coleopteran Insect Pests through RNA Interference.” Nature

Biotechnology 25 (11): 1322–26.

Jaubert-Possamai, Stéphanie, Gaël Le Trionnaire, Joël Bonhomme, Georges K

Christophides, Claude Rispe, and Denis Tagu. 2007. “Gene Knockdown by RNAi in

106

the Pea Aphid Acyrthosiphon Pisum.” BMC Biotechnology 7 (1): 63.

https://doi.org/10.1186/1472-6750-7-63.

Jefferies, Kevin C., Daniel J. Cipriano, and Michael Forgac. 2008. “Function, Structure

and Regulation of the Vacuolar (H+)-ATPases.” Archives of Biochemistry and

Biophysics 476 (1): 33–42. https://doi.org/10.1016/j.abb.2008.03.025.

Jing, Tian-Xing, Yang Tan, Bi-Yue Ding, Wei Dou, Dan-Dan Wei, and Jin-Jun Wang.

2018. “NADPH–Cytochrome P450 Reductase Mediates the Resistance of Aphis

(Toxoptera) Citricidus (Kirkaldy) to Abamectin.” Frontiers in Physiology 9

(August): 986. https://doi.org/10.3389/fphys.2018.00986.

Joga, Mallikarjuna R, Moises J Zotti, Guy Smagghe, and Olivier Christiaens. 2016.

“RNAi Efficiency, Systemic Properties, and Novel Delivery Methods for Pest Insect

Control: What We Know So Far.” Frontiers in Physiology 7: 553.

https://doi.org/10.3389/fphys.2016.00553.

Lee, Doo-Hyung, Brent D Short, Shimat V Joseph, J Christopher Bergh, and Tracy C

Leskey. 2013. “Review of the Biology, Ecology, and Management of Halyomorpha

Halys (Hemiptera: Pentatomidae) in China, Japan, and the Republic of Korea.”

Environmental Entomology 42 (4): 627–41. https://doi.org/10.1603/EN13006.

Leskey, Tracy C., George C. Hamilton, Anne L. Nielsen, Dean F. Polk, Cesar Rodriguez-

Saona, J. Christopher Bergh, D. Ames Herbert, et al. 2012. “Pest Status of the

Brown Marmorated Stink Bug, Halyomorpha Halys in the USA.” Outlooks on Pest

Management 23 (5): 218–26. https://doi.org/10.1564/23oct07.

Li-Byarlay, Hongmei, Yang Li, Hume Stroud, Suhua Feng, Thomas C Newman, Megan

Kaneda, Kirk K Hou, et al. 2013. “RNA Interference Knockdown of DNA Methyl-

107

Transferase 3 Affects Gene Alternative Splicing in the Honey Bee.” Proceedings of

the National Academy of Sciences of the United States of America 110 (31): 12750–

55. https://doi.org/10.1073/pnas.1310735110.

Li, Jie, Xiao-Ping Wang, Man-Qun Wang, Wei-Hua Ma, and Hong-Xia Hua. 2013.

“Advances in the Use of the RNA Interference Technique in Hemiptera.” Insect

Science 20 (1): 31–39. https://doi.org/10.1111/j.1744-7917.2012.01550.x.

Mogilicherla, Kanakachari, Jeffrey L. Howell, and Subba Reddy Palli. 2018. “Improving

RNAi in the Brown Marmorated Stink Bug: Identification of Target Genes and

Reference Genes for RT-QPCR.” Scientific Reports 8 (1): 3720.

https://doi.org/10.1038/s41598-018-22035-z.

Mutti, NS, J Louis, Pappan LK, K Pappan, K Begum, Chen MS, Y Park, et al. 2008. “A

Protein from the Salivary Glands of the Pea Aphid, Acyrthosiphon Pisum, Is

Essential in Feeding on a Host Plant.” Proceedings of the National Academy of

Sciences of the United States of America 105 (29): 9965–69.

Nishino, Hideaki, and Teruo Ishibashi. 2000. “Evidence for Requirement of NADPH-

Cytochrome P450 Oxidoreductase in the Microsomal NADPH-Sterol Δ7-Reductase

System.” Archives of Biochemistry and Biophysics 374 (2): 293–98.

https://doi.org/10.1006/abbi.1999.1602.

Owens, D R, Jr. Herbert D. A., G P Dively, D D Reisig, and T P Kuhar. 2013. “Does

Feeding by Halyomorpha Halys (Hemiptera: Pentatomidae) Reduce Soybean Seed

Quality and Yield?” Ecen Journal of Economic Entomology 106 (3): 1317–23.

Palli, Subba Reddy. 2014. “RNA Interference in Colorado Potato Beetle: Steps toward

Development of DsRNA as a Commercial Insecticide.” Current Opinion in Insect

108

Science 6 (December): 1–8. https://doi.org/10.1016/j.cois.2014.09.011.

Piermarini, Peter M., Daniel C. Akuma, John C. Crow, Taylor L. Jamil, Willa G.

Kerkhoff, Kenyatta C.M.F. Viel, and Christopher M. Gillen. 2017. “Differential

Expression of Putative Sodium-Dependent Cation-Chloride Cotransporters in Aedes

Aegypti.” Comparative Biochemistry and Physiology Part A: Molecular &

Integrative Physiology 214 (December): 40–49.

https://doi.org/10.1016/j.cbpa.2017.09.007.

Riga, M., D. Tsakireli, A. Ilias, E. Morou, A. Myridakis, E.G. Stephanou, R. Nauen, et al.

2014. “Abamectin Is Metabolized by CYP392A16, a Cytochrome P450 Associated

with High Levels of Acaricide Resistance in Tetranychus Urticae.” Insect

Biochemistry and Molecular Biology 46 (March): 43–53.

https://doi.org/10.1016/j.ibmb.2014.01.006.

Schmittgen, Thomas D, and Kenneth J Livak. 2008. “Analyzing Real-Time PCR Data by

the Comparative CT Method.” Nature Protocols 3 (6): 1101–8.

https://doi.org/10.1038/nprot.2008.73.

Shi, Li, Jiao Zhang, Guangmao Shen, Zhifeng Xu, Peng Wei, Yichao Zhang, Qiang Xu,

and Lin He. 2015. “Silencing NADPH-Cytochrome P450 Reductase Results in

Reduced Acaricide Resistance in Tetranychus Cinnabarinus (Boisduval).” Scientific

Reports 5 (October): 15581. https://doi.org/10.1038/SREP15581.

Sparks, Michael E., Kent S. Shelby, Daniel Kuhar, and Dawn E. Gundersen-Rindal.

2014. “Transcriptome of the Invasive Brown Marmorated Stink Bug, Halyomorpha

Halys (Stål) (Heteroptera: Pentatomidae).” PLoS ONE 9 (11): e111646.

https://doi.org/10.1371/journal.pone.0111646.

109

Terenius, Olle, Alexie Papanicolaou, Jennie S. Garbutt, Ioannis Eleftherianos, Hanneke

Huvenne, Sriramana Kanginakudru, Merete Albrechtsen, et al. 2011. “RNA

Interference in Lepidoptera: An Overview of Successful and Unsuccessful Studies

and Implications for Experimental Design.” Journal of Insect Physiology 57 (2):

231–45. https://doi.org/10.1016/j.jinsphys.2010.11.006.

Whyard, Steven, Aditi D. Singh, and Sylvia Wong. 2009. “Ingested Double-Stranded

RNAs Can Act as Species-Specific Insecticides.” Insect Biochemistry and

Molecular Biology 39 (11): 824–32. https://doi.org/10.1016/j.ibmb.2009.09.007.

Wieczorek, H, G Grber, W R Harvey, M Huss, H Merzendorfer, and W Zeiske. 2000.

“Structure and Regulation of Insect Plasma Membrane H(+)V-ATPase.” The

Journal of Experimental Biology 203 (Pt 1): 127–35.

http://www.ncbi.nlm.nih.gov/pubmed/10600681.

Wynant, Niels, Dulce Santos, Rik Verdonck, Jornt Spit, Pieter Van Wielendaele, and

Jozef Vanden Broeck. 2014. “Identification, Functional Characterization and

Phylogenetic Analysis of Double Stranded RNA Degrading Enzymes Present in the

Gut of the Desert Locust, Schistocerca Gregaria.” Insect Biochemistry and

Molecular Biology 46 (March): 1–8. https://doi.org/10.1016/j.ibmb.2013.12.008.

Yang, Yihua, Song Chen, Shuwen Wu, Lina Yue, and Yidong Wu. 2006. “Constitutive

Overexpression of Multiple Cytochrome P450 Genes Associated with Pyrethroid

Resistance in Helicoverpa Armigera” Journal of Economic Entomology 99 (5):

1784–89. https://doi.org/10.1603/0022-0493-99.5.1784.

Yao, J, D Rotenberg, A Afsharifar, K Barandoc-Alviar, and Whitfield AE. 2013.

“Development of RNAi Methods for Peregrinus Maidis, the Corn Planthopper.”

110

PloS One 8 (8).

Yu, Na, Olivier Christiaens, Jisheng Liu, Jinzhi Niu, Kaat Cappelle, Silvia Caccia,

Hanneke Huvenne, and Guy Smagghe. 2013. “Delivery of DsRNA for RNAi in

Insects: An Overview and Future Directions.” Insect Science 20 (1): 4–14.

https://doi.org/10.1111/j.1744-7917.2012.01534.x.

Zha, Wenjun, Xinxin Peng, Rongzhi Chen, Bo Du, Lili Zhu, and Guangcun He. 2011.

“Knockdown of Midgut Genes by DsRNA-Transgenic Plant-Mediated RNA

Interference in the Hemipteran Insect Nilaparvata Lugens.” PloS One 6 (5): e20504.

https://doi.org/10.1371/journal.pone.0020504.

Zhao, Haiming, Xin Yi, Zhen Hu, Meiying Hu, Shaohua Chen, Rizwan-ul-Haq

Muhammad, Xiaolin Dong, and Liang Gong. 2013. “RNAi-Mediated Knockdown of

Catalase Causes Cell Cycle Arrest in SL-1 Cells and Results in Low Survival Rate

of Spodoptera Litura (Fabricius).” PLoS ONE 8 (3): e59527.

https://doi.org/10.1371/journal.pone.0059527.

Zhu, Fang, Sarah Sams, Tim Moural, Kenneth F. Haynes, Michael F. Potter, and Subba

R. Palli. 2012. “RNA Interference of NADPH-Cytochrome P450 Reductase Results

in Reduced Insecticide Resistance in the Bed Bug, Cimex Lectularius.” PLoS ONE 7

(2): e31037. https://doi.org/10.1371/journal.pone.0031037.

Zhu, Fang, Jingjing Xu, Roshan Palli, Joseph Ferguson, and Subba R Palli. 2011.

“Ingested RNA Interference for Managing the Populations of the Colorado Potato

Beetle, Leptinotarsa Decemlineata.” Pest Management Science 67 (2): 175–82.

https://doi.org/10.1002/ps.2048.

111

4.7 Tables and figures:

Primer Tm Size Effa Forward Sequence Reverse Sequence Name (0C) (bp) %

For dsRNA Synthesis, with T7-promoter sequence TAATACGACTCACTATAGGG at the 5’ region

HhCAT AAGACAGCGCAAGGAGAAAG GATGCCCTGCGAAGATGATT 62 704

HhvATP CTGCACAGAGGAGAAGG ACCCAATGGAGCCTAAGA 65 794

HhCPR CCTAAGGAAGCAGCACAC GTCTCTCCAACTGGCTTTC 64 494

dsGFP AGTGGAGAGGGTGAAGGTGA AAAGGGCAGATTGTGTGGAC 60 688 92

For qRT-PCR Analysis

HhCAT CTTCGACAGGGAGAGGAT CTGGGTGATGTCGTTAGTG 55 91 91

HhvATP GAGCAAGAAGGCGATAGTG TCCAGCAACAAACCCAAG 53 87 74

HhCPR CCCATGGTAATGACCTCAA GCTACGGCCACTTGATTT 53 75 80

HhEF1α GCTGATTGTGCTGTGTTA ACGAGTCTGTCCATTCTT 50 78 98

aPrimer efficiency (note- efficiencies only for qRT-PCR study are mentioned)

Table 4.1: Primer sequences, annealing temperatures, size and efficiencies of transcripts

HhCAT, HhvATPase, HhCPR, dsGFP (control) and HhEF1α (reference gene for qRT-

PCR study).

112

Injection point

Figure 4.1: Double stranded RNA injection site (metathoracic region) in H. halys.

113

Figure 4.2: Effect of RNAi induced gene silencing on HhCAT expression in H. halys.

Column graph showing the distribution of HhCAT expression (black bars) measured through the qRT-PCR analysis in insects injected with HhCAT dsRNA (dsCAT) in comparison with those injected with GFP dsRNA (grey bars) are shown. Following the dsRNA injections, the HhCAT expression levels were significantly different

(P<0.05) compared to control at all three time points. Asterisk sign indicate significance.

114

Figure 4.3: Effect of RNAi induced gene silencing on HhvATP expression in H.

halys.

Column graph showing the distribution of HhvATP expression (black bars) measured through the qRT-PCR analysis in insects injected with HhvATP dsRNA (dsvATP) in comparison with those injected with GFP dsRNA (grey bars) are shown. Following the dsRNA injections, the HhvATP expression levels were significantly different

(P<0.05) compared to control at all three time points. Asterisk sign indicate significance.

115

Figure 4.4: Effect of RNAi induced gene silencing on HhCPR expression in H. halys.

Column graph showing the percent fold change of HhCPR expression (black bars) measured through the qRT-PCR analysis in insects injected with HhCPR dsRNA

(dsCPR) in comparison with those injected with GFP dsRNA (grey bars) are shown.

Following the dsRNA injections, the HhCPR expression levels were significantly different (P<0.05) compared to control at all three time points. Asterisk sign indicate significance.

116

A) B)

Figure 4.5: Mortality and fecundity of H. halys recorded for ten days after the injections with dsCAT and dsvATP. A) Cumulative mortality in dsCAT and dsvATP injected insects compared to the control GFP. Following the dsRNA injections, the HhvATP cumulative mortality was significantly different (P<0.05) compared to control. Asterisk sign indicate significance. B) Total number of eggs (fecundity) recorded in dsCAT and dsvATP injected insects compared to the control GFP.

117

A) B)

Figure 4.6: Effect of RNAi nebulization induced gene silencing on HhCPR expression in H. halys. Column graph showing the percent fold change of HhCPR expression (black bars) measured through the qRT-PCR analysis in insects nebulized with HhCPR-siRNA in comparison with those nebulized with water (grey bars) are shown. Standard errors were not calculated as the data is from one replicate.

A) Percent fold change of HhCPR-siRNA expression in the 3rd instar nymphs of H. halys. B) Percent fold change of HhCPR-siRNA expression in H. halys adults.

118

CHAPTER 5

Removing an obligate bacterial endosymbiont changes free amino acid levels in

brown marmorated stink bug, Halyomorpha halys

5.1 Abstract

Most insect species improve their fitness with cooperation from bacterial

symbionts. In most cases, these symbionts play an important role in providing

essential nutrients that allow the insect to feed on a wide range of host plants deficient

in essential amino acids or other nutrients. Halyomorpha halys (brown marmorated

stink bug-BMSB) is a highly polyphagous pest that feeds on more than 170 plant

species. The primary obligate bacterial symbiont of BMSB is Candidatus Pantoea

carbekii (P. carbekii). P. carbekii increases BMSB fitness and survival, presumably

by providing essential nutrients, including amino acids. Studying the free amino acids

potentially provided by P. carbekii will help explain the symbiotic interaction and

could reveal novel approaches to improve BMSB management. In this study, we

determined the impact of P. carbekii on free amino acid levels in BMSB, comparing

levels in 3rd instar nymphs with (symbiotic) and without (aposymbiotic) P. carbekii.

A total of 23 free amino acids were detected, including 18 proteinogenic (9 essential,

9 non-essential) and 5 non-proteinogenic amino acids.Total free amino acid content

was lower in aposymbiotic compared to symbiotic BMSB, although the difference

was not significant. However, we did observe significant differences in the absolute

levels of certain free amino acids. Symbiotic BMSB had significantly higher

119 concentrations of asparagine, aspartic acid, proline and tyrosine. Aposymbiotic

BMSB had higher levels of lysine and alanine. Previous studies have shown that these amino acids are associated with vital functions in insects including protein folding, stress regulation and metabolism that likely contribute to BMSB fitness. Our data provide evidence of BMSB and P. carbekii physiological interactions, and that P. carbekii potentially aids in the production and metabolism of many important amino acids. Results from this study will expand our knowledge on the BMSB-P. carbekii interaction that could be exploited in developing novel management tactics.

5.2 Introduction

Symbiotic bacteria are ubiquitous in nature and play an important role in the ecology and evolution of eukaryotes (Sudakaran et al. 2015). Most insect species improve their fitness through cooperation with bacterial symbionts. These symbionts often provide essential nutrients that are lacking or in suboptimal levels in an herbivorous insect diet, thus allowing the insect to feed on a wider range of nutritionally diverse hosts (Skidmore and Hansen 2017). In addition to the nutrient provisioning role, bacterial symbionts also detoxify plant toxins and help breakdown plant polymers, enhancing an insect’s ability to adapt to new hosts (Douglas 2009;

Hansen and Moran 2014). Removal of symbionts from insects in vitro has resulted in delayed growth, increased mortality, reduced fecundity and sterility in stink bugs

(Hosokawa et al. 2006, Taylor et al. 2014). A recent study on the pea aphid

(Acyrthosiphon pisum) endosymbiont, Buchnera aphidicola, illustrated its importance for ammonia recycling in addition to the insect host’s growth and reproduction (Kim

120

et al. 2018). Not only do bacterial symbionts have important biological and

physiological roles, they have been used as a mechanism to induce RNA-interference,

which could improve sustainable pest management tactics (Whitten et al. 2016).

Bacterial symbionts can be either obligatory or facultative in their association

with the host. Both types of symbionts can provide nutrients, defense and resistance

to the host, and can also manipulate reproductive capacity (Feldhaar 2011; Flórez et

al. 2015; Oliver et al. 2003). Insect hosts maintain obligate symbionts within the

insect body in a specialized organ called a bacteriome, whereas facultative symbionts

reside in intra- or extracellular regions of the insect (Baumann 2005). During

reproduction, an insect will transmit obligate symbionts to their offspring, but

facultative symbionts are usually horizontally transmitted (i.e. taken up from the plants or environment) (Chrostek et al. 2017). Facultative symbionts are usually not essential for host survival and the association is often temporary (Su et al. 2013). In contrast, obligate symbionts have an intimate association with their host and play an important role in insect nutritional ecology (Moran et al. 1993; McCutcheon et al.

2009) especially in polyphagous insects like aphids (Douglas 1998; Vogel and Moran

2011) and stink bugs (Hosokawa et al. 2016; Bansal et al. 2014).

One such notorious polyphagous pest is Halyomorpha halys, commonly known as the brown marmorated stink bug (BMSB). It was first detected in North America in

1996 and is currently found in 44 states in the U.S. and four Canadian provinces, causing severe agricultural and nuisance problems (www.stopbmsb.org). BMSB has a wide host range and feeds on more than 100 plant species, including important agricultural crops such as soybean, corn, apple, other orchard and ornamental plants

121

(Lee et al. 2013). This invasive species harbors a gamma-proteobacteria, obligate

primary symbiont, Candidatus Pantoea carbekii (P. carbekii) (Bansal et al. 2014).

Immediately after hatching, BMSB offspring feed on the maternal secretions present

on the egg casing to acquire the symbiont, P. carbekii (Bansal et al. 2014; Kenyon et

al. 2015). The consumed symbiont passes through the foregut, midgut and

permanently resides in the distal gut region of BMSB (Bansal et al. 2014). The

genome of P. carbekii encodes biosynthetic pathways for the production of several

amino acids (phenylalanine, tryptophan, methionine, lysine, threonine and histidine),

vitamins/co-factors (folate, riboflavin, pyridoxal-5’phosphate), lipoate, glutathione

and iron-sulfur clusters (Kenyon et al. 2015). Based on the genome of P. carbekii, this symbiont likely provides BMSB with these important nutrients and amino acids.

Amino acids can be either proteinogenic or non-proteinogenic, depending on their role in protein formation. A total of 22 proteinogenic amino acids including nine essential and 11 non-essential amino acids are used to assemble proteins (House

1962). Essential amino acids cannot be synthesized by an insect and are usually

acquired from the symbionts or the diet, whereas an insect can synthesize non-

essential amino acids. Non-proteinogenic amino acids act as important intermediates

in several metabolic pathways in insects (Suring et al. 2016) or as plant defenses

(Huang et al. 2011). Free amino acids (both proteinogenic and non-proteinogenic)

exist in the insect hemolymph and provide an available source for all tissues during

physiological processes.

To better understand the nutrient-provisioning role of P. carbekii and the

symbiotic association with its host, BMSB, our study focused on the amounts of

122

proteinogenic and non-proteinogenic amino acids. We hypothesized that BMSB and

P. carbekii closely cooperate in providing nutrients and amino acids lacking in the

insect’s diet. We predicted that, upon removing P. carbekii from BMSB, the levels of

free amino acids would be lowered. The predicted nutrient provisioning role of P.

carbekii may contribute to the fitness and broad host range of BMSB. Results from

this study will not only enhance our knowledge on the BMSB-P. carbekii association,

but may also be exploited in novel symbiont- mediated management strategies.

5.3 Materials and Methods

Insects:

A laboratory colony of BMSB was established in summer 2012 with nymphs and adults collected from a soybean field (GPS: 40.76, -81.91) and supplemented from various locations around Wooster, Ohio. Colonies are maintained in a walk-in growth chamber with 16:8 (light:dark) photoperiod, 28±2°C, and 60-70% relative humidity.

The insects had access to a varied diet including soybeans, corncobs, green beans, celery, carrots, apples and grapes. Thirty egg masses (15 for control and 15 for treatment) laid within 24-48 hours were collected from the adult cages.

Symbiotic and aposymbiotic BMSB:

To clear the bacterial symbionts present on the egg casing, we surface sterilized

15 egg masses following a protocol described (Taylor et al. 2014). Briefly, egg

masses were soaked for 5 minutes in 100% ethanol, followed by soaking in 10%

Clorox for six minutes. Eggs were then rinsed once in ethanol and twice in distilled

123 water. Removal of bacteria was confirmed using PCR and agarose gel, resulting in nymphs that were symbiont-free (aposymbiotic) (Figure 5.1). The 15 control egg masses were not manipulated in anyway (symbiotic). Treated (aposymbiotic) and control (symbiotic) egg masses were placed in separate 500 ml deli plastic containers with a perforated lids, a water-soaked cotton wick, and a green bean pod (Phaseolus vulgaris) as diet. Consistent with a previous study (Taylor et al. 2014) aposymbiotic

BMSB did not reach the adult stage; therefore, analyses were conducted on 3rd instar nymphs. For each sample, we recorded the mass of three 3rd-instar nymphs in a 0.5ml microcentrifuge tube and stored them at -80oC until further analysis (n = 15 and 14 for symbiotic and aposymbiotic BMSB, respectively).

Free amino acid analyses:

We collected the exocarp subepidermis and mesocarp of one uninfested green bean per replicate using fine forceps and dissecting scissors. The collected tissue was massed and stored in a 0.5ml microcentrifuge tube at -80oC until further processing (n

= 15).

Sample preparation and amino acid extraction:

Green bean and BMSB samples were homogenized with a plastic pestle using 500

μl of 0.01N HCl. The samples were vortexed for ten min at 900 rpm and centrifuged at 14,000 rpm for five minutes. After centrifugation, 100 μl of supernatant was analyzed for free amino acids using the EZ:faast GC-MS physiological amino acid analysis kit (Phenomenex, Torrance, CA).

124

We injected 2 μL of EZ:faast-derivatized sample into an Agilent Technologies

7890A gas chromatograph (Santa Clara, CA) fitted with a Zebron ZB-AAA (10 m ×

0.25 mm) capillary column and coupled to an Agilent Technologies 5975C inert mass

selective detector. Using a splitless injection at 250°C and helium carrier flow of

1.2 mL/min, the oven temperature was increased from 80 °C for 0 min to 320 °C

at 30°C/min, with a final hold of one minute and a total run time of nine minutes. The

MS temperatures were as follows: ion source 240°C, quadrupole 180°C, and auxiliary

310°C. The scan range was 45–400 with a threshold of 150. Amino acids were

identified by comparison of retention times and mass spectra of authentic standards.

Levels were quantified using a relative response database created by the Agilent

Chemstation software of the external amino acid standards provided with the EZ:faast

kit. Although this method is suitable for analyzing a large number of amines, the

essential amino acid arginine cannot be quantified.

The quantification data was tested for normality and homogeneity of variances

before performing ANOVA. For ANOVA on the relative proportions of free amino

acids, the values were arcsine square root transformed. Concentrations of free amino

acids (nmol/mg and nmol/bug) were compared using one-way ANOVA followed by

Tukey’s range test in Minitab 17.

5.4 Results

Body mass of symbiotic and aposymbiotic BMSB:

To determine the differences in the body mass, we compared the total body mass

of symbiotic and aposymbiotic treatments. Aposymbiotic BMSB had 236% higher

125 body mass than symbiotic BMSB (P=0.030) based on the log-transformed data. Due to the difference in insect body weight among the treatments, individual amino acid levels were standardized by total number of insects used per sample (n=3).

Total free amino acids profile in symbiotic BMSB, aposymbiotic BMSB and green beans:

To better understand the role of P. carbekii in providing essential nutrients to

BMSB, we initially observed the differences in the total free amino acid levels among all the treatments. We predicted that the total free amino acid levels would be higher in symbiotic compared to aposymbiotic BMSB. We measured the total free amino acid concentration (nmol/mg) in symbiotic and aposymbiotic BMSB and green beans after normalizing by sample mass and transforming by arcsine square root (Figure

5.2). There was no significant difference between the symbiotic and aposymbiotic

BMSB, however the total amino acid concentration was significantly lower in green beans compared to symbiotic and aposymbiotic BMSB (P<0.001).

The relative proportions of all free amino acids were also measured in symbiotic

(Figure 5.3A) and aposymbiotic BMSB (Figure 5.3B) and green beans (Figure 5.3C).

The free amino acids serine, proline, asparagine, aspartic acid, lysine and tyrosine were significantly different in all three treatments (symbiotic, aposymbiotic BMSB and green beans, P<0.001). Alternatively, the free amino acids glycine, methionine, glutamine, glutamic acid, ornithine, histidine and tryptophan were significantly lower in green beans compared to insect treatments (P≤0.001). Only γ-aminobutyric acid was significantly higher in green beans compared to insect treatments (P<0.001).

126

Among the symbiotic and aposymbiotic BMSB, alanine, valine and isoleucine were significantly higher in aposymbiotic BMSB (P≤0.02).

Absolute levels of free amino acids:

To understand which specific amino acids might be important for the P. carbekii-

BMSB interaction, we quantified the absolute levels of essential and non-essential amino acids in symbiotic and aposymbiotic BMSB. We hypothesized that both amino acid levels will be higher in symbiotic BMSB compared to aposymbiotic BMSB, if P. carbekii is potentially providing them. We measured nine essential amino acids including histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine (Figure 5.4). Among all amino acids, only lysine had a significantly higher concentration in aposymbiotic BMSB compared to symbiotic

BMSB (P=0.029).

We also quantified the levels of nine non-essential amino acids among the total free amino acids including, alanine, asparagine, aspartic acid, glutamine, glutamic acid, glycine, proline, serine, and tyrosine (Figure 5.5). Among these amino acids, asparagine, aspartic acid, proline and tyrosine were significantly higher in concentration in symbiotic BMSB (P≤0.02) and amino acid; alanine was significantly higher in concentration in aposymbiotic BMSB (P<0.0001).

In addition, we also quantified the concentrations of non-proteinogenic amino acids including, α-aminoadipic acid, α-aminobutyric acid, β-aminobutyric acid, γ- aminobutyric acid and ornithine. No significant differences were found in any of the non-proteinogenic amino acids (P>0.05).

127

5.5 Discussion

In this study, we compared free amino acids in symbiotic and aposymbiotic

BMSB and green beans (a typical food source). The total free amino acids were

significantly lower in green beans compared to symbiotic BMSB (Figure 5.2). There

was no significant difference in the total amino acid levels between symbiotic and

aposymbiotic BMSB, despite lower overall values in aposymbiotic BMSB. However,

we did observe significant differences in the relative proportions and absolute

concentrations of free amino acids among symbiotic, aposymbiotic BMSB and green

beans (Figures 5.3-5.5).

For a polyphagous insect like BMSB, its host plants might have amino acids that

are in low concentrations (tyrosine, proline, lysine, glycine, etc.), which are

potentially required for the growth and development of BMSB. Indeed, the most

abundant amino acids in green beans included asparagine, aspartic acid, serine and γ-

aminobutyric acid (Figure 5.3). A study on green beans also had higher aspartic acid,

glutamic acid and low proline, methionine and histidine (Gonzalez et al. 1997). The amino acids that are lacking or low in plants are synthesized by facultative or obligate

endosymbionts or by the insects themselves (Skidmore and Hansen 2017).

Although the samples were collected at the 3rd instar nymph stage, we still

observed significant differences in the body masses between symbiotic and

aposymbiotic BMSB. Similar results were also observed in bean bug, Riptortus

pedestris, in which the expanded sac-like midgut region of aposymbiotic bean bugs

was larger than the symbiotic bugs (Futahashi et al. 2013). To remove the effect of

128 body mass differences, amino acid concentrations were analyzed on a per-individual basis.

The symbiotic association of P. carbekii with BMSB potentially aid in the production and metabolism of several amino acids. This is supported by the quantitative differences we observed in the absolute concentrations of free amino acid levels in symbiotic BMSB compared to aposymbiotic BMSB. We observed significant differences in the levels of one essential (Figure 5.4) and five non- essential (Figure 5.4) amino acids. Similar results were also observed in pea aphids

(Acyrthosiphon pisum), where the amino acids such as tyrosine acquired from the diet is different in symbiotic and aposymbiotic pea aphids (Wilkinson and Ishikawa

1999).

Lysine was the only free, essential amino acid with significantly lower concentrations (41% lower, P=0.029) in symbiotic BMSB compared to aposymbiotic

BMSB. Although other study showed that aposymbiotic pea aphids had reduced assimilation of lysine from the diet (Wilkinson and Ishikawa 1999), in BMSB, major precursors including diaminopimelate decarboxylase and dihydrodipicolinate reductase are involved in lysine biosynthetic process. The free amino acid titers are dynamic and symbiotic BMSB might have synthesized and utilized lysine quickly, while in aposymbiotic BMSB, the host might have produced lysine using alternative pathways was not utilized efficiently resulting in accumulation of lysine. The P. carbekii genome also had genes related to lysine synthesis such as lysine tRNA ligase

(Kenyon et al. 2015) raising a possibility that the lysine biosynthetic process is potentially shared between BMSB and P. carbekii. Although, lysine is an essential

129

amino acid mostly synthesized by bacteria, the metabolic pathways are incomplete in

the genomes of several primary symbionts including Sulcia, Carsonella and a few

Buchnera spp; in these cases the host or a co-symbiont can usually produce lysine

(Hansen and Moran 2014). An alternative hypothesis is that BMSB might have

potential alternative pathway for lysine biosynthesis increasing the levels in

aposymbiotic BMSB.

Bacterial symbionts of insects and parasitic nematodes can also synthesize non-

essential amino acids such as proline and tyrosine (Ankrah et al. 2017; Crawford et al.

2010; Otero et al. 2018). Consistent with our hypothesis to observe higher levels of amino acids in symbiotic BMSB, we found the non-essential amino acids asparagine, aspartic acid, proline, and tyrosine to be significantly higher in symbiotic BMSB compared to aposymbiotic BMSB. However, free amino acid, alanine was significantly low in symbiotic, compared to aposymbiotic BMSB (P<0.001).

Asparagine and aspartic acid were 42% (P=0.021) and 54% lower (P<0.001) in aposymbiotic BMSB compared to symbiotic BMSB. Asparagine helps in generating ammonia in Aedes aegypti (Scaraffia et al. 2010), although its potential role in

hemipterans is unclear. Aspartic acid plays an important role in producing β-alanine

in mosquitoes, Aedes aegypti (Richardson et al. 2010). The symbionts of European

firebug (Pyrrhocoris apterus) and the African cotton stainer (Dysdercus fasciatus)

form a cofactor from aspartic acid to produce pantothenate to their hosts (Salem et al.

2014). Using aspartic acid as precursor, Buchnera of aphids synthesize several

essential amino acids (Wilkinson et al. 2001). Similar to BMSB, the levels of aspartic

acid in black bean aphids were higher in symbiotic insects compared to aposymbiotic

130

(Miao et al. 2003). Plants usually have higher levels of asparagine and aspartic acid

(Gonzalez et al. 1997) and our study also had significantly higher levels (Figure 5.3)

in green beans. As these amino acids are abundant and readily available in plants,

BMSB and P. carbekii might not have the necessity to synthesize asparagine and

aspartic acid. The watery saliva of BMSB and green stink bugs have enzymes and

protein components and digestive enzymes to breakdown plant diet (Ramzi and

Hosseininaveh 2010; Peiffer and Felton 2014). The saliva of symbiotic BMSB might

have been efficient in digesting the plant proteins releasing the asparagine and

aspartic acid amino acids compared to aposymbiotic, which might not have consumed

equal amount of plant food due to reduced fitness. This explains why the levels of

asparagine and aspartic acid were significantly higher in symbiotic BMSB.

Proline is another non-essential amino acid that was 38% lower (P=0.008) in

aposymbiotic BMSB. This amino acid regulated stress in the symbiotic bacterial

genera of Photorhabdus and Xenorhabdus present in entomopathogenic nematodes

(Crawford et al. 2010). Proline also acts as a fuel for insect flight by enhancing the carbohydrate oxidation process in species of blow flies (Sacktor and Childress 1967),

bees and wasps (Teulier et al. 2016). Proline is synthesized from alanine and acetyl-

CoA in the insect fat body and its pathway requires precursors like glutamate 5-

semialdehyde and pyrroline 5-carboxylate (Candy et al. 1997). The significant

reduction of proline in aposymbiotic BMSB indicates P. carbekii’s cooperative role

in supplementing proline to BMSB and its potential role in stress regulation. Even

though the P. carbekii genome lacks genes related to proline biosynthesis (including

proA and proB), it does contain precursors required in proline synthesis including

131

glutamate gamma-semialdehyde dehydrogenase, acetyl glutamate kinase and pyrroline 5-carboxylate (Kenyon et al. 2015). A BMSB transcriptome did contain

both these precursors, glutamate 5-semialdehyde and pyrroline 5-carboxylate (Bansal

and Michel 2018), which may explain a mutualistic interaction of BMSB and P.

carbekii by providing required proline precursors.

Similarly, tyrosine was 65% low in aposymbiotic BMSB (P=0.001). Tyrosine is

important in cuticle sclerotization and pigmentation in several insects including

Tribolium castaneum and Manduca sexta. (Gorman & Arakane, 2010; Hopkins et al.

1982; Brehme, 1941) and is produced in the insect’s body from phenylalanine

(Brunet 1963). A BMSB transcriptome included tyrosine decarboxylase, which is a

mixed function oxidase that hydroxylates phenylalanine to produce tyrosine (Bansal

and Michel 2018). Phenylalanine and tyrosine tRNA ligases were found in the P.

carbekii genome that play a vital role in transferring amino acids onto its tRNA

(Banerjee and Chakraborty 2016; Kenyon et al. 2015). Prephenate dehydratase is

another enzyme involved in tyrosine biosynthesis which is important in the aphid-

buchnera relationship (Jiménez et al. 2000). Indeed this enzyme is present in both the

BMSB and the P. carbekii genomes (Bansal and Michel 2018; Kenyon et al. 2015)

and may be produced by a collaborative interaction. Alanine was the only non-

essential amino acid that was 31% lower in symbiotic BMSB explaining a possible

role of BMSB in synthesizing alanine. Due to genome reductions, endosymbionts of

several insects including, whiteflies (Upadhyay et al. 2015), aphids (Hansen &

Moran, 2011), and sharpshooters (Wu et al. 2006) have lost the capability of

synthesizing alanine and therefore is possibly facilitated by the insect host. The

132

transcriptome of BMSB also had β-ureidopropionase, an important enzyme in the

biosynthetic process of β-alanine. This enzyme is also found in Drosophila

melanogaster and helps synthesize β-alanine (Lundgren et al. 2008).

In summary, we studied the relative proportions and absolute levels of free amino

acids to understand the collaborative role of BMSB and its obligate symbiont P.

carbekii. Significant differences were observed in the relative proportions and

absolute amounts of free amino acids in BMSB treatments. The results showed

significant decreases in the concentrations of many free amino acids present in

aposymbiotic BMSB, except for lysine and alanine, which were significantly higher

in aposymbiotic BMSB. These free amino acids have diverse and important

physiological functions related to stress regulation and metabolism. As previous study

has shown, removal of P. carbekii will negatively affect the fitness and survival of

BMSB (Taylor et al. 2014), and our data is consistent with reduced BMSB fitness

likely due to the role of P. carbekii in providing essential nutrients and amino acids.

This suggests an important and collaborative role of P. carbekii and its host, BMSB in generating these important amino acids for physiological processes. Results from this study will improve our knowledge on the BMSB-P. carbekii interaction that may further be exploited in developing symbiont-mediated management tactics.

133

5.6 References:

Ankrah, Nana Y D, Junbo Luan, and Angela E Douglas. 2017. “Cooperative Metabolism

in a Three-Partner Insect-Bacterial Symbiosis Revealed by Metabolic Modeling.”

Journal of Bacteriology 199 (15): e00872-16. https://doi.org/10.1128/JB.00872-16.

Banerjee, Rajat, and Shruti Chakraborty. 2016. “Phenylalanyl-TRNA Synthetase.”

Research and Reports in Biochemistry 6 (June): 25.

https://doi.org/10.2147/RRBC.S83482.

Bansal, Raman, Andrew P Michel, and Zakee L Sabree. 2014. “The Crypt-Dwelling

Primary Bacterial Symbiont of the Polyphagous Pentatomid Pest Halyomorpha

Halys (Hemiptera: Pentatomidae).” Environmental Entomology 43 (3): 617–25.

http://ee.oxfordjournals.org/content/43/3/617.abstract.

Bansal, Raman, and Andy Michel. 2018. “Expansion of Cytochrome P450 and Cathepsin

Genes in the Generalist Herbivore Brown Marmorated Stink Bug.” BMC Genomics

19 (1): 60. https://doi.org/10.1186/s12864-017-4281-6.

Baumann, Paul. 2005. “Biology Bacteriocyte-Associated Endosymbionts of Plant Sap-

Sucking Insects.” Annual Review of Microbiology 59 (January): 155–89.

https://doi.org/10.1146/annurev.micro.59.030804.121041.

Brunet, P. C. J. 1963. “Tyrosine Metabolism in Insects.” Annals of the New York

Academy of Sciences 100 (2): 1020–34. https://doi.org/10.1111/j.1749-

6632.1963.tb42948.x.

Candy, D.J, A Becker, and G Wegener. 1997. “Coordination and Integration of

134

Metabolism in Insect Flight.” Comparative Biochemistry and Physiology Part B:

Biochemistry and Molecular Biology 117 (4): 497–512.

https://doi.org/10.1016/S0305-0491(97)00212-5.

Chrostek, Ewa, Kirsten Pelz-Stelinski, Gregory D D Hurst, and Grant L Hughes. 2017.

“Horizontal Transmission of Intracellular Insect Symbionts via Plants.” Frontiers in

Microbiology 8: 2237. https://doi.org/10.3389/fmicb.2017.02237.

Crawford, Jason M, Renee Kontnik, and Jon Clardy. 2010. “Regulating Alternative

Lifestyles in Entomopathogenic Bacteria.” Current Biology : CB 20 (1): 69–74.

https://doi.org/10.1016/j.cub.2009.10.059.

Douglas, A. E. 1998. “Nutritional Interactions in Insect-Microbial Symbioses: Aphids

and Their Symbiotic Bacteria Buchnera.” Annual Review of Entomology 43 (1): 17–

37. https://doi.org/10.1146/annurev.ento.43.1.17.

Douglas, A E. 2009. “The Microbial Dimension in Insect Nutritional Ecology.”

Functional Ecology 23: 38–47. https://doi.org/10.1111/j.1365-2435.2008.01442.x.

Feldhaar, Heike. 2011. “Bacterial Symbionts as Mediators of Ecologically Important

Traits of Insect Hosts.” Ecological Entomology 36 (5): 533–43.

https://doi.org/10.1111/j.1365-2311.2011.01318.x.

Flórez, Laura V, Peter H W Biedermann, Tobias Engl, and Martin Kaltenpoth. 2015.

“Defensive Symbioses of Animals with Prokaryotic and Eukaryotic

Microorganisms.” Natural Product Reports 32 (7): 904–36.

https://doi.org/10.1039/c5np00010f.

135

Futahashi, Ryo, Kohjiro Tanaka, Masahiko Tanahashi, Naruo Nikoh, Yoshitomo

Kikuchi, Bok Luel Lee, and Takema Fukatsu. 2013. “Gene Expression in Gut

Symbiotic Organ of Stinkbug Affected by Extracellular Bacterial Symbiont.” PLoS

ONE 8 (5): e64557. https://doi.org/10.1371/journal.pone.0064557.

Gonzalez-Castro, M J, J Lopez-Hernández, J Simal-Lozano, and M J Oruña-Concha.

1997. “Determination of Amino Acids in Green Beans by Derivatization with

Phenylisothiocianate and High-Performance Liquid Chromatography with

Ultraviolet Detection.” Journal of Chromatographic Science 35.

http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.902.5810&rep=rep1&typ

e=pdf.

Gorman, Maureen J, and Yasuyuki Arakane. 2010. “Tyrosine Hydroxylase Is Required

for Cuticle Sclerotization and Pigmentation in Tribolium Castaneum.” Insect

Biochemistry and Molecular Biology 40 (3): 267–73.

https://doi.org/10.1016/j.ibmb.2010.01.004.

Hansen, A. K., and N. A. Moran. 2011. “Aphid Genome Expression Reveals Host-

Symbiont Cooperation in the Production of Amino Acids.” Proceedings of the

National Academy of Sciences 108 (7): 2849–54.

https://doi.org/10.1073/pnas.1013465108.

Hansen, Allison K., and Nancy A. Moran. 2014. “The Impact of Microbial Symbionts on

Host Plant Utilization by Herbivorous Insects.” Molecular Ecology 23 (6): 1473–96.

https://doi.org/10.1111/mec.12421.

Hopkins, Theodore L, Thomas D Morgan, Yoichi Aso, and Karl J Kramer. 1982. “N-β-

136

Alanyldopamine: Major Role in Insect Cuticle Tanning.” Source: Science, New

Series 21725487 (23): 364–66. http://www.jstor.org/stable/1688788.

Hosokawa, Takahiro, Yoshiko Ishii, Naruo Nikoh, Manabu Fujie, Nori Satoh, and

Takema Fukatsu. 2016. “Obligate Bacterial Mutualists Evolving from

Environmental Bacteria in Natural Insect Populations.” Nature Microbiology 1 (1):

15011. https://doi.org/10.1038/nmicrobiol.2015.11.

Hosokawa, Takahiro, Yoshitomo Kikuchi, Naruo Nikoh, Masakazu Shimada, and

Takema Fukatsu. 2006. “Strict Host-Symbiont Cospeciation and Reductive Genome

Evolution in Insect Gut Bacteria.” PLoS Biology 4 (10): e337.

https://doi.org/10.1371/journal.pbio.0040337.

House, H L. 1962. “Insect Nutrition.” Annual Review of Biochemistry 31 (1): 653–72.

https://doi.org/10.1146/annurev.bi.31.070162.003253.

Huang, Tengfang, Georg Jander, and Martin de Vos. 2011. “Non-Protein Amino Acids in

Plant Defense against Insect Herbivores: Representative Cases and Opportunities for

Further Functional Analysis.” Phytochemistry 72 (13): 1531–37.

https://doi.org/10.1016/J.PHYTOCHEM.2011.03.019.

Jiménez, N, F González-Candelas, and F J Silva. 2000. “Prephenate Dehydratase from

the Aphid Endosymbiont (Buchnera) Displays Changes in the Regulatory Domain

That Suggest Its Desensitization to Inhibition by Phenylalanine.” Journal of

Bacteriology 182 (10): 2967–69. https://doi.org/10.1128/JB.182.10.2967-2969.2000.

Katherine S. Brehme. 1941. “The Effect of Adult Body Color Mutations upon the Larva

137

of Drosophila Melanogaster.” Genetics, Vol 27. 1941.

Kenyon, Laura J, Tea Meulia, and Zakee Sabree. 2015. “Habitat Visualization and

Genomic Analysis of ‘Candidatus Pantoea Carbekii,’ the Primary Symbiont of the

Brown Marmorated Stink Bug.” Genome Biology and Evolution 7 (2): 620–35.

Kim, Dohyup, Bushra F. Minhas, Hongmei Li-Byarlay, and Allison K. Hansen. 2018.

“Key Transport and Ammonia Recycling Genes Involved in Aphid Symbiosis

Respond to Host-Plant Specialization.” Genes Genomes Genetics, May,

g3.200297.2018. https://doi.org/10.1534/g3.118.200297.

Lee, Doo-Hyung, Brent D Short, Shimat V Joseph, J Christopher Bergh, and Tracy C

Leskey. 2013. “Review of the Biology, Ecology, and Management of Halyomorpha

Halys (Hemiptera: Pentatomidae) in China, Japan, and the Republic of Korea.”

Environmental Entomology 42 (4): 627–41. https://doi.org/10.1603/EN13006.

Lundgren, Stina, Bernhard Lohkamp, Birgit Andersen, Jure Piškur, and Doreen

Dobritzsch. 2008. “The Crystal Structure of β-Alanine Synthase from Drosophila

Melanogaster Reveals a Homooctameric Helical Turn-Like Assembly.” Journal of

Molecular Biology 377 (5): 1544–59. https://doi.org/10.1016/J.JMB.2008.02.011.

McCutcheon, J. P., B. R. McDonald, and N. A. Moran. 2009. “Convergent Evolution of

Metabolic Roles in Bacterial Co-Symbionts of Insects.” Proceedings of the National

Academy of Sciences 106 (36): 15394–99. https://doi.org/10.1073/pnas.0906424106.

Miao, Xue-xia, Ming Gan, and De-Cheng Ding. 2003. “The Role of Bacterial Symbionts

in Amino Acid Composition of Black Bean Aphids.” Insect Science 10 (3): 167–71.

138

https://doi.org/10.1111/j.1744-7917.2003.tb00380.x.

Moran, N. A., M. A. Munson, P. Baumann, and H. Ishikawa. 1993. “A Molecular Clock

in Endosymbiotic Bacteria Is Calibrated Using the Insect Hosts.” Proceedings of the

Royal Society B: Biological Sciences 253 (1337): 167–71.

https://doi.org/10.1098/rspb.1993.0098.

Oliver, K. M., J. A. Russell, N. A. Moran, and M. S. Hunter. 2003. “Facultative Bacterial

Symbionts in Aphids Confer Resistance to Parasitic Wasps.” Proceedings of the

National Academy of Sciences 100 (4): 1803–7.

https://doi.org/10.1073/pnas.0335320100.

Otero-Bravo, Alejandro, Shana Goffredi, and Zakee L Sabree. 2018. “Cladogenesis and

Genomic Streamlining in Extracellular Endosymbionts of Tropical Stink Bugs.”

Genome Biology and Evolution 10 (2): 680–93. https://doi.org/10.1093/gbe/evy033.

Peiffer, Michelle, and Gary W. Felton. 2014. “Insights into the Saliva of the Brown

Marmorated Stink Bug Halyomorpha Halys (Hemiptera: Pentatomidae).” PLoS

ONE 9 (2): e88483. https://doi.org/10.1371/journal.pone.0088483.

Ramzi, Samar, and Vahid Hosseininaveh. 2010. “Biochemical Characterization of

Digestive α-Amylase, α-Glucosidase and β-Glucosidase in Pistachio Green Stink

Bug, Brachynema Germari Kolenati (Hemiptera: Pentatomidae).” Journal of Asia-

Pacific Entomology 13 (3): 215–19. https://doi.org/10.1016/J.ASPEN.2010.03.009.

Richardson, Graham, Haizhen Ding, Tom Rocheleau, George Mayhew, Erin Reddy, Qian

Han, Bruce M Christensen, and Jianyong Li. 2010. “An Examination of Aspartate

139

Decarboxylase and Glutamate Decarboxylase Activity in Mosquitoes.” Molecular

Biology Reports 37 (7): 3199–3205. https://doi.org/10.1007/s11033-009-9902-y.

Sacktor, Bertram, and Charles C. Childress. 1967. “Metabolism of Proline in Insect

Flight Muscle and Its Significance in Stimulating the Oxidation of Pyruvate.”

Archives of Biochemistry and Biophysics 120 (3): 583–88.

https://doi.org/10.1016/0003-9861(67)90522-X.

Salem, Hassan, Eugen Bauer, Anja S Strauss, Heiko Vogel, Manja Marz, and Martin

Kaltenpoth. 2014. “Vitamin Supplementation by Gut Symbionts Ensures Metabolic

Homeostasis in an Insect Host.” Proceedings of the Royal Society B 281: 20141838.

https://doi.org/10.1098/rspb.2014.1838.

Scaraffia, Patricia Y, Qingfen Zhang, Kelsey Thorson, Vicki H Wysocki, and Roger L

Miesfeld. 2010. “Differential Ammonia Metabolism in Aedes Aegypti Fat Body and

Midgut Tissues.” Journal of Insect Physiology 56 (9): 1040–49.

https://doi.org/10.1016/j.jinsphys.2010.02.016.

Skidmore, Isabel H., and Allison K. Hansen. 2017. “The Evolutionary Development of

Plant-Feeding Insects and Their Nutritional Endosymbionts.” Insect Science 24 (6):

910–28. https://doi.org/10.1111/1744-7917.12463.

Su, Qi, Xiaomao Zhou, and Youjun Zhang. 2013. “Symbiont-Mediated Functions in

Insect Hosts.” Communicative and Integrative Biology 6 (3): 1–7.

https://doi.org/10.4161/cib.23804.

Sudakaran, Sailendharan, Franziska Retz, Yoshitomo Kikuchi, Christian Kost, and

140

Martin Kaltenpoth. 2015. “Evolutionary Transition in Symbiotic Syndromes

Enabled Diversification of Phytophagous Insects on an Imbalanced Diet.” The ISME

Journal 9 (12): 2587–2604. https://doi.org/10.1038/ismej.2015.75.

Suring, Wouter, Janine Marië, Rhody Broekman, Nico M Van Straalen, and Dick

Roelofs. 2016. “Biochemical Pathways Supporting Beta-Lactam Biosynthesis in the

Springtail Folsomia Candida.” https://doi.org/10.1242/bio.019620.

Taylor, Christopher M., Peter L. Coffey, Bridget D. DeLay, and Galen P. Dively. 2014.

“The Importance of Gut Symbionts in the Development of the Brown Marmorated

Stink Bug, Halyomorpha Halys (Stål).” PLoS ONE 9 (3): e90312.

https://doi.org/10.1371/journal.pone.0090312.

Teulier, Loïc, Jean-Michel Weber, Julie Crevier, and Charles-A Darveau. 2016. “Proline

as a Fuel for Insect Flight: Enhancing Carbohydrate Oxidation in Hymenopterans.”

Proceedings. Biological Sciences 283 (1834): 20160333.

https://doi.org/10.1098/rspb.2016.0333.

Upadhyay, Santosh Kumar, Shailesh Sharma, Harpal Singh, Sameer Dixit, Jitesh Kumar,

Praveen C Verma, and K Chandrashekar. 2015. “Whitefly Genome Expression

Reveals Host-Symbiont Interaction in Amino Acid Biosynthesis.” PloS One 10 (5):

e0126751. https://doi.org/10.1371/journal.pone.0126751.

Vogel, Kevin J, and Nancy A Moran. 2011. “Sources of Variation in Dietary

Requirements in an Obligate Nutritional Symbiosis.” Proceedings. Biological

Sciences 278 (1702): 115–21. https://doi.org/10.1098/rspb.2010.1304.

141

Whitten, Miranda M A, Paul D Facey, Ricardo Del Sol, Meirwyn C Evans, Jacob J

Mitchell, Owen G Bodger, Paul J Dyson, et al. 2016. “Symbiont-Mediated RNA

Interference in Insects.” Proc. R. Soc. B 283 (1825): 20160042.

https://doi.org/10.1098/rspb.2016.0042.

Wilkinson, T L, D Adams, L B Minto, and A E Douglas. 2001. “The Impact of Host

Plant on the Abundance and Function of Symbiotic Bacteria in an Aphid.” Journal

of Experimental Biology 204 (17): 3027 LP-3038.

http://jeb.biologists.org/content/204/17/3027.abstract.

Wilkinson, T L, and H Ishikawa. 1999. “The Assimilation and Allocation of Nutrients by

Symbiotic and Aposymbiotic Pea Aphids, Acyrthosiphon Pisum.” Entomologia

Experimentalis et Applicata 91: 195–201.

https://link.springer.com/content/pdf/10.1007%2F978-94-017-1890-5_25.pdf.

Wu, Dongying, Sean C Daugherty, Susan E Van Aken, Grace H Pai, Kisha L Watkins,

Hoda Khouri, Luke J Tallon, et al. 2006. “Metabolic Complementarity and

Genomics of the Dual Bacterial Symbiosis of Sharpshooters.” PLoS Biology 4 (6):

e188. https://doi.org/10.1371/journal.pbio.0040188.

142

5.7 Figures:

Figure 5.1: Agarose gel showing the symbiont clearance in the treated DNA samples of

2nd and 3rd instar nymphs. Tested with 16S universal bacterial (600bp) and P. carbekii specific (500bp) primers. Used 1kb DNA ladder. BMSB nymph with ‘+’ indicates the presence of P.carbekii and ‘-’ indicates absence of P.carbekii.

143

Figure 5.2: Box and whisker plot of the concentration (nmol/mg) of total free amino

acids in symbiotic BMSB, aposymbiotic BMSB and green beans tissue. The horizontal line within the box indicates the median, boundaries of the box indicate the 25th- and 75th

-percentile, and the whiskers indicate the highest and lowest values. Data points that fall

outside the highest and lowest values (upper and lower quartiles) are plotted as open

circles. The diamond symbol marked in the plot indicates the mean. Different letters over

the bars indicate significant difference among treatments (p<0.05).

144

Figure 5.3: The proportional composition of free amino acids based on the arcsine square root transformed values in A) symbiotic BMSB, B) aposymbiotic BMSB, and C) green bean.

145

Figure 5.4: Box and whisker plot of essential amino acids concentration (nmol/bug) in

symbiotic and aposymbiotic BMSB. The horizontal line within the box indicates the

median, boundaries of the box indicate the 25th- and 75th -percentile, and the whiskers indicate the highest and lowest values. Data points that fall outside the highest and lowest values (upper and lower quartiles) are plotted as open circles. The diamond symbol indicates the mean. Significant difference among treatments is indicated with an asterisk

(p<0.05).

146

Figure 5.5: Box and whisker plot of non-essential amino acids concentration (nmol/bug)

in symbiotic and aposymbiotic BMSB. The horizontal line within the box indicates the

median, boundaries of the box indicate the 25th- and 75th -percentile, and the whiskers indicate the highest and lowest values of the results. Data points that fall outside the highest and lowest values (upper and lower quartiles) are plotted as open circles. The diamond symbol indicates the mean. Significant difference among treatments is indicated with an asterisk (p<0.05).

147

CHAPTER 6

Metatranscriptomic analysis reveals importance of host-symbiont association and

their nutrient-provisioning role in brown marmorated stink bug, Halyomorpha

halys

6.1 Abstract

The fitness of most insect species is improved with the cooperation from bacterial endosymbionts. The bacterial endosymbionts are known to live inside the insect host and play a vital role in providing essential nutrients that are deficient in the insect’s diet.

Insect-symbiont interactions are well studied in hemipteran pests such as aphids.

Halyomorpha halys (brown marmorated stink bug-BMSB, Hemiptera: Pentatomidae) is a notorious invasive pest that is known to feed on more than 300 plant species. The primary obligate bacterial symbiont of BMSB is Candidatus Pantoea carbekii (P. carbekii). P. carbekii increases BMSB’s fitness and survival, presumably by providing essential nutrients, including amino acids and vitamins. Studying the symbiotic interaction of

BMSB-P. carbekii will provide insights on the molecular and physiological functions as well as the nutrient provisioning role of P. carbekii. In this study using a ribodepletion strategy, we assembled a gut metatranscriptome of symbiotic and aposymbiotic BMSB which includes sequences from both the host (BMSB) and bacteria (P. carbekii). A total of 283 differentially expressed transcripts were downregulated (padj<0.05) in the absence of P. carbekii and 11 of these had specific enriched functions (p<0.001, FDR<0.05), representing amino acid and vitamin biosynthesis. Our findings confirm that P. carbekii

148 is required by the host due to direct roles in synthesizing essential nutrients including amino acids arginine, lysine and the vitamin thiamine. Other basic functions of the cell, such as cell division and formation of chromatin, are also potentially affected by the absence of P. carbekii, which could contribute to the reduced fitness of aposymbiotic

BMSB. Results from this research may be exploited to target the specific genes/enzymes affecting the BMSB-P. carbekii association and help in developing novel pest management strategies.

6.2 Introduction

There is growing evidence on the biology and importance of insect-symbiont associations. A long-term close association of two or more species is defined as

‘symbiosis’. There are three main types of symbioses (mutualism, commensalism and antagonism) and examples of all exist with insect symbionts (Boucher et al. 1982;

Bronstein 2009). Bacterial symbionts are traditionally divided into two groups, obligate

(i.e. primary), or facultative (i.e. secondary) symbionts. Facultative symbionts are not essential for host survival, are not found in all individuals of host populations, and have effects ranging from mutualism to antagonism (Moran et al. 2008, Engelstädter and Hurst

2009, Gerardo and Parker 2014). By contrast, obligate symbionts are essential for the host’s survival and usually play a significant role in synthesizing nutrients that are lacking in a host’s diet (Akman et al. 2002; Douglas 2014; Bennett and Moran 2015;

Bansal et al. 2014). Obligate symbionts are known to increase the fitness of the host, facilitating adaptation and persistence in the environment. In addition to nutrient synthesis, several other benefits are associated with bacterial symbionts including

149

protection from pathogens, pheromone production, pesticide resistance (Dillon et al.

2005; Xu et al. 2015; Chung et al. 2013; Kikuchi et al. 2012). Symbionts in insects are

also known to broaden the host range of insects (Bourtzis et al. 2009).

Disrupting the insect-symbiont association potentially has negative impact on the

fitness and survival of the host. Many studies on hemipteran insects have used in vitro

sterilization techniques to prevent the nymphs from acquiring the symbionts in order to

study the effects of symbiont removal (Kikuchi et al. 2007; Prado et al. 2006; Fukatsu and Hosokawa 2002). Experimental removal of symbionts resulted in reduced fitness and development, higher mortality in several hemipteran hosts including plataspid stink bug

(Fukatsu and Hosokawa 2002) and other pentatomid species such as stink bugs (Abe et al. 1995, Kikuchi et al. 2007, Prado and Almeida 2009, Taylor et al. 2014).

Halyomorpha halys (BMSB-brown marmorated stink bug) is a notorious agricultural and nuisance pest belonging to the order Pentatomidae (Hemiptera). It was first detected

in United States in Allentown, PA in 1996 and is currently found in 44 states in the U.S.,

causing severe agricultural and nuisance problems (www.stopbmsb.org). BMSB has a

wide host range and is known to feed on >100 plant species, including important

agricultural crops such as soybean, corn, apple, other orchard and ornamental plants (Lee,

et al. 2013). This invasive species harbors an primary obligate symbiont, Candidatus

Pantoea carbekii (P. carbekii), which is a gamma proteobacterium (Bansal, Michel, and

Sabree 2014). Immediately after hatching, BMSB offspring feed on the maternal

secretions present on the egg casing to acquire the symbiont, P. carbekii (Bansal et al.

2014; Kenyon et al. 2015). The acquired symbiont passes through the foregut, midgut and

permanently resides in the distal gut region of BMSB (Bansal et al. 2014). The genome

150

of P. carbekii encodes biosynthetic pathways for the production of several amino acids

(phenylalanine, tryptophan, methionine, lysine, threonine and histidine), vitamins/co-

factors (folate, riboflavin, pyridoxal-5’phosphate) (Kenyon et al. 2015). Based on the genome of P. carbekii, this symbiont likely provides BMSB with these important nutrients and amino acids. However, these predicted hypotheses are not tested or further studied.

Therefore, the main goal of this study was to understand the host-symbiont

interaction and their role in providing nutrients by identifying the differentially expressed

genes between symbiotic and aposymbiotic BMSB. We hypothesized that BMSB-P.

carbekii closely cooperate in synthesis and metabolism of nutrients that are lacking in

BMSB’s diet. We predict that genes involved in the production of amino acids or

vitamins to be downregulated in aposymbiotic BMSB.

Developing a metatranscriptome will provide the sum total of genes expressed by all the organisms in the sample. Genes expressed by both BMSB and P.carbekii can be

studied from a metatranscriptome, using symbiotic and aposymbiotic treatments. This

will help understand the molecular coordination and identify genes related to nutrient

provisioning in BMSB-P.carbekii association. Till now the metatranscriptome approach

was used only used in termites and ants to understand the insect-microbe interactions

(Marynowska et al. 2017; Johansson et al. 2013; Peterson and Scharf 2016) and not reported in other insect species. For the first time in a hemipteran insect, a metatranscriptome was prepared by depleting the ribosomal RNA rather than mRNA enrichment. Our research findings will provide insights on the physiological interactions of BMSB-P. carbekii association and their nutrient provisioning role. Results from this

151 study may be exploited to target genes/enzymes that affect both BMSB and P. carbekii and help in developing novel pest management strategies using effective tools such as

RNA interference.

6.3 Materials and methods

Insect colony:

A laboratory colony of BMSB was established in summer 2012 with nymphs and adults collected from a soybean field (GPS: 40.76, -81.91) and supplemented from various locations around Wooster, Ohio. Colonies are maintained in a walk-in growth chamber with 16:8 (light:dark) photoperiod, 28±2°C, and 60-70% relative humidity. The insects had access to a varied diet including soybean plants or pods, corncobs, green beans, celery, carrots, apples and grapes.

BMSB egg mass sterilization:

We collected a total of 20 egg masses (10 for control and 10 for treatment), and each egg mass typically had 23-27 eggs. To clear the bacterial symbionts present on the egg casing, we surface sterilized 10 egg masses following the protocol described in a previous study (Taylor et al. 2014). Briefly, egg masses were immersed in a 100% ethanol bath for

5 minutes followed by 10% bleach solution separately for 6 minutes; then rinsed once in a separate ethanol bath and twice in a distilled water bath. The 10 egg masses in the control group were not manipulated in anyway. Both the symbiotic and aposymbiotic were placed in separate 16oz deli plastic containers with perforated lids for an air supply

152

and a soaked cotton wick as source of water. An excised pod of green bean (Phaseolus

vulgaris) was added to each plastic container as diet for emerging nymphs.

Tissue dissections, RNA extraction and cDNA library preparation:

We collected 3rd instar nymphs (<24 hours old) in a tube placed in liquid nitrogen and then dissected whole gut tissues immediately in RNAlater. Each biological replicate

included 10-pooled guts, and we had a total of 5 replicates per treatment (symbiotic and

aposymbiotic). To reduce variations within the experiment, 10-pooled guts were collected

from the 3rd instar nymphs that emerged from a single egg mass. The dissected gut tissues were stored at -80oC until further analysis.

Total RNA was extracted from the guts using the PureLink RNA kit (Ambion,

Applied Biosystems, TX, USA). The quantity of RNA was estimated using Nanodrop

2000 spectrophotometer (Thermo Scientific, MA, USA) and RNA quality was assessed

using a bioanalyzer (Tapestation) at the Molecular and Cellular Imaging Center on the

CFAES Wooster Campus. To reduce eukaryotic bias in library preparation, ribosomal

RNA was depleted using a Ribo-Zero Gold rRNA Removal kit (Illumina Inc., CA, USA).

The universal primers provided with the Illumina Ribo-Zero Gold rRNA Removal kit

was used for removing the rRNA contamination. The kit included a 1:1 ratio of HMR

(human, mouse, rat) and bacterial probes, which removed both insect and bacterial rRNA.

The cDNA libraries were then prepared using TruSeq stranded mRNA library prep kit

(Illumina Inc., CA, USA), following the manufacturer’s protocol. The quality of libraries

was confirmed using a high sensitivity DNA chip on an Agilent Bioanalyzer 2100

(Agilent Technologies, CA, USA). Each treatment (symbiotic and aposymbiotic) and

153

biological replicate (1-5 per treatment) were indexed separately for a total of 10 prepped

libraries for sequencing.

Metatranscriptome sequencing, assembly, annotation and differential expression

analysis:

The libraries were sent to HudsonAlpha Genomic Services Laboratory (Huntsville,

AL, USA) for quality control screening and sequencing on one lane of the Illumina

HiSeq 2500 platform, using 100bp paired-end sequences. The raw sequencing data was

processed to remove poor quality reads and the fastq files were generated using the

program Illumina CASAVA (Illumina CASAVA-1.8). Removal of adapters was

performed using Trimmomatic, version 0.38 (Bolger, Lohse, and Usadel 2014). The

rRNA depletion was measured by mapping the rRNA sequences to Silva database (Quast

et al. 2013). The remaining rRNA reads after the ribo-depletion, were removed after

comparing with eight other rRNA databases using SortMeRNA (version 2.1), comparing

our data with the eight default rRNA databases (Kopylova et al. 2012). The paired end reads were binned by mapping against the transcriptome of BMSB (Ioannidis et al. 2014)

and genome of P. carbekii (Kenyon et al. 2015) using BBsplit in the BBmaptools

package (Brian 2017). Any reads that were ambiguous or unmapped to the transcriptome

or genome were removed. Reads that were >200 bp from each treatment were

individually assembled with default parameters using Trinity, version 2.2.0 (Haas et al.

2013). The quality of the de novo assembled libraries was assessed by Transrate, version

1.0.3 (Unna et al. 2016) and count data for individual treatments was generated using

RSEM, version 1.3.1 (Li and Dewey 2011). Counts from RSEM were transformed in

154

Tximport (Soneson et al. 2015) for differential gene expression analyses using the

DESeq2 Bioconductor package, version 1.15.46 (Love et al. 2014) in R statistical

software, version 1.1.456. To find enriched gene ontology terms within the differentially

expressed transcripts, we performed enrichment analysis with Fisher’s exact test at FDR

of 0.05, p-value <0.05 and log2fold change cutoff as 1 using Blast2GO (Conesa et al.

2005).

Transcriptome assembly of P. carbekii:

The reads of the symbiotic treatment that mapped to the genome of P. carbekii were used to build a P. carbekii transcriptome. Using HISAT2, version 2.1.0 and StringTie, version 1.3.4 (Pertea et al. 2016), P. carbekii transcripts with more than 100 reads (100X coverage) were mapped and aligned to the genome of P. carbekii (Kenyon et al. 2015).

Biological replicates were individually mapped and later merged to generate a transcriptome. The longest open reading frames were predicted from the assembled transcripts using TransDecoder (Haas et al. 2013). Predicted peptides were mapped against prokaryotic databases for assigning Kegg ontology (KO) in BlastKOALA

(Kanehisa et al. 2016). We used reconstruct pathway option in BlastKOALA, to further understand the role of specific transcripts in biosynthetic and metabolism pathways.

6.4 Results

Assembly and characterization of BMSB gut metatranscriptome:

In total, 238,704,858 raw reads from ten libraries were mapped to the BMSB transcriptome or the P. carbekii genome (Table 6.1) and then used for de novo assembly.

155 rRNA reads not removed by ribo-depletion were identified by comparing reads with eight other rRNA databases using SortMeRNA and then were filtered from our metatranscriptome. Of the 86,452 assembled contigs, at least 50% of the contigs had a length of 984 bp (N50) and 90% of the contigs had a length of 254 bp (N90) and the mean open reading frame (ORF) length was 65.65% (Table 6.2). The E-value distribution of the hits in the non-redundant (Nr) database revealed that 59.67% of the mapped sequences showed significant homology (less than 1e-50) (Figure 6.1A). Annotation of transcripts against Nr database showed highest similarity to BMSB followed by

Cryptotermes secundus (drywood termite) and Cimex lectularius (bed bug) (Figure 6.1B).

To identify the physiological functions represented in the BMSB gut, we selected the top ten gene ontology (GO) terms represented by the transcripts and categorized into the

‘biological process’, ‘molecular function’ and ‘cellular component’ (Figure 6.2).

Transcripts with the GO terms of metabolic and cellular process were higher in the

‘biological process’ category relative to other GO terms. In the ‘molecular function’ category, catalytic activity and binding had abundant transcripts and in the ‘cellular process’ category, transcripts with the terms of integral component of membrane and membrane related were higher relative to other GO terms.

Differential gene expression analysis of BMSB gut:

To study the impact of clearing the P. carbekii on BMSB, we determined the differentially expressed genes in symbiotic and aposymbiotic BMSB. For this study we focused on BMSB transcripts with FDR less than 0.001 as significantly down regulated.

Using DESeq2 analysis, a total of 69,331 transcripts were differentially expressed and, of

156 these, 25,449 transcripts that did not have padj values due to high variation among the biological replicates were filtered out. In total, 384 transcripts were significantly up regulated (padj<0.05) and 50 transcripts had >1 log2 fold change whereas 283 transcripts were down regulated with <1 log2 fold change (padj<0.05). Only a small percentage of the differentially expressed transcripts had annotations: 3.64% (14 transcripts) of up regulated transcripts and 13.07% (37 transcripts) of down regulated transcripts. The transcripts with higher expression were not found in any enriched functions Enriched functions with decreased transcript expression were filtered for p<0.001 which resulted in

11 specific enriched functions relative to general functions (Table 6.3). The specifically enriched GO terms in the ‘biological process’ category in down regulated transcripts included lysine, arginine, thiamine biosynthetic processes, post-transcriptional gene silencing, chromatin silencing at rDNA and D-amino acid metabolic process. The GO terms including D-amino acid oxidase, nucleosome DNA binding, transaminase and aminotransferase activity was included in the category of ‘molecular function’. Only one

GO term, nuclear nucleosome, was included in the ‘cellular component’ category. Nine transcripts encoding these GO terms were annotated as bifunctional succcinylornithine/acetylornithine transaminase, D-aspartate oxidase, thiazole synthase and two proteins (histone H3 and protein pelota) (Table 6.3).

Transcriptome of P. carbekii:

To determine the transcripts expressed by P. carbekii in the symbiotic treatment, we performed a transcriptome analysis using BlastKOALA (https://www.kegg.jp/blastkoala/) with the focus on amino acid and vitamin biosynthetic pathways. (note: differential

157

expression analysis was not performed on P. carbekii transcriptome as the aposymbiotic

treatment lacked P. carbekii transcripts). A total of 81,63,479 reads were obtained from

the symbiotic treatment and these reads were mapped and aligned to the P. carbekii

genome (Kenyon et al. 2015). The total reads were aligned using HISAT2 and assembled

using StringTie. The resulted assembly was translated, reads <100 bp were removed and

the candidate coding regions within transcript sequences were identified using

TransDecoder, resulting in 786 predicted peptides from a total of 862 transcripts. Kegg

analysis of the 786 predicted peptides provided functional annotations to 90.1%(708

transcripts). Of these 708 transcripts, 29 were unclassified, 214 transcripts belonged to

the ‘genetic information processing’ category, 63 belonged to ‘amino acid metabolism’

and 60 transcripts belonged to ‘metabolism of cofactors and vitamins category’ (Table

6.4). Among the functional annotated transcripts, several of them coded for enzymes

involved in the biosynthetic and metabolic pathways of amino acids and vitamins

including arginine (Figure 6.3), lysine (Figure 6.4) and thiamine (Figure 6.5).

6.5 Discussion

The genome of P.carbekii predicts several hypotheses that P.carbekii encodes many

biosynthetic pathways to help synthesize essential nutrients to its host BMSB (Kenyon et

al. 2015). This prediction is also supported by fitness experiments, which show early

mortality when P. carbekii is removed. However, these nutrient-provisioning hypotheses

further need to be confirmed. Therefore, the main objective of this research was to

understand the interaction of BMSB-P.carbekii and for nutrient provisioning by identifying the differentially expressed genes and understanding expression of P. carbekii

158

genes in nutrient provisioning pathways. To accomplish this for the first time in

hemipteran insects, we developed a metatranscriptome using symbiotic and aposymbiotic

BMSB treatments.

In insects, the obligate symbiotic association between host and bacteria have a

significant role in synthesizing several nutrients, vitamins and cofactors (Baumann 2005;

Douglas 2011; Kenyon et al. 2015). To understand the fundamental physiology of the symbiotic and aposymbiotic BMSB gut, we studied the molecular functions represented

by the transcripts. Transcripts with the ‘metabolic’ and ‘cellular process’ GO terms were

higher in the ‘biological process’ category and transcripts with ‘catalytic activity’ and

‘binding’ were abundant in the ‘molecular function’ category. The basic physiological

functions in any insect include catalytic, metabolic and cellular processes. These GO

terms are found in abundance in most of the insect species. The GO terms ‘integral

component of membrane’ and ‘membrane associated’ were higher in the ‘cellular

process’ category which explains the significance of membrane transporters in the gut

that play a vital role in transporting the nutrients synthesized to other cells or tissues.

Indeed, several of these transcripts were differentially expressed, including biosynthesis

and metabolism of amino acids (lysine, arginine) and vitamins (thiamine). A total of 9

BMSB transcripts have encoded these GO terms (Table 6.3 – transcript IDs) that

represent enzymes including D-aspartate oxidase, bifunctional succcinylornithine/

acetylornithine transaminase, thiazole synthase and two proteins (histone H3 and protein

pelota). This study focuses on the functions of these 9 transcripts and their potential role

in biosynthetic pathways of amino acids and vitamins that help understand the symbiotic

association of BMSB and P. carbekii.

159

D-amino acids such as D-aspartate are present in vertebrates and invertebrates and play a role in vital physiological functions including development and hormone secretion

(Aniello 2007). D-aspartate oxidase is a flavoprotein that catalyzes the oxidative deanimation of D-amino acids generating 2-oxo acids such as oxaloacetate (Krebs 1935;

Still and Buell 1949). Oxaloacetate is an intermediate that enters the citrate cycle as 2- oxoglutarate to synthesize other amino acids and fatty acids (Nelson and Cox 2005).

Synthesis of oxaloacetate involves conversion of L-aspartate to D-aspartate by enzymes aspartate racemase and D-aspartate oxidase (Figure 6.3A). The gene that encodes aspartate racemase was found in P. carbekii whereas D-aspartate oxidase encoded gene was found in host BMSB. Our results showed D-aspartate oxidase is significantly downregulated in aposymbiotic BMSB as the P. carbekii is missing to provide D- aspartate, which is further, converted to oxaloacetate (Figure 6.3A). This suggests that P. carbekii plays a vital role in providing aspartate racemase to help synthesize oxaloacetate.

Biosynthesis of arginine and lysine require succcinylornithine/acetylornithine transaminase (commonly known as Arg D) in catalyzing the steps of the biosynthetic pathways (Ledwidge and Blanchard 1999). The enzyme acetylornithine transaminase converts N-acetylglutamate semialdehyde to N-acetyl ornithine, which is further converted to synthesize amino acid arginine (Figure 6.3B). Whereas, succcinylornithine transaminase enzyme specifically converts N-suucinyl L-2 amino 6-oxopimelate to N- succinyl L,L-2-6 diaminopimelate, which is further converted to synthesize amino acid lysine (Figure 6.4B). Both the enzymes succcinylornithine and acetylornithine transaminases were found to be significantly downregulated in aposymbiotic BMSB,

160

negatively affecting the biosynthetic pathways of arginine and lysine. However, an

alternative pathway to synthesize lysine has been observed in the host BMSB (Figure

6.4A). Lysine plays a vital role in development and growth in insects (Chang 2004) and

helps in calcium absorption in humans (Civitelli et al. 1992). Arginine in addition to

proline helps in freeze tolerance in Drosophila melanogaster (Vladimı́r et al. 2016) and arginase resulted from arginine metabolism helps in the formation of proline in silkmoth,

Hyalophora gloveri (Raghupathi and Campbell 1969). The enzymes involved in

biosynthesis of arginine and lysine are shared between BMSB and P. carbekii

emphasizing the obligate symbiotic association between BMSB and P. carbekii which

also supports the hypotheses predicted by Kenyon et al. (Kenyon et al. 2015).

Studies show that the content of arginine and lysine are higher in histone proteins for optimal interaction with DNA (Vandegrift et al. 1974; Daly and Mirsky 1955).Histones

are DNA-binding proteins that are found in the chromatin material and histone H3 is one of the five main proteins involved in chromatin structure (Bhasin et al. 2006). In aposymbiotic BMSB, the absence of P. carbekii disrupted the symbiotic association with its host likely negatively affected the amino acid biosynthetic pathways including arginine and lysine. This resulted in significant down regulation of enzymes involved in these pathways and potentially impacted the formation of the histone H3 proteins.

Indeed, this process was also down regulated in BMSB. Our data indicate that symbiont removal affects not only metabolism and biosynthesis of nutrients but also could disrupt the fundamental processes of a cell such as chromatin formation.

The biosynthesis of thiamine (vitamin B1) requires formation of thiazole and pyrimidine moieties separately. Thiazole moiety is derived from oxidative condensation

161 of 1-deoxy-D-xylulose 5-phosphate, cysteine and glycine (Du et al. 2011) which involves enzymes encoded by both BMSB and P. carbekii. However, the genome of P. carbekii does not encode for thiazole synthase (Kenyon et al. 2015) which is one of the enriched enzymes in BMSB. BMSB transcript representing thiazole synthase was significantly down regulated in aposymbiotic BMSB. Thiazole synthase might be only enzyme that helps in the formation of the thiazole phosphate carboxylate tautomer, which further helps in the formation of thiamine mono and diphosphates (Figure 6.5). Although several studies suggest that symbionts help in supplementation of vitamin B (Hosokawa et al.

2010; Salem et al. 2014), our results suggest that thiamine is synthesized due the symbiotic association between BMSB and P. carbekii. The enzymes that encode the canonical pathways to synthesize arginine, lysine and thiamine are shared by both BMSB and P. carbekii (Figure 6.3-6.5).

Another transcript that is significantly downregulated in the aposymbiotic BMSB is the protein pelota. Initial studies on the protein pelota showed that it is required for the meiotic cell division during spermatogenesis in male Drosophila melanogaster (Eberhart and Wasserman 1995). Another study showed that the pelota protein is highly conserved in organisms and regulates self-renewal of germline stem cells in the ovaries of

Drosophila (Xi et al. 2005). Disruption or mutations in pelota protein has caused delay of growth in Drosophila, failure of sporulation in yeast and embryonic lethality in mice, suggesting that pelota is required for normal progression of cell division (Eberhart and

Wasserman 1995; Adham et al. 2003; Davis and Engebrecht 1998). In addition, we found

11 proteins with GO term ‘cell cycle caulobacter’ in P. carbekii that are known play an important role in cell cycle and cell development in Escherichia coli and Caulobacter

162

crescentus (Curtis and Brun 2010; Ulisse et al. 2007). These proteins might also play a

vital role in P. carbekii cell cycle along with protein pelota. Suppression of pelota protein in aposymbiotic BMSB suggests that absence of P. carbekii has potentially affected the

progression of cell division and growth of BMSB resulting in reduced fitness.

In conclusion, this is the first investigation of the gut metatranscriptome of BMSB,

especially in regards to host and bacterial contributions. Our results shed light on the

molecular and physiological collaborations of BMSB and P. carbekii in biosynthesis and

metabolism of nutrients including amino acids and vitamins. These findings also

corroborate the hypotheses predicted by Kenyon et al. (Kenyon et al. 2015), suggesting that the obligate association of P. carbekii with BMSB is essential in synthesis of nutrients such as arginine, lysine and thiamine. The information on differentially expressed genes in this study can be exploited to target specific genes/enzymes that affect the BMSB-P. carbekii association and help in developing novel pest management strategies.

163

6.6 References

Abe, Yoshihiko, Koji Mishiro, and Masaaki Takanashi. 1995. “Symbiont of Brown-

Winged Green Bug, Plautia Stali Scott.” Japanese Journal of Applied Entomology

and Zoology 39 (2): 109–15. https://doi.org/10.1303/jjaez.39.109.

Adham, Ibrahim M, Mahmoud A Sallam, Gerd Steding, Monika Korabiowska, Ulrich

Brinck, Sigrid Hoyer-Fender, Changkyu Oh, and Wolfgang Engel. 2003.

“Disruption of the Pelota Gene Causes Early Embryonic Lethality and Defects in

Cell Cycle Progression.” Molecular and Cellular Biology 23 (4): 1470–76.

https://doi.org/10.1128/MCB.23.4.1470-1476.2003.

Akman, Leyla, Atsushi Yamashita, Hidemi Watanabe, Kenshiro Oshima, Tadayoshi

Shiba, Masahira Hattori, and Serap Aksoy. 2002. “Genome Sequence of the

Endocellular Obligate Symbiont of Tsetse Flies, Wigglesworthia Glossinidia.”

Nature Genetics 32 (3): 402–7. https://doi.org/10.1038/ng986.

Bansal, Raman, Andrew P Michel, and Zakee L Sabree. 2014. “The Crypt-Dwelling

Primary Bacterial Symbiont of the Polyphagous Pentatomid Pest Halyomorpha

Halys (Hemiptera: Pentatomidae).” Environmental Entomology 43 (3): 617–25.

http://ee.oxfordjournals.org/content/43/3/617.abstract.

Baumann, Paul. 2005. “Biology of Bacteriocyte-Associated Endosymbionts of Plant Sap-

Sucking Insects.” Annual Review of Microbiology 59 (1): 155–89.

https://doi.org/10.1146/annurev.micro.59.030804.121041.

Bennett, Gordon M., and Nancy A. Moran. 2015. “Heritable Symbiosis: The Advantages

164

and Perils of an Evolutionary Rabbit Hole.” Proceedings of the National Academy of

Sciences 112 (33): 10169–76. https://doi.org/10.1073/pnas.1421388112.

Bhasin, Manoj, Ellis L. Reinherz, and Pedro A. Reche. 2006. “Recognition and

Classification of Histones Using Support Vector Machine.” Journal of

Computational Biology 13 (1): 102–12. https://doi.org/10.1089/cmb.2006.13.102.

Bolger, Anthony M., Marc Lohse, and Bjoern Usadel. 2014. “Trimmomatic: A Flexible

Trimmer for Illumina Sequence Data.” Bioinformatics 30 (15): 2114–20.

https://doi.org/10.1093/bioinformatics/btu170.

Boucher, D H, S James, and K H Keeler. 1982. “The Ecology of Mutualism.” Annual

Review of Ecology and Systematics 13 (1): 315–47.

https://doi.org/10.1146/annurev.es.13.110182.001531.

Bourtzis, K., and Miller, T. A. (EDS.) CRC Press, Boca Raton. 2009. “Insect Symbiosis.

Vol. 3. (Contemporary Topics in Entomology Series).” 3 (2): 409–11.

Brian, Bushnell. 2017. “BBMap Short-Read Aligner, and Other Bioinformatics Tools.”

2017. http://sourceforge.net/ projects/bbmap/.

Bronstein, Judith L. 2009. “The Evolution of Facilitation and Mutualism.” Journal of

Ecology 97 (6): 1160–70. https://doi.org/10.1111/j.1365-2745.2009.01566.x.

Chang, Chiou Ling. 2004. “Effect of Amino Acids on Larvae and Adults of Ceratitis

Capitata (Diptera: Tephritidae).” Annals of the Entomological Society of America 97

(3): 529–35. https://doi.org/10.1603/0013-8746(2004)097[0529:eoaaol]2.0.co;2.

Chung, S. H., C. Rosa, E. D. Scully, M. Peiffer, J. F. Tooker, K. Hoover, D. S. Luthe, and

165

G. W. Felton. 2013. “Herbivore Exploits Orally Secreted Bacteria to Suppress Plant

Defenses.” Proceedings of the National Academy of Sciences 110 (39): 15728–33.

https://doi.org/10.1073/pnas.1308867110.

Civitelli, R, D T Villareal, D Agnusdei, P Nardi, L V Avioli, and C Gennari. 1992.

“Dietary L-Lysine and Calcium Metabolism in Humans.” Nutrition (Burbank, Los

Angeles County, Calif.) 8 (6): 400–405.

http://www.ncbi.nlm.nih.gov/pubmed/1486246.

Conesa, A., S. Gotz, J. M. Garcia-Gomez, J. Terol, M. Talon, and M. Robles. 2005.

“Blast2GO: A Universal Tool for Annotation, Visualization and Analysis in

Functional Genomics Research.” Bioinformatics 21 (18): 3674–76.

https://doi.org/10.1093/bioinformatics/bti610.

Curtis, Patrick D, and Yves V Brun. 2010. “Getting in the Loop: Regulation of

Development in Caulobacter Crescentus.” Microbiology and Molecular Biology

Reviews : MMBR 74 (1): 13–41. https://doi.org/10.1128/MMBR.00040-09.

D. L. Nelson and M. M. Cox. 2005. Principles of Biochemistry (4th Edn). New York: W.

H. Freeman. http://doi.wiley.com/10.1002/cbf.1216.

D’Aniello, Antimo. 2007. “D-Aspartic Acid: An Endogenous Amino Acid with an

Important Neuroendocrine Role.” Brain Research Reviews 53 (2): 215–34.

https://doi.org/10.1016/j.brainresrev.2006.08.005.

D’Ulisse, V., M. Fagioli, P. Ghelardini, and L. Paolozzi. 2007. “Three Functional

Subdomains of the Escherichia Coli FtsQ Protein Are Involved in Its Interaction

166

with the Other Division Proteins.” Microbiology 153 (1): 124–38.

https://doi.org/10.1099/mic.0.2006/000265-0.

Daly, M M, and A E Mirsky. 1955. “Histones with High Lysine Content.” The Journal of

General Physiology 38 (3): 405–13.

http://www.ncbi.nlm.nih.gov/pubmed/13221780.

Davis, L, and J Engebrecht. 1998. “Yeast Dom34 Mutants Are Defective in Multiple

Developmental Pathways and Exhibit Decreased Levels of Polyribosomes.”

Genetics 149 (1): 45–56. http://www.ncbi.nlm.nih.gov/pubmed/9584085.

Dillon, R. J., C. T. Vennard, A. Buckling, and A. K. Charnley. 2005. “Diversity of Locust

Gut Bacteria Protects against Pathogen Invasion.” Ecology Letters 8 (12): 1291–98.

https://doi.org/10.1111/j.1461-0248.2005.00828.x.

Douglas, Angela E. 2011. “Lessons from Studying Insect Symbioses.” Cell Host &

Microbe 10 (4): 359–67. https://doi.org/10.1016/j.chom.2011.09.001.

Douglas, Angela E. 2014. “Molecular Dissection of Nutrient Exchange at the Insect-

Microbial Interface.” Current Opinion in Insect Science 4 (October): 23–28.

https://doi.org/10.1016/j.cois.2014.08.007.

Du, Qinglin, Honghai Wang, and Jianping Xie. 2011. “Thiamin (Vitamin B1)

Biosynthesis and Regulation: A Rich Source of Antimicrobial Drug Targets?”

International Journal of Biological Sciences 7 (1): 41–52.

http://www.ncbi.nlm.nih.gov/pubmed/21234302.

Eberhart, C G, and S A Wasserman. 1995. “The Pelota Locus Encodes a Protein

167

Required for Meiotic Cell Division: An Analysis of G2/M Arrest in Drosophila

Spermatogenesis.” Development (Cambridge, England) 121 (10): 3477–86.

http://www.ncbi.nlm.nih.gov/pubmed/7588080.

Engelstädter, Jan, and Gregory D.D. Hurst. 2009. “The Ecology and Evolution of

Microbes That Manipulate Host Reproduction.” Annual Review of Ecology,

Evolution, and Systematics 40 (1): 127–49.

https://doi.org/10.1146/annurev.ecolsys.110308.120206.

Fukatsu, Takema, and Takahiro Hosokawa. 2002. “Capsule-Transmitted Gut Symbiotic

Bacterium of the Japanese Common Plataspid Stinkbug, Megacopta Punctatissima.”

Applied and Environmental Microbiology 68 (1): 389–96.

https://doi.org/10.1128/AEM.68.1.389-396.2002.

Gerardo, Nicole M, and Benjamin J Parker. 2014. “Mechanisms of Symbiont-Conferred

Protection against Natural Enemies: An Ecological and Evolutionary Framework An

Ecological Framework for Studying Protection.” Current Opinion in Insect Science

4: 8–14. https://doi.org/10.1016/j.cois.2014.08.002.

Haas, Brian J, Alexie Papanicolaou, Moran Yassour, Manfred Grabherr, Philip D Blood,

Joshua Bowden, Matthew Brian Couger, et al. 2013. “De Novo Transcript Sequence

Reconstruction from RNA-Seq Using the Trinity Platform for Reference Generation

and Analysis.” Nature Protocols 8 (8): 1494–1512.

https://doi.org/10.1038/nprot.2013.084.

Hosokawa, Takahiro, Ryuichi Koga, Yoshitomo Kikuchi, Xian-Ying Meng, and Takema

Fukatsu. 2010. “Wolbachia as a Bacteriocyte-Associated Nutritional Mutualist.”

168

Proceedings of the National Academy of Sciences of the United States of America

107 (2): 769–74. https://doi.org/10.1073/pnas.0911476107.

Ioannidis, Panagiotis, Yong Lu, Nikhil Kumar, Todd Creasy, Sean Daugherty, Marcus C

Chibucos, Joshua Orvis, et al. 2014. “Rapid Transcriptome Sequencing of an

Invasive Pest, the Brown Marmorated Stink Bug Halyomorpha Halys.” BMC

Genomics 15 (1): 738. https://doi.org/10.1186/1471-2164-15-738.

Johansson, Helena, Kishor Dhaygude, Stafva Lindström, Heikki Helanterä, Liselotte

Sundström, and Kalevi Trontti. 2013. “A Metatranscriptomic Approach to the

Identification of Microbiota Associated with the Ant Formica Exsecta.” PLoS ONE

8 (11): e79777. https://doi.org/10.1371/journal.pone.0079777.

Kanehisa, Minoru, Yoko Sato, and Kanae Morishima. 2016. “BlastKOALA and

GhostKOALA: KEGG Tools for Functional Characterization of Genome and

Metagenome Sequences.” Journal of Molecular Biology 428 (4): 726–31.

https://doi.org/10.1016/j.jmb.2015.11.006.

Kenyon, Laura J, Tea Meulia, and Zakee Sabree. 2015. “Habitat Visualization and

Genomic Analysis of ‘Candidatus Pantoea Carbekii,’ the Primary Symbiont of the

Brown Marmorated Stink Bug.” Genome Biology and Evolution 7 (2): 620–35.

Kikuchi, Y., M. Hayatsu, T. Hosokawa, A. Nagayama, K. Tago, and T. Fukatsu. 2012.

“Symbiont-Mediated Insecticide Resistance.” Proceedings of the National Academy

of Sciences 109 (22): 8618–22. https://doi.org/10.1073/pnas.1200231109.

Kikuchi, Y., T. Hosokawa, and T. Fukatsu. 2007. “Insect-Microbe Mutualism without

169

Vertical Transmission: A Stinkbug Acquires a Beneficial Gut Symbiont from the

Environment Every Generation.” Applied and Environmental Microbiology 73 (13):

4308–16. https://doi.org/10.1128/AEM.00067-07.

Kopylova, Evguenia, Laurent Noé, and Hélène Touzet. 2012. “SortMeRNA: Fast and

Accurate Filtering of Ribosomal RNAs in Metatranscriptomic Data.” Bioinformatics

28 (24): 3211–17. https://doi.org/10.1093/bioinformatics/bts611.

Krebs, H A. 1935. “Metabolism of Amino-Acids: Deamination of Amino-Acids.” The

Biochemical Journal 29 (7): 1620–44.

http://www.ncbi.nlm.nih.gov/pubmed/16745832.

Ledwidge, Richard, and John S Blanchard. 1999. “The Dual Biosynthetic Capability of

N-Acetylornithine Aminotransferase in Arginine and Lysine Biosynthesis.”

https://doi.org/10.1021/bi982574a.

Lee, Doo-Hyung, Brent D Short, Shimat V Joseph, J Christopher Bergh, and Tracy C

Leskey. 2013. “Review of the Biology, Ecology, and Management of Halyomorpha

Halys (Hemiptera: Pentatomidae) in China, Japan, and the Republic of Korea.”

Environmental Entomology 42 (4): 627–41. https://doi.org/10.1603/EN13006.

Li, Bo, and Colin N Dewey. 2011. “RSEM: Accurate Transcript Quantification from

RNA-Seq Data with or without a Reference Genome.” BMC Bioinformatics 12 (1):

323. https://doi.org/10.1186/1471-2105-12-323.

Love, Michael I, Wolfgang Huber, and Simon Anders. 2014. “Moderated Estimation of

Fold Change and Dispersion for RNA-Seq Data with DESeq2.” Genome Biology 15

170

(12): 550. https://doi.org/10.1186/s13059-014-0550-8.

Marynowska, Martyna, Xavier Goux, David Sillam-Dussès, Corinne Rouland-Lefèvre,

Yves Roisin, Philippe Delfosse, and Magdalena Calusinska. 2017. “Optimization of

a Metatranscriptomic Approach to Study the Lignocellulolytic Potential of the

Higher Termite Gut Microbiome.” BMC Genomics 18 (1): 681.

https://doi.org/10.1186/s12864-017-4076-9.

NA, Moran, McCutcheon JP, and A Nakabachi. 2008. “Genomics and Evolution of

Heritable Bacterial Symbionts.” Annual Review of Genetics 42: 165–90.

Pertea, Mihaela, Daehwan Kim, Geo M Pertea, Jeffrey T Leek, and Steven L Salzberg.

2016. “Transcript-Level Expression Analysis of RNA-Seq Experiments with

HISAT, StringTie and Ballgown.” Nature Protocols 11 (9): 1650–67.

https://doi.org/10.1038/nprot.2016.095.

Peterson, Brittany F., and Michael E. Scharf. 2016. “Metatranscriptome Analysis Reveals

Bacterial Symbiont Contributions to Lower Termite Physiology and Potential

Immune Functions.” BMC Genomics 17 (1): 772. https://doi.org/10.1186/s12864-

016-3126-z.

Prado, Simone S., and Rodrigo P. P. Almeida. 2009. “Role of Symbiotic Gut Bacteria in

the Development of Acrosternum Hilare and Murgantia Histrionica.” Entomologia

Experimentalis et Applicata 132 (1): 21–29. https://doi.org/10.1111/j.1570-

7458.2009.00863.x.

Prado, Simone S., Daniel Rubinoff, and Rodrigo P. P. Almeida. 2006. “Vertical

171

Transmission of a Pentatomid Caeca-Associated Symbiont.” Annals of the

Entomological Society of America 99 (3): 577–85. https://doi.org/10.1603/0013-

8746(2006)99[577:vtoapc]2.0.co;2.

Quast, Christian, Elmar Pruesse, Pelin Yilmaz, Jan Gerken, Timmy Schweer, Pablo

Yarza, Jörg Peplies, and Frank Oliver Glöckner. 2013. “The SILVA Ribosomal

RNA Gene Database Project: Improved Data Processing and Web-Based Tools.”

Nucleic Acids Research 41 (Database issue): D590-6.

https://doi.org/10.1093/nar/gks1219.

Raghupathi Reddy, S R, and J W Campbell. 1969. “Arginine Metabolism in Insects. Role

of Arginase in Proline Formation during Silkmoth Development.” The Biochemical

Journal 115 (3): 495–503. http://www.ncbi.nlm.nih.gov/pubmed/5353522.

Salem, Hassan, Eugen Bauer, Anja S Strauss, Heiko Vogel, Manja Marz, and Martin

Kaltenpoth. 2014. “Vitamin Supplementation by Gut Symbionts Ensures Metabolic

Homeostasis in an Insect Host.” Proceedings of the Royal Society B 281: 20141838.

https://doi.org/10.1098/rspb.2014.1838.

Smith-Unna, Richard, Chris Boursnell, Rob Patro, Julian M Hibberd, and Steven Kelly.

2016. “TransRate: Reference-Free Quality Assessment of de Novo Transcriptome

Assemblies.” Genome Research 26 (8): 1134–44.

https://doi.org/10.1101/gr.196469.115.

Soneson, Charlotte, Michael I. Love, and Mark D. Robinson. 2015. “Differential

Analyses for RNA-Seq: Transcript-Level Estimates Improve Gene-Level

Inferences.” F1000Research 4 (December): 1521.

172

https://doi.org/10.12688/f1000research.7563.1.

Still, J L, and M V Buell. 1949. “Studies on the Cyclophorase System; D-Aspartic

Oxidase.” The Journal of Biological Chemistry 179 (2): 831–37.

http://www.ncbi.nlm.nih.gov/pubmed/18150016.

Taylor, Christopher M., Peter L. Coffey, Bridget D. DeLay, and Galen P. Dively. 2014.

“The Importance of Gut Symbionts in the Development of the Brown Marmorated

Stink Bug, Halyomorpha Halys (Stål).” PLoS ONE 9 (3): e90312.

https://doi.org/10.1371/journal.pone.0090312.

Vandegrift, Vaughn, Martin Serra, Dexter S. Moore, and Thomas E. Wagner. 1974.

“Role of the Arginine-Rich Histones in the Maintenance of DNA Conformation in

Chromatin.” Biochemistry 13 (25): 5087–92. https://doi.org/10.1021/bi00722a005.

Vladimı́r, Vladimı́r, Koš Taí, Jaroslava Korbelová, Korbelová, Rodolphe Poupardin,

Martin Moos, and Petr S ̌ Imek. 2016. “Arginine and Proline Applied as Food

Additives Stimulate High Freeze Tolerance in Larvae of Drosophila Melanogaster.”

https://doi.org/10.1242/jeb.142158.

Xi, Rongwen, Choung Doan, Dazhi Liu, and Ting Xie. 2005. “Pelota Controls Self-

Renewal of Germline Stem Cells by Repressing a Bam-Independent Differentiation

Pathway.” Development (Cambridge, England) 132 (24): 5365–74.

https://doi.org/10.1242/dev.02151.

Xu, Letian, Qiaozhe Lou, Chihang Cheng, Min Lu, and Jianghua Sun. 2015. “Gut-

Associated Bacteria of Dendroctonus Valens and Their Involvement in Verbenone

173

Production.” Microbial Ecology 70 (4): 1012–23. https://doi.org/10.1007/s00248-

015-0625-4.

174

6.7 Tables and figures

S. No. Treatment # Reads Size (gb)

1 Aposymbiotic R1 30,136,749 3.4

2 Aposymbiotic R2 28,132,160 3.2

3 Aposymbiotic R3 22,819,950 2.6

4 Aposymbiotic R4 29,456,194 3.4

5 Aposymbiotic R5 29,201,874 3.3

6 Symbiotic R1 28,654,929 3.3

7 Symbiotic R2 16,724,672 1.9

8 Symbiotic R3 22,562,212 2.6

9 Symbiotic R4 18,653,665 2.2

10 Symbiotic R5 12,362,453 1.5

Table 6.1: Summary of sequencing statistics

175

Table 6.2: Summary of de novo Trinity assembly: statistics and quality assessment.

176

Figure 6.1: Total hits and top blast hits against non-redundant database. A) e-value distribution and C) Top-hit blast species distribution.

177

Figure 6.2: Top ten-gene ontology (GO) terms represented by the BMSB transcripts, categorized into the biological process, molecular function and cellular component.

178

Transcript Enzymes S. No. GO Name FDR P-Value IDs Related

lysine biosynthetic process via 1 2.422E-04 1.76E-07 diaminopimelate

2 arginine biosynthetic process bifunctional 2.422E-04 1.76E-07 DN56668 succinyldiaminopimelate succinylornithine 3 DN44900 2.422E-04 1.76E-07 transaminase activity /acetylornithine DN57316 N2-acetyl-L-ornithine:2- transaminase

4 oxoglutarate 5-aminotransferase 2.422E-04 1.76E-07

activity

5 D-amino acid metabolic process DN39502 D-aspartate 4.806E-02 1.86E-04

6 D-amino-acid oxidase activity DN29703 oxidase 2.317E-03 3.64E-06

DN43823 7 thiamine biosynthetic process thiazole synthase 5.749E-03 1.25E-05 DN55014

8 posttranscriptional gene silencing 3.171E-02 8.44E-05

9 chromatin silencing at rDNA DN18784 Histone H3 3.806E-02 1.24E-04

10 nucleosomal DNA binding DN27595 Protein pelota 3.806E-02 1.24E-04

11 nuclear nucleosome 3.806E-02 1.24E-04

Table 6.3: Specifically enriched functions of 11 BMSB down regulated transcripts with

p<0.001 (FDR p <0.05).

179

Number of S. No. Functional Category transcripts

1 Genetic Information Processing 116

2 Protein families: genetic information processing 98

3 Amino acid metabolism 63

4 Carbohydrate metabolism 61

5 Metabolism of cofactors and vitamins 60

6 Nucleotide metabolism 51

7 Energy metabolism 48

8 Protein families: signaling and cellular processes 35

9 Environmental Information Processing 28

10 Glycan biosynthesis and metabolism 24

11 Lipid metabolism 18

12 Protein families: metabolism 15

13 Cellular process 11

14 Metabolism of other amino acids 9

15 Metabolism of terpenoids and polyketides 9

Table 6.4: Functional annotation of P. carbekii transcripts against prokaryotic database in BlastKOALA.

180

A) B)

Figure 6.3: Enzymes involved in the biosynthetic pathway of A) Oxaloacetate and B)

Arginine amino acid. The enzymes in red color are encoded by host BMSB and in blue color are encoded by symbiont P. carbekii. The BMSB enzymes in red bold are differentially expressed in the DeSeq2 analysis.

181

A) B)

Figure 6.4: Enzymes involved in the biosynthetic pathway of A) L-lysine from 2- oxoglutarate and B) L-lysine from L-aspartate. The enzymes in red color are encoded by host BMSB and in blue color are encoded by symbiont P. carbekii. The BMSB enzyme in red bold is differentially expressed in the DeSeq2 analysis.

182

Figure 6.5: Enzymes involved in the biosynthetic pathway of vitamin thiamine. The enzymes in red color are encoded by host BMSB and in blue color are encoded by symbiont P. carbekii. The BMSB enzymes in red bold are differentially expressed in the

DeSeq2 analysis.

183

CHAPTER 7

Summary and future work

7.1 Summary and future work

Insect pests belonging to the order Hemiptera (including aphids, stink bugs,

whiteflies) cause significant damage to important agricultural commodities. The use of

insecticides has significantly increased in order to control the insect pests, which

negatively impacts beneficial insects, increases secondary pest outbreaks and facilitates

insecticide resistance. The piercing sucking mouthparts of the hemipteran phytophagous

insects allow feeding on the plant phloem, which is nutritionally imbalanced. To solve

this imbalance, most Hemipterans have co-evolved with bacterial endosymbionts.

Bacterial endosymbionts live inside the insect host and play a vital role in providing

essential nutrients that are lacking or in suboptimal levels in the insect’s diet. Insect-

symbiont interactions are well studied in Hemipteran pests such as aphids; however there

is limited information on the molecular coordination of insects and symbionts in other

notorious pests such as stink bugs. Understanding the fundamental biology of

agriculturally important pests such as stink bugs and investigating the molecular and

physiological mechanisms will not only provide information, but also help in developing

sustainable pests management strategies.

H. halys, commonly known as brown marmorated stink bug (BMSB, Hemiptera:

Pentatomidae) is a polyphagous invasive pest that causes damage to more than 100 agricultural and ornamental plants. It was first detected in North America in 1996 and is currently found in 44 states in the U.S. and four Canadian provinces, causing severe

184 agricultural and nuisance problems (www.stopbmsb.org). BMSB has a wide host range and feeds on important agricultural crops such as soybean, corn, apple, other orchard and ornamental plants (Lee et al. 2013). Stink bugs cause significant feeding damage to these soybean varieties (McPherson et al. 2008; Rao et al. 2002) and can prefer one soybean variety over the other, affecting the yield, quality and germination potential (La Mantia et al. 2018; De et al. 2013). Therefore, I investigated the feeding preferences and extent of damage caused to the soybean by BMSB. Indeed, BMSB caused severe feeding damage all soybean PIs used in this study and had a significant negative impact on the seed weight and damage incidence, but I did not observe evidence of a feeding preference among the PIs studied. Results from Chapter 2 suggested that intensified scouting during

BMSB susceptible soybean growth stages is required and the specialty soybeans used in this study should be treated similar to conventional soybean if the infestation exceeds the economic threshold.

Generalist insects like BMSB have a wide host range as it has potentially well- developed detoxification mechanisms to overcome the plant defenses. Cytochrome P450 monoxygenases (P450s) are well known for detoxification and metabolism of plant secondary metabolites encountered in the diet of many generalist insects (Feyereisen,

1999, 2006; Feyereisen, 2015; Guengerich, 2001; Scott & Wen, 2001). BMSB has over

163 total P450s, and P450s belonging to the CYP6 (HhCYP6) sub-family are known for detoxification of plant secondary metabolites. There is lack of knowledge on the gene expression of HhCYP6 members and their potential role in BMSB adaptation at the physiological level. Therefore, Chapter 3 of this dissertation focused on characterization and analysis of tissue, sex and diet-specific expression of HhCYP6 genes. Results of this

185

study showed differential transcription profiles of HhCYP6 genes in tissues suggesting

their role in diverse and important physiological functions related to the gut, fat body and

Malpighian tubules. This study has advanced our understanding of detoxification

enzymes in BMSB and provides a baseline for functional studies.

To study the function of potentially important genes in BMSB, I developed a

standard RNA interference (RNAi) method via microinjection. In Chapter 4, I have

successfully silenced the expression of NADPH-dependent cytochrome P450 reductase

(HhCPR), catalase (HhCAT) and vacuolar-type ATPase subunit-a (HhvATP) genes in

BMSB, which are known to be effective RNAi targets in other insects. There was a significant and systemic knockdown in the gene expression of these candidates when compared to the control population. In addition, reduction in the expression of HhvATP negatively impacted the survival of BMSB; however no phenotype was associated with

knockdown of HhCPR and HhCAT. Although HhCPR was successfully silenced, a major

limitation of this study was not evaluating if knockdown led to decreased susceptibility to

insecticides, since this gene is hypothesized to facilitate insecticide detoxification. It is

possible that, given additional time and challenges with a stressor like insecticide,

more HhCPR and HhCAT-silenced individuals would have died, consistent with the

importance of this gene seen in other insects. Preliminary work on a nebulization method

to silence HhCPR gene in BMSB nymphs and adults also showed promising results;

however this technique requires further evidence. This study has established a standard

method of dsRNA delivery via microinjection in BMSB, which helps in documenting

essential functions of important target genes.

186

BMSB feeds on nutritionally imbalanced plant sap and the nutrients that are

lacking in the plant’s diet are predicted to be provided by a bacterial endosymbiont.

BMSB harbors an obligate primary symbiont, Candidatus Pantoea carbekii (P. carbekii),

which is a gamma proteobacteria (Bansal et al. 2014). P. carbekii increases BMSB’s fitness and survival, presumably by providing important nutrients, including vitamins and essential and non-essential amino acids. Studying the symbiotic interaction of BMSB-P.

carbekii will provide insights on the molecular and physiological functions as well as the

nutrient provisioning role of P. carbekii. Therefore, in Chapter 5, I have determined the

impact of P. carbekii on free amino acid levels in symbiotic and aposymbiotic BMSB.

The results showed significant decrease in the concentrations of both essential and non-

essential amino acids present in aposymbiotic BMSB, except for lysine and alanine,

which were significantly higher in aposymbiotic BMSB. These free amino acids have

diverse and important functions related to stress regulation and metabolism, suggesting a

collaborative role of P. carbekii and its host in generating these important amino acids for

physiological processes.

To further understand the specific nutrient-provisioning role and molecular

coordination of BMSB and P. carbekii, I developed a metatranscriptome that focused on

the expression of both BMSB and P. carbekii transcripts (Chapter 6). This study provided

insights on the molecular and physiological collaborations between BMSB and P.

carbekii in the biosynthesis and metabolism of nutrients including amino acids and

vitamins. I focused on a total of 9 BMSB transcripts from the metatranscriptome that

represented enzymes including D-aspartate oxidase, succcinylornithine/ acetylornithine

transaminase, thiazole synthase and two proteins (histone H3 and protein pelota). The

187

findings of this chapter suggested that the association of P. carbekii with BMSB is

essential in synthesis of nutrients such as arginine, lysine and thiamine. The information

on differentially expressed genes in this study can be exploited to target specific

genes/enzymes that affect the BMSB-P. carbekii association and help in developing novel pest management strategies.

In summary, my dissertation research described the feeding damage, detoxification mechanisms and molecular coordination of the BMSB-P. carbekii association. Field studies have provided an overview of feeding preferences and damage caused to different soybean PIs. The role of P450s has shed light on detoxification mechanisms at physiological level and RNAi was developed as an efficient tool to further study the functions of important genes in BMSB. The well-characterized metatranscriptome of

BMSB provided a substantial resource for future molecular studies.

Future work targeting specific differentially expressed transcripts predicted to be important for the BMSB-P. carbekii association would provide additional data to fully understand BMSB biology. Silencing the expression of important enzymes like ArgD which is a bifunctional enzyme can signifcantly reduce the fiteness and development of

BMSB. Information from functional studies can be exploited in developing sustainable management tactics and ultimately reducing the use of insecticides. Overall, results of my entire research contributed to the fundamental biology and molecular physiology of insect-symbiont interactions, which are common throughout insects.

188

Figure 7.1: Working model of BMSB revealing answers to the research questions.

BMSB has no feeding preferences and caused damage to both high and low protein

soybean varieties. Cytochrome P450s present in the tissues of BMSB play an important

role in detoxification and metabolism of plant toxins encountered in the plant diet.

Endosymbiont, P. carbekii supplements nutrients potentially lacking in the diet of BMSB

and the host symbiont association is required to synthesize these essential nutrients such as amino acids, lysine, arginine and vitamin-thiamine.

189

7.2 References

Bansal, Raman, Andrew P Michel, and Zakee L Sabree. 2014. “The Crypt-Dwelling

Primary Bacterial Symbiont of the Polyphagous Pentatomid Pest Halyomorpha

Halys (Hemiptera: Pentatomidae).” Environmental Entomology 43 (3): 617–25.

http://ee.oxfordjournals.org/content/43/3/617.abstract.

De, Efrain, Santana Souza, Edson Luiz, Lopes Baldin, José Paulo, Gonçalves Franco Da

Silva, and André Luiz Lourenção. 2013. “Feeding Preference of Nezara Viridula

(Hemiptera: Pentatomidae) and Attractiveness of Soybean Genotypes.” Chilean

Journal Of Agricultural Research 73 (4). https://doi.org/10.4067/S0718-

58392013000400004.

Feyereisen, René. 1999. “Insect P450 Enzymes.” Annual Review of Entomology 44: 507–

33.

Feyereisen, René. 2006. “Evolution of Insect P450” 34: 1252–55.

Feyereisen, René. 2015. “Insect P450 Inhibitors and Insecticides: Challenges and

Opportunities.” Pest Management Science 71 (6): 793–800.

https://doi.org/10.1002/ps.3895.

Guengerich, F P. 2001. “Common and Uncommon Cytochrome P450 Reactions Related

to Metabolism and Chemical Toxicity.” Chemical Research in Toxicology 14 (6):

611–50. http://www.ncbi.nlm.nih.gov/pubmed/11409933.

Lee, Doo-Hyung, Brent D Short, Shimat V Joseph, J Christopher Bergh, and Tracy C

Leskey. 2013. “Review of the Biology, Ecology, and Management of Halyomorpha

190

Halys (Hemiptera: Pentatomidae) in China, Japan, and the Republic of Korea.”

Environmental Entomology 42 (4): 627–41. https://doi.org/10.1603/EN13006.

Mantia, Jonathan M La, M A Rouf Mian, and Margaret G Redinbaugh. 2018.

“Identification of Soybean Host Plant Resistance to Brown Marmorated Stink Bugs

in Maturity Group III Plant Introductions.” Journal of Economic Entomology 111

(1): 428–34. https://doi.org/10.1093/jee/tox295.

McPherson, R. M., W. C. Johnson, E. G. Fonsah, and P. M. Roberts. 2008. “Insect Pests

and Yield Potential of Vegetable Soybean (Edamame) Produced in Georgia.”

Journal of Entomological Science 43 (2): 225–40. https://doi.org/10.18474/0749-

8004-43.2.225.

Rao, M. S. S., A. S. Bhagsari, and A. I. Mohamed. 2002. “Fresh Green Seed Yield and

Seed Nutritional Traits of Vegetable Soybean Genotypes.” Crop Science 42 (6):

1950. https://doi.org/10.2135/cropsci2002.1950.

Scott, J G, and Z Wen. 2001. “Cytochromes P450 of Insects: The Tip of the Iceberg.”

Pest Management Science 57 (10): 958–67. https://doi.org/10.1002/ps.354.

191

8. References

Abe, Yoshihiko, Koji Mishiro, and Masaaki Takanashi. 1995. “Symbiont of Brown-

Winged Green Bug, Plautia Stali Scott.” Japanese Journal of Applied Entomology

and Zoology 39 (2): 109–15. https://doi.org/10.1303/jjaez.39.109.

Ahmad, Sami. 1992. “Biochemical Defence of Pro-Oxidant Plant Allelochemicals by

Herbivorous Insects.” Biochemical Systematics and Ecology 20 (4): 269–96.

Akman, Leyla, Atsushi Yamashita, Hidemi Watanabe, Kenshiro Oshima, Tadayoshi

Shiba, Masahira Hattori, and Serap Aksoy. 2002. “Genome Sequence of the

Endocellular Obligate Symbiont of Tsetse Flies, Wigglesworthia Glossinidia.”

Nature Genetics 32 (3): 402–7. https://doi.org/10.1038/ng986.

Bansal, Raman, Andrew P Michel, and Zakee L Sabree. 2014. “The Crypt-Dwelling

Primary Bacterial Symbiont of the Polyphagous Pentatomid Pest Halyomorpha

Halys (Hemiptera: Pentatomidae).” Environmental Entomology 43 (3): 617–25.

http://ee.oxfordjournals.org/content/43/3/617.abstract.

Bansal, Raman, Priyanka Mittapelly, Yuting Chen, Praveen Mamidala, Chaoyang Zhao,

and Andy Michel. 2016. “Quantitative RT-PCR Gene Evaluation and RNA

Interference in the Brown Marmorated Stink Bug.” Plos One 11 (5): e0152730.

https://doi.org/10.1371/journal.pone.0152730.

Bennett, Gordon M., and Nancy A. Moran. 2015. “Heritable Symbiosis: The Advantages

and Perils of an Evolutionary Rabbit Hole.” Proceedings of the National Academy of

Sciences 112 (33): 10169–76. https://doi.org/10.1073/pnas.1421388112.

192

Clavero, Miguel, and Emili García-Berthou. 2005. “Invasive Species Are a Leading

Cause of Animal Extinctions.” Trends in Ecology & Evolution 20 (3): 110.

https://doi.org/10.1016/j.tree.2005.01.003.

De, Efrain, Santana Souza, Edson Luiz, Lopes Baldin, José Paulo, Gonçalves Franco Da

Silva, and André Luiz Lourenção. 2013. “Feeding Preference of Nezara Viridula

(Hemiptera: Pentatomidae) and Attractiveness of Soybean Genotypes.” Chilean

Journal of Agricultural Research 73 (4). https://doi.org/10.4067/S0718-

58392013000400004.

Diaz-Albiter, Hector, Roanna Mitford, Fernando A. Genta, Mauricio R. V. Sant’Anna,

and Rod J. Dillon. 2011. “Reactive Oxygen Species Scavenging by Catalase Is

Important for Female Lutzomyia Longipalpis Fecundity and Mortality.” PLoS ONE

6 (3): e17486. https://doi.org/10.1371/journal.pone.0017486.

Douglas, Angela E. 2014. “Molecular Dissection of Nutrient Exchange at the Insect-

Microbial Interface.” Current Opinion in Insect Science 4 (October): 23–28.

https://doi.org/10.1016/j.cois.2014.08.007.

Erejomovich, J A. 1980. “El Vaneo De Frutos; Como Limitante Para El Cultivo De La

Soja.” Rev. Facultad de Agronomía. Vol. 1.

http://sedici.unlp.edu.ar/bitstream/handle/10915/29258/Documento_completo.pdf?se

quence=1.

Feyereisen, René. 1999. “Insect P450 Enzymes.” Annual Review of Entomology 44: 507–

33.

193

Feyereisen, René. 2006. “Evolution of Insect P450” 34: 1252–55.

Feyereisen, René. 2015. “Insect P450 Inhibitors and Insecticides: Challenges and

Opportunities.” Pest Management Science 71 (6): 793–800.

https://doi.org/10.1002/ps.3895.

Fukatsu, Takema, and Takahiro Hosokawa. 2002. “Capsule-Transmitted Gut Symbiotic

Bacterium of the Japanese Common Plataspid Stinkbug, Megacopta Punctatissima.”

Applied and Environmental Microbiology 68 (1): 389–96.

https://doi.org/10.1128/AEM.68.1.389-396.2002.

Guengerich, F P. 2001. “Common and Uncommon Cytochrome P450 Reactions Related

to Metabolism and Chemical Toxicity.” Chemical Research in Toxicology 14 (6):

611–50. http://www.ncbi.nlm.nih.gov/pubmed/11409933.

Hoebeke, E. R., and M. E. Carter. 2003. “Halyomorpha Halys (Stål) (Heteroptera:

Pentatomidae): A Polyphagous Plant Pest from Asia Newly Detected in North

America.” Proceedings of the Entomological Society of Washington 105 (1): 225–

37.

JA, Baum, T Bogaert, W Clinton, Heck GR, P Feldmann, O Ilagan, S Johnson, et al.

2007. “Control of Coleopteran Insect Pests through RNA Interference.” Nature

Biotechnology 25 (11): 1322–26.

Jefferies, Kevin C., Daniel J. Cipriano, and Michael Forgac. 2008. “Function, Structure

and Regulation of the Vacuolar (H+)-ATPases.” Archives of Biochemistry and

Biophysics 476 (1): 33–42. https://doi.org/10.1016/j.abb.2008.03.025.

194

Joseph, Shimat V, Jonathan W Stallings, Tracy C Leskey, Greg Krawczyk, Dean Polk,

Bryan Butler, and J Christopher Bergh. 2014. “Spatial Distribution of Brown

Marmorated Stink Bug (Hemiptera: Pentatomidae) Injury at Harvest in Mid-Atlantic

Apple Orchards.” Journal of Economic Entomology 107 (5): 1839–48.

https://doi.org/10.1603/EC14154.

Kenyon, Laura J, Tea Meulia, and Zakee Sabree. 2015. “Habitat Visualization and

Genomic Analysis of ‘Candidatus Pantoea Carbekii,’ the Primary Symbiont of the

Brown Marmorated Stink Bug.” Genome Biology and Evolution 7 (2): 620–35.

Kikuchi, Y., T. Hosokawa, and T. Fukatsu. 2007. “Insect-Microbe Mutualism without

Vertical Transmission: A Stinkbug Acquires a Beneficial Gut Symbiont from the

Environment Every Generation.” Applied and Environmental Microbiology 73 (13):

4308–16. https://doi.org/10.1128/AEM.00067-07.

Leskey, Tracy C., Brent D. Short, Bryan R. Butler, and Starker E. Wright. 2012. “Impact

of the Invasive Brown Marmorated Stink Bug, Halyomorpha Halys (Stål), in Mid-

Atlantic Tree Fruit Orchards in the United States: Case Studies of Commercial

Management.” Psyche: A Journal of Entomology 2012 (July): 1–14.

https://doi.org/10.1155/2012/535062.

Mantia, Jonathan M La, M A Rouf Mian, and Margaret G Redinbaugh. 2018.

“Identification of Soybean Host Plant Resistance to Brown Marmorated Stink Bugs

in Maturity Group III Plant Introductions.” Journal of Economic Entomology 111

(1): 428–34. https://doi.org/10.1093/jee/tox295.

Mao, W, M A Schuler, and M R Berenbaum. 2007. “Cytochrome P450s in Papilio

195

Multicaudatus and the Transition from Oligophagy to Polyphagy in the

Papilionidae.” Insect Molecular Biology 16 (4): 481–90.

https://doi.org/10.1111/j.1365-2583.2007.00741.x.

McPherson, R. M., G. K. Douce, and R. D. Hudson. 1993. “Annual Variation in Stink

Bug (Heteroptera: Pentatomidae) Seasonal Abundance and Species Composition in

Georgia Soybean and Its Impact on Yield and Quality.” Journal of Entomological

Science 28 (1): 61–72. https://doi.org/10.18474/0749-8004-28.1.61.

Nishino, Hideaki, and Teruo Ishibashi. 2000. “Evidence for Requirement of NADPH-

Cytochrome P450 Oxidoreductase in the Microsomal NADPH-Sterol Δ7-Reductase

System.” Archives of Biochemistry and Biophysics 374 (2): 293–98.

https://doi.org/10.1006/abbi.1999.1602.

Olson, Lars J. 2006. “The Economics of Terrestrial Invasive Species: A Review of the

Literature.” Agricultural and Resource Economics Review. Vol. 35.

http://entnemdept.ufl.edu/Hodges/als4161/Secure/PDF

Files/Articles/Olson2006.pdf.

Owens, D R, Jr. Herbert D. A., G P Dively, D D Reisig, and T P Kuhar. 2013. “Does

Feeding by Halyomorpha Halys (Hemiptera: Pentatomidae) Reduce Soybean Seed

Quality and Yield?” Ecen Journal of Economic Entomology 106 (3): 1317–23.

Panizzi, A. R., and F. Slansky. 1985. “Review of Phytophagous Pentatomids (Hemiptera:

Pentatomidae) Associated with Soybean in the Americas.” The Florida

Entomologist 68 (1): 184. https://doi.org/10.2307/3494344.

196

Prado, Simone S., and Rodrigo P. P. Almeida. 2009. “Role of Symbiotic Gut Bacteria in

the Development of Acrosternum Hilare and Murgantia Histrionica.” Entomologia

Experimentalis et Applicata 132 (1): 21–29. https://doi.org/10.1111/j.1570-

7458.2009.00863.x.

Prado, Simone S., Daniel Rubinoff, and Rodrigo P. P. Almeida. 2006. “Vertical

Transmission of a Pentatomid Caeca-Associated Symbiont.” Annals of the

Entomological Society of America 99 (3): 577–85. https://doi.org/10.1603/0013-

8746(2006)99[577:vtoapc]2.0.co;2.

Ragsdale, David W., Douglas A. Landis, Jacques Brodeur, George E. Heimpel, and

Nicolas Desneux. 2011. “Ecology and Management of the Soybean Aphid in North

America.” Annual Review of Entomology 56 (1): 375–99.

https://doi.org/10.1146/annurev-ento-120709-144755.

Rice, Kevin B, Chris J Bergh, Erik J Bergmann, Dave J Biddinger, Christine Dieckhoff,

Galen Dively, Tara Gariepy, et al. 2014. “Biology , Ecology , and Management of

Brown Marmorated Stink Bug (Hemiptera : Pentatomidae)” 5 (3): 1–13.

Scott, J G, and Z Wen. 2001. “Cytochromes P450 of Insects: The Tip of the Iceberg.”

Pest Management Science 57 (10): 958–67. https://doi.org/10.1002/ps.354.

Taylor, Christopher M., Peter L. Coffey, Bridget D. DeLay, and Galen P. Dively. 2014.

“The Importance of Gut Symbionts in the Development of the Brown Marmorated

Stink Bug, Halyomorpha Halys (Stål).” PLoS ONE 9 (3): e90312.

https://doi.org/10.1371/journal.pone.0090312.

197

Turnipseed, S G, and M Kogan. 1976. “Soybean Entomology.” Annual Review of

Entomology 21 (1): 247–82. https://doi.org/10.1146/annurev.en.21.010176.001335.

Wieczorek, H, G Grber, W R Harvey, M Huss, H Merzendorfer, and W Zeiske. 2000.

“Structure and Regulation of Insect Plasma Membrane H(+)V-ATPase.” The

Journal of Experimental Biology 203 (Pt 1): 127–35.

http://www.ncbi.nlm.nih.gov/pubmed/10600681.

Yao, J, D Rotenberg, A Afsharifar, K Barandoc-Alviar, and Whitfield AE. 2013.

“Development of RNAi Methods for Peregrinus Maidis, the Corn Planthopper.”

PloS One 8 (8).

Zhao, Haiming, Xin Yi, Zhen Hu, Meiying Hu, Shaohua Chen, Rizwan-ul-Haq

Muhammad, Xiaolin Dong, and Liang Gong. 2013. “RNAi-Mediated Knockdown of

Catalase Causes Cell Cycle Arrest in SL-1 Cells and Results in Low Survival Rate

of Spodoptera Litura (Fabricius).” PLoS ONE 8 (3): e59527.

https://doi.org/10.1371/journal.pone.0059527.

Zhu, Fang, Sarah Sams, Tim Moural, Kenneth F. Haynes, Michael F. Potter, and Subba

R. Palli. 2012. “RNA Interference of NADPH-Cytochrome P450 Reductase Results

in Reduced Insecticide Resistance in the Bed Bug, Cimex Lectularius.” PLoS ONE 7

(2): e31037. https://doi.org/10.1371/journal.pone.0031037.

Miner, F. D. (1961). Stink bug damage to soybeans. Arkansas Agricultural Experiment

Station. Farm Research. 10: 12.

Cissel, B. J., Whalen, Dively, G., Hooks, C. T., Patton Venogopal, D., Aigner, B.,

Herbert, B. A., Kuhar, T., Malone, S., Seymore. E. (2015). Brown marmorated stink

198

bug biology and management in Mid-Atlantic soybeans. Virginia Cooperation

Extension Publication No. Ento – 168NP.

Aigner, B. L., D. A. Herbert, G. P. Dively, D. Venugopal, J. Whalen, B. Cissel, T. P.

Kuhar, C. C. Brewster, J. W. Hogue, and E. Seymore. 2016. “Comparison of Two

Sampling Methods for Assessing Halyomorpha Halys (Hemiptera: Pentatomidae)

Numbers in Soybean Fields.” Journal of Economic Entomology 109 (6): 2586–89.

https://doi.org/10.1093/jee/tow230.

Aigner, B. L., T. P. Kuhar, D. A. Herbert, C. C. Brewster, J. W. Hogue, and J. D. Aigner.

2017. “Brown Marmorated Stink Bug (Hemiptera: Pentatomidae) Infestations in

Tree Borders and Subsequent Patterns of Abundance in Soybean Fields.” Journal of

Economic Entomology 110 (2): 487–90. https://doi.org/10.1093/jee/tox047.

Blaauw, Brett R, Dean Polk, and Anne L Nielsen. 2015. “IPM-CPR for Peaches:

Incorporating Behaviorally-Based Methods to Manage Halyomorpha Halys and Key

Pests in Peach.” Pest Management Science 71 (11): 1513–22.

https://doi.org/10.1002/ps.3955.

Clavero, Miguel, and Emili García-Berthou. 2005. “Invasive Species Are a Leading

Cause of Animal Extinctions.” Trends in Ecology & Evolution 20 (3): 110.

https://doi.org/10.1016/j.tree.2005.01.003.

Clissold, F. J., G. D. Sanson, and J. Read. 2006. “The Paradoxical Effects of Nutrient

Ratios and Supply Rates on an Outbreaking Insect Herbivore, the Australian Plague

Locust.” Journal of Animal Ecology 75 (4): 1000–1013.

https://doi.org/10.1111/j.1365-2656.2006.01122.x.

Cober, Elroy R., and Harvey D. Voldeng. 2001. “A New Soybean Maturity and

199

Photoperiod-Sensitivity Locus Linked to E1 and T.” Crop Science 41 (3): 698–698.

http://go.galegroup.com/ps/i.do?id=GALE%7CA76629353&sid=googleScholar&v=

2.1&it=r&linkaccess=fulltext&issn=0011183X&p=AONE&sw=w&userGroupNam

e=cens39029.

Fehr, Walter R, and Charles E Caviness. 1977. “Stages of Soybean Development.” Iowa

Coop. Ext. Serv. Spec. Rep. 80. Iowa State Univ., Ames, IA.

http://lib.dr.iastate.edu/specialreports.

Felipe, Matías de, José A. Gerde, and José L. Rotundo. 2016. “Soybean Genetic Gain in

Maturity Groups III to V in Argentina from 1980 to 2015.” Crop Science 56 (6):

3066. https://doi.org/10.2135/cropsci2016.04.0214.

Fischer, K., and K. Fiedler. 2000. “Response of the Copper Butterfly Lycaena Tityrus to

Increased Leaf Nitrogen in Natural Food Plants: Evidence against the Nitrogen

Limitation Hypothesis.” Oecologia 124 (2): 235–41.

https://doi.org/10.1007/s004420000365.

Franca Neto, J. B., F. C. Krzyzanowski, and N. P. Da Costa. 1998. “The Tetrazolium Test

for Soybean Seeds.” EMBRAPA-CNPSo, Londrina, Brazil. Documentos, 115, 71p,

September, 71p.

https://www.infoteca.cnptia.embrapa.br/infoteca/handle/doc/460029.

Joseph, Shimat V, Jonathan W Stallings, Tracy C Leskey, Greg Krawczyk, Dean Polk,

Bryan Butler, and J Christopher Bergh. 2014. “Spatial Distribution of Brown

Marmorated Stink Bug (Hemiptera: Pentatomidae) Injury at Harvest in Mid-Atlantic

Apple Orchards.” Journal of Economic Entomology 107 (5): 1839–48.

https://doi.org/10.1603/EC14154.

200

Kamminga, K. L., A. L. Koppel, D. A. Herbert, and T. P. Kuhar. 2012. “Biology and

Management of the Green Stink Bug.” Journal of Integrated Pest Management 3

(3): C1–8. https://doi.org/10.1603/IPM12006.

Kim, C S, Glenn Schaible, Lynn Garrett, Ruben Lubowski, and Donna Lee. 2008.

“Economic Impacts of the U.S. Soybean Aphid Infestation: A Multi-Regional

Competitive Dynamic Analysis.” Agricultural and Resource Economics Review.

Vol. 37. http://sbrusa.net.

Koch, Robert L., Daniela T. Pezzini, Andrew P. Michel, and Thomas E. Hunt. 2017.

“Identification, Biology, Impacts, and Management of Stink Bugs (Hemiptera:

Heteroptera: Pentatomidae) of Soybean and Corn in the Midwestern United States.”

Journal of Integrated Pest Management 8 (1). https://doi.org/10.1093/jipm/pmx004.

Lee, Doo-Hyung, Brent D Short, Shimat V Joseph, J Christopher Bergh, and Tracy C

Leskey. 2013. “Review of the Biology, Ecology, and Management of Halyomorpha

Halys (Hemiptera: Pentatomidae) in China, Japan, and the Republic of Korea.”

Environmental Entomology 42 (4): 627–41. https://doi.org/10.1603/EN13006.

Lu, Zhong-Xian, Kong-Luen Heong, Xiao-Ping Yu, and Cui Hu. 2004. “Effects of Plant

Nitrogen on Ecological Fitness of the Brown Planthopper, Nilaparvata Lugens Stal.

in Rice.” Journal of Asia-Pacific Entomology 7 (1): 97–104.

https://doi.org/10.1016/S1226-8615(08)60204-6.

McPherson, R. M., W. C. Johnson, E. G. Fonsah, and P. M. Roberts. 2008. “Insect Pests

and Yield Potential of Vegetable Soybean (Edamame) Produced in Georgia.”

Journal of Entomological Science 43 (2): 225–40. https://doi.org/10.18474/0749-

8004-43.2.225.

201

McPherson, R, J McPherson, and Robert McPherson. 2000. Stink Bugs of Economic

Importance in America North of Mexico. CRC Press.

https://doi.org/10.1201/9781420042429.

Miyao, G. M., R. M. Davis, and H. J. Phaff. 2000. “Outbreak of Eremothecium Coryli

Fruit Rot of Tomato in California.” Plant Disease 84 (5): 594–594.

https://doi.org/10.1094/PDIS.2000.84.5.594C.

Ragsdale, David W., Douglas A. Landis, Jacques Brodeur, George E. Heimpel, and

Nicolas Desneux. 2011. “Ecology and Management of the Soybean Aphid in North

America.” Annual Review of Entomology 56 (1): 375–99.

https://doi.org/10.1146/annurev-ento-120709-144755.

Rao, M. S. S., A. S. Bhagsari, and A. I. Mohamed. 2002. “Fresh Green Seed Yield and

Seed Nutritional Traits of Vegetable Soybean Genotypes.” Crop Science 42 (6):

1950. https://doi.org/10.2135/cropsci2002.1950.

Raza, Ghulam, Mohan B Singh, and Prem L Bhalla. 2017. “In Vitro Plant Regeneration

from Commercial Cultivars of Soybean.” BioMed Research International 2017:

7379693. https://doi.org/10.1155/2017/7379693.

Silva, F A C, J J da Silva, R A Depieri, and Antônio Ricardo Panizzi. 2012. “Feeding

Activity, Salivary Amylase Activity, and Superficial Damage to Soybean Seed by

Adult Edessa Meditabunda (F.) and Euschistus Heros (F.) (Hemiptera:

Pentatomidae).” Neotropical Entomology 41 (5): 386–90.

https://doi.org/10.1007/s13744-012-0061-9.

Sterner, Robert Warner., and James J. Elser. 2002. Ecological Stoichiometry : The

Biology of Elements from Molecules to the Biosphere. Princeton University Press.

202

https://www.jstor.org/stable/j.ctt1jktrp3.

Summerfield, R.J., H. Asumadu, R.H. Ellis, and A. Qi. 1998. “Characterization of the

Photoperiodic Response of Post-Flowering Development in Maturity Isolines of

Soyabean [Glycine Max(L.) Merrill] ‘Clark.’” Annals of Botany 82 (6): 765–71.

https://doi.org/10.1006/ANBO.1998.0755.

Tuzar M, Abdullah N A P, Mohd Lassim M B, Kamaruzaman Jusoff, and Puteh A B.

2010. “The Effects of Temperature Stress on the Quality and Yield of Soya Bean

[(Glycine Max L.) Merrill.].” Journal of Agricultural Science. Vol. 2.

http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.665.2078&rep=rep1&typ

e=pdf.

Vyavhare, Suhas S., Michael O. Way, and Raul F. Medina. 2015. “Determination of

Growth Stage-Specific Response of Soybean to Redbanded Stink Bug (Hemiptera:

Pentatomidae) and Its Relationship to the Development of Flat Pods.” Journal of

Economic Entomology 108 (4): 1770–78. https://doi.org/10.1093/jee/tov145.

Wilkerson, G. G., J. W. Jones, K. J. Boote, and G. S. Buol. 1989. “Photoperiodically

Sensitive Interval in Time to Flower of Soybean.” Crop Science 29 (3): 721.

https://doi.org/10.2135/cropsci1989.0011183X002900030037x.

Bagchi, Vikram A., Joel P. Siegel, Mark R. Demkovich, Luke N. Zehr, and May R.

Berenbaum. 2016. “Impact of Pesticide Resistance on Toxicity and Tolerance of

Hostplant Phytochemicals in Amyelois Transitella (Lepidoptera: Pyralidae).”

Journal of Insect Science 16 (1): iew063. https://doi.org/10.1093/jisesa/iew063.

Bansal, Raman, and Andy Michel. 2018. “Expansion of Cytochrome P450 and Cathepsin

Genes in the Generalist Herbivore Brown Marmorated Stink Bug.” BMC Genomics

203

19 (1): 60. https://doi.org/10.1186/s12864-017-4281-6.

Bass, Chris, and Linda M Field. 2011. “Gene Amplification and Insecticide Resistance.”

Pest Management Science 67 (8): 886–90. https://doi.org/10.1002/ps.2189.

Cintra-Socolowski, Priscila, Roberta Nocelli, Thaisa Roat, Elaine Silva-Zacarin, and

Osmar Malaspina. 2016. “Comparative Physiology of Malpighian Tubules: Form

and Function.” Open Access Insect Physiology 6 (April): 13.

https://doi.org/10.2147/OAIP.S72060.

Claudianos, C, H Ranson, R M Johnson, S Biswas, M A Schuler, M R Berenbaum, R

Feyereisen, and J G Oakeshott. 2006. “A Deficit of Detoxification Enzymes:

Pesticide Sensitivity and Environmental Response in the Honeybee.” Insect

Molecular Biology 15 (5): 615–36. https://doi.org/10.1111/j.1365-

2583.2006.00672.x.

Cohen, M B, M A Schuler, and M R Berenbaum. 1992. “A Host-Inducible Cytochrome

P-450 from a Host-Specific Caterpillar: Molecular Cloning and Evolution.”

Proceedings of the National Academy of Sciences of the United States of America 89

(22): 10920–24. https://doi.org/10.1073/PNAS.89.22.10920.

D.G. Hoshizaki, L.I. Gilbert, K. Iatrou, S.S. Gill. 2005. Fat-Cell Development:

Comprehensive Molecular Insect Science. Amsterdam: Elsevier.

Dermauw, Wannes, Nicky Wybouw, Stephane Rombauts, Bjorn Menten, John Vontas,

Miodrag Grbic, Richard M Clark, Rene Feyereisen, and Thomas Van Leeuwen.

2013. “A Link between Host Plant Adaptation and Pesticide Resistance in the

204

Polyphagous Spider Mite Tetranychus Urticae.” Proceedings of the National

Academy of Sciences of the United States of America 110 (2): E113-22.

https://doi.org/10.1073/pnas.1213214110.

Dow, Julian A T, and Shireen A Davies. 2006. “The Malpighian Tubule: Rapid Insights

from Post-Genomic Biology.” Journal of Insect Physiology 52 (4): 365–78.

https://doi.org/10.1016/j.jinsphys.2005.10.007.

Gutierrez, Eugenio, David Wiggins, Barbara Fielding, and Alex P Gould. 2007.

“Specialized Hepatocyte-like Cells Regulate Drosophila Lipid Metabolism.” Nature

445 (7125): 275–80. https://doi.org/10.1038/nature05382.

He, H, A C Chen, R B Davey, and G W Ivie. 2002. “Molecular Cloning and Nucleotide

Sequence of a New P450 Gene, CYP319A1, from the Cattle Tick, Boophilus

Microplus.” Insect Biochemistry and Molecular Biology 32 (3): 303–9.

Heidel-Fischer, Hanna M, Dalial Freitak, Niklas Janz, Lina Söderlind, Heiko Vogel, and

Sören Nylin. 2009. “Phylogenetic Relatedness and Host Plant Growth Form

Influence Gene Expression of the Polyphagous Comma Butterfly (Polygonia c-

Album).” BMC Genomics 10 (1): 506. https://doi.org/10.1186/1471-2164-10-506.

Helvig, Christian, Nathalie Tijet, René Feyereisen, F Ann Walker, and Linda L Restifo.

2004. “Drosophila Melanogaster CYP6A8, an Insect P450 That Catalyzes Lauric

Acid (Omega-1)-Hydroxylation.” Biochemical and Biophysical Research

Communications 325 (4): 1495–1502. https://doi.org/10.1016/j.bbrc.2004.10.194.

Huber, D. P. W., M. L. Erickson, C. M. Leutenegger, J. Bohlmann, and S. J. Seybold.

205

2007. “Isolation and Extreme Sex-Specific Expression of Cytochrome P450 Genes

in the Bark Beetle, Ips Paraconfusus, Following Feeding on the Phloem of Host

Ponderosa Pine, Pinus Ponderosa.” Insect Molecular Biology 16 (3): 335–49.

https://doi.org/10.1111/j.1365-2583.2007.00731.x.

Hung, C F, M R Berenbaum, and M A Schuler. 1997. “Isolation and Characterization of

CYP6B4, a Furanocoumarin-Inducible Cytochrome P450 from a Polyphagous

Caterpillar (Lepidoptera:Papilionidae).” Insect Biochemistry and Molecular Biology

27 (5): 377–85. http://www.ncbi.nlm.nih.gov/pubmed/9219364.

Jiang, Hong-Bo, Jin-Jun Wang, Guo-Ying Liu, and Wei Dou. 2008. “Molecular Cloning

and Sequence Analysis of a Novel P450 Gene Encoding CYP345D3 from the Red

Flour Beetle, Tribolium Castaneum.” Journal of Insect Science (Online) 8: 1–7.

https://doi.org/10.1673/031.008.5501.

Jones, Christopher M., Miriam Daniels, Melanie Andrews, Russell Slater, Robert J. Lind,

Kevin Gorman, Martin S. Williamson, and Ian Denholm. 2011. “Age-Specific

Expression of a P450 Monooxygenase (CYP6CM1) Correlates with Neonicotinoid

Resistance in Bemisia Tabaci.” Pesticide Biochemistry and Physiology 101 (1): 53–

58. https://doi.org/10.1016/J.PESTBP.2011.07.004.

Kariakin, Andrei, Dimitri Davydov, Julian A Peterson, and Christiane Jung. 2002. “A

New Approach to the Study of Protein-Protein Interaction by FTIR: Complex

Formation between Cytochrome P450BM-3 Heme Domain and FMN Reductase

Domain.” Biochemistry 41 (46): 13514–25.

Lamb, David C, and Michael R Waterman. 2013. “Unusual Properties of the Cytochrome

206

P450 Superfamily.” Philosophical Transactions of the Royal Society of London.

Series B, Biological Sciences 368 (1612): 20120434.

https://doi.org/10.1098/rstb.2012.0434.

Lee, Wonhoon, Roberto Guidetti, Michele Cesari, T.D. Gariepy, Yong-Lak Park, and

Chang-Gyu Park. 2018. “Genetic Diversity of Halyomorpha Halys (Hemiptera,

Pentatomidae) in Korea and Comparison with COI Sequence Datasets from East

Asia, Europe, and North America.” Florida Entomologist 101 (1): 49–54.

https://doi.org/10.1653/024.101.0110.

Li, Fei Fei, Hai Dong Wang, Wang Song, Jun Cui, and Meng Lou Li. 2014. “Molecular

Cloning and Characterization of a Novel P450 Gene Encoding CYP6BK18 from

Dastarcus Helophoroides (Coleoptera: Bothrideridae).” Journal of Insect Science 14

(February): 1–8. https://doi.org/10.1093/jisesa/ieu105.

Li, W., M. A. Schuler, and M. R. Berenbaum. 2003. “Diversification of Furanocoumarin-

Metabolizing Cytochrome P450 Monooxygenases in Two Papilionids: Specificity

and Substrate Encounter Rate.” Proceedings of the National Academy of Sciences

100 (Supplement 2): 14593–98. https://doi.org/10.1073/pnas.1934643100.

Li, X., J. Baudry, M. R. Berenbaum, and M. A. Schuler. 2004. “Structural and Functional

Divergence of Insect CYP6B Proteins: From Specialist to Generalist Cytochrome

P450.” Proceedings of the National Academy of Sciences 101 (9): 2939–44.

https://doi.org/10.1073/pnas.0308691101.

Li, Xianchun, Mary A Schuler, and May R Berenbaum. 2007. “Molecular Mechanisms of

Metabolic Resistance to Synthetic and Natural Xenobiotics.” Annual Review of

207

Entomology 52: 231–53. https://doi.org/10.1146/annurev.ento.51.110104.151104.

Liu, Su, Xiang Jun Rao, Mao Ye Li, and Shi Guang Li. 2015. “Identification and

Expression Profiles of Putative Cytochrome P450 Monooxygenase Genes from

Cnaphalocrocis Medinalis (Lepidoptera: Pyralidae).” Entomological Research 45

(3): 141–49. https://doi.org/10.1111/1748-5967.12106.

McGraw, Lisa A., Greg Gibson, Andrew G. Clark, and Mariana F. Wolfner. 2004.

“Genes Regulated by Mating, Sperm, or Seminal Proteins in Mated Female

Drosophila Melanogaster.” Current Biology 14 (16): 1509–14.

https://doi.org/10.1016/J.CUB.2004.08.028.

Musasia, Fauzia K, Alfred O Isaac, Daniel K Masiga, Irene A Omedo, Ramadhan

Mwakubambanya, Richard Ochieng, and Paul O Mireji. 2013. “Sex-Specific

Induction of CYP6 Cytochrome P450 Genes in Cadmium and Lead Tolerant

Anopheles Gambiae.” Malaria Journal 12 (March): 97.

https://doi.org/10.1186/1475-2875-12-97.

Peiffer, Michelle, and Gary W. Felton. 2014. “Insights into the Saliva of the Brown

Marmorated Stink Bug Halyomorpha Halys (Hemiptera: Pentatomidae).” PLoS

ONE 9 (2): e88483. https://doi.org/10.1371/journal.pone.0088483.

Petersen Brown, R., M. R. Berenbaum, and M. A. Schuler. 2004. “Transcription of a

Lepidopteran Cytochrome P450 Promoter Is Modulated by Multiple Elements in Its

5′ UTR and Repressed by 20-Hydroxyecdysone.” Insect Molecular Biology 13 (4):

337–47. https://doi.org/10.1111/j.0962-1075.2004.00486.x.

208

Poupardin, R., M. A. Riaz, J. Vontas, J. P. David, and S. Reynaud. 2010. “Transcription

Profiling of Eleven Cytochrome P450s Potentially Involved in Xenobiotic

Metabolism in the Mosquito Aedes Aegypti.” Insect Molecular Biology 19 (2): 185–

93. https://doi.org/10.1111/j.1365-2583.2009.00967.x.

Ranasinghe, C, and A A Hobbs. 1998. “Isolation and Characterization of Two

Cytochrome P450 CDNA Clones for CYP6B6 and CYP6B7 from Helicoverpa

Armigera (Hubner): Possible Involvement of CYP6B7 in Pyrethroid Resistance.”

Insect Biochemistry and Molecular Biology 28 (8): 571–80.

Rupasinghe, S. G., Z. Wen, T.-L. Chiu, and M. A. Schuler. 2007. “Helicoverpa Zea

CYP6B8 and CYP321A1: Different Molecular Solutions to the Problem of

Metabolizing Plant Toxins and Insecticides.” Protein Engineering Design and

Selection 20 (12): 615–24. https://doi.org/10.1093/protein/gzm063.

Scott, J G, and Z Wen. 2001. “Cytochromes P450 of Insects: The Tip of the Iceberg.”

Pest Management Science 57 (10): 958–67. https://doi.org/10.1002/ps.354.

Snodgrass, G L, J J Jr Adamczyk, and J Gore. 2005. “Toxicity of Insecticides in a Glass-

Vial Bioassay to Adult Brown, Green, and Southern Green Stink Bugs (Heteroptera:

Pentatomidae).” Journal of Economic Entomology 98 (1): 177–81.

Sosa-Gomez, Daniel R, Jovenil J Da Silva, Ivani de Oliveira Negrao Lopes, Ivan C

Corso, Alvaro M R Almeida, Giorla C Piubelli De Moraes, and Matrhew E Baur.

2009. “Insecticide Susceptibility of Euschistus Heros (Heteroptera: Pentatomidae) in

Brazil.” Journal of Economic Entomology 102 (3): 1209–16.

209

“Stop BMSB: Biology, Ecology, and Management of Brown Marmorated Stink Bug in

Specialty Crops.” 2014. 2014. http://www.stopbmsb.org.

Tripathi, Sarvind, Huiying Li, and Thomas L Poulos. 2013. “Structural Basis for Effector

Control and Redox Partner Recognition in Cytochrome P450.” Science (New York,

N.Y.) 340 (6137): 1227–30. https://doi.org/10.1126/science.1235797.

Tzou, P, S Ohresser, D Ferrandon, M Capovilla, J M Reichhart, B Lemaitre, J A

Hoffmann, and J L Imler. 2000. “Tissue-Specific Inducible Expression of

Antimicrobial Peptide Genes in Drosophila Surface Epithelia.” Immunity 13 (5):

737–48.

Wang, Jing, Laura Kean, Jingli Yang, Adrian K Allan, Shireen A Davies, Pawel Herzyk,

and Julian AT Dow. 2004. “Function-Informed Transcriptome Analysis of

Drosophila Renal Tubule.” Genome Biology 5 (9): R69. https://doi.org/10.1186/gb-

2004-5-9-r69.

Warren, James T, Anna Petryk, Guillermo Marques, Michael Jarcho, Jean-Philippe

Parvy, Chantal Dauphin-Villemant, Michael B O’Connor, and Lawrence I Gilbert.

2002. “Molecular and Biochemical Characterization of Two P450 Enzymes in the

Ecdysteroidogenic Pathway of Drosophila Melanogaster.” Proceedings of the

National Academy of Sciences of the United States of America 99 (17): 11043–48.

https://doi.org/10.1073/pnas.162375799.

Wen, Zhimou, Liping Pan, May R Berenbaum, and Mary A Schuler. 2003. “Metabolism

of Linear and Angular Furanocoumarins by Papilio Polyxenes CYP6B1 Co-

Expressed with NADPH Cytochrome P450 Reductase.” Insect Biochemistry and

210

Molecular Biology 33 (9): 937–47. http://www.ncbi.nlm.nih.gov/pubmed/12915185.

Wen, Zhimou, and Jeffrey G Scott. 2001. “Cytochrome P450 CYP6L1 Is Specifically

Expressed in the Reproductive Tissues of Adult Male German Cockroaches,

Blattella Germanica (L.).” Insect Biochemistry and Molecular Biology 31 (2): 179–

87. https://doi.org/10.1016/S0965-1748(00)00116-8.

Werck-Reichhart, Danièle, and René Feyereisen. 2000. “Cytochromes P450: A Success

Story.” Genome Biology 1 (6): reviews3003.1. https://doi.org/10.1186/gb-2000-1-6-

reviews3003.

Xie, Wen, Xin Yang, Chunhai Chen, Zezhong Yang, Litao Guo, Dan Wang, Jinqun

Huang, et al. 2018. “The Invasive MED/Q Bemisia Tabaci Genome: A Tale of Gene

Loss and Gene Gain.” BMC Genomics. https://doi.org/10.1186/s12864-018-4448-9.

Xu, Yong-qiang, Jin-jun Wang, Hong-bo Jiang, Wei Dou, Pei-an Tang, and Feng-ming

An. 2009. “Identification, Characterization, and Expression of P450 Gene Encoding

CYP6BQ13v2 from the Red Flour Beetle, Tribolium Castaneum (Herbst)

(Coleoptera: Tenebrionidae).” Agricultural Sciences in China 8 (10): 1210–18.

https://doi.org/10.1016/S1671-2927(08)60331-4.

Yang, Jingli, Caroline McCart, Debra J Woods, Selim Terhzaz, Karen G Greenwood,

Richard H ffrench-Constant, and Julian A T Dow. 2007. “A Drosophila Systems

Approach to Xenobiotic Metabolism.” Physiological Genomics 30 (3): 223–31.

https://doi.org/10.1152/physiolgenomics.00018.2007.

Yang, Z, Y Zhang, X Liu, and X Wang. 2011. “Two Novel Cytochrome P450 Genes

211

CYP6CS1 and CYP6CW1 from Nilaparvata Lugens (Hemiptera: Delphacidae):

CDNA Cloning and Induction by Host Resistant Rice.” Bulletin of Entomological

Research 101 (1): 73–80. https://doi.org/10.1017/S0007485310000192.

Yu, Liying, Weiqi Tang, Xiaoli Ma, Liette Vasseur, W. Simon Baxter, Guang Yang,

Shiguo Huang, Fengqin Song, and Minsheng You. 2015. “Characterization and

Expression of the Cytochrome P450 Gene Family in Diamondback Moth, Plutella

Xylostella (L.),” 1–9. https://doi.org/10.1038/srep08952.

Zhu, Fang, Timothy W Moural, David R Nelson, and Subba R Palli. 2016. “A Specialist

Herbivore Pest Adaptation to Xenobiotics through Up-Regulation of Multiple

Cytochrome P450s.” Scientific Reports 6 (February): 20421.

https://doi.org/10.1038/srep20421.

Zuo, Yu-Han, and Mei-Er Chen. 2014. “Differential Gene Expression in Male and

Female Fat Body in the Oriental Fruit Fly, Bactrocera Dorsalis.” Archives of Insect

Biochemistry and Physiology 85 (1): 48–59. https://doi.org/10.1002/arch.21142.

Baum, James A, Thierry Bogaert, William Clinton, Gregory R Heck, Pascale Feldmann,

Oliver Ilagan, Scott Johnson, et al. 2007. “Control of Coleopteran Insect Pests

through RNA Interference.” Nat Biotech 25 (11): 1322–26.

http://dx.doi.org/10.1038/nbt1359.

Bewick, Viv, Liz Cheek, and Jonathan Ball. 2004. “Statistics Review 12: Survival

Analysis.” Critical Care 8 (5): 389. https://doi.org/10.1186/cc2955.

Demaeght, Peter, Wannes Dermauw, Dimitra Tsakireli, Jahangir Khajehali, Ralf Nauen,

Luc Tirry, John Vontas, Peter Lümmen, and Thomas Van Leeuwen. 2013.

212

“Molecular Analysis of Resistance to Acaricidal Spirocyclic Tetronic Acids in

Tetranychus Urticae: CYP392E10 Metabolizes Spirodiclofen, but Not Its

Corresponding Enol.” Insect Biochemistry and Molecular Biology 43 (6): 544–54.

https://doi.org/10.1016/j.ibmb.2013.03.007.

Deng, Fei, and Zhangwu Zhao. 2014. “Influence of Catalase Gene Silencing on the

Survivability of Sitobion Avenae.” Archives of Insect Biochemistry and Physiology

86 (1): n/a-n/a. https://doi.org/10.1002/arch.21161.

Fire, Andrew, SiQun Xu, Mary K Montgomery, Steven A Kostas, Samuel E Driver, and

Craig C Mello. 1998. “Potent and Specific Genetic Interference by Double-Stranded

RNA in Caenorhabditis Elegans.” Nature 391 (6669): 806–11.

http://dx.doi.org/10.1038/35888.

Ghosh, Saikat Kumar B., Wayne B. Hunter, Alexis L. Park, and Dawn E. Gundersen-

Rindal. 2017. “Double Strand RNA Delivery System for Plant-Sap-Feeding

Insects.” PLOS ONE 12 (2): e0171861.

https://doi.org/10.1371/journal.pone.0171861.

Gu, Liuqi, and Douglas C. Knipple. 2013. “Recent Advances in RNA Interference

Research in Insects: Implications for Future Insect Pest Management Strategies.”

Crop Protection 45 (March): 36–40.

https://doi.org/10.1016/J.CROPRO.2012.10.004.

Hannon, Gregory J. 2002. “RNA Interference.” Nature 418 (6894): 244–51.

https://doi.org/10.1038/418244a.

Huang, Jia-Hsin, Jesus Lozano, and Xavier Belles. 2013. “Broad-Complex Functions in

Postembryonic Development of the Cockroach Blattella Germanica Shed New Light

213

on the Evolution of Insect Metamorphosis.” Biochimica et Biophysica Acta (BBA) -

General Subjects 1830 (1): 2178–87. https://doi.org/10.1016/j.bbagen.2012.09.025.

Huang, Yong, Xue-Ping Lu, Luo-Luo Wang, Dong Wei, Zi-Jiao Feng, Qi Zhang, Lin-

Fan Xiao, Wei Dou, and Jin-Jun Wang. 2015. “Functional Characterization of

NADPH-Cytochrome P450 Reductase from Bactrocera Dorsalis: Possible

Involvement in Susceptibility to Malathion.” Scientific Reports 5 (December):

18394. https://doi.org/10.1038/srep18394.

Jaubert-Possamai, Stéphanie, Gaël Le Trionnaire, Joël Bonhomme, Georges K

Christophides, Claude Rispe, and Denis Tagu. 2007. “Gene Knockdown by RNAi in

the Pea Aphid Acyrthosiphon Pisum.” BMC Biotechnology 7 (1): 63.

https://doi.org/10.1186/1472-6750-7-63.

Jing, Tian-Xing, Yang Tan, Bi-Yue Ding, Wei Dou, Dan-Dan Wei, and Jin-Jun Wang.

2018. “NADPH–Cytochrome P450 Reductase Mediates the Resistance of Aphis

(Toxoptera) Citricidus (Kirkaldy) to Abamectin.” Frontiers in Physiology 9

(August): 986. https://doi.org/10.3389/fphys.2018.00986.

Joga, Mallikarjuna R, Moises J Zotti, Guy Smagghe, and Olivier Christiaens. 2016.

“RNAi Efficiency, Systemic Properties, and Novel Delivery Methods for Pest Insect

Control: What We Know So Far.” Frontiers in Physiology 7: 553.

https://doi.org/10.3389/fphys.2016.00553.

Li-Byarlay, Hongmei, Yang Li, Hume Stroud, Suhua Feng, Thomas C Newman, Megan

Kaneda, Kirk K Hou, et al. 2013. “RNA Interference Knockdown of DNA Methyl-

Transferase 3 Affects Gene Alternative Splicing in the Honey Bee.” Proceedings of

the National Academy of Sciences of the United States of America 110 (31): 12750–

214

55. https://doi.org/10.1073/pnas.1310735110.

Mogilicherla, Kanakachari, Jeffrey L. Howell, and Subba Reddy Palli. 2018. “Improving

RNAi in the Brown Marmorated Stink Bug: Identification of Target Genes and

Reference Genes for RT-QPCR.” Scientific Reports 8 (1): 3720.

https://doi.org/10.1038/s41598-018-22035-z.

Mutti, NS, J Louis, Pappan LK, K Pappan, K Begum, Chen MS, Y Park, et al. 2008. “A

Protein from the Salivary Glands of the Pea Aphid, Acyrthosiphon Pisum, Is

Essential in Feeding on a Host Plant.” Proceedings of the National Academy of

Sciences of the United States of America 105 (29): 9965–69.

Nishino, Hideaki, and Teruo Ishibashi. 2000. “Evidence for Requirement of NADPH-

Cytochrome P450 Oxidoreductase in the Microsomal NADPH-Sterol Δ7-Reductase

System.” Archives of Biochemistry and Biophysics 374 (2): 293–98.

https://doi.org/10.1006/abbi.1999.1602.

Palli, Subba Reddy. 2014. “RNA Interference in Colorado Potato Beetle: Steps toward

Development of DsRNA as a Commercial Insecticide.” Current Opinion in Insect

Science 6 (December): 1–8. https://doi.org/10.1016/j.cois.2014.09.011.

Piermarini, Peter M., Daniel C. Akuma, John C. Crow, Taylor L. Jamil, Willa G.

Kerkhoff, Kenyatta C.M.F. Viel, and Christopher M. Gillen. 2017. “Differential

Expression of Putative Sodium-Dependent Cation-Chloride Cotransporters in Aedes

Aegypti.” Comparative Biochemistry and Physiology Part A: Molecular &

Integrative Physiology 214 (December): 40–49.

https://doi.org/10.1016/j.cbpa.2017.09.007.

Terenius, Olle, Alexie Papanicolaou, Jennie S. Garbutt, Ioannis Eleftherianos, Hanneke

215

Huvenne, Sriramana Kanginakudru, Merete Albrechtsen, et al. 2011. “RNA

Interference in Lepidoptera: An Overview of Successful and Unsuccessful Studies

and Implications for Experimental Design.” Journal of Insect Physiology 57 (2):

231–45. https://doi.org/10.1016/j.jinsphys.2010.11.006.

Whyard, Steven, Aditi D. Singh, and Sylvia Wong. 2009. “Ingested Double-Stranded

RNAs Can Act as Species-Specific Insecticides.” Insect Biochemistry and

Molecular Biology 39 (11): 824–32. https://doi.org/10.1016/j.ibmb.2009.09.007.

Wynant, Niels, Dulce Santos, Rik Verdonck, Jornt Spit, Pieter Van Wielendaele, and

Jozef Vanden Broeck. 2014. “Identification, Functional Characterization and

Phylogenetic Analysis of Double Stranded RNA Degrading Enzymes Present in the

Gut of the Desert Locust, Schistocerca Gregaria.” Insect Biochemistry and

Molecular Biology 46 (March): 1–8. https://doi.org/10.1016/j.ibmb.2013.12.008.

Yang, Yihua, Song Chen, Shuwen Wu, Lina Yue, and Yidong Wu. 2006. “Constitutive

Overexpression of Multiple Cytochrome P450 Genes Associated with Pyrethroid

Resistance in <I>Helicoverpa Armigera</I>” Journal of Economic

Entomology 99 (5): 1784–89. https://doi.org/10.1603/0022-0493-99.5.1784.

Yu, Na, Olivier Christiaens, Jisheng Liu, Jinzhi Niu, Kaat Cappelle, Silvia Caccia,

Hanneke Huvenne, and Guy Smagghe. 2013. “Delivery of DsRNA for RNAi in

Insects: An Overview and Future Directions.” Insect Science 20 (1): 4–14.

https://doi.org/10.1111/j.1744-7917.2012.01534.x.

Zha, Wenjun, Xinxin Peng, Rongzhi Chen, Bo Du, Lili Zhu, and Guangcun He. 2011.

“Knockdown of Midgut Genes by DsRNA-Transgenic Plant-Mediated RNA

Interference in the Hemipteran Insect Nilaparvata Lugens.” PloS One 6 (5): e20504.

216

https://doi.org/10.1371/journal.pone.0020504.

Zhu, Fang, Jingjing Xu, Roshan Palli, Joseph Ferguson, and Subba R Palli. 2011.

“Ingested RNA Interference for Managing the Populations of the Colorado Potato

Beetle, Leptinotarsa Decemlineata.” Pest Management Science 67 (2): 175–82.

https://doi.org/10.1002/ps.2048.

Ankrah, Nana Y D, Junbo Luan, and Angela E Douglas. 2017. “Cooperative Metabolism

in a Three-Partner Insect-Bacterial Symbiosis Revealed by Metabolic Modeling.”

Journal of Bacteriology 199 (15): e00872-16. https://doi.org/10.1128/JB.00872-16.

Banerjee, Rajat, and Shruti Chakraborty. 2016. “Phenylalanyl-TRNA Synthetase.”

Research and Reports in Biochemistry 6 (June): 25.

https://doi.org/10.2147/RRBC.S83482.

Baumann, Paul. 2005. “Biology Bacteriocyte-Associated Endosymbionts of Plant Sap-

Sucking Insects.” Annual Review of Microbiology 59 (January): 155–89.

https://doi.org/10.1146/annurev.micro.59.030804.121041.

Brunet, P. C. J. 1963. “Tyrosine Metabolism in Insects.” Annals of the New York

Academy of Sciences 100 (2): 1020–34. https://doi.org/10.1111/j.1749-

6632.1963.tb42948.x.

Candy, D.J, A Becker, and G Wegener. 1997. “Coordination and Integration of

Metabolism in Insect Flight*.” Comparative Biochemistry and Physiology Part B:

Biochemistry and Molecular Biology 117 (4): 497–512.

https://doi.org/10.1016/S0305-0491(97)00212-5.

Hansen, A. K., and N. A. Moran. 2011. “Aphid Genome Expression Reveals Host-

217

Symbiont Cooperation in the Production of Amino Acids.” Proceedings of the

National Academy of Sciences 108 (7): 2849–54.

https://doi.org/10.1073/pnas.1013465108.

Hansen, Allison K., and Nancy A. Moran. 2014. “The Impact of Microbial Symbionts on

Host Plant Utilization by Herbivorous Insects.” Molecular Ecology 23 (6): 1473–96.

https://doi.org/10.1111/mec.12421.

Lundgren, Stina, Bernhard Lohkamp, Birgit Andersen, Jure Piškur, and Doreen

Dobritzsch. 2008. “The Crystal Structure of β-Alanine Synthase from Drosophila

Melanogaster Reveals a Homooctameric Helical Turn-Like Assembly.” Journal of

Molecular Biology 377 (5): 1544–59. https://doi.org/10.1016/J.JMB.2008.02.011.

McCutcheon, J. P., B. R. McDonald, and N. A. Moran. 2009. “Convergent Evolution of

Metabolic Roles in Bacterial Co-Symbionts of Insects.” Proceedings of the National

Academy of Sciences 106 (36): 15394–99. https://doi.org/10.1073/pnas.0906424106.

Miao, Xue-xia, Ming Gan, and De-Cheng Ding. 2003. “The Role of Bacterial Symbionts

in Amino Acid Composition of Black Bean Aphids.” Insect Science 10 (3): 167–71.

https://doi.org/10.1111/j.1744-7917.2003.tb00380.x.

Moran, N. A., M. A. Munson, P. Baumann, and H. Ishikawa. 1993. “A Molecular Clock

in Endosymbiotic Bacteria Is Calibrated Using the Insect Hosts.” Proceedings of the

Royal Society B: Biological Sciences 253 (1337): 167–71.

https://doi.org/10.1098/rspb.1993.0098.

Oliver, K. M., J. A. Russell, N. A. Moran, and M. S. Hunter. 2003. “Facultative Bacterial

218

Symbionts in Aphids Confer Resistance to Parasitic Wasps.” Proceedings of the

National Academy of Sciences 100 (4): 1803–7.

https://doi.org/10.1073/pnas.0335320100.

Otero-Bravo, Alejandro, Shana Goffredi, and Zakee L Sabree. 2018. “Cladogenesis and

Genomic Streamlining in Extracellular Endosymbionts of Tropical Stink Bugs.”

Genome Biology and Evolution 10 (2): 680–93. https://doi.org/10.1093/gbe/evy033.

Peiffer, Michelle, and Gary W. Felton. 2014. “Insights into the Saliva of the Brown

Marmorated Stink Bug Halyomorpha Halys (Hemiptera: Pentatomidae).” PLoS

ONE 9 (2): e88483. https://doi.org/10.1371/journal.pone.0088483.

Ramzi, Samar, and Vahid Hosseininaveh. 2010. “Biochemical Characterization of

Digestive α-Amylase, α-Glucosidase and β-Glucosidase in Pistachio Green Stink

Bug, Brachynema Germari Kolenati (Hemiptera: Pentatomidae).” Journal of Asia-

Pacific Entomology 13 (3): 215–19. https://doi.org/10.1016/J.ASPEN.2010.03.009.

Richardson, Graham, Haizhen Ding, Tom Rocheleau, George Mayhew, Erin Reddy, Qian

Han, Bruce M Christensen, and Jianyong Li. 2010. “An Examination of Aspartate

Decarboxylase and Glutamate Decarboxylase Activity in Mosquitoes.” Molecular

Biology Reports 37 (7): 3199–3205. https://doi.org/10.1007/s11033-009-9902-y.

Sacktor, Bertram, and Charles C. Childress. 1967. “Metabolism of Proline in Insect

Flight Muscle and Its Significance in Stimulating the Oxidation of Pyruvate.”

Archives of Biochemistry and Biophysics 120 (3): 583–88.

https://doi.org/10.1016/0003-9861(67)90522-X.

219

Scaraffia, Patricia Y, Qingfen Zhang, Kelsey Thorson, Vicki H Wysocki, and Roger L

Miesfeld. 2010. “Differential Ammonia Metabolism in Aedes Aegypti Fat Body and

Midgut Tissues.” Journal of Insect Physiology 56 (9): 1040–49.

https://doi.org/10.1016/j.jinsphys.2010.02.016.

Skidmore, Isabel H., and Allison K. Hansen. 2017. “The Evolutionary Development of

Plant-Feeding Insects and Their Nutritional Endosymbionts.” Insect Science 24 (6):

910–28. https://doi.org/10.1111/1744-7917.12463.

Su, Qi, Xiaomao Zhou, and Youjun Zhang. 2013. “Symbiont-Mediated Functions in

Insect Hosts.” Communicative and Integrative Biology 6 (3): 1–7.

https://doi.org/10.4161/cib.23804.

Sudakaran, Sailendharan, Franziska Retz, Yoshitomo Kikuchi, Christian Kost, and

Martin Kaltenpoth. 2015. “Evolutionary Transition in Symbiotic Syndromes

Enabled Diversification of Phytophagous Insects on an Imbalanced Diet.” The ISME

Journal 9 (12): 2587–2604. https://doi.org/10.1038/ismej.2015.75.

Suring, Wouter, Janine Marië, Rhody Broekman, Nico M Van Straalen, and Dick

Roelofs. 2016. “Biochemical Pathways Supporting Beta-Lactam Biosynthesis in the

Springtail Folsomia Candida.” https://doi.org/10.1242/bio.019620.

Teulier, Loïc, Jean-Michel Weber, Julie Crevier, and Charles-A Darveau. 2016. “Proline

as a Fuel for Insect Flight: Enhancing Carbohydrate Oxidation in Hymenopterans.”

Proceedings. Biological Sciences 283 (1834): 20160333.

https://doi.org/10.1098/rspb.2016.0333.

220

Upadhyay, Santosh Kumar, Shailesh Sharma, Harpal Singh, Sameer Dixit, Jitesh Kumar,

Praveen C Verma, and K Chandrashekar. 2015. “Whitefly Genome Expression

Reveals Host-Symbiont Interaction in Amino Acid Biosynthesis.” PloS One 10 (5):

e0126751. https://doi.org/10.1371/journal.pone.0126751.

Vogel, Kevin J, and Nancy A Moran. 2011. “Sources of Variation in Dietary

Requirements in an Obligate Nutritional Symbiosis.” Proceedings. Biological

Sciences 278 (1702): 115–21. https://doi.org/10.1098/rspb.2010.1304.

Whitten, Miranda M A, Paul D Facey, Ricardo Del Sol, Meirwyn C Evans, Jacob J

Mitchell, Owen G Bodger, Paul J Dyson, et al. 2016. “Symbiont-Mediated RNA

Interference in Insects.” Proc. R. Soc. B 283 (1825): 20160042.

https://doi.org/10.1098/rspb.2016.0042.

Wilkinson, T L, D Adams, L B Minto, and A E Douglas. 2001. “The Impact of Host

Plant on the Abundance and Function of Symbiotic Bacteria in an Aphid.” Journal

of Experimental Biology 204 (17): 3027 LP-3038.

http://jeb.biologists.org/content/204/17/3027.abstract.

Wilkinson, T L, and H Ishikawa. 1999. “The Assimilation and Allocation of Nutrients by

Symbiotic and Aposymbiotic Pea Aphids, Acyrthosiphon Pisum.” Entomologia

Experimentalis et Applicata 91: 195–201.

https://link.springer.com/content/pdf/10.1007%2F978-94-017-1890-5_25.pdf.

Wu, Dongying, Sean C Daugherty, Susan E Van Aken, Grace H Pai, Kisha L Watkins,

Hoda Khouri, Luke J Tallon, et al. 2006. “Metabolic Complementarity and

Genomics of the Dual Bacterial Symbiosis of Sharpshooters.” PLoS Biology 4 (6):

221

e188. https://doi.org/10.1371/journal.pbio.0040188.

Adham, Ibrahim M, Mahmoud A Sallam, Gerd Steding, Monika Korabiowska, Ulrich

Brinck, Sigrid Hoyer-Fender, Changkyu Oh, and Wolfgang Engel. 2003.

“Disruption of the Pelota Gene Causes Early Embryonic Lethality and Defects in

Cell Cycle Progression.” Molecular and Cellular Biology 23 (4): 1470–76.

https://doi.org/10.1128/MCB.23.4.1470-1476.2003.

Akman, Leyla, Atsushi Yamashita, Hidemi Watanabe, Kenshiro Oshima, Tadayoshi

Shiba, Masahira Hattori, and Serap Aksoy. 2002. “Genome Sequence of the

Endocellular Obligate Symbiont of Tsetse Flies, Wigglesworthia Glossinidia.”

Nature Genetics 32 (3): 402–7. https://doi.org/10.1038/ng986.

Baumann, Paul. 2005. “Biology of Bacteriocyte-Associated Endosymbionts of Plant Sap-

Sucking Insects.” Annual Review of Microbiology 59 (1): 155–89.

https://doi.org/10.1146/annurev.micro.59.030804.121041.

Bhasin, Manoj, Ellis L. Reinherz, and Pedro A. Reche. 2006. “Recognition and

Classification of Histones Using Support Vector Machine.” Journal of

Computational Biology 13 (1): 102–12. https://doi.org/10.1089/cmb.2006.13.102.

Bolger, Anthony M., Marc Lohse, and Bjoern Usadel. 2014. “Trimmomatic: A Flexible

Trimmer for Illumina Sequence Data.” Bioinformatics 30 (15): 2114–20.

https://doi.org/10.1093/bioinformatics/btu170.

Boucher, D H, S James, and K H Keeler. 1982. “The Ecology of Mutualism.” Annual

Review of Ecology and Systematics 13 (1): 315–47.

https://doi.org/10.1146/annurev.es.13.110182.001531.

222

Bourtzis, K., and Miller, T. A. (EDS.) CRC Press, Boca Raton. 2009. “Insect Symbiosis.

Vol. 3. (Contemporary Topics in Entomology Series).” 3 (2): 409–11.

Brian, Bushnell. 2017. “BBMap Short-Read Aligner, and Other Bioinformatics Tools.”

2017. http://sourceforge.net/ projects/bbmap/.

Bronstein, Judith L. 2009. “The Evolution of Facilitation and Mutualism.” Journal of

Ecology 97 (6): 1160–70. https://doi.org/10.1111/j.1365-2745.2009.01566.x.

Chang, Chiou Ling. 2004. “Effect of Amino Acids on Larvae and Adults of Ceratitis

Capitata (Diptera: Tephritidae).” Annals of the Entomological Society of America 97

(3): 529–35. https://doi.org/10.1603/0013-8746(2004)097[0529:eoaaol]2.0.co;2.

Chung, S. H., C. Rosa, E. D. Scully, M. Peiffer, J. F. Tooker, K. Hoover, D. S. Luthe, and

G. W. Felton. 2013. “Herbivore Exploits Orally Secreted Bacteria to Suppress Plant

Defenses.” Proceedings of the National Academy of Sciences 110 (39): 15728–33.

https://doi.org/10.1073/pnas.1308867110.

Civitelli, R, D T Villareal, D Agnusdei, P Nardi, L V Avioli, and C Gennari. 1992.

“Dietary L-Lysine and Calcium Metabolism in Humans.” Nutrition (Burbank, Los

Angeles County, Calif.) 8 (6): 400–405.

http://www.ncbi.nlm.nih.gov/pubmed/1486246.

Conesa, A., S. Gotz, J. M. Garcia-Gomez, J. Terol, M. Talon, and M. Robles. 2005.

“Blast2GO: A Universal Tool for Annotation, Visualization and Analysis in

Functional Genomics Research.” Bioinformatics 21 (18): 3674–76.

https://doi.org/10.1093/bioinformatics/bti610.

223

Curtis, Patrick D, and Yves V Brun. 2010. “Getting in the Loop: Regulation of

Development in Caulobacter Crescentus.” Microbiology and Molecular Biology

Reviews : MMBR 74 (1): 13–41. https://doi.org/10.1128/MMBR.00040-09.

D. L. Nelson and M. M. Cox. 2005. Principles of Biochemistry (4th Edn). New York: W.

H. Freeman. http://doi.wiley.com/10.1002/cbf.1216.

D’Aniello, Antimo. 2007. “D-Aspartic Acid: An Endogenous Amino Acid with an

Important Neuroendocrine Role.” Brain Research Reviews 53 (2): 215–34.

https://doi.org/10.1016/j.brainresrev.2006.08.005.

D’Ulisse, V., M. Fagioli, P. Ghelardini, and L. Paolozzi. 2007. “Three Functional

Subdomains of the Escherichia Coli FtsQ Protein Are Involved in Its Interaction

with the Other Division Proteins.” Microbiology 153 (1): 124–38.

https://doi.org/10.1099/mic.0.2006/000265-0.

Daly, M M, and A E Mirsky. 1955. “Histones with High Lysine Content.” The Journal of

General Physiology 38 (3): 405–13.

http://www.ncbi.nlm.nih.gov/pubmed/13221780.

Davis, L, and J Engebrecht. 1998. “Yeast Dom34 Mutants Are Defective in Multiple

Developmental Pathways and Exhibit Decreased Levels of Polyribosomes.”

Genetics 149 (1): 45–56. http://www.ncbi.nlm.nih.gov/pubmed/9584085.

Dillon, R. J., C. T. Vennard, A. Buckling, and A. K. Charnley. 2005. “Diversity of Locust

Gut Bacteria Protects against Pathogen Invasion.” Ecology Letters 8 (12): 1291–98.

https://doi.org/10.1111/j.1461-0248.2005.00828.x.

224

Douglas, Angela E. 2011. “Lessons from Studying Insect Symbioses.” Cell Host &

Microbe 10 (4): 359–67. https://doi.org/10.1016/j.chom.2011.09.001.

Du, Qinglin, Honghai Wang, and Jianping Xie. 2011. “Thiamin (Vitamin B1)

Biosynthesis and Regulation: A Rich Source of Antimicrobial Drug Targets?”

International Journal of Biological Sciences 7 (1): 41–52.

http://www.ncbi.nlm.nih.gov/pubmed/21234302.

Eberhart, C G, and S A Wasserman. 1995. “The Pelota Locus Encodes a Protein

Required for Meiotic Cell Division: An Analysis of G2/M Arrest in Drosophila

Spermatogenesis.” Development (Cambridge, England) 121 (10): 3477–86.

http://www.ncbi.nlm.nih.gov/pubmed/7588080.

Hosokawa, Takahiro, Ryuichi Koga, Yoshitomo Kikuchi, Xian-Ying Meng, and Takema

Fukatsu. 2010. “Wolbachia as a Bacteriocyte-Associated Nutritional Mutualist.”

Proceedings of the National Academy of Sciences of the United States of America

107 (2): 769–74. https://doi.org/10.1073/pnas.0911476107.

Ioannidis, Panagiotis, Yong Lu, Nikhil Kumar, Todd Creasy, Sean Daugherty, Marcus C

Chibucos, Joshua Orvis, et al. 2014. “Rapid Transcriptome Sequencing of an

Invasive Pest, the Brown Marmorated Stink Bug Halyomorpha Halys.” BMC

Genomics 15 (1): 738. https://doi.org/10.1186/1471-2164-15-738.

Kanehisa, Minoru, Yoko Sato, and Kanae Morishima. 2016. “BlastKOALA and

GhostKOALA: KEGG Tools for Functional Characterization of Genome and

Metagenome Sequences.” Journal of Molecular Biology 428 (4): 726–31.

https://doi.org/10.1016/j.jmb.2015.11.006.

225

Kikuchi, Y., M. Hayatsu, T. Hosokawa, A. Nagayama, K. Tago, and T. Fukatsu. 2012.

“Symbiont-Mediated Insecticide Resistance.” Proceedings of the National Academy

of Sciences 109 (22): 8618–22. https://doi.org/10.1073/pnas.1200231109.

Kopylova, Evguenia, Laurent Noé, and Hélène Touzet. 2012. “SortMeRNA: Fast and

Accurate Filtering of Ribosomal RNAs in Metatranscriptomic Data.” Bioinformatics

28 (24): 3211–17. https://doi.org/10.1093/bioinformatics/bts611.

Krebs, H A. 1935. “Metabolism of Amino-Acids: Deamination of Amino-Acids.” The

Biochemical Journal 29 (7): 1620–44.

http://www.ncbi.nlm.nih.gov/pubmed/16745832.

Ledwidge, Richard, and John S Blanchard. 1999. “The Dual Biosynthetic Capability of

N-Acetylornithine Aminotransferase in Arginine and Lysine Biosynthesis †.”

https://doi.org/10.1021/bi982574a.

Li, Bo, and Colin N Dewey. 2011. “RSEM: Accurate Transcript Quantification from

RNA-Seq Data with or without a Reference Genome.” BMC Bioinformatics 12 (1):

323. https://doi.org/10.1186/1471-2105-12-323.

Love, Michael I, Wolfgang Huber, and Simon Anders. 2014. “Moderated Estimation of

Fold Change and Dispersion for RNA-Seq Data with DESeq2.” Genome Biology 15

(12): 550. https://doi.org/10.1186/s13059-014-0550-8.

Peterson, Brittany F., and Michael E. Scharf. 2016. “Metatranscriptome Analysis Reveals

Bacterial Symbiont Contributions to Lower Termite Physiology and Potential

Immune Functions.” BMC Genomics 17 (1): 772. https://doi.org/10.1186/s12864-

226

016-3126-z.

Raghupathi Reddy, S R, and J W Campbell. 1969. “Arginine Metabolism in Insects. Role

of Arginase in Proline Formation during Silkmoth Development.” The Biochemical

Journal 115 (3): 495–503. http://www.ncbi.nlm.nih.gov/pubmed/5353522.

Salem, Hassan, Eugen Bauer, Anja S Strauss, Heiko Vogel, Manja Marz, and Martin

Kaltenpoth. 2014. “Vitamin Supplementation by Gut Symbionts Ensures Metabolic

Homeostasis in an Insect Host.” Proceedings of the Royal Society B 281: 20141838.

https://doi.org/10.1098/rspb.2014.1838.

Soneson, Charlotte, Michael I. Love, and Mark D. Robinson. 2015. “Differential

Analyses for RNA-Seq: Transcript-Level Estimates Improve Gene-Level

Inferences.” F1000Research 4 (December): 1521.

https://doi.org/10.12688/f1000research.7563.1.

Vandegrift, Vaughn, Martin Serra, Dexter S. Moore, and Thomas E. Wagner. 1974.

“Role of the Arginine-Rich Histones in the Maintenance of DNA Conformation in

Chromatin.” Biochemistry 13 (25): 5087–92. https://doi.org/10.1021/bi00722a005.

Vladimı́r, Vladimı́r, Koš Taí, Jaroslava Korbelová, Korbelová, Rodolphe Poupardin,

Martin Moos, and Petr S ̌ Imek. 2016. “Arginine and Proline Applied as Food

Additives Stimulate High Freeze Tolerance in Larvae of Drosophila Melanogaster.”

https://doi.org/10.1242/jeb.142158.

Xi, Rongwen, Choung Doan, Dazhi Liu, and Ting Xie. 2005. “Pelota Controls Self-

Renewal of Germline Stem Cells by Repressing a Bam-Independent Differentiation

227

Pathway.” Development (Cambridge, England) 132 (24): 5365–74.

https://doi.org/10.1242/dev.02151.

Araujo, R.N., A. Santos, F.S. Pinto, N.F. Gontijo, M.J. Lehane, and M.H. Pereira. 2006.

“RNA Interference of the Salivary Gland Nitrophorin 2 in the Triatomine Bug

Rhodnius Prolixus (Hemiptera: Reduviidae) by DsRNA Ingestion or Injection.”

Insect Biochemistry and Molecular Biology 36 (9): 683–93.

https://doi.org/10.1016/j.ibmb.2006.05.012.

Baum, James A., and James K. Roberts. 2014. Progress towards RNAi-Mediated Insect

Pest Management. Advances in Insect Physiology. 1st ed. Vol. 47. Elsevier Ltd.

https://doi.org/10.1016/B978-0-12-800197-4.00005-1.

Bewick, Viv, Liz Cheek, and Jonathan Ball. 2004. “Statistics Review 12: Survival

Analysis.” Critical Care 8 (5): 389. https://doi.org/10.1186/cc2955.

Demaeght, Peter, Wannes Dermauw, Dimitra Tsakireli, Jahangir Khajehali, Ralf Nauen,

Luc Tirry, John Vontas, Peter Lümmen, and Thomas Van Leeuwen. 2013.

“Molecular Analysis of Resistance to Acaricidal Spirocyclic Tetronic Acids in

Tetranychus Urticae: CYP392E10 Metabolizes Spirodiclofen, but Not Its

Corresponding Enol.” Insect Biochemistry and Molecular Biology 43 (6): 544–54.

https://doi.org/10.1016/j.ibmb.2013.03.007.

Deng, Fei, and Zhangwu Zhao. 2014. “Influence of Catalase Gene Silencing on the

Survivability of Sitobion Avenae.” Archives of Insect Biochemistry and Physiology

86 (1): n/a-n/a. https://doi.org/10.1002/arch.21161.

Fire, Andrew, SiQun Xu, Mary K Montgomery, Steven A Kostas, Samuel E Driver, and

Craig C Mello. 1998. “Potent and Specific Genetic Interference by Double-Stranded

228

RNA in Caenorhabditis Elegans.” Nature 391 (6669): 806–11.

http://dx.doi.org/10.1038/35888.

Ghosh, Saikat Kumar B., Wayne B. Hunter, Alexis L. Park, and Dawn E. Gundersen-

Rindal. 2017. “Double Strand RNA Delivery System for Plant-Sap-Feeding

Insects.” PLOS ONE 12 (2): e0171861.

https://doi.org/10.1371/journal.pone.0171861.

Gu, Liuqi, and Douglas C. Knipple. 2013. “Recent Advances in RNA Interference

Research in Insects: Implications for Future Insect Pest Management Strategies.”

Crop Protection 45 (March): 36–40.

https://doi.org/10.1016/J.CROPRO.2012.10.004.

Hannon, Gregory J. 2002. “RNA Interference.” Nature 418 (6894): 244–51.

https://doi.org/10.1038/418244a.

Jaubert-Possamai, Stéphanie, Gaël Le Trionnaire, Joël Bonhomme, Georges K

Christophides, Claude Rispe, and Denis Tagu. 2007. “Gene Knockdown by RNAi in

the Pea Aphid Acyrthosiphon Pisum.” BMC Biotechnology 7 (1): 63.

https://doi.org/10.1186/1472-6750-7-63.

Jing, Tian-Xing, Yang Tan, Bi-Yue Ding, Wei Dou, Dan-Dan Wei, and Jin-Jun Wang.

2018. “NADPH–Cytochrome P450 Reductase Mediates the Resistance of Aphis

(Toxoptera) Citricidus (Kirkaldy) to Abamectin.” Frontiers in Physiology 9

(August): 986. https://doi.org/10.3389/fphys.2018.00986.

Joga, Mallikarjuna R, Moises J Zotti, Guy Smagghe, and Olivier Christiaens. 2016.

“RNAi Efficiency, Systemic Properties, and Novel Delivery Methods for Pest Insect

Control: What We Know So Far.” Frontiers in Physiology 7: 553.

229

https://doi.org/10.3389/fphys.2016.00553.

Li-Byarlay, Hongmei, Yang Li, Hume Stroud, Suhua Feng, Thomas C Newman, Megan

Kaneda, Kirk K Hou, et al. 2013. “RNA Interference Knockdown of DNA Methyl-

Transferase 3 Affects Gene Alternative Splicing in the Honey Bee.” Proceedings of

the National Academy of Sciences of the United States of America 110 (31): 12750–

55. https://doi.org/10.1073/pnas.1310735110.

Li, Jie, Xiao-Ping Wang, Man-Qun Wang, Wei-Hua Ma, and Hong-Xia Hua. 2013.

“Advances in the Use of the RNA Interference Technique in Hemiptera.” Insect

Science 20 (1): 31–39. https://doi.org/10.1111/j.1744-7917.2012.01550.x.

Riga, M., D. Tsakireli, A. Ilias, E. Morou, A. Myridakis, E.G. Stephanou, R. Nauen, et al.

2014. “Abamectin Is Metabolized by CYP392A16, a Cytochrome P450 Associated

with High Levels of Acaricide Resistance in Tetranychus Urticae.” Insect

Biochemistry and Molecular Biology 46 (March): 43–53.

https://doi.org/10.1016/j.ibmb.2014.01.006.

Schmittgen, Thomas D, and Kenneth J Livak. 2008. “Analyzing Real-Time PCR Data by

the Comparative CT Method.” Nature Protocols 3 (6): 1101–8.

https://doi.org/10.1038/nprot.2008.73.

Shi, Li, Jiao Zhang, Guangmao Shen, Zhifeng Xu, Peng Wei, Yichao Zhang, Qiang Xu,

and Lin He. 2015. “Silencing NADPH-Cytochrome P450 Reductase Results in

Reduced Acaricide Resistance in Tetranychus Cinnabarinus (Boisduval).” Scientific

Reports 5 (October): 15581. https://doi.org/10.1038/SREP15581.

Sparks, Michael E., Kent S. Shelby, Daniel Kuhar, and Dawn E. Gundersen-Rindal.

2014. “Transcriptome of the Invasive Brown Marmorated Stink Bug, Halyomorpha

230

Halys (Stål) (Heteroptera: Pentatomidae).” PLoS ONE 9 (11): e111646.

https://doi.org/10.1371/journal.pone.0111646.

Zhao, Haiming, Xin Yi, Zhen Hu, Meiying Hu, Shaohua Chen, Rizwan-ul-Haq

Muhammad, Xiaolin Dong, and Liang Gong. 2013. “RNAi-Mediated Knockdown of

Catalase Causes Cell Cycle Arrest in SL-1 Cells and Results in Low Survival Rate

of Spodoptera Litura (Fabricius).” PLoS ONE 8 (3): e59527.

https://doi.org/10.1371/journal.pone.0059527.

Chrostek, Ewa, Kirsten Pelz-Stelinski, Gregory D D Hurst, and Grant L Hughes. 2017.

“Horizontal Transmission of Intracellular Insect Symbionts via Plants.” Frontiers in

Microbiology 8: 2237. https://doi.org/10.3389/fmicb.2017.02237.

Crawford, Jason M, Renee Kontnik, and Jon Clardy. 2010. “Regulating Alternative

Lifestyles in Entomopathogenic Bacteria.” Current Biology : CB 20 (1): 69–74.

https://doi.org/10.1016/j.cub.2009.10.059.

Douglas, A. E. 1998. “Nutritional Interactions in Insect-Microbial Symbioses: Aphids

and Their Symbiotic Bacteria Buchnera.” Annual Review of Entomology 43 (1): 17–

37. https://doi.org/10.1146/annurev.ento.43.1.17.

Douglas, A E. 2009. “The Microbial Dimension in Insect Nutritional Ecology.”

Functional Ecology 23: 38–47. https://doi.org/10.1111/j.1365-2435.2008.01442.x.

Feldhaar, Heike. 2011. “Bacterial Symbionts as Mediators of Ecologically Important

Traits of Insect Hosts.” Ecological Entomology 36 (5): 533–43.

https://doi.org/10.1111/j.1365-2311.2011.01318.x.

Flórez, Laura V, Peter H W Biedermann, Tobias Engl, and Martin Kaltenpoth. 2015.

231

“Defensive Symbioses of Animals with Prokaryotic and Eukaryotic

Microorganisms.” Natural Product Reports 32 (7): 904–36.

https://doi.org/10.1039/c5np00010f.

Futahashi, Ryo, Kohjiro Tanaka, Masahiko Tanahashi, Naruo Nikoh, Yoshitomo

Kikuchi, Bok Luel Lee, and Takema Fukatsu. 2013. “Gene Expression in Gut

Symbiotic Organ of Stinkbug Affected by Extracellular Bacterial Symbiont.” PLoS

ONE 8 (5): e64557. https://doi.org/10.1371/journal.pone.0064557.

Gonzalez-Castro, M J, J Lopez-Hernández, J Simal-Lozano, and M J Oruña-Concha.

1997. “Determination of Amino Acids in Green Beans by Derivatization with

Phenylisothiocianate and High-Performance Liquid Chromatography with

Ultraviolet Detection.” Journal of Chromatographic Science 35.

http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.902.5810&rep=rep1&typ

e=pdf.

Gorman, Maureen J, and Yasuyuki Arakane. 2010. “Tyrosine Hydroxylase Is Required

for Cuticle Sclerotization and Pigmentation in Tribolium Castaneum.” Insect

Biochemistry and Molecular Biology 40 (3): 267–73.

https://doi.org/10.1016/j.ibmb.2010.01.004.

Hopkins, Theodore L, Thomas D Morgan, Yoichi Aso, and Karl J Kramer. 1982. “N-β-

Alanyldopamine: Major Role in Insect Cuticle Tanning.” Source: Science, New

Series 21725487 (23): 364–66. http://www.jstor.org/stable/1688788.

Hosokawa, Takahiro, Yoshiko Ishii, Naruo Nikoh, Manabu Fujie, Nori Satoh, and

Takema Fukatsu. 2016. “Obligate Bacterial Mutualists Evolving from

232

Environmental Bacteria in Natural Insect Populations.” Nature Microbiology 1 (1):

15011. https://doi.org/10.1038/nmicrobiol.2015.11.

Hosokawa, Takahiro, Yoshitomo Kikuchi, Naruo Nikoh, Masakazu Shimada, and

Takema Fukatsu. 2006. “Strict Host-Symbiont Cospeciation and Reductive Genome

Evolution in Insect Gut Bacteria.” PLoS Biology 4 (10): e337.

https://doi.org/10.1371/journal.pbio.0040337.

House, H L. 1962. “Insect Nutrition.” Annual Review of Biochemistry 31 (1): 653–72.

https://doi.org/10.1146/annurev.bi.31.070162.003253.

Huang, Tengfang, Georg Jander, and Martin de Vos. 2011. “Non-Protein Amino Acids in

Plant Defense against Insect Herbivores: Representative Cases and Opportunities for

Further Functional Analysis.” Phytochemistry 72 (13): 1531–37.

https://doi.org/10.1016/J.PHYTOCHEM.2011.03.019.

Jiménez, N, F González-Candelas, and F J Silva. 2000. “Prephenate Dehydratase from

the Aphid Endosymbiont (Buchnera) Displays Changes in the Regulatory Domain

That Suggest Its Desensitization to Inhibition by Phenylalanine.” Journal of

Bacteriology 182 (10): 2967–69. https://doi.org/10.1128/JB.182.10.2967-2969.2000.

Katherine S. Brehme. 1941. “The Effect of Adult Body Color Mutations upon the Larva

of Drosophila Melanogaster.” Genetics, Vol 27. 1941.

Kim, Dohyup, Bushra F. Minhas, Hongmei Li-Byarlay, and Allison K. Hansen. 2018.

“Key Transport and Ammonia Recycling Genes Involved in Aphid Symbiosis

Respond to Host-Plant Specialization.” Genes Genomes Genetics, May,

233

g3.200297.2018. https://doi.org/10.1534/g3.118.200297.

McCutcheon, J. P., B. R. McDonald, and N. A. Moran. 2009. “Convergent Evolution of

Metabolic Roles in Bacterial Co-Symbionts of Insects.” Proceedings of the National

Academy of Sciences 106 (36): 15394–99. https://doi.org/10.1073/pnas.0906424106.

Du, Qinglin, Honghai Wang, and Jianping Xie. 2011. “Thiamin (Vitamin B1)

Biosynthesis and Regulation: A Rich Source of Antimicrobial Drug Targets?”

International Journal of Biological Sciences 7 (1): 41–52.

http://www.ncbi.nlm.nih.gov/pubmed/21234302.

Eberhart, C G, and S A Wasserman. 1995. “The Pelota Locus Encodes a Protein

Required for Meiotic Cell Division: An Analysis of G2/M Arrest in Drosophila

Spermatogenesis.” Development (Cambridge, England) 121 (10): 3477–86.

http://www.ncbi.nlm.nih.gov/pubmed/7588080.

Engelstädter, Jan, and Gregory D.D. Hurst. 2009. “The Ecology and Evolution of

Microbes That Manipulate Host Reproduction.” Annual Review of Ecology,

Evolution, and Systematics 40 (1): 127–49.

https://doi.org/10.1146/annurev.ecolsys.110308.120206.

Gerardo, Nicole M, and Benjamin J Parker. 2014. “Mechanisms of Symbiont-Conferred

Protection against Natural Enemies: An Ecological and Evolutionary Framework An

Ecological Framework for Studying Protection.” Current Opinion in Insect Science

4: 8–14. https://doi.org/10.1016/j.cois.2014.08.002.

Haas, Brian J, Alexie Papanicolaou, Moran Yassour, Manfred Grabherr, Philip D Blood,

234

Joshua Bowden, Matthew Brian Couger, et al. 2013. “De Novo Transcript Sequence

Reconstruction from RNA-Seq Using the Trinity Platform for Reference Generation

and Analysis.” Nature Protocols 8 (8): 1494–1512.

https://doi.org/10.1038/nprot.2013.084.

Johansson, Helena, Kishor Dhaygude, Stafva Lindström, Heikki Helanterä, Liselotte

Sundström, and Kalevi Trontti. 2013. “A Metatranscriptomic Approach to the

Identification of Microbiota Associated with the Ant Formica Exsecta.” PLoS ONE

8 (11): e79777. https://doi.org/10.1371/journal.pone.0079777.

Li, Bo, and Colin N Dewey. 2011. “RSEM: Accurate Transcript Quantification from

RNA-Seq Data with or without a Reference Genome.” BMC Bioinformatics 12 (1):

323. https://doi.org/10.1186/1471-2105-12-323.

Marynowska, Martyna, Xavier Goux, David Sillam-Dussès, Corinne Rouland-Lefèvre,

Yves Roisin, Philippe Delfosse, and Magdalena Calusinska. 2017. “Optimization of

a Metatranscriptomic Approach to Study the Lignocellulolytic Potential of the

Higher Termite Gut Microbiome.” BMC Genomics 18 (1): 681.

https://doi.org/10.1186/s12864-017-4076-9.

NA, Moran, McCutcheon JP, and A Nakabachi. 2008. “Genomics and Evolution of

Heritable Bacterial Symbionts.” Annual Review of Genetics 42: 165–90.

Pertea, Mihaela, Daehwan Kim, Geo M Pertea, Jeffrey T Leek, and Steven L Salzberg.

2016. “Transcript-Level Expression Analysis of RNA-Seq Experiments with

HISAT, StringTie and Ballgown.” Nature Protocols 11 (9): 1650–67.

https://doi.org/10.1038/nprot.2016.095.

235

Quast, Christian, Elmar Pruesse, Pelin Yilmaz, Jan Gerken, Timmy Schweer, Pablo

Yarza, Jörg Peplies, and Frank Oliver Glöckner. 2013. “The SILVA Ribosomal

RNA Gene Database Project: Improved Data Processing and Web-Based Tools.”

Nucleic Acids Research 41 (Database issue): D590-6.

https://doi.org/10.1093/nar/gks1219.

Smith-Unna, Richard, Chris Boursnell, Rob Patro, Julian M Hibberd, and Steven Kelly.

2016. “TransRate: Reference-Free Quality Assessment of de Novo Transcriptome

Assemblies.” Genome Research 26 (8): 1134–44.

https://doi.org/10.1101/gr.196469.115.

Still, J L, and M V Buell. 1949. “Studies on the Cyclophorase System; D-Aspartic

Oxidase.” The Journal of Biological Chemistry 179 (2): 831–37.

http://www.ncbi.nlm.nih.gov/pubmed/18150016.

Xu, Letian, Qiaozhe Lou, Chihang Cheng, Min Lu, and Jianghua Sun. 2015. “Gut-

Associated Bacteria of Dendroctonus Valens and Their Involvement in Verbenone

Production.” Microbial Ecology 70 (4): 1012–23. https://doi.org/10.1007/s00248-

015-0625-4.

236