Mitochondrial-Associated LRPPRC is Related With Poor Prognosis Potentially and Exerts as an Oncogene via Maintaining Mitochondrial Function in Pancreatic Cancer

Qiongying Hu Department of Laboratory Medicine, hospital of chengdu university of traditional chinese medicine Li Wang Department of Pancreatic Surgery, west china hospital of sichuan university Yi Zhang Department of pancreatic surgery, west china hospital of sichuan university Bole Tian Department of pancreatic surgery, west china hospital of sichuan university ziyi Zhao (  [email protected] ) Hospital of Chengdu University of Traditional Chinese Medicine https://orcid.org/0000-0003-1871- 5197 Ya Zhang Department of Endocrinology, hospital of chengdu university of Traditional chinese medicine

Primary research

Keywords: LRPPRC, autophagy/mitophagy, pancreatic cancer, mitochondrial homeostasis, chemoresistance, reactive oxygen species (ROS)

Posted Date: February 8th, 2021

DOI: https://doi.org/10.21203/rs.3.rs-171632/v1

License:   This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License

Page 1/23 Abstract

Background

The mitochondrial-associated protein LRPPRC exerts multiple functions involved in physiological processes, including mitochondrial translation, cell cycle progression and tumorigenesis. Previously, LRPPRC was reported to regulate mitophagy by interacting with Bcl-2 and Beclin 1 and thus modifying the activation of PI3KCIII and autophagy. Considering that LRPPRC was found to be negatively associated with survival rate, we hypothesize that LRPPRC may be involved in pancreatic cancer progression via its regulation of autophagy.

Methods real-time quantitative PCR was performed to detect the expression of LRPPRC in 90 paired pancreatic cancer and adjacent tissues and fve pancreatic cancer cell lines. Mitochondrial reactive oxidative species (ROS) level and function were measured. Mitophagy was measured by performing to detect LC3 level.

Results

By performing RT-qPCR, the association of LRPPRC with the prognosis of pancreatic cancer was established and pancreatic cancer tissues had signifcantly higher LRPPRC expression than adjacent tissues. LRPPRC was negatively associated with the overall survival rate. LRPPRC was also upregulated in pancreatic cancer cell lines. Knockdown of LRPPRC promoted ROS accumulation, decreased mitochondrial membrane potential (MMP), promoted autophagy/mitophagy, and induced mitochondrial dysfunction. Subsequently, knockdown of LRPPRC inhibited malignant behaviors in PANC-1 cells, including proliferation, migration, invasion, tumor formation and chemoresistance to gemcitabine. Finally, by inhibiting autophagy/mitophagy using 3-MA, the inhibitory effect of LRPPRC knockdown on proliferation was reversed.

Conclusion

Taken together, our results indicate that LRPPRC may act as an oncogene via maintaining mitochondrial homoeostasis and could be used as a predictive marker for patient prognosis in pancreatic cancer.

Introduction

Pancreatic cancer is one of the leading causes of cancer-related death and has a very low overall survival rate of approximately 5% and a median survival of less than 6 months [1]. In patients suffering from therapy failure, including induction of chemoresistance and radioresistance, distant metastasis before surgical operation has been discovered [2]. Pancreatic cancer is characterized by diverse mutations, including RAS, Smad4 and p53, and thus frequently exhibits chemoresistance [3] and insensitivity to radiotherapy [4]. Our earlier study revealed that pancreatic cancer and cancer stem-like cells (CSCs) derived from pancreatic cancer cells have higher levels of long noncoding RNAs and thus induce

Page 2/23 chemoresistance [5]. Even so, we still know little about the regulators of malignant behaviors of pancreatic cancer.

Leucine-rich pentatricopeptide repeat-containing (LRPPRC), also known as LRP130, is a member of the pentatricopeptide repeat protein family and exerts multiple functions involving homeostasis, microtubule alterations, RNA stability, DNA/RNA binding, transcriptional activity in mitochondria, metabolic processes, RNA nuclear export, tumorigenesis and tumor progression [6–10]. LRPPRC is localized to both the cytoplasm and mitochondria [8]. In the mitochondrial matrix, LRPPRC binds to single-stranded RNA and thus posttranscriptionally regulates mitochondrial and subsequently regulates mitochondrial functions [11]. In cancer progression, LRPPRC was also reported to be associated with mitochondria by interacting with Parkin and thus stabilizing Parkin substrates, including Bcl-2 and Parkin itself to inhibit autophagy, and consequently, LRPPRC protects mitochondria from autophagy degradation [12]. Knockdown of LRPPRC causes a decrease in Bcl-2, followed by Beclin 1 release to form complexes with PI3KCIII to activate basal levels of autophagy [13]. In this manner, LRPPRC acts as an autophagy/mitophagy inhibitor via maintaining mitochondrial membrane potential (MMP) and thus promoting mitochondrial function (14).

Mitochondria play essential roles in physiological processes, including energy production, cell signaling and apoptosis [15, 16]. Reactive oxygen species (ROS), as a byproduct of energy production in mitochondria, have been shown to promote protein oxidation and consequent misfolding and/or unfolding of mitochondrial localized in the mitochondrial matrix [17, 18]. Under physiological conditions, the balance between ROS accumulation and ROS scavenging is strictly regulated to avoid oxidative stress, which can regulate the mitochondrial permeability transition pore (mPTP) and thus maintain healthy mitochondrial homeostasis [13]. By considering that LRPPRC is reported to exert critical roles in maintaining MMP via regulating autophagy/mitophagy, it is supposed that LRPPRC might regulate ROS accumulation and scavenge and thus maintaining MMP. Previous reports have shown that LRPPRC may act as an oncogene in several kinds of cancer, including hepatoma, lung adenocarcinoma, esophageal squamous cell carcinoma and colon cancer [19]; however, the exact role of LRPPRC in pancreatic cancer and whether its regulatory effect on mitochondria is involved in these processes are still unclear.

In this study, we detected the expression level of LRPPRC in 90 pancreatic cancer and paired adjacent tissues and fve pancreatic cancer cell lines to investigate the relevance of LRPPRC expression. Furthermore, we also established the potential association of its regulation of mitochondrial function with the malignant behaviors of pancreatic cancer, especially cell proliferation. In conclusion, our results indicated that LRPPRC may be a critical marker for prognosis and a potential therapeutic target in pancreatic cancer.

Material And Methods Clinical tissue samples

Page 3/23 Our study included 90 patients (57 males, 33 females; mean age 61.9 years; range 36–85), were recruited from May 2010 and August 2018 after obtaining their writtern informed consent. All patients survived from 3 to 7.2 years were confrmed by telephone and mail. The study items included age, gender, tumor size, and tumor-node-metastasis stage. Patient characteristics are summarized in Table 1. Tissues were fxed in 10% formaldehyde, embedded in parafn, cut into 1.5 mm in diameter and 4 µm in thick, and mounted on a tissue microarray.

Table 1 Correlation between clinicopathological characteristics and LRPPRC expression

Total n LRPPRC P

low high

Age 0.361

≤60 40 15 25

＞60 50 20 30

Gender 0.219

Male 57 21 36

Female 33 11 22

Tumor size 0.195

≤5cm 55 21 34

＞5cm 35 12 23

N 0.016*

N0 51 21 30

N1 39 12 27

* P value for expression levels compared by Mann-Whitney test

Immunohistochemical staining

The tissue microassay were stained for immunohistochemical analysis. Microarray was baked at 60℃ for 2 h, deparafnization with xylene, and then rehydrated, after being washed three times in 1×PBS. Then, rehydrated microarray was incubated with 3% hydrogen peroxide for 10 min in methanol to inactivate endogenous peroxidase activity, and then blocked using 2.5% bovine serum albumin (BSA) dissolved in PBS against nonspecifc binding sites for 30 min at room temperature (RT). Then anti- LRPPRC antibody (diluted in 1:200; Cat. No.: ab97505; Abcam, Cambridge, England) was added for over- night incubation at 4℃. Incubated microarray was then rinsed for three times in ice-cold PBS and

Page 4/23 incubate with a horseradish-peroxidase-conjugated antibody (diluted in 1:5000; Cat. No.: ab7090; Abcam) for 1h at RT. The microarray was developed then with 3, 3’-diaminobenzidine solution for 2–5 min, washed briefy in running water and imaged under a microscope (Olympus BX51; Olympus, Japan). Immunohistochemical analysis

Staining of LRPPRC was mainly detected in the cytoplasm of tumor tissues, and slightly observed in the nucleus of tumor tissues. The ratio of positive stained cells, intensity of stained cells and staining score were reviewed independently by two pathologists without knowing the clinical features or survival status of the patients. The ratio of positive stained cells was graded as follows: 0 = staining of ≤ 1 %; 1 = staining of 1–20%; 2 = staining of 21–40%; 3 = staining of 41–60%; 4 = staining of 61–80% and 5 = staining of ≥ 81%. The intensity of stained cells was graded as follows: 0 = no signal; 1 = week signal; 2 = moderate signal; 3 = strong signal. The staining score was graded as follows: The ratio of positive stained was graded as follows: low expressing group = the ratio of positive stained cells×staining score ≤ 7.5; high expressing group = the ratio of positive stained cells×staining score༞7.5. Cell culture

The pancreatic cancer cell line Panc-1, SW1990, MIA PaCa-2, CFPAC-1 and BxPC-3 were incubated in Dulbecco Modifed Eagle Medium (DMEM, Life Technologies, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS, Sigma Chemical Co., St. Louis, MO), penicillin (100U/ml) and streptomycin

(100U/ml) (Life Technologies, Grand Island, NY, USA) at 37℃ incubator with 5% CO2. The normal human pancreatic cell line HPC-Y5 was incubated in DMEM and other supplements described above. All cells were purchased from Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China). Cell viability assays

Cells were seeded (5×103/well) in 96-well plates overnight. After the treatment of doxorubicin (--100 µM) for 24 h, 10 µL tetrazolium salt CCK-8 (Cell Counting Kit-8 [CCK-8]; Keygen, Nanjing, People’s Republic of China) was added to each well (fnal volume ratio as 10%). Optical density was measured at a wavelength of 450 nm (OD450). Western blot

The primary antibodies used was listed as followed: Rabbit monoclonal anti-LRPPRC antibody (1: 2000, #ab97505); Rabbit monoclonal anti-GFP antibody (1: 2000, #ab290); Rabbit monoclonal anti-LC3B antibody (1:1000, #ab51520); Rabbit monoclonal anti-p62 antibody (1:1000, #ab109012); Rabbit monoclonal anti- Bcl-2 antibody (1:1000, #abab32124); Rabbit monoclonal anti- Beclin 1 antibody (1:1000, #ab208612); Rabbit monoclonal anti-PI3KCIII antibody (1:1000, #ab154598); Rabbit monoclonal anti-β-actin antibody (1:5000, #ab8227). Goat anti-rabbit IgG H&L antibody (HRP ladled, 1:10000, #ab7090) was used as secondary antibody. Blot bands were quantifed via densitometry with Image J software (National Institutes of Health Baltimore, MD, USA). β-actin was used as an internal reference. To detect the cleavage of LC3-II, LC3-II in Mock + siNC group was considered as 1.

Page 5/23 JC-1 staining

Cells were briefy washed with PBS for three times and incubated with 10 µM of JC-1 (Life Technologies, Grand Island, NY, USA) at 37℃ avoiding from light for 15–30 min. Supernatant was removed and 2ml PBS containing 5 µg of DAPI was added into cultured cells for 5-min incubation at 37℃ avoiding from light. Then, cells were re-washed with PBS for three times and imaged using a fuorescence microscope (X71, Olympus, Melville, NY). ATP detection

Cells were washed with ice-cold PBS and resuspended in detection buffer supplemented with 0.22M sucrose, 0.12 M mannitol, 40 mM Tricine, pH7.5, and 1mM EDTA. After 5-min incubation on ice, sample was analyzed using Optocomp I BG-1 luminometer (GEM Biomedical Inc.) using the ATP Bioluminiscent Assay kit (Sigma) following the manufacturer’s instruction. RT-qPCR

Total RNA was reverse-transcripted into cDNA using an Reverse Transcriptase Kit (RIBOBIO, Guangzhou, China). Syber Green Master Mix (Life Technologies) was employed and analyzed the relative expressing levels in a ABI7500 system (Applied Biosystems, Foster City, CA, USA) under the following conditions: 95℃ 10min, 60 cycles of 95℃ 15s, and 60℃ 1min. The specifc primers used were followed: LRPPRC, 5’-CTGCACTGTGCTCTTCAAGC-3’ and 5’-GACTGCACACTACCGAAGCA-3’; β-actin, 5’- AGCCATGTACGTAGCCATCC-3’ and 5’- CTCTCAGCTGTGGTGGTGAA-3’; COX I, 5’- GGAGCAGTATTCGCCATCAT − 3’ and 5’- CGACGAGGTATCCCTGCTAA − 3’; COX 3, 5- GAACATACCAAGGCCACCAC-3’, 5’-TAATTCCTGTTGGGGGTCAG-3’ and 5’- -3’; ND1, 5’- CTCCCTATTCGGAGCCCTAC-3’ and 5’- GGAGCTCGATTTGTTTCTGC-3’; Cyb, 5’- GTCGGCGAAGAAAAATGTGT-3’ and 5’- AAGCTGCTCACAGAGGGGTA-3’. Staining of mitochondria

For labeling cells with a mitochondrial marker, 2 mL of DMEM medium with 10% FBS containing 100 nM Mitotracker Green/5 ug of DAPI per well at 37°C for 30 min. Prior to imaging, the labeling medium was removed and replaced with fresh DMEM medium with 10% FBS and imaged with a fuorescence microscope ROS staining

Cells were seeded on 6-well plates and cultured with 10 µM 2′,7′-dichlorodihydrofuorescein diacetate (DCFH-DA) (Beyotime, Wuhan, China) for 30 min at 37 ℃ avoiding from darkness. After 3 washes with ice-cold PBS, cells were imaged using a fuorescence microscope at 488 nm excitation and 525 nm emission wavelengths. Cell cycle analysis

Page 6/23 Cells were suspended and washed with ice-cold PBS to remove left medium. Cells were fxed with ice-cold 70% ethanol overnight at 4℃. Then cells were stained with propidium iodide (PI) staining buffer (100 µg/ml RNase A and 40 µg/ml PI in PBS) for 15 min in dark. Then cells were analyzed by 3 laser Navios fow cytometers (Beckman Coulter, Brea, CA, USA). Apoptosis analysis

Cells were suspended and washed with ice-cold PBS to remove left medium. Cell pellet was resuspended in 1×binding buffer and stained with 5 µl fuorescein isothiocyanate-labeled Annexin V at 4℃ for 30 min in the dark. Then 10 µl of PI was added at 4℃ for 5 min in the dark. Then cells were analyzed by fow cytometry using 3 laser Navios fow cytometers (Beckman Coulter, Brea, CA, USA). Migration and invasion

2.5×105 cells were seeded in a 6-well plate and allowed for attaching overnight. The scratch was made with a sterile 10-µl pipette tip. 0 and 24 h later, images were taken.

5×103 cells were seeded into upper chamber (8-µm pore size; Corning Inc., Corning, NY. USA) coated with Matrigel (Sigma–Aldrich, St. Louis, MO, USA). 24-hour later, chamber was fxed with 4% paraformaldehyde and stained with 0.25% crystal violet (Sigma–Aldrich). Colony formation and tumor formation

2×103 Cells were seeded on six well-plates and maintained in medium containing FBS for 10–14 days until visible clones appeared. For staining of colonies, 500 µL of Giemsa solution (Keygen, Nanjing, China) was added into each well and incubated for 30 min and removed followed by 3 washes using PBS.

For performing colony formation in soft agar, each well of a 6-well plate contained 2 mL of 0.5% (w/v) low-melting agar (Sigma–Aldrich, St. Louis, MO, USA) in DMEM medium with 10% FBS was laid in each well. Suspended cells were mixed equally, and 5×103 cells in 2 mL of 0.3% low-melting agar in 10% FBS were added above the polymerized base solution. Plates were incubated (37℃, 5% CO2) for 14 days before colony number and diameter were quantifed microscopically. Real-Time Cellular Analysis (RTCA)

The xCELLigence RTCA system was employed to monitor the real-time proliferation. The RTCA Station was maintained put in 37°C, 5% CO2 incubator 1 h followed by the manufacturer’s instruction. For each group, cell viability was analyzed in 4 replicate wells. Statistical analysis

All statistical analyses were performed using the SPSS version 16.0 software package (SPSS Inc. Chicago, IL, USA). A paired samples t test was used to analyze the differences between the pancreatic cancer samples and the paired adjacent noncancerous tissue samples. Associations between LRPPRC

Page 7/23 expression and clinicopathological characteristics were analyzed by the Mann–Whitney test and the Kruskal–Wallis test. Survival curves were estimated using the Kaplan-Meyer method, and the log rank test was used to calculate differences between the curves. A probability level of 0.05 was chosen for statistical signifcance.

Results

The expression level of LRPPRC is upregulated in clinical samples of pancreatic cancer and related cell lines

LRPPRC expression was determined by performing immunohistochemistry in 90 pancreatic cancer samples and paired adjacent samples. The number of LRPPRC-positive cells in pancreatic cancer tissues (97.0 ± 9.6%) was signifcantly higher than that in paired adjacent tissues (57.0 ± 17%, P < 0.01). The staining intensity of LRPPRC in pancreatic cancer tissues (1.6 ± 0.3) was signifcantly higher than that in paired adjacent tissues (1.2 ± 0.2, P < 0.05). Consequently, the difference in LRPPRC staining between these paired tissues was statistically signifcant (P༜0.001) (Fig. 1A & B). To evaluate the relationship between LRPPRC expression and the prognosis of pancreatic cancer, the Kaplan-Meyer method was employed to perform the overall survival analysis. The staining score ≤ 7.5 was considered as low LRPPRC, and ༞7.5 was considered as high LRPPRC. As illustrated in Fig. 1C, the pancreatic cancer patients whose tumors had high levels of LRPPRC had signifcantly shorter survival than those with no or low levels of LRPPRC (P < 0.001). To confrm whether a similar expression pattern of LRPPRC exists in pancreatic cancer cell lines, LRPPRC in pancreatic cancer cell lines, including PANC-1, SW1990, MIA PaCa-2, CFPAC-1 and BxPC-3, was compared with that in the pancreatic nontumor cell line HPC-Y5. As expected, both the mRNA and protein levels of LRPPRC in pancreatic cancer cell lines were signifcantly higher than those in HPC-Y5 cells (Fig. 1D & E). For further in vitro experiments, PANC-1 was selected for its high endogenous LRPPRC level. LRPPRC potentially inhibits the basal level of autophagy in PANC-1 and BxPC-3 cells

It was recently reported that in cancer development, LRPPRC associates with mitochondria and thus regulates mitophagy/autophagy [13, 20], which prompted us to explore whether LRPPRC in pancreatic cancer cells is associated with endogenous cleavage of LC3. Considering that all pancreatic cancer cells present high levels of LRPPRC, PANC-1 and BxPC-3 cells were selected for further experiments after efcient LRPPRC knockdown (Fig. 2A). In PANC-1 and BxPC-3 cells, knockdown of LRPPRC obviously increased the number of GFP-LC3 puncta (Fig. 2B), and cleaved GFP-LC3-II was also observed to be increased after LRPPRC knockdown (Fig. 2C).

Considering that LRPPRC regulates the basal level of autophagy via modifying mitochondrial membrane potential (MMP) [12], we further analyzed the MMP by performing JC-1 staining. As presented in Fig. 3A, both LRPPRC knockdown and rapamycin treatment obviously increased the green fuorescence intensity

Page 8/23 of JC-1 monomers (green), suggesting that knockdown of endogenous LRPPRC has a detrimental effect on MMP, which represents mitochondrial dysfunction. To determine whether endogenous LRPPRC is related to mitochondrial function, refected by ATP synthesis, mitochondrial DNA copy number, mitochondrial mass and mitochondrial transcriptional activity, cells after LRPPRC knockdown were employed for further analysis. As shown in Fig. 3B, knockdown of endogenous LRPPRC signifcantly decreased ATP synthesis, which was similar to that of the rapamycin-treated group. By detecting mitochondrial gene expression, it was observed that without affecting nuclear gene CDPK3 expression, knockdown of LRPPRC and rapamycin exposure decreased the transcriptional activity of mitochondria (Fig. 3C). Further analysis of mitochondrial mass and DNA copy number also showed that knockdown of LRPPRC obviously attenuated the function of mitochondria (Fig. 3D & E). To further confrm whether the effects of LRPPRC on mitochondrial homeostasis are wiedely existed in pancreatic cancer cells, we employed BxPC-3, which obviously expressing LRPPRC (Fig. 1E). As shown in supplement Fig. 1, expectedly, knockdown of LRPPRC presented a detrimental effect on MMP, and decreased ATP synthesis, mitochondrial ADNA copy number and mitochondrial transcriptional activity.

Mitochondrial dysfunction is the main source of ROS accumulation [18]. This led us to detect cellular ROS, and the results expectedly showed that knockdown of LRPPRC and exposure to rapamycin obviously increased ROS accumulation (Fig. 3F). Taken together, our data indicated that endogenous LRPPRC tightly regulates MMP, mitochondrial function and mitochondrion-related ROS accumulation. The effects of LRPPRC on malignant behaviors in PANC-1 cells

It is well known that mitochondrial dysfunction regulates the basal level of autophagy/mitophagy and thus regulates the malignant behavior of tumors [21]. The effects of mitochondrial dysfunction caused by knockdown of LRPPRC on malignant behaviors in PANC-1 cells are not fully understood. Considering that knockdown of LRPPRC induces ROS accumulation, which is potentially the main cause of mitochondrial dysfunction, the ROS scavenger NAC or MitoQ10 was employed after LRPPRC knockdown. As shown in Fig. 4A, LRPPRC knockdown signifcantly inhibited S phase entry of the cell cycle, which was reversed by the addition of both NAC and MitoQ10. Knockdown of LRPPRC failed to affect apoptosis and caspase-9 protein cleavage, which is necessary for mitochondrial-dependent apoptosis, indicating that the regulation of basal autophagy/mitophagy by LRPPRC is not necessary for cell survival without stress (Fig. 4B & C).

Then, we also examined the effects of LRPPRC on malignant behaviors in PANC-1 cells, including migration, invasion and colony formation. As shown in Fig. 4D, E, F & G, knockdown of LRPPRC obviously inhibited malignant behaviors, and thus effect could be reversed by scavenging ROS. Taken together, LRPPRC might regulate malignant behaviors via exerting metabolic processes. LRPPRC desensitizes PANC-1 cells to gemcitabine via inhibiting ROS accumulation induced by gemcitabine

Page 9/23 Gemcitabine, the main drug of choice for pancreatic cancer patients [22, 23], promotes ROS accumulation and thus induces apoptosis, at least in part [24]. Thus, we examined the effect of LRPPRC on chemosensitivity to gemcitabine. The CCK-8 assay illustrated that knockdown of LRPPRC signifcantly sensitized PANC-1 cells to gemcitabine, which could be reversed by pretreatment with both NAC and MitoQ10, demonstrating that LRPPRC induced desensitization potentially via reducing ROS accumulation (Fig. 5A). To examine whether ROS scavengers maintained MMP decreased by knockdown of LRPPRC, JC-1 staining followed by fow cytometry was carried out, and as expected, both NAC and MitoQ10 helped to maintain MMP (Fig. 5B). The result of apoptotic induction in response to treatment with 1 µmol/L gemcitabine for 24 h showed that knockdown of LRPPRC increased gemcitabine-induced apoptosis, which was reversed by ROS scavengers (Fig. 5C).

To further confrm whether LRPPRC-regulated ROS accumulation is responsible for gemcitabine sensitivity, we frst detected that ROS accumulation was obviously promoted after knockdown of LRPPRC and pretreatment with ROSUP or H2O2 (Fig. 5D&E). Notably, LRPPRC knockdown slightly affected ROS level, which indicates its slight effect on endogenous ROS level without gemcitabine treatment. Induction of apoptosis by knockdown of LRPPRC was similar to the effects of ROS accumulation in response to both ROSUP and H2O2 treatment (Fig. 5F). Notably, ROSUP or H2O2 treatment failed to obviously promote apoptosis in LRPPRC-knockdown PANC-1 cells, indicating that LRPPRC may mainly regulate gemcitabine sensitivity by modifying ROS levels (Fig. 5F). LRPPRC regulates cell proliferation mainly via inhibiting mitophagy/autophagy

Considering that LRPPRC inhibits the basal level of mitophagy/autophagy by interacting with Bcl-2 [12] and Beclin-1 [23, 25, 26], subsequently activating PI3KCIII [10, 11], we transiently knocked down LRPPRC, Bcl-2, Beclin 1, and PI3KCIII by transfecting cells with specifc siRNAs. In addition, 3-MA, an autophagy inhibitor, was employed to inhibit autophagy induced by LRPPRC knockdown. As shown in Fig. 6A, knockdown of LRPPRC signifcantly increased the cleavage of GFP-LC3, which was reversed by the addition of 3-MA, indicating that LRPPRC plays a critical role in inhibiting mitophagy/autophagy. Consistently, LRPPRC was also found to be critical for ATP synthesis via inhibiting mitophagy/autophagy (Fig. 6B). To determine whether the LRPPRC-modifed basal level of mitophagy/autophagy is critical for its regulatory roles in proliferation, cell cycle analysis and real-time cell proliferation assays were performed after LRPPRC knockdown with or without 3-MA addition. As expected, cell cycle blockade in response to LRPPRC knockdown was obviously reversed by the addition of 3-MA (Fig. 6C), and the proliferation inhibition in response to LRPPRC knockdown was partially reversed by the addition of 3-MA, indicating that LRPPRC-regulated mitophagy/autophagy is critical for its role as a tumor promoter (Fig. 6D).

Discussion

Page 10/23 Pancreatic cancer is one of the leading causes of cancer-related death worldwide [27]. Despite the characteristics of pancreatic cancer, such as poor prognosis, late diagnosis and metastasis, the high rate of chemoresistance is one of the leading reasons for poor prognosis [28]. Gemcitabine is the only frst- line chemotherapeutic for pancreatic cancer patients and exhibits only a 12% tumor response rate [28]; the median survival with gemcitabine treatment is still a dismal 5.65 months with a 1-year survival rate of 18% [29]. In the current study, we used pancreatic cancer cells as a cell model to investigate the molecular mechanism of chemoresistance to gemcitabine. Our results demonstrated that LRPPRC exerted protective effects against gemcitabine in pancreatic cancer cells. LRPPRC dramatically promoted PANC-1 cell survival, proliferation, migration, and invasion and improved mitochondrial function. This study is among the frst to report the regulatory roles of LRPPRC in mitochondrial homeostasis and mitochondrial function in human pancreatic cancer cells. Further, we supplied solid evidence to suggest that LRPPRC is upregulated and tightly associated with a low 5-year survival rate. LRPPRC also increased the proportion of cancer cells in G1/G0 cell cycle phases and inhibited cell death (mainly apoptosis). Thus, LRPPRC could be further investigated as a promising target of pancreatic cancer.

LRPPRC tightly regulates the progression of cell cycle phases probably via regulating mitochondrial function and mitophagy. Previous studies have shown that in cancer progression, LRPPRC interacts with Beclin 1 and Bcl-2 and forms a ternary complex to maintain Bcl-2 stability [12, 13], resulting in the maintenance of mitochondrial homeostasis and mitochondrial function. Expectedly, knockdown of LRPPRC causes a decrease in Bcl-2, followed by Beclin 1 release to form complexes with PI3KCIII to activate basal levels of autophagy [12]. In our study, we found that knockdown of LRPPRC, Bcl-2, Beclin 1, and PI3K or blockage of autophagy with 3-MA decreased autophagy/mitophagy and ATP synthesis. Here, we observed signifcant promotion of cell proliferation after LRPPRC knockdown, which was reversed by the addition of 3-MA; the regulatory mechanism by which LRPPRC regulates cell proliferation is potentially associated with LRPPRC-regulated autophagy/mitophagy, as suggested by other studies [30]. Accordingly, we hypothesized that LRPPRC may regulate malignant behaviors, including migration, invasion and chemosensitivity, by regulating mitochondria.

Pancreatic cancer cells, which are characterized by rapid growth and proliferation, require elevated metabolism, biosynthesis and energy production [31]. Mitochondrial homeostasis and function are essential for physiological processes and energy production. LRPPRC is well known as a regulator of mitochondrial function in cancer progression that acts by interacting with mitochondrial-related proteins, including Beclin 1 and Bcl-2, thus activating PI3KCIII [12, 13]. Overexpressed LRPPRC maintains mitochondrial homeostasis by interacting with Beclin 1 and Bcl-2 and maintains mitochondrial membrane potential [12, 13]. In this study, we observed a similar phenomenon in our pancreatic cancer cell line, where LRPPRC expression was relatively high and mitochondrial membrane potential, mitochondrial ATP synthesis and malignant behaviors were attenuated by LRPPRC knockdown. Increased autophagy/mitophagy in response to LRPPRC knockdown also inhibited malignant behaviors, which could be reversed by the addition of 3-MA, demonstrating that the regulation of autophagy/mitophagy mediated by LRPPRC is potentially critical.

Page 11/23 LRPPRC is a widely expressed protein in human tissues and is deeply involved in metabolic processes. The dysfunction of LRPPRC can cause , French-Canadian type (LSFC), a human disorder characterized by neurodegeneration and cytochrome c oxidative defciency [9]. It was also found to be tightly associated with tumor progression. Vandin and colleagues reported that in ovarian cancer patients, mutations in LRPPRC were found to reduce the survival of patients [32]. In prostate cancer, Jiang and colleagues reported that LRPPRC was expressed at a much higher level compared to that in adjacent tissue and positively correlated with tumor grade, metastasis and serum PSA. These results prompted us to determine whether the expression level of LRPPRC was associated with pancreatic cancer. Expectedly, by performing tissue scanning, it was observed that both the ratio of positively stained cells and the intensity of stained cells in pancreatic cancer tissue presented a higher expression level of LRPPRC in cancer cells compared to that in adjacent tissue, indicating its potential roles in cancer progression.

Conclusion

In this study, we show that LRPPRC is highly expressed in pancreatic cancer cells and negatively correlated with survival rate. We also demonstrated that LRPPRC regulated autophagy/mitophagy and maintained mitochondrial function. Consequently, LRPPRC promoted malignant behaviors and chemoresistance in pancreatic cancer cells. Therefore, LRPPRC may act as an oncogene by protecting mitochondria from autophagy/mitophagy-mediated degradation.

Declarations Acknowledgments

Thanks Dr Tao Hong (Sichuan University) for helping in language editing

Ethical Approval

The experiments were approved by the Medical Ethics Committee of the Shanghai Outdo Biotech Company.

Consent for publication

Not applicable.

Availability of data and material

All data and material are available and contained in this manuscript

Page 12/23 Competing interests

There is no confict of interests confrmed by all authors.

Funding

This study was supported by the Fundation of Science & Technology Department of Sichuan Province (2019YJ0034) and National Natural Science Foundation of China (82074298).

Authors' contributions

Ya Zhang and Ziyi Zhao analyzed and interpreted the patient data. Qiongying Hu, Li Wang, and Yi Zhang performed the cellular relative experiments. Qiongying Hu and Bole Tian contributed to experiment design, supervision and manuscript writing. All authors read and approved the fnal manuscript.

Data Availability

The data used to support the fndings of this study are available from the corresponding author upon request.

Disclosure

Li Wang is the frst author, Bole Tian, Ziyi Zhao and Qiongying Hu are co-corresponding authors. Yi Zhang is coauthor.

References

[1] R. Siegel, Naishadham D.andJemal A., "Cancer statistics, 2012," CA Cancer J Clin, vol. 62, no. 1, pp. 10- 29, 2012.

[2] M. L. Rossi, Rehman A. A.andGondi C. S., "Therapeutic options for the management of pancreatic cancer," World J Gastroenterol, vol. 20, no. 32, pp. 11142-11159, 2014.

[3] J. J. Kim and Tannock I. F., "Repopulation of cancer cells during therapy: an important cause of treatment failure," Nat Rev Cancer, vol. 5, no. 7, pp. 516-525, 2005.

[4] Q. Huang, Li F., Liu X., Li W., Shi W., Liu F. F., O'Sullivan B., He Z., Peng Y., Tan A. C., Zhou L., Shen J., Han G., Wang X. J., Thorburn J., Thorburn A., Jimeno A., Raben D., Bedford J. S.andLi C. Y., "Caspase 3- mediated stimulation of tumor cell repopulation during cancer radiotherapy," Nat Med, vol. 17, no. 7, pp. 860-866, 2011.

Page 13/23 [5] L. Wang, Dong P., Wang W., Huang M.andTian B., "Gemcitabine treatment causes resistance and malignancy of pancreatic cancer stem-like cells via induction of lncRNA HOTAIR," Exp Ther Med, vol. 14, no. 5, pp. 4773-4780, 2017.

[6] N. S. Ghiso and Lennon G. G., "lrp130 gene assigned to 2," In Vitro Cell Dev Biol Anim, vol. 30A, no. 11, pp. 744, 1994.

[7] N. Tsuchiya, Fukuda H., Sugimura T., Nagao M. and Nakagama H., "LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1," Eur J Biochem, vol. 269, no. 12, pp. 2927-2933, 2002.

[8] S. Mili and Pinol-Roma S., "LRP130, a pentatricopeptide motif protein with a noncanonical RNA- binding domain, is bound in vivo to mitochondrial and nuclear RNAs," Mol Cell Biol, vol. 23, no. 14, pp. 4972-4982, 2003.

[9] V. K. Mootha, Lepage P., Miller K., Bunkenborg J., Reich M., Hjerrild M., Delmonte T., Villeneuve A., Sladek R., Xu F., Mitchell G. A., Morin C., Mann M., Hudson T. J., Robinson B., Rioux J. D.andLander E. S., "Identifcation of a gene causing human defciency by integrative genomics," Proc Natl Acad Sci U S A, vol. 100, no. 2, pp. 605-610, 2003.

[10] M. Michaud, Barakat S., Magnard S., Rigal D.andBaggetto L. G., "Leucine-rich protein 130 contributes to apoptosis resistance of human hepatocarcinoma cells," Int J Oncol, vol. 38, no. 1, pp. 169-178, 2011.

[11] B. Ruzzenente, Metodiev M. D., Wredenberg A., Bratic A., Park C. B., Camara Y., Milenkovic D., Zickermann V., Wibom R., Hultenby K., Erdjument-Bromage H., Tempst P., Brandt U., Stewart J. B., Gustafsson C. M.andLarsson N. G., "LRPPRC is necessary for polyadenylation and coordination of translation of mitochondrial mRNAs," EMBO J, vol. 31, no. 2, pp. 443-456, 2012.

[12] J. Zou, Yue F., Jiang X., Li W., Yi J.andLiu L., "Mitochondrion-associated protein LRPPRC suppresses the initiation of basal levels of autophagy via enhancing Bcl-2 stability," Biochem J, vol. 454, no. 3, pp. 447-457, 2013.

[13] J. Zou, Yue F., Li W., Song K., Jiang X., Yi J.andLiu L., "Autophagy inhibitor LRPPRC suppresses mitophagy through interaction with mitophagy initiator Parkin," PLoS One, vol. 9, no. 4, pp. e94903, 2014.

[14] N. W. Blackstone, "The impact of mitochondrial endosymbiosis on the evolution of calcium signaling," Cell Calcium, vol. 57, no. 3, pp. 133-139, 2015.

[15] C. Wang and Youle R. J., "The role of mitochondria in apoptosis*," Annu Rev Genet, vol. 43, pp. 95- 118, 2009.

[16] N. G. Larsson, "Somatic mitochondrial DNA mutations in mammalian aging," Annu Rev Biochem, vol. 79, pp. 683-706, 2010.

Page 14/23 [17] K. Niforou, Cheimonidou C.andTrougakos I. P., "Molecular chaperones and proteostasis regulation during redox imbalance," Redox Biol, vol. 2, pp. 323-332, 2014.

[18] D. B. Zorov, Juhaszova M.andSollott S. J., "Mitochondrial reactive oxygen species (ROS) and ROS- induced ROS release," Physiol Rev, vol. 94, no. 3, pp. 909-950, 2014.

[19] T. Tian, Ikeda J., Wang Y., Mamat S., Luo W., Aozasa K.andMorii E., "Role of leucine-rich pentatricopeptide repeat motif-containing protein (LRPPRC) for anti-apoptosis and tumourigenesis in cancers," Eur J Cancer, vol. 48, no. 15, pp. 2462-2473, 2012.

[20] H. Y. Zhang, Ma Y. D., Zhang Y., Cui J.andWang Z. M., "Elevated levels of autophagy-related marker ULK1 and mitochondrion-associated autophagy inhibitor LRPPRC are associated with biochemical progression and overall survival after androgen deprivation therapy in patients with metastatic prostate cancer," J Clin Pathol, vol. 70, no. 5, pp. 383-389, 2017.

[21] L. E. Drake, Springer M. Z., Poole L. P., Kim C. J.andMacleod K. F., "Expanding perspectives on the signifcance of mitophagy in cancer," Semin Cancer Biol, vol. 47, pp. 110-124, 2017.

[22] E. G. Chiorean, Von Hoff D., Wan Y., Margunato-Debay S., Botteman M.andGoldstein D., "Performance status dynamics during treatment with nab-paclitaxel plus gemcitabine versus gemcitabine alone for metastatic pancreatic cancer," Cancer Manag Res, vol. 10, pp. 1389-1396, 2018.

[23] D. D. Von Hoff, Ervin T., Arena F. P., Chiorean E. G., Infante J., Moore M., Seay T., Tjulandin S. A., Ma W. W., Saleh M. N., Harris M., Reni M., Dowden S., Laheru D., Bahary N., Ramanathan R. K., Tabernero J., Hidalgo M., Goldstein D., Van Cutsem E., Wei X., Iglesias J.andRenschler M. F., "Increased survival in pancreatic cancer with nab-paclitaxel plus gemcitabine," N Engl J Med, vol. 369, no. 18, pp. 1691-1703, 2013.

[24] G. K. Patel, Khan M. A., Bhardwaj A., Srivastava S. K., Zubair H., Patton M. C., Singh S., Khushman M.andSingh A. P., "Exosomes confer chemoresistance to pancreatic cancer cells by promoting ROS detoxifcation and miR-155-mediated suppression of key gemcitabine-metabolising enzyme, DCK," Br J Cancer, vol. 116, no. 5, pp. 609-619, 2017.

[25] J. Zou, Li W., Misra A., Yue F., Song K., Chen Q., Guo G., Yi J., Kimata J. T.andLiu L., "Correction: The viral restriction factor Tetherin prevents leucine-rich pentatricopeptide repeat-containing protein (LRPPRC) from association with Beclin 1 and B-cell CLL/lymphoma 2 (Bcl-2) and enhances autophagy and mitophagy," J Biol Chem, vol. 294, no. 13, pp. 5211, 2019.

[26] J. Zou, Li W., Misra A., Yue F., Song K., Chen Q., Guo G., Yi J., Kimata J. T.andLiu L., "The viral restriction factor tetherin prevents leucine-rich pentatricopeptide repeat-containing protein (LRPPRC) from association with beclin 1 and B-cell CLL/lymphoma 2 (Bcl-2) and enhances autophagy and mitophagy," J Biol Chem, vol. 290, no. 11, pp. 7269-7279, 2015.

Page 15/23 [27] R. L. Siegel, Miller K. D.andJemal A., "Cancer Statistics, 2017," CA Cancer J Clin, vol. 67, no. 1, pp. 7- 30, 2017.

[28] A. M. Storniolo, Enas N. H., Brown C. A., Voi M., Rothenberg M. L.andSchilsky R., "An investigational new drug treatment program for patients with gemcitabine: results for over 3000 patients with pancreatic carcinoma," Cancer, vol. 85, no. 6, pp. 1261-1268, 1999.

[29] J. H. Lu, Shi Z. F. and Xu H., "The mitochondrial cyclophilin D/p53 complexation mediates doxorubicin-induced non-apoptotic death of A549 lung cancer cells," Mol Cell Biochem, vol. 389, no. 1-2, pp. 17-24, 2014.

[30] X. Li, Lv L., Zheng J., Zhou J., Liu B., Chen H., Liang C., Wang R., Su L., Li X.andFan D., "The signifcance of LRPPRC overexpression in gastric cancer," Med Oncol, vol. 31, no. 2, pp. 818, 2014.

[31] S. Bhattacharya, Pal K., Sharma A. K., Dutta S. K., Lau J. S., Yan I. K., Wang E., Elkhanany A., Alkharfy K. M., Sanyal A., Patel T. C., Chari S. T., Spaller M. R.andMukhopadhyay D., "GAIP interacting protein C- terminus regulates autophagy and exosome biogenesis of pancreatic cancer through metabolic pathways," PLoS One, vol. 9, no. 12, pp. e114409, 2014.

[32] F. Vandin, Clay P., Upfal E.andRaphael B. J., "Discovery of mutated subnetworks associated with clinical data in cancer," Pac Symp Biocomput, pp. 55-66, 2012.

Figures

Page 16/23 Figure 1

The expression of LRPPRC in pancreatic cancer tissues and cell lines A. Immunohistochemical staining was performed to detect the expression levels of LRPPRC in pancreatic cancer tissues compared to adjacent tissues. B. The ratio of positive stained cells (%, P＜0.01, vs. adjacent tissue, n=90), intensity of stained cells (P＜0.01, vs. adjacent tissue, n=90) and staining score (P＜0.001, vs. adjacent tissue, n=90) were presented by scatter plot of LRPPRC expression levels in 90 primary pancreatic cancer tissues. C. Kaplan-Meier postoperative survival curve for patterns with pancreatic cancer and LRPPRC expression was presented to demonstrate the correlation between survival time and LRPPRC level in 90 primary pancreatic cancer patients. The mRNA (D) and protein (E) levels of LRPPRC in pancreatic cancer cells were detected and normalized to pancreatic non-tumor cells (P＜0.05, vs. HPC-Y5).

Page 17/23 Figure 2

LRPPRC potentially inhibited basal level of autophagy/mitophagy in PANC-1 cells. A. After introduction of shRNA targets to LRPPRC, protein level of LRPPRC was measured by western blot to confrm the efcient knockdown. B. The localization of cleaved GFP-LC3-I and II were imaged. C. The cleavage of GFP-LC3 was further confrmed by western blot to detect GFP-LC3-I/II with the presence of autophagy inducer, rapamycin. D-F. Western blot was performed to detect the expressing levels of endogenous LC3-II and P62 with or without the presence of BAF. *P＜0.05, vs. Mock group.

Page 18/23 Figure 3 knockdown of LRPPRC regulated MMP, mitochondrial function and ROS accumulation. A. After knockdown of LRPPRC and exposure to rapamycin for 24 h, JC-1 staining was performed. JC-1 aggregates (red), monomers (green) and nucleus (blue) were observed to observe the mitochondrial homeostasis. After knockdown of LRPPRC and exposure to rapamycin ATP synthesis was measured (B), transcriptional levels of COX 1, COX 3, ND1, Cyb and CDPK3 were quantitatively analyzed (C), mitochondrial DNA content were quantitatively analyzed (D), mitochondrial mass was measured by performing mitotracker green staining (E), and ROS accumulation was stained by performing DHCF-DA (F), to confrm its effects on mitochondrial function and mass. *P＜0.05, vs. shScrambled group; #P＜0.05, vs. Mock group.

Page 19/23 Figure 4

Knockdown of LRPPRC regulates malignant behaviors potentially via induced ROS A. To detect the effect of LRPPRC on the distribution of cell cycle phases, PI staining followed by fow cytometry was measured. B. To detect the effect of LRPPRC on the cell apoptosis, Annexin V-FITC/PI double staining followed by fow cytometry was performed. C. Elisa was performed to measure caspase-9 protein level. D. Scratch assay was performed to detect migrating capacity affected by LRPPRC protein. E. after plating 5000 or 10000 cells, transwell assay was performed to detect invasive capacity affected by LRPPRC. Tumor formation on plats or in soft agar was also measured to present the effects of LRPPRC on tumor formation ability (F & G).

Page 20/23 Figure 5

Knockdown of LRPPRC sensitized PANC-1 cells to gemcitabine via promoting ROS accumulation A. CCK- 8 assay was performed to detect gemcitabine sensitivity after LRPPRC knockdown. *P＜0.05, vs. shScrambled group; #P＜0.05, vs. shLRPPRC-1/2 group. B. JC-1 staining was performed followed by fow cytometric assay to detect the effect of LRPPRC on mitochondrial membrane potential. C. Annexin V- FITC/PI double staining was performed to detect apoptosis after LRPPRC knockdown with or without

Page 21/23 NAC and MitoQ10 supplement. *P＜0.05, vs. shScrambled group; #P＜0.05, vs. shLRPPRC-1/2 group. D. ROS level was measured after LRPPRC knockdown with or without NAC pretreatment. E. ROS level was measured after LRPPRC knockdown with or without ROS inducers. F. Annexin V-FITC/PI double staining was performed to detect apoptosis with pretreatment of ROS inducers.

Figure 6 knockdown of LRPPRC inhibited cell proliferation via promoting autophagy/mitophagy. A. after knockdown of LRPPRC, Bcl-2, Beclin 1 or PI3KCIII, respectively, protein levels were detected by performing western blot, to determine the potential effects of LRPPRC on regulating LC-3 cleavage. To reveal the effects of LRPPRC, Bcl-2, Beclin 1 and PI3K on mitochondrial function, ATP synthesis was detected (B). *P＜0.05, vs. siScrambled group, cell cycle phases were measured by performing PI staining followed by fow cytometric assay (C), real-time cell proliferation assay was performed (D).

Supplementary Files

This is a list of supplementary fles associated with this preprint. Click to download.

supplement.editingcertifcate.pdf

Page 22/23 supplement.ethicsapproval.pdf

Page 23/23