Mechanistic Studies and Catalytic Engineering of The

AN ABSTRACT OF THE DISSERTATION OF

Hatem A. Abuelizz for the degree of Doctor of Philosophy in Pharmacy presented on May 26, 2015.

Title: Mechanistic Studies and Catalytic Engineering of the

Pseudoglycosyltransferase VldE

Abstract approved: ______

Taifo Mahmud

This thesis describes an investigation of the molecular basis of the substrate specificity and catalytic mechanism of a unique pseudoglycosyltransferase (PsGT) enzyme, VldE. PsGTs are a newly discovered group of glycosyltransferase (GT)- like proteins that catalyze the transfer of a pseudosugar to an acceptor molecule via a C-N bond formation. This inspiring pseudoglycosidic C-N coupling is involved in the biosynthesis of pseudosugar-containing natural products, such as the α- glycosidase inhibitors acarbose and amylostatins, the antibiotic pyralomicin 1a, and the antifungal agent validamycin A. The validamycin PsGT VldE is a GT-like protein similar to trehalose 6-phosphate synthase (OtsA). OtsA catalyzes a coupling reaction between UDP-glucose and glucose 6-phosphate to yield α,α-1,1-trehalose

6-phosphate. In contrast to OtsA, VldE catalyzes a coupling reaction between two pseudosugar substrates, GDP-valienol and validamine 7-phosphate, to give validoxylamine A 7´-phosphate with an α,α-N-pseudoglycosidic linkage. In spite of

its unique catalytic function, little is known about the molecular basis governing its substrate specificity and reaction mechanism.

To understand the molecular basis for the substrate specificity and catalytic activity of VldE we first examined the role of the N- and C-terminal domains of the protein in its substrate recognition and catalysis. This was pursued by comparative biochemical and kinetic studies using VldE, OtsA and two chimeric proteins, which were produced by swapping the N- and C-terminal domains of VldE with those of

OtsA from Streptomyces coelicolor. The wild-type enzymes and the resulting chimeric proteins were tested using a variety of synthetically prepared sugar

(pseudosugar) donor and acceptor substrates. The results showed that both substrate specificity and acceptor molecule nucleophilicity play a role in the catalytic activity of VldE. Moreover, we found that the N-terminal domains of OtsA and VldE not only play a major role in selecting the sugar (pseudosugar) acceptors, but also control the type of nucleotidyl diphosphate moiety of the sugar (pseudosugar) donors. The study provided new insights into the distinct substrate specificity and catalytic activities of OtsA and VldE, and demonstrated that a C-1 amino group of the acceptor is necessary for the PsGT coupling reaction to occur. This result explains why all known natural products whose formations involve a PsGT contain amino linkage.

The second part of the study addressed a fundamental question as to how VldE catalyzes a coupling between two non-sugar molecules with net retention of the

‘anomeric’ configuration of the donor cyclitol in the product. The current paradigm suggests that retaining GTs, such as GT family-5 (glycogen synthase) and GT family-20 (OtsA), function via an internal return (SNi)-like mechanism involving an oxocarbenium ion-like transition state. However, as the donor substrate for VldE is an activated pseudosugar (GDP-valienol), oxocarbenium ion formation is not possible in the VldE-catalyzed coupling reaction. Taking advantage of information from the X-ray crystal structures of VldE, additional chimeric and point mutant proteins, were produced and tested. The study revealed a significant role of the N- terminal domains of OtsA and VldE in governing their substrate specificities, particularly for the acceptor molecules. In the case of VldE, the acceptor molecules need to have a strong nucleophilic group (amino group) at C-1, whereas OtsA needs an acceptor substrates with a hydroxyl group at C-1. Our work suggests that the distinct substrate specificities of OtsA and VldE are due to the differences in topology of the proteins particularly of the second half of the N-terminal domains

(amino acids 128-266). Moreover, the study revealed a possible new reaction mechanism unique to the PsGT VldE and is different from the proposed (SNi)-like mechanism for the retaining GT OtsA. The new mechanism involves a deprotonation at C-7 of the unsaturated pseudosugar donor (GDP-valienol), followed by an electron shift of the ring olefin leading to 1,4-elimination of GDP.

The oxocarbenium ion-like transition state geometry of GDP-valienol and the

resemblance of the protein-ligand interactions with those of OtsA suggest that the

C-N bond formation should occur via a front-face attack of the nucleophilic amino group of the acceptor molecule to give a product with net retention of the anomeric configuration. Combined together, the results not only provide insights into the molecular basis for the distinct substrate specificity and catalytic activity of VldE, but also present evidence for a potentially new catalytic mechanism unique to

PsGT enzymes.

©Copyright by Hatem A. Abuelizz

May 26, 2015

Mechanistic Studies and Catalytic Engineering of the Pseudoglycosyltransferase

VldE

Hatem A. Abuelizz

A DISSERTATION

submitted to

Oregon State University

in partial fulfillment of

the requirements for the

degree of

Doctor of Philosophy

Presented May 26, 2015

Commencement June, 2015

Doctor of Philosophy dissertation of Hatem A. Abuelizz presented on May 26, 2015

APPROVED:

Major Professor, representing Pharmacy

Dean of College of Pharmacy

Dean of the Graduate School

I understand that my dissertation will become part of the permanent collection of Oregon State University libraries. My signature below authorizes release of my dissertation to any reader upon request.

Hatem A. Abuelizz, Author

ACKNOWLEDGEMENTS

All praise and glory to Allah the almighty who alone made this thesis to be accomplished. I am honored and privileged to glorify his name in the sincerest way through this accomplishment and ask him to accept my effort. Peace and mercy be upon his prophet Mohammad.

I would like to express my deepest and sincere gratitude to my advisor Dr.

Taifo Mahmud for his guidance, advices, constant help, and support. I also would like to thank Dr. Shumpei Asamizu, Summer T. Nguyen and Yi Ling D. Cheung for technical assistance, and contribution during my research work. I also thank my thesis committee members Dr. Mark Zabriskie, Dr. Kerry McPhail, Dr. Fred

Stevens and Dr. Daniel D. Rockey for their invaluable cooperation. I also would like to thank King Saud University for providing me the scholarship and fund.

I owe my deepest gratitude to my wife, my soul mate, Arwa Hamid, for her patience. I would not have been completed my studies without her encouragement and support, after Allah’s help. I also would like to thank my little pies, my sons

Adi and Taim for their patience. I really admit that my studies took me away from them, but after all, I dedicate my work to them. I also would like to express my sincere gratefulness to my parents, Dr. Ahmad Abuelizz and Abla Al-Balbeesi for their prayers and words of encouragement. I also thanks my siblings, Hazem,

Shahd, Amer and Noor Alain for their love and nice wishes. Special thanks to my parents in law, Zakaria Hamid, and Seham Suliman, and my brothers and sisters in law for their prayers and love. I ask Allah to bless them.

I also thanks all my friends and labmates for their invaluable help throughout my studies specially Mostafa Abugrain.

TABLE OF CONTENTS

Page

CHAPTER ONE: General Introduction ...... 1

1.1. Sugar-containing natural products ...... 2

1.2. Glycosyltransferases ...... 4

1.2.1. Glycosyltransferase folds ...... 5

1.2.2. Retaining and inverting glycosyltransferases...... 8

1.2.2.1. Inverting glycosyltransferases ...... 8

1.2.2.2. Retaining glycosyltransferases ...... 11

1.3. Pseudosugar-containing natural products ...... 13

1.3.1. C7N-aminocyclitols (pseudoaminooligosaccharides) ...... 15

1.3.2. Validamycin A ...... 17

1.3.2.1. Biosynthetic origin of validamycin ...... 18

1.3.2.2. Validamycin gene cluster ...... 20

1.3.2.3. Validamycin biosynthetic pathway ...... 21

1.3.2.4. VldE crystal structure ...... 25

1.4. Thesis overview ...... 29

1.5. References ...... 30

CHAPTER TWO: Distinct Substrate Specificity and Catalytic Activity of the

Pseudoglycosyltransferase VldE ...... 38

2.1. Abstract ...... 39

TABLE OF CONTENTS (Continued)

Page

2.2. Introduction ...... 40

2.3. Results ...... 45

2.3.1 Comparative analysis of VldE, Escherichia coli OtsA and

Streptomyces coelicolor OtsA...... 45

2.3.2. Design and construction of VldE/OtsA(Sco) chimeras ...... 51

2.3.3. Chimera-1 can produce a hybrid pseudo-aminodisaccharide ...... 56

2.3.4. Chimera-2 displays OtsA activity ...... 59

2.3.5. VldE prefers GDP-valienol over GDP-glucose as substrate ...... 61

2.3.6. The role of the N-terminal domain in governing the type of bonding

...... 61

2.3.7. Amino group is necessary for pseudoglycoside formation ...... 63

2.3.8. VldE recognizes 1-amino-1-deoxyglucose 6-phosphate as an acceptor

molecule ...... 67

2.3.9. The N-terminal domain plays a significant role in the NDP-sugar

preference of VldE and OtsA ...... 70

2.4. Discussion ...... 72

2.5. Significance ...... 78

2.6. Materials and methods ...... 79

2.7. References ...... 105

TABLE OF CONTENTS (Continued)

Page

CHAPTER THREE: Molecular analysis of the pseudoglycosyltransferase VldE revealed a possible 1,4-elimination/1,4-addition mechanism ...... 108

3.1. Abstract ...... 109

3.2. Introduction ...... 110

3.3. Results ...... 113

3.3.1. Comparative Bioinformatic Analysis of GT and PsGT family-20 .. 113

3.3.2 Examination of the significance of the Asn325 and Gln385 residues

for substrate specificity and/or catalytic function of VldE ...... 115

3.3.3. Interrogating the N-terminal domain of VldE ...... 117

3.3.4. Determining the importance of the conserved amino acid residues in

the N-terminal domains for substrate specificity ...... 120

3.3.5. Examination of the significance of Asp158, His182, and Asp383 in

VldE catalysis...... 125

3.3.6. 1,4-Elimination-addition may be involved in VldE catalysis ...... 129

3.4. Discussion ...... 133

3.6. Material and methods ...... 138

3.7. References ...... 147

CHAPTER FOUR: General Conclucion ...... 149

LIST OF FIGURES

Figure Page

Figure 1.1: Chemical structures of glycosylated natural products...... 4 Figure 1.2: Most common glycosyltransferase folds. The figure adopted from (Lairson et al., 2008)...... 6 Figure 1.3: Proposed catalytic mechanism of inverting and retaining glycosyltransferase. (A) Inverting glycosyltransferases catalyze the coupling reaction through a direct-displacement SN2-like mechanism. (B) Retaining glycosyltransferase with a proposed double-displacement mechanism involves a glycosyl-enzyme intermediate. (C) Retaining glycosyltransferases utilize SNi mechanism through an oxocarbenium ion-like transition state...... 9 Figure 1.4: Chemical structures of various aminocyclitol-containing natural products. Colors indicate different aminocyclitol cores, which are derived from different biosynthetic pathways...... 14 Figure 1.5: Biosynthetic pathways to aminocyclitols. MIPS, 1L-myo-inositol 1- phosphate synthase; DOIS, 2-deoxy-scyllo-inosose synthase; EEVS, 2-epi-5- epi-valiolone synthase...... 15

Figure 1.6: Examples of C7N-aminocyclitols-containing natural products ...... 17 Figure 1.7: Proposed reaction mechanism of 2-epi-5-epi-valiolone synthase ...... 19 Figure 1.8: Genetic organization of validamycin biosynthetic gene clusters in various organisms. A) Validamycin (vld) cluster in S. hygroscopicus subsp. limoneus; B) validamycin (val) cluster in S. hygroscopicus subsp. jinggangensis 5008; C) Validoxylamine A (amir) cluster in A. mirum. Figure adopted from (Asamizu et al., 2013)...... 21 Figure 1.9: Early steps of validamycin biosynthesis...... 22 Figure 1.10: Late steps of validamycin biosynthesis ...... 24 Figure 1.11: VldE overall folding comparison to OtsA by superimposition. (A) The monomeric VldE folding is represented in a ribbon diagram, with the N- terminal domain in red, and the C-terminal domain in blue. (B) A comparison of the overall folding of VldE (green) with OtsA (gray). (C) The topology diagram of VldE with β-strands and α-helices. Blue boxes identify the β-hairpin motif and the β-sheets core of the N- and C-terminal Rossmann domain. The figure adopted from (M. C. Cavalier, 2012)...... 26

LIST OF FIGURES (Continued)

Figure Page

Figure 1.12: Comparison of the VldE and OtsA catalytic sites in ribbon diagrams. (A) GDP-protein interactions within the VldE active site (B) UDP-protein interactions within the active site of OtsA. The figure adopted from (M. C. Cavalier, 2012)...... 27 Figure 1.13: (A) The catalytic site of VldE in the presence (yellow) and absence (green) of validoxylamine A 7´-phosphate. (B) validoxylamine A 7´-phosphate binding within the catalytic sites of VldE (yellow) and OtsA (gray). Figure adopted from (M. C. Cavalier, 2012)...... 28 Figure 2.1: Chemical structures of pseudosugar-containing natural products...... 41 Figure 2.2: Catalytic activities of VldE and OtsA...... 43 Figure 2.3: Kinetic studies of OtsA(Sco). (A) Michaelis-Menten curve for ADP- glucose with a saturated amount of glucose 6-phosphate; (B) Michaelis-Menten curve for glucose 6-phosphate with a saturated amount of ADP-glucose; (C) Michaelis-Menten curve for GDP-glucose with a saturated amount of glucose 6-phosphate; (D) Michaelis-Menten curve for glucose-6-phosphate with a saturated amount of GDP-glucose...... 46 Figure 2.4: (-)-ESI-MS analysis of OtsA(Eco) and OtsA(Sco) using various NDP- glucose as sugar donors and glucose 6-phosphate as sugar acceptor. Boiled enzymes were used as negative controls. Red arrows indicate the expected product trehalose 6-phosphate...... 47 Figure 2.5: HPLC analysis of VldB and RmlA-L89T reactions using valienol 1- phosphate (V1P) with various nucleotidyl triphosphates at λ=210 nm. Red stars indicate NDP-valienols produced by VldB. Blue stars indicate NDP-valienol produced by RmlA-L89T...... 49 Figure 2.6: (-)-ESI-MS analysis of VldB and RmlA-L89T reactions using valienol 1-phosphate (V1P) and various nucleotidyl triphosphates...... 50 Figure 2.7: (-)-ESI-MS analysis of VldE with various NDP-valienols. The m/z values for the substrates are given in bold and that for the expected product is given in red...... 50

LIST OF FIGURES (Continued)

Figure Page Figure 2.8: Domain swapping between VldE and OtsA. A, secondary structures of OtsA(Sco) and VldE. Black arrows indicate the sites where the domains from the two proteins are connected. B, cartons of the expression plasmids for the production of chimera-1 and chimera-2. C, model structures for VldE, OtsA(Sco), chimera-1, chimera-2, and their expected hybrid products. D, SDS PAGE of purified recombinant VldE, OtsA, chimera-1 (Ch-1) and chimera-2 (Ch-2)...... 51 Figure 2.9A: Partial (truncated) secondary structure of VldE produced by the Phyre2 program. Arrow indicates the site of cleavage for domain swapping. .. 53 Figure 2.9B: Partial (truncated) secondary structure of OtsA(Sco) produced by the Phyre2 program. Arrow indicates the site of cleavage for domain swapping. .. 54 Figure 2.10: Characterization of VldE, OtsA, Chimera-1 and Chimera-2 with a variety of sugar and pseudosugar substrates. The amino groups are depicted in their unprotonated forms and the curved arrows are intended to show the possible C-N or C-O bond formations, they do not represent the -1 -1 stereospecificity of the reactions. (+++), kcat/Km >1.0 s .mM ; (++), kcat/Km 0.2 -1 -1 -1 -1 -1 -1 – 1.0 s .mM ; (+), kcat/Km 0.02 – 0.2 s .mM ; (±), kcat/Km <0.02 s .mM ; (-) no reaction. Natural or expected substrates for the enzymes are presented in boxes...... 55 Figure 2.12: (+)-ESI-MS/MS analysis of validoxylamine A produced by chimera- 1+VldH and VldE+VldH...... 57 Figure 2.11: ESI-MS analysis of chimera-1 and VldE reactions with GDP-glucose and valienamine 7-phosphate ...... 57 Figure 2.13: Kinetic studies of Chimera-1. (A) Michaelis-Menten curve for GDP- glucose with a saturated amount of validamine 7-phosphate; (B) Michaelis- Menten curve for validamine 7-phosphate with a saturated amount of GDP- glucose...... 58 Figure 2.14: (-)-ESI-MS analysis of reaction products of OtsA(Sco), VldE, Chimera-1, and Chimera-2 with GDP-glucose and glucose 6-phosphate or GDP-valienol and glucose 6-phosphate as substrates. Red arrow shows the m/z value for the expected product...... 60 Figure 2.15: Kinetic studies of Chimera-2. (A) Michaelis-Menten curve for GDP- glucose with a saturated amount of glucose 6-phosphate; (B) Michaelis-Menten curve for glucose 6-phosphate with a saturated amount of GDP-glucose...... 60

LIST OF FIGURES (Continued)

Figure Page Figure 2.16: (-)-ESI-MS analysis of reaction products of OtsA(Sco), VldE, Chimera-1, and Chimera-2 with GDP-glucose and validamine 7-phosphate or GDP-valienol and validamine 7-phosphate as substrates. Red arrow shows the m/z value for the expected product...... 63 Figure 2.17: Chemical synthesis of validol 7-phosphate...... 64 Figure 2.18: ESI-MS analysis of OtsA/VldH and Chimera-2/VldH with GDP- glucose and validol 7-phosphate as substrates...... 65 Figure 2.19: (-)-ESI-MS analysis of reaction products of OtsA(Sco), VldE, Chimera-1, and Chimera-2 with GDP-glucose and validol 7-phosphate or GDP- valienol and validol 7-phosphate as substrates. Red arrow shows the m/z value for the expected product...... 66 Figure 2.20: Kinetic parameters of VldE, OtsA, chimera-1 and chimera-2 with various substrates. Gray squares indicate very low catalytic reaction observed. Black squares indicate no catalytic reaction observed...... 66 Figure 2.21: Coupling reaction between GDP-valienol and 1-amino-1- deoxyglucose 6-phosphate by VldE...... 68 Figure 2.22: ESI-MS analysis of VldE reaction with GDP-valienol and 1-amino-1- deoxyglucose 6-phosphate. No expected product was observed in the (-)-ESI- MS spectra (top two panels). The degradation product, valienamine (red arrow), can only be detected by (+)-ESI-MS...... 69 Figure 2.23: HPLC analysis of VldE and Chimera-1 reactions with GDP-valienol and 1-amino-1-deoxyglucose 6-phosphate at λ=210 nm. Red asterisk indicates valienamine peak...... 70 Figure 2.24: (-)-ESI-MS analysis of Chimera-1 and Chimera-2 reactions with various NDP-glucoses...... 71 Figure 2.25: 1H NMR spectrum of 2,3,4,7-tetra-O-benzylvalidol...... 86 Figure 2.26: 13C NMR spectrum of 2,3,4,7-tetra-O-benzylvalidol...... 86 Figure 2.27: 1H -1H COSY spectrum of 2,3,4,7-tetra-O-benzylvalidol...... 87 Figure 2.28: gHMBC spectrum of 2,3,4,7-tetra-O-benzylvalidol...... 87 Figure 2.29: HSQC spectrum of 2,3,4,7-tetra-O-benzylvalidol...... 88 Figure 2.30: NOESY spectrum of 2,3,4,7-tetra-O-benzylvalidol...... 88 Figure 2.31: 1H NMR spectrum of 1,2,3,4,7-penta-O-benzylvalidol...... 90

LIST OF FIGURES (Continued)

Figure Page Figure 2.32: 13C NMR spectrum of 1,2,3,4,7-penta-O-benzylvalidol...... 90 Figure 2.33: 1H NMR spectrum of 1,2,3,4-tetra-O-benzyl-7-O-acetylvalidol...... 92 Figure 2.34: 13C NMR spectrum of 1,2,3,4-tetra-O-benzyl-7-O-acetylvalidol...... 92 Figure 2.35: 1H NMR spectrum of 1,2,3,4-tetra-O-benzylvalidol...... 94 Figure 2.36: 13C NMR spectrum of 1,2,3,4-tetra-O-benzylvalidol...... 94 Figure 2.37: 1H NMR spectrum of 1,2,3,4-tetra-O-benzyl-7-O-dibenzylphosphate- validol...... 96 Figure 2.38: 13C NMR spectrum of 1,2,3,4-tetra-O-benzyl-7-O-dibenzylphosphate- validol...... 96 Figure 2.39: 1H -1H COSY spectrum of 1,2,3,4-tetra-O-benzyl-7-O- dibenzylphosphate-validol...... 97 Figure 2.40: gHMBC spectrum of 1,2,3,4-tetra-O-benzyl-7-O-dibenzylphosphate- validol...... 97 Figure 2.41: HSQC NMR spectrum of 1,2,3,4-tetra-O-benzyl-7-O- dibenzylphosphate-validol...... 98 Figure 2.42: NOESY spectrum of 1,2,3,4-tetra-O-benzyl-7-O-dibenzylphosphate- validol...... 98 Figure 2.43: 1H NMR spectrum of validol 7-phosphate...... 100 Figure 2.44: 13C NMR spectrum of validol 7-phosphate...... 100 Figure 2.45: 31P NMR spectrum of validol 7-phosphate...... 101 Figure 3.1: Partial multiple amino acid alignment of VldE and other putative PsGT20 and OtsA enzymes. Conserved residues in PsGT20s are in red and those in OtsAs are in blue. Potential recognition residues for sugar vs nonsugar acceptors are highlighted in yellow. Amino acid numbering is based on the VldE protein...... 114 Figure 3.2: Superimposition of the VldE cyclitol binding sites in the presence (yellow) and absence (green) of validoxylamine A 7´-phosphate. The figure adopted from (Cavalier et al., 2012a)...... 115

LIST OF FIGURES (Continued)

Figure Page Figure 3.3: (-)-ESI-MS analysis of VldE-N325S, VldE-Q385M using GDP-valienol or GDP-glucose as sugar donor and validamine 7-P or glucose 6-P as sugar acceptor. Boiled enzymes were used as negative control. Red peaks indicates the expected product, validoxylamine A 7`-P and green peaks indicate the substrates, the GDP-valienol (m/z 600) or GDP-glucose (m/z 604)...... 117 Figure 3.4: Conformational change of VldE using VldE•GDP•TRE crystallographic data. Residues 11-50 of the β–hairpin motif (β2 and β3) and strands β5 and β6 showed a 10.9 °A shift toward the catalytic site...... 118 Figure 3.5: (-)-ESI-MS analysis of chimera-3 using GDP-valienol or GDP-glucose as sugar donor and validamine 7-P, glucose 6-P or validol 7-P as sugar acceptor. Boiled enzymes were used as negative control. Red peaks indicate the expected product trehalose 6-P (m/z 421) or pseudotrehalose (m/z 419) and green peaks indicate the substrates GDP-valienol (m/z 600) or GDP-glucose (m/z 604). .. 120 Figure 3.6: (-)-ESI-MS analysis of VldE-N109H and Chimera1-N109H using GDP-valienol or GDP-glucose as sugar donor and validamine 7-P or glucose 6- P as sugar acceptor. Boiled enzymes were used as negative control. Red peaks indicate the expected product validoxylamine A 7`-P and green peaks indicate the substrates GDP-valienol (m/z 600) or GDP-glucose (m/z 604)...... 122 Figure 3.7: (-)-ESI-MS analysis of VldE-K11N-L178G, Chimera1-K11N-L178G, VldE-L9V-N109H-T135N, and Chimera1-L9V-N109H-T135N using GDP- valienol or GDP-glucose as sugar donor and validamine 7-P or glucose 6-P as sugar acceptor. Boiled enzymes were used as negative control. Red peaks indicate the expected product validoxylamine A 7`-P and green peaks indicate the substrates GDP-valienol (m/z 600) or GDP-glucose (m/z 604)...... 123 Figure 3.8: (-)-ESI-MS analysis of VldE-L9V-N109H-T135N, and Chimera-1- L9V-N109H-T135N using GDP-valienol or GDP-glucose as sugar donor and glucosamine 6-P as sugar acceptor. Boiled enzymes were used as negative control. Green peaks indicate the substrates GDP-valienol (m/z 600) or GDP- glucose (m/z 604)...... 124

LIST OF FIGURES (Continued)

Figure Page Figure 3.9: Interaction between trehalose and VldE amino acid residues within the catalytic site. Shown is a trehalose (TRE) within the VldE cyclitol binding site in ribbon diagrams. Residues/molecules of interest are represented in stick models. The dotted lines mark hydrogen bonds. (A) The mesh represents the [Fo]-[Fc] electron density omit map of trehalose within the VldE catalytic site (pink). The map is contoured at 3.0s levels. Trehalose makes interactions with the backbone amides of residues Gly384, Gln385, Asn386, and Leu387 as well with the side-chains of Asp383, His182 and Arg290. (B) Shown is a superimposition of the catalytic sites of VldE•GDP•VDO model (yellow) and the VldE•GDP•TRE model (pink) in ribbon diagrams. Due to the absence of the phosphate moiety, Arg326 and Asn325 also swing out of the catalytic site. Figure adopted from (Cavalier et al., 2012a)...... 126 Figure 3.10: (-)-ESI-MS analysis of VldE-D158N, VldE-H182A, VldE-D383N and OtsA-H154A using GDP-valienol or GDP-glucose as sugar donor and validamine 7-P or glucose 6-P as sugar acceptor. Boiled enzymes were used as negative control. Red peaks indicate the expected product validoxylamine A 7`- P or trehalose 6-P (421 m/z) and green peaks indicate the substrates GDP- valienol (m/z 600) or GDP-glucose (m/z 604)...... 127 Figure 3.11: (-)-ESI-MS analysis of VldE-H182A, VldE-D158N, chimera1-H182A and chimera1-D158N using GDP-glucose as sugar donor and validamine 7-P as sugar acceptor. Boiled enzymes were used as negative control. Red peaks indicate the expected product and green peaks indicate the substrates GDP- valienol (m/z 600) or GDP-glucose (m/z 604)...... 129

Figure 3.12: Proposed reaction mechanism of pseudoglycosyltransferase. (A) SNi- mechanism of retaining glycosyltransferase. (B) SNi-like mechanism of pseudoglycosyltransferase. (C) Deprotonation at C-7 leading to electron shifts and 1,4 elimination reaction. (D) C-N bond formation occurs via a 1,4-addition mechanism……………………………………………………………………….. 138

Figure 3.13: (-)-ESI-MS analysis of VldE using GDP-valienol as sugar donor and validamine 7-P as sugar acceptor in H2O or D2O. Boiled enzymes were used as negative controls. The m/z 414 and 415 (in red) are the expected product validoxylamine A 7´-P and deuterated validoxylamine A 7´-P, respectively. Bottom two panels show fragmentation patterns for the VldE products. The m/z 258 is the acceptor cyclitol daughter ion (validamine 7-phosphate)...... 132 Figure 3.14: SDS-PAGE of recombinant VldE, chimera-3 and mutants ...... 141

LIST OF TABLES

Table Page

Table 2.1. Bacterial strains, plasmids, and primers used in this study……………79

Table 2.2. Kinetics data for OtsA(Sco), VldE, Chimera-1 and Chimera-2……...104

Table 3.1: Bacterial strains and plasmids used in this study…………………….143

Table 3.2: primers used in this study...... 145

DEDICATION

1. I dedicate this work to my wife, my sons, my parents, my siblings, my parents in law, and

my friends, who offered me unconditional love, prayers, and support.

CHAPTER ONE

General Introduction

Hatem A. Abuelizz

1.1. Sugar-containing natural products

Among the myriad of naturally occurring compounds are sugar-containing natural products, such as oligo- and polysaccharides, glycoproteins, glycolipids, and glycosylated natural products. To date, hundreds of glycosylated natural products have been isolated from bacteria, fungi, and plants (Elshahawi et al.,

2015a; Luzhetskyy and Bechthold, 2008; Luzhetskyy et al., 2008; Thibodeaux et al.,

2008). Many of them have played an important role in treating diseases in humans, animals, and plants. The glycosylated anthracycline antibiotics, such as doxorubicin and aclarubicin, have been used for decades as cancer chemotherapy

(Moore et al., 1989). The glycosylated macrolide antibiotic erythromycin A and its synthetic derivatives have become one of the most important classes of antibiotics.

Similarly, due to its outstanding activity and low frequency of bacterial resistance, the glycopeptide antibiotic vancomycin has gained recognition as the last resort medication for certain infections caused by Gram-(+) bacteria.

It has been well documented that sugar moieties attached to bioactive natural products are extremely important for their activity (Bertho et al., 1998a;

Bertho et al., 1998b; Retsema and Fu, 2001; Schlunzen et al., 2003) (Losey et al.,

2002). Many of those sugars play a significant role in their pharmacokinetics, pharmacodynamics, solubility and/or potency (Gantt et al., 2011). For example, modifications of the sugar moieties of aclarubicin either broaden the accessibility of the drug to tumors, reduce tumor cell resistance to the drug, or abolish the

compound activity (Arcamone et al., 1997; Gate et al., 2003). Epimerization of the

C-4-OH of daunosamine, the aminosugar of doxorubicin, drastically enhances the drug’s pharmacokinetics, increasing volume of distribution and glucuronidation rate, which results in enhanced body clearance (Carvalho et al., 2009; Minotti et al.,

2004; Smith et al., 2010). The activity of vancomycin, which inhibits bacterial transpeptidases by binding to the D-Ala-D-Ala termini of lipid-PP-disaccharide- pentapeptides, is significantly reduced by removal of its disaccharide moiety

(Solenberg et al., 1997). Interestingly, modification of the carbohydrate- hydrophobicity (such as in ortivancin and teicoplanin) improves the antibiotic binding to the D-Ala-D-Lac termini, circumventing vancomycin resistance (Ge et al., 1999; Sussmuth, 2002). The effect of sugar moiety alteration on natural products bioactivity highlights potential strategies for developing new drugs through sugar modifications.

OH O OH O O O O O OH O OH O H O OH HO OH OH OH O O OH OH O O O N H O H O O O OH O OH O O O O O O OH O O O Doxorubicin Aclarubicin O O H - - Antitumor Antitumor O 4 epi doxorubicin O N n umor H2N OH NH2 A tit O

OH Erythromycin nt ot c OH OH A ibi i HO H O O O OH NH H N NH2 O H HO Cl NH Cl O Cl HO O O O O O O HN O H HO O HO O O HO OH NH H O NH O O O H HO O NH H H H H N O O 2 O O N N Cl H O N N HO HN O O NH H O H H H O HN O NH HN O NH2 O OH HO 2 O H H HN N N NH N N O O HO O HO OH H H O H O OH O OH OH HO Cl HO O OH O Vancomycin HO Teicoplanin n o c O N O , A tibi ti H O O O Antibiotic antiviral Cl OH Cl O O HO OH OH OH OH H2N O OH OH O Oritavancin Antibiotic NH OH

Figure 1.1: Chemical structures of glycosylated natural products.

1.2. Glycosyltransferases

Biosynthetically, the attachment of sugar moieties to natural products is catalyzed by glycosyltransferase enzymes. Glycosyltransferases are a large and diverse class of enzymes found in nature. They play an important role in many aspects of biological systems. Currently, there are more than 140,000 putative glycosyltransferase genes reported in the database (the Carbohydrate-Active enZyme database (CAZy) as of August 2014 in www.cazy.org). They are classified

into families based on their amino acid sequence similarity. Currently, there are more than 92 families of glycosyltransferases, which are regularly updated in the

Carbohydrate Active enZyme database (CAZy) (Hansen et al., 2010). However, only a portion of them have been carefully characterized.

Functionally, glycosyltransferases transfer an activated donor sugar residue to an acceptor. The donor groups can be lipid-linked sugar phosphates or sugar 1- phosphates, but are mostly nucleotide sugars (Hansen et al., 2010). Nucleotide sugar-dependent glycosyltransferases are also referred as Leloir enzymes, in honor of Luis F. Leloir who identified the nucleotide sugars that are fundamental to the metabolisms of the carbohydrates (Lairson et al., 2008). The acceptor groups, also known as aglycones, are extremely diverse and the products can be glycoproteins, glycolipids, oligo/polysaccharides and many other natural products (Hansen et al.,

2010).

1.2.1. Glycosyltransferase folds

In addition to the amino acid sequence-based classification, glycosyltransferases are also distinguished based on their three-dimensional folds.

Interestingly, despite the significantly large number of families of glycosyltransferases, only two distinct structural folds are known for the nucleotide-sugar-dependent glycosyltransferases, GT-A and GT-B folds. Primarily, they contain Rossmann-like β/α/β domains (Lairson et al., 2008).

GT-A GT-B

Figure 1.2: Most common glycosyltransferase folds. The figure is adopted from (Lairson et al., 2008).

The GT-A fold is best described in SpsA, a glycosyltransferase in the polysaccharide biosynthesis of Bacillus subtilis (Stragier, 1996). It is considered as a single domain because of the adjoining nature of the two Rossmann-like domains.

The N-terminal is the nucleotide binding domain and consists of two α-helices and four parallel β-strands. In the C-terminal domain, an open groove is formed by a mixed β-sheet flanked by three α-helices responsible for binding the acceptor

(Charnock, 1999). Moreover, the Asp-X-Asp signature (DXD) in most GT-A glycosyltransferases coordinates a divalent cation, which in turn coordinates with the phosphate group of the nucleotide donors (Hansen et al., 2010).

The GT-B fold is represented by the T4-bacteriophage β- glycosyltransferase (Lairson et al., 2008). The protein is a member of GT63 that transfers glucose (from UDP-glucose) to the hydroxymethyl moieties of the modified cytosine bases. The crystal structure of the T4-bacteriophage β- glycosyltransferase revealed that it consists of two β/α/β Rossmann-like domains in a non-abutting opposing orientation, with a catalytic site located between the domains. The N-terminal domain consists of seven α-helices and seven stranded parallel twisted β-sheets responsible for acceptor binding. The C-terminal domain consists of five α-helices and six stranded parallel twisted β-sheet responsible for nucleotide donor binding (Vrielinkl, 1994).

On the basis of sequence similarity and alignment studies, a third topology,

GT-C, has been proposed for integral membrane GTs with a modified DxD motif in the first extracellular loop (Liu and Mushegian, 2003). These include the oligosaccharyltransferases, PglB and AglB, whose X-ray crystal structures and catalytic mechanism have recently been determined, revealing the importance of the transmembrane domains, particularly the associated external loops, for substrate binding and catalysis (Gerber et al., 2013; Lizak et al., 2011; Lizak et al., 2014;

Matsumoto et al., 2013). Interestingly, the peptidoglycan GTs adopt neither of the

GT-A, GT-B, or GT-C folds. X-ray crystal structures of Staphylococcus aureus and

Aquifex aeolicus PBP1A peptidoglycan GTs revealed their strong resemblance to lysozyme (Huang et al., 2012; Lovering et al., 2007; Yuan et al., 2007).

1.2.2. Retaining and inverting glycosyltransferases

Glycosyltransferase formation of glycosidic bond inherits two possible stereochemical outcomes. The anomeric configuration of the product can be retained or inverted with respect to the donor substrate. Hence, glycosyltransferases can further be classified as retaining or inverting enzymes. The stereochemistry of the product is most likely determined by the reaction mechanism employed by the enzyme. Interestingly, stereochemistry outcomes cannot be predicted based on sequence similarity or folding. There are examples of both GT-A and GT-B folds glycosyltransferases catalyze both retaining and inverting reaction. Therefore, there is no known correlation between the folding topology and the product’s anomeric configuration (Coutinho et al., 2003).

1.2.2.1. Inverting glycosyltransferases

The reaction mechanism of inverting glycosyltransferases is well understood. The inversion of the anomeric centers has been shown to occur through a direct displacement SN2-like reaction (Figure 1.3). In this reaction, a catalytic base amino acid residue deprotonates the nucleophile of the acceptor, which then displaces the nucleotidyl diphosphate leaving group of the sugar donor.

+ + A - δ- - O O δ+ O O O O - O H O δ Hδ+ O O O O HO HO δ+ HO R R R O Oδ- OH - - - O P O O P O O P O

+2 OR OR +2 OR M M+2 M

Oxacarbenium ion-like transition state

+ B +

- - O O O O O O O O O HO HO HO

O H O - H O O R - O O P O - R OH R - OR O P O O P O +2 OR +2 M M+2 M OR

Glycosyl-enzyme intermediate

+ + + + C δ- O NH2 O δ+ O δ+ NH NHδ+ 2 O O O HO HO δ+ HO δ+ - δ+ O H O δ δ- - H O H O - R δ O O O P O - R - R OR O P O O P O OR OR M+2 M+2 M+2

Oxacarbenium ion-like transition state + + + +

O NH δ- 2 O δ+ δ+ NH O NH O δ+ 2 HO O O HO δ+ δ- HO O R δ+ H O - - - O R δ+ δ OH δ H O - O - R - O P O O P O O P O OR +2 OR +2 OR M M M+2

Figure 1.3: Proposed catalytic mechanism of inverting and retaining glycosyltransferase. (A) Inverting glycosyltransferases catalyze the coupling reaction through a direct-displacement SN2-like mechanism. (B) Retaining glycosyltransferase with a proposed double-displacement mechanism involves a glycosyl-enzyme intermediate. (C) Retaining glycosyltransferases utilize SNi mechanism through an oxocarbenium ion-like transition state.

Inverting glycosyltransferase with GT-A folding have been seen in β-1,3-N- acetylgucosaminyltransferase, β-1,4-galactosyltransferase, N- acetylglucosaminyltransferase I and glucuronyltransferase. X-ray crystal structures of these proteins revealed a conserved aspartate or glutamate, which is within hydrogen bonding distance from the nucleophilic hydroxyl group of the acceptor (Charnock and Davies, 1999; Jinek et al., 2006; Kakuda et al., 2004;

Pedersen et al., 2000; Ramakrishnan et al., 2006; Unligil et al., 2000; Yang et al.,

2009). Moreover, the divalent cation in most GT-A is necessary to electrostatically stabilize the negative charges on the phosphate of the leaving group and facilitate its departure (Lairson et al., 2008). However, some metal ion-independent sialyltransferases and β-1,6-GlcNActransferases use hydroxyls of basic amino acids to stabilize the leaving group (Chiu et al., 2007; Pak et al., 2006).

GT-B folding glycosyltransferases are more diverse. The inverting glycosyltransferase, T4 bacteriophage β-glucosyltransferase uses aspartate as a base with the positively charged amino acids side-chains to facilitate the departure of the leaving group. The divalent cation in this enzyme is, unlike GT-A, involved in the product release (Lariviere and Morera, 2002, 2004). The glycosyltrasferase involved in vancomycin biosynthesis also uses aspartate as a catalytic base.

However, the departure of the leaving group is facilitated by interactions of a tyrosine hydroxyl group side chain with a histidine imidazole group as well as a helix dipole (Mulichak et al., 2003; Mulichak et al., 2001; Mulichak et al., 2004).

Sometimes histidine is also used as a catalytic base, which interacts with the carboxylate group of the adjacent aspartate. This occurs in the terpene/flavonoid glycosyltransferase UGT71G1, the flavonoid glucosyltransferase VvGTI, the macrolide glycosyltransferases OleD and OleI, and the bifunctional N- and O- glucosyltransferase from Arabidopsis thaliana (Bolam et al., 2007; Brazier-Hicks et al., 2007; Miley et al., 2007; Offen et al., 2006; Xiong et al., 2008).

1.2.2.2. Retaining glycosyltransferases

Retaining glycosyltransferase activity is present in both GT-A and GT-B folds. It has been proposed that retaining glycosyltransferases catalyze a glycosidic bond formation via a double-displacement SN2 mechanism involving a covalently bound glycosyl-enzyme intermediate. This was inspired by the reaction mechanism of the sugar hydrolysis enzymes glycosidases. In this mechanism, a nucleophilic amino acid residue of the enzyme first displaces the leaving phosphate group to give a glycosyl-enzyme intermediate with an inverted anomeric center, followed by a second displacement of the nucleophilic residue by the acceptor group from the opposite side, resulting in a net retention of anomeric configuration (Lairson et al.,

2008; Ly et al., 2002; Persson et al., 2001). The phosphate leaving group is proposed to act as a base, which deprotonates the nucleophile of the acceptor. The bovine galactosyltransferase α3GalT has been proposed to adopt this mechanism.

However, most retaining glycosyltransferases lack a conserved signature of the nucleophilic residue as well as being in close proximity to the anomeric center.

Therefore, either the catalytic site has to undergo reorganization to allow an SN2 reaction, or most, if not all, retaining glycosyltransferases adopt a different reaction mechanism (Lairson et al., 2008).

More recently, an alternative mechanism, known as an internal return (SNi)- like mechanism, has been proposed for the trehalose 6-phosphate synthase OtsA

(Lairson et al., 2008). The SNi mechanism involves a partial ion pair-transition state formed by a partial decomposition of the donor group. Interestingly, the intermediate lifetime is longer than the collapse to give back the starting material.

In this mechanism, the leaving phosphate oxygen acts as a base to activate the acceptor, which attacks the anomeric carbon from the front face (Lairson et al.,

2008). This activation has been implicated from the farnesyl diphosphate (FPP) synthase from Escherichia coli and Trypanosoma cruzi (Gabelli et al., 2006;

Hosfield et al., 2004).

Retaining glycosyltransferases with GT-A fold, such as the galactosyltransferase LgtC from Neisseria meningitidis, uses an Asp-X-Asp signature to coordinate the divalent cation to stabilize the negative charges and facilitate the leaving group (Gibbons et al., 2002; Persson et al., 2001). However, another GT-A protein, rabbit muscle glycogen phosphorylase (rmGP), and the GT-

B retaining α-(1,3)-glucosyltransferase WaaG from E. coli use amino acids with positively charged side chains for the leaving group facilitation (Lairson et al.,

2008; Martinez-Fleites et al., 2006).

1.3. Pseudosugar-containing natural products

In addition to sugar-containing natural products, there are pseudosugar

(cyclitol)-containing compounds that show important biological activity. The term

“pseudosugars” refers to analogs of monosaccharides in which the ring oxygen has been replaced by a methylene group (Barbaud et al., 1995; Barton et al., 1988;

Brunkhorst et al., 1999; Callam and Lowary, 2000; Suami and Ogawa, 1990;

Yoshikawa et al., 1994). The main feature of this class of natural products is the presence of one or more sugar-derived cyclitol (pseudosugar) moieties, which contribute to their significant chemical and biological properties. Members of this class of natural products include the aminoglycoside antibiotics, such as kanamycin, neomycin and streptomycin, which are used clinically to treat bacterial infections, the potent α–glycosidase inhibitor acarbose, which is used to treat non-insulin- dependent diabetes mellitus, and the antifungal agent validamycin A, which is used as a crop protectant to treat sheath blight disease of rice plants (Mahmud, 2003b,

2007).

NH2 O NH2 HO O OH HO CH HO N OH H2N O OHH NH O NH O HN NH HO 2 O Kanamycin NH2 tre tom cin O OH S p y OHO OH H O O H CHN OH NH2 3 OH OH

H3C O N NH2 H O H3C HN N HO CH3 OH OH H3C H3C OH OH OH O HO O O OH CH HO Pactamycin 3 OH O HO N OH H Validamycin OH OH OH

Figure 1.4: Chemical structures of various aminocyclitol-containing natural products. Colors indicate different aminocyclitol cores, which are derived from different biosynthetic pathways.

Based on their biosynthetic origins, this class of natural products is currently divided into four groups: myo-inositol-derived aminoglycosides [e.g. streptomycin], 2-deoxy-scyllo-inosose-derived aminoglycosides [e.g. kanamycin], cyclopentitol-derived antibiotics [e.g. pactamycin], and 2-epi-valiolone- or 2-epi-5- epi-valiolone-derived C7N-aminocyclitols [e.g. validamycin]. The first three groups are originated from a C6-sugar phosphate (hexose) precursor and the fourth group is originated from sedoheptulose 7-phosphate, a C7-sugar phosphate from the pentose phosphate pathway (Mahmud, 2003b, 2007; Mahmud, 2009).

streptomycin hygromycin spectinomycin

-2 HO OPO3 HO OH OH OH myo-inositol 1-phosphate

MIPS

CH2OH pentose HC C O OH validamycin kanamycin O O phosphate HO acarbose OH DOIS H C OH pathway HO C H EEVS HO butirosin HO OH cetoniacytone neomycin HO C H H C OH OH salbostatin gentamicin 2-deoxy-scyllo-inosose H C OH H C OH O OH H C OH H C OH OH -2 -2 CH2OPO3 CH2OPO3 glucose 6-phosphate sedoheptulose 7-phosphate 2-epi-5-epi-valiolone

HO O HO AcHN OR N-acetylglucosamine

pactamycin trehazolin allosamidin

Figure 1.5: Biosynthetic pathways to aminocyclitols. MIPS, 1L-myo-inositol 1- phosphate synthase; DOIS, 2-deoxy-scyllo-inosose synthase; EEVS, 2-epi-5-epi- valiolone synthase.

1.3.1. C7N-aminocyclitols (pseudoaminooligosaccharides)

Most, if not all, C7-pseudosugar-containing natural products are produced by soil bacteria of the order of Actinomycetes (Mahmud, 2003b). They are mainly represented by the pseudo-aminooligosaccharides, oligosugar mimetics with significant biomedical and biological importance, mainly due to their potent sugar- hydrolase inhibitory activity. Many of them share a conserved pharmacophore, an unsaturated aminocyclitol moiety (valienamine), in their chemical structures (Flatt

and Mahmud, 2007). The valienamine moiety adopts a half-chair conformation, which resembles the oxocarbenium ion transition state of sugar hydrolysis by the glycosidase enzymes. Consequently, a number of natural and synthetic compounds containing this structure have been used as potent competitive inhibitors of biologically important sugar hydrolases (Kameda et al., 1980; Ogawa et al., 2007).

These include the α-glucosidase inhibitor acarbose (used as an antidiabetic drug), the trehalase inhibitor validamycin A (used as an antifungal), and the neuraminidase inhibitor oseltamivir (Tamiflu®, used as an anti-influenza drug).

However, epoxy, hydroxy or dihydroxy forms of valienamine are also present. The modes of formation of these fascinating sugar mimetics have been the subject of many investigations (Mahmud, 2003a; Mahmud et al., 2007; Ogawa et al., 1988).

Amongst them, validamycin A has so far been the most extensively studied and is discussed in more detail in the next section.

OH OH OH OH HO OH HO O O HO HO OH OH HO N O OH HO HHO HO N OH HO N OH OH OH O H O H OH OH O OH OH OH HO salbostati validamycin A acarbose OH O O n HO OH OH

O OH O O OH OH O O HO HN HO OH

NH2 OH O NH HO N O 2 HO N O OH O OH HHO HHO OH OH OH OH oseltamivir O O CH3 O O OH Tamiflu® HO HO cetoniacytone A OH OH OH O trestatin A O OH adiposin HO OH O O HO OH HO O O OH

HOHO

Figure 1.6: Examples of C7N-aminocyclitols-containing natural products

1.3.2. Validamycin A

Validamycin A is a pseudotrisaccharide first identified by Takeda Chemical

Company during a screening effort to discover new antibiotics. This weakly basic and water-soluble compound was isolated from the soil bacterium Streptomyces hygroscopicus subsp. limoneus. Structurally, it consists of two pseudosugar

(cyclitol) units connected by a nitrogen bridge, and glucose, which is attached to the C-4´ via a glycosidic link (Dong, 2001). Validamycin A has been used for many years as a crop-protectant against Rhizoctonia solani (Pellicularia sasakii) that causes sheath blight diseases in rice plants. It is also used to prevent damping- off of cucumber seedling (Iwasa, 1970, 1971). The antifungal activity of

validamycin A is due to its ability to inhibit trehalase, a hydrolase enzyme that breaks down trehalose, a disaccharide that functions as energy storage in fungi

(Guirao-Abad et al., 2013). This inhibition leads to depletion of glucose and accumulation of trehalose in the cells to a toxic levels of more than 8% of dry weight mycelia (Shigemoto, 1992). Validamycin A has also shown insecticidal activity (Asano, 1990), (Kameda, 1987). This natural product is also an important source of valienamine, which is used as a precursor for the synthesis of the antidiabetic voglibose (Ogawa and Kanto, 2009; Xu et al., 2009).

1.3.2.1. Biosynthetic origin of validamycin

The origin of the C7-carbon skeleton of validamycin was established by

Rinehart and co-workers through feeding the producing bacterium with 13C-labeled glucose (Toyokuni, 1987). The study found that both the unsaturated cyclitol

(valienamine) and the saturated cyclitol (validamine) of validamycin A are derived from glucose, not from the shikimate pathway as originally predicted. In a separate

13 isotope incorporation study with [U- C3]glycerol of the acarbose pathay, Floss and coworkers discovered that the valienamine moiety is assembled from C2+C2+C3 carbon units, which is distinct from the C4+C3 assembly involved in the formation of dehydroquinate of the shikimate pathway (Degwert, 1987). Further isotope incorporation studies using syntheticly prepared cyclitols revealed that the C7N- aminocyclitol moieties (valienamine and validamine) of acarbose and validamycin are derived from 2-epi-5-epi-valiolone (Dong et al., 2001; Stratmann et al., 1999).

Subsequently, a putative gene, acbC, whose product is homologues to dehydroquinate (DHQ) synthases, was found in the biosynthetic gene cluster of acarbose in Actinoplanes sp. SE50/110 (Stratmann et al., 1999). Heterologous expression of this gene in Streptomyces lividans and characterization of the gene product showed that the protein catalyzes the cyclization of sedoheptulose 7- phosphate to 2-epi-5-epi-valiolone. On the basis of its resemblance to the DHQ synthases, a five-step reaction mechanism for AcbC has been proposed. Those include dehydrogenation at C-5 by NAD+, phosphate group elimination, C-5 ketone reduction, ring opening and rotation along the C-5 and C-6 bond, and intramolecular aldol condensation (Figure 1.7) (Bai, 2006b; Stratmann, 1999; Yu et al., 2005).

OH OH O O OH O HO OH O HO HO O OH -2 OH H O PO -2 PO3 2

sedoheptulose 7-phosphate + NAD NADH OH OH O O OH O HO HO O OH OH OH H :B

OH OH OH OH HO HO OH OH O O OH O 2-epi-5-epi-valiolone H+ Figure 1.7: Proposed reaction mechanism of 2-epi-5-epi-valiolone synthase

1.3.2.2. Validamycin gene cluster

Using the acbC gene from the acarbose biosynthetic gene cluster, Deng,

Floss and their coworkers successfully probed a homologous gene (valA) in the validamycin producer Streptomyces hygroscopicus subsp. Jinggangensis (Yu,

2005). This finding allowed the localization of the biosynthetic gene cluster of validamycin (val cluster) in this producing strain. Moreover, functional analysis and heterologous expression of the genes in Streptomyces lividans 1326 have led to the identification of 8 genes that are important for validamycin biosynthesis (Bai,

2006a). An analogous biosynthetic gene cluster (vld cluster) has also been identified in another validamycin producing bacterium, Streptomyces hygroscopicus subsp. limoneus (Singh et al., 2006). More recent genetic and comparative metabolomics studies further revealed a highly similar biosynthetic pathway to validoxylamine A in Actinosynnema mirum DSM 43827 (Asamizu et al., 2013). This finding raised important questions as to how and why bacteria produce pseudoaminooligosaccharides such as the validamycins.

Figure 1.8: Genetic organization of validamycin biosynthetic gene clusters in various organisms. A) Validamycin (vld) cluster in S. hygroscopicus subsp. limoneus; B) validamycin (val) cluster in S. hygroscopicus subsp. jinggangensis 5008; C) Validoxylamine A (amir) cluster in A. mirum. Figure adopted from (Asamizu et al., 2013).

1.3.2.3. Validamycin biosynthetic pathway

As described above, the two cyclitol moieties of validamycin A are derived from 2-epi-5-epi-valionone, a cyclization product of sedoheptulose 7-phosphate.

Detailed genetic and biochemical studies by Mahmud, Bai and their co-workers demonstrated that 2-epi-5-epi-valiolone is epimerized to 5-epi-valionone by ValD, a new type of α-hydroxyketo-epimerase from the Vicinal Oxygen Chelate (VOC) superfamily (Bai, 2006a; Xu, 2009). 5-epi-Valionone then undergoes a dehydration reaction to produce valienone by yet undetermined dehydratase (DH) (Figure 1.9).

H2C OH

C O OH HO C H HO HO H C OH H C OH ValA HO H C OH O -2 OH CH2OPO3 2-epi-5-epi-valiolone sedoheptulose 7-P

ValD

OH OH HO HO HO

DH? HO O HO O OH OH 5- -valiolone valienone epi

Figure 1.9: Early steps of validamycin biosynthesis.

Incorporation studies using isotopically labeled intermediates showed that valienone is the precursor of both the unsaturated and saturated cyclitol moieties of validamycin A. These two distinct cyclitol units are proposed to occur via two separate pathways. A portion of valienone is phosphorylated to valienone 7- phosphate by a C7-cyclitol kinase, ValC (VldC) (Minagawa et al., 2007).

Subsequently, stereoselective reduction of C-1 of valienone 7-phosphate, followed by migration of the phosphate group from C-7 to C-1 give valienol 1-phosphate as product. Nucleotidylation of valienol 1-phosphate, catalyzed by a sugar 1- phosphate nucleotidyltransferase homologue, ValB (VldB), gives GDP-valienol

(Yang et al., 2011).

The pathway that leads to the saturated cyclitol moiety has not been completely elucidated. It is proposed that another portion of valienone is reduced to validone and phosphorylated to validone 7-phosphate by the kinase ValC (VldC)

(Minagawa et al., 2007). Validone 7-phosphate is subsequently converted to validamine 7-phosphate by the aminotransferase ValM (Bai, 2006a). However, it is also possible that phosphorylation and transamination occur prior to the reduction of the double bond. The product validamine 7-phosphate is a substrate for the coupling enzyme VldE (ValL), an unusual glycosyltransferase-like enzyme that couples GDP-valienol and validamine 7-phosphate to give validoxylamine A 7´- phosphate (Asamizu et al., 2011). The latter compound is then dephosphorylated by a phosphatase, VldH, to give validoxylamine A. Finally, glucosylation of validoxylamine A by a glycosyltransferase, VldK (ValG), gives validamycin A

(Bai, 2006a; Minagawa et al., 2007). One of the main focus of this dissertation is to understand the catalytic mechanism of the coupling reaction between GDP-valienol and validamine 7-phosphate catalyzed by VldE.

-2 OH OPO3

HO HO ValC

HO O HO O OH OH valienone valienone 7-P

ValN ValK

-2 OH OPO3

HO HO

HO O HO OH OH OH validone valienol 7-P

ValC ValO

-2 OPO3 OH

HO HO

-2 HO O HO OPO3 OH OH validone 7-P valienol 1-P

ValM ValB

-2 OPO3 OH

HO HO

HO NH2 HO OGDP OH VldE OH validamine 7-P GDP-valienol

-2 OH OPO3 OH OH HO OH HO OH VldH UDP-glucose HO N OH HO N OH H H OH OH OH OH validoxylamine A 7'-phosphate validoxylamine A ValG

OH OH OH HO O O HO OH OH HO N OH H OH OH Validamycin

Figure 1.10: Late steps of validamycin biosynthesis

1.3.2.4. VldE crystal structure

The glycosyltransferase-like enzyme VldE is unique in that it catalyzes an unprecedented nonglycosidic C-N coupling of non-sugar (pseudosugar) substrates,

GDP-valienol and validamine 7-phosphate, to give a product with an α,α-amino linkage. This raises fundamental questions as to how a GT-like enzyme catalyzes a condensation of two non-sugar molecules with retention of configuration. Similar enzymes that catalyze the transfer of pseudosugars, or

“pseudoglycosyltransferases” (PsGTs), have also been identified in other pseudooligosaccharides’ biosynthetic pathways.

In collaboration with the group of Dr. Yong-Hwan Lee in Louisiana State

University, we obtained X-ray crystal structures of VldE in complex with guanosine 5´-phosphate (GDP), with GDP and trehalose (TRE), and with GDP and validoxylamine A 7´-phosphate (VDO). Despite their low 23% amino acid sequence identity and 29% similarity, the folding of VldE is remarkably similar to the E. coli OtsA. VldE has a similar GT-B folding as OtsA, which is comprised of two Rossmann β/α/β domains. In the “open” confirmation, the N-terminal domain showed two strands observed as a β–hairpin extended away from the catalytic site.

The binding of the ligands within VldE is most likely similar to OtsA because of the conservation of the key residues within the binding pocket.

Figure 1.11: VldE overall folding comparison to OtsA by superimposition. (A) The monomeric VldE folding is represented in a ribbon diagram, with the N- terminal domain in red, and the C-terminal domain in blue. (B) A comparison of the overall folding of VldE (green) with OtsA (gray). (C) The topology diagram of VldE with β-strands and α-helices. Blue boxes identify the β-hairpin motif and the β-sheets core of the N- and C-terminal Rossmann domain. The figure adopted from (M. C. Cavalier, 2012).

Comparison of the crystal structure of VldE in complex with GDP to that of

OtsA with UDP revealed that the protein interactions with ribose and the phosphate moieties in VldE and OtsA are conserved. However, the catalytic pocket of VldE, which interacts with the nucleobase guanine, is significantly different from that of

OtsA, which interacts with uridine. The binding of guanine within the VldE catalytic pocket is mediated by three hydrophilic residues, Arg321, Asn323, and

Thr366, whereas that of uridine with OtsA is mediated by Ile295, Pro297, and

Leu344. This explains the preference of GDP-activated donor substrate by VldE and UDP-activated donor substrate by OtsA.

Comparison of the crystal structure of VldE in complex with validoxylamine A 7´-phosphate with that of OtsA in complex with the same ligand also showed high similarity between these two proteins (Figure 1.13). Many amino acid residues within the active site are conserved in OtsA and VldE, except that

Asn325 and Gln385 in VldE are replaced by Ser299 and Met363, respectively, in

OtsA. The highly similar protein-ligand interactions and the conserved amino acid residues within the active sites of VldE and OtsA suggest that these two enzymes catalyze coupling reactions using similar mechanisms.

Figure 1.13: (A) The catalytic site of VldE in the presence (yellow) and absence (green) of validoxylamine A 7´-phosphate. (B) validoxylamine A 7´-phosphate binding within the catalytic sites of VldE (yellow) and OtsA (gray). Figure adopted from (M. C. Cavalier, 2012).

However, the OtsA-catalyzed reaction has been proposed to function via an internal return (SNi)-like mechanism involving an oxocarbenium ion-like transition state. Such transition state is not possible in the VldE-catalyzed coupling reaction, as the donor substrate for VldE is an activated pseudosugar (GDP-valienol), not an activated sugar. Furthermore, little was known about the molecular basis governing

PsGT substrate specificity and catalytic mechanism. As all known natural pseudooligosaccharides contain amino linkages, it was unclear whether or not the amino group on the acceptor is necessary for the pseudoglycosyltransfer reaction to occur.

1.4. Thesis overview

This dissertation describes our ongoing efforts to decipher the molecular basis of substrate specificity and catalytic mechanism of VldE. The following

Chapter (Chapter 2) describes comparative biochemical and kinetic studies using

OtsA, VldE, and their chimeric proteins, which were produced by swapping the N- and C-terminal domains of VldE with those of OtsA from Streptomyces coelicolor.

In Chapter 3, a detailed study on the catalytic mechanism of VldE using fragment swapping and point mutation experiments is described.

1.5. References

Arakawa, K., Bowers, S.G., Michels, B., Trin, V., and Mahmud, T. (2003). Biosynthetic studies on the alpha-glucosidase inhibitor acarbose: the chemical synthesis of isotopically labeled 2-epi-5-epi-valiolone analogs. Carbohydr Res 338, 2075-2082.

Arcamone, F., Animati, F., Berettoni, M., Bigioni, M., Capranico, G., Casazza, A.M., Caserini, C., Cipollone, A., De Cesare, M., Franciotti, M., et al. (1997). Doxorubicin disaccharide analogue: apoptosis-related improvement of efficacy in vivo. J Natl Cancer Inst 89, 1217-1223.

Asamizu, S., Abugreen, M., and Mahmud, T. (2013). Comparative metabolomic analysis of an alternative biosynthetic pathway to pseudosugars in Actinosynnema mirum DSM 43827. ChemBioChem 14, 1548-1551.

Asamizu, S., Yang, J., Almabruk, K.H., and Mahmud, T. (2011). Pseudoglycosyltransferase catalyzes nonglycosidic C-N coupling in validamycin a biosynthesis. J Am Chem Soc 133, 12124-12135.

Asano, N., Takeuchi, M., Kameda, Y., Matsui, K., and Kono, Y. (1990). Trehalase inhibitors, validoxylamine A and related compounds as insecticides. J of Antibiotics 43, 722-726.

Bai, L.L., L. Xu, H. Minagawa, K. Yu, Y. Zhang, Y. Zhou, X. Floss, H. G. Mahmud, T. Deng, Z. (2006a). Functional analysis of the validamycin biosynthetic gene cluster and engineered production of validoxylamine A. Chemist & Biol 13, 387-397.

Bai, L.L., L.; Xu, H.; Minagawa, K.; Yu, Y.; Zhang, Y.; Zhou, X.; Floss, H. G.; Mahmud, T.; Deng, Z., (2006b). Functional analysis of the validamycin biosynthetic gene cluster and engineered production of validoxylamine A. . Chemist & Biol 13, 387-397.

Barbaud, C., Bols, M., Lundt, I., and Sierks, M.R. (1995). Synthesis of the first pseudosugar-C-disaccharide. A potential antigen for eliciting glycoside-bond forming antibodies with catalytic groups. Tetrahedron 51, 9063-9078.

Barton, D.H.R., Géro, S.D., Cléophax, J., Machado, A.S., and Quiclet-Sire, B. (1988). Synthetic methods for the preparation of D- and L-pseudo-sugars from D- glucose. J Chem Soc, Chem Commun, 1184-1186.

Bertho, G., Gharbi-Benarous, J., Delaforge, M., Lang, C., Parent, A., and Girault, J.P. (1998a). Conformational analysis of ketolide, conformations of RU 004 in solution and bound to bacterial ribosomes. J Med Chem 41, 3373-3386.

Bertho, G., Ladam, P., Gharbi-Benarous, J., Delaforge, M., and Girault, J.P. (1998b). Solution conformation of methylated macrolide antibiotics roxithromycin and erythromycin using NMR and molecular modelling. Ribosome-bound conformation determined by TRNOE and formation of cytochrome P450- metabolite complex. Int J Biol Macromol 22, 103-127.

Bolam, D.N., Roberts, S., Proctor, M.R., Turkenburg, J.P., Dodson, E.J., Martinez- Fleites, C., Yang, M., Davis, B.G., Davies, G.J., and Gilbert, H.J. (2007). The crystal structure of two macrolide glycosyltransferases provides a blueprint for host cell antibiotic immunity. Proc Natl Acad Sci USA 104, 5336-5341.

Brazier-Hicks, M., Offen, W.A., Gershater, M.C., Revett, T.J., Lim, E.K., Bowles, D.J., Davies, G.J., and Edwards, R. (2007). Characterization and engineering of the bifunctional N- and O-glucosyltransferase involved in xenobiotic metabolism in plants. Proc Natl Acad Sci USA 104, 20238-20243.

Brunkhorst, C., Andersen, C., and Schneider, E. (1999). Acarbose, a pseudooligosaccharide, is transported but not metabolized by the maltose- maltodextrin system of Escherichia coli. J of Bacteriol 181, 2612-2619.

Callam, C.S., and Lowary, T.L. (2000). Total synthesis of both methyl 4a-carba-D- arabinofuranosides. Org Lett 2, 167-169.

Carvalho, C., Santos, R.X., Cardoso, S., Correia, S., Oliveira, P.J., Santos, M.S., and Moreira, P.I. (2009). Doxorubicin: the good, the bad and the ugly effect. Curr Med Chem 16, 3267-3285.

Charnock, S.J., and Davies, G.J. (1999). Structure of the nucleotide-diphospho- sugar transferase, SpsA from Bacillus subtilis, in native and nucleotide-complexed forms. Biochemistry 38, 6380-6385.

Charnock, S.J.a.D., G. J (1999). Structure of the nucleotide-diphospho-sugar transferase, SpsA from Bacillus subtilis, in native and nucleotide-complexed forms. Biochemistry 38(20): 6380-6385.

Chiu, C.P., Lairson, L.L., Gilbert, M., Wakarchuk, W.W., Withers, S.G., and Strynadka, N.C. (2007). Structural analysis of the alpha-2,3-sialyltransferase Cst-I from Campylobacter jejuni in apo and substrate-analogue bound forms. Biochemistry 46, 7196-7204.

Coutinho, P.M., Deleury, E., Davies, G.J., and Henrissat, B. (2003). An evolving hierarchical family classification for glycosyltransferases. J Mol Biol 328, 307-317.

Degwert, U.v.H., R.; Pape, H.; Herrold, R. E.; Beale, J. M.; Keller, P. J.; Lee, J. P.; Floss, H. G., (1987). Studies on the biosynthesis of the alpha-glucosidase inhibitor acarbose: valienamine, a m-C7N unit not derived from the shikimate pathway. J of Antibiotics (Tokyo) 40 (6), 55-61.

Dong, H., Mahmud, T., Tornus, I., Lee, S., and Floss, H.G. (2001). Biosynthesis of the Validamycins: Identification of Intermediates in the Biosynthesis of Validamycin A by Streptomyces hygroscopicus var. limoneus. J Am Chem Soc 123, 2733-2742.

Elshahawi, S.I., Shaaban, K.A., Kharel, M.K., and Thorson, J.S. (2015). A comprehensive review of glycosylated bacterial natural products. Chem Soc Reviews 4, 4.

Gabelli, S.B., McLellan, J.S., Montalvetti, A., Oldfield, E., Docampo, R., and Amzel, L.M. (2006). Structure and mechanism of the farnesyl diphosphate synthase from Trypanosoma cruzi: implications for drug design. Proteins 62, 80-88.

Gantt, R.W., Peltier-Pain, P., and Thorson, J.S. (2011). Enzymatic methods for glyco(diversification/randomization) of drugs and small molecules. Nat Prod Rept 28, 1811-1853.

Gate, L., Couvreur, P., Nguyen-Ba, G., and Tapiero, H. (2003). N-methylation of anthracyclines modulates their cytotoxicity and pharmacokinetic in wild type and multidrug resistant cells. Biomed Pharmacother 57, 301-308.

Ge, M., Chen, Z., Onishi, H.R., Kohler, J., Silver, L.L., Kerns, R., Fukuzawa, S., Thompson, C., and Kahne, D. (1999). Vancomycin derivatives that inhibit peptidoglycan biosynthesis without binding D-Ala-D-Ala. Science 284, 507-511.

Gibbons, B.J., Roach, P.J., and Hurley, T.D. (2002). Crystal structure of the autocatalytic initiator of glycogen biosynthesis, glycogenin. J Mol Biol 319, 463- 477.

Hansen, S.F., Bettler, E., Rinnan, A., Engelsen, S.B., and Breton, C. (2010). Exploring genomes for glycosyltransferases. Mol bioSyst 6, 1773-1781.

Hosfield, D.J., Zhang, Y., Dougan, D.R., Broun, A., Tari, L.W., Swanson, R.V., and Finn, J. (2004). Structural basis for bisphosphonate-mediated inhibition of isoprenoid biosynthesis. J Biol Chem 279, 8526-8529.

Iwasa, T., E. Higashide, et al. (1971). Studies on validamycins, new antibiotics. II. Production and biological properties of validamycins A and B. J of Antibiotics (Tokyo) 24(2): 107-113.

Iwasa, T., H. Yamamoto, et al (1970). Studies on validamycins, new antibiotics. I. Streptomyces hygroscopicus var. limoneus nov. var., validamycin-producing organism. J of Antibiotics (Tokyo) 23(6): 595-602.

Jinek, M., Chen, Y.W., Clausen, H., Cohen, S.M., and Conti, E. (2006). Structural insights into the Notch-modifying glycosyltransferase Fringe. Nat Struct Mol Biol 13, 945-946.

Kakuda, S., Shiba, T., Ishiguro, M., Tagawa, H., Oka, S., Kajihara, Y., Kawasaki, T., Wakatsuki, S., and Kato, R. (2004). Structural basis for acceptor substrate recognition of a human glucuronyltransferase, GlcAT-P, an enzyme critical in the biosynthesis of the carbohydrate epitope HNK-1. J Biol Chem 279, 22693-22703.

Kameda, Y., N. Asano, et al. (1987). Validoxylamines as Trehalase Inhibitors. J of Antibiotics 40(4): 563-565.

Lairson, L.L., Henrissat, B., Davies, G.J., and Withers, S.G. (2008). Glycosyltransferases: structures, functions, and mechanisms. Ann Rev of Biochem 77, 521-555.

Lariviere, L., and Morera, S. (2002). A base-flipping mechanism for the T4 phage beta-glucosyltransferase and identification of a transition-state analog. J Mol Biol 324, 483-490.

Lariviere, L., and Morera, S. (2004). Structural evidence of a passive base-flipping mechanism for beta-glucosyltransferase. J Biol Chem 279, 34715-34720.

Losey, H.C., Jiang, J., Biggins, J.B., Oberthur, M., Ye, X.Y., Dong, S.D., Kahne, D., Thorson, J.S., and Walsh, C.T. (2002). Incorporation of glucose analogs by GtfE and GtfD from the vancomycin biosynthetic pathway to generate variant glycopeptides. Chemist & Biol 9, 1305-1314.

Luzhetskyy, A., and Bechthold, A. (2008). Features and applications of bacterial glycosyltransferases: current state and prospects. App micr and biotech 80, 945-952.

Luzhetskyy, A., Mendez, C., Salas, J.A., and Bechthold, A. (2008). Glycosyltransferases, important tools for drug design. Curr Top Med Chem 8, 680- 709.

Ly, H.D., Lougheed, B., Wakarchuk, W.W., and Withers, S.G. (2002). Mechanistic studies of a retaining alpha-galactosyltransferase from Neisseria meningitidis. Biochemistry 41, 5075-5085.

M. C. Cavalier, Y.Y., S. Asamizu, D. Neau, K. H. Almabruk, T. Mahmud, Y. Lee (2012). Mechanistic insights into validoxylamine A 7’-phosphate synthesis by VldE using the structure of the entire product complex. Plos 7.

Mahmud, T. (2003). The C7N aminocyclitol family of natural products. Nat Rrod Rept 20, 137-166.

Mahmud, T. (2007). Biosynthesis of Unusual Aminocyclitol-Containing Natural Products. J Nat Prod 70, 1384-1391.

Mahmud, T. (2009). Progress in aminocyclitol biosynthesis. Curr Opp Chem Biol 13, 161-170.

Martinez-Fleites, C., Proctor, M., Roberts, S., Bolam, D.N., Gilbert, H.J., and Davies, G.J. (2006). Insights into the synthesis of lipopolysaccharide and antibiotics through the structures of two retaining glycosyltransferases from family GT4. Chemist & Biol 13, 1143-1152.

Miley, M.J., Zielinska, A.K., Keenan, J.E., Bratton, S.M., Radominska-Pandya, A., and Redinbo, M.R. (2007). Crystal structure of the cofactor-binding domain of the human phase II drug-metabolism enzyme UDP-glucuronosyltransferase 2B7. J Mol Biol 369, 498-511.

Minagawa, K., Zhang, Y., Ito, T., Bai, L., Deng, Z., and Mahmud, T. (2007). ValC, a new type of C7-Cyclitol kinase involved in the biosynthesis of the antifungal agent validamycin A. ChemBioChem 8, 632-641.

Minotti, G., Menna, P., Salvatorelli, E., Cairo, G., and Gianni, L. (2004). Anthracyclines: molecular advances and pharmacologic developments in antitumor activity and cardiotoxicity. Pharmacol Rev 56, 185-229.

Moore, M.H., Hunter, W.N., d'Estaintot, B.L., and Kennard, O. (1989). DNA-drug interactions. The crystal structure of d(CGATCG) complexed with daunomycin. J Mol Biol 206, 693-705.

Mulichak, A.M., Losey, H.C., Lu, W., Wawrzak, Z., Walsh, C.T., and Garavito, R.M. (2003). Structure of the TDP-epi-vancosaminyltransferase GtfA from the chloroeremomycin biosynthetic pathway. Proc Natl Acad Sci USA 100, 9238-9243.

Mulichak, A.M., Losey, H.C., Walsh, C.T., and Garavito, R.M. (2001). Structure of the UDP-glucosyltransferase GtfB that modifies the heptapeptide aglycone in the biosynthesis of vancomycin group antibiotics. Structure 9, 547-557.

Mulichak, A.M., Lu, W., Losey, H.C., Walsh, C.T., and Garavito, R.M. (2004). Crystal structure of vancosaminyltransferase GtfD from the vancomycin biosynthetic pathway: interactions with acceptor and nucleotide ligands. Biochemistry 43, 5170-5180.

Offen, W., Martinez-Fleites, C., Yang, M., Kiat-Lim, E., Davis, B.G., Tarling, C.A., Ford, C.M., Bowles, D.J., and Davies, G.J. (2006). Structure of a flavonoid

glucosyltransferase reveals the basis for plant natural product modification. Embo J 25, 1396-1405.

Ogawa, S., and Kanto, M. (2009). Design and synthesis of 5a- carbaglycopyranosylamime glycosidase inhibitors. Curr Top Med Chem 9, 58-75.

Pak, J.E., Arnoux, P., Zhou, S., Sivarajah, P., Satkunarajah, M., Xing, X., and Rini, J.M. (2006). X-ray crystal structure of leukocyte type core 2 beta1,6-N- acetylglucosaminyltransferase. Evidence for a convergence of metal ion- independent glycosyltransferase mechanism. J Biol Chem 281, 26693-26701.

Pedersen, L.C., Tsuchida, K., Kitagawa, H., Sugahara, K., Darden, T.A., and Negishi, M. (2000). Heparan/chondroitin sulfate biosynthesis. Structure and mechanism of human glucuronyltransferase I. J Biol Chem 275, 34580-34585.

Persson, K., Ly, H.D., Dieckelmann, M., Wakarchuk, W.W., Withers, S.G., and Strynadka, N.C. (2001). Crystal structure of the retaining galactosyltransferase LgtC from Neisseria meningitidis in complex with donor and acceptor sugar analogs. Nat Struct Biol 8, 166-175.

Ramakrishnan, B., Ramasamy, V., and Qasba, P.K. (2006). Structural snapshots of beta-1,4-galactosyltransferase-I along the kinetic pathway. J Mol Biol 357, 1619- 1633.

Retsema, J., and Fu, W. (2001). Macrolides: structures and microbial targets. Int J Antimicrob Agents 18, S3-10.

Schlunzen, F., Harms, J.M., Franceschi, F., Hansen, H.A., Bartels, H., Zarivach, R., and Yonath, A. (2003). Structural basis for the antibiotic activity of ketolides and azalides. Structure 11, 329-338.

Shick, J.M., and Dunlap, W.C. (2002). Mycosporine-like amino acids and related Gadusols: biosynthesis, acumulation, and UV-protective functions in aquatic organisms. Ann Rev of Physiol 64, 223-262.

Shigemoto, R., T. Okuno, et al. (1992). Effects of Validamycin A on the Growth of and Trehalose Content in Mycelia of Rhizoctonia solani Incubated in a Medium Containing Several Sugars as the Sole Carbon Source. Japanese J of Phytopathol 58(5): 685-690.

Singh, D., Seo, M.J., Kwon, H.J., Rajkarnikar, A., Kim, K.R., Kim, S.O., and Suh, J.W. (2006). Genetic localization and heterologous expression of validamycin biosynthetic gene cluster isolated from Streptomyces hygroscopicus var. limoneus KCCM 11405 (IFO 12704). Gene 376, 13-23.

Smith, L.A., Cornelius, V.R., Plummer, C.J., Levitt, G., Verrill, M., Canney, P., and Jones, A. (2010). Cardiotoxicity of anthracycline agents for the treatment of cancer: systematic review and meta-analysis of randomised controlled trials. BMC Cancer 10, 1471-2407.

Solenberg, P.J., Matsushima, P., Stack, D.R., Wilkie, S.C., Thompson, R.C., and Baltz, R.H. (1997). Production of hybrid glycopeptide antibiotics in vitro and in Streptomyces toyocaensis. Chemist & Biol 4, 195-202.

Stragier, P.a.L., R. (1996). Molecular Genetics of Sporulation in Bacillus subtilus. Ann Rev of Genetics 297–341.

Stratmann, A.M., T.; Lee, S.; Distler, J.; Floss, H. G.; Piepersberg, W., (1999). The AcbC protein from Actinoplanes species is a C7-cyclitol synthase related to 3- dehydroquinate synthases and is involved in the biosynthesis of the alphaglucosidase inhibitor acarbose. J Biol Chem 274, 10889-10896.

Suami, T., and Ogawa, S. (1990). Chemistry of carba-sugars (pseudo-sugars) and their derivatives. Adv Carbohydr Chem Biochem 48, 21-90.

Sussmuth, R.D. (2002). Vancomycin resistance: small molecule approaches targeting the bacterial cell wall biosynthesis. ChemBioChem 3, 295-298.

Thibodeaux, C.J., Melancon, C.E., 3rd, and Liu, H.W. (2008). Natural-product sugar biosynthesis and enzymatic glycodiversification. Angew Chem Int Ed Engl 47, 9814-9859.

Toyokuni, T.J., W.-Z.; Rinehart, K. L. (1987). Biosynthetic Studies on Validamycins: A C2 + C2 + C3 Pathway to an Aliphatic C7N Unit. J Am Chem Soc 109, 3481-3482.

Unligil, U.M., Zhou, S., Yuwaraj, S., Sarkar, M., Schachter, H., and Rini, J.M. (2000). X-ray crystal structure of rabbit N-acetylglucosaminyltransferase I: catalytic mechanism and a new protein superfamily. Embo J 19, 5269-5280.

Vrielinkl, A.R., W.; Driessen, H. P.C.; Freemont, P. (1994). Crystal structure of the DNA modifying enzyme beta-glucosyltransferase in the presence and absence of the substrate uridine diphosphoglucose. Embo J 13.

Xiong, Y., Patana, A.S., Miley, M.J., Zielinska, A.K., Bratton, S.M., Miller, G.P., Goldman, A., Finel, M., Redinbo, M.R., and Radominska-Pandya, A. (2008). The first aspartic acid of the DQxD motif for human UDP-glucuronosyltransferase 1A10 interacts with UDP-glucuronic acid during catalysis. Drug Metab Dispos 36, 517-522.

Xu, H., Yang, J., Bai, L., Deng, Z., and Mahmud, T. (2009). Genetically engineered production of 1,1'-bis-valienamine and validienamycin in Streptomyces hygroscopicus and their conversion to valienamine. App Microb and Biotech 81, 895-902.

Xu, H.Z., Y. Yang, J. Mahmud, T. Bai, L. Deng, Z. (2009). Alternative epimerization in C(7)N-aminocyclitol biosynthesis is catalyzed by ValD, a large protein of the vicinal oxygen chelate superfamily. Chemist & Biol 16, 567-576.

Yang, J., Xu, H., Zhang, Y., Bai, L., Deng, Z., and Mahmud, T. (2011). Nucleotidylation of unsaturated carbasugar in validamycin biosynthesis. Org & Biomol Chem 9, 438-449.

Yang, Y., Boze, H., Chemardin, P., Padilla, A., Moulin, G., Tassanakajon, A., Pugniere, M., Roquet, F., Destoumieux-Garzon, D., Gueguen, Y., et al. (2009). NMR structure of rALF-Pm3, an anti-lipopolysaccharide factor from shrimp: model of the possible lipid A-binding site. Biopolymers 91, 207-220.

Yoshikawa, M., Murakami, N., Yokokawa, Y., Inoue, Y., Kuroda, Y., and Kitagawa, I. (1994). Stereoselective conversion of D-glucuronolactone into pseudosugar: Syntheses of pseudo -α-D-glucopyranose, pseudo-β-D-glucopyranose, and validamine. Tetrahedron 50, 9619-9628.

Yu, Y., Bai, L., Minagawa, K., Jian, X., Li, L., Li, J., Chen, S., Cao, E., Mahmud, T., Floss, H.G., et al. (2005). Gene cluster responsible for validamycin biosynthesis in Streptomyces hygroscopicus subsp. jinggangensis 5008. App and Envir Microb 71, 5066-5076.

Yu, Y.B., L. Minagawa, K. Jian, X. Li, L. Li, J. Chen, S. Cao, E. Mahmud, T. Floss, H. G. Zhou, X. Deng, Z. (2005). Gene cluster responsible for validamycin biosynthesis in Streptomyces hygroscopicus subsp. jinggangensis 5008. App and Envir Microb 71, 5066-5076.

CHAPTER TWO

Distinct Substrate Specificity and Catalytic Activity of the

Pseudoglycosyltransferase VldE

Hatem A. Abuelizz and Taifo Mahmud

Chemistry & Biology (In press) Cell Press, 600 Technology Square, Cambridge, MA 02139 39

2.1. Abstract

The pseudoglycosyltransferase (PsGT) VldE is a glycosyltransferase-like protein that is similar to trehalose 6-phosphate synthase (OtsA). However, in contrast to OtsA, which catalyzes condensation between UDP-glucose and glucose

6-phosphate, VldE couples two pseudosugars to give a product with an α,α-N- pseudoglycosidic linkage. Despite their unique catalytic activity and important role in natural products biosynthesis, little is known about the molecular basis governing their substrate specificity and catalysis. Here, we report comparative biochemical and kinetic studies using recombinant OtsA, VldE, and their chimeric proteins with a variety of sugar and pseudosugar substrates. We found that the chimeric enzymes can produce hybrid pseudo-(amino)disaccharides and an amino group in the acceptor is necessary to facilitate a coupling reaction with a pseudosugar donor. Furthermore, we found that the N-terminal domains of the enzymes not only play a major role in selecting the acceptors, but also control the type of nucleotidyl diphosphate moiety of the donors.

2.2. Introduction

Glycosyltransferases (GTs, EC 2.4.x.y) are enzymes that catalyze the transfer of a sugar moiety from an activated sugar donor onto a sugar acceptor or an aglycone, resulting in sugar-containing products. GTs are widely distributed in nature and play a central role in the structural and physiological aspects of living organisms; they are involved in the synthesis of oligo/polysaccharides, glycoproteins, glycolipids, glycosylated natural products, and many others (Breton et al., 2006; Elshahawi et al., 2015b; Wagner and Pesnot, 2010). Consequently, there are currently over 150,000 genes believed to encode members of the 90+ families of GTs listed in the databases (NCBI, CAZy – www.cazy.org), and this number is growing rapidly (Hansen et al., 2010).

Despite the large number of families of GTs with diverse primary sequences and functions, to date, only two distinct structural folds are known for most nucleotide sugar-dependent GTs: GT-A and GT-B folds. The GT-A fold is characterized by a single domain fold, made up of an α/β/α sandwich (a seven- stranded β-sheet core flanked by α-helices) that resembles a Rossmann fold

(Breton et al., 2006). The central β-sheet is flanked by a small antiparallel β-sheet connected by a metal-coordinating DXD motif-containing loop, and together they form the active site (Chang et al., 2011). On the other hand, the crystal structures of

GT-B GTs revealed that they consist of two distinct β/α/β Rossmann-like domains in non-abutting opposing orientation, with a catalytic site located between the domains. The N-terminal domain is responsible for the acceptor binding, whereas the C-terminal domain is responsible for nucleotide donor binding (Chang et al.,

2011; Vrielink et al., 1994).

Figure 2.1: Chemical structures of pseudosugar-containing natural products.

Recently, we discovered a number of putative GTs that can catalyze nonglycosidic C-N couplings in the biosynthesis of pseudosugar-containing natural products, such as the α-glucosidase inhibitors acarbose and amylostatins, the antibiotic pyralomicin 1a, and the antifungal agent validamycin A (Figure 2.1)

(Asamizu et al., 2013; Asamizu et al., 2011; Flatt et al., 2013). The term

“pseudosugars” refers to analogs of monosaccharides in which the ring oxygen has been replaced by a methylene group (Barbaud et al., 1995; Barton et al., 1988;

Brunkhorst et al., 1999; Callam and Lowary, 2000; Suami and Ogawa, 1990;

Yoshikawa et al., 1994). The enzymes that catalyze the transfer of pseudosugars, or

“pseudoglycosyltransferases” (PsGTs), are believed to have evolved from ancestral

GTs. Our recent studies on VldE, a trehalose 6-phosphate synthase (TPS)-like protein from the validamycin biosynthetic pathway, revealed that the enzyme does not catalyze the coupling between UDP-glucose and glucose 6-phosphate, but catalyzes an unprecedented nonglycosidic C-N coupling of GDP-valienol and validamine 7-phosphate to give validoxylamine A 7´-phosphate with an α,α-amino linkage (Figure 2.2) (Asamizu et al., 2011). This finding raises fundamental questions as to how a GT-like enzyme catalyzes a condensation of two non-sugar molecules with retention of configuration.

Figure 2.2: Catalytic activities of VldE and OtsA.

The current paradigm suggests that retaining GTs, such as the GT family-20

TPS (OtsA) and family-5 glycogen synthases (based on the CAZy classification), function via an internal return (SNi)-like mechanism involving an oxocarbenium ion-like transition state, as opposed to a double SN2 displacement mechanism

(Lairson et al., 2008; Lee et al., 2011). Seminal X-ray crystallography and linear free energy relationship studies by Davis, Davies, and co-workers on OtsA using validoxylamine A 7´-phosphate as a transition state mimic demonstrate the involvement of a front-face nucleophilic attack involving hydrogen bonding

between the leaving group (UDP) and the nucleophile (acceptor sugar), in the OtsA reaction (Errey et al., 2010; Lee et al., 2011). The leaving-group phosphate is proposed to act as a base to deprotonate the acceptor. Furthermore, kinetic isotope effects indicate the participation of a highly dissociative oxocarbenium ion-like transition state in the reaction (Lee et al., 2011). However, as the donor substrate for VldE is an activated pseudosugar (GDP-valienol), oxocarbenium ion formation is not possible in the VldE-catalyzed coupling reaction. Moreover, little is known about the molecular basis governing PsGT substrate specificity and catalytic mechanism, and whether or not the amino group on the acceptor is necessary for the reaction to occur. To investigate the substrate specificity and catalytic mechanism of VldE and its relationship with OtsA, we carried out careful biochemical and kinetic studies of recombinant VldE, OtsA, and their chimeric proteins, which were engineered by swapping the N- and C-terminal domains of the two proteins, with a variety of synthetically prepared sugar (pseudosugar) donor and acceptor substrates. Here, we report new insights into the distinct substrate specificity and catalytic activities of OtsA and VldE and their chimeric proteins.

2.3. Results

2.3.1 Comparative analysis of VldE, Escherichia coli OtsA and Streptomyces coelicolor OtsA

The PsGT VldE is highly similar to the TPS OtsA. X-ray crystal structures of VldE from Streptomyces hygroscopicus subsp. limoneus and the well-studied

UDP-forming Escherichia coli TPS [OtsA(Eco)] demonstrated that both proteins adopt a GT-B fold with the C-terminal domain generally accepted to be the one that recognizes a nucleotidylated sugar donor and the N-terminal domain recognizes a sugar acceptor, with the domains connected by a linker (Cavalier et al., 2012b;

Gibson et al., 2002b). It has been reported that OtsA utilizes a sequential ordered bi-bi mechanism in which UDP-glucose (the sugar donor) binds to the active site first and is followed by glucose 6-phosphate (the sugar acceptor) (Lee et al., 2011).

The conserved architectural structures of VldE and OtsA with two distinct substrate-binding domains provide unusual opportunity to investigate their catalytic properties through domain swapping. Therefore, we set out to create chimeric proteins of VldE and OtsA and investigate the effects of each domain to the substrate specificity and catalytic activities of the proteins. However, direct comparisons of the primary amino acid sequences of VldE with OtsA(Eco) only showed 23% identity between the two proteins. On the other hand, TPS from the model soil bacterium Streptomyces coelicolor [OtsA(Sco)] is more similar to VldE

(29% identity and 45% similarity). However, no detailed biochemical studies of this enzyme have been reported in the literature.

Figure 2.3: Kinetic studies of OtsA(Sco). (A) Michaelis-Menten curve for ADP- glucose with a saturated amount of glucose 6-phosphate; (B) Michaelis-Menten curve for glucose 6-phosphate with a saturated amount of ADP-glucose; (C) Michaelis-Menten curve for GDP-glucose with a saturated amount of glucose 6- phosphate; (D) Michaelis-Menten curve for glucose-6-phosphate with a saturated amount of GDP-glucose.

To confirm the catalytic function of OtsA(Sco), the gene was cloned in pRSET B and expressed in E. coli BL21(DE3) pLysS. Characterization of the recombinant protein with GDP-, ADP-, UDP-, CDP-, and dTDP-glucose

individually as sugar donor and glucose 6-phosphate as sugar acceptor revealed that

-1 -1 OtsA(Sco) prefers ADP-glucose (Km = 0.459 ± 0.05 mM; kcat/Km = 4.57 s .mM )

-1 -1 and GDP-glucose (Km = 0.681 ± 0.077 mM; kcat/Km = 3.77 s .mM ) as sugar donors (Figure 2.3, Table 2.2). To some extent, the enzyme also processes UDP- glucose (Km >1.5 mM) and CDP-glucose (Km >4 mM), albeit in much lower binding affinity. No product can be detected in the reaction with dTDP-glucose

(Figure 2.4).

Figure 2.4: (-)-ESI-MS analysis of OtsA(Eco) and OtsA(Sco) using various NDP- glucose as sugar donors and glucose 6-phosphate as sugar acceptor. Boiled enzymes were used as negative controls. Red arrows indicate the expected product trehalose 6-phosphate.

Whereas OtsA(Sco) has broad substrate specificity, recognizing GDP-,

ADP-, UDP-, and CDP-glucose as sugar donors, VldE was only known to recognize GDP-valienol as a pseudosugar donor. No other NDP-valienols have previously been tested, because the corresponding nucleotidyltransferase enzyme

VldB appeared to prefer GTP as substrate, and produces GDP-valienol (Yang et al.,

2011). The preference of VldE toward GDP-valienol was also supported by its X- ray crystal structures (Cavalier et al., 2012b). However, it was unclear if VldE can process other NDP-valienols. Therefore, we prepared all five possible NDP- valienols and evaluated the substrate preference of VldE – whether or not it can process other NDP-valienols. GDP-, ADP-, and CDP-valienols were prepared from valienol 1-phosphate and their corresponding nucleotidyl triphosphates (GTP, ATP, or CTP), using VldB (Yang et al., 2011), whereas UDP- and dTDP-valienol were prepared from valienol 1-phosphate and UTP and dTTP, respectively, using RmlA-

L89T, an engineered broad spectrum nucleotidyltransferase (Moretti et al., 2011), kindly provided by Prof. Jon Thorson at the University of Kentucky (Figures 2.5 and 2.6). Although RmlA-L89T has been known to have relaxed substrate specificity towards various sugar phosphates (Moretti et al., 2011), the present study showed that RmlA-L89T is also able to process an unsaturated carbasugar phosphate. Incubation of VldE with NDP-valienols and validamine 7-phosphate revealed that VldE only accept GDP-valienol as substrate (Figure 2.7). Based on the similar GDP-sugar substrates, high sequence similarity, and their Streptomyces origin, we selected OtsA(Sco) for domain swapping experiments with VldE.

GTP+V1P GTP+V1P +boiled-VldB +boiled-RmlA

GTP+V1P GTP+V1P +VldB +RmlA

ATP+V1P ATP+V1P +boiled-VldB +boiled-RmlA

ATP+V1P ATP+V1P +VldB +RmlA

UTP+V1P UTP+V1P +boiled-VldB +boiled-RmlA

UTP+V1P UTP+V1P +VldB +RmlA

CTP+V1P CTP+V1P +boiled-VldB +boiled-RmlA

CTP+V1P CTP+V1P +VldB +RmlA

dTTP+V1P dTTP+V1P +boiled-VldB +boiled-RmlA

dTTP+V1P dTTP+V1P +VldB +RmlA

Figure 2.5: HPLC analysis of VldB and RmlA-L89T reactions using valienol 1- phosphate (V1P) with various nucleotidyl triphosphates at λ=210 nm. Red stars indicate NDP-valienols produced by VldB. Blue stars indicate NDP-valienol produced by RmlA-L89T.

Figure 2.6: (-)-ESI-MS analysis of VldB and RmlA-L89T reactions using valienol 1-phosphate (V1P) and various nucleotidyl triphosphates.

Figure 2.7: (-)-ESI-MS analysis of VldE with various NDP-valienols. The m/z values for the substrates are given in bold and that for the expected product is given in red.

2.3.2. Design and construction of VldE/OtsA(Sco) chimeras

Figure 2.8: Domain swapping between VldE and OtsA. A, secondary structures of OtsA(Sco) and VldE. Black arrows indicate the sites where the domains from the two proteins are connected. B, cartons of the expression plasmids for the production of chimera-1 and chimera-2. C, model structures for VldE, OtsA(Sco), chimera-1, chimera-2, and their expected hybrid products. D, SDS PAGE of purifiedC recombinant VldE, OtsA, chimera-1 (Ch-1) and chimera-2 (Ch-2).

Guided by the crystal structures of VldE and predicted secondary structure and folding of OtsA(Sco) – as its crystal structures are not yet available – we designed chimeric PsGTs using these two proteins. Secondary structure and protein folding prediction was performed using the Phyre2 program

(http://www.sbg.bio.ic.ac.uk) (Figures 2.8, 2.9A and 2.9B) (Kelley and Sternberg,

2009). The sites for domain swapping were chosen within loops (between amino acid residues Thr275-Glu276 of OtsA(Sco) and residues Gly266-Arg267 of VldE) which are located in the linker regions of the two proteins. We chose these positions with the expectation that the secondary structures of the N- and C-terminal domains would not be disrupted and they provide the least interruption of the tertiary protein structure (Figure 2.7A). The model structures of the expected chimeric proteins were then reanalyzed using Phyre2. The results showed that the modeled structures for chimera-1 (N-terminus of VldE, C-terminus of OtsA(Sco)) and chimera-2 (N- terminus of OtsA(Sco), C-terminus of VldE) (Figure 2.7B) share 71% and 61% similarity, respectively, to that of VldE, with 100% confidence (Figure 2.7B)

(Kelley and Sternberg, 2009). The DNA fragments representing the N- and C-

terminal domains of the enzymes were then amplified by PCR; the N-terminal fragment from one parental gene was replaced with an equivalent fragment of the second parental gene and vice versa. As no convenient restriction sites are available within the desired region of the genes, cloning of the chimeric genes was performed by blunt end ligations between the two fragments and the products were ligated to the pRSET B vector (Figure 2.7C). The genes were expressed in E. coli

BL21(DE3) pLysS, providing soluble recombinant chimera-1 and chimera-2

(Figure 2.7D).

Figure 2.9A: Partial (truncated) secondary structure of VldE produced by the Phyre2 program. Arrow indicates the site of cleavage for domain swapping.

Figure 2.9B: Partial (truncated) secondary structure of OtsA(Sco) produced by the Phyre2 program. Arrow indicates the site of cleavage for domain swapping.

Figure 2.10: Characterization of VldE, OtsA, Chimera-1 and Chimera-2 with a variety of sugar and pseudosugar substrates. The amino groups are depicted in their unprotonated forms and the curved arrows are intended to show the possible C-N or C-O bond formations, they do not represent the stereospecificity of the reactions. -1 -1 -1 -1 (+++), kcat/Km >1.0 s .mM ; (++), kcat/Km 0.2 – 1.0 s .mM ; (+), kcat/Km 0.02 – 0.2 -1 -1 -1 -1 s .mM ; (±), kcat/Km <0.02 s .mM ; (-) no reaction. Natural or expected substrates for the enzymes are presented in boxes.

2.3.3. Chimera-1 can produce a hybrid pseudo-aminodisaccharide

Chimera-1, together with VldE and OtsA(Sco), were characterized using either GDP-valienol or GDP-glucose as the sugar donor and validamine 7- phosphate or glucose 6-phosphate as the sugar acceptor. Both GDP-valienol and validamycin 7-phosphate were prepared according to procedures reported previously (Asamizu et al., 2011). As expected, chimera-1 was able to catalyze the coupling between GDP-glucose and validamine 7-phosphate to give a hybrid pseudo-aminodisaccharide with an apparent Km value of 1.1 ± 0.07 mM and kcat/Km

-1 -1 -1 -1 0.15 s •mM for GDP-glucose and Km 0.975 ± 0.1 mM and kcat/Km 0.11 s •mM for validamine 7-phosphate (Figures 2.10K and 2.13). Negative ion mode ESI-MS analysis of the new product gave an m/z of 418 [M-H]-, consistent with the expected pseudo-aminodisaccharide phosphate product (Figure 2.11). Moreover, addition of the phosphatase VldH to the reaction mixture resulted in a dephosphorylated product, which showed an m/z of 340 [M+H]+ in positive ESI-

MS mode. This compound was further confirmed by MS/MS analysis, which gave fragment ions at 322, 310, 294, and 178 (Figure 2.12), indicating the presence of validamine moiety in the product. This hybrid pseudo-aminodisaccharide product is relatively unstable, readily degrading under the reaction conditions. Prolonged incubation (more than one hour) resulted in a significant reduction of the product intensity in the ESI-MS. As a result, numerous attempts to isolate the compound from the reaction mixtures were unsuccessful.

GDP-Glc+Vmine7P+boiled Ch-1 GDP-Glc+Vmine7P+boiled VldE 312.44 603.87 100 348.45 100 312.47 603.86 329.46 50 661.50 50 350.51 352.48 604.86 311.81 352.46 412.40 470.55 512.77 432.21 507.55 601.91 534.80 0 0 300 350 400 450 500 550 600 650 300 350 400 450 500 550 600 650 m/z m/z GDP-Glc+Vmine7P+VldE GDP-Glc+Vmine7P+Ch-1 603.85 313.84 [M- 100 - 100 [M-H] 441.86 603.86 350.39 361.90 661.51 293.61 50 312.55 50 417.9 349.72 499.63 372.46 417.8 407.58 472.65 502.32 557.65 625.85 521.77 557.52 0 0 300 350 400 450 500 550 600 650 300 350 400 450 500 550 600 650 m/z m/z GDP-Glc+Vmine7P+Ch-1+boiled VldH GDP-Glc+Vmine7P+VldE+boiled VldH 264.84 316.98 100 100 300.92 300.98 50 50 318.96 324.91 521.81 385.87 421.78 443.98 362.92 402.16 416.65 587.38 546.65 603.79 649.01 496.71 553.25 660.36 0 0 250 300 350 400 450 500 550 600 650 300 350 400 450 500 550 600 650 m/z m/z GDP-Glc+Vmine7P+VldE+VldH GDP-Glc+Vmine7P+Ch-1+VldH [M+H] 300.97 300.87 100 [M+H] 100

324.97 339.9 362.03 50 443.96 50 340.0 605.74 362.99 416.93 378.80 496.92 444.14 526.94 586.21 625.42 577.00 627.79 0 0 250 300 350 400 450 500 550 600 650 300 350 400 450 500 550 600 m/z m/z Figure 2.11: ESI-MS analysis of chimera-1 and VldE reactions with GDP-glucose and valienamine 7-phosphate

GDP-Glc+Vmine7P+Ch-1+VldH ms/ms m/z 340 GDP-Glc+Vmine7P+VldE+VldH ms/ms m/z 340

340.2 340.2 10 10 (+)-ESI 9 Ch- 1 (+)-ESI 9 VldE 9 9 8 8 8 8 7 7 17 17 7 OH OH 7 OH OH

6 HO OH 6 HO OH O O Relativ Relativ 6 6

5 HO N OH 339.9 5 HO N OH e e Abundanc Abundanc H H 5 OH OH 5 OH OH . . 4 M Wt: 339 34 4 M Wt: 339 34 4 4 3 3 3 3 2 2 310.0 309.9

2 2 1 293.9 357.5 1 178.1 1 274.2 1 322.0 178.1 241.0 321.8 5 5

0 0 15 20 25 30 35 15 20 25 30 35

Figure 2.12: (+)-ESI-MS/MS analysis of validoxylamine A produced by chimera- 1+VldH and VldE+VldH.

A Chimera-1 with GDP-glucose B Chimera-1 with Validamine-7P 0.18 0.12

0.16 Rate (µmol/mg/s) Rate

Rate (µmol/mg/s) Rate 0.10 0.14

0.12 0.08

0.10 0.06 0.08 Vmax = 0.166 µM/s Vmax = 0.108 µM/s

0.06 0.04 Km = 1081 µM Km = 975 µM 0.04 0.02 0.02

0.00 0.00 0 2000 4000 6000 8000 10000 12000 0 2000 4000 6000 8000 10000 12000 [Substrate] (µM) [Substrate] (µM)

Figure 2.13: Kinetic studies of Chimera-1. (A) Michaelis-Menten curve for GDP- glucose with a saturated amount of validamine 7-phosphate; (B) Michaelis-Menten curve for validamine 7-phosphate with a saturated amount of GDP-glucose.

Interestingly, chimera-1 can also catalyze the coupling between GDP-

valienol and validamine 7-phosphate (Figure 2.10C), albeit in a much lower

conversion rate. The enzyme affinity to GDP-valienol (Km >10 mM) is significantly

lower than to GDP-glucose (Km 1.1 ± 0.07 mM), indicating that GDP-valienol is

not a preferred substrate for chimera-1 (Figure 5). This is consistent with the fact

that chimera-1 contains the OtsA C-terminal domain. However, when GDP-

valienol was used as a donor in the parent protein OtsA(Sco), with either

validamine 7-phosphate or glucose 6-phosphate as acceptor, no products could be

observed (Figures 2.10B and 2.10N), suggesting that the C-terminal domain of

OtsA can only accept GDP-valienol (a pseudosugar) as substrate when it is fused

with the N-terminal domain of VldE.

2.3.4. Chimera-2 displays OtsA activity

As chimera-2 consists of the N-terminal domain of OtsA(Sco) and the C- terminal domain of VldE, the protein was incubated with GDP-valienol and glucose

6-phosphate. It is expected that this reaction would furnish a hybrid product similar to that of chimera-1, except in a reverse combination. However, we discovered that chimera-2 is unable to process the two substrates to produce the desired product

(Figure 2.10P). Nor can it catalyze the coupling between GDP-valienol and validamine 7-phosphate (Figure 2.10D). However, interestingly, the protein is able to catalyze the condensation of GDP-glucose and glucose 6-phosphate to give trehalose 6-phosphate (Figures 2.10H and 2.14), suggesting that the C-terminal domain of chimera-2, which is originated from VldE, is able to recognize GDP- glucose (Km 3.56 ± 0.38 mM) as substrate (Figure 2.15).

Figure 2.14: (-)-ESI-MS analysis of reaction products of OtsA(Sco), VldE, Chimera-1, and Chimera-2 with GDP-glucose and glucose 6-phosphate or GDP- valienol and glucose 6-phosphate as substrates. Red arrow shows the m/z value for the expected product.

A Chimera-2 with GDP-glucose B Chimera-2 with Glucose-6P 0. 2.5

0.5 Rate (µmol/mg/s)

Rate (µmol/mg/s) 2.

0. 1.5 0.

1. 0.

Vmax = 2.9 Vmax = 0.844 Km = 3560 Km = 6441 0.5 0.

0. 0. 0 200 400 600 800 1000 1200 0 200 400 600 800 1000 1200 [Substrate] [Substr ate]

Figure 2.15: Kinetic studies of Chimera-2. (A) Michaelis-Menten curve for GDP- glucose with a saturated amount of glucose 6-phosphate; (B) Michaelis-Menten curve for glucose 6-phosphate with a saturated amount of GDP-glucose.

2.3.5. VldE prefers GDP-valienol over GDP-glucose as substrate

The ability of chimera-2 to process GDP-glucose and glucose 6-phosphate has urged us to reinvestigate the substrate specificity of VldE and whether VldE itself can process these substrates. The enzyme was incubated with GDP-glucose and glucose 6-phosphate, as well as with GDP-glucose and validamine 7- phosphate. The reaction was terminated after one hour and the products were immediately analyzed by ESI-MS. While incubation of VldE with GDP-glucose and glucose 6-phosphate did not give any product (Figure 2.10E), it can in fact process GDP-glucose and validamine 7-phosphate to give a product (m/z 418 [M-

H]-) (Figures 2.10I and 2.11 and 2.12), which is identical with that of chimera-1. As described above, this hybrid compound is relatively unstable, requiring early termination of incubation and immediate analysis of the sample for clear observation of the product. Its low stability may explain why this product was not observed in our previous experiments (Asamizu et al., 2011). In light of the present results, we conclude that the C-terminal domain of VldE can recognize both GDP- valienol (Km 0.06 ± 0.012 mM) (Asamizu et al., 2011) and GDP-glucose (Km >2.2 mM) as substrate, but with >37-fold greater affinity toward GDP-valienol.

2.3.6. The role of the N-terminal domain in governing the type of bonding

One of the differences between OtsA and VldE is that OtsA catalyzes the formation of a glycosidic bond (C-O bond), whereas VldE forms a nitrogen linkage

(C-N bond). Based on the results of our biochemical studies of chimera-1 and

chimera-2, we concluded that the N-terminal domains of VldE and OtsA(Sco) have more rigid substrate specificity or are mechanistically more restricted than their C- terminal domains. Chimera-1, which contains the N-terminal domain of VldE, only recognizes validamine 7-phosphate, but not glucose 6-phosphate, whereas chimera-

2, which contains the N-terminal domain of OtsA, only recognizes glucose 6- phosphate, but not validamine 7-phosphate, as an acceptor molecule. To confirm if this rigid substrate specificity is also observed in the parent proteins, we incubated

VldE with GDP-valienol and glucose 6-phosphate (Figures 2.10M and 2.14), and

OtsA(Sco) with GDP-glucose and validamine 7-phosphate (Figures 2.10J and

2.16). As expected, both reactions did not give any desired products (Figures 2.16), confirming that the N-terminal domains of VldE and OtsA(Sco) play a significant role in governing the type of substrates and/or catalytic reactions. However, whether that is due to the differences in nucleophilicity (–OH versus –NH2) or the presence of a ring oxygen (sugar versus cyclitol) of the acceptor molecules was unclear.

Figure 2.16: (-)-ESI-MS analysis of reaction products of OtsA(Sco), VldE, Chimera-1, and Chimera-2 with GDP-glucose and validamine 7-phosphate or GDP-valienol and validamine 7-phosphate as substrates. Red arrow shows the m/z value for the expected product.

2.3.7. Amino group is necessary for pseudoglycoside formation

To investigate whether nucleophilicity or the presence of a ring oxygen of the acceptor molecule plays a bigger role in the coupling reaction, we synthesized validol 7-phosphate, a validamine 7-phosphate analog in which the C-1 amino group has been replaced with a hydroxy group, and used it as the acceptor molecule. The compound was synthesized from tetrabenzylvalidone (Asamizu et al., 2011) following a procedure shown in Figure 2.17.

OBn OBn OBn NaH BnO - n n L selectride B O BnBr B O

BnO O THF BnO OH DMF BnO OBn n OB 63% OBn 94% OBn tetrabenzylvalidone

Ac Ac H ZnCl 2O/ O 2 : (2 1) 36% OH OAc . 1 iPr NP OBn ( -)2 ( )2 BnO a BnO 1H tetrazole CH3ON . - n n CH OH n n 2 m CPBA B O OB 3 B O OB n n 50% OB 34% OB

O O - O P OBn O P O - HO OBn 10% Pd/C 7 O HO BnO HO H2 5 OH 2 1 n n CH OH B O OB 3 HO OH - OH 2 O PO OBn 70% OH 3

va o - os a e lid l 7 ph ph t

Figure 2.17: Chemical synthesis of validol 7-phosphate.

Validol 7-phosphate was then incubated with chimera-1 and chimera-2 in the presence of either GDP-valienol or GDP-glucose. The results showed that chimera-1 did not recognize validol 7-phosphate as acceptor molecule, indicating that the amino group is critical for the PsGT reaction (Figures 2.10S and 2.20). On the other hand, chimera-2 can only catalyze the coupling between GDP-glucose and validol 7-phosphate (Figure 2.10T), but not between GDP-valienol and validol 7- phosphate (Figure 2.20), which is in agreement with the notion that the amino group is required for the pseudoglycosidic coupling to occur. This was further

confirmed by testing validol 7-phosphate with the parent proteins VldE and OtsA.

As expected, VldE was not able to catalyze the coupling between GDP-valienol and validol 7-phosphate (Figure 2.10Q), whereas OtsA was able to couple GDP- glucose and validol 7-phosphate to give a hybrid product (Figure 2.10R), α,α- pseudo-trehalose 7´-phosphate, which upon VldH hydrolysis gave α,α-pseudotrehalose (Figure 2.19) (Bock et al., 1991). Although OtsA can recognize validol 7- phosphate as substrate, kinetic studies of OtsA with GDP-glucose and validol 7- phosphate revealed the enzyme affinity to validol 7-phosphate (Km >10 mM) is significantly lower than to glucose 6-phosphate (Km 0.587 ± 0.11 mM) (Figure

2.20, Table 2.2).

Figure 2.18: ESI-MS analysis of OtsA/VldH and Chimera-2/VldH with GDP- glucose and validol 7-phosphate as substrates.

Figure 2.19: (-)-ESI-MS analysis of reaction products of OtsA(Sco), VldE, Chimera-1, and Chimera-2 with GDP-glucose and validol 7-phosphate or GDP- valienol and validol 7-phosphate as substrates. Red arrow shows the m/z value for the expected product.

Figure 2.20: Kinetic parameters of VldE, OtsA, chimera-1 and chimera-2 with various substrates. Gray squares indicate very low catalytic reaction observed. Black squares indicate no catalytic reaction observed.

Based on the above results, we proposed that strong nucleophilic character is key for pseudoglycoside formation involving GDP-valienol, and that in the OtsA reaction the ring oxygen in the sugar acceptor (glucose 6-phosphate) plays a significant role for the glycosylation reaction to take place efficiently.

2.3.8. VldE recognizes 1-amino-1-deoxyglucose 6-phosphate as an acceptor molecule

To further confirm the importance of amino group in pseudoglycoside formation, we tested 1-amino-1-deoxyglucose 6-phosphate, which resembles glucose 6-phosphate but with an amino group at the anomeric (C-1) position, as sugar acceptor. This compound was prepared by stirring glucose 6-phosphate in

600 mM ammonium acetate at room temperature for 2 days (Lim et al., 2006;

Vetter and Gallop, 1995). Incubation of VldE with GDP-valienol and 1-amino-1- deoxyglucose 6-phosphate, however, did not give the expected product pseudo- aminotrehalose (Figure 2.23). Interestingly, careful analysis of the reaction mixture by ESI-MS and HPLC revealed the presence of valienamine, a hydrolytic product of validoxylamine A and the synthetic precursor of the antidiabetic drug voglibose.

No valienamine was observed in the reaction with boiled enzyme, indicating that the compound is produced from an enzymatic reaction (Figures 2.22 and 2.23).

Therefore, we postulated that the coupling reaction between GDP-valienol and 1- amino-1-deoxyglucose 6-phosphate did occur and the product, pseudo-

aminotrehalose, is then hydrolyzed to valienamine via an imine intermediate

(Figure 2.21).

Figure 2.21: Coupling reaction between GDP-valienol and 1-amino-1- deoxyglucose 6-phosphate by VldE.

Figure 2.22: ESI-MS analysis of VldE reaction with GDP-valienol and 1-amino-1- deoxyglucose 6-phosphate. No expected product was observed in the (-)-ESI-MS spectra (top two panels). The degradation product, valienamine (red arrow), can only be detected by (+)-ESI-MS.

Figure 2.23: HPLC analysis of VldE and Chimera-1 reactions with GDP-valienol and 1-amino-1-deoxyglucose 6-phosphate at λ=210 nm. Red asterisk indicates valienamine peak.

2.3.9. The N-terminal domain plays a significant role in the NDP-sugar preference of VldE and OtsA

X-ray crystal structures of OtsA(Eco) and VldE bound to UDP and GDP, respectively, demonstrated the sites and specific NDP binding pockets in the C- terminal domains of the enzymes, which is consistent with the notion that the C- terminal domains determine the selection of the NDP-sugar or NDP-cyclitol substrates. However, incubations of chimera-1 or chimera-2 with GDP-, ADP-,

UDP-, CDP-, and dTDP-glucose individually with their corresponding acceptor molecules revealed that chimera-1, which contains the C-terminal domain of

OtsA(Sco), can only process GDP-glucose (similar to VldE) (Figure 2.25), whereas chimera-2, which contains the C-terminal domain of VldE, can accept all NDP- glucoses, except dTDP-glucose, as substrates, similar to OtsA(Sco) (Figure 2.25).

These are completely opposite to the NDP specificity of the parent proteins from which the C-terminal domains are originated. Therefore, in contrast to the current paradigm for GT-B GTs, the results strongly suggest that the N-terminal domains of

OtsA and VldE play a significant role in selecting the type of nucleotidyl diphosphate moiety of the donor sugars.

Figure 2.24: (-)-ESI-MS analysis of Chimera-1 and Chimera-2 reactions with various NDP-glucoses.

2.4. Discussion

Based on their X-ray crystal structures, OtsA and VldE are grouped into the

GT-B structural type. The conserved architectural structures of this group of proteins with two distinct substrate-binding domains have made them an attractive target for domain swapping-based engineering. Domain swapping is a common strategy for engineering proteins that have distinct catalytic or substrate binding regions. Therefore, conceptually it is a promising and attainable approach for mechanistic studies or diversification of GT-B type GTs. However, in practice this approach is not always straightforward, as identifying ideal recombination sites within two different GTs and preserving their catalytic functions are sometimes challenging. Nevertheless, a number of successful constructions of functional chimeric GTs have been reported over the past 15 years, most notably those from the urdamycin pathway UrdGT1b and UrdGT1c (Hoffmeister et al., 2001), the plant flavonoid GTs UGT74F1 and UGTT74F2 (Cartwright et al., 2008), and the glycopeptide GTs GtfB and Orf10* (Truman et al., 2009). However, all of these GT pairs are highly homologous and they perform analogous glycosylations; UrdGT1b and UrdGT1c share 91% sequence identity, UGT74F1 and UGTT74F2 possess

76% identity, and GtfB and Orf10* share 70% identity. On the other hand, VldE and OtsA(Sco) only share 29% amino acid sequence identity. Therefore, our success in constructing functional chimeras from these two proteins is rather a fortunate event. More importantly, it provides evidence that both VldE and

OtsA(Sco) are amenable to protein engineering through domain-swapping technology.

As predicted in most, if not all, GT-B GTs, the C-terminal domains of OtsA and VldE are believed to interact with the sugar or pseudosugar donors and the N- terminal domain interacts with the acceptors. X-ray crystal structures of VldE in complex with GDP and validoxylamine A 7´-phosphate showed interactions between purine (from GDP) and Arg321, Asn323, Asn361, and Thr366 residues in the C-terminal domain, whereas in those of E. coli OtsA showed interactions of the smaller pyrimidine (from UDP) with Leu344, Ile295, Pro297, and His338 residues.

Streptomyces coelicolor OtsA, however, differs from E. coli OtsA in that it prefers purine-derived NDP substrates. However, in contrast to VldE, which strictly use

GDP-valienol, OtsA(Sco) can use both GDP- and ADP-glucose (purine analogs) and to smaller extent UDP- and CDP-glucose (pyrimidine analogs).

Interestingly, despite ample evidence to support the distinctive roles of the

N- and C-terminal domains, we found, through characterization of the chimeric proteins, that the N-terminal domains of VldE and OtsA(Sco) also play a significant role in the NDP-sugar preference. Chimera-1, which harbors the C- terminal domain of OtsA(Sco) (that recognizes GDP-, ADP-, UDP-, and CDP- glucoses), can only process GDP-glucose, whereas chimera-2, which contains the

C-terminal domain of VldE (that recognizes only GDP-valienol), can accept GDP-,

ADP-, UDP-, and CDP-glucoses as substrates. Therefore, we propose that, in addition to or in lieu of the C-terminal domain, the N-terminal domains of OtsA and VldE play a significant role in selecting the type of NDP moiety of the donor sugars. As most of the catalytic events in GT-B GTs occur in the interface of the two domains, it is possible that the N-terminal domain is actually involved in the primary recognition of the NDP-sugar(s), presumably when the enzyme is in its

“open” form, and the donor substrate is subsequently directed to its binding pocket in the C-terminal domain side of the interface.

The N-terminal domains of OtsA(Sco) and VldE are also responsible for the selection of the acceptor molecules. Accordingly, chimera-1, which consists of the

N-terminal domain of VldE and the C-terminal domain of OtsA(Sco), is able to utilize GDP-glucose and validamine 7-phosphate as substrates. However, chimera-

2, which consists of the N-terminal domain of OtsA(Sco) and the C-terminal domain of VldE, is unable to couple GDP-valienol and glucose 6-phosphate. In fact, this was not due to the lack of activity of the enzyme, as it can catalyze the coupling between GDP-glucose and glucose 6-phosphate to give trehalose 6- phosphate. Therefore, we propose that a strong nucleophilic group in the acceptor is necessary for a successful coupling reaction involving a pseudosugar donor. This was corroborated by incubating VldE with GDP-valienol and 1-amino-1- deoxyglucose 6-phosphate. Although the expected product pseudo-aminotrehalose could not be directly observed, the identification of valienamine in the reaction

mixtures with an active enzyme, but not in those with a heat-inactivated enzyme, strongly suggests that pseudo-aminotrehalose was actually formed, but was spontaneously hydrolyzed to valienamine (Figure 2.22). On the other hand, incubation of VldE with GDP-valienol and validol 7-phosphate did not give any products, further confirmed the importance of the amino group in the reaction. The notion that the nucleophilicity of the acceptor molecule plays a significant role in the catalytic activity of PsGT enzymes is consistent with the fact that all natural products whose formations are postulated to involve PsGTs contain amino linkages

(Mahmud, 2003a).

Some important insights into the distinct substrate specificity and reactivity of Ots(Sco), VldE, and their chimeras were also gained from the kinetics studies

(Figure 2.10). First, it is evident from the apparent specificity constants (kcat/Km values) of OtsA(Sco) with various substrates that this enzyme is highly optimized for its natural substrates, NDP-glucose and glucose 6-phosphate. OtsA(Sco) does not recognize GDP-valienol or validamine 7-phosphate as substrates (Figure 2.10).

Although the enzyme uses validol 7-phosphate as an acceptor molecule, the relative catalytic rate for this compound is significantly low. This is in spite of their shared chair conformation, suggesting that the ring oxygen in the sugar acceptor (glucose

6-phosphate) plays a significant role for its higher binding affinity and/or for the glycosylation reaction to take place efficiently.

Second, kinetics data also suggest that the PsGT VldE can only optimally process GDP-valienol and validamine 7-phosphate. Although it can also use GDP- glucose as a donor molecule (only when it is incubated with validamine 7- phosphate as an acceptor), in comparison to GDP-valienol its affinity to the enzyme and catalytic rate are significantly low. This unambiguously confirmed the distinct substrate specificity of OtsA(Sco) and VldE, and that VldE is a dedicated PsGT, not a GT with broad substrate specificity.

Third, compared to other substrates, GDP-valienol shows unusually high binding affinity to VldE; in fact, it is considerably higher than that of GDP-glucose to OtsA (Figure 2.10). This is likely due to the half-chair conformation of the cyclohexene ring of GDP-valienol, which resembles the oxocarbenium ion transition state. Indeed, a number of natural and synthetic compounds containing this structure have been used as potent competitive inhibitors of biologically important sugar hydrolases. Those include the α-glucosidase inhibitor acarbose

(used as an antidiabetic drug), the trehalase inhibitor validamycin A (used as an antifungal), and the neuraminidase inhibitor oseltamivir (Tamiflu®, used as an anti- influenza drug). Interestingly, while the VldE product validoxylamine A 7´- phosphate also contains an oxocarbenium ion-like structure, which arguably can inhibit the enzyme activity, the apparent kcat/Km values of VldE remain relatively high (2.0 sec-1•mM-1 for GDP-valienol and 0.39 sec-1•mM-1 for validamine 7- phosphate). Thus, we speculate that the binding affinity of the product to the

enzyme is lower than that of the substrate GDP-valienol, as in addition to the oxocarbenium ion-like structure, GDP-valienol has strong enzyme-GDP hydrogen- bonding interactions, which is more likely to have competitive advantages over validoxylamine A 7´-phosphate. Indeed, the apparent kcat/Km values of VldE for its natural substrates are about half of those of OtsA (Figure 5 and Table 1), but, this may be merely due to intrinsic factors related to the reactivity of the pseudosugar donor.

Fourth, although both chimera-1 and chimera-2 are functionally active, their apparent kcat/Km values are relatively low. It is unclear, however, if this is due to the inherent nature of engineered proteins of two different origins or to suboptimal swapping sites in the linker regions. Nevertheless, we observed a meaningful shift in the specificity constants of chimera-2 to glucose 6-phosphate and validol 7- phosphate from those of the parent protein OtsA(Sco). Compared to the distinct kcat/Km values for glucose 6-phosphate and validol 7-phosphate in OtsA(Sco), both substrates appear to have comparable kcat/Km values in chimera-2. Whether this is due to the influence of the C-terminal domain of VldE (in chimera-2) remains to be investigated.

2.5. Significance

To date, there are over 150,000 genes encoding proteins across over 90 known families of glycosyltransferases (GTs) listed in the databases, and this number is growing rapidly. However, only a fraction of them have been functionally characterized. The challenge lies in the fact that not all of them are

‘true’ GT enzymes. Our recent study revealed that some putative GTs can catalyze a nonglycosidic C-N coupling in the biosynthesis of pseudosugar-containing natural product. The pseudosugar-transferase enzymes, or

“pseudoglycosyltransferases” (PsGTs), might have evolved from ancestral GTs to the extent that they can recognize non-sugars as donor substrates. However, little is known about their substrate selectivity and catalytic mechanisms. This lack of knowledge hinders the exploitation of their full potential and may pose critical barriers to progress in glycoscience, drug discovery, and related fields. The present paper describes our success in engineering two chimeric proteins from the GT

OtsA(Sco) and the PsGT VldE and their characterizations through comparative biochemical and kinetics studies. The studies not only provide new insights into the substrate selectivity and catalytic function of these proteins, but also open up new opportunities in the broad area of glycoscience and drug discovery, such as facilitating the development of new technical capabilities to generate carbohydrate mimetics, redesign glycoconjugates, and create novel bioactive natural products.

2.6. Materials and methods

2.6.1. Bacterial strains and plasmids:

Table 2.1. Bacterial strains, plasmids, and primers used in this study

Strain/plasmid Properties/product Source/Ref

Streptomyces A gift from A model representative of Streptomycetes coelicolor A3(2) Dr. H. Floss

Streptomyces A gift from hygroscopicus Wild-type producer of validamycin Dr. H. Floss subsp. limoneus

1.4-kb XhoI/EcoRI chm1 fragment in pRSET pRSET-B-Chm1 This work B (XhoI/EcoRI)

1.4-kb BamHI/EcoRI chm2 fragment in pRSET-B-Chm2 This work pRSET B (BamHI/EcoRI) pRSET-B- 1.4-kb BamHI/EcoRI otsA fragment in pRSET This work OtsA(Sco) B (BamHI/EcoRI)

pRSET-B- 1.4-kb XhoI/EcoRI OtsA fragment in pRSET (Asamizu et OtsA(Eco) B al., 2011) pRSET-B- 0.8-kb XhoI/EcoRI OtsB fragment in pRSET (Asamizu et OtsB(Eco) B al., 2011)

1.1-kb NdeI/XhoI vldB fragment in pRSET B (Yang et al., pET20b(+)-vldB (NdeI/XhoI) 2011)

1.4-kb XhoI/EcoRI vldE fragment in (Asamizu et pRSETB-vldE pET20b(+) (XhoI/EcoRI) al., 2011)

1.1-kb XhoI/EcoRI vldH fragment in pRSET (Asamizu et pRSETB-vldH B (XhoI/EcoRI) al., 2011) A gift from 0.9-kb NdeI/EcoRI rmlA-L89T fragment in RmlA-L89T Dr. J. pET28a (NdeI/EcoRI) Thorson Ch1-VldE- 5´-GGTGACTCGAGACATATGTACAA Acceptor-F GGTTGCA-3´ This work

Ch1-VldE- 5´-CCGTCGAGGGTGAGCGGGCTGTAG Acceptor-R CCGAGC-3´ This work

Ch1-OtsA- 5´-CGAGCTGTCCAAGAACATCGTGCG Donor-F CGGTCT-3´ This work

Ch1-OtsA- 5´-TAGGAATTCTCAGCCCCGCAGCGC Donor-R CTCCAA-3´ This work

Ch2-OtsA- 5´-TAGGGATCCGCATATGGTGACCG Acceptor-F GATCTGA-3´ This work

Ch2-OtsA- 5´-GTGCGGTCCACCCGCACGATGGT Acceptor-R GCGGCGG-3´ This work

Ch2-VldE- 5´-CCGCAACCCGCAACTGCCCGAA Donor-F GGGATCGA-3´ This work

Ch2-VldE- 5´-TGAGAATTCTCAGGAAGGACCAA Donor-R TATGCGG-3´ This work

OtsA-Forward 5´-TAGGGATCCG CATATGGTGACCG GATCTGA-3´ This work

OtsA-Reverse 5´-TAGGAATTCTCAGCCCCGCAGCG CCTCCAA-3´ This work

Restriction sites are underlined

2.6.2. Domain swapping between VldE and OtsA(Sco)

DNA fragments of the VldE-N-terminal domain, VldE-C-terminal domain,

OtsA-N-terminal domain and OtsA-C-terminal domain were amplified by PCR using PfuTurbo DNA polymerase (Agilent Technology) and the listed primer pairs

(Table 2.1). The 5´-end of the VldE-N-terminal domain DNA fragment was digested with XhoI and the 3´-end of the OtsA-C-terminal domain DNA fragment was digested with EcoRI. The resulted DNA fragments were ligated into the vector pRSET B (Invitrogen), predigested with XhoI and EcoRI, to give pRSET-B- chimera-1. Similarly, the 5´-end of OtsA-N-terminal domain DNA fragment and the

3´-end of VldE-C-terminal domain DNA fragment were digested with BamHI and

EcoRI, respectively, and ligated into pRSET B, predigested with BamHI and

EcoRI, to give pRSET-B-chimera-2. The identity of the chimera-1 and chimera-2 genes was confirmed by Sanger DNA sequencing in the Center for Genome

Research and Biocomputing (CGRB) at Oregon State University.

2.6.3. Chimera-1, chimera-2, OtsA(Sco), OtsA(Eco), VldB, VldE, and VldH production and purification

pRSET-B-chimera-1, pRSET-B-chimera-2, pRSET-B-otsA(Sco), pRSET-B- otsA(Eco), pET20-vldB, pRSETB-vldE and pRSETB-vldH were used to transform

E. coli BL21(DE3) pLysS. Transformants were grown overnight at 37 ºC on LB agar plate containing ampicillin (100 μg/mL) and chloramphenicol (25 μg/mL). A single colony was inoculated into LB medium (3 mL) containing ampicillin (100

μg/mL) and chloramphenicol (25 μg/mL) and cultured at 37 ºC for 6 h and this seed culture (1 mL) was transferred into a 500 mL flask containing LB medium (100 mL) containing ampicillin (100 μg/mL) and chloramphenicol (25 μg/mL), and grown at 28 ºC until OD600 reached 0.6. Then, the temperature was reduced to 18

ºC, and after 2 h of adaptation, IPTG was added to a final concentration of 0.1 mM to induce the C-terminal hexahistidine-tagged VldB and the N-terminal hexahistidine-tagged chimera-1, chimera-2, OtsA(Sco), OtsA(Eco), VldE and VldH proteins. After further growth for 14 h, the cells were harvested by centrifugation

(5000 rpm, 10 min, 4 ºC) and stored at -80 ºC until used.

Cell pellets from 50 mL of culture were washed with binding (B) buffer (40 mM NaH2PO4 (pH 8.0), 300 mM NaCl and 10 mM imidazole) (1 mL) and centrifuged (4000 rpm, 10 min, 4 ºC). Then, B buffer (1 mL) was added and the mixtures were sonicated (8 W, 15 s, 4 times). After centrifugation (14,500 rpm, 20 min, 4 ºC), the supernatant was purified using Ni-NTA spin column (Qiagen) at 4

ºC using washing (W) buffer (40 mM NaH2PO4 pH 8.0, 300 mM NaCl, and 20 mM imidazole) (2 x 600 µL) and elution (E) buffer (40 mM NaH2PO4 pH 8.0, containing 300 mM NaCl, and 500 mM imidazole) (500 µL). Eluted proteins were dialyzed against dialysis buffer (10mM Tris-HCl pH 7.5, 0.1 mM DTT, 1 mM

MgCl2) (1 L) 3 times for 3 h each. Purified proteins were analyzed by SDS_PAGE and concentrated by ultrafiltration using Amicon YM-10 (Millipore). Protein concentration was determined using the Bradford assay (Bio-Rad) using BSA as a standard.

2.6.4. Preparation of NDP-valienol

NDP-valienol was prepared according to a reported procedure (Yang et al.,

2011). Briefly, valienol 1-phosphate (6 mM) was incubated with ATP, GTP, CTP,

UTP or dTTP (6 mM) in the presence of VldB or RmlA-L89T (10 µM) and MgCl2

(10 mM) in Tris-HCl buffer (50 mM, pH 7.5) at 30 °C and the progress of the reactions was monitored by ESI-MS. After 4 h, the reactions were quenched with an equal volume of MeOH and centrifuged (14,500 rpm, 5 min, 4 °C).

2.6.5. Chemical syntheses of validol 7-phosphate

2.6.5.1. General

All chemical reactions were performed under an argon or nitrogen atmosphere employing oven-dried glassware. Analytical thin-layer chromatography

(TLC) was performed using silica plates (60 Å) with a fluorescent indicator (254 nm, EMD Millipore), which were visualized with a UV lamp and ceric ammonium molybdate (CAM) solution. Chromatographic purification of products was performed on silica gel (60 Å, 72–230 mesh, EMD Millipore). Proton NMR spectra were recorded on Bruker 300, 400 or 500 MHz spectrometers. Proton chemical shifts are reported in ppm (δ) relative to the residual solvent signals as the internal

1 standard (CDCl3: δH 7.26; D2O: δH 4.79). Multiplicities in the H NMR spectra are described as follows: s = singlet, bs = broad singlet, d = doublet, bd = broad doublet, t = triplet, bt = broad triplet, q = quartet, m = multiplet; coupling constants are reported in Hz. Carbon NMR spectra were recorded on Bruker 300 (75 MHz),

400 (100 MHz) or 500 (125 MHz) spectrometers with complete proton decoupling.

Carbon chemical shifts are reported in ppm (δ) relative to the residual solvent signal as the internal standard (CDCl3: δC 77.16), or with sodium 2,2- dimethylsilapentane-5-sulphonate (DSS) (δ 0.0) as an external standard.

Phosphorus NMR spectra were recorded on a Bruker 400 (162 MHz) spectrometer with complete proton decoupling. Phosphorus chemical shifts are reported in ppm

(δ) relative to an 85% H3PO4 (δ 0.0) external standard. Low-resolution electrospray ionization (ESI) mass spectra were recorded on a ThermoFinnigan liquid

chromatograph-ion trap mass spectrometer, and high-resolution electrospray mass spectra were recorded on a Waters/Micromass LCT spectrometer. Size exclusion chromatography was done on Sephadex LH-20 (Pharmacia). All other chemicals were purchased from Sigma-Aldrich and used without further purification.

2.6.5.2. 2,3,4,7-Tetra-O-benzylvalidol

A mixture of protected 2,3,4,7-tetra-O-benzylvalidone(Asamizu et al., 2011)

(300 mg, 55.9 μmol) and L-Selectride (200 µL, 1 M in THF) in THF (5 mL) was stirred for 14 h at 0 °C. Then, the reaction mixture was warmed up to room temperature and stirred for an additional 2 h. The reaction mixture was quenched with sat. aq. NH4Cl (5 mL) and water (5 mL). Then the aqueous layer was extracted with EtOAc, dried over Na2SO4, and concentrated under reduced pressure. Column chromatography of the product (silica gel, Hex-EtOAc = 3:1) yielded the title

20 1 compound (190 mg, 63%). [α] D (c = 1, EtOAc) +37.9. H NMR (500 MHz,

CDCl3) δ 7.5-7.25 (m, H-Bn, 20H) 5.03 – 4.88 (m, CH2-Bn, 8H), 4.21 (brs, H-

1, 1H), 3.94 (t, J = 9.3 Hz, H-3, 1H), 3.84 (dd, J = 8.8, 3.7 Hz, H-7b, 1H), 3.59

(t, J = 9.3 Hz, H-4, 1H), 3.55 – 3.47 (td, J = 9.3, 2.8 Hz, H-7a & H-2, 2H), 2.27

(t, J = 9.3 Hz, H-5, 1H), 2.03 (td, J = 13.2, 2.8 Hz, H-6b, 1H), 1.67 (t, J = 13.2 Hz,

13 H-6a, 1H). C NMR (125 MHz, CDCl3) δ 139.1, 138.9, 138.7, 138.2, 128.6, 128.4,

128.4, 127.9, 127.7, 127.6, 127.0, 83.7, 83.4, 80.9, 77.6, 77.2, 76.7, 75.8, 75.3,

+ 73.1, 72.7, 69.9, 66.7, 65.3, 36.8, 30.3. HRMS (ESI) [M+NH4] : m/z 556.30591

+ (calcd for C35H38O5 [M+NH4] : m/z 556.30575).

Figure 2.25: 1H NMR spectrum of 2,3,4,7-tetra-O-benzylvalidol.

Figure 2.26: 13C NMR spectrum of 2,3,4,7-tetra-O-benzylvalidol.

Figure 2.27: 1H -1H COSY spectrum of 2,3,4,7-tetra-O-benzylvalidol.

Figure 2.28: gHMBC spectrum of 2,3,4,7-tetra-O-benzylvalidol.

Figure 2.29: HSQC spectrum of 2,3,4,7-tetra-O-benzylvalidol.

Figure 2.30: NOESY spectrum of 2,3,4,7-tetra-O-benzylvalidol.

2.6.5.3. 1,2,3,4,7-Penta-O-benzylvalidol

To a solution of 2,3,4,7-tetra-O-benzylvalidol (190 mg, 0.35 mmol) in DMF

(10 mL) was added NaH (35 mg, 0.71 mmol) in DMF (3 mL) and stirred for 1 h at

10 °C. Then, the reaction mixture was cooled down to 0 °C and BnBr (50 µL, 0.709 mmol) was added dropwise and then stirred for 20 h at rt. The reaction mixture was quenched with sat. aq. NH4Cl (5 mL) and then diluted with EtOAc (30 mL) and washed with NaHCO3 (2 x 30 mL) and brine (3 x 30 mL). The organic layer was dried over Na2SO4, filtered and concentrated under reduced pressure. Column chromatography of the product (silica gel, Hex-EtOAc = 4:1) yielded the title

19 1 compound (210 mg, 94%). [α] D (c = 1.2, EtOAc) +38.9. H NMR (500 MHz,

CDCl3) δ 7.5-7.25 (m, H-Bn, 25H), 5.08-4.40 (m, CH2-Bn, 10H), 4.13 (t, J = 9.4

Hz, H-3, 1H), 3.95 (brs, H-1, 1H), 3.76 (dd, J = 10.2, 4.5 Hz, H-7b, 1H), 3.57

(dd, J = 10.8, 9.4 Hz, H-4, 1H), 3.48 (dt, J = 10.2, 4.5 Hz, H-7a & H-2, 2H), 2.25

(m, H-5, 1H), 2.04 (dt, J = 14.5, 3.7 Hz, H-6b, 1H), 1.49 – 1.40 (m, H-6a, 1H). 13C

NMR (125 MHz, CDCl3) δ 139.3, 139.0, 138.9, 138.8, 138.7, 128.6, 128.4, 128.3,

128, 127.9, 127.8, 127.7, 127.5, 127.4, 84.0, 83.6, 81.1, 77.5, 77.1, 76.7, 75.8, 75.3,

+ 73.2, 73.0, 72.5, 71.2, 70.1, 37.1, 28.6. HR-MS (ESI) [M+NH4] : m/z 646.35390

+ (calcd for C42H44O5 [M+NH4] : m/z 646.35270).

Figure 2.31: 1H NMR spectrum of 1,2,3,4,7-penta-O-benzylvalidol.

Figure 2.32: 13C NMR spectrum of 1,2,3,4,7-penta-O-benzylvalidol.

2.6.5.4. 1,2,3,4-tetra-O-benzyl-7-O-acetylvalidol

To a solution of 1,2,3,4,7-penta-O-benzylvalidol (210 mg, 0.33 mmol) in

Ac2O-AcOH (2:1; 6 mL) was added ZnCl2 (455.7 mg, 3.34 mmol), and the reaction mixture was stirred for 7 h at rt. The reaction mixture was diluted with water (10 mL) and EtOAc (10 mL), and the organic layer washed with sat. aq. Na2CO3 (3 x

10 mL). The organic layer was dried over MgSO4, filtered and concentrated under reduced pressure to give a crude product. Column chromatography (silica gel, Hex-

20 EtOAc = 3:1) of the product yielded the title compound (70 mg, 36%). [α] D (c =

1 2, EtOAc) +40.3. H NMR (500 MHz, CDCl3) δ 7.45-7.25 (m, H-Bn, 20H), 5.05-

4.58 (m, H-CH2-Bn, 8H), 4.24 (dd, J = 11.0, 4.6 Hz, H-4, 1H), 4.11 (m, H-7b and

H-3, 2H), 3.91 (brs, H-1, 1H), 3.53 – 3.29 (m, H-7a & H-2, 2H), 2.31 – 2.19 (m, H-

5, 1H), 1.91 (s, H-Ac, 3H), 1.23 – 1.11 (m, H-6b, 1H), 0.94 – 0.80 (m, H-6a, 1H).

13 C NMR (125 MHz, CDCl3) δ 171.0, 139.0, 138.7, 138.6, 138.5, 128.4, 128.4,

128.3, 128.1, 128.0, 127.7, 127.7, 127.6, 127.5, 127.5, 127.4, 83.9, 83.7, 83.5, 80.4,

77.3, 77.0, 76.8, 75.8, 75.2, 75.1, 72.9, 72.8, 72.5, 71.5, 64.5, 35.7, 28.3, 20.8.

+ + HRMS (ESI) [M+NH4] : m/z 598.31731 (calcd for C37H40O6 [M+NH4] : m/z

598.31631).

Figure 2.33: 1H NMR spectrum of 1,2,3,4-tetra-O-benzyl-7-O-acetylvalidol.

Figure 2.34: 13C NMR spectrum of 1,2,3,4-tetra-O-benzyl-7-O-acetylvalidol.

2.6.5.5. 1,2,3,4-tetra-O-benzylvalidol.

To a solution of 1,2,3,4-tetra-O-benzyl-7-O-acetylvalidol (63 mg, 0.11 mmol) in MeOH (3.4 mL) was added 30% NaOMe in MeOH (2.6 mL, 14.4 mmol) via syringe at 0 °C, and the reaction mixture was stirred for 4 h at rt. The reaction was quenched by addition of sat. aq. NH4Cl (5 mL) and water (5 mL), and extracted with EtOAc (20 mL). The organic layer was washed with brine (10 mL), dried over MgSO4, filtered and concentrated under reduced pressure to give a crude product. Column chromatography of the product (silica gel, Hex-EtOAc = 3:1)

20 1 yielded the title compound (20 mg, 34%). [α] D (c = 0.1, EtOAc) +5.1. H NMR

(400 MHz, CDCl3) δ 7.5-725 (m, H-Bn, 20H) 4.95-4.52 (m, CH2-Bn, 8H), 4.06 –

3.94 (m, H-3, 1H), 3.81 (brs, 1H), 3.55 (m, H-7b, 1H), 3.51 – 3.39 (m, H-7a, 1H),

3.32 (m, H-2 & H-4, 2H), 2.04 (m, H-5, 1H), 1.79 (dt, J = 14.3, 3.7 Hz, H-6b, 1H),

13 1.02 (ddd, J = 27.7, 14.3, 3.7 Hz, H-6a, 1H). C NMR (100 MHz, CDCl3) δ 136.5,

136.2, 136.1, 135.9, 126.0, 125.8, 125.7, 125.5, 125.4, 125.2, 125.1, 125.0, 124.9,

81.3, 81.0, 79.8, 74.8, 74.5, 74.2, 73.1, 72.4, 70.3, 69.9, 68.8, 62.2, 35.7, 27.2, 25.5,

+ 22.2, 20.2, 11.6. HRMS (ESI) [M+NH4] : m/z 556.30632 (calcd for C35H38O5

+ [M+NH4] : m/z 556.30575).

Figure 2.35: 1H NMR spectrum of 1,2,3,4-tetra-O-benzylvalidol.

Figure 2.36: 13C NMR spectrum of 1,2,3,4-tetra-O-benzylvalidol.

2.6.5.6. 1,2,3,4-tetra-O-benzyl-7-O-dibenzylphosphate-validol

To a solution of 1,2,3,4-tetra-O-benzylvalidol (20 mg, 37 μmol) and 1H- tetrazole (8.59 mg, 0.12 mmol) in CH2Cl2 (5 mL) was added dibenzyl N,N- diisopropylphosphoramidite (25.68 mg, 0.0744 mmol) in CH2Cl2 (5 mL) at rt under argon, and the reaction mixture was stirred for 2 h at rt. The reaction mixture was cooled to 0 °C and mCPBA (16.04 mg (70%), 0.09 mmol) was added. After 30 min stirring at 0 °C, the reaction mixture was diluted with EtOAc (20 mL) and washed with NaHCO3 (2 x 20 mL) and brine (3 x 20 mL). The organic layer was dried over

Na2SO4, filtered and concentrated under reduced pressure. Column chromatography of the product (silica gel, Hex-EtOAc = 2:1) yielded the title compound (20 mg,

25 1 50%). [α] D (c = 0.3, EtOAc) +25.9. H NMR (500 MHz, CDCl3) δ 7.42 – 7.19

(m, H-Bn, 30H), 5.07 – 4.54 (m, CH2-Bn, 12H), 4.31 – 4.27 (m, H-4, 1H), 4.06 –

3.95 (m, H-7b & H-3, 2H), 3.83 (brs, H-1, 1-H), 3.34 – 3.29 (m, H-7a & H-2, 2H),

2.18 – 2.10 (m, H-5, 1H), 1.83 (dt, J = 14.5, 3.7 Hz, H-6b, 1H), 1.14 (m, H-6a, 1H).

13 C NMR (125 MHz, CDCl3) δ 139.1, 138.6, 138.6, 138.6, 135.9, 135.8, 128.6,

128.6, 128.5, 128.5, 128.4, 128.3, 128.3, 128.3, 128.0, 127.9, 127.7, 127.7, 127.6,

127.5, 127.4, 83.6, 83.2, 79.9, 77.3, 77.0, 76.8, 75.6, 75.2, 72.7, 72.4, 71.3, 69.3,

+ 69.3, 67.8, 67.8, 37.1, 37.0, 27.7. HRMS (ESI) [M+NH4] : m/z 816.36738 (calcd

+ for C49H51O8P [M+NH4] : m/z 816.36598).

Figure 2.37: 1H NMR spectrum of 1,2,3,4-tetra-O-benzyl-7-O-dibenzylphosphate- validol.

Figure 2.38: 13C NMR spectrum of 1,2,3,4-tetra-O-benzyl-7-O-dibenzylphosphate- validol.

Figure 2.39: 1H -1H COSY spectrum of 1,2,3,4-tetra-O-benzyl-7-O- dibenzylphosphate-validol.

Figure 2.40: gHMBC spectrum of 1,2,3,4-tetra-O-benzyl-7-O-dibenzylphosphate- validol.

Figure 2.41: HSQC NMR spectrum of 1,2,3,4-tetra-O-benzyl-7-O- dibenzylphosphate-validol.

Figure 2.42: NOESY spectrum of 1,2,3,4-tetra-O-benzyl-7-O-dibenzylphosphate- validol.

2.6.5.7. Validol 7-phosphate

A mixture of 1,2,3,4-tetra-O-benzyl-7-O-dibenzylphosphate-validol (25 mg,

0.03 μmol) and 10% Pd/C (20 mg) in MeOH (1.8 mL) and EtOAc (1.2 mL) containing 12 M HCl (30 μL) was hydrogenated under atmospheric pressure for 20 h. The reaction mixture was filtered through Celite and a cellulose syringe filter, washed with MeOH and concentrated. The crude product was further purified with

21 Sephadex LH-20 to give pure validol 7-phosphate (3 mg, 70%). [α] D (c = 0.17,

1 H2O) +20.7. H NMR (500 MHz, D2O) δ 4.02 (brs, H-1, 1H), 3.91 (m, H-7a, 1H),

3.85 (m, H-7b, 1H), 3.52 (t, J = 9.5 Hz, H-3, 1H), 3.39 (m, H-4, 1H), 3.28 (t, J =

9.5 Hz, H-2, 1H), 1.91 – 1.78 (m, H-5 and H-6b, 2H), 1.50 (t, J = 13.9 Hz, H-6a,

13 1H). C NMR (175 MHz, D2O) δ 74.2, 73.9, 72.3, 68.8, 65.2 (d, JC-P = 20 Hz), 37.2

31 (d, JC-P = 29.7 Hz), 30.1. P NMR (162 MHz, D2O; H3PO4): δ 0.85. HRMS (ESI)

- - [M-H] : m/z 257.04290 (calcd for C7H15O8P [M-H] : m/z 257.04208).

100

Figure 2.43: 1H NMR spectrum of validol 7-phosphate.

Figure 2.44: 13C NMR spectrum of validol 7-phosphate.

101

Figure 2.45: 31P NMR spectrum of validol 7-phosphate.

2.6.6. Chemical synthesis of 1-amino-1-deoxyglucose 6-phosphate

1-amino-1-deoxyglucose 6-phosphate was prepared by adding D-glucose 6- phosphate (26 mg, 100 mM) to ammonium acetate solution (46 mg, 600 mM) and stirred at room temperature for 2 days (Lim et al., 2006; Vetter and Gallop, 1995).

The conversion of glucose 6-phosphate to 1-amino-1-deoxyglucose 6-phosphate was confirmed by 1H NMR and mass spectrometry analyses.

102

2.6.7. Glycosyltransferase assays

The catalytic activity of VldE, OtsA(Sco), OtsA (Eco), chimera-1, and chimera-2 was examined using NDP-glucoses or NDP-valienols as sugar donors and glucose 6-phosphate, validamine 7-phosphate or validol 7-phosphate as sugar acceptors. Each reaction contained (100 µL) donor substrate (5 mM), acceptor substrate (5 mM), protein (10 µM), MgCl2 (10 mM) and Tris-HCl (50 mM, pH

7.5). The reaction mixtures were incubated at 30 °C and aliquots (10 µL) of the reactions were collected at 1, 2, 3, 5, and 12 h and quenched with an equal volume of MeOH and centrifuged (14,500 rpm, 5 min, 4 °C). The supernatants were analyzed by ESI-MS.

2.6.8. HPLC analysis of VldB, RmlA-L89T, VldE, and chimera-1 products

The reactions were quenched by adding two volumes of MeOH and centrifuged. The supernatants were analyzed by HPLC (Shimazu SPD-20A system) with a C18 column (YMC-Pack ODS-A, 250 x 4.6 mm, 5 μm) using 0.5% MeOH in H2O containing 10 mM NH4HCO3 as eluent at a flow rate of 1 mL/min. Elution profiles were monitored at 210 nm.

2.6.9. Kinetic analysis of VldE, OtsA, chimera-1 and chimera-2

Km and kcat values for VldE, OtsA, chimera-1 and chimera-2 were determined by using the phosphopyruvate kinase (PK) and lactate dehydrogenase

(LDH) coupled assay (Sigma-Aldrich). The reaction mixture (100 μL) contained

103

Tris-HCl buffer (50 mM, pH 7.5), MgCl2 (5 mM), VldE (1 μM), phosphoenolpyruvate (1.5 mM), NADH (0.5 mM), PK (37 U), and LDH (46 U), in addition to a serial dilution of the donor substrate and 2 mM of the acceptor substrate for the determination of the value for the donor substrate, and a serial dilution of the acceptor substrate and 2 mM donor substrate for the determination of the value for acceptor substrate. Oxidation of NADH to NAD+ was monitored in

96-well plates using a spectrophotometric microplate reader (at 340 nm. Reaction mixtures lacking the enzyme were used as negative control (blank). The data were collected in triplicate. Michaelis-Menten plot (SigmaPlot, Systat Software Inc.) was used for Km and kcat value determination.

104

Table 2.2. Kinetics data for OtsA(Sco), VldE, Chimera-1 and Chimera-2.

OtsA(Sco) Kinetic GDP- ADP- Glucose- Validol- parameters Glucose-6P glucose glucose 6P 7P 0.681 + 0.459 + 0.79 + Km (mM) 0.587 + 0.11 >10 0.077 0.05 0.13

-1 1.18 + kcat (s ) 2.5 + 0.12 0.815 + 0.05 2.1 + 0.1 ---- 0.08 - kcat/Km (s 3.77 1.39 4.57 1.5 ---- 1.mM-1)

VldE Kinetic GDP- Validamine- GDP- parameters valienol# 7P# glucose 0.06 ± Km (mM) 0.308 ± 0.035 >2.2 0.012

-1 0.12 ± kcat (s ) 0.12 ± 0.007 ---- 0.012 - kcat/Km (s 2.0 0.39 ---- 1.mM-1)

Chimera-1 Kinetic GDP- Validamine- GDP- parameters glucose 7P valienol Km (mM) 1.1 + 0.07 0.975 + 0.1 >10

-1 0.166 + kcat (s ) 0.11 + 0.0035 ---- 0.003 - kcat/Km (s 0.151 0.11 ---- 1.mM-1) Chimera-2 Kinetic GDP- parameters Glucose-6P Validol-7P glucose Km (mM) 3.56 + 0.38 6.44 + 0.95 4.95 + 0.7

-1 0.58 + kcat (s ) 2.9 + 0.134 0.843 + 0.067 0.038 - kcat/Km (s 0.814 0.131 0.12 1.mM-1)

#Data adapted from Asamizu et al. (2011).

105

2.7. References

Asamizu, S., Abugreen, M., and Mahmud, T. (2013). Comparative Metabolomic Analysis of an Alternative Biosynthetic Pathway to Pseudosugars in Actinosynnema mirum DSM 43827. ChemBioChem 14, 1548-1551.

Asamizu, S., Yang, J., Almabruk, K.H., and Mahmud, T. (2011). Pseudoglycosyltransferase catalyzes nonglycosidic C-N coupling in validamycin A biosynthesis. J. Am. Chem. Soc. 133, 12124-12135.

Barton, D.H.R., Géro, S.D., Cléophax, J., Machado, A.S., and Quiclet-Sire, B. (1988). Synthetic methods for the preparation of D- and L-pseudo-sugars from D- glucose. J. Chem. Soc., Chem. Commun., 1184-1186.

Bock, K., Guzman, J.F., Duus, J.O., Ogawa, S., and Yokoi, S. (1991). A nuclear magnetic resonance spectroscopic and conformational study of eight pseudo- trehaloses (D-glucopyranosyl 5a-carba-D- and -L-glucopyranosides). Carbohydr. Res. 209, 51-65.

Breton, C., Snajdrova, L., Jeanneau, C., Koca, J., and Imberty, A. (2006). Structures and mechanisms of glycosyltransferases. Glycobiology 16, 29R-37R.

Callam, C.S., and Lowary, T.L. (2000). Total synthesis of both methyl 4a-carba-D- arabinofuranosides. Org. Lett. 2, 167-169.

Cartwright, A.M., Lim, E.K., Kleanthous, C., and Bowles, D.J. (2008). A kinetic analysis of regiospecific glucosylation by two glycosyltransferases of Arabidopsis thaliana: domain swapping to introduce new activities. J. Biol. Chem. 283, 15724- 15731.

106

Cavalier, M.C., Yim, Y.S., Asamizu, S., Neau, D., Almabruk, K.H., Mahmud, T., and Lee, Y.H. (2012). Mechanistic insights into validoxylamine A 7'-phosphate synthesis by VldE using the structure of the entire product complex. PLoS One 7, e44934.

Chang, A., Singh, S., Phillips, G.N., Jr., and Thorson, J.S. (2011). Glycosyltransferase structural biology and its role in the design of catalysts for glycosylation. Curr. Opin. Biotechnol. 22, 800-808.

Elshahawi, S.I., Shaaban, K.A., Kharel, M.K., and Thorson, J.S. (2015). A comprehensive review of glycosylated bacterial natural products. Chem. Soc. Rev. DOI: 10.1039/c4cs00426d

Errey, J.C., Lee, S.S., Gibson, R.P., Martinez Fleites, C., Barry, C.S., Jung, P.M., O'Sullivan, A.C., Davis, B.G., and Davies, G.J. (2010). Mechanistic insight into enzymatic glycosyl transfer with retention of configuration through analysis of glycomimetic inhibitors. Angew. Chem. Int. Ed. Engl. 49, 1234-1237.

Flatt, P.M., Wu, X., Perry, S., and Mahmud, T. (2013). Genetic insights into pyralomicin biosynthesis in Nonomuraea spiralis IMC A-0156. J. Nat. Prod. 76, 939-946.

Gibson, R.P., Turkenburg, J.P., Charnock, S.J., Lloyd, R., and Davies, G.J. (2002). Insights into trehalose synthesis provided by the structure of the retaining glucosyltransferase OtsA. Chem. Biol. 9, 1337-1346.

Hansen, S.F., Bettler, E., Rinnan, A., Engelsen, S.B., and Breton, C. (2010). Exploring genomes for glycosyltransferases. Mol. Biosyst. 6, 1773-1781.

Hoffmeister, D., Ichinose, K., and Bechthold, A. (2001). Two sequence elements of glycosyltransferases involved in urdamycin biosynthesis are responsible for substrate specificity and enzymatic activity. Chem. Biol. 8, 557-567.

Kelley, L.A., and Sternberg, M.J. (2009). Protein structure prediction on the Web: a case study using the Phyre server. Nat. Protoc. 4, 363-371.

Lairson, L.L., Henrissat, B., Davies, G.J., and Withers, S.G. (2008). Glycosyltransferases: structures, functions, and mechanisms. Annu. Rev. Biochem. 77, 521-555.

107

Lee, S.S., Hong, S.Y., Errey, J.C., Izumi, A., Davies, G.J., and Davis, B.G. (2011). Mechanistic evidence for a front-side, SNi-type reaction in a retaining glycosyltransferase. Nat. Chem. Biol. 7, 631-638.

Lim, J., Grove, B.C., Roth, A., and Breaker, R.R. (2006). Characteristics of ligand recognition by a glmS self-cleaving ribozyme. Angew. Chem. Int. Ed. Engl. 45, 6689-6693.

Mahmud, T. (2003). The C7N aminocyclitol family of natural products. Nat. Prod. Rep. 20, 137-166.

Moretti, R., Chang, A., Peltier-Pain, P., Bingman, C.A., Phillips, G.N., Jr., and Thorson, J.S. (2011). Expanding the nucleotide and sugar 1-phosphate promiscuity of nucleotidyltransferase RmlA via directed evolution. J. Biol. Chem. 286, 13235- 13243.

Suami, T., and Ogawa, S. (1990). Chemistry of carba-sugars (pseudo-sugars) and their derivatives. Adv. Carbohydr. Chem. Biochem. 48, 21-90.

Truman, A.W., Dias, M.V., Wu, S., Blundell, T.L., Huang, F., and Spencer, J.B. (2009). Chimeric glycosyltransferases for the generation of hybrid glycopeptides. Chem. Biol. 16, 676-685.

Vetter, D., and Gallop, M.A. (1995). Strategies for the synthesis and screening of glycoconjugates. 1. A library of glycosylamines. Bioconjug. Chem. 6, 316-318.

Vrielink, A., Ruger, W., Driessen, H.P., and Freemont, P.S. (1994). Crystal structure of the DNA modifying enzyme beta-glucosyltransferase in the presence and absence of the substrate uridine diphosphoglucose. EMBO J. 13, 3413-3422.

Wagner, G.K., and Pesnot, T. (2010). Glycosyltransferases and their assays. ChemBioChem 11, 1939-1949.

Yang, J., Xu, H., Zhang, Y., Bai, L., Deng, Z., and Mahmud, T. (2011). Nucleotidylation of unsaturated carbasugar in validamycin biosynthesis. Org. Biomol. Chem. 9, 438-449.

Yoshikawa, M., Murakami, N., Yokokawa, Y., Inoue, Y., Kuroda, Y., and Kitagawa, I. (1994). Stereoselective conversion of D-glucuronolactone into pseudosugar: Syntheses of pseudo-α-D-glucopyranose, pseudo-β-D-glucopyranose, and validamine. Tetrahedron 50, 9619-9628.

108

CHAPTER THREE

Molecular analysis of the pseudoglycosyltransferase VldE revealed a possible 1,4-elimination/1,4-addition mechanism

Hatem A. Abuelizz and Taifo Mahmud

In progress

109

3.1. Abstract

The pseudoglycosyltransferase (PsGT) enzyme VldE is a homologue of the retaining glycosyltransferase (GT) trehalose 6-phosphate synthase (OtsA). It catalyzes a coupling reaction between two pseudosugar units, GDP-valienol and validamine 7-phosphate, to give a product with α,α-N-pseudoglycosidic linkage.

Despite its unique catalytic function, the molecular bases for its substrate specificity and reaction mechanism are still obscure. Here, we report a comparative mechanistic study of VldE and OtsA using various engineered chimeric proteins and point mutants of the enzymes. We found that the distinct substrate specificities between VldE and OtsA are most likely due to topological differences within the hot spot amino acid regions of their N-terminal domains. We also found that the

His182 residue is important for a coupling reaction with GDP-valienol as pseudosugar donor, but not with GDP-glucose. Moreover, results of isotope exchange experiments suggest that coupling reaction with GDP-valienol involves deprotonation at C-7, which leads to 1,4-elimination of GDP, followed by a nucleophilic attack by validamine 7-phosphate to give the product via a 1,4- addition mechanism. The study revealed a possible new reaction mechanism that is unique to the PsGT VldE and is different from the proposed SNi-like mechanism for the retaining GT OtsA.

110

3.2. Introduction

Glycosyltransferases are enzymes that catalyze the transfer of sugar (glycone) from a sugar donor to a sugar acceptor (aglycone). They play a central role in the biosynthesis of sugar-containing molecules, such as glycosylated natural products, glycolipids, and glycoproteins, many of which are involved in pathogenesis, cellular recognition, signaling, and bacterial cell wall biosynthesis (Hansen et al.,

2010). Biochemically, glycosyltransferases catalyze a coupling reaction between an activated sugar donor, in the form of nucleoside diphosphates (e.g., UDP-glucose,

GDP-mannose), nucleoside monophosphates (e.g., CMP-NeuAc), lipid phosphates

(e.g., dolichol phosphate oligosaccharides) or unsubstituted phosphates, and a sugar acceptor to give a glycosylated product. The products may have either retained or inverted stereoconfiguration at the anomeric center in respect to the stereoconfiguration of the donor substrates (Lairson et al., 2008).

Supported by X-ray crystal structures, point mutations, and kinetic isotope effect studies, the catalytic mechanism of inverting glycosyltransferases has been accepted to occur via an SN2 mechanism (Bruner and Horenstein, 1998; Kim et al.,

1988; Lairson et al., 2008). On the other hand, retaining glycosyltransferase has been proposed to adopt a double-displacement mechanism, which involves the formation of a covalent enzyme-intermediate binding with an inverted configuration, followed by a second inversion by the acceptor molecule to give a product with a retained stereochemistry (Lairson et al., 2004; Soya et al., 2011).

111

However, amino acid sequence alignments and structural data for many retaining glycosyltransferases did not show conserved nucleophilic amino acid residues within the reasonable distance to the anomeric center to act as a nucleophile

(Gibson et al., 2002b; Martinez-Fleites et al., 2006; Persson et al., 2001). Recently, an SNi-like mechanism, which involves a highly dissociative oxocarbenium ion-like transition state and a front-face nucleophilic attack, has been proposed in a retaining glycosyltransferase, trehalose 6-phosphate synthase (OtsA) (Lee et al.,

2011). OtsA is a member of family 20 glycosyltransferase (GT-20) that catalyzes a coupling reaction between UDP-glucose and glucose 6-phosphate to give α,α-1,1- trehalose-6 phosphate as a product (Gibson et al., 2002a). X-ray crystal structures of OtsA in complex with uridine diphosphate (UDP) and a transition state mimicry, validoxylamine A 7´-phosphate, as well as results from a kinetic isotope effect study suggest the involvement of an oxocarbenium ion-like transition state in OtsA catalysis (Errey et al., 2010; Lee et al., 2011). Moreover, this mechanism involves a hydrogen bonding between the leaving NDP group and the acceptor nucleophile, which allows a front-face nucleophilic attack to form a glycosidic bond with a retained stereoconfiguration. The leaving group phosphate also acts as a general base that deprotonates the acceptor nucleophile (Lee et al., 2011).

VldE, a pseudoglycosyltransferase that is involved in the biosynthesis of validoxylamine A 7´-phosphate (VDO), is highly homologous to OtsA. However,

VldE catalyzes a coupling reaction between GDP-valienol and validamine 7-

112

phosphate, both of which are pseudo-sugars, to give a product with an α,α-amino linkage – a net retention of stereochemistry (Asamizu et al., 2011). Therefore, it is tempting to speculate that VldE adopts the same SNi mechanism as has been suggested for OtsA. However, as GDP-valienol is a pseudosugar, which lacks the oxygen atom in the ring, the formation of an oxocarbenium ion in the VldE- catalyzed coupling reaction is not possible, raising a question as to how the C-N bond formation actually occurs.

In addition, our studies have shown that OtsA can only catalyze coupling reactions between UDP-glucose and glucose 6-phosphate (or to some extent validol

7-phosphate), both of which contain a C-1 hydroxy group. On the other hand VldE can only catalyze coupling reactions between GDP-valienol (or to some extent

GDP-glucose) and validamine 7-phosphate or 1-amino-1-deoxyglucose 6- phosphate (both of which contain a C-1 amino group) (Abuelizz and Mahmud,

2015). Therefore, VldE may be considered as an N-(pseudo)glycosyltransferase, as opposed to an O-glycosyltransferase as in OtsA. However, it was unclear if these differences were due to particular amino acid residues or certain topologies in the pockets that might be different between OtsA and VldE. Here, we report comparative bioinformatics and mechanistic studies of VldE and OtsA using various engineered chimeric and point mutant proteins. The results provide new insights into the molecular bases for the substrate specificity and catalytic activity of the PsGT VldE.

113

3.3. Results

3.3.1. Comparative Bioinformatic Analysis of GT and PsGT family-20

In addition to VldE, we have identified two PsGT family-20 homologues,

SalC and Amir_1997, which are involved in the biosynthesis of salbostatin in

Streptomyces albus ATCC 21838 (Choi et al., 2008) and validoxylamine A in

Actinocynema mirum DSM 43827 (Asamizu et al., 2013), respectively. Also, through a genome mining study we have identified another putative PsGT-20,

Staur_3137, from the myxobacterium Stigmatella aurantiaca DW4/3-1. Using multiple amino acid sequence alignments we compared the amino acid sequences of the PsGT-20 proteins with OtsA from E. coli, Mycobacterium tuberculosis and

Streptomyces coelicolor, and revealed a number of conserved amino acid residues that are different between these two families of proteins (Figure 3.1) The conserved amino acid residues Leu9, Lys11, Asn109, Thr135, Leu178 in the N-terminal domains of most PsGT-20 proteins are replaced with Val, Asn, His, Asn, and Gly, respectively, in OtsA. Interestingly, SalC, whose acceptor molecule is an aminosugar, is more similar to OtsA than VldE in the N-terminal domain (Figure

3.1).

114

Figure 3.1: Partial multiple amino acid alignment of VldE and other putative PsGT20 and OtsA enzymes. Conserved residues in PsGT20s are in red and those in OtsAs are in blue. Potential recognition residues for sugar vs nonsugar acceptors are highlighted in yellow. Amino acid numbering is based on the VldE protein.

In the C-terminal domains, there are at least 10 amino acid residues that are conserved in PsGT-20 proteins, but are consistently different from their corresponding residues in OtsA. Interestingly, many of these residues are located in the active site or adjacent to the amino acids that directly interact with the substrates or the products (Figure 3.2). Of particular interest were Asn325 and

Gln385, which are amongst the amino acids shown to directly interact with VDO in the X-ray crystal structures, but are replaced with Ser and Met in OtsA.

115

Figure 3.2: Superimposition of the VldE cyclitol binding sites in the presence (yellow) and absence (green) of validoxylamine A 7´-phosphate. The figure adopted from (Cavalier et al., 2012a).

3.3.2 Examination of the significance of the Asn325 and Gln385 residues for substrate specificity and/or catalytic function of VldE

X-ray crystal structures of VldE indicated that Asn325 interacts with the phosphate group of the acceptor cyclitol of VDO, suggesting that this residue helps navigate and position the substrate validamine 7-phosphate for catalysis. On the other hand, Gln385 interacts with the hydroxy groups of the donor cyclitol

(Cavalier et al., 2012a). To investigate if the Asn325 and Gln385 residues are

116

important for the substrate specificity and/or catalytic function of VldE, we generated N325S and Q385M single-point mutants of VldE and tested them against

GDP-glucose and glucose 6-phosphate (OtsA substrates) and GDP-valienol and validamine 7-phosphate (VldE substrates). Point mutations were performed following the site-directed mutagenesis protocol using VldE-pRSET-B as a template (Liu and Naismith, 2008). The sense and antisense PCR primers were designed, at the nucleotide sites that code for N325 and Q385, by changing the nucleotide sequence to code for serine and methionine, respectively (Table 3.2).

The resulting mutants VldE-N325S and VldE-Q385M were transferred and expressed in E. coli BL21 DE3 pLysS and the recombinant proteins were tested.

We found that these mutations did not change the VldE capability to recognize

GDP-valienol and validamine 7-phosphate. Moreover, the mutated proteins are not able to recognize GDP-glucose and glucose 6-phosphate, suggesting that N325 and

Q385 are not directly involved in governing the substrate specificity of the proteins

(Figure 3.3).

117

Figure 3.3: (-)-ESI-MS analysis of VldE-N325S, VldE-Q385M using GDP- valienol or GDP-glucose as sugar donor and validamine 7-P or glucose 6-P as sugar acceptor. Boiled enzymes were used as negative control. Red peaks indicates the expected product, validoxylamine A 7`-P and green peaks indicate the substrates, the GDP-valienol (m/z 600) or GDP-glucose (m/z 604).

3.3.3. Interrogating the N-terminal domain of VldE

Our recent comparative biochemical and kinetic studies using recombinant

OtsA, VldE, and their chimeric proteins (Chimera-1 and Chimera-2) with a variety of sugar and pseudosugar substrates revealed a significant role of the N-terminal domain of VldE in its PsGT activity. To locate the amino acid residues within the

118

N-terminal domain of VldE that might be important for its unique catalytic activity and/or substrate specificity, we engineered an additional chimeric protein, in which the first part of the N-terminal domain of OtsA was replaced with an equivalent fragment of VldE. From our studies on the crystal structures of VldE, we identified several differences in the tertiary structures of the N-terminal domains of VldE and

OtsA, particularly within amino acid residues 1-120. This includes the presence of a β–hairpin motif between amino acid residues 11-50, which is missing in OtsA.

Moreover, this region includes β5 and β6 strands between amino acids 88-110, which together with the β-hairpin motif (β2 and β3) showed a significant movement (10.9 °A) during the "opening" and "closing" of the catalytic site (Figure

3.4). Replacing this portion of the protein with that of VldE may alter the substrate specificity or catalytic activity of OtsA.

Figure 3.4: Conformational change of VldE using VldE•GDP•TRE crystallographic data. Residues 11-50 of the β–hairpin motif (β2 and β3) and strands β5 and β6 showed a 10.9 °A shift toward the catalytic site.

119

Using a spliced extension PCR, we constructed a chimera-3 gene, which encodes a protein in which one-half of the N-terminal domain is from VldE

(residues 1-128) and the rest is from OtsA (EA-A). The gene was cloned in the expression vector pRSET-B, which is then transferred and expressed in E. coli

BL21 DE3 pLysS. The recombinant protein was tested against GDP-valienol and validamine 7-phosphate as well as GDP-glucose and glucose 6-phosphate as substrates. The result showed that Chimera-3 could only catalyze a coupling between GDP-glucose and glucose 6-phosphate, but not between GDP-valienol and validamine 7-phosphate, suggesting that Chimera-3 is more similar to OtsA than

VldE and the first half of the N-terminal domain is not a critical determinant for the distinct functionality of VldE and OtsA (Figure 3.5).

Previously, we showed that OtsA and Chimera-2, which contains the N- terminal domain of OtsA and the C-terminal domain of VldE, were able to utilize validol 7-phosphate, a phosphorylated cyclitol compound similar to validamine 7- phosphate but lacking an amino group, as an acceptor molecule. Both VldE and

Chimera-1, which contains the N-terminal domain of VldE and the C-terminal domain of OtsA, do not accept validol 7-phosphate as substrate (Abuelizz and

Mahmud, 2015). However, with only a half of the N-terminal domain of Chimera-3 is OtsA-origin it is tempting to investigate if the protein can recognize validol 7- phosphate as substrate. Hence, we tested Chimera-3 for its activity against GDP- glucose and validol 7-phosphate. The result showed that the enzyme can in fact

120

catalyze a coupling reaction between GDP-glucose and validol 7-phosphate to produce pseudotrehalose, suggesting that amino acid residues within the second half of the N-terminal domain play a role in the substrate specificity of these enzymes (Figure 3.5).

Figure 3.5: (-)-ESI-MS analysis of chimera-3 using GDP-valienol or GDP-glucose as sugar donor and validamine 7-P, glucose 6-P or validol 7-P as sugar acceptor. Boiled enzymes were used as negative control. Red peaks indicate the expected product trehalose 6-P (m/z 421) or pseudotrehalose (m/z 419) and green peaks indicate the substrates GDP-valienol (m/z 600) or GDP-glucose (m/z 604).

3.3.4. Determining the importance of the conserved amino acid residues in the

N-terminal domains for substrate specificity

As described above, our earlier substrate specificity studies with VldE, OtsA, and their chimeric proteins revealed that the N-terminal domain of VldE is highly specific to validamine 7-phosphate (with an NH2-group) and that of OtsA is

121

specific to glucose 6-phosphate and to some extent accepting validol 7-phosphate

(with a OH-group) as acceptor substrates. Chimera-1, which contains the N- terminal domain of VldE, is able to accept validamine 7-phosphate, whereas

Chimera-2, which contains the N-terminal domain of OtsA, can utilize glucose 6- phosphate and validol 7-phosphate as (pseudo)sugar acceptors. To explore the importance of the conserved amino acid residues in the N-terminal domain for substrate selectivity, we generated three sets of site-directed mutants of VldE and

Chimera-1.

First, we generated N109H mutants of VldE and Chimera-1. This mutation is intended to explore the possibility of the involvement of H89 of OtsA in the activation/deprotonation of the acceptor sugar glucose 6-phosphate. Although such function may be performed by the diphosphate group of the NDP (Lee et al., 2011), its relatively close proximity (6 Å) to the C-1 hydroxy group of the acceptor molecule merits closer examinations. Moreover, a careful study of the bifunctional

N/O glycosyltransferase UGT72B1 revealed that the H19 residue plays a significant role in the O-glycosyltransferase activity of the protein. Point mutation of H19 to Q19 only reduced the N-glycosylation activity by two-fold but reduced the O-glycosyltransferase activity by 300-fold. It is proposed that H19 acts as a general base, abstracting the proton from the C-1 hydroxy group of the acceptor, whereas Q19 may be able to orient the substrate for catalysis but lacks the ability to abstract the proton (Brazier-Hicks et al., 2007).

122

Figure 3.6: (-)-ESI-MS analysis of VldE-N109H and Chimera1-N109H using GDP- valienol or GDP-glucose as sugar donor and validamine 7-P or glucose 6-P as sugar acceptor. Boiled enzymes were used as negative control. Red peaks indicate the expected product validoxylamine A 7`-P and green peaks indicate the substrates GDP-valienol (m/z 600) or GDP-glucose (m/z 604).

Second, we generated K11N and L178G double-mutants of VldE and Chimera-

1. These residues are the only two amino acids that are conserved in the N-terminal domains of all putative PsGT-20, including SalC. Therefore, K11 and L178 may play a role in the acceptor substrate selectivity.

Third, we generated L9V, N109H, and T135N triple-mutants of VldE and

Chimera-1. These amino acid residues are conserved in VldE, Amir_1997, and

123

Staur_3137, but are different in SalC and the OtsAs. The high similarity of SalC and OtsA in this domain is consistent with the fact that SalC utilizes 1-deoxy-2- aminoglucose 6-phosphate (a sugar substrate) as acceptor molecule. However, whether or not the conserved residues are responsible for the substrate selectivity was unknown.

Figure 3.7: (-)-ESI-MS analysis of VldE-K11N-L178G, Chimera1-K11N-L178G, VldE-L9V-N109H-T135N, and Chimera1-L9V-N109H-T135N using GDP- valieno l or GDP-glucose as sugar donor and validamine 7-P or glucose 6-P as sugar acceptor. Boiled enzymes were used as negative control. Red peaks indicate the expected product validoxylamine A 7`-P and green peaks indicate the substrates GDP-valienol (m/z 600) or GDP-glucose (m/z 604).

All mutant proteins were tested against GDP-valienol and validamine 7- phosphate as well as GDP-glucose and glucose 6-phosphate. Interestingly, despite the above alterations, the mutants did not show any change in their substrate

124

specificity; they still recognize GDP-valienol and validamine 7-phosphate as substrates to produce validoxylamine A 7´-phosphate (Figures 3.6, 3.7 and 3.8).

Moreover, as the putative acceptor substrate for SalC is a 2-amino-sugar, we tested the L9V, N109H, and T135N triple-mutant proteins using GDP-valienol and glucosamine 6-phosphate as substrates. However, no products could be observed in the ESI-MS analysis of the reactions. Combined together, the results suggest that the unique substrate specificity of VldE is not directly controlled by certain amino acid residues in the N-terminal domain but may be due to the overall topology of the domain.

Figure 3.8: (-)-ESI-MS analysis of VldE-L9V-N109H-T135N, and Chimera-1- L9V -N109H-T135N using GDP-valienol or GDP-glucose as sugar donor and glucosamine 6-P as sugar acceptor. Boiled enzymes were used as negative control. Green peaks indicate the substrates GDP-valienol (m/z 600) or GDP-glucose (m/z 604).

125

3.3.5. Examination of the significance of Asp158, His182, and Asp383 in VldE catalysis

As described above, the formation of trehalose 6-phosphate by the retaining

GT OtsA has been proposed to occur via the SNi-like mechanism involving an oxocarbenium ion transition state. However, oxocarbenium ion formation is not possible in the VldE-catalyzed coupling reaction. Therefore, it is unclear if VldE can catalyze the C-N bond formation in the same way as OtsA forms the glycosidic bond. However, we hypothesize that the olefinic moiety of GDP-valienol plays a critical role in facilitating the coupling reaction. Moreover, X-ray crystal structures of VldE in complex with validoxylamine A 7´-phosphate showed three amino acid residues, Asp158, His182 and Asp383, are located near the ligand and may be involved in the catalysis. However, these amino acids are conserved in both VldE and OtsA. In the VldE•VDO crystal structure, His182 and Asp383 interact with the donor cyclitol; His182 interacts with the C-7 hydroxy group and Asp383 interacts with the C-2 hydroxy group (Figure 3.9A). Additionally, Asp158 swings 62-83º toward the catalytic center to interact with the hydroxyls of the acceptor cyclitol in the VldE•VDO complex compared to the VldE•TRE complex (Figure 3.9B).

126

A B

Figure 3.9: Interaction between trehalose and VldE amino acid residues within the catalytic site. Shown is a trehalose (TRE) within the VldE cyclitol binding site in ribbon diagrams. Residues/molecules of interest are represented in stick models. The dotted lines mark hydrogen bonds. (A) The mesh represents the [Fo]-[Fc] electron density omit map of trehalose within the VldE catalytic site (pink). The map is contoured at 3.0s levels. Trehalose makes interactions with the backbone amides of residues Gly384, Gln385, Asn386, and Leu387 as well with the side- chains of Asp383, His182 and Arg290. (B) Shown is a superimposition of the catalytic sites of VldE•GDP•VDO model (yellow) and the VldE•GDP•TRE model (pink) in ribbon diagrams. Due to the absence of the phosphate moiety, Arg326 and Asn325 also swing out of the catalytic site. Figure adopted from (Cavalier et al., 2012a).

To examine the significance of Asp158, His182, and Asp383 in VldE catalysis, we generated three single-point mutants of VldE: D158N, H182A and

D383N. The mutant proteins were tested against GDP-valienol and validamine 7- phosphate and the products were analyzed by ESI-MS. The results showed that mutation of Asp383 to Asn did not directly affect the catalytic activity of VldE, however, replacing Asp158 with Asn or His182 with Ala completely abolished the

127

catalytic activity of VldE, suggesting that Asp158 and His182 are critical for the

VldE activity (Figure 3.10).

Figure 3.10: (-)-ESI-MS analysis of VldE-D158N, VldE-H182A, VldE-D383N and OtsA-H154A using GDP-valienol or GDP-glucose as sugar donor and validamine 7-P or glucose 6-P as sugar acceptor. Boiled enzymes were used as negative control. Red peaks indicate the expected product validoxylamine A 7`-P or trehalose 6-P (421 m/z) and green peaks indicate the substrates GDP-valienol (m/z 600) or GDP-glucose (m/z 604).

Moreover, we generated two single point mutants of chimera-1: D158N and

H182A. Interestingly, when GDP-valienol was substituted with GDP-glucose,

VldE and chimera-1 D158N and H182A mutants were able to catalyze the glycosylation reaction to give the expected hybrid product pseudo-

128

aminodisaccharide (Abuelizz and Mahmud, 2015), suggesting that Asp158 and

His182 are not essential for the coupling reaction involving GDP-glucose (Figure

3.11). This was further confirmed by replacing the corresponding His residue

(His154) in OtsA with Ala, leading to an OtsA mutant that is still able to catalyze a coupling reaction between GDP-glucose and glucose 6-phosphate (Figure 3.10).

Interestingly, in OtsA His154 has been shown to interact with the C-6 hydroxy group of GDP-glucose, and the main-chain carbonyl oxygen of His154 has been proposed to participate in catalysis by stabilizing the oxocarbenium ion transition state (Gibson et al., 2002b). The fact that the H154A mutant is catalytically active indicates that replacement of His154 to Ala still provides similar main-chain carbonyl oxygen necessary for transition state stabilization. A similar result has been observed when His154 was replaced with Asn, where the mutant protein is still active, albeit in reduced catalytic activity (Lee et al., 2011). Whereas the imidazole side chain of the His residue is not essential in the OtsA catalysis, it appears to be necessary for the VldE reaction when GDP-valienol is used as a donor molecule (Figure 3.10).

129

Figure 3.11: (-)-ESI-MS analysis of VldE-H182A, VldE-D158N, chimera1-H182A and chimera1-D158N using GDP-glucose as sugar donor and validamine 7-P as sugar acceptor. Boiled enzymes were used as negative control. Red peaks indicate the expected product and green peaks indicate the substrates GDP-valienol (m/z 600) or GDP-glucose (m/z 604).

3.3.6. 1,4-Elimination-addition may be involved in VldE catalysis

The direct involvement of the Asp158 and His182 residues in the coupling reaction between GDP-valienol and validamine 7-phosphate may implicate an acid- base reaction in the C-N bond formation with retention of stereoconfiguration.

However, the lack of direct involvement of Asp383 in the reaction ruled out the possibility of a double SN2-mechanism. Alternatively, it may be speculated that deprotonation at C-7 may initiate electron shifts, leading to a 1,4 elimination reaction (Figure 3.12C). To have this to happen, however, everything would have to line up appropriately to coordinate the deprotonation and the subsequent loss of the nucleotidyl diphosphate. Subsequently, the C-N bond formation may occur via a 1,4-addition mechanism as shown in Figure 3.12D, assuming this reaction takes

130

place faster than the possible tautomerization of the dienol to an α,β unsaturated aldehyde. Interestingly, crystal structures of VldE showed that His182 is located in the vicinity of the C-7 of GDP-valienol (M. C. Cavalier, 2012).

131

Based on the above results, we hypothesize that His182 residue acts as a general base, which may be polarized by the neighboring Asp158, and deprotonates the C-7 methylene. To investigate this possibility, we carried out enzymatic reactions of VldE with GDP-valienol and validamine-7 phosphate in D2O. The product validoxylamine A 7´-phosphate was washed multiple times with H2O and analyzed by ESI-MS. The result indicated an incorporation of a deuterium in the product with an m/z of 415. Further analysis of the product by ESI-MS/MS revealed the incorporation of deuterium in the unsaturated cyclitol moiety of the product (Figure 3.13). The results support the notion that Asp158 and His182 are involved in the catalysis by eliminating one of the C-7 methylene hydrogen, leading to a cascade of 1,4 elimination reaction that results in the release of the nucleotidyl diphosphate. Subsequently, the amino group of the acceptor molecule would attack the pseudo-anomeric carbon from the front face to form a C-N bond via a 1,4-addition mechanism. Additionally, the Asp158 residue may function to stabilize the C-7 hydroxy group to prevent rapid tautomerization of the dienol to an

α,β unsaturated aldehyde, which may hinder the 1,4-addition.

132

Figure 3.13: (-)-ESI-MS analysis of VldE using GDP-valienol as sugar donor and validamine 7-P as sugar acceptor in H2O or D2O. Boiled enzymes were used as negative controls. The m/z 414 and 415 (in red) are the expected product validoxylamine A 7´-P and deuterated validoxylamine A 7´-P, respectively. Bottom two panels show fragmentation patterns for the VldE products. The m/z 258 peak is the acceptor cyclitol daughter ion (validamine 7-phosphate).

133

3.4. Discussion

The similarity of the VldE-catalyzed reaction with that of trehalose 6-phosphate synthase (OtsA) has led to a speculation that they may adopt a similar catalytic mechanism. OtsA catalyzes a coupling between NDP-glucose and glucose 6- phosphate through an SNi-like mechanism, which involves a highly dissociative oxocarbenium ion transition state (Lee et al., 2011). VldE may utilize a similar mechanism involving an olefinic cyclitol that adopts a half-chair conformation similar to the NDP-glucose oxocarbenium ion transition state. However, no oxocarbenium ion transition state can be formed in the VldE reaction, as the pseudosugar substrate lacks the ring oxygen. This has raised a question whether or not VldE can catalyze the C-N bond formation in the same way as OtsA forms the glycosidic bond.

Comparative bioinformatics studies between PsGT-20 (VldE and its homologues) and GT-20 (OtsA from several bacteria) revealed a number of conserved amino acids residues shared between VldE and OtsA as well as those that are unique to VldE. From ten amino acid residues unique to the C-terminal domain of VldE, only two (Asn325 and Gln385) are shown in the crystal structures to directly interact with the ligands in the active site pocket. In OtsA, these residues are replaced with Ser and Met (Cavalier et al., 2012a). However, point mutation of

Asn325 and Gln385 in VldE with Ser and Met neither change the substrate specificity nor the catalytic activity of the enzyme. This result is consistent with our

134

previous finding that the C-terminal domain of VldE does not seem to play a major role in governing its PsGT catalysis. Moreover, in addition to catalyzing the coupling between GDP-valienol and validamine 7-phosphate, VldE can also couple

GDP-glucose and validamine 7-phosphate, albeit in much lower efficiency. Again, this indicates that the C-terminal domain of VldE is less specific. On the other hand, the N-terminal domain appears to be the one that is significantly affecting the substrate specificity, particularly of the acceptor molecules, which in the case of

VldE need to have a strong nucleophilic group, such as validamine 7-phosphate and

1-amino-1-deoxyglucose 6-phosphate, both of which contain a C-1 amino group

(Abuelizz and Mahmud, 2015).

Construction and characterization of Chimera-3, in which the first half of the N- terminal domain is derived from VldE (residues 1-128) and the second half is from

OtsA, shed more light on the nature and role of the N-terminal domain in the enzyme’s substrate selectivity and catalysis. We discovered that the first half of the

N-terminal domain of VldE including the unusual β–hairpin motif between amino acid residues 11-33 and β5 and β6 between amino acids 88-110 is not, or at least not by its own, a determinant factor for the VldE unique PsGT activity. We also learned that the conserved amino acid residues Leu9, Lys11, Asn109, Thr135, and

Leu178 are not directly involved in determining VldE substrate specificity and/or catalysis. Therefore, the most likely region within the protein that is directly related to its PsGT function is the second half of the N-terminal domain. In this region, in

135

addition to Thr135 and Leu178, which are unique to VldE and related PsGTs, there are other conserved amino acid residues, such as Asp158, Tyr159, and His182.

However, they are also conserved in OtsA. X-ray crystal structures of VldE and

OtsA revealed that both Asp158 and His182 are located in the vicinity of the sugar donors. However, these residues appear to be less important for OtsA catalysis, as replacing the Asp residue with Asn or the His residue with Ala did not significantly affect the activity of the enzyme. However, interestingly, similar point mutations in

VldE completely abolished the ability of the enzyme to couple GDP-valienol and validamine 7-phosphate. More surprisingly, they did not affect its ability to couple

GDP-glucose and validamine 7-phosphate. This finding suggests that: a) both

Asp158 and His182 are critical for VldE’s PsGT activity, and b) VldE catalyzes

GDP-valienol + validamine 7-phosphate and GDP-glucose + validamine 7- phosphate coupling reactions via two different mechanisms.

The involvement of Asp158 and His182 in the C-N coupling of GDP-valienol and validamine 7-phosphate strongly implicates an acid-base catalysis in the VldE

PsGT reaction. This is different from the SNi-mechanism proposed for OtsA. VldE reactions using D2O as solvent and MS/MS analysis of the product revealed the incorporation of a deuterium atom in the unsaturated cyclitol moiety (donor molecule), indicating a deprotonation and reprotonation event may have taken place during the coupling reaction. Although the exact location of this isotope exchange is unclear at this point, based on the location of Asp158 and His182

136

relative to the ligand and the position of the olefin in GDP-valienol it may be postulated that this event occurs at C-7. Deprotonation at C-7 followed by a shift of the ring olefin would lead to a 1,4-elimination of GDP. Subsequently, the C-N bond formation may occur via a 1,4-addition mechanism involving a front-face attack of the nucleophilic amino group of the acceptor molecule. It may be postulated that an oxocarbenium-like transition state geometry is an important feature for the GT/PsGT coupling reactions with retained stereoconfiguration.

Intimate hydrogen bonding between the departing GDP and the acceptor nucleophile may direct the nucleophilic attack to occur from the same face as the leaving group. To investigate whether or not the isotopic exchange occurs at C-7,

2 further study using GDP-[7- H2]valienol is necessary, as replacement of one of the deuterium atoms with hydrogen will unambiguously confirm the involvement of the 1,4-elimination/1,4-addition mechanism.

As Asp158 and His182, which are required for VldE coupling reaction, are also present in OtsA, it may be postulated that the main determinant for the VldE unique

PsGT reaction is its acceptor substrate specificity. We have shown in a previous study that VldE N-terminal domain is specific for the acceptor substrate validamine

7-phosphate, but to some extent also uses 1-amino-1-deoxyglucose 6-phosphate, which contains a C-1 amino group. On the other hand, OtsA N-terminal domain is specific for the acceptor substrate glucose 6-phosphate, but to some extent also uses validol 7-phosphate, which contain a C-1 hydroxy group. Davis and coworker have

137

shown in a bifunctional N/O glucosyltransferase, UGT72B1, that a deprotonating amino acid residue is necessary for activating the nucleophilic hydroxy group of the acceptor in the O-glycosylation but not for activating the amino group in the N- glycosylation (Brazier-Hicks et al., 2007). However, such amino acid residue appears to be inessential in the OtsA catalysis, as the departing diphosphate group may function as a base to activate the acceptor molecule. Nevertheless, we decided to investigate if any of the conserved amino acid residues within the N-terminal domain that are different between VldE and OtsA is involved in activating or selecting the acceptor molecule. However, single point mutations of those residues did not give any change it their substrate selectivity. Therefore, we propose that the distinct substrate specificity of OtsA and VldE is most likely due to the difference in topology of the proteins particularly of the second half of the N-terminal domain.

This knowledge may lead to understanding of the catalytic mechanisms of other

PsGTs, including those from other families such as the acarbose putative PsGTs

AcbS/GacS, wich are similar to glycogen synthases (GT5 family).

138

3.6. Material and methods

3.6.1. General

Low-resolution electrospray ionization (ESI) mass spectra were recorded on a ThermoFinnigan Liquid Chromatograph-Ion Trap Mass Spectrometer. Restriction endonucleases were purchased from Invitrogen or Promega. Preparation of plasmid

DNA was done by using a QIAprep Spin Miniprep Kit (QIAGEN). PfuTurbo DNA polymerase was used for amplification of the mutants. GTP, GDP-glucose and glucose 6-phosphate were purchased from Sigma. GDP-valienol, validamine 7- phosphate and validol 7-phosphate according to the published protocols (Abuelizz and Mahmud, 2015; Asamizu et al., 2011; Yang et al., 2011). The nucleotide sequences of the generated mutants were determined at the Center for Genome

Research and Biocomputing (CGRB) Core Laboratories, Oregon State University.

3.6.2 Construction of chimera-3

DNA sequences for amino acids 1-128 (384 bp) of VldE and amino acids

102-456 (1062 bp) of OtsA were amplified by PCR using overlap extension PCR technique. Fragment E was amplified from the plasmid VldE-pRSET-B using primers VldE-F and Chimera-3-R and pfu turbo polymerase, as well as, fragment A was amplified from the plasmid OtsA-pRSET-B using primers Chimera-3-F and

OtsA-R. Primers Chimera-3-F and Chimera-3-R were designed with 15 complementary base pair for overlapping (Table 3.2). Fragments E and A were

139

used as templates for a second PCR using primers VldE-F and OtsA-R. The newly synthesized PCR fragment was digested with XhoI and EcoRI and ligated into pRSET-B (Life technologies) to give pRSET-B-chimera-3. The chimera-3 gene was confirmed by DNA sequencing at the Center for Genome Research and

Biocomputing (CGRB) at Oregon State University. The confirmed mutants were then transferred to E. coli BL21 (DE3) pLysS to carry the overexpression experiment.

3.6.3. Site-directed mutagenesis

Site-directed mutagenesis of VldE, chimera-1 and OtsA was performed using the listed pair primers (N325S, Q385M, N109H, L97, K11N, T135N, L178G,

D158N, H182A and D383N) and amplified by polymerase chain reaction (PCR) using Pfu Turbo DNA polymerase. VldE-pRSET-B, OtsA-pRSETB and chimera-1- pRSET-B were used as templates. PCR amplification reactions were performed using the following conditions: 95°C denaturation for 5 min, followed by 18 cycles of 95°C for 60 s, with primer annealing and extension 68°C for 6 min. Extension for 18 min at 68°C. The PCR product was cooled to 4°C and then digested with 1

µL of DpnI at 37 ºC for 1 h. 2 µL was then transferred into E. coli DH10B and the mutants were confirmed by sequencing. The confirmed mutant DNAs were then transferred to E. coli BL21 (DE3) pLysS for overexpression and biochemical experiments.

140

3.6.4. Production and purification of side-directed mutant and chimera-3 proteins

Site-directed mutant and chimera-3 proteins were produced as N-His6 fusion proteins using pRSET-B in Escherichia coli BL21 (DE3) pLysS.

Transformants were grown overnight at 37 ºC on LB agar plate containing ampicillin (100 μg/mL) and chloramphenicol (25 μg/mL). A single colony was inoculated into LB medium (3 mL) containing ampicillin (100 μg/mL) and chloramphenicol (25 μg/mL) and cultured at 37 ºC for 6 h and this seed culture (1 mL) was transferred into a 500 mL flask containing LB medium (100 mL) containing ampicillin (100 μg/mL) and chloramphenicol (25 μg/mL), and grown at

28 ºC until OD600 reached 0.6. Then, the temperature was reduced to 18 ºC, and after 2 h of adaptation, IPTG was added to a final concentration of 0.1 mM to induce the N-terminal His6-tagged proteins. After further growth for 14 h, the cells were harvested by centrifugation (5000 rpm, 10 min, 4 ºC) and stored at -80 ºC until used. Cell pellets from 50 mL of culture were washed with binding (B) buffer

(40 mM NaH2PO4 (pH 8.0), 300 mM NaCl and 10 mM imidazole) (1 mL) and centrifuged (4000 rpm, 10 min, 4 ºC). Then, B buffer (1 mL) was added and the mixtures were sonicated (8 W, 15 s, 4 times). After centrifugation (14,500 rpm, 20 min, 4 ºC), the supernatant was purified using Ni-NTA spin column (Qiagen) at 4

ºC using washing (W) buffer (40 mM NaH2PO4 pH 8.0, 300 mM NaCl, and 20 mM imidazole) (2 x 600 μL) and elution (E) buffer (40 mM NaH2PO4 pH 8.0, containing 300 mM NaCl, and 500 mM imidazole) (500 μL). Eluted proteins were

141

dialyzed against dialysis buffer (10mM Tris-HCl pH 7.5, 0.1 mM DTT, 1 mM

Figure 3.14: SDS-PAGE of recombinant VldE, chimera-3 and mutants

3.6.5. Enzyme assays

The catalytic activity of the mutants and chimera-3 was examined using

GDP-glucose or GDP-valienol as sugar donors and glucose 6-phosphate, validamine 7-phosphate or

142

validol 7-phosphate as sugar acceptors. Each reaction contained (100 μL) donor substrate (5 mM), acceptor substrate (5 mM), protein (10 μM), MgCl2 (10 mM) and

Tris-HCl (50 mM, pH 7.5). The reaction mixtures were incubated at 30 °C and aliquots (10 μL) of the reactions were collected at 1, 2, 3, 5, and 12 h and quenched with an equal volume of MeOH and centrifuged (14,500 rpm, 5 min, 4 °C). The supernatants were analyzed by ESI-MS.

3.6.6. VldE enymatic assay in D2O

After the protein has been produced and dialyzed, it was concentrated by ultrafiltration using Amicon YM-10 (Millipore). The concentrated protein were replaced with 1 mL D2O containing (10 mM Tris-HCl pH 7.5, 0.1 mM DTT, 1 mM

MgCl2) and concentrated again for two times. Protein concentration was determined using the Bradford assay (Bio-Rad) using BSA as a standard. The reaction was done using GDP-valienol as donor substrate (5 mM), validamine 7-P as acceptor substrate (5 mM), protein (10 μM), MgCl2 (10 mM) and Tris-HCl (50 mM, pH 7.5). The reaction mixtures were incubated at 30 °C for 5 h. 2 mL H2O were added to the reaction mixture and let it stand in 4 °C for 1 h and then lyophilized. The lyophilization and dilution in 2 mL H2O were repeated 3 times.

The dried product was then diluted in 50 μL MeOH and centrifuged (14,500 rpm, 5 min, 4 °C). The supernatants were analyzed by ESI-MS.

143

3.6.7. Bacterial strains and plasmids:

Table 3.1: Bacterial strains and plasmids used in this study.

Strain/plasmid Properties/product Source/Ref

Escherichia coli - - - F ompT hsdSB (rB mB ) gal dcm (DE3) pLysS BL21(DE3) Promega (CmR) pLysS F- mcrA ∆(mrr-hsdRMS-mcrBC)φ80lacZ∆M15 E. coli DH10B ∆lacX74 recA1 endA1 araD139 ∆(ara, leu)7697 GibcoBRL galU galK λ- rspL nupG Life pRSET B N-terminal His-tagged fusion peptide Technologies pRSET-B- 1.4-kb XhoI/EcoRI chm3 fragment in pRSET B This work Chimera-3 (XhoI/EcoRI) pRSET-B- 1.4-kb BamHI/EcoRI otsA fragment in pRSET This work OtsA(Sco) B (BamHI/EcoRI) 1.4-kb XhoI/EcoRI vldE fragment in pET20b(+) (Asamizu et pRSETB-vldE (XhoI/EcoRI) al., 2011) (Abuelizz 1.4-kb XhoI/EcoRI chm1 fragment in pRSET B and pRSET-B-Chm1 (XhoI/EcoRI) Mahmud, 2015) pRSET-B-VldE- 1.4-kb XhoI/EcoRI vldE-N325S fragment in This work N325S pRSET B (XhoI/EcoRI) pRSET-B-VldE- 1.4-kb XhoI/EcoRI vldE-N325S fragment in This work Q385M pRSET B (XhoI/EcoRI) pRSET-B-VldE- 1.4-kb XhoI/EcoRI vldE-N109H fragment in This work N109H pRSET B (XhoI/EcoRI)

144

pRSET-B- 1.4-kb XhoI/EcoRI chm1-N109H fragment in This work Chm1-N109H pRSET B (XhoI/EcoRI) pRSET-B-VldE- 1.4-kb XhoI/EcoRI vldE-K11N-L178G This work K11N-L178G fragment in pRSET B (XhoI/EcoRI) pRSET-B- 1.4-kb XhoI/EcoRI chm1-K11N-L178G Chm1-K11N- This work fragment in pRSET B (XhoI/EcoRI) L178G pRSET-B-VldE- 1.4-kb XhoI/EcoRI vldE-L9V-N109H-T135N L9V-N109H- This work fragment in pRSET B (XhoI/EcoRI) T135N pRSET-B- 1.4-kb XhoI/EcoRI chm1-L9V-N109H-T135N Chm1-L9V- This work fragment in pRSET B (XhoI/EcoRI) N109H-T135N pRSET-B-VldE- 1.4-kb XhoI/EcoRI vldE-D158N fragment in This work D158N pRSET B (XhoI/EcoRI) pRSET-B- 1.4-kb XhoI/EcoRI chm1-D158N fragment in This work Chm1-D158N pRSET B (XhoI/EcoRI) pRSET-B-VldE- 1.4-kb XhoI/EcoRI vldE-H182A fragment in This work H182A pRSET B (XhoI/EcoRI) pRSET-B- 1.4-kb XhoI/EcoRI chm1-H182A fragment in This work Chm1-H182A pRSET B (XhoI/EcoRI) pRSET-B-VldE- 1.4-kb XhoI/EcoRI vldE-D383N fragment in This work D383N pRSET B (XhoI/EcoRI) pRSET-B- 1.4-kb BamHI/EcoRI otsA-H154A fragment in OtsA(Sco)- This work pRSET B (BamHI/EcoRI) H154A

145

Table 3.2: primers used in this study.

Primer name Sequence

VldE-F 5'- GGT GAC TCG AGA CAT ATG TAC AAG GTT GCA -3'

OtsA-R 5'- TAGGAATTCTCAGCCCCGCAGCGCCTCCAA -3'

Chimera-3-F 5'- GAC GCC CGC GAA GGC TGG GCC TCC TAC GAG -3'

Chimera-3-R 5'- CTC GTA GGA GGC CCA GCC TTC GCG GGC GTC -3'

VldE-N325S-F 5'- GGC ACG TAC AGT CGG GAG GGA TTC ATC -3'

VldE-N325S-R 5'- GAT GAA TCC CTC CCG ACT GTA CGT GCC -3'

VldE-Q385M-F 5'- ACT GTC GAC GGT ATG AAC CTG AGC ACG -3'

VldE-Q385M-R 5'- CGT GCT CAG GTT CAT ACC GTC GAC AGT -3'

VldE-N109H-F 5'- TGG GCG GCG AAC CAC TAC GGC TGG GAC-3'

VldE-N109H-R 5'- GTC CCA GCC GTA GTG GTT CGC CGC CCA -3'

VldE-L178G-F 5'- GAC GCG CCG ATC GGG CTC TTC GTC CAC -3'

VldE-L187G-R 5'- GTG GAC GAA GAG CCC GAT CGG CGC GTC -3'

VldE-T135N-F 5'- TTC GGC CGC TTC AAC CGC GAC TTC GCC -3'

VldE-T135N-R 5'- GGC GAA GTC GCG GTT GAA GCG GCC GAA -3'

VldE-K11N-F 5'- TTC CTC GCC AGC AAC CGC GCG GCG ATC -3'

VldE-K11N-R 5'- GAT CGC CGC GCG GTT GCT GGC GAG GAA -3'

VldE-L9V-F 5'- TCT GAG ATC TTC GTC GCC AGC AAG CGC -3'

VldE-L9V-R 5'- GCG CTT GCT GGC GAC GAA GAT CTC AGA -3'

VldE-D158N-F 5'- TAC CTC GTC CAC AAC TAC CAG CTG GTC -3'

VldE-D158N-R 5'- GAC CAG CTG GTA GTT GTG GAC GAG GTA -3'

146

VldE-H182A-F 5'- CTG CTC TTC GTC GCC ATC CCG TGG CCG -3'

VldE-H182A-R 5'- CGG CCA CGG GAT GGC GAC GAA GAG CAG -3'

VldE-D383N-F 5'- AAC TCA ACT GTC AAC GGT CAA AAC CTG -3'

VldE-D383N-R 5'- AGG TTT TGA CCG TTG ACA GTT GAG TTG -3'

OtsA-H154A-F 5'- CGG CCA CTT CTC GGC CAC GCC CTG GGC -3'

OtsA-H154A-R 5'- GCC CAG GGC GTG GCC GAG AAG TGG CCG -3'

147

3.7. References

Abuelizz, H.A., and Mahmud, T. (2015). New Insights into the Distinct Substrate Specificity and Catalytic Activity of the Pseudoglycosyltransferase VldE. Chemist & Biol.

Asamizu, S., Abugreen, M., and Mahmud, T. (2013). Comparative metabolomic analysis of an alternative biosynthetic pathway to pseudosugars in Actinosynnema mirum DSM 43827. ChemBioBhem 14, 1548-1551.

Asamizu, S., Yang, J., Almabruk, K.H., and Mahmud, T. (2011). Pseudoglycosyltransferase catalyzes nonglycosidic C-N coupling in validamycin a biosynthesis. J Am Chem Soc 133, 12124-12135.

Bruner, M., and Horenstein, B.A. (1998). Isotope trapping and kinetic isotope effect studies of rat liver alpha-(2-->6)-sialyltransferase. Biochemistry 37, 289-297.

Choi, W.S., Wu, X., Choeng, Y.H., Mahmud, T., Jeong, B.C., Lee, S.H., Chang, Y.K., Kim, C.J., and Hong, S.K. (2008). Genetic organization of the putative salbostatin biosynthetic gene cluster including the 2-epi-5-epi-valiolone synthase gene in Streptomyces albus ATCC 21838. Applied microbiology and biotechnology 80, 637-645.

Gibson, R.P., Lloyd, R.M., Charnock, S.J., and Davies, G.J. (2002a). Characterization of Escherichia coli OtsA, a trehalose-6-phosphate synthase from glycosyltransferase family 20. Acta Crystallogr D Biol Crystallogr 58, 349-351.

148

Gibson, R.P., Turkenburg, J.P., Charnock, S.J., Lloyd, R., and Davies, G.J. (2002b). Insights into trehalose synthesis provided by the structure of the retaining glucosyltransferase OtsA. Chem Biol 9, 1337-1346.

Hansen, S.F., Bettler, E., Rinnan, A., Engelsen, S.B., and Breton, C. (2010). Exploring genomes for glycosyltransferases. Mol Biosyst 6, 1773-1781.

Kim, S.C., Singh, A.N., and Raushel, F.M. (1988). Analysis of the galactosyltransferase reaction by positional isotope exchange and secondary deuterium isotope effects. Arch Biochem Biophys 267, 54-59.

Lairson, L.L., Chiu, C.P., Ly, H.D., He, S., Wakarchuk, W.W., Strynadka, N.C., and Withers, S.G. (2004). Intermediate trapping on a mutant retaining alpha- galactosyltransferase identifies an unexpected aspartate residue. J Biol Chem 279, 28339-28344.

Lairson, L.L., Henrissat, B., Davies, G.J., and Withers, S.G. (2008). Glycosyltransferases: structures, functions, and mechanisms. Annu Rev Biochem 77, 521-555.

Liu, H., and Naismith, J.H. (2008). An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol. BMC Biotechnol 8, 1472-6750.

Soya, N., Fang, Y., Palcic, M.M., and Klassen, J.S. (2011). Trapping and characterization of covalent intermediates of mutant retaining glycosyltransferases. Glycobiology 21, 547-552.

Yang, J., Xu, H., Zhang, Y., Bai, L., Deng, Z., and Mahmud, T. (2011). Nucleotidylation of unsaturated carbasugar in validamycin biosynthesis. Org Biomol Chem 9, 438-449.

149

CHAPTER FOUR

General Conclucion

Hatem A. Abuelizz

150

The pseudoglycosyltransferase VldE is structurally and functionally related to the glycosyltransferase OtsA but the former recognizes pseudosugars, instead of sugars, as substrates. This unusual catalytic capability is extremely important from a pharmaceutical standpoint, as pseudosugars or sugar mimetics play a significant role in treating diseases in humans, animals, and plants. In order to increase the utility of pseudosugar catalyzing enzymes and understand the natural evolution of their catalytic mechanism, detailed mechanistic studies of VldE was performed.

The construction of functional chimeras from VldE and OtsA from

Streptomyces coelicolor, which only share 29% amino acid sequence identity, demonstrates that both VldE and OtsA are amenable to protein engineering through domain-swapping technology. Careful biochemical and kinetic studies of recombinant VldE, OtsA, and the chimeric proteins revealed that the N-terminal domains of VldE and OtsA(Sco) are involved in the NDP-sugar preference and the selection of the acceptor substrates. The studies also showed that the VldE N- terminal domain only recognizes acceptor substrates with an amino group at C-1, such as validamine 7-phosphate and 1-amino-1-deoxyglucose 6-phosphate. This is consistent with the fact that all natural products whose formations are postulated to involve PsGTs such as VldE contain amino linkages. On the other hand, the OtsA

N-terminal domain only recognizes acceptor substrates with a hydroxy group at C-

151

1, such as glucose 6-phosphate and validol 7-phosphate. The above results confirmed that VldE, is a dedicated PsGT enzyme, not a GT enzyme with relaxed substrate specificity.

Furthermore, the knowledge gained from the kinetic studies of VldE,

OtsA(Sco) and their chimeric proteins suggest that the ring oxygen in the sugar acceptor (glucose 6-phosphate) plays a role for its higher binding affinity to OtsA and/or for the glycosylation reaction to take place efficiently. Moreover, results from point mutation experiments together with those of a chimeric protein, in which the first half of the N-terminal domain is from VldE whereas the rest of the protein is from OtsA, suggests that the topology of the second half of the N- terminal domain is responsible for the substrate specificity.

The half-chair conformation of the cyclohexene ring of GDP-valienol, which resembles the oxocarbenium ion transition state, is highly significant for the binding affinity to VldE compared to that of GDP-glucose to OtsA. Although the

VldE product validoxylamine A 7´-phosphate also contains an oxocarbenium ion- like structure, the binding affinity of the product to the enzyme is predicted to be lower than that of the substrate GDP-valienol, which has strong enzyme-GDP hydrogen-bonding interactions.

152

Our work also suggests that the PsGT VldE adopts a different reaction mechanism from that of OtsA (SNi-like mechanism). Deprotonation at C-7 by

His182 would allow an electron shift of the ring olefin leading to 1,4-elimination of

GDP. This is followed by formation of a C-N bond via a 1,4-addition mechanism, which involves a front-face attack of the acceptor’s nucleophilic amino group. The oxocarbenium ion-like transition state geometry of GDP-valienol may be important for a coupling reaction with retained stereoconfiguration.