€)-t- o\
Genetic localisation and molecular characterisation of genes for inherited ataxias
A thesis submitted for the degree of Doctor of Philosophy to the Uníversity of Adelaide by
Kathryn Louise Friend (BSc)
School of Medicine Department of Paediatrics, Womerls and Children s Hospital Adelaide
July 2000
i Addendum
Page iv; line 5: ARGF should read AGRF
Page 21-; Change 4Í a" last patagraph to read: The identification of a disease causing mutation Tttiulty allows the assessment of mutations in this gene in other families with identical clinical symptoms. Identification of additional mutations will indicate genetic heterogeneity / homogenerty and further, provides appropriate confirmation of carier s tatus, presymptomatic and prenatal diagnosis
Page 30; lines 9,L0,1L: Replace (AGC)" with (CAG)"
Page 32; line L1: Replace Becher er al. 1997 with Irkeuchi et al. j.995
Page 35; end of line 25: Add - Anticipation was originally thought to be an artefact of Sgcertfn_ment (Peruose 1'945) and although the identification of triplet repeats identified a biological explanation it is possible that the apparent anticipÃtion seen in some families may still be due to ascertainment bias.
Page 39; line 25: Replace inheritance with phenotype
Page 40; end of last line: Add - (reviews; Hackam et aI. 1998; Paulson 1999; see Table ü-s)
Page 54; line 3: Replace an with and
Page 61; line 91: Replace are with of
Page 79;line 1: Table 3-2 should read Table 3-6
Page 93; line L: Replace exclude with EXCLUDE
Page 95; lines 28 and 29; Replace a strong hint of linkage with linkage
Page'l'1'4; line 5: After undeterrrined., add - Sporadic cases of FHM may not be due to genetic defect.
Page1,27; line 16: Replace (Table 5-1a) with (Table S-3)
Page 1,31,; line 24: Replace (Table S-9) with (Table S-Z)
last paragraph with - In summary, the xperiments and RED assay failed to give be responsible for the symptoms in S-CA
Page1,68;1ine 12: Replace is with are Page 181; line 25: Add The individual in which the homozygous expansion at the FRDA locus was detected was subsequently deemed to have typical FRDA with later onset.
Page 201.; ltne7 Add - Ikeuchi T, Koide R, Onodera O, Tanaka H, Oyake M, Takano FI, Tsuji S Dentatorubral-pallidoluysian atrophy (DRPLA). Molecular basis for wide clinical features of DRPLA. Clin Neurosci \995;3(1):23-7
Page 209; line 4 Add - Penrose LS The problem of anticipation in pedigrees of dystrophia myotoníca. Arìn Eugenics1'4:\25 -132.
Response to reviewers comments
Page 71,; Response to reviewer - Assumption of equal allele frequencies does not significantþ change lod scores attained thus it is valid to use equal allele frequencies.
Page 92; Response to reviewer - The individual in question is coded as unlcrown for linkage analysis has phenotype which can be attríbuted to a car accident thus it is more valid to assign an urilmowïr phenotype rather than to assume this person to be a phenocopy.
Pages 1.05,1.07; Response to reviewer - It is acknowledged that there are at least three loci for FHM. The intention of the candidate is to highlight the phenotypic heterogeneity for the CACNALA gene and to question whether other genes will be involved in these disorders with similar phenotypic heterogerreity.
Page 109; Response to reviewer - Penetrance refers to expression of symptoms rather than variability of phenotype. Thus, in these pedigrees the penetrance is complete although the phenotype may vary.
Page\L2; Response to reviewer - All othet affected individuals in EA-2 family (family 1) have episodic ataxia and no migraine. Individual III.1 has only migraine and thus most likely represents a variant phenotype. Given the early onset of episodic ataxia and the áge of this individual (33 years old) it ís not likely that this individual is presymptomatic, although it is possible that IIL1 may develop episodic ataxia.
Acknowledgments
I wish to thank all my colleagues in the Depattment of Cytogenetics and Molecular Genetics (WCH) for their ongoing support and friendship during these studies. In particular I thank: Marie Mangelsdorf for friendship, moral support, useful discussions and advice, meals at the pub late in the everring and pouring acrylamide gels at the end of the day; Hilary Phillips, Robyn Wallace and Georgina Hollway for their friendship, useful discussions and organisation of the microsatellite primer dilutions; Jo Crawford" Agi Gedeon, Oliva Handt, Sonia Dayans, Merran Finnis, Llmne Hobson, Scott Whitmore, Elizabeth Baker, Helen Eyre Erica Woollatt and Rosalie Smith for their friendship, words of wisdom and advice and good cheer during these studies - it was always a pleasure to share my working day with these people. I also wish to thank my supervisors Rob Richards and Grant Sutherland for discussions and critical appraisal of this thesis, John Mulley for useful and helpful discussions on linkage analysis and Liz Thompson for advice and proof reading of clinican aspects of this thesis. I thank the various clinicians, particularþ Drs E. Haan, G Suthers and E. Thompson and Ms S. White, for collecting family material and making it available for our use, and to the families themselves for their co-operation. I thank my parents for their encolüagement, support and love during these studies. Most importantly, I wish to sincereþ thank my husband, best friend and colleagae,lozef. Gecz lor his undying patience, love, inspiratiorç words of encouragement and support and always useful and informative discussions. And fi.,ully to our delightful daughter, Ellen, for her 40 minute naps which made finishing off this thesis take longer than I anticipated, and for her wonderful smiles which made me realise that it didn't matter.
iii List of abbreviations The following list contains abbreviations used throughout the thesis: A adenosine Ab antibody ADCA autosomal dominant cerebellar ataxia ARGF Australian Genome Researdr Facility BAC bacterial artificial chromosome Blast Basic local align:rrent search tool bp base pair C cytosine cDNA complementary DNA CEPH Centre d'Etude de Polymorphism Humain CHCL Cooperative lfuman Linkage Centre cM centiMorgan dATP deoxy adenosine triphosphate dCTP deoxy cytosine triphosphate dGTP deoxy guanosine triphosphate DIRECT Direct identification of repeat expansions cloning technique DM myotonic dystrophy DNA deoxyribonucleic acid DRPLA Dentatorubral pallidoluysian atrophy dTTP deoxy thymidine triphosphate EA-1 episodic ataxia type 1 EA-2 episodic ataxia type2 EST expressed sequence tags FHM familial hemiplegic migraine FRDA Friedreich ataxia HD Huntington fisease IMVS Institute for Medical and Veterinary Science IOSCA Infantile onset of spinocerebellar ataxia LCL lymphoblast cell line Mb megabase MDE mutation detection enhancement MJD Machado-Joseph disease MRI magnetic reson€rnce i-ug-g NCBI national centre for biotechnology information NPCA non progressive cerebell,ar ataxia PAC PL artificial chromosome PCR polymerase chain reaction PIC polymorphic information content RACE rapid amplification of cDNA ends RED repeat expansion detection RFLP restriction fragment length polymorphism SBMA spinal-bulbar muscular atrophy scA (1-L0) spinocerebellar ataxia (1-10) SNP single nucleotide polymorphism sscA/P single strand conformation analysis / polymorphism URL uniform resource locatíon WB western blot WCH Women's and Childrerfs Hospital YAC yeast artificial chromosome
iv SUMMARY:
Inherited ataxias are genetically and clinically heterogeneous. They can be divided into several categories based on the following: inherited ataxias resulting from metabolic dysfunctiorç congenital ataxias, early onset ataxias and late onset ataxias. The last three groups, that is, the congenital, early and late onset ataxias are those which were examined in detail in this thesis.
The congenital ataxias or non-progressive congenital ataxias (NPCAs) can be divíded into two groups, syndromal and pr;re. Although several gene localisations for the syndromal forms were lcrown when this study commenced no localisations for the pure NPCAs had been identified. DNA from a large family (PKS0248) segregating NPCA was collected and the gene localised by tinkage to the short arm of chromosome 3 (*itt a maximum two point lod score of 4.26 at 0:0 for D3S3630), Recombinant events in the family map the gene to an
18.9cM region distal to D3S1304. This represents the first genetic localisation for an autosomal dominant pure congenital ataxia. The candidate genes within this region are; inositol 1,4,5 -tiphosphate receptor type L (ITPRI), neural cell adhesion molecule (CALL) and plasmacytoma - associated neuronal glycoprotein (PANG), although these ate yet to be screened for mutations. It is anticipated that a mutation will be detected in one of these genes thus enabling molecular diagnosis for NPCA.
The early onset ataxias include Friedreich ataxia, episodic ataxias and several cerebellar ataxias with distinct associated syndromal features. Nonsense mutations in CACNALA (a calcium charurel subunit) have been shown to cause episodic ataxia type 2 (EA-2). Interestingly, it has also been found that mutations in the same gene cause a late onset ataxía, SCA6, and familial hemiplegic migraine (FHM). Two mutations were identified in the CACNALA geneduring the course of these studies. The first of these was identified in a family with familial hemiplegic migraine. The mutation characterised in this family had been previously identified and reported in several other families and thus confirmed that this mutation was recurrent. The second mutation, identified in a family segregating Í.or EA-2, was a novel missense mutation in exon 32 of the CACNAI,A gene. This mutation represents the first missense mutation described for EA-2. It is intriguing that one individual in the family inherits the mutation and accompanying 'affected' haplotype but experiences
V migraine alone, with no apparent symptoms of EA-2. This finding expands the spectrum of mutations shown to be responsible for EA-2.
The final section of the thesis deals with the late onset spinocerebellar ataxias. This group of ataxias is the most genetically heterogeneous with eleven localisations identified by linkage
studies. The genes for seven of these have been characterised and the majority shown to be due to expansions of a normally polymorphic (CAG)n repeat, which is translated to a polyglutamine tract. The exception to this is SCA8, where the expanded (CTG)1 repeat is thought to be located in the 3' untranslated region of the associated gene although this assignment has been challenged (Stevanin et al. 2000, Worth et al. 2000). Two families with SCA were examined in this study in an attempt to identify the disease causing mutation. Neither family had expansions of the trinucleotide repeats at the characterised SCA loci (ie SCA'1,2,3,6,7,8 and DRPLA). The genetic localisations for SCA4, SCAS, SCA10 and SCA11 were excluded in the larger of the two families (PK80237), indicating that this represents an additional SCA locus. A genome screen was subsequentþ undertaken to localise the gene segregating in this family (PK80237). Due to the small number of affected individuals in this family, the gene localisation was unsuccessful. Chromosomal regions whidr were unable to be excluded include chromosomes 4, 7, I and 14. EXCLUDE analysis of affected only haplotypes indicates chromosomes 8 and 14 to be the most likeþ positions. From the available literature and including this family, there could be at least 16 loci for the genetically heterogeneous late onset autosomal dorrinant cerebellar ataxias.
Alternate additional strategies were employed in an attempt to identify the gene segregating in this family (PK80237). The methods which were applied were the repeat expansion detection assay (RED assay), identification of proteins containing polyglutamine repeat expansion by hybridisation with specific antibodies (Ab-1C2), and screening of (CAG)tt
positive CDNA clones to identify a novel expansion. None of these approaches succeeded in identifying a novel (CAG)n repeat expansion suggesting that either a small expansion may
be responsible for the disorder or that a different type of mutation may be invloved. Additionally, !28 sporadic and familial cases of SCA were screened for novel expansions at 14 different (CAG). positive cDNA clones, again with no new expansions detected.
These same L28 cases were also screened for expansions at the characterised SCA loci (SCA'J,,2,3,6,7,8 andDRPLA) and at the Friedreich ataxia (FRDA) locus in order to identify the disease causing mutations in these affected individuals. Of the familial SCA cases 17%
Vi (N:3) were determined to have expansions at the SCA1 locus, while 6% (N=L) have expansions at the SCA3/MJD locus. Assessment of the sporadic cases revealed 4% (N=4) to have expansions at the SCA1 locus, 3% (N:3) expansions at the SCA3/MJD locus while L expansion was detected at each of the FRDA and SCAZ loci. Overall 22% (N:4) of familial
cases had detectable mutations while only 10% (N=9) of all cases were able to be confirmed molecularþ. Thus, for the cases tested the majority remain molecularly undiagnosed. These results highlight the genetic heterogeneity within familial cases of late onset SCAs and stress the importance of detecting additional genes for the genetic classification and diagnosis of the SCAs.
vll CONTENTS Page
Statement of Declaration tl
Acknowledgments lll
Abbreviatione iv
Summary v
Contente vlll
Chapter 1 : LITERATURE REVIEW
I LINKAGE TO IDENTIFICATION OF GENE ! 1l INHERITED ATAXIAS 22
Chapter 2 MATERIAL AND METHODS 44
Chapter 3 CONGENITAL ATAXIA 63
Chapter 4 EARLY ONSET ATAXIAS 702
Chapter 5 LATE ONSET ATAXIAS 1.21
Chapter 6 REPEAT EXPANSION DETECTION ASSAYS 142
ClrapterT SCREENING OF (CAG)n POSITTVE cDNA CLONES L62
Chapter I SPINOCEREBELLAR ATAXIA FREQUENCY ANALYSIS 778
Chapter 9 CONCLUSION t9t
viii REFERENCES 195
APPENDIX I : Two point lod scores (Congenital ataxias - Chapter 3) 2L9
APPENDIX II : Two point lod ecores (Late onset ataxias - Chapter 5) ool¡
APPENDIX III : Two point lod scores (Late onset ataxias - Chapter 5) 236
APPENDD( IV: Published paper 241
Detection of a novel missense mutation and second recurrent mutation in the CACNA1A gene in individuals with EA-z and FHM. Kathrlm L Friend, Denis Crinunins,Thanh G Phan, Carolyn M Sue 3, Alison Colley, Victor SC Fung, ]ohn GL Morris, Grant R Sutherland, Robert I Richards'
APPENDIX V : Paper for submission to Neurology 242
Comprehensive Screening of Australian SCApatients reveals prevelence of SCA1 (CAG)n repeat expansions. K Friend, K Boundy, E Haan, D Burrows, E Thompson and RI Richards.
APPENDD( VI : Paper in preparation 2s7
Localisation of Autosomal Dominant Pure Congenital ataxiato Chromosome 3p. K, Friend, T. Dudding and RI Richards
lx Chapter f.i DIAGNOSIS TO GENE IDENTIFICATION Page SUMMARY ,
i.l Linkage analysis ,
i.1.1 Two point analysis for computation of lod EcoÍies 4 i.7.2 Multipoint analysis 4 i.1.3 Exclueion mapping 5
i.2 Tools for linkage analysis 5
i.2.1 Molecular tools 5
i.2.l.l Mini and microsatellite markers 6 i.2.1.2 Single nucleotide polymorphisms (sNPs) I
i.2.2 Pedigree structure and clinical information 9
i.2.2.7 Clinical information 9 i.2.2.2 Pedigree atructure 10
i.3 Identification of the disease gene t7
i.3.1 Positional cloning 77 i.3.2 Functional cloning 72 I.J.J Candidate gene approach t2 i.3.4 Positional candidate approach 13 i.3.5 Database screening - in silico positional candidate approach 74 i.3.6 Traditional methods of transcript identification 15
i.4 Distinctive features 77
r.5 Exclusion of candidat€ g€ne 77
i.6 Mutation detection 18
i.6.1 Single strand conformation aasay (SSCA) 18 i.6.2 Heteroduplex analysie 79 i.6.3 Denaturin gff empetature gradient gel electrophoresis 79 i.6.4 Chemical mismatch cleavage L9 i.6.s Direct sequencing 20
i.7 Verification of mutation 20
1 CHAPTER l.i:
DIAGNOSIS TO GENE IDENTIFICATION SUMMARY
The identification through phenotype of a discrete genetic entity allows clinical diagnosis to be made. The molecular characterisation of the gene for that inherited disorder enables laboratory confirmation of clinical diagnosis and permits accurate genetic testing of other famity members for presymptomatic status, prenatal diagnosis (if appropriate) or carrier status. Discovery of the disease causing gene and subsequent detection of the spectrum of associated mutations can lead to the delineation of the functionally important domains within the gene.
The objective of this research is to further characterise the genetic basis in families and individuals with both inherited and apparent sporadic forms of ataxia. Several families with both late onset and early/congenital ataxia, together with a large number of apparently sporadic cases with late onset ataxia were studied to identify the undetlying genetic defect. The background into the procedures used for the identification of a disease gene (Chapter 1.i) and the currerrt lmowledge of inherited ataxias (Ctrapter 1.ü) is reviewed. i.l Linkage analysis
Linkage analysis enables the gene responsible for a primarily monogenic disease phenotype to be mapped to a defined position on one of the 23 pairs of human chromosomes. The fundamental mathematical theory enabling linkage to be established comPares the number of recombinants to the number of non recombinants in a family at a given locus. When a marker segregates independentþ of the disease gene (eg is on another chromosome) the probability of the marker and disease segregating togethet is 50% for each potentially informative meiosis. When a genetic marker is shown to be linked to a disease gene the distance between them or the recombination fraction (0) is less than 50% or 0.5. The object
of linkage analysis is to show that the deviation from 50% recombination is statistically significant. Figure i-1 demonstrates the principles of a marker linked and unlinked to a disease phenotype for an autosomal dominant disorder.
2 a
13,14 14,15
14,16 13,15 14,15 14,15 14,14 13,14 13,14 15,16
ilt
15,16 13,14 14,15 13,14 14,15 13,16 14,16
b
13,14 14,'t5
14,16 14,15 13,15 14,'t5 13,14 14,14 13,14 15,16
ilr
13,16 14,14 14,15 13,14 13,15 13,16 14,'t6
o,l affected female, affected male o,¡ normal female, normal male
Figure i-1: Principles of linkage. ln situation a all atfected individuals inherit the allele 13, while in scenario b, allele 13 segregates independantly of disease status and thus, the disease locus is unlinked to this microsatellite marker. (Alleles 13,14,15 and 16 refer to AC repeat copy number for this marker)
3 i.1.1 Two point analyeis for computation of lod Ecores
Two point linkage analysis compares the segregation of the disease gene to one genetic marker. Computer programs (eg MLINK from the LINKAGE package) allow the rapid computation of lod scores from family data (Lathrop and Lalouel 1984). These programs apply the basic theory of the relative ratio of non recombinants to recombinants to evaluate the likelihood (L) of recombination in a family under a given set of parameters. The coûrmon (base 10) log of the likelfüood ratio (ie log1gl,(0)/L(0.5), where 0 varíes between
0.0 and 0.5) is lcþwn as the lod score (Z).
A lod score (Z) between the disease gene and a particular genetic marker of greater or equal to +3 demonstrates linkage. Conversely, a value (Z) of less than -2 excludes that locus. The lod score is calculated over a range of recombination fractions (0) from 0 to 0.5 and when the maximum lod score exceeds +3 the test of linkage is significant and the location of the disease gene from a genetic marker may be determined (Ott 1991-). The lod scotes from several families may be added together provided that the disease is genetically homogeneous.
Factors which need to be taken into consideration when calculating lod scores include:- mode of iriheritance, frequency of disease locus, penetrance values (if the disease in question has incomplete penetrance) and frequency of alleles for markers used in the analysis, i.1.2 Multipoint mapping
When a region of linkage is indicated by two point linkage analysis the benefits of multipoint linkage analysis may be two-fold. Multipoint analysis allows the computation of a location score for the disease locus taking into account genotypes of several adjacent marker loci simultaneously.
1. The multipoint analysis can increase the percentage of infotmative meioses as information from more than one locus is considered. Thus, multipoint analysis may achieve a higher lod score (converted from location scores generated by multipoint analysis) than attainable with two point analysis. Caution should be observed when using this approach for the analysis of multifactorial disorders since the estimates of (0) may be inflated (Risch
1ee0). 4 2. Placement of the disease gene is achieved in an interval between two markers, with odds which can be compared with those for placement in the most likely interval. As the disease locus is moved and compared to markers within the region of positive lod scores the highest lod score with tespect to these markers is calculated thus refining localísation. i.1.3 Exclusion mapping
A complete genome screen may be necessary to identify the genetic localisation of a disorder. Occasionally, after such coverage, no single region of linkage (ie lod scores above +3) is evident. There may instead be several regions which are indicative of linkage (ie positive lod scores, but less than +3). In these instances the EXCLUDE program (Edwards 1987) may be applied to indicate regions of no linkage and to highlight the region or regions of potential linkage. Regions which do not show evidence of linkage can subsequentþ be disregarded. Those genetic localities suggestive of linkage can be anaþsed further with additional markers to demonstrate or exclude linkagø by multipoint analysis, therefore enabling the genetic location of a disease Sene to be established. i.2 Tools for linkage analyeis i.2.1 Molecular tools
In order to conduct linkage analysis it is necessaty to be able to follow genetic markers through a family. In the early L980s markers lcrown as restriction fragment l"tgth polymorphisms (RFLPs) were utilised. RFLPs are due to non deleterious single base changes which can be detected by the ensuing creation or destruction of a restriction enzyme recognition site. These markers could be used to follow transmission of loci in farrilies with inherited disorders (Kan et aI.1978, Gusella et al. 1.983). Th" construction of genetic maPs of RFLPs enabled the localisation of genetic traits (Donis-Keller et al. 1987).
There are several disadvantages with using RFLPs. The procedure is laborious involving Southern analysis and subsequent hybridisation, acquisition of results is slow - usually taking one to two weeks to attairU large amounts of genomic DNA are needed for the analysis to take place and probes used in the analysis need to be distributed throughout the scientific community.
5 The advent of PCR and the ongoing efforts of the Fluman Genome Project have provided immense and irnmediate resources enabling the process of linkage analysis and eventual gene identification to be greatly simplified and become moÌe efficient (review - Borsani et al.
1,ee8). i.2.7.7 Mini and microsatellite markers
Within the human genome there are a vast number of interspersed repetitive DNA sequences. M*y of these repetitive elements consist of small repeat blocks generally of 2-10 repeat units. The smaller repeat units eg di, tri and tetra nucleotide repeats are normally polymorphic in repeat copy number, as aÍe the longer variable number of tandem repeats (VNTRs) (|effreys et al. L9S5). The specific group of (AC)r, dinucleotide repeats have proved to be exceptionaþ useful for genetic linkage analysis. It is estimated that 50 - 100 000 blocks of (AC)r. repeats exist within the human genome (Weber L989).
Features of these microsatellite markers whidr make them parti.olutly useful as genetic markers are:
1. High polymorphic _information content (PIC): :- In general longer, uninterrupted repeats are more polymorphic than shorter, intermpted repeats. The terms polymorphic irrformation content (PIC) and heterozygosity relate to the infonnativeness of a marker. The high* the PIC value, the more likely it is that a marker will be informatíve when assessed in a family. Markers with low PIC values may provide less information regarding the segregation of that particular region of DNA. Figure i-2 illustrates the segregation of an (AC) repeat marker in a pedigree.
2. Ease of application :- Microsatellite (AC)r. repeats differ from one another by virtue of the copy number of the repeat unit. Primers are designed from the unique sequence flanking the (AC)r, repeat. PCR products are then able to be amplified from genomíc DNA isolated from family members (eg blood samples). The optimal size for PCR products is between 100-250 bp. Two base pair differences from PCR products of this size are easily resolved on denaturing polyacrylarnide gels enabling the segregation pattern for a particular marker to be detersrined.
6 allele 15 14 13
lanel 2 3 4 5 6 7 I
13,14 14,15
13,15 14,15 13,15 14,14 13,14 13,14
O, n femate, mate
Figure i-2: Analysis of an AC microsatellite repeat marker through a kindred. Alleles 13, 14, and 15 represents 13, 14, and 15 copies of the repeat unit respectively. These alleles are transmitted through the family in a mendelian fashion. (Multiple bands (2) are seen per allele, these are due to the ditferent DNA strands, referred to as stuttering)
7 3. Construction of comprehensive genetic maps:- A comprehensive genetic map using AC repeat microsatellite polymorphic markers has been developed (Gyapay et al. 'J.gg4, Dib et al. 1996). Analysis of segregation and recombination between microsatellite markers within CEPH pedigrees allows the assignment of genetic distances. These large multigeneration pedigrees are available to the scientific community and provide a valuable resource for linkage mapping. These rricrosatellites have been placed along the chromosomes by virfue of recombination with one another. Markers whidr do not recombine or have a low incidence of recombination are genetically closer together than those markers which recombine more readily.
The unit of genetic distance is the Morgan (M); 1 cM (centMorgan) is on average equivalent, in physical distance to approximately LMb (megabase) of DNA and geneticalTy, Lo/o recombination (Donis-Keller et al.1987). Th" recombinatiory or genetic distance does not necessarily reflect the physical distance. Certain regions of chromosomes are often associated with different rates of recombination. Recombination rates also differ between females and males. In generat telomeric regions exhibit higher rates of recombination while centromeric regions have comparably lower rates of recombination for the same physical distance (Mohrenweiser et al. L998).
i.2.L.2 Single nucleotide polymorphisms (SNPo)
While the analysis of AC repeats is deemed to be quick and easy, it is still relatively time consuming. Automated methods, utilising fluorescent label and automated genot¡>ers have reduced the manual labour involved and greatþ decreased tumover time for an errtire genome scïeen. This technology, however, still requires the use of electrophoresis and additionally, this automation comes at a price often beyond the means of most molecular laboratories.
Perhaps the greatest advance and the mapping data which is likely to replace the microsatellite approach in the near future is that of biallelic marker, although the cost of this new automation procedure is at present still too exPensive for the majority of laboratories. These single nucleotide polymorphisms (SNPs), whle not dissimilar to RFLPs, can be analysed very quickly and efficiently. Large numbers can be assessed, off-setting their relatively lower heterozygosity as compared with microsatellites. SNPs occur approximately every 1 in 1000 base pairs (Cooper et al. 1985) *d it is estimated that a I map of 700-900 moderateþ polymorphic SNPs is equivalent to the current 300-400 microsatellite map (Kruglyak 1997). Prototype genotyping chips (high density variation - detection DNA chips) have been developed which allow simultaneous typing of large numbers of SNPs and these have been used to construct a genetic map indicating the location of over 2000 SNPs. Thus, with the aid of the vast quantity of sequencing data generated by the Human Genome Project and the ease of reading these two allelic results with rapidly developing automated microchip technology, in the near future mass genotyping will be achieved with the analysis of SNPs (Chee et al. 1996, W*g et al. 1998). i.2.2 Pedigree etructure and clinical information
Another important element in mapping a disorder by linkage analysis is accurate phenotype inforrrration and pedigtee strucfure. Given that the genetic localisation of a disease locus relies on this information it is imperative that it is correct. i.2.2.1 Clinical information
Any discrepancies or clinical anomalies should be noted and taken into consideration. Individuals with uncertain phenot¡re can be factored into the analysis as either unlcnown affection status or with varying liability or penetrance values assigned.
Situations which may influence and dictate the use of penetrance/liability values in the linkage analysis are :
1. Variable phenotype:- disparate degrees of either progression and or severity of the disease. In many disorders there can be wide deviation in clinical presentation.
2. Late onset disease:- individuals in later generations of a family and not yet exhibiting the disease phenot¡re. It is important to reduce the number of samples from patients who are not of age when symptoms may be apparent. Inclusion of such non penetrant individuals may reduce the power of linkage results obtained. Affected only analysis, or the use of liability classes can be used to accommodate variable age of onset.
Particularly with late onset disorders, sample collection from younger unaffected family members incurs the problem of presymptomatic diagnosis and should be avoided unless appropriate genetic counselJing is soughf prior to collection of samples.
9 i.2.2.2 Pedigree structure
Family relationships should be well documented to reduce potential discrepancies and problems in the linkage analysis. Fortunately this problem is aided by the high degree of heterozygosity of microsatellite markers commonly used in typing families. Potential misinformation regarding genealogical relationships of individuals and also non-paternity are usually detected rapidly with the analysis of these markers.
Pedigrees need to be large enough to allow accurate assignment of linkage. Linkage information from smaller pedigrees may only allow exclusion from candidate localisations. Alternatively, if the phenotype is clinically homogeneous linkage results from several pedigrees may be added together to increase the chance of detection of linkage (results from these families, expressed as lod scores, are additive). It is imperative in these cases that the
disease condition is genetically homogeneous.
Affected pedigrees should contain enough informative meioses to yield a lod score of greater or equal to 3. Greater information will be attained from families w'ith more potentially informative meioses. Computer programs such as SLINK (Weeks et al. 1990) enable the researcher to simulate linkage analysis in a pedigree. This programme estimates the probability of detecting linkage in a given family, quickly determining whether a family has sufficient informative meioses to enable linkage to be established.
Another important feature is to have few inferred haplotypes thereby enabling the phase of genetic markers to be more easily assigned. The more complete the pedigree structure the greater the irrformation retrieved. Outlying family members can be extremely important, however, in delimiting the disease localisation once linkage is confirmed.
10 i.3 Identification of the disease gene
Once the genetic localisation is ascertained the identification of the gene involved in causing the symptoms is the next goal. There are several different strategies which may be followed, The tactics utilised depend on the following factors:- 1. Size of the region of interest 2. Availability of cloned genomic DNA of the region of interest 3. Availability of sequence of the region of interest 4. Functional leowledge of disease locus 5. Characterisation of similar disease genes, inhuman or model organisrrs
i.3.1 Positional Cloning
Positional cloning does not reþ on any lcrowledge of the gene in question, This method relies heavily on chromosomal aberrations to pinpoint disrupted genes or on linkage data from numerous families to physically reduce the region which needs to be screened. This approach relies on the availability and/or generation of cloned genomic DNA (eg YAC, BAC and PAC libraries) and systematically subcloning and walking with the ultimate aim to identify potential transcripts in the region (Ramsay 1994, Ioarunou et aL 1994, Collins !995, Kim et aI. 1996). This method is particularþ laborious and if to be undertaken refinement of a small physical distance is essential for progress to be made.
M*y of the early genes which were cloned by this technique were aided in refinement of genetic locality by the availability of resources such as deletions (eg Duchenne muscular dystrophy (Monaco et al. 1986). In fact until 1,993, of the 1,5 genes characterised, 13 had cytogenetic rearï¿rngements to help pinpoint and identify the gene (Table i-1). Further/ many of the disease genes which have been identified by this method are commonly occurring diseases and thus had large family resources to refine genetic localisation.
11 Table i-1: Inherited disease identified by positional cloning until L993 (Adapted from Collins 1995)
Disease locus (y"*) Cytogenetic Trinucleotide repeat
1.986 Chronic + granulomatous disease Duchenne muscular + dystrophy Retinoblastoma + L989 Cystic fibrosis 1.990 Wilms tumour + Neurofibromatosis + type 1 Testis determining + factor Choroideraemia + 1.991 Fragile X syndrome + + Familial polyposis coli + Kallmann syndrome + Anirifia + 1992 Nor:rie s¡rndrome + Myotonic dystrophy + Lowe sr¡ndrome +
i.3.2 Functional cloning
As the name suggests functional cloning relies on lcnowledge of the function of the disease
gene. This may include understanding of the metabolic defect involved in pathogenicity or information regarding protein product (either as amino acid sequence and/or antibodies available). cDNA libraries can be screened by a variety of methods in the elucidation of the disease gene (Ballabio L993). M*y disorders do not lend themselves to this approach, in fact most of the genes about which we have sufficient functional knowledge have already been cloned.
i.3.3 Candidate gene approach
This method relies on some lcrowledge of function of the disease gene. Additional information from phenotype variation observed in model organisms may also be useful in helping to choose appropriate candidate genes. Further, educated guesses regarding possible candidate genes may assist in elucidation of the gene respotìr¡ible. This method can T2 be particularly laborious and is often used in conjunction with some additional lcrowledge of the probable location of the disease causing gene (see positional candidate approach). Examples of human disease genes cloned by candidate gene approach are listed in Table i-2 below (table is taken from CollinsL992) :
Table i-2: Human disease genes identified by candidate gene approach
Disease Gerte Retinitis pigmentosa Rhodopsin Retinitis pigmentosa Peripherin F arLilial hlpertrophic Cardiac myosin heavy chain cardiomyopathy Mali gnant hyperthermia Ryanodine receptor Li-Fraumeni slmdrome P53 Marfan syndrome Fibriltin Alzheimers disease Amyloid precursor (early onset) protein X-linked spinobulbar Androgen receptor muscular dystrophy Waardenburg srmdrome HuP2
i.3.4 Positional candidate approach
This technique utilises all of the above mentioned approaches and thus would appear to be the most efficient (Ballabio 1.993).It is the method of choice when attempting to identífy a
gerre from the vast mrmber in the human genome. As the name suggests, the positional candidate approach relies on a some knowledge about functioru tissue(s) of expression and a reliable estimation of the genetic localisation of the gene. Obviously, the smaller the physical distance and more functional lcrowledge will reduce the number of potential candidate genes to be screened. Known disease loci in model organisms can also provide information which is invaluable for this approach.
Any characterised genes whidr fall into the defined mapping interval can be assessed for their suitability as candidate genes. Information which can be useful in deciding which gene to screen as a potential candidate is functiorç homologies to lmown genes/ or expression patterns of the gene. Additionalþ model organisms, eg mice, which may have identified mutations and similar phenotype c¿ur provide useful guides for the assessment of candidate genes.
13 i.3.5 Databaoe scÍreening - in sílìco positional candidate approach
Sequence information available from public databases on the internet significantly enhances the rapidly evolving technique of in silico positional candidate approaches. The amount of sequence information has been greatly enriched by the progress of the Human Genome Project. This ínternational effort aims to have the entire human genome sequenced by the year 2005 (Collins et al. 1998). More recent estimates indicate that the human genome will be sequenced by 2003 with a working draft available by March 2000 (Mattick et aL.1,999).
Much of the data already generated has been organised into detailed physical and genetic maps. As more sequence is generated it will be made accessible on public databases. Analysis of genomic sequence using available exon prediction programmes may provide some insight into the gene structure of transcripts. Genomic sequence can also be assessed for inter species homology, regulatory sequences and potential functional domains with the aid of available software.
A strategy which has proved to be invaluable is the generation of ESTs (expressed sequence tags). These small fragments of sequence are generated from randomly selected cDNA clones. Currentþ there are many databases whictr provide information regarding genetic localisatiorç sequence homology and allows arrangement of overlapping ESTs into "IlniGene clusters". Each UniGene cluster essentially represents part of one transcript. Alignment of overlapping ESTs in silico enables longer sequences to be identified.
The sequences obtained for these fragments of cDNA clones can be amplified by PCR and used to pull out full length cDNA clones from various and appropriate cDNA libraries, or methods such as 5' and 3'RACE (rapid amplification of cDNA ends) can be used to lengthen the EST if no full length cDNA clones are detected. Links to other databases provide information regarding genetic and physical location of cloned genes and ESTs (Borsani et al. 1998 review).
Thus, the sequence irrformation generated by the Human Genome Project provides easily accessible data and quick methods for scanrring a region to see if urry appropriate candidates exist for the region of interest.
L4 \ /hile the Human Genome Project is expected to have the entire human genome sequenced early in the new millenium, the identification of all potential genes is conceivably going to take much longer. Thus, while this pool of data is significant and of considerable value to the researcher it may not provide completed sequence information for the region of concem. i.3.6 Traditional methods of transcript identification
I4/hile the scanning of databases may lead to the identification of the gene of interest it may be necessary to resort to more traditional methods when no good candidates are present fn silico.T\erc are other resources which may be assessed in the search of a disease gene. For many chromosomes there are physical maps available and YAC, BAC, PAC and cosmid contigs of the area of interest may be readily available. These clones can be screened for transcripts by a variety of means.
Some of the more traditional and more laborious methods used to identify transcripts in a region of interest are listed below in Table i-3:
Table i-3: Methods for identifying transcripts inlarge genomic region (modified from Collins 1992)
1 Hybridisation based a. 1.1 Evolutionary consetvation (zoo blots) 1..2 Northemblots 1.3 Identification of CpG islands b. 1..4 cDNA library screening 1.5 Direct selection of cDNAs
2 Function based 2.L Exon trapping 2.2 Promoter ttapping 2.3 Poly A signal trapping 2.4 Gene transfer and transcript identification
15 In section L.a of the Table i-3 the approaches used for identification of transcripts are based on hybridisation of specific, single copy DNA subclones from the region of interest. Results from such experiments provide general information regarding the gene content of the DNA fragment used as the probe. The northem blot allows determinatíon of the size of a potential transcript in a genomic region" the zoo blot enables cross species homology to be determined and the identification of CpG islands by restriction analysis are indicative of a gene rich genomic clone.
Drawbacks of these strategies include the fact that a single copy probe is necessary for reliable, clean interpretation of results. Therefore a large amount of subcloning needs to be undertaken. For northem blot anaþsis the transcript must be expressed in the RNA from which the tissue was derived and in large quantity. Cross species sequence homology searches are based on the fact that coding regions are more highly conserved than non coding regions. Potential genes Irray be missed if the sequence has significantly diverged from other species (review Panish and Nelson 1993).
Scanningthe regionfor CpG islands provides a rapid means of assessing a large stretch of genomic DNA. These islands are small regions of genomic DNA containing restriction sites cleavable by different rare cutters. These small unrnethylated CpG-rich regions are frequently associated with transcripts (Bird 1986). The creation of NofI libraries permits the cloning of DNA adjacent to the CpG islands (Patel et al. L991). Not all genes are associated with CpG islands and thus in these cases this tectrnique is of limited value.
cDNA selection (from libraries or with immobilised genomic sources) directþ pulls out the transcripts from the region of interest by various methods. Direct cDNA selection using immobilised genomic clones from the region of interest enables non specific hybrids to be eliminated and selected clones eluted. Several rounds of selection and amplification results in rapid enrichment and identification of specific cDNA clones encoded by large genomic regions (Lovett et al. 1,991). These can then be compared to genomic sequence to identify exon/intron boundaries, species homology and expression by reverse transcription PCR.
t6 Of the functional approaches to transcript identification, perhaps the most efficient and useful is that of exon trapping. This method allows coding sequence to be isolated from relatively high complexity genomic DNA. This method relies on the existence of donor and accepter splice sites at intron/exon boundaries. Briefly, genomic fragments ftom the region of interest are cloned into a vector system which has splice sites which can combine with those of the introduced genomic sequence, thus identifying exonic sequence (Buckler et al. 1,99L). Alterations to the original protocol increased the sensitivity of the vector and the overall efficiency.
The main benefit of this approach is that it is not dependent on naturaf expression of the transcript. This bypasses problems with tissue and development specific expression patterns. Additionally, norrrral expression levels of the RNA does not affect isolation of a transcript. The disadvantage of this technique is the reliance upon functional 3' and 5' splice sites, thus rendering intronless genes unidentifiable by this method (Church et al. 1ee4\.
i.4 Distinctive features
There may be characteristic featutes which may help to identify the type of gene involved in a particular disorder. For example loss of heterozygosity is used as a pointer to indicate where a tumour suppressor gene may lie (Friend et al. L986). Other groups of disorders eg those which exhibit anticipation may be due to expansion of a repeat sequence. It is important to note any peculiarities of a group of disorders which may enable faster elucidation of the gene(s).
i.5 Exclusion of candidate gene
When a gene is consídered to be a candidate for a particular disorder, the easiest way to exclude the gene is to show that a normally occurring polymorphism within it does not segregate with disease status in a family. These polymorphisms may be present as silent exonic base changes, a base change in an intron or microsatellite repeat within an intron of the candidate gene. Demonstration of recombination with a potential candidate eliminates the need for laborious mutation screening.
Converseþ any polymorphism which shows perfect segregation does not allow ¿ìny more irrformation to be ascertained except that this gene remains a candidate and mutation screening needs to undertaken to find the molecrrlar defect in affected patient DNA.
T7 i.6 Mutation detection
There are mÉmy methods of screerring a candidate gene for disease causing mutations. The techniques described in the following text represent only a proportion of the available techniques and are by no meâns an exhaustive list of mutatíon detection assays (for comprehensive protocols for mutation detection see Landegren 1996). The approaches discussed allow mutation screening in both genomic and cDNA sequences. Each source of these templates has both advantages and disadvantages. Genomic DNA is generally much easier to obtain and to work with than cDNA and enables exonic, intronic and promoter sequences to be screened. However, analysis of genomic DNA requires a krowledge of the
gene structure which is not always available.
i.6.1- Single Strand Conformation assay (SSCA)
This assay was implemented and developed by Orita et al. in 1989. The principle behind this technology is that a single base change or small deletion in primary sequence may confer alterations in subsequent three dimensional structure of the single DNA strand. PCR products from the gene of interest are amplified and denatured. The resulting single strands form three dimensional conformations dependent upon sequence composition. These structures are then electrophoresed through a non denaturing polyacrylamide gel. Any conformational change willbe detected as ¿m aberrantþ migrating band when compared to control samples.
SSCA analysis detects approximately 80% of mutations in PCR products of 200-300 bps (Liu and Sommer 1994). Larger PCR products generally grve poor results detecting only 50% of. potential mutations. Modifications, such as alteration of pH and addition of glycero| can enhance detection rate. This method detects not only single base substitutions but also deletions and insertions, however, the exact position and nature of a mutation needs to be confirmed by sequencing.
Perhaps of all the techniques described in this section the SSCA is the easiest and quickest
way to screen large genes for mutations. Additionally, PCR products can be multiplexed, 2- 3 (or more) sets of different primers in the one PCR reaction, increasing speed and improving eff iciency greatly.
18 i.6.2 Heteroduplex analysis
Heteroduplex analysis can also detect base differences in sequence composition. \Â/hen both normal and the base substituted sequence are present in the same PCR reaction, denatured and allowed to reanneal, mixed heteroduplexes may be formed. These are resolved from homoduplexes onnon-denaturing polyacrylamide gels. This analysis detects approximately
80"/o of mutations in PCR products ideally sized from 200-300 bp (\,\Ihite et al.1,992). i.6.3 Denaturing / Temperature gradient gel electrophoresis
This technique depends on differential migration of normal and mutant DNA. Double stranded DNA generated by PCR is run through a gradient of denaturant or temperature. As the DNA migrates through the gef the strands progressively dissociate dependent on sequence. The partial "melting" of DNA results in altered mobility in migration.
Mutations are most readily detected when the modified sequence is located within a domain of relatively low melting temperature. To enhance this feature GC clamps (30-50 (GC) base pairs) are affixed at the 5' ends of PCR primers (Sheffield et al. 1989). Advantages of this technique are a high detection rate (95%) in large (up to 600 bp) PCR products and the method of screening is usually non-radioactive (Myers et al. 1987). The major disadvantage is the preparation and optimisation of conditions prior to mutation screening. This method, like SSCA, does not detennine the change or position of sequence alteration, thus, requiring sequencing for identification and confi::mation.
i.6.4 Chemical mismatch cleavage
In this assay initial heteroduplex molecules are fonrred by denaturing and reannealling. Maxam Gilbert sequencing chemistry (Maxam and Gilbert 1.977) is then applied to chemically modify any mismatched bases. The labelled DNA is then cleaved by piperidine at the site of modification (mismatch), followed by gel electrophoresis and autoradiography.Osium tetroxide is used for the modification of mismatched thymidines (T) while mismatched cytosines (C) are modified with hydroxlamine. Mispairing of the bases adenosine and cytosine, in the wild-type sense strand, are detected by also Iabelling the anti-sense strand of the wild type DNA in the heteroduplex. This technique is very sensitive and allows scaffúng of large PCR products with up to 1.7 kilobases successfully screened. The site and nature of the mutation is detected simultaneously making this technique highty desirable. F{owever, the major disadvantage of this technique is the large T9 number of procedures involved and the use of highly toxic reagents. These detrimental characteristics often deterrnine that this very sensitive technique is not considered. i.6.5 Direct sequencing
Direct sequencing allows a PCR product of a specific regionwithin a gene to be screened for mutations without subcloning. Sequencing determines the exact nature and location of a mutation and thus is the ultimate method of mutation detection. Anomalies detected by DGGE, SSCA and HA all need to be sequenced to determine sequence alteration.
Sequencing of regions of candidate genes, without prior mutation screening techniques is ideal, however, this can be more laborious and expensive, especially for larger genes. Additionally, in autosomal dominant disorders, sequencing of PCR products from heterozygous individuals may not yield reliable and easily assessed results. Double peaks detected in the sequencing reaction indicate sites of mutation howevet, these double peaks can often occur as a result not of sequence change but of sequencing artefact. Thus, the chances of false positives is increased. Subcloning PCR products may help to eliminate problems with sequencing background" however, this procedure may introduce errors not present in the original PCR product (personal observation)
i.7 Verification of mutation
A detected anomaly needs verification to determine whether the mutation is a neutral polymorphism or disease causing. Changes such as exonic deletions, insertions and nonsense mutations are most often obvious, resulting i. frameshift or causing premature termination. Subtle single base pair substitutions need more thorough exarrrination in order to clarify the potential effects of the mutation.
20 Several criteria need to be met to assign disease causing status to a putative mutation.
1. The base substitution is not detected in a large number of unaffected, normal control samples
2. The same mutation (or mutations in the same gene) ate detected in r¡nrelated affected individuals
3. Assessment of functional significance of the mutation. This pertains to the location of the mutation, :- A missense mutation within an exon of the gene should be considered with respect to its effect on corìÉ¡erved regions of the gene at both the DNA and protein level. :- A missense mutation in the intron of a gene can be screened for potential as a splice site mutatíon.
4. AÊÍ.ect on expression (detectable only if expression of the normal gene product is in easily accessible tissue, eg lymphoblasts or fibroblasts)
While it is not always possible to categorise a potentia-l mutation as disease causing, supporting data and evidence from model organisms or similar mutations in comparable díseases can help substantiation. Functional analysis of the identified mutation in model organisms can provide useful and compelling information regarding the effect of a particular mutation on the norrrral Processes of a gene.
The identification of a disease causing mutation initially allows the assessment of mutations in this gene in other families with identical clinical symptoms, thus providing appropriate confirmatíon of carrier status, presymptomatic diagnosis and prenatal diagnosis.
Further studies of the normal function of the gene product may lead to a better understanding of its biological significance and interactions with the ultimate goal of administering drug or gene replacement therapy enabling affected individuals to lead as normal a life as possible.
2I Chapter f.ii : INHERITED ATAXIAS Page ii.l Introduction 23
ä.2 Classifications 24
ii.3 Congenital ataxias 26
ä,4 Early onset ataxias 27
ii.4.1 Friedreich ataxia 27 ü.4.2 Episodic ataxia typ" I 28 ii.4.3 Episodic ataxia type II 28 ü.4.4 Familial hemiplegic migraine 29 ii.4.5 Splnocerebellar ataxia - 6. 29
rr.5 Late onset ataxias 29
ii.5.1 Known loci for late onset SCAg 30
ii.6 Clinical features 3t
ii.6.1 Cerebellat eigns 31 ü.6.2 Other phyeical signs 31 ii.6.3 Neurophysiological signs 33 ü.6.4 Neuroimaging findings 34
ü.7 Common properties of SCAe 34
ii.7.L Polyglutamine tract 34 ü.7.2 Anticipation 35 ä.7.3 Dynamic mutation - etability of repeat 36 ii.7.4 Toxicity of polyglutamines 39
ii.8 Hypothesee 43
22 CHAPTER 1.ii:
INHERITED ATAXIAS ii.1 Introduction
Ataxia refers to the failure of muscular co-ordinatior¡ presenting clinically as iregularity of muscular action. Cerebellar ataxia is ataxia due to disease or dysfunction of the cetebellum. It is the single clinical finding of ataxia whidr unites all of the disorders whidr are incorporated in this study.
While ataxia is the cortmon denominator in the inherited ataxias the severiþ age at onset, progression and other associated symptoms c¿ìn vary greatly both within and between families. These disorders are clinically heterogeneous and families with similar clinical feafures can be delineated to form the basis for a clinical classification. The subgroups include, congenitøl øtøxiøs, metøbolic øtaxias, atøxic disorders associøted with defectioe DNA repair
and eørly ønd løte onset inherited ataxiø, (Harding 1.993, Konigsmark and Weiner 1,970) (Table ü-1).
As there are a large number of disorders whic-h fall under the broad classification of inherited ataxias the clinical and genetic features of only those inherited ataxias which will be examined in more detail shall be discussed from here on. The focus of this study will be a subset of the ataxias, namely lhe congenitøl and thLe eørlyfløte onset atøxias, with an emphasis on the lqte onset øtaxiøs.
23 ii.2 Classifications
Table ii-l: Classification of inherited ataxias based on clinical criteria (mode of inheritance), genetic location (where known), or molecular basis (where gene identified): (adapted from Harding 1993)
CONGENITAL ATAXIAS Disorder Inheritance Localisation Gene/protein Mutation locus Congenital ataxia with mental AR, AD, AR (10q241) UN UN retardation +/- spasticity XLR
Congenital ataxia with episodic AR UN UN UN hyperpnoea, and mental retardation; $oubert syndrome)
Congenital ataxia with mental AD UN UN UN retardation and partial aniridia (Gillespie syndrome)
Dysequilibrium syndrome AR UN UN UN
INHERITED ATAXIC SYNDROMES WITH KNOWN METABOLIC DEFECTS Disorder Inheritance Localisation Geny'protein / Mutatíon locus Intermittent Ataxias Argininosuccinase deficiencY; AR, XLD UN UN UN
Aminoacidurias; AR UN UN UN
Disorders of the pyruvate and AR UN UN UN lactate metabolism
Progressive ataxias Abeta- and hypobetalipo - AR 4q microsoma12 mrcsense proteinemia trigtyceride transfer protein
Isolated vitamin E deficiency AR Bq 0,-tocopherol3 deletionl transfer missense protein
Sialidosis AR 6p21, neuraminidasea missense
X-linked ataxia, ichthyosis, XLR Xp steroid deletion and tapetoretinal dystrophy sulfatases missense (arylsulfatase C deficiency)
Disorders associated with defective DNA repair Ataxia telangiectasia AR 11q ATMó insertion/ deletion Cockaynes syndrome AR cs-A / csB? missense/ nonsense 24 Table ü-1. continued: Classification of inherited ataxias based on clinical criteria (mode of inheritance), genetic location (where known), or molecular basis (where gene identified): (adapted from Harding 1993)
EARLY ONSET ATAXIAS Disorder Inheritance Localisation Gene/protein / Mutation locus Friedreichs ataxia AR 9p X25 GAA
Early onset cerebellar ataxia with hypogonadism, deafness AR UN UN UN and or dementia
with congenital deafness AR UN UN UN
with retained tendon reflexes AR UN UN UN
with myoclonus AR/AD UN UN UN (Ramsay Hunt syndrome)
Familial periodic ataxia AD 12p KCNAl mlssense with myokymia
Familial periodic ataxia AD 19q CACNÁlA nonsense withoutmyokymia
LATE ONSET CEREBELLAR ATAXIAS Cerebellar ataxia with retinal AD 3p K.A7 CAG degeneration Cerebellar ataxia with optic AD L4 scA3/MJD CAG ahophy / dementia f extra- AD 12 DRPLA CAG pyramidal features / AD 6p SCAl CAG ophthalmoplegia. AD l6q SCA4 UN
Cerebellar ataxia with slow saccades AD 12p SCA2 CAG with epilepsy AD 22 SCAlO UN AD 13p SCAS CTG
" PttÍe" cerebellar ataxia AD 19p13 SCA6 CAG mrssense AD L1cen SCAS UN AD 15q14-21..3 SCA11 UN
Note (EA-1 /2 episodic ataxia type L/ 2; SCA - spinocerebellar ataxia; MID - Machado Joseph disease; DRPLA - dentatorubral pallidoluysian atrophy; AD - autosomal dominant AR - Autosomal recessive XLD - XJinked dominant XLR - X-linked recessive UN-unknown CAA/CAG = repeat expansion rrutation) References: 1. Nikali et aL.1995,2. Sharp et al.1Ð3,3. Ouahchi K et al. 1995 4. Bonten et al. 1996 5. Basler et al. 1992 6. Savitsky et al. 1995 7. Mallery et al. L998. References for genes characterised for early and late onset ataxias are referred to in text.
25 ii.3 Congenital ataxias
The unifying feature of the congenitøl øtaxiøs is that they are non progressive. In the majority of cases, the co-ordination of these patients improves with age (Harding 1984). The cerebellar dysfunction in these infants usually gives rise to abnormal motor development and hypotonia. Symptoms which present later include nystagmus (uncontrolled, involuntary eye movement), difficulty with co-ordination when reaching for objects and tmncal ataxia on attempting to sit. Several forms of congenital ataxia (or non-progressive congenital ataxia, NPCA) are associated with mental retardation. All modes of inheritance; autosomal recessive, autosomal dominant and X-linked inheritance have been observed for the congenital ataxias (Harding 1'993).
Distinctive clinical features observed in some of the congenital ataxias enables subgrouping:
1. Gillespie slmdrome:- ataxia associated with partial aniridia (partial loss of the iris) and mental retardation (Crawfurd d'A et al. 1.979). Mutations in the PAX6 gene have been identified in patients with aniridia alone with no neurological affect noted. Mutations in this same gene have been speculated to cause Gillespie slmdrome, however, there is no evidence that this is the case. It may be that as yet undiscovered mutations in the same
gene may lead to other phenot¡res (Prosser and van Heyningen1998 review).
2. joubert syndrome:- ataxia associated with abnormal eye movement, hypernea (excessive imagination or activity of the mind) and mental retardation. Dysgenesis (inappropriate development) of the cerebellar ver:nris is also observed in this disorder (Friede and Boltshauser L978). To date, no localisation or associated gene product has been identified for this clinical entity.
3. Dysequilibrium syndrome:- ataxia associated with mental retardation and marked motor delay. Affected drildren genetally do not walk before the age of 1.0 years. This disorder is prevalent in Scandinavia and has been described rarely in other geographical locations (Hagberg et al. L972). There is no genetic localisation or associated
gene identified for dysequilibrium syndrome.
26 4. Infantile onset spinocerebellar ataxia (IOSCA):- ataxia associated with peripheral sensory neuropathy, epilepsy, hearing impairment, eye abnormalities and female primary hypogonadism. This complex disorder has been described only in Finland, with haplotype analysis confirming a founder effect (Nikali et al. 1995). The gene for this recessively inherited disorder is located at1,0q24, but has not yet been identified (Nikali et aL.1997).
5. There exist other non specific congenital ataxia syndromes - refened to as pure congenital ataxias. These are often associated with spasticity and / or mental retardation although this is not universal. Autopsy of these patíents indicates pontoneocerebellar hypoplasia or granule cell hypoplasia. At present no genes or localisations have been identified for these disorders.
The analysis of families with congenital ataxias may enable the identification of genes involved in these diseases and thus aid in the understanding of their pathogenesis.
The early nnd løte onset inherited øtøxiøs include a group collectiveþ known as spinocerebellar ataxias (SCAs). M*y molecular advances have taken place in recent years leading to the identification of genes and associated mutations for many of these disorders. Recent discovery of the molecular basis for many of the clinically heterogeneous late onset SCAs now enables routine diagnosis for many patients. ii.4 Early onset ataxias
Eørly onset øtøxias include: Eriedreich atøxiø (FRDA), Episodic øtøxiø type 1. (EA-1) and
Episodic øtaxiø type 2 (EA-2).
ii.4.1 Friedreich ataxia
This disorder is the most common of all the early onset ataxias. Age of onset is usualþ between 8-15 years but can vary (Harding 1981). Gait ataxia is the common presenting feature with later symptoms including absent tendon reflexes in the legs, dysarthria and areflexia (reflexes which are absent oï can not be elicited).
The underlying mutation for this disorder was identified n 1,997 by Campuzarto et aI. Homozygous expansions of a normally occutring (GAA)n repeat in intron 1 of the frataxin
geneare detected in approximately 96o/o of all patients. (Normal range n: 6-29 : affected range n: 1.2O-1700) (Durr et al. L996, Filla et al.'J.996, Epplen et al. 1997 and Morrterrrini 27 et al. L997). Various point mutations have been identified in some individuals with FRDA not having an homozygous expansion (Cossee et al. t999).
Expression studies indicate that there is a decrease in the level of frataxin in patients with FRDA. The mechanism involved in the reductíon of gene product is unknown. It has been proposed that the (GAA)n expansion may affect mRNA stability, splicing efficiency or transcriptional/ translational processes (Montermini et aI.'l'997).
Although this disorder is recognised as clinically distinct, molecular analysis corrfirms diagnosis in classical cases and allows direct assessment of this locus in atypical cases.
ä.4.2 Epieodic ataxia type I (EA-1)
Individuals affected with EA-1 have periodic ataxia associated with myokymia (continuous small muscle movement) and/or dysarthria (slurring of speech). These periodic attacks are often initiated by movement and startle and may last for seconds or minutes. Onset is usually in late childhood or early adolescence and affected individuals do not develop persistent ataxia or cerebellar atrophy. Symptoms do however, persist through to adulthood. (Brunt and van Weerden, 1990).
Several missense mutations in the Shøker - related neuronal voltage gated potassium (K+) ion channel gene, KCNAL, have been shown to be responsible for EA-L (Browne et al. 1994). To date, EA-1 is the only lrrownhuman ataxia to be caused by dysfunction of a potassium charurel.
ii.4.3 Episodic ataxia type II (EA-2)
EA-2 is characterised by periodic ataxia with associated nystagmus (invohrntary rapid movement of the eyeball). Unlike EA-1 there is no myokymia observed in individuals affected with EA-2. Ataxic attacks are usually provoked by emotional or physícal stress and last from several minutes to days (Bain et al. 1,992). Patients often respond to treatrrrent with acetazolamide (Griggs et al.'J,978). Mutations in the brain specific voltage gated calcium ion channel gene, CACNAIA, have been shown to be responsible for EA-2 (Ophoff et aL.1,996).
28 ii.4.4 Familial hemiplegic migraine (FHM)
Interestingly missense mutations in the CACNA1A gene have been shown to cause an allelic disorder to EA-2, familial hemiplegic mþaine (Ophoff et eI. 1996). Patients with FHM experience recurrent attacks of disabling headache associated with nausea and aura. These attacks are often accompanied by hemiparesis or hemiplegia (one sided weakness of the body). Cerebellar atrophy has been noted in FHM families linked to the 19pI3 locus (CACNALA gene) (Terwindt et al.!996). ii. .5 Spinocerebellar ataxia - 6 (SCA6)
A third allelic disease, SCA6, is also caused by mutations in this calcium ion channel gene. SCA 6 is a progressive ataxia with onset later than both EA-2 and FHM. The most common mutation in this disorder is a mild expansion of a normally polymorphic (CAG)n repeat located in the 3'coding region of the gene (Zhuctrenko et al.1'997).
\¡/hile these disorders; EA-z, FHM and SCA6 are clinically discrete there is considerable overlap inphenotype. Some patients with EA-2 exhibit migraine and in both FHM and EA- 2 there may be progressive ataxia present (von Brederlow et aI.1995, Joutel et al. 1.993). The identification of additional mutations in the CACNALA gene may enable a clearer conelation between phenotype and genotype to be drawn and greater understanding of the functional domains of the CACNAI'A gene.
ii.S Late onset ataxias
T\e løte onset spinocerebellar øtøxias are characterised by progressive degeneration affecting the cerebellum, brain stem and spinocerebellar tracts to varying degrees. This leads to generalised incoordination particularly affecting gait (gait ataxia), speech (dysarthria) *d swallowing (dysphagia). Symptoms typically appear between the second and fourth decade of life and are progressive. After onset, duration of the disease varies greatly from 12 to 38 years. Both duration and severity of the disease vary not orùy between families but also within the same family (Konigsmark and Weiner 1970, Harding 1,993, Haines et al.
1.e84).
29 ii.5.1 Known loci for late onset SCAg
It is in this group of ataxias that the greatest molecular advances have been made in the last six years. To date, twelve løte onset øutosomøl øtøxiøs have been genetically localised (Orr et aL. 1993, Kawaguchi et al. 1994, Koide et aI. L994, Nagafuchi et aL'1994, Ranum et al. 'J,994, Flanigan et al. '1,996, Imbert et aI. 1996, Sanpei et al. -1"996, Lindbald et aL. L996, David et al. 1.997, Znuchenko et al. \997, Zu. et aI.1999, Koob et al. 1999, Worth et al. 1999 Hol¡nes et al. 1999). These include Dentatorubral pallidoluysian atrophy (DRPLA), a distinct ataxic disorder and SCA L,2,3,4,5,6,7,8,L0,11 and12. The genes for six of these disorders have been molecularly characterised and the mutation identified for each of these loci is an expansion of an (AGC)n repeat in affected individuals. Normal range of copy number is approximately \2-40 (AGC) copies whereas the affected (disease) range is generally 40-85 (AGC) copies (Table ii-2) (Orr et al. 1993, Kawaguchi et al. 'J,994, Koide et aL.1994, Nagafuchi et al. 1994,Imbert et aL.1996, Sanpei et aL 1996, Lindbald et aL L996, David et aL.1997, Zruchenko et aL.7997).
One of the latest additions to this growing list of characterised genes, SCA8, differs from those previously described. The (CTG)', repeat expanded in SCAS is reported to be located within the 3' untranslated region of the gene. Clinical symptoms of individuals with this expansion are consistent other with SCAs, including gait ataxia and dysarthria (Koob et al. 1999). The correlation between (CTG)', copy number and disease severity at this locus is not
well established, in fact, several groups have identified expansions in apparent unaffected individuals (Stevanin et al. 2000, Worth et al. 2000). Thus, the analysis of additional patients may enable a better understanding of this newly characterised locus.
The SCA12 locus has been characterised and shown to be due to a (CTG)tr in the 5'
untranslated region of the PPP2R2B gene (Holmes et al. 1,999). This, however, has been reported in a single family only. Since the expanded repeats for both SCAB and SCA12 differ from the (CAG)^ expansion detected for the other SCA loci it is most probable that
the mechanism resulting in SCAS and SCA12 nay differ to that for SCAs previously characterised. Therefore much of the discussion to follow relates to the SCA loci characterised to be due to an expansion of a translated (CAG)n.
30 Table ii-2: Summary o1. molecular details of leownSCA loci.
Locus Chr. Anticipation. NR AR Gene Product SCAl 6 Pat. 19-38 40-81 Ataxin -1 SCA2 12 Pat. 22-28 37-50 Ataycn -2 scA3 / MJD t4 Pat. 1.3-36 68-79 Ataxin -3 SCA4 1.6 Unk Unk Unk Unk SCA5 11. Yes Unk Unk Unk SCA6 t9 Not det. 4-20 21.-27 CACNAlA* 5CA7 3 Mat / Pat$ 7-r7 38-130 Ataxin-7 SCAS 13 Mat / Pat: 1.6-37 107-L27 Unk # SCAlO 22 Unk Unk Unk Unk SCA11 15 Unk Unk Unk Unk SCA12 5 Unk <29 >65 PPP2R2B DRPLA 12 Pat 8-25 54-68 Atrophin
Chr. - chromosome; NR - -normal (CAG). rq>eat copy range; AR - affected (expanded) (CAG)'., repeat copy range; Pat - patemal anticipation; Mat - matemal anticipation; Unk - unknown; " - SCA6 due to both small expansions of (CAG)', repeat and missense mutations within the CACN,4lA gene, Pat$ - patemal anticipation more marked,Mat/Pat = - both maternal and paternal anticipation observed; # - SCAB - is due to expansions of (CTG)', repeat in the 3'untranslated region; Not det - not determined. ii.6 Clinical features ii.6.1 Cerebellar signs
Patients with late onset SCA usually present with initial signs of gait ataxia in the earþ stages of the disease. This manifests as difficulties when attempting to stand on one leg or hop and slowly (in most cases) progresses to a broad based gait and reeling. This is often accompanied by other signs of limb ataxia such as difficulties with finger to nose and heel to shin m€uloeuvres. Shrrring of speech (dysarthria) follows shortþ after or is noticeable at first examination. Progressive ataxia leads to loss of ambulation and speech which is nearþ unintelligible (Harding 1993).
ä.6.2 Other physical eigns
Individuals with spinocerebellar ataxias may also exhibit a variety of other associated clinical features. These include brisk tendon reflexes and peripheral neuropathy, often typified by distal symmetric loss together with loss of ankle jerks. Some patients may have generalised arefLexia (absence or inability of reflexes to be elicited). Extrapyramidal signs may be noted late in the disease progression and take the form of dystonic posturing, and choreiform or athetoid movements (invohrntary movements).
31 Visual loss is not common. Many cases of SCA with associated visual impairment are due to nutations at the SCAT locus. It is this clinical finding which sets SCAT apaft from the other SCAs. Patients with SCAT may not necessarily present with visual loss but invariably individuals will develop retinal degeneration.
The other spinocerebellar ataxia which has some clinically distinct features is DRPLA. Additional features to those already mentioned above include epilepsy and developmental delay, although these features are most often identified only in juvenile forms of the disorder. Dementia is observed in many cases, both juvenile and later-onset. The ataxic features of this disease are more predominant in mid to late onset cases of this disease (Naito and Oyanagt 1,982). This disorder while clinically easier to recognise appears to
manifest predominantþ in Japan (Becher et al. 1997).
While both SCAT and DRPLA have some distiguishing clinical features, these features appear to be more salient in early onset of the respective disorder and may not be apparent in late onset presentations of the disease.
When one examines the group of late onset ataxias as a whole it is obvious that there is considerable phenotypic variation and overlap observed gwing limited value to the ADCA clinical classification (Table ü-3 - overleaf).
32 Table ii-3: Clinical features of late onset spinocerebellar ataxias (Table adapted from Chapter l"- Wells and Warren 1998)
Classification (Associated phenotype) Disorder Prominent features
ADCA I (Ophthalmoplegra, optic atrophy SCAl Gait ataxia, dysarthria, often dementia, pyramidal and extrapyramidal hyperreflexia ophthalmopares is extrapyramidal features)
SCA2 Similar to SCA1, with more marked anticipatiorç often hyporef lexia
scA3/MlD Extrapyramidal features often prominenÇ marked phenotypic variation
SCA4 Ataxia slowly progressive significant sensory axonal polyneuropatþ
ADCA II (Pigmentary retinopathy +/- SCAT Severe retinopathy with macular ophthalmoplegia and extrapyramidal degeneration and visual loss features)
ADCA III (Pure cerebellar ataxia) SCAS Slowly progressive ataxia and dysarthria
SCA6 Slowly progressive ataxia, dysarthria and vibratory / propioceptive loss SCA11. Slowly progressive ata xia ii.6.3 Neurophysiological fíndings
Nerve conduction studies indicate reduced amplitudes of sensory responses and essentially normal motor nerve conduction confirming the presence of polyneuropathy in SCA patients. These abnormalities tend to become more prevalent later in disease progression. In individuals who present with upper motor neuron signs distinctive abnormalities are detected by central motor conduction studies. Oculomotor recordings, in some cases/ show slowing of the saccades. This has been noticed to be a general finding oÍ. SCA2 (Lorenzetti et aI. L997). As with many of the peripheral symptoms not all of the neurophysiological abnormalities aïe detected uniformly in all cases of SCA. The progression of the disease and the locus involved in the disorder dictates the severity and variety of the symptoms in each case.
33 ii.6.4 Neuroimaging findinge
In all cases of SCA, i-uæog studies show pontocerebellar atrophy to varying degrees. Magnetic resonance imugmg (MRI) may indicate significant atrophy of the cerebellar vetutis and hemispheres as well as the pontine base, middle cerebellar peduncles, medulla and cervical spinal cord. In generaf i-"g-g does not allow any distinction to be made between the different loci causing SCAs.
It is often impossible to differentiate between the different classes of spinocerebellar ataxia by neuroimagng alone. In general SCA1, SCA2 and SCA3 are almost indistinguishable from each other. The rate of progression tends to be generally slower in SCAS and SCA6 and some individuals with mutations at these two loci will have a normal lifespan. Clinically, individuals with SCAS, SCA6 and SCA11 have almost exclusively "purely cerebellar" signs with few other signs. SCAT and DRPLA are clinically distinct in that they are universally, but not exclusively, associated with visual impairment and dementia respectively.
Although there are some clinical features which appear to divide the SCAs there remains a high degree of clinical overlap between these disorders. Therefore, molecular analysis of patients provides the only definitive classification (Schols et aL.1997). ii.7 Common molecular properties of SCAs ii.7.1 Polyglutamine tract
One common property of the majority of these genes, thus far, is that they have an (CAG)tt repeat within the coding region of the gene (encoding a polyglutamine tract). It is this mutual attribute which has given these disorders the name "polyglutamine disorders". Expansions of the (CAG),' repeat above an otherwise normal threshold results in a disease state.
Two of the SCAs, SCA1 and SCA2, have on their normal copy allele an intermption of CAT and CAA respectively. Affected or expanded alleles at these two loci assume a perfect repeat compositiorç having lost the intermptions characteristically present in the normal alleles. Thus, at least for SCA1 and SCA2 both the composition and length of the repeat appears to be associated with pathogenicity (Ctrung et al.'I-.993, Cancel et aL. 1,997).
34 The length of the repeat in the affected allele is of major importance and for the majority of SCA loci correlates with the severity and age of onset of the disease (See anticipation below for details).
The importance of the expansion of the polyglutamine is higilighted by the fact that almost all of the genes characterised for the SCAs have no la:rown homology to any other l¡rovm
genes and more significantþ no homology to each other at either the protein or DNA level, except for this repeat.
SCA6 is one exception and is due to expansions \ rithin the CACN,AIA gene, a gene with high homology to other members of the calcium channel gene family (Zhuchenko et al. 1,996).It is of considerable functional irrrportance that point mutations in this same gene have been shown to cause a progressive form of late onset SCA as well as EA-2 and FHM
(Ophoff et a1.1.996 and Yue et aL 1997). A newly described SCA locus, SCA8, is possibly due to an expansion of an untranslated (CTG)n repeat (Koob et al. 1999).The latest addition to SCA loci, SCAL2, is due to an expansion of an (CAG)n repeat within the 5'
rrnhanslated region of the PPP2R2B gene. It may well be that the mechanisms causing the SCA6, SCAS and SCA12 phenot¡res are different from that for all of the other SCAs.
ü.7.2 Anticipation
Muny of these disorders e>r:hibit a genetic phenomenon lcnown as anticipation. This refers to the increase of severity and/or the decrease of age at onset of symptoms in affected individuals of successive generations. It has been shown that in the majority of the løte onæt
spinocerebellnr atøxiøs there is a strong conelation between age ol onset andf or severity of disease progression and the (AGC) repeat copy number. More severely affected individuals (notably for SCAT and DRPLA) and individuals who have an earlier age of onset/more severe progression of the disorder generally carry larger allele sizes (in the affected range) (Jodice et al.'1994, Ranum et al.1994, Maruyama et al. 1995, Cancel et aL.1,997). It was the discovery and understanding of this type of mutatiorç coined dynamic mutatior¡ which provided a molecular understanding for the phenomenon of anticipation (Sutherland et al. 1.eet).
35 ü.7.3 Dynamic mutation - stability of repeat
Muny disorders including not only the SCAs have been shown to be due to d¡rnamic mutations (Table ü-4). The first of these genes to be cloned was that for the fragile X slmdrome (Yu et a1.1.991) in the FMR1 gene. Mutations in this gene are responsible for the most common form of familial mental retardation. The triplet expanded in this disorder is a (CCG)" repeat. Unlike the SCAs (except SCAS) this repeat is not within the coding region of
the gene (Eichler et aL.1993).
Table ii-4: Human diseases associated with dynamic mutation
CAG repeat disorders ¿ue coûunonly referred to as polyglutamine disorders since the repeat encoding polyglutamine is within the coding region. Expanded repeats for these disorders are in the range 21,-130 (CAG) repeat units.
Dieorder Gene locue Spinobulbar muscular dystrophy (SBMA) AR Huntington disease (HD) Qr15) Spinocerebellar ataxias (SCA) scAL,2,3,6,7 Dentatorubral and pallidoluysian atrophy and Haw River syndrome DRPLA (837)
Repeat expansions (CTG, CCG and GAA) for the following disorders reside in the untranslated regions of the genes. Expansions are much larger in the r¿mge of 100- 3000 repeat units.
Disorder Gene locus Myotonic dystrophy (DM) DMPK Fragile X syndrome FRAXA FRAXE mental retardation FRAXE Friedreichs ataxia (FRDA) X25 Spinocerebellar ataxia I (SCA8) SCAS
The dynamic mutations have in common the property that the expanded triplet repeat copy number is not necessarily stable on transmission and there is associated anticipation. In general, larger repeats correlate with more severe disease/more severe progression and/or earlier age of onset. Thus, it is clear that if on transrrission the repeat copy of an affected allele expands then the resultant offspring will have a more severe phenot¡re than that seen in the parent. Lrcreases in copy nurnber are generally more common than decreases, therefore, as the potentially expanding repeat is passed through generations the severity may be greater andf ot age of onset earlier. 36 65 * ¡ *
55 + # a * ¡ + 45 * age at I *' * onset * I 35 # f{ * * * I I * 25 * # I *
r¡ 15 # + & + # +
scA2 36 38 40 42 44 46 48 50 scAT 35 45 55 75 95 115 135 scAl 3s 40 45 50 55 60 65 70 75 80 85 SCAs 50 60 70 80 90 (CAG)n copy number
Figure ii-1: Scatter plots for age at onset (years) versus (CAG)n repeat copy number for SCA2(r= -o.87), SCAT (r= -0.93) SCAI (r= -0.94) and SCAS (r= - 0.87) and the linear correlation co-efficient (r) for each. These results indicate that there is a strong negative correlation between age-at-onset and (CAG)n copy number. (Data from Orr et al. 1993, Kawaguchi et al. 1994Oancel et al. 1997, David et al. 1997,
37 a b Okasaki Okasaki fragment Y \' 5' 3' \ lil\ 3 5' 3' 5'
S mple tandem repeat n=a Simple tiandem repeat n=b
\ 5' 3' 5', 3'
3 5' ó 5'
during polymerization Slip and slide during potymerization Slippage n=a fì=b (5'end anchored by unique flankÍng (5' end not anchored) sequence)
5' 3' 5' 3'
3' ililil1ililil 5', 5' Repair fì=â+Y Repair n=b+z (y is small) (z is large)
repeat tffi
Figure ii-2: Models for slippage mediated changes in (n=a) only one single stranded break is likely to occur in the addition (or deletion) of a few copies (y) of the can occur within the repeat in the process of replicat (z) ãncnóiéO (át éitnèr enrj) by unique sequence and is therefore free to slide during polymerization enabling the addition of many more copies than were present in the original sequence (b), pending the outcome of the repair process- g) æ Small repeat copy numbers and intermpted repeats (ie normal alleles) are more stably transmitted (see review Sutherland and Richards 1994). Additionally, it has been shown that not only can these repeats expand on transmission but cases of reduction of repeat size have also been documented (Telenius et al. L995). Further, for some of the disorders there appeaïs to be a strong sex-of-parent influence on instability (Table ü-1. and Figr:re ii-1).
There have been many mechanisms suggested for this observation of expansion. The theory most favoured is that of slippage. This process is proposed to occur during replication and the principle is outlined in Figure ü-2 (Richards and Sutherland 1994; Pearson and Sinden
1,996). Whenpoly (CAG)', (ot other repeat sequence) is on the leading strand this repeat is more unstable, and prone to expansion. This model explains both the noted increases and decreases in expansion sizes.
The relative capacity of the ten possible trinucleotide repeat units to be expanded im E.coli was tested with competition assays. Observations of replication of these various introduced repeat sequences indicated that CTG/CAG sequence is preferentially expanded (Ohshima et aI.1996). In both yeast and E.coli it has been shown that the stability of (CAG)tr repeat is dependent upon orientation, relative to the direction of DNA replication (Maurer et al. 1,996). Sarkar et al. (1998) provide additional support that the Okazaki fragments have a role to play in the mutation process by showing that inE.coli, the repeat length at whidr the amplitication of a CTG repeat alters coincides with the approximate length of the Okazaki fragment. This is consistent with the proposal that Okazaki fragments that are anchored by unique DNA flanJ ä.7.4 Toxicity of polyglutamines The mode of inheritance for the late onset SCAs is autosomal dominant. Dominant inheritance can be explained by a gain of function or by a dominant negative mutation. It is current opinion that the polyglutarrrines exert a gain of function effect. This is supported clinically by the fact that the SCAs are primarily late onset (Housman 1995). Two other disorders, Huntington disease (HD) and spinal bulbar muscular dystrophy (SBMA), although clinically distinct from the SCAs ate also caused by expansions of a (CAG)rt repeat. Results from studjes of patients with these two disorders indicates that the expanded (CAG)n repeat is a gain of function mutation (White et al. 1997, Merry et al. 1ee8). 39 Experimental evidence has shown that the absence of a single huntingtin allele does not produce Huntington disease (Ambrose 1994\. Further, individuals with homozygous expansion appear not to have a more severe phenotype than heterozygotes. This implies that the expansion not only exerts a gain of function but also, in the case of HD does not significantly affect the normal function of the gene (Durr et aL.1999). At the SBMA locus point mutations give a completely different phenotype than that observed when there is an expansion present (McPhaul et al. 1991). Neurological features, therefoÍe, are only present as a consequence of a repeat expansion at the SBMA locus. In contrast both point mutations and expansions at the SCA 6 locus result in a similar phenotype. It is curious to note, however, that other missense mutations in the same gene carrse completely different phenotypes (ie EA-2 and FHM; Ophoff et al. 1996). Although there is no direct supporting evidence, it can be speculated that SCA6 may be due to a different mechanism than the other polyglutamine disorders and thus willbe excluded from the general statements to follow. Additionally there is evidence that expansion homozygotes at the DRPLA locus may be more severely affected than theirheterozygote counterparts (Sato et al. 1995). This may be due to an extra gain of function effect not seen in HD. Aside from these exceptions it is generally accepted that the polyglutamine disorders result from a gain of function mutation. M*y early experiments indicate that the disease state may be due to an aggregation/ accumulation of this polyglutamine protein and as such demonstrate a gain of function property of the protein. In vivo the polyglutamine containing aggregates (or inclusions) were shown to be intranuclear or in the cytosol and generally restricted to brain regions affected by the disease. 40 It is important to note that these inclusions were not detected in the brains of unaffected individuals, thus providing strong ci¡cumstantial evidence for their role in pathogenesis. Furtherrnore in juvenile onset HD intranuclear inclusions are far more frequent when compared to adult onset brains. In many respects aggregation formation of huntingtin" atrophin-1, ataxin-1 and ataxin-3 reflect results of in oiao studies. Aggregates only form in cells transfected with constructs containing expanded alleles. In aitro experiments have allowed greater rrnderstanding and refinement of the mechanism involved in aggregation (reviews; Hackam et aL 1998; Paulson 1999; see Table ii-S). Table ii-S: Aggregates in polyglutamine expansion diseases Localisation Disease tn axoo in aitro regions most affected (inaiao) HD intranuclear intranuclear striatum perinuclear perinuclear cerebral cortex; SBMA intranuclear perinuclear spinal motor neufotìs DRPLA intranuclear intranuclear basal ganglia; perinuclear cerebellum SCAl. intranuclear intranuclear cerebellum; basal gúrglrø- SCA2 cytoplasmic ? cerebellum; brainstem SCA3 intranuclear intranuclear cerebelhrm; perinuclear perinuclear basal ganglia SCA6 ? ? cerebellar purkirq'ie cells SCAT intranuclear intranuclear cerebellum; retina Transgenic models for various SCAs reveal neuronal intranuclear inclusions (NIs) (Davies et aL.7997, Wanick et aL. 1998). These have been described in all of the disorders except SCA2 and SCA6. It is interesting to note here that these two disorders have the shortest of the expanded alleles. It has also been demonstrated that the polyglutamine nuclear aggregates are positive for ubiquitin indicating that the polyglutamine protein is misfolded (Paulson et aI.1997'). Initial studies on these NIs were intriguing and it was proposed that they were the underlying and unifying pathological structure in these disordets. Ffowevet, recent sfudies provide evidence for a less substantial role lor aggtegates. Evidence suggests that these inclusions may not correlate with neurodegeneration or neuronal cell death (Davies et al. 'J,997, Saudou et al. 1.998). Perhaps the most important finding is that SCA1 transgenic 4T mice may not require nuclear aggregates for the initiation of pathogenesis (Klement et al 1ee8). It is proposed that the nuclear inclusion may have some pathogenic influence. The mechardsm of pathogenesis is suggested to be two step. The slow progression of the disease in humans together with results from transgenic mouse models suggest that there may be an early and prolonged period of neuronal dysfunction and a later period of neuronal demise. If the NIs play a part in the pathogenesis it is most likely to be near the point of neuronal death. One way this may occur is that the NIs might compromise normal function by sequestering transcription factors or other regulatory nuclear proteins. It has been shown that NIs (inDrosophilø) can sequester certain polyglutamine containing proteins, such as the basal transcrþtion-factor TATA binding protein (Perez et al. 1998). Although the exact role of the nuclear inclusíons is not clear, their presence is implicated in neurodegeneration. Results indicate that nuclear expression is essential for pathogenesis. Several hypotheses regarding the pathogenic function of the mutant protein in the nucleus include the possibility that the nucleus is less efficient at degrading, refolding or disaggregating misfolded proteins than the cytoplasm. Altematively, aggregation may be preferentially fostered in the nucleus (Klement et al. 1998, Saudou et al. L998, Petez et al. 1,998) although, recent experiments in transgenic mice carrying a CAG expansion in exon 1 of the HD gene indicate that inclusions are detected in non-neuronal cells (Sathasivam et al. 1,999).It has been postulated that the aggregates may not directly cause disease and are simply a by product of another cellular process or alternatively, the inclusions may represent a protective responr¡e (Sisodia 1998). Recent experiments utilising conditional transgenic mice models for Huntington disease have indicated that damage caused by these inclusions may be reversible. In these experiments blockade of expression of the mutant huntingtin fragment in symptomatic mice leads to a disappear¿rnce of inclusions and amelioration of behavioural phenotype, leading to speculation that HD and other neurodegenerative disorders may be treatable (Yamamoto et al. 2000). Whatever role the expanded polyglutmines have it is obvíous that this common property influences pathogenesis of the disease. The identification of additional genes responsible for this clinically and genetically heterogeneous group of disorders may heþ to unravel their complexity and allow greater understanding of the role of the polyglutamines in neurodegeneration. 42 ii.8 Hypotheses: The hypotheses and aims of the project are: 1,. The symptoms ol individuals from familíes affected with late onset spinocerebellar ataxia and early onset ataxia with associated mental retardation are due to a single gene defect. 2. The disease phenotype segregating in families with ADCA (PK80237 and PK80248) may be due to an expansion of an (CAG)'. repeat. 3. Sporadic cases of SCA may be due to expansions of an (CAG)'. repeat. 4. Individuals exhibiting symptoms of EA-2 and FHMhave mutations in the CACNALA gene. Aims The aims of this project are to identify and characterise genes that are responsible for autosomal dominant cerebellar ataxias, both early and late onset/ and to see what relationship, rf any, they have to the other already characterised genes. Any individuals which are segregating for an SCA type disorder will be screened for known mutations and also methods will be employed to endeavour to identify new genes responsible for the symptoms. Given that the majority of SCAs which have been identified are due to expansions of an (CAG)', repeat, it is anticipated that additional genes for the late onset spinocerebellar ataxias may have a similar underlying molecular basis. Molecular characterisation for the gene responsible for SCA6 has shown that mutations in the same gene, a P/Qtype calcium channel alpha subunit (CACNAI,A), cause familial hemiplegic migraine and another autosomal dominant ataxía, Episodic ataxia type-Z (Ophoff et al.'1.996). Given the interesting property of this gene to be involved in three distinct genetic entities attempts üdll be made to identify and characterise mutations in the CACNAI.A geneinpatients with eitherEA-2 and FHM. 43 Chapter 2: MATERIAL AND METHODS Page 2.1 Extraction of genomic DNA 45 2.7,1 Lymphocyte DNA ieolation 45 2.1.2 DNA isolation from lymphoblast cell lines 47 2.1.3 Quantitation 47 2.2 Polymerase chain reaction (PCR) 48 2.2,1 Optimising PCR conditione 48 2.2.2 Long range PCR 49 2.2,3 HOT PCR - PAGE 50 2.3 Mutation detection 51 2.3.L SSCA gel conditions 52 2.4 Sequencing 53 2.4.7 Purification of PCR product from agaroee gels 54 2.4.2 Elution of PCR products from polyacrylamide gels 55 2.4.3 Dye terminator cycle sequencing 55 2.5 Databases 56 2.6 Primer design 57 2.7 Repeat Expansion Detection asEay (RED) asoay 57 2.7.1 Prep aration of oligonucleotides 57 2.7.2 Reaction conditions 58 2.7.3 Ge/tlybridisation 58 2.8 Monoclonal Ab analysis s9 2.8.! Protein extraction 59 2.8.2 Electrophoresis 60 2.8.3 Weetern blot 6t 2.9 Linkage analysis 6l 2.9.7 SLINK analysis 67 2.9.2 MLINK analysis 6l 2.9.3 MULTIPOilVT analysie 62 2.9.4 EXCLUDE analyeis 62 2.7O Radiation Hybrid panel - mapping 62 44 CHAPTER 2: MATERIAL AND METHODS 2.LBxtraction of genomic DNA (DNA was extracted by Ms. Jean Spence and Ms. Shirley Richardson within the Department of Cytogenetics and Molecular genetics, WCH, Adelaide) 2.1.7 Lynphocyte DNA isolation: Genorric DNA was extracted from lymphocytes by modification of the classical method (Wyman and White, 1980) including lysis with proteinase K and SDS, extraction with phenol and chloroforrrr to remove proteins and cell debris, and precipitation with ethanol. Peripheral blood samples were collected into 2 x'J.0 ml EDTA tubes and stored at -20"C until DNA was extracted. Fresh samples may be extracted immediately, without fueezing. Cell lysis and Proteinase K treatment L Transfer each blood to 50 ml polypropylene tube and rinse the EDTA tube once with cell lysis buffer (0.32 M sucrose/ 10 mM TrisHCl/ 5 mM N{gClr/ to/'v f v Triton X-100). 2 Make up the volume to 30 ml with cell lysis buffer. Place tubes on ice for 30 min. 3. Centrifuge the cell suspensíons at 2000 g,4C for 1.5 min, (3500 rpm in a Jouan centrifuge) and remove the supernatant by suction to the l0 ml mark. Add a further 20 ûù cell lysis buffer and resuspend the cells gently by inversion before spinning as before. 4 Remove the entire supernatant leaving approximately 1 ml, making sure not to remove cells. 45 5. Resuspend the pellet in 3.25 ml proteinase K buffer (10 mM TrisHCl/10 mM NaCl/ 10 mM disodium EDTA), togetherwith 0.5 ml10% SDS and 0.2 ml of 10 mg/mL Proteinase K (Boehringer Mannheim) and incubate at37"C overnight, or at least 4 hrs, with constant agitation or on a slow wheel. Phenol extraction 1 Add 5 ml (1:1 ratio) buffer saturated phenol (equilibrated with 1"0 mM TrisHCl, L mM EDTA) and mix gently with the cell lysate by inversion on a wheel for 1.0 min. 2 Centrifuge at 2000 g for 10 min, 3000 rpm inJouan centrifuge at L5'C. 3 Transfer the aqueous, upper phase to a l-0 ml polypropylene tube. Extract with another 5 ml phenof then spin at 400 g for L0 min. 4. Again transfer the top phase to a fresh 10 ml tube Chlorofonn extraction 1 Add chloroform:ísoamyl alcohol (zaz\ to 10 ml and mix. 2 Spin at 400 g for 1.0 min. 3 Carefully remove the aqueous top layer and place in a fresh tube. Ethanol precipitation 1 Add 100 ttl/Ítl (7/1,0 w) of 3 M NaAcetate (pH:5.2) and two volumes of íce-cold 99% ethanol. 2 Transfer precipitated DNA to an Eppendorf tube and centrifuge at 17000 g at 4oC for 10-15 min. 3 Wash the pellet tn70% ethanol then desiccate tmder vacuum in a speed vacuum concentrator (model RH40-1L, SAVANT Instruments Inc.). 4 Redissolve the dried down pellet in 20-100 ¡tl of TE (10 mM TrisHCl/ 0.1 mM EDTA), estimated from the stze ol the pellet and adjust to a final concentration of 1, ng/mlfollowing DNA quantitation (see 2.1'.3). 46 2.1.2 DNA isolation from lymphoblast cell lines DNA from lymphoblast cell lines are extracted by the same method as above but scaled up or down based on the approximate mass of cells to be extracted. In general the volumes used were as follows: 1. Resuspend cell pellet in 400 Ltl Proteinase K buffer 50 pl 10% SDS 50 Ft Proteinase K (final conc. 1 mg/ml) 2 Rotate on a wheel at 37"C overnight, or at least 4 hrs. 3 Extraction proceeds as above (ie 500 ¡rl phenol mixed well with the lysate, then 500 pl of 1:1 phenolchloroform/isoamyl alcohol and finally exttact with 500 ¡rl chloroform/isoamyl alcohol.) Transfer the aqueous phase to a fresh tube on each extraction 4 Transfer the final aqueous phase to a clean tube and add 50 ttl Nu Acetate (3 M) and 1 rrl ice-cold ethanol. 5 Wash the precipitate in7Ùo/o Ethanol, mix and spin, then remove all ethanol and dry down pellet under vacuum before resuspending in 20 Ff TE 2.1.3 Quantitation The concentration of DNA was deterrrined by measuting the absorbance at a wavelength 260 nm (Cecil C82020). Various molar extinction coefficient based constants are: one OD unit for double stranded DNA: 50 pg/ml; for single stranded DNA and RNA = 40 pg/nl and for oligonucleotides = 30 pg/ml. The following equation is used to calculate the concentration of DNA/ RNA/ oligonucleotides Concentration (pg/frl) : (absorbance at ODzeo x dilution factor x molar extinction coefficient constant) /1000) 47 2.2 Polynerase chain reaction (PCR): 2.2.1 Optimising PCR conditions Specific primers flanking a unique DNA sequence or polymorphic repeat can be used to exponentially amplify the target sequence for analysis. PCR conditions for primer pairs were optimised generally using the standard protocol below. This standardisation procedure was successful for greater than 90% of all primer pairs tested. l /hen conditions for a set of primers did not conform to this standard protocol, adjustments to MgClz and annealing temperature were made. Lists of primer pairs used for various analyses are indicated in the ivla.terial and Methods section of the appropriate chapter. PCR reaction mix: VoI (¡tl) per 10 ¡tl Final concentration DNA (100 nglpl) 1.0 10 nglpr L M BME 0.L 10 mM 2 X PCR buffer (+ dNTPs) 5.0 1X (200 ¡rM dNTPs) 15 mM MgCl2 1.0 1.5 mM forwardprimer (7íng/pl) 1.0 7.5ng/¡tJ, reverse primer (75 ng/UI) L.0 7 .5 ng/pJ, Taq polymerase (5 U/¡tl-Gibco) 0.2 0.1 U/pf H2O to 10¡11. (2 X PCR mix : 33 mM (NH4)2SOz, L33 mM Tris-HCl (pH:8.8), L3 mM EDTA, 0,34 ng/ míBSA, 20o/o DMSO, 400 pM dNTPs (dATP,dCTP,dGTP and dTTP). PCR cycling conditions(standard): STEP CYCLE 94"C 1 min 60"C 1nún 72'C 1 min X 1.0 cycles 94"C 1 min 55'C 1 min 30 sec 72C 1 nrin 30 sec X 25 cycles 72C 10 min 48 Z.2.2Longrange PCR Long range PCR kit (Boehringer Marmheim) is used for the amplification of alleles at the FRDA locus. PCR conditions for LONG RANGE PCR T. MASTER MIX 1 dNTPs (10 mM each) dATP 2.5 ttl dCTP 2.5 ¡tl dcTP 2.5 Uf dTTP 2.5 trl Primer mix (75 ng/ pJ) 5.0 pl HzO (up to 25 ¡tt) 5.0 pl Add 20 UI MASTER MIX 1. to 5.0 ¡rl genomic template DNA (100 nglpf) in 500 ¡tl PCR tube 2. MASTER MIX 2 10X buffer 2 (supplied) 5.0 Ul (firrul MgCl2 2.25 mM included inbuffer) enzyme mix (Taq and Pwo polymerases supplied) 0.75 pl II2o 19.25 $, Add 25 pI MASTER MIX 2 to each tube PCR cycling conditions (long range): 94'C (2 min) X 1. cycle 94"C (45 sec), 68oC (6 ntin) X 35 cycles PCR products are resolved on a 1.5% agarose gel (with SPP-I/ EcoRI marker) 49 2.2.3 H.ot PCR - PAGE For products to be separated and visualised by polyacrylamide gel electrophoresis (PAGE) (ie (AC)* (CAG)n and mutation screening by single strand conformation analysis (SSCA)) the standard reaction (2.2.1) incorporates 0.2 p.Ci/pI32P dCTP into the product (so called HoT PCR) For amplification of (CAG)'. repeats the analogue 7-deaza dGTP is used in place of dGTP in the standard PCR buffer nrrx (2.2.1). PAGE is used in diagnosis for direct sizing of trinucleotide repeats that are associated with disease when expanded or for genotyping polymorphic microsatellite markers used in linkage analysis. A similar, but non-denafuring, system is used as a rapid screen for mutation by SSCA. Standard 10 ¡rl hot PCR products were amplified with gene specific primers. All primers used are listed in the Material and Methods section of the appropriate chapters. 30 ¡rl of formamide loading buffer (95% deionised formamide, 1, mM EDTA, 0.1"% xylene cyanol and 0.1,% bromophenol blue) was added to each PCR reaction. Heat denature at 94CÍot 5 min. Load 5-8 Ltl per well for AC/CAG repeat markers; 2-3 ttl for SSCA gels. PCR products for genotyping ((AC)r, and (CAG)', repeats) are separated on a 0.4 mm thick 5% polyacrylamide gel (BioRad Sequigenru sequencing cell). 1,. 5 ¡rl of heat denatured PCR product was loaded onto the 5o/o polyacrylamide The recipe for the standard 5% polyacrylamide gel is as follows: 5o/o acrylarride (acrylamide : bis acrylamide;19 : 1) 7 M urea 1X TBE runningbuffer 1 ¡rl of both TEMED and APS (Arnmonium persulphate (25'/") is added per 1 ml of solution ie 100 ml acrylanride add 100 ttl TEMED and APS 2 The gelwas run at 1800-2000V, maintained at between45 and 50"C. 50 3 After 2-4 hours running time the gel was transferred to 3 MM Whatmann btotting paper and dried at 80"C in a BioRad 583 gel drier. 4 PCR products were visualised by exposure to X-ray film at - 70"C lor 30 nrin to overnight 2.3 Mutation detection Genetic variation and disease-causing mutations ate often the result of single base changes or deletions or duplications of one or more nucleotides. Single strand conformation analysis (SSCA) detects differences in strand mobility resulting from the effects of primary sequence changes on the folded structure of a single strand of DNA. Altered intramolecular interactions in generatirg u three dimensional folded structure may cause the molecules to move at different rates through a nond.enaturing polyacrylanride gel. Chances of detecting these changes can be improved by using different gel conditions. The gel systems used for mutation analysis werc 4.5% and 1.0% nondenaturing polyacrylamide gels (49:1 acrylamide:bisacryla-rride) both with 5% glycerol added and a comrnercial product Mutation Detection Enhancement (MDE *) 9"1 (AT Biochem 50620). Using a combination of these conditions the mutation detection rate by SSCA screening is approximately 80% (Orita et al. 1989; Sheffield et al. 1993; Ranvik-Glavac et aL'1,994; Jordanova et al.'J.,997). PCR conditions and loading 1 Standard hot PCR (10 Ul reaction) is used in conjunctíon with gene specific primers. All primers used are listed in the lvlaterial and Methods section of the appropriate chapters. 2 10 ¡rl of formamide loading buffer (95% deionised formamide, 1 mM EDTA, 0.1% xylene cyanol and 0.1% bromophenolblue) was added to each PCR reaction. 3 Heat denatured at 94C for 5 min. 4 Place tubes directþ on ice. 5 Load2-gpJperwell. 51 2.3.1 SSCA gel conditions 4,5o/o acrylamideþis acrylamide (49:1),5olo glycerol SSCA gel: 40o/o acrylamide '1.4.7 ml 2Y.bts acrylamide 4.5 ml gþerol 5ml SXTBE 20 ml H2O to 100 ml Run gel in 1XTBE buffer for approximately 20 hours at 450V. 10o/o acrylamide/bis acrylamide (49:1),SVo glycerol SSCA gel: 40% acrylanride 245 mI 27obis acrylamide 10 mt gþerol 5ml SXTBE 20 ml H2O upto 100 ml Run gel in 1XTBE buffer for approximately 2L hours at 700V MDE gel The standard gel percentage used was 37.5% MDE solution, run in 0.6XTBE. Tlris gelwas runfor approximately 24 hours at 700V. 52 2.4 Sequencing 2.4.1 Preparation of PCR products. PCR products for sequencing are amptfied as above except for increasing total reaction volume to 100 Uf. 5-10 ¡tl of the resultant products are run out on art 1.0-2.0% agarose gel to check the quality. If a single, clean PCR specific band is obtained, then this product is cleaned using the PCR purification kit described following. PCR products were purified using the QlAquick PCR purification kit (QIAGEN) ensuring the removal of unincorporated nucleotides, primers and polymerase. 1 Add 500 ¡rl of QlAquick PB buffer 100 Fl PCR product. (Large PCR reaction are amplified to increase the quantity of PCR product, thus increasing fecovery. 2 This mixture is transferred to a spin column and placed in the collection tube (both supplied). Centrifuge at fulIspeed for 1 min. Discard flowthrough 3. Add 750 ¡tl QlAquick PE buffer to spin column Spin full speed - 1 min. Discard flowthrough and spin for an additional minute. 4 Transfer spin column to a clean flip top eppendorf tube and air dry DNA on column (room temp). 5 Add 50 ¡tl of HzO to DNA, elute at room temp for 5 min. 6 Centrifuge full speed 1 min - Eluted DNA is collected in the eppendorf tube. 53 2.4.2Parilication of PCR products from agarose gel If there are spurious bands detected when a PCR product is run out on ¿m agarose gel the then appropriate, specific band must be excised from the gel an purified prior to sequencing to avoid contamination and subsequent poor quality sequencing results. The DNA withinthe excised band is purified using the following protocol (Boehringer and Mannheim gel purification kit). 1. DNA is separated on an ageirose gel of suitable concentration (Pharmacia). Runningbuffer used is 1XTBE (45 mM Tris-borate, 1 mM EDTAy pH:8.0) 2 Band of interest is cut from gel removing excess agarose. 3 Add 300 pl of agarose stabilising buffer (buffer2) to agarose. Add 10 ¡rl silica solution (vial1). 4 Incubate 10 min 56-60"C, vortex every 2-3 min. Centrifuge 30s, discard supernatant. 5 Resuspend pellet in 500 Ff DNA binding buffer (vial 3). Vortex, centrifuge and disca¡d supernatant. 6 Wash pellet in 500 ¡tl wash buffer (vial 4). Centrifuge and discard supernatant. Repeat 1 time. 7 Remove all liquid and dry pellet at room temperature - L5 min. Add 20-50 Ul HtO, vortex and incubate at 56-60"C L0 min. Centrifuge and transfer supernatant to a clean tube. I Quantitate DNA. 54 2.4.3 Elution of PCR products from polyacrylamide gels. PCR products representing different alleles from (AC)r. or (CAG)', repeat loci may not be able to be separated well on agarose gels. Thetefore products from these reactions must be separated and excised from a polyacrylamide gel and eluted prior to sequencing. PCR products are amplified as described in section 2.2.1,. t. After autoradiography the film is placed carefully over the polyacrylamide gel and the position of the band of interest is marked on the gel. 2. This section of gel is the cut out and placed into 500 Fl lIrO and eluted for 1- 2 hours - no longer. 3. 1 ¡rl of this eluted DNA is thenused as template in a 100 FIPCR to amplify sufficient product for sequencing and is purified as per 2.3.2. 2.3.4 Dye terminator cycle sequencing All DNA sequencing was conducted using an Applied Biosystems 373 or 377 automated DNA sequencer. Prior to sequencing purified PCR products are run 1.0-2.0% agarose gels to deterrrine quality and recovery of product. Purified PCR products are sequenced using the ABI Prism Dye Terminator Cycle Sequencing Ready Reaction Kit. PCR product 50-100 ng Sequencing prirrrer 10 ng (Forward, reverse) ABI Terminator ready ¡eaction mix 4 pl Half term reaction mix 4 Ul HrO to 20 ¡ú Cycling conditions 96oC 30 sec 50"C L5 sec 60"C 4 min X 25 cycles. 55 Sequencing reactíon are purified wíth ethanol precipitation. 1. Add 50 pf 95% ethanol and2 pf 3M NaAc to sequencing reactions 2. Ice 10 min. 3. Centrifuge at maximum speed 30 min. 4. Remove supematant; wash pellet n70% ethanol. 5. Dry under vacuum. Resultant sequencing reactions were nrn on polyacrylamide gels (373 or 377 ABI sequencing apparatus) at the Department of Haematology IMVS Adelaide. 2.5 Databasee M*y interlinked databases were accessed during the course of this study to quickly and efficiently collect information regarding genetic markers, location of genes, characterised gene polymorphisms and sequence. Those most frequently accessed are listed in the following table: Table I: World wide web (WWW) URLs (uniform resource locators) for most used databases Database URL GDB http:/ /www.gdb.ory/ SHGC http : / / vrww-sh gc. stanf ord. edu/ mapping/ index.htl¡n Whitehead Institute/ MIT http: / / www-genome.wi.mit. edu / cgt-bn/ contig/ phys- maP NCBI \,vww.nc The human genome database (GDB) has collated data concerning human genes, probes, clones, markers and allele frequencies of markers. The site, developed at the Stanford Human Genome Centre (SHGC) provides information allowing radiation hybrid mapping of PCR products (See section 2JJ.01or details). Data pertaining to physical maps of human chromosomes was accessed through the human physical mapping project at the Whitehead institute. One of the most useful sites is that at NCBI (the National Centre for Biotechnology Information). This site contains links to OMIMTM (Online Mendelian Inheritance of Man), BLAST server (Basic local alignment search tool - for sequence comparisons), GenBank, dbEST (a division of GenBank containing sequence and other data for ESTs), Unigene and the human transcrþt map (see Borsani et al. 1998 for review). s6 2.6 Primer design Primers were design for the analysis of lcrown (AC)r, repeat markers and screening for polymorphisms and mutations in candidate genes. Occasionally primers for published microsatellite markers were redesigned for technical improvernent. Primers were designed from appropriate flanJ 2.7 Repeat Expansion Detection aosay (RED) assay Detailed description of thls procedure can be found in Chapter 6. 2.7 .l P reparation of oligonucleotides Oligonucleotides (oligos) used in ligation reaction (following) were purified on 8% polyacrylanide/ 6 M urea gel followed by phosphorylation. Phosphorylation oligo (1 pslÉ) 100 pt 10X PNK buffer 30 trt 100 mM dATP (NEB) 30 pt L mM spernr-idine 30 Ft PNK e u/ Fl (NEB) 10 pl HrO 100 pf *NB PNK: polynucleotide kinase (Boehringer Mannheim) 57 2.7 .2 Re action conditions Cycling reaction 10 ¡rl or 20 ¡tl reactions are performed in a fast capillary thermal sequencer (Corbett Research). Components of the cycling reaction ¿üe as follows: 5 pg genomic DNA 50 ng phosphorylated oligonucleotide (CAG)rz 5U Ampligase (Epicentre Technologies) to L0 ¡tl in supplied buffer Cycling conditions Incubate94C-5min 80"C - 90 sec 94"C - 10 sec X396 cycles 2.7.3 Gel / Hybridisation Electrophoresis 1. Add 4 plformamide loading dye (section2.2.3\ 2 Heat denature 94oC - 5 min 3. Load onto 5% poþacrylarride gel (section 2.2.3) run for 2-3 hours keeping current constant at7OW. Extra care should be taken whenloading to avoid leakage and thus reduce background. 4 Blot gel onto 3 MM \A/hatmann paper and subsequentþ transfer onto N+ membrane (Hybond) using a Hoefer TE-90 genesweep transfer unit. 58 Hybridisation Labelling probe L oligo (10 rlrg/ÞLl) LFl H2o 29 pJ 2 Heat95oC-5min 3 Add [32P]-¿CTP s Fl labelling buffer 10 Ul Klenow enzyme 2 ¡tl (Amersham) Incubate - 10 min at37"C 4 Denature at 94'C - 5 min before adding to hybridisation solution 5 Hybridise in7% SDS / 0.5 M NazHPO¿ (pH=7.0) overnight 6 Wash filter at 65'C in 2XSSPE, O.lo/o SDS - 20 min followed by O.IXSSPE, 0.1%SDS for 20-30 min 7 Expose to X-ray fil¡n for 7-\2 days 2.8 Monoclonal Ab analysis Detail of this procedure can be found in Chapter 6. 2.8.1 Protein extraction (The cell source used for protein extraction was from lymphoblastoid cell lines,) 1 Collect cells in 50ml falcone¡ tube, spin 5 min in Jouan centrifuge (4"C) 2 Wash pellet in 1XPBS spin 5 min in Jouan centrifuge (4"C) Resuspend pellet in approx 1 ml PBS - transfer to 1.5 ml tube 3 Resuspend pellet in 1 X vol TGEK (500 pt minimum) Leave cells on ice 10 rrin ADD INHIBITORS : PMSF -1 mM; PIC - 10 Ft TGEK 50 mM Tris-HCl(pH=8.0) L0% glycerol 5 mM EDTA (pH:8.0) 150 mM KCI 4 Sonicate on ice 5 Centrifuge 4"C - 15 min 6 Keep supernatant - recentrifuge 7 Quantitate 59 2.8.2 Electrophoresis 1 Resolving Gel- 6% (acrylamide: bis acrylamide ;37.5:1) 40% acrylamide 8.50 ml 1.5 mM Tris-HCl(pH:8.8) 12.5 ml L0% SDS 0.5 ml HrO 28.25 ml TEMED 25 Fl APS (L0%) 2s0 ur total 50 ml 2 Pour resolving gel" approximately 1" cm below comb level add small amount of HzO to make gel levef remove before pouring stacking gel. Leave gel to set 45 min - t hour. 3 Stacking geL - 6% (acrylamide : bis acrylamide ; 37.5 :1) 40% acrylamide 2.50 ml 0.5 mM Tris-HCl (pH:6.8) 6.30 ml L0% SDS 0.25 ml HrO 15.9 ml TEMED 25 PJ APS (10%) 12s ú, total 25 ml Pour stacking gel and insert comb. Gels are run in 1% SDS-PAGE rururingbuffer 10% SDS-PAGE running buffer Tris 30.275 g Glycine 1.44.13 g HrO to 1000 ml 4 Mix 20 pl (20 þg,/Vl) protein with 20 pl loading dye (Bme included). Heat at 94C1or 5 mín Load 20 ¡tl into each well Run at 200V for L.5 - 3 hours Appropriate markers weÍe mn on the gel to allow sizing 60 2.8.3 Weetern blot analysis Blotting was carried out by electroblotting, transferring protein onto 0.45¡tm cellulosenitrate membrane (Schleicher and Schuell). The buffer used for electroblotting was as follows: 1OXSDS - PAGE runringbuffer 100 ml Methanol 200 ml H2O 700 mt Electoblotting was carried out at 150 mAmp for 60 min. Filters werewashed with 1XPBS 2.9 Linkage analysis Several linkage programmes were used for linkage investigations. The details are each program is summarise below: 2.9.1 SLINK analyeis The SLINK program (Weeks et al. 1990) provides a simulated linkage analysis for a given pedigree to explore the probability of mapping the disease locus for a specified model of transmission over a range of realistic parameters (such as penetrance). The progtam allows the researcher to set ma¡kers at various intervals (eg 10 or 20 cM) and estimates the likelihood of mapping with markers at these distances. Effectívely SLINK establishes whether a family has enough potentially informative meiosis to detect linkage and by adding and deleting different family members their rel¡ative importance for establishing linkage can be explored. 2.9.2 MLINK analysie The MLINK program (Lathrop and Lalouel1984) allows the rapid generation of two point lod scores in affected pedigrees. Several files must be constructed to run MLINK - the first of these, INFILE, contains data regarding the pedigree structure (family relationships), affection status, liabitity classes (if any) and marker genot¡res. The second, the DATAFILE, has irrfororation on disease gene frequency, penetrance, mode of inheritance and allele frequencies. The linkage support programs (ie MAKEPED, PREPLINK LCP, PEDIN and LRP) make construction of datafiles and running ðt VfUNf faster and easier. MLINK calculates pairwise lod scores at a given recombination fraction for each microsatellite marker (usually set at 0 : 0, 0.01., 0.05, 0.2,0.3, O.4)' 6T 2.9.3 MULTPOINT analyeis Multipoint mapping using LINKMAP takes into account joint probabilities of genotypes at several loci simultaneously, thus overcoming deficiencies caused by markers whidr are not fully informative (Lathrop et at. 1984). Each LINKMAP run assesses up to four markers against the disease locus, moving the position of the disease locus on subsequent runs. Location scores are calculated at positions outside and between sets of markers. Division by 4.6 coverts the location score calculated to lod scores. This multipoint analysis locates the disease gene more precisely than two point data alone and can provide the relative likelihood of location of a disease gene within the most likely marker interval, compared with the next most likely marker interval. 2.9.4EXCLUDE analysis The EXCLUDE program (Edwards,1.987) assesses the results (manually entered into the EXCLUDE data file) of genome wide by two-point lod scores and highlights regions of exclusion and generates the probability of a localisation at the non excluded sites. Results are expressed as a probability of location to a particular chromosome and also the rel¡ative likelihood of that position with respect to the entire genome screen. This analysis is particularþ useful when linkage is not obvious from two point lod scores from the initial screen since it takes into account results from the entire genome. EXCLUDE analysis guides decision making by highlightingregions of the genome where additional markers need to be examined to provide more definite data, either in support of linkage, or in support of exclusion. 2.10 Radiation Hybrid panel - mapping Clarification and confirmation of genetic location of both genes and microsatellite markers is often important when mapping a disease locus for the reduction of genetic intervals as well as ascertaining that a candidate gene truly lies within the region of interest. A medium resolution panel of radiation hybrid clones of the whole human genome was created at the Starrford Human Genome Centre to assist in such instances (Stewart et al. 1.997). Tltts commercially available so called G3 panel has 83 clones and is readily screened by PCR. Results ftom the PCR are entered into a database at http:/ /shgc-www.stanford.edu / *rd here they are analysed and placed within the already characterised framework map. 62 Chapter3 : CONGENITALATAXIAS Page SUMMARY 64 3.7 Introduction 65 3.1.1 Clinicalclassification 65 3.1.2 Genetic classification 66 3.2 Material and Methods 67 3.2.7 Subiects - Clinical description 67 3.2.2 Linkage analysis 70 3.2.2.1Assessment of known SCA loci 70 3.2.2.3 SLINK 77 3.2.3 Genome screen 7t 3.2.3.1 Linkage analysis 7t 3.2.3.2 Two point LOD scoree 7t 3.2.3.3 EXCLUDE 72 3.2.3.4 Multipoint mapping 72 3.2.4 Identiflcation of novel microsatellite markers 72 3.2.5 Candidate genee 73 3.2.5.1 Identif ication 73 3.2.5.2 Radiation hybrid panel screening 73 3.2.5.3 Mutation screening 73 3.3 Results 75 3.3.1. Linkage analysis 75 3.3.1.1 Known SCA localisations 75 3.3.L.2 SLINK 76 3.3.1.3 Genome scr€en 76 3.3.7.4 Chromosome2T - LOD scores: initial pedigree 78 3.3.1.5 Identification of novel microsatellite markere 78 3.3.1.6 Chromosome 21- LOD scoreo: extended pedigree 79 3.3.2 Candidate geneE 83 3.3.2.7 Mutation screening 83 3.3.2.2 r(CN/6 84 3.3.2.3 r(Clv/ls 88 3.4 Genome screen 88 3.4.7 EXCLUDE 92 3.4.2 Multipoint analysis 93 3.5 Diecussion 95 63 Chapter 3 : CONGENITAL ATAXIAS SUMMARY' Mapping studies in a large famíly (PK80284) segregating for congenital ataxia with associated mental retardation or non progressive congenital ataxia (NPCA) indicate linkage to chromosome 3p: maximum two point lod score 4.26 at 0:0 for the microsatellite marker D3S3630. This represents the first genetic localisation for an autosomal dominant pure congenital ataxia. Several plausible candidate genes, with neurological involvement, reside within the genetic interval identified: inositol 1.,4,5 - triphosphate receptor type 1 (fTPR1), neural cell adhesion molecule (CALI) and plasmacytoma - associated neuronal glycoprotein (PANG), but as yet these genes have not been screened for mutations. Significantþ NPCA is the most difficult category of the congenital ataxias to clinically diagnose since within this group considerable clinical heterogeneity exists. For the majority of cases prognosis is not possible from early developmental milestones, neurological signs or neuroimaging (Steinlin et al. 1998a). Thus, this genetic localisation will lead to the eventual identification and characterisation of the disease gene and availability of precise molecular diagnosis and improve prognosis. 64 3.1 Inttoduction 3.1.1 Clinical claosification Published clinical data pertaining to the hereditary congenital ataxias is sparse, based on few familial cases, with limited family material available and assessed. This particular group of ataxias is characterised by early symptoms of hypotonia and developmental delay, with slightly later presentation of ataxia. In generaf the ataxia is a chronic problem, neither deteriorating nor improving significantþ with age, however, improvement is noted in some individuals as they presumably leam to compensate for motor problems (Furman et al. 1.984, Fenichel and Phillips 1989). These disorders can be classified into two distinct grouPs: L) nonprogressive ataxia without additional symptoms (pure congenital ataxia) and 2) syndromes with associated congenital ataxia. Pure congenital ataxia or non progressive congenital ataxia (NPCA) can be due to abnormalitíes such as cerebellar hypoplasia. Accurate diagnosis of the more distinctive syndromal congenital ataxias may be possible by clinical assessment (41 Shawan et al. Lees). The majority of disorders in this group fall into the broad category of pure congenital ataxia and while clinical identification of this class of ataxias is possible, it is a very general classification. Whilst it is commonly accepted that these disorders are clinically and genetícally heterogeneous, a diagnosis of congenital ataxia can be useful for clinical assessment. Early prognosis from developmental milestones/ neurological signs and neuroimaging is difficulq however, follow up of individuals c¿rÍr lead to a more confident clinical diagnosis of these non-progressive congenital ataxias (Steinlin L998a, Steinlin et al. 1ee8b). 65 3.1.2 Genetic classification There has been little genetic characterisation for the congenital ataxias. Mutations in the paired box homeotic gene, PAX6, have been proposed to be involved in the autosomal recessive syndromal congenital ataxia, Gillespie syndrome (Glaser et al. 1994; Dollfus et al. 1,998). Mutations in this same gene have been shown to cause aniridia (absence of the iris). Partial aniridia is an associated phenotype described in patients with Gillespie syndrome, leading to the supposition that this gene may somehow be implicated. Apart from this minor overlap in phenotype, however, there is little evidence to support the involvement of PAX6, and in fact most data suggests the contrary. Glaser et al. (L994) d.etected no changes tr.PAXí by SSCA analysis inthree families with Gillespie syndrome and in the same study two of the families segregated independentþ of the 11pL3 localisation of the PAX6 gene. Further evidence which excludes the involvement of t}lre PAX6 gene in Gillespie syndrome is provided from a study by Dollfus et al. (L998). This group identified a patient with Gillespie syndrome and a de noao translocation t(X;11)(p22.32;p12). T}:re 11,pL2 breaþoint is close to the physical location of the PAX6 gene, however, fluorescent in situ hybridisation and mutation screeningoÍ PAX6 have failed to detect any physical alteration of this gene. To date the only sound genetic information regarding the congenital ataxias has been the genetic localisation of two congenital ataxias, an autosomal recessive s¡mdromal form and an X-linked pure congenítal ataxia. The rare autosomal recessive s;mdromal congenital ataxia, infantile onset spinocerebellar ataxia (IOSCA) has been genetically localised at 1,0q24 (Nikali et al. L995). Although no gene(s) has been identified for this disorder, two potential candidate genes PAX2, a transcription factor, and CyPt7, a cytochrome with a major role in ste¡oid productiorç lie within and close to the critical region respectively. Although CYPIT does not lie immediately within the region defined by ancestral recombination; it was considered as a candidate gene because of the clinjcal finding of hypogonadism in females with IOSCA. Sequence analysis of the coding regions of both these gerres revealed no differences when compared with normal control samples, although mutations within the inttonic sequences (eg splice site mutations) or regulatory regions were not excluded in this screen (NikaÏ et al.t997). 66 The clinically more homogeneous group of pure congenital ataxias with associated mental retardation has only an X-linked form genetically positioned. This pure congenital cerebellar hypoplasia s)¡ndrome has been mapped to a 38 cM interval on the short arm of the X chromosome (Illarioshkin et aL.1996) and remains the only reported genetic localisation to date. Thus, it is important to study families which fall into this clinical category in order to gain an rrnderstanding of the genetic mechanism, with the ultimate goal of elucidating the function of all of the genes involved in these disorders. Thís chapter describes linkage mapping in a single family with non progressive congenital ataxia (NPCA) which does not segregate with the X chromosome. 3.2 Material and Methode 3.2.1 Subjecte - Clinical description (Clinical assessment was undertaken by Dr. Tracey Dudding at Hunter Genetics NSW, Australia.) A large family segregating for an autosomal dominant congenital ataxia was analysed in an attempt to localise and eventually identify the gene involved in the disorder, This farrily consisted of 47 individuals, of which DNA was available and collected from 25 individuals, L5 of whom were classified as affected (Pedigree: Figure 3-1). Clinically this family has non progressive congenital ataxia with associated mental retardation. Ataxia is present from birth and delay in walking has been noted in affected individuals. Older members of the pedigree experience gait ataxia and dysarthria although grr"n the non progressive nafure, symptoms vary in this older generation and affected members often have more mild symptoms as they have apparently learned to compensate for motot problems. Clinical symptoms in several individuals; IL3, IL8, III.L and III.L8 have not been well defined. Individual IL3 has mild clinical signs of the disorder. Individual II.8 was apparently difficult to examine, having received hip damage from a car accident, thus affecting assessment of gait ataxia. Individual IIL1 has not been personally examined by Dr T. Dudding but is thought to be unaffected from information gained by othet family members, however, it is believed that this individual does have dysarthria. Individual III.18 67 is a poor student at school and has nystagmus as the orùy sign of cerebellar ataxia - notably in this male, gait ataxia and dysarthria were absent. Additionally several affected members, III.6 and IV.2, have marked vermal hypoplasia on MRI (magnetic resonance imaging). Flowever, this clinical feature is not universal among apparently similarly affected individuals. Individuals II.6, III.7 and III.9 do not have abnormalities detected on MRI. It is important to note that MRIs have not been conducted on any other individuals and thus, this has not been established as a reliable indicator for phenotype. The phenot¡>e characterised in this family most closely resembles that described by Fenidrel and Phillips (1989). Affected individuals are described to have non progressive ataxia from bfuth. The extent of mental impairment varies both between and within fanrilies. Additionally, magnetic resonance imaging results indicating hypoplasia of the cerebell¡ar vermis was described in some but not all affected individuals (Furman et al. 1985, Tomiwa et al. 'J,987, Rivier and Echerure 'J.992 and Imamura et al. 1993). Although few affected individuals with this, or a similar disorder, have been described the clinical description appears consistent with that described in the family central to the present study. 6B ñ15 16 4 5 7 12 7571 7119 75ô9 71'13 71'14 8066 7121 7565 '16 3 4 18 l9 n 8642 8683 75m 711t 7120 8370 711ô 75ô6 7567 tv 7118 7æ 8684 E6A5 8684 r.E Alfæled male. unaflected male a.o Affected lemaþ. unaltected lemaþ O Unknoì,vn aflectlon slatus Figure G1: pedigree pKeO,2B4 - seg gatíng for conçnital al is ind¡cated in blue. lnitial genotyp¡ng.was done on th¡s sect¡on of the pedigree taiñräy pnromoso¡ãæ zz,z.t,,n1s ãñã lði È;tra tamii! mem ) - ion is refened to as the extended in the text. lndividuals with o identifying four digit numbers have given blood samples for D cô 3.2.2 Linkage analysis 3.2.2.7 Assessment of known SCA loci. While it is unlikely that a (CAG)', expansion at any of the l,rrown late onset SCA loci is involved in this disorder it is possible that another mutation within one of these genes may callse a clinically distinct but allelic congenital ataxia. To test this hypothesis, linkage analysis at SCA loci (SCAI, SCAZ, SCA3/MID SCA6, SCAT and DRPLA) was undertaken to exclude an allelic mutation at one of these genes. The primers wel€ the same as those refened to in chapter 8 (see section 8.3). Additionally, linkage was also tested to microsatellite markers, D10S530 and DL0S'L92, at the chromosome L0 localisation identified for a rare recessive fonrr of congenital ataxia (IOSCA). This was canied out to exclude the hypothesis that this gene might be involved. Analysis of all these markers was conducted on the initial pedigree (Figure 3-1). Primer pairs used in the analysis for chromosome 10 are as follows Dl0S192 Forvr¡ard primer 5'TTA TAC TAG GAA ACA AGG CTT ACC 3' Reverse primer s'GGG CTT AAA TGA ATG AGC AC 3' D105530 Forward primer 5' TCT AGC AGT AAG AGT TGT GTC TCC 3' Reverse primer s'TTG ACA AGG CCA TCA AAA C 3' 70 3.2.2.2 SLINK The initiat pedigree was tested by the SLINK program (Material and Methods chapter 2.9.1) to validate that a genome screen could detect linkage. 3.2.3 Genome Bcreen 3.2.3.1 Linkage analysis Initially 36 microsatellite markers from chromosomes 18-22 were typed manually by the candidate (Materials and Methods chapter 2.2.3), while those for the rest of the genome (a ftrrther 329 microsatellite markers) were typed at Australian Genome Research Facility (AGRF). This service provides, at cost of reagents and labour, automated analysis of family DNA by fluorescent microsatellite marker analysis combined with automated computer genotyping. Data was transmitted back to the laboratory where linkage analysis was carried out. The average distance between markers was 20cM. An additional 17, 5 and l- microsatellite m.arkers from chromosomes 3, !3, artd 21, respectively, were assessed by the candidate to resolve the possible localisations to these chromosomes, as indicated by the genome screen. Primer sequences for analysis of microsatellite markers were obtained from several sources. The majority of sequences are reported in Gyapay et aI. (1.994) *d Dib et al. (1996), whilst others were accessed through CHLC (Cooperative Ffuman Linkage Centre at http:/ /www.chlc.org/). Several other markers were identified through BLAST searches of available genome sequence for chromosome 2L (see below). 3.2.3.2 Twopoint lod scores Calculation of two point lod scores from raw genot¡re data (both manual and automated genotype data) was performed by the candidate. The pedigree structure and aJfection status used in the two point linkage analysis is that indicated in the pedigree (Figure 3-1). The two point linkage analysis was performed using the Linkage 5.2 package (Lathrop and Lalouel 1984) under the assumption of autosomal dominant inheritance and a disease frequency of 1:10 000. The allele frequencies were assumed to be equal for each marker tested. Given that age of onset is early, penetrance was set at 1.00 (Material and Methods 2.e,2). 7l 3.2.3.3 EXCLUDE Results from the two point linkage analysis from the extended pedigree were examined using the EXCLUDE programme (Material and Methods chapter 2.9.4). This procedure condensed genome-wide lod scores to highlight the most probable regions of lirkage, which were then subjected to precise multipoint analysis. 3.2.3.4 Multipoint mapping Multipoint analysis of chromosome 3 markers D}SS1297, D3S3630, and D3S1304 was completed by the candidate (Material and Methods 2.9.3). The genetic distances set between adjacent markers were ascertained from various maps (Gyapay et al.1994, Dib et al.1996). 3.2.4 ldentification of novel microsatellite markers Several microsatellite markers for analysis of chromosome 21 were characterised with the use of BLASTn software. Available sequence in the area of interest was scanned for AC and CAG repeats not previously described and published. Unique sequence flanking these repeat regions was sought to make primers for the analysis of these repeats in the family (PK80284) (see Material and Methods chapter 2.6). Primer sequences for these novel microsatellite markers are as follows: PAC 21-1GT Forward primer 5' GAG AAC CCA ACT AAA GCA TG 3' Reverse primer 5' ATG CAT GCA CAC AAA GCT ACG 3' PAC21-2GT Forrr*rard primer 5' TCA TAC AGT CAC CTG AAT ACC TTG 3' Reverse primer 5' GAT TAT TTG ATG GGA TCA AGA GAC A 3' 72 Primer sequences designed by the candidate for the analysis of an AC microsatellite marker in the vicinity of a candidate gene, IÇCNIS are listed below: KCNn5 Forward primer 5, GAT CAG CAC TCC TCA GTG 3' Reverse primer 5'TCA CTC TTT GGT GAG CCA 3' 3.2.5 Candidate genes 3.2.5.L Identification Database searches for candidate genes or additional polymorphisms within the region of interest of chromosomes 3 and 21. were undertaken using the following URL sites: GDB http:/ /www.gdb.ory/ GenBank http: / / www.ncbi.nlm.nfü .gov / W eb / GenBank/ UniGene http: / / www.ncbi.nlm,nih. gov/ UniGene/ Thehuman transcript map http: / / www.ncbi,nln.nfü .gov f genemap / IÂtrhitehead institute http : / / www- genome.wi. mit. edu / OMIM http: / / www.ncbi.nlm.nih.gov/ Omim/ 3.2.5.2 Radiation hybrid panel screening Clarification of more precise genetic location of candidate genes was achieved with the use of the G3 radiation hybrid panel. This panel of human genomic segments allows accurate genetic placement of PCR products from the candidate genes with respect to lrrown anchored sequenced tagged sites (Material and Methods chapter 2.10). 3.2.5.3 Mutation screening Several candidate genes were identified and screened for potential mutations. Mutation screening was achieved by the SSCA method. Three different gel systems, MDE gels, So/o and1.\o/o polyacrylamide gels (with the addition of 5% glycerol) were used for the screening of potential candidate genes (Material and Methods chapter 2.3). The primers used for the analysis of KCN/6 are indicated in Figure 3-4 (see results section 3.3.2.3) and primer sequences are listed below in Table 3-1. The primer sequences for this 73 gene were taken from Genbarìk (NM002240). After manual assembly of intron exon boundaries in Figure 3-4 the primers indicated were s¡rnthesised in order to cover the entire coding region of the gene and the available flanking intronic sequence. Table 3-1: Primers sequences used for the in the mutation screening of the I(CN/6 gene. r(cN/6 3W-F s', CGC TAC CTG ACC GAT ATC TTC 3', KCN/6 3W-R s', CAG GGT CTC TGC CCT CTT CT 3', KCN/6 - 3R s', ATG AGA GAC AAG GAA AGA TTG TG 3', KCN/6 - 9F s', AAA GAG CCA GCC TTT CAT TC 3', KCN/6 - 10R s', CTA TGT GGT CCA TGT CTC C 3', KCN/6 - 11F s', ATG ATC TGG TGG TTG ATC GC 3', KCN/6 - 12R s', TGA ACT CCC CCT CCG AGG TC 3', KCN/6 - 13F s', ACA TTG TGG AGG CTT CCA TC 3', KCNI6 - PCR1sF s',CAT GGA AAG CCC ACA CTT AC 3', KCN/6 - PCR1sR s', GAC CAA CTC AGG GGC AGC TC 3', F =Forr,r¡ard primer; R: Reverse primer The primer pairs used in the analysis of the KCNIS gene are indicated in Figure 3.5 (see results section 3.3.2.3) and primer sequences are listed in Table 3.2, following : Table 3.2: Primer sequences for amplification of exons and flanking intronic sequences of the KCNIS gene: KCN/15 1.0 F1 Forwardprimer 5'ATC ATC GGGGGT CAG TT 3' 1.0 R1 Reverse primer 5' GGG AGC CAT GC'C CCT CT 3' 2.1F2 Forward primer 5' TCA CAT GAT GAT TCT AT 3' 2.1R2 Reverse primer 5' AGT GGC AGC GAA CAG GG 3' 2.2F3 Forward prirner 5' GTG GAG ATA CAA ACT CA 3' 2.2 R3 Reverse primer 5' TGA CGT GGG TCT GCA GG 3' 2.3 F4 Forward primer 5' GAT TCA GTG CCA GTC CT 3' 2.3 R4 Reverse primer 5'GAA ATC AGC CAC ATA TT 3' 2.4F5 Forward primer 5' TGT GCC TGT GGT ATC TC 3' 2.4 R5 Reverse primer 5' TAG CCA CAA GAT CAA AG 3' 2.5 F6 Forward primer S'CTG CAC GGA CAT ACA AA 3' 2.5 R6 Reverse primer 5'GGT ATT ACC ACA TAG AC 3' 74 3.3 Results 3.3.1 Linkage analysis 3.3.L.1 Known SCA localisations Linkage analysis revealed that the gene segregating in this family with congenital ataxía was not any of those for the already identified loci (SCA1 ,2,3,4,5,6,7,10 and DRPLA), excluding the possibility of a different type of mutation in these genes. Further, CAG repeat expansion analysis revealed that there was no expansion in affected members of this famiþ (PK80284) for those genes lcrownto have CAGexpansions associated with SCA (SCAL, SCAZ, SCA3, SCAT and DRPLA) (results not shown). Additionally, microsatellite markers linked to a rare autosomal recessive disorder IOSCA, located at 10q24, were screened; again no evidence of linkage to this locus was found, Linkage analyses for all of these sites are in tables 3-3,3-4 following: Table 3-3: Two point lod scores for (CAG)', repeat polymorphism at lcrown SCA loci in family PK80284 (NPCA). Two point lod scores at 0 : MARKER O.OO 0.05 0.1 0.2 0.3 0.4 SCAl -infinity -3.60 -2.48 -1.30 -0.68 -o.29 SCA2 -infinity -1.37 -o.73 -o.21 -0.06 -0.05 SCA3 -infinity -4.86 -J.l/ -r.57 -o.75 -o.26 DRPLA -infinity -2.57 -7.87 -1.O2 -0.53 -0.2r SCA6 -infinity -3.1.6 -2.O3 -0.98 -0.45 -0.15 K.A7 -infinity 0.1 0.30 0.40 0.35 o.21 75 Table 3-4: Two point lod scores for microsatellite markers at SCA localisations- chromosome 16 (SCA4), chromosome L1 (SCAS) chromosonte 22 (SCA) and chromosome 10 (IOSCA) and family PK80284. Two point lod scores at 0 : MARKER O.O 0.01 0.05 0.1 o.2 0.3 0.4 D165402 -infìnity -2.O9 -0.88 -o.52 -0.38 -o.32 -0.L5 D165393 -infinity --6.70 -3.O7 -1.79 -o.72 -0.29 -0.10 D115903 -infinity -5.88 -3.42 -2.28 -L.18 -0.59 -o.23 GATA -infinity --3.09 -7.72 -1.14 -0.59 -0.30 -0.11 D115905 -infinity -5.38 -2.71 -1.63 -o.69 -o.26 -0.06 D105530 -infinity -'1.39 -0.72 -o.44 -0.19 -0.08 -0,02 D105192 -infinity -2.19 -0.88 -0.38 o.o2 0.74 0.12 D225274 -infinity -3.\L -L.76 -1.18 -0.58 -o.24 -0.06 3,3.1.2 SLINK results Results fron the simulated linkage studp SLINK are indicated in Table 3-5. (see lvlaterial and Methods section 2.9.1, Í.or details), These results clearly indicate that there is high probability of detecting linkage to the disease gene in this family, assuming that the one gene is responsible for all affected individuals in this family. Table 3-5: SLINK results for simulated linkage infamily PK80284-initial pedigree. Lod score Probability 1 85% 2 78% 3 69% maximum lod score [4.81 3.3.1-.3 Genome screen Commencement of a manual genome screen, which is both laborious and time consuming, was undertaken on the initial pedigree (Figure 3.1) in an initial attempt to assign the gene to a chromosome. Microsatellite markers along the length of chromosomes 18-22 were screened first. Two point linkage analysis of results from these chromosomes initially indicated that there was potential linkage to chromosome 2L (Table 3-6 and Pedþee; Figure 3.2). Lod score results for chromosomes 1.8-20 and22 are given in Appendix I. 76 2 4 71'15 12 l1 25 23 16 41 13 12 34 22 16 5 52 I 10 12 7565 7571 71 19 7569 7'113 7114 8065 7121 D2'1S1904 11 12 22 22 22 22 22 02151256 11 i4 34 13 31 ,l '1 5 51 D21 S1257 23 24 'I 5 43 5't 23 32 D21 S1253 2g 33 2 !+ 23 51 22 Dã51252 i6 67 5 56 14 56 e7 D2t5270 44 13 21 21 21 21 13 D215267 11 33 33 21 13 33 33 Dã51255 63 71 47 47 34 61 47 71 DãS14s9 '1 3 32 s2 11 11 32 21 32 21 D21S1¡140 13 21 921 s2 't1 11 DãS26e 42 12 14 33 22 1 42 021S168 32 41 s4 32 31 41 02151690 43 49 54 54 35 43 5 43 3 D-2151260 22 23 B2 32 2'l 23 23 D215212 54 23 45 1s) -1 4 23 Dã51890 2g 76 21 6 76 16 n 4 16 8€42 E6E3 v17 7120 711 6 75ô6 7567 7570 4370 21 22 21 22 22 22 22 22 '1 't3 51 '1 1 41 41 31 11 1 '12 35 35 45 55 51 45 52 34 32 23 22 13 13 43 ôí 52 25 46 46 66 61 17 22 D21 11 11 23 -3 13 13 -: 33 33 41 13 17 27 74 41 45 33 54 47 12 33 33 12 22 22 21 22 22 21 12 33 33 12 4s 23 42 34 54 41 12 24 24 43 31 42 34 54 24 44 4g 24 25 34 23 31 22 42 12 21 45 15 22 12 47 ;; IV 3 E684 86€6 6686 7114 7s68 12 '12 '12 32 2 24 11 11 11 4 55 52 55 43 3 22 21 'I 22 33 15 56 12 34 4 11 21D21æ70 ì1 t'¿ 31 4'1 ;. 54 53 34 53 6¿ 23 31 23 21 11 21 23 31 23 ¡,o Aflæted mdê, unalf€o-ted mal€ 63 !r* 52 24 53 a, O Aflæted temal€, unatfæled female 32 23 34 24 @ UnlooMsffæ1im6taùJs 45 'l 42 22 45 4 12 23 12 'I 1 21 31 42 3.3.\.4 Chromosome2l - LOD scores: Initial pedigree Haplotype analysis from chromosome 2L was determined on the section of the pedigree (Figure 3.1) initially collected for linkage analysis. Additional family members wet€ collected during the course of the study in an attempt to clarify the possible gerre localisation on chromosome 2L. Two point lod scores indicated linkage al-rrost along the entirety of the chromosome, with one lod score of greater than +3 achieved. (Table 3-6 pedigree; Figure 3-2) The microsatellite marker D215270 revealed no recombination with affected or unaffected individuals in the initial pedigree (no results were obtained for the extended pedigree). The lod score at D215270 (z(max):3.31 at 0:0.00), however, is a probable artefact since extended haplotype analysis of additional markers in this region indicated that that D2lS270 is a recombinant in individual IV.2. The genotype of the mother of this individual is uninformative making this recombinant undetectable when D21S27O is considered alone (Figure 3-2). These data were reliant on the affection status as given in Figure 3-1. 3.3.1.5 Identification of novel microsatellite markers In order to help clarify the conflicting and inconsistent haplotype date, new microsatellite markers in the regions of interest were sought. Two microsatellite (AC)n markers were identified from BLASTn searches of available PAC sequence of chromosome 21 (Accession number 265A22) - PAC 21-1,GT and PAC 21-2GT (Material and Methods- section 2.5). These markers were physically mapped using the Stanford radiation hybrid panel and shown to reside distal toD2lS\256 (Material and Methods-section 2.10). The repeat l*gth of these microsatellite markers in the PAC sequence were 24 and 1.9, however, both these markers were uninformative in this family (data not shown). 78 Table 3-2: Two point lod scores for chromosome 21. microsatellite markers and initial pedigree (PK80284) (individual IV.2 coded as affected). Region in bold is indicative of linkage; however, assessment of markers in this region failed to reveal a marker which was non recombinant in individual IV.2 - results for D215270 are discussed in 3.3.1,.4 Two point lod score at 0=o MARKER O.O 0.01 0.05 0.1 0.2 0.3 0.4 zg max D2751904 -infinity -2.O9 -0.88 -0.52 -0.38 -o.32 -0.15 -0.15 0.40 D2151256 -infinity o.64 1..19 1.31 1.27 o.93 0.52 1.31 0.10 D21.571 -infinity o.67 7.23 1..34 7.23 0.95 0.54 7.34 0.10 D2751257 -infinity -3.55 -0.95 -0.01 o.64 o.71. 0.48 o.71 0.30 D2151974 -infinity -3.10 '7.72 -1.74 -0.59 --0.30 -0.11 -0.11 0.40 D2151253 -infinity -o.92 o.24 0.53 0.51 0.25 0.01 0.53 0.10 D2151258 -infinity 1.96 2.43 , /L' 2.O5 1.45 o,72 2.43 0.05 D2t9tgt0 -infiniÇ o.7L 1.84 2.LO 1.94 1.43 o.73 2.to 0.10 D2751252 -infinity 2.28 2.72 2.68 2.24 1.58 o.77 2.72 0.05 D27s.270 3.31 3.26 3.04 2.76 2.15 1.45 o.67 3.31 0.00 D2tS267 -infinity o.o2 0.59 o.73 0.68 0.46 0.16 0.73 0.10 D2151255 -infinity 2.45 2.88 2.83 2.36 7.67 0.81 2.88 0.05 D2751439 -infinity 7.77 1.84 1.99 1.80 7.32 o.64 1.99 0.10 D2tSL440 -infinity 1.77 1.84 1.99 1.80 1.32 0.64 1.99 0.10 D2rS268 -infinify 0.16 1.32 1.62 1.56 t.t6 0.59 1.62 0.10 D215168 -infinify 2.15 2.60 2.57 2.16 1.53 o.76 2.60 0.05 D21S1893 -infinity 0.34 o.92 1.05 1.00 0.78 0.45 1.05 0.10 D2151260 -infinity o.21 0.80 0.95 o.93 o.74 0.43 0.95 0.10 D215272 -infinity -o.67 0.61 0.98 1.08 0.87 0.51 1.08 0.10 D21S1890 -infinity -1..84 0.04 o.67 o.96 o.82 o.47 o.96 o.20 3.3.7.6 Chromosonte 2! - LOD scores: extended pedigree Several opposing assumptions with regard to the affection status of certain individuals in this study were considered in an attempt to explore if any region of chrorrosome 2L might be involved in this disorder. Details of these assumptions are outlined in the discussion of this chapter. Haplotype analysis of markers when individual IV.2 is assumed to be unaffected and subsequent linkage results based on the initial pedigree information suggest 79 that the region of interest is between microsatellite markers D21.5268 and D21S1257. T\e genetic distance between these markers is estimated to be approximately 12.4cM (see pedigree: Figure 3-2, Figure 3-3). If individual IV.2 is assumed to be affected an alternate region is indicated, placing the disease genebetweenD21,S26S and D215I439. This is based on speculation that the recombination event in IL3 was below the mutant gene and in IV.2 above the mutant gene (Figure 3-2). Examination of additional family members (extended pedigree) however, did not support these locations (Figure 3-2, Table 3-8). However, given that the clinical information for several individuals was uncertain and the fact that several candidate genes lay within the regions of interest it was decided to test the best candidates for potential mutations before proceeding with a laborious total genome screen. Table 3-7: Two point lod scores (chromosome 2L microsatellite markers) for initial pedigree (PK80284) (IV.2 coded as unlmown status). Regions in bold is strongly indicative of linkage. Two point lod scores at 0 = MARKER O.O 0.01 0.05 0.1 O.7 0.3 O.4 z 0 max D2151904 -infinity -2.09 -0.88 -o.52 -0.38 -o.32 -0.15 -0.15 o.40 D2tst256 2.37 2.33 2.19 2.Ol 1.60 1.15 o.62 2.37 0.00 D2tst7 2.41 2.37 2.23 2.04 1.63 7.17 0.ó3 2.41 0.00 D2157257 -infinity -1,85 0.05 o.69 1.O4 0.93 o.57 1.04 0.20 D2151974 -infinity -7.40 -0.72 -0.44 -0.19 -0.08 -o.o2 -0.02 0.40 D2157253 -infinity o.78 1.24 1..23 0.91 0.47 0.11 1.24 0.10 D2LSt258 3.72 3.66 3.43 3.72 2.44 1.67 0.81 3.72 0.00 D21S1910 -infinity 2.41 2.84 2.79 2.33 1.65 0.83 2.84 0.10 D2t9t252 4.O4 3.98 3.72 3.38 2,U 1.80 o.87 4,O4 0.00 D2LS270 3.31 3.26 3.04 2.76 2.L5 1,45 o.67 3.3L 0.00 D2tS267 1,75 7,72 t.59 1.43 1.08 0.68 o.26 1.75 0.00 D21S1255 4.21 4.15 3.88 3.53 2.76 1..89 0.91 4.21 0.00 D2t9t439 2.85 2.87 2.84 2.69 2.20 1.54 o,74 2.87 0.01 D2tsr440 2.85 2.87 2.84 2.69 2.20 L.54 0.74 2.87 0.01 D215268 -infinity 0.16 1..32 7.62 1.56 7.1.6 0.59 1.62 0.10 D2751,68 -infinity 1..86 2.32 2.32 1..95 1.38 o.69 2.32 0.05 D2tSL893 -infinity 0.04 o.& 0.80 0.80 0.63 o.37 0.80 0.20 D2157260 -infinity -0.09 o.52 o.70 o.73 0.59 0.35 o.73 0.20 D2152\2 -infinity -0.90 0.33 o.72 o.87 o.73 o.43 o.87 o.20 D21S1890 -infinity -2.t3 -o.23 o.41 o.76 0.67 0.39 0.76 0.2Ô 80 Distance (in cM) Marker Gene D21S1904 8.7 D2151256 12.4 D2151257 1.9 D21S1914 1.1 D2151253 4.5 D2151258 10.1 KCNEl Ð2151252 l 2.6 t D21S.270 0.5 KCN,]6 t D215267 l 1.0 t D21s1255 D21S1,lil9 1.5 D21s1440 KCNJ15 t D21s268 l 3.8 D21s1 88 t D21s1893 3.5 t D21S1260 6.1 D215212 t D2151890 Figure 3-3: Location of potassium genes, KCNEI, KCN.6 and KCNJ15 with respect to microsatellite markers on chromosome 21. Not all markers are indicated with genetic distance - markers D2151440, D2151439 and D215212are placed in a region as exact genetic distances are unknown. Distances are taken from Dib et al. 1996. 81 Table 3-8: Two point lod scores for chromosome 2L microsatellite marker and extended pedigree-(individual IV.2 affected). (Results from D215270 are indicative of linkage, however, assessment of markers close to this region indicate recombination events - Figure 3-2.) Two point lod scores at 0 = MARKER O.O 0.01 0.05 0.1 0.2 0.3 O.4 z O max D2751904 -infinity -3.57 -1.64 -0.95 -0.45 -o.26 -o.72 -0.12 0.40 D2151.256 -infinity t.70 2.17 2.17 1.84 1.33 0.72 2.77 0.05 D21.511 -infinity -o.37 0.82 1,15 1.18 o.92 0.52 1.18 o.20 D215L257 -infinity -2.42 o.o7 o.87 1..23 1.O4 o.6L 1..23 0.20 D215L914 -infinity -5.84 -3.11 -2.00 -0.98 4.46 -o.17 -o.L7 0.40 D2751253 -infinity -2.06 -o.25 0.28 o.44 0.25 0.04 o.44 0.20 D2151258 -infinity 1.13 2.21 2.4L 2.15 1.56 o.77 2.27 0.05 D2151910 -infinity -2.03 0.45 1..24 1.55 1.27 0.ó8 1.55 0.20 D2151252 -infinity 1.14 2.23 2.42 2.16 L.57 o.79 2.23 0.05 D2tS270 3.31 3.26 3.04 2.76 2.15 1.45 o.67 3.31 0.00 D2tS267 -infinity -2.76 -0.83 -o.14 o.29 0.31 0.13 0.31 0.30 D2151255 -infinity -o.29 7.49 1.97 1.98 1.51 o.76 1.98 o.20 D275L439 -infinity o.24 1.54 1.90 1.85 1.38 o.69 1.90 0.10 D21.5'1.440 -infinity o.24 1.54 1.90 1.85 1.38 o.69 'i..90 0.10 D215268 -iofinrty -o.70 1.09 1..60 1.65 1.25 0.63 1.60 0.10 D215168 -infinity 1.30 2.37 2.55 2.25 1.62 0.81 2.55 0.L0 D21S1893 -infinity -0.68 0.53 0.89 0.99 0.81 o.47 o.99 0.20 D2751.260 -infinity -2.53 -0.60 0.10 0.55 0.57 0.38 o.57 0.30 D215212 -infinity -0.61 o.61 0.98 1.08 o.87 0.51 1.08 0.20 D21S1890 -infinity -1.84 0.04 o.67 o.96 0.82 o.47 o.96 0.20 82 3.3.2 Candidate genes Mining of several public databases (listed in the Material and Methods section 3.2.3.1), revealed the presence of greater than 20 previously characterised genes in and around the interval between D2LS268 and D21S1257. Avatlable information concerning these genes ranged from limited infonnation to fully characterised sequence and function. Of those genes identified by computer searches the more interesting ones to be considered for potential candidates are listed below: soDl - superoxide dismutase GRlI(1 glutamate receptor iontropic kainate 1 DSCRRl Down syndrome chromosome region L protein MNHB minibrain (Drosophila homolog) KCNEl potassium channel KCNI6 potassium channel r(cN/l5 potassium channel PCP4 brain specific polypeptide 3.3.2.7 Mutation ecreening Before a total genome screen was undertaken several plausible candidate genes located on chromosome 21., I(CN/6 and KCNIS, were assessed by SSCA to exclude them as candidates or to identify potential mutations in the family (see discussion for detailed explanation). Additionaltry, arry polymorphisms detected within the gene(s) or previously identified by other groups were typed through the extended family to identify potential recombinants (Material and Methods -section 2.3.1). 83 3.3.2.2KCN16 Mapping by radiation hybrid panel placed this gene between the markers D215270 and D215267 (Figure 3-3). Screening of coding exons was undertaken according to Figure 3-4. Further several intronic boundaries were able to be screened using various combinations of primers. Several previously described polymorphisms were detected" however, SSCA analysis of affected individuals (IL6 and III.7) on three different gel systems did not reveal any aberrant bandshifts when compared to normal individuals in the same family and normal blood bank control samples (results not shown). A previously described mutation in the Tfieñaer mouse was identified in the H5 pore region of the mouse homolog of KCN/6. This region was scleened by SSCA analysis in family PK80284. Results indicated that there was no abnormal band detected in the affected individuals although a previously reported polymorphism was detected. There was no recombination with this polymorphism detected (Figúe 3-5)' Although not fully informative, the combined haplotype analysis of the three polymorphisms indicates that there is no recombination between this gene and the initial pedigree, however, a recombinant was detected on analysis of the extended pedigrees (Figure 3-5). This was consistent with linkage data from this region. 84 lnùon 4 Ð(on4 158 15F+ 43sbp + 10F+-+<- Æ7fr 10R 3F 248bo 3R !! 27.arp 4 l¡E æsbp 11R<- 13F-+'+ 215bo 13R 3WF+ 387bp 3WR<- 12F 2Æ 1n 14F 149bp 14R +'<- + + Oo Ln * * ** ** * t******* 1 23 4 5 6 7 I 9 10 11 12 13't4 15 1617 18 19 20 21æ n 24 is E !: e F F = ÊËFÞFgËFgËÈEË88 withh th€ mus homolog of rophiil deleded hqe wæ a pdymoryh¡s al this lds. * Afiæled ind¡viduals de lndlcated whh il alerisks 3 4 11 12 12 't4 16 4 5 10 11 12 7571 71 19 80ô5 7't21 7565 11 12 11 1't 12 11 12 21 12 21 12 't2 12 12 2'l 12 12 16 18 19 71m 7566 7567 8682 8683 22 12 I 11 'I 1 11 't2 2 12 12 22 21 / 12 11 2 12 12 '! 22 21 21 12 2 2 8684 8685 2 22 2 IV 1 2 2 2 2 22 1 ¡ , O Afl€cted mle, unsfæted mal€ a,O Afiæ'ted lmale, unafæled femalo O Unkrcwn dfæi¡on staùs nucleotide Primer I 106 F1 209 290 351 R1 449 551 651 751 856 965 IOTl rt76 r28t 1387 I49l 1560 t70l 1805 1896 2020 2t2a 2236 2339 2443 F2 2552 2623 2685 2'146 F3,R2 2808 2871 2933 2996 3056 3120 3laz F4,R3 3y+4 3306 3369 3430 3492 F5 3554 R4 3616 3676 373'7 3799 F6 3861 R5 3924 3986 4W 4llt 4t'75 B6 421A 438-5 4493 4596 4102 4808 4913 Figure 3.6: Blast comparison of complete cDNA sequence lor KCNJ1S (Accession number U731 91 against genomic sequence (Accession number 4P000021). Exons are indicated in upper case while introns are indicated in lower case. Forward primer sequences are highlighted in pink, reverse primer sequences are hþhlightedin blue. Primer sequences are listed in the material and methods section (3.3.2.3). 87 3.3.2.3 r(CIV/ls Mapping by radiation hybrid panel placed this gene between the markers D2LS1255 and D275268 (Figure 3-3). Primer sequences were designed after available genomic sequence ü/as compared with known cDNA sequence (accession number Y10745). Appropriate design of these primers enabled all exons and flanking intron sequence to be assessed (Figure 3-6 - previous page) SSCA analysis of affected individuals on three different gel systems did not reveal any aberrant bandshifts when compared to normal individuals in the same family and normal blood bank control samples. Additionally no variants wete detected in any individual tested. A new microsatellite repeat marker was identified approximately 7 kílobases upstream of exon L of the KCN/15 gene, thus creating a new polymorphic marker for use in screening the family. \ ¡hilst not extremely inforrnative, this microsatellite marker did reveal a total of 4 alleles with an estimated heterozygosity of 69%. No recombination was detected in the àxtended family for this AC repeat matker although section B of the family was entirely unirrformative (results not shown). 3.4 Genome screen The two point lod score analysis of entire chromosome 21 markers wíth all available data was unable to refute or confirm a chromosome 2'J. location, prompting an entire genome screen to search for an a-Ltemative localisation. Automated genotyping to complete the analysis of the genome was undertaken at the AGRF. This service generates ra\ / genotype data whiclr can then be readily analysed by linkage programs (ie MLINK); all linkage analyses were undertaken by the candidate. Markers examined were spaced on average 20 cM apart. Two point LOD scores were calculated using the extended pedigree in Figure 3-1. IndividualsIll.T and IV.6 were not analysed for all markers due to exhausted and limited DNA supplies respectively. Results from the entire genome screen are in Appendix I. Analysis of the genotype data obtained revealed several regions of potential interest, 88 including chromosomes 3, L3 and 2L. Surprisingly, a lod score of +3 was achieved at two regions (D215270-detected in the initial manual genotyping and D13S175); however, subsequent analysis of additional markers in these areas revealed recombinants, excluding these regions. Results from chromosome 2'J, are discussed in the previous section while chromosomes 3 and 1.3 is discussed in the following section Chromosome 1.3 Microsatellite markers atD1^3S175 were only partially informative;, however, there were no recombinants detected at this locus (Figure 3-7 and Table 3-8). Analysis of the microsatellite marker D13S283 (ScM proximal to D13S175) gave no evidence of linkage at this site excluding linkage for more than 10cM either side of D13S283, suggesting that the lod score associated with D13S75 was probably a chance observation (Table 3-8). Table 3-9: Two point lod scores for chromosome L3 microsatellite markers. Two point lod scores at 0 = MARKER O.O 0.01 0.05 0.1 o.2 0.3 0.4 D135175 3.10 3.O4 2.81 251 1.88 7.19 o.49 D135283 -infinity -4.89 -3.19 -2.55 -7.57 -0.40 -o.27 Chromosome 3 The microsatellite markers D3S3630 gave a lod score suggestive of linkage (z =2.89 at 0=0.05). Additional markers at this possible chromosome 3 localisation were assessed to clarify the possibility of linkage to this region (Table 3-9). Individual II.8 was difficult to examine due to hip injuries sustained in a car accident and therefore was assigned unknown affection status to assist determining genetic location. A maximum lod score of 4.26 (0 = 0.00) was attained for the microsatellite marker D3S3630. Results from haplotype analysis (pedigree - Figure 3-8) indicate the that the disease gene lies distal to D3S1304 on tip of chromosome 3p. 89 3 4 7115 1 i0,1',l2 14 4 5 I 12 7571 7119 7569 7'113 7114 60e5 7565 110,1æ 110,110 110,110 110,110 112,1n 1 10,120 1 ^2110,110 1 10,11 0 4 16 8682 8663 7570 7117 71æ æ70 7116 75&ì 7567 110,112 1'10,112 110,112 l t0,'1 12 110,110 110,116 110,120 110,1ã) t1ô,11ô 7114 75€6 æa4 86€5 8686 IV 108,112 110,110 r10,116 110,116 I , tr Alfæled mal€, unaf€cN€d målo a,O Alfslsd fffiale, un8fiecl€d lemale ø Figure3-7: Genotype data for microsatellite marker Dl3S175. Allele 11.0.segregates with disease status. Due to the low informativeness of this mäker,and fact thai ho recomhinatants for both atfected and unafüected individuals are detected, a lod score above +3 was obtained. Results from microsatellite marker D135283 were more informative and excluded this region (see results for details). \0 O 5 t¡s1so7 ûs1æ7 ttæ¡M re18tt3s1304 5 7 8 12 12 2 22 32 4 24 42 2 21 41 5 6065 11 32 2 13 4 41 3 21 4 4 3 4 20 4 15 18 71?o 868¿ 8684¡ 7570 25 7116 7ffi 7#t ffr 23 2 23 23 4 21 12 46 2 21 21 5 6 91 14 1 t1 21 5 1 22 42 2 24 13 2 33 13 51 1 l3 42 5 tv 7114 712 8A84 86€5 8666 fril 22 2 12 12 41 2 32 32 52 2 21 21 45 I 32 32 62 2 21 ¡,tr Afiect€d malo. unaffæt€d mde 32 I 21 a.O Affed€d lmal€, uatlæ't€d fmd€ O Lhloom ailæliff Sat6 nf - no lwll green. Figure 3-8: Haptotype anatysis of chromosome 3 microsatellite markers in family .1599281.3.)p€rent.9r.s.eaqq. ¡a.plojVPp is. indicated in Råombinant eùent3'in indivÍduats ttt.11 and lV.3 indicate that the disease gene liesdistal to D3S1304. lndividual ll.8 (indicated in green) inherits the tffected napOtype. This indivudual sustained hip injuries in a car accident,Ihus clinicat assessment of this individual is unclear. For two point linkage analysis this individual was coded as unknown affection status. (o î Table 3-10: Initial two point lod scores for extended pedigree and chromosome 3 microsatellite markers - Individual II.8 coded as unaffected Two point lod score at e= MARKER O.O 0.01 0.05 0.1 o.2 0.3 0.4 D3S1307 -infinity t.26 L.77 1.81 1.55 1.09 0.53 D351297 -infinity 1..72 2.L9 2.18 1.85 1.35 o.73 D3S3630 -infinity 2.49 2.89 2.79 2.25 1.50 o.66 D3S1304 -infinity -o.56 7.22 1.71 L.73 1.30 0.67 D35\263 -infinity o.70 1..80 2.O2 1.80 L.27 0.60 D352338 -infinity -0.56 1.22 1.71. \.73 1.29 0.63 Table 3-L1: Two point lod scores for extended pedigree and microsatellite markers onchromosome 3 - Individual II.8 coded as unlmown. Two point lod score at 0= MARKER O.O 0.01 0.05 0.1 o.2 0.3 0.4 D351307 3.01 2.96 2.77 2.51 1.94 1.31 0.61 D351297 3.87 3.O2 2.85 2.68 1.85 1.35 o.73 D3S3630 4.26 4.L9 3.89 3.49 2.65 1..72 o.74 D3S1304 -iofinity 1.14 2.22 2,41 2.\2 1.51 o.75 D3SL263 -infinity o.41 1.53 1.77 7.60 1.13 0.54 D3S2338 -infinity -0.86 0.94 1.45 1.52 1..74 o.57 9T 3,4.1 EXCLUDE resultg Using data from the initial pedígree, results from the EXCLUDE analysis support the same regions indicated by two point linkage analysis, confirming that regioru on chromosome 21. and 3 are the most likely locations for the congenital ataxia disease gene segregating in the family (PK80284) exanrined. Although the probability indicates that the disease gene is most likeþ on chromosome 2L (89y"), the results for likelihood of most likely position indicate greater involvement of chromosome 3 (Table 3-12). Additional markers in these regions were tested in the farn-ily to identify which of these regions is more consistent with linkage (results in previous section). Haplotype analysis is consistent with the location of the disease gene b"i.g on chromosome 3, assuming an unlorown affection status for individual II.8 (Figure 3-8 previous page), This individual is difficult to examine due to hip da-mage resulting from a car accident. All other individuals assigned both #fected and unaffected stafus have haplotype results consistent with a chromosome 3 localisatioru urrlike the situation for chromosome 21 (Figure 3-2). EXCLUDE analysis represents a simple and rapid means of highlighting possible regions for linkage, based on lod scoÍes obtained from the genome screen. These regions then need to be examined for additional markers analysed by more precise multipoint methods. 92 Table 3-12: Exclude results from lod scores genome screen of 20 cM coverage of microsatellite markers; (Probabilities are expressed as percentages, Max likelihood = maximum likelihood: likelihood of the most probable position - rounded up to whole number). Chromosome Probability (%) Max Likelihood 1 0.08 331,1 2 0.00 5 3 10.62 4717186 4 0.00 1, 5 0.00 2 6 0.00 1 7 0.00 12 I 0.03 2976 9 0.00 1 10 0.00 20 11 0.00 1 72 0.00 40 13 0.00 1271, 14 0.00 1 15 0.00 3 16 0.00 6 17 0.00 9 18 0.00 1 19 0.00 6 20 0.00 1 21, 89.27 1604542 22 0.00 3 3.4.2 Multipoint analysis Multipoint analysis for microsatellite markers D35L297, D3S3630 and D3S1304 was conducted to identify the maximum lod score. The maximum lod score achieved was 3.43, with the most likely location of the gene to be between D3S3630 and D3S1297 (Figure 3-9). This analysis was based on affection status as depicted in figure 3-1, extended pedþee. 93 +4 D3S1297 D3S3630 D3S1304 +3.43 t t t +3 o oL ao o 9+2 'õC o = +1 0 0 5 10 15 Distance (cM) Figure 3-9:The multipoint linkage map calculated by LINKMAP module of LINKAGE (version 5.2). The highest likelihood of the locus for the congenital ataxia segregating in family (PK80284) is in the interval defined by flanking markers D3S1297 and D3S3630. 94 3.5 Discuseion The positional candidate approach (Ballabio 1993) was implemented to identify the congenital ataxia disease gene segregating in family. To assign the gene to a chromosomal location, manual screening of the genome was initiated. After examination of microsatellite markers spread over 5 chromosomes (18-22) evidence for linkage to chromosome 21. was detected. Attempted confirmation and refinement of this localisation using additional microsatellite markers along the length of this chromosome was unable to reveal any region of no recombination between marker and disease phenotype. This was the outcome for both the initial pedigree and extended pedigree structure (Figures 3-2,3-3). Given that the initial two point lod scores were encouraging (Table 3-6), several assumptions regarding affection status for some family members were made in an attempt to fully explore the possibility of linkage to this chromosome. IndividuaLs III.6 and IV.2 have abnormal MRIs when compared to closely related family members while affected individuals, lII.7 and IIL9, have normal MRI results. This raises the possibility that individuals III.6 and IV.2 may have a clinically similar but distinct disorder. It is important to note here, though, that MRI sc€u1s have not been assessed ín any other indíviduals except individual II.9, who has normal imaging. Several families described with a sinrilar phenotype also have varying MRI findings, thus this assumption was treated with caution (Furman et al. 1985, Tomíwa et al.'1.987, Fenichel and Phillips 1989, Rivier and Echenne, 1992 and Imamura et al. 1993). Family members III.L0, III.11 and their children IV.4, IV.s and IV.6 have not been formally examined by a neurologist but they have been assessed by the same medical geneticist, Dr T. Dudding who also assessed the remainder of the pedigree. She concluded that the affected individuals in this more remote branch of the family have the same disorder as that segregating in the main section of the pedþee (Figure 3-1 - remote part of the pedigree bracketed). Blood samples were collected from these individuals (who were not initially available for study) when it became obvious that the linkage analysis was difficult to reconcile with a localisation to chromosome 2L despite two point lod scores suggesting a strong hint of linkage in the initial pedigree. The remote section of the family was found to be recombinant with the region segregatingwith the disease phenotype in the initial pedigree (Figure 3-2). As a conseçluence this remote section of the pedigree was a valuable addition 95 and helped clarify the realisation that the gene for congenital ataxia may not be on chromosome 21. The two different scenarios described above were considered in the calculation of two point lod scores. Whenindividual IV.2 is coded as unlsnown (initiâl pedigree) then two point lod scores rise above +3 at 0=0 for several markers (Table 3-7), cnt:ical recombinant events in II.3 confirm these results placing the disease gene betweenD2lSl297 andD219268 (Figure 3-4. If IV.2 is considered to be affected (initial pedigree) then the disease gene may lie between D2LS268 and D2LSL439. However, for both these situations, if clinical data from the extended pedigree is assumed to be correct then a chromosome 2L location is urrlikely on genotype data (Figure 3-2).It appeared prudent to thoroughly check these areas prior to continuation of the time consuming and expensive genome screen since several credible candidate genes reside within or close to the regions suggested on chromosome 2L. Mutations in the potassium channel gene, KCN,4L, on chromosome 12 and the calcium channel gene, CACNAI.A, on chromosome 19, both cause forms of episodic ataxia, supporting an hypothesis of involvement of an ion channel in a congenital forrrr of ataxia (Browne et al.'I-.994 and Ophoff et aL.1996). Three potassium channel genes resided within and close to the region of interest, between D2T51257 and D21S1439: KCNE1, KCN/6 and I(CN/15 (Figure 3-3). Missense mutations in the cardiac delayed rectifíer potassium channel gene KCNE1 have been identified in individuals with both ]ervell and Lange-Nielsen (JLNS) slmdrome and 'I..997). long QT syndrome (Sptawski et a7.1997, Schultze-Bahr et al.1997, Tyson et al. Long QT syndrome is also l,rrown to be caused by missense mutations in the voltage-gated potassium channel gene KVLQTL (also leown as KCN.4.9) (Waog et al. L996). Individuals with these two disorders exhibit cardio-auditory dysfunction often leading to sudden death, with associated bilateral congenital deafness and are clinically indistinguishable because KCNE1 encodes beta-subunits which co-assemble with the alpha subunits of KVLQTL to form cardiac potassium charurels (Sanguinetti et al.1996). 96 \Â/hile it is possible that mutations in this same gene may canse congenital ataxia it is not likely given that the product of KCNEI, minK is central to the control of the heart rate and rhythm (McDonald et al. L997\. Furthermore this gene is restrictively localised in the apical membrane portion of epithelial cells. Therefore KCNE1 was not considered as a candidate. Ironically this potassium channel is the smallest of those on chromosome 2L with an open reading frame consisting of one exon of approximately 400 bp and thus would have been the easiest and quickest to screen. From the results of the radiation mapping panel I(CN/6 would reside just outside the critical region for the initial pedigree if individu aI IY .2 is affected (Figure 3-3). However, if the abnormal MRI results of this individual are considered to be of limited value in the diagnosis and this individual is assumed to be unaffected then the region of localisation can be expanded to include this gene. This possibility was explored to the limit because there are valid ïeasons for regarding this gene as a prime candidate for this disorder. A missense mutation in the mouse homologue of this gene, Girk2, has been found ín the weaaû mouse. Themutation identifiedinweøoer mice is within the H5 pore region of the channel. Mice homozygous for the disease phenofire exhibit severe ataxia which is present from approximately the second week of life. The principal phenotype of the of the mutant mouse is a weaving gait and it is thought that this symptom is at least in part due to severe hypoplasia of the cerebellum. On examination the cerebellum of these animals is dramatically reduced in size resulting from the depletion of granule cell neurons, the major cell type present in the cerebellum. In addition to the loss of granule cells there are also dinrinished nurnbers of Purkinjie cells. The histology of these cells is also changed such that their dendritic trees appear to be shrunken and abnormally located. Heterozygous mice are not ataxic but do have an intermediate number of surviving granule cells (Rakic and Sidman 1.973, Patil et al. 1995). Weaaer mice provided considerable insight into the development of the cerebellum. Apart from the histological findings described above, lueøoer mice also display progressive postnatal depletion of dopaminergic cells in the mesencephenlon and have thus been proposed as a model for Parkinson disease (Goldowitz and Smeyne 1995), In a study by Bandma¡n et al. (1996) sequence analysis of the H5 pore region was normal in 50 sporadic and familial cases of Parkinson disease making it unlikely that this gene is involved in the pathogenesis of Parkinson disease. Also, weøaer mice exhibit ataxia and fine tremor rather 97 than the rigid movements characteristic of patients with Parkinson disease, supporting this finding. The KCN/6 gene encodes a G-protein activated inward rectifier potassium channel. The function of this channel may involve the regulation of insulin secretion by glucose andf or neurotransmitters acting through G-protein-coupled receptors (Sakura et al. 1995). It is expressed in several tissues including brain and for these reasons and those described above it was decided that this gene was a good candidate to test for mutations in the congenital ataxia family (PK80284). hritially the mutation within the H5 pore region detected in weøaer mice was screened by SSCA analysis in the family. No abnormal band was detected in the affected individuals although a previously reported polymorphism was detected in this family (PK80284) (Figure 3-5); no recombination was detected with this polymorphism and affection status. Additionally two other polymorphisms were detected in this gene - one previously described and another identified in this study. Although these polymorphisms were not fully informative, the combined haplotype analysis indicates a tecombination between this gene and affection status on analysis of the extended pedigree (Figure 3-5). SSCA analysis of the entire coding region and available flanking intronic sequences of the I(CN/6 gene failed to identify an aberrant band segregating with affection status in this family. Further:nore, sequence analysis of these same regions did not reveal a mutation in affected individuals' Taking all these results into considetation KCN/6 can be excluded as the causative gene. The second of the potassium charurel genes to be screened for mutations in this family was the KCNIS gene. This potassium channel gene encodes an ATP-sensitive inward rectifier potassium channel. It ís thought that this gene may be responsible for potassium buffering action of glial cells in the brain (Sakura et al. 1995). Although the genomic structure of this gene has not been charactetised the complete cDNA sequence is available and BLAST comparison identified a sequenced genomic region enabling exon/intron boundaries to be identified (Figr:re 3-5). SSCA analysis of these exorìs failed to identify any change in conformation in affected individuals infamily PK80284' 9B A novel AC repeat microsatellite was identified by the BLASTn search. This microsatellite was 7 kb upstream of exon 1 of KCNIS. Genotyping of this microsatellite through the congenital ataxia family indicated no recombination between this gene and the disease phenotype; however, this marker was not fully informative. There remained the possibility that this gene may be involved in the congenital ataxia. Mutation detection rate using SSCP gels is not 100% and a potential mutation may have been missed using this screening technique, Due to the fact that there was no absolute mapping evidence that the gene for congenital ataxia resíded in this regiorç sequence analysis was not carried out. Other genes which lie close the region of interest on chromosome 2L but were not examined in detail are listed in section 3.3.2. It was at this stage that the genome screen was undertaken and from these results and exploration of possible alternative localisations by subsequent EXCLUDE analysis (Table 3- 12) it became further apparent that the initiat chromosome 21 localisation could not be substantiated. Surprisingly, a lod score of +3 was identified on chromosome L3i howevet, this was shown to be a chance result as the region was subsequently excluded. Combined linkage results from two point analysis, (EXCLUDE analysis) and multipoint analysis indicated that the most likely position for the gene for the congenital ataxia segregating in family PK80284 is on chromosome 3 between 3pter and D3S1304. Thus, the focus of this study shifted to chromosome 3. Microsatellite markers on distal 3p gave the highest two point lod scores (Tables 3-10 and 3-LL). Again there was discordance between clinical and marker data - individual II.8 was presumed to be clinically unaffected although appeared to have inherited the "disease" chromosome 3p haplotype. This individual was difficult to examine for gait ataxia, having received hip damage from a car accident and thus for the pu{pose of identifying the localisation on 3p, an unlmown clinical status may in fact be more appropriate for this individual. Reassessment of two point lod scores after recoding II.8 to affection unknown gave a maximum two point lod score of 4.26 at D3S3630. Multipoint analysis with the phenotype of this individual (IL8) set as unaffected, achieved a maximum lod score of 3.43, placing the disease between D3S3630 and D3S1,297, thus confirming the results of the two point analysis. Recombination events indicate the critical region to be distal of D3SL304, within a genetic distance of L8.9cM (Gyapay et al. 1,996). Database searches 99 revealed the following genes, among others, within this interval:- Inositol 1,4,5-triphosphate receptor tlpe 1,, neural cell adhesion molecule and plasmacytoma-associated neuronal glycoprotein. Each of these genes could be considered a valid positional candidate for the following reasons: Type 1 inositol l,4,5 - triphosphate receptors (ITPR1) couple to calcium channels and bind inositol L,4,5 - triphosphate errabling the release of calcium from the endoplasmic retículum. These receptors are found inboth neuronal and nonneuronal tissues with the neuronal form most abundant in Purkinje cells (Yamada et aL.1.994). Mice which are ITPR1 deficient most often die in utero; however, the majority of those which are bom alive have severe ataxia and tonic-clonic seizures, dy-g before they are weaned. Electroencephalograms of these mice indicate that ITPR1 is essential for normal brain furrctior'ç although the cerebell,ar Purkinje cells appear to be spared (Matsumoto et al. 1996). Mutations in the calcium charurel gene CACNALA canse both episodic ataxía type 2 and spinocerebellar ataxia 6 (Ophoff et al. .J,996 arrd Zruchenko et aI. t997) *d thus it could be speculated that mutations tn Itprl may give rise to an ataxic phenotype. While endeavouring to identify genes contributing to the mental retardation in 3p- s¡rndronre patients, Wei et al. (1998) characterised the neural. cell adhesion nrolecule gene (CALL). This gene was shown to be expressed at specific developmental stages in the central netvous system, spinal cord and peripheral nervous system. This gene can be considered given the apparent overlap in phenotype (mental retardation) with 3p- syndrome patients and the high expression in neural tissues. Additionally, mutations in the neural cell adhesion molecule LL cause mental retardation and brain malformations, referred, to as CRASH syndrome (Corpus callosurn hypoplasia, retardation, adducted thumbs, spasticity and hydrocephalus) (Yamasaki et a1.1997). The third and final gene to be considered a candidate is plasmacytoma -associated neuronal glycoprotein (PANG), again a neuronal adhesion molecule. The mouse honrolog (Pang) rs expressed only in the brain and has been considered a candidate to examine in the neurological murine mutants opf (opisthotonous) and dfw (deaf waddler) (Mock et al. 1ee6). 100 Due to time constraints these genes have not yet been examined for molecular family. Screening for mutations in these genes represents the continuation of the candidate approach to identifying a disease causing mutation for this disorder. The candidate region at this stage remains too large (18.9cM) for positional cloning however; additional families, if available for screenin& may enable the reduction of the candidate intewal for more efficient application of the positional candidate approach. Continual searches of databases may uncover other candidate genes as they are submitted and become available to the general scientific community. The results from this study highlight the difficulties which can be experienced in mapping disease genes by linkage anaþsis both with spurious lod scores elevated by chance and difficulties in arriving at definitive clinical diagnosis for all family members. Recognition that the initial (potential) chromosome 21 localisation could not be proven led to the continuation of the genome screen to identify more probable linkage to chromosome 3p: maximum lod score 4.26 at 0:0.00 for D3S3630. It is speculated that mutation screening of ITPR'1,, CALL and PANG may result in the identification of the disease causing mutation in this and possibly other families with NCPA. Localisation to the 3pter region represents the first genetic localisation for an autosomal dominant pure congenital ataxia. Significantly this is the more difficult category of the congenital ataxias to fiagnose since within this group significant clinical heterogeneity exists. For the majority of cases early prognosis is not possible from early developmental milestones, neurological signs or neuroimaging (Steinlin et al. I998a), thus the identification of genetic localisatíon and the eventual characterisation of the disease gene will enable molecular diagnosis and perhaps provide a basis for improved prognosis. 101 Chapter 4 : EARLY ONSET ATAXIAS - Page SUMMARY 103 4.7 Introduction to4 4.2 Subiects -Clinical Eummary to7 4.2.\ Episodic ataxia typ" 2 (EA-2) to7 4.2.2 Familial hemiplegic migraine (FHM) 107 4.3 Methods 109 4.3.1 DNA samples 109 4.3.2 Linkage analysis 109 4.3.3 Mutation analysis - SSCA 109 4.3.4 Sequence analysis 110 4.3.5 Electronic database information 11.0 4.4 Results 110 4.4.1 Linkage analysis 110 4.4.2 Mutationscreening t12 4,4.3 Sequence comparison tt2 4.5 Diecussion 1'77 r02 CHAPTER 4: EARLY ONSET ATAXIAS SUMMARY Mutations in the P/Q type Ca2+ channel crL- subunit gene, CACNA1A have been identified in three genetically distinct disorders, EA-2, FHM and SCA6. In the current study a novel missense mutation in exon 32 of this gene, CACNÁ1,A was identified in a family segregating for EA-2. This mutation was not detected tr.252 normal blood bank control samples and urrlike previously reported mutations lor EA-Z does not disrupt the reading frame of the gene. Rather it results in an Atg1,666His substitution. Interestingly, this mutation was identified in one family member with migraine alone, thus expanding the spectrum phenotypic variation associated with this mutation. A second mutation in exon 16 of CACNALA was detected in an individual from a snall nuclear family segregating FHM. The mutation identified in this patient, Thr666Met, was shown to be the same as one previously described by Ophoff et al. (1996). This mutation was subsequently described in a large number of uruelated patients with FHM and associated mild permanent cerebellar ataxia (Ducros et aI.1999), confirming that this is a recurrent mutation. 103 4.1 Introduction Three of the genes responsible for early onset hereditary ataxias have been molecularly characterised. These are: Friedreichs ataxia (FRDA), episodic ataxia type 1 (EA-l) and episodic ataxia type2 (EA-2). The symptoms for FRDA have been shown to be due to an homozygous expansion of a (GAA)" repeat within the first intron of the frataxin gene. This mutation results in a major reduction of expression of a mitochondrial proteirç frataxin (Campuzano et al. 1997). Similar to the late onset SCA disorders, disease severity for FRDA appears to be correlated with the size of the expanded allele. Interestingly, the size of the smaller allele appears to be the primary determinant of disease severity and progression. The smaller the size of the lowet copy number allele, the less severe the symptoms (Filla et aI. 1,996b). While this disorder is the most common of the three early onset ataxias mentioned here it is not discussed further in this chapter. EA-1 and EA-2 are associated with two different ion charrnel genes and these are referred to as charurelopathies. Missense mutations in the brain potassium channel gene, KCNz4,1, cause EA-1 (Browne et al. 1.994). This disorder is characterised by short attacks of ataxia and dysarthria with associated myokymia. These attacks are precipitated by movement and last from seconds to minutes. Affected individuals do not develop cerebell¡ar atrophy or persistent ataxia (Brunt and van Weerden 1,990). Expression studies indicate that mutations impair the capability of affected neurones to repolarise efficiently after an action potential (Adel-rnan et aI.1995). Symptoms for (EA-2) are variable and include acute periodic attacks of unsteadiness, gait ataxia and dysarthria. Some patients also experience episodes of vertigo and nausea. Episodes of symptoms c¿tÍt last from several minutes to a few hours or even days. The frequency of attacks varies greatly among patients and attacks are often precipitated by emotional or physical stress, coffee or alcohol Clinical onset is genetally during childhood, with few cases described where onset is after 40 years. In the majority of patients with EA- 2, oraladministration of acetazolamide will prevent or dramatically lessen attacks (Farrher and Mustian-1963; I¡Vhite 1969; Griggs el aL.1978). Mutations in the brain specific P/Q type Ca2+ channel uL-subunit gene, C'{CNAIA have beenidentified inEA-Z approximately 50% of FHM cases localised to 19p13 and also in a third allelic rlisorder, SCA6. Unlike FHM and EA-2, SCA6 is a progressive, late onset ataxta. To date, four different missense mutations have been characterised for FHM. For ro4 patients with EA-2, three mutations, distinct from those identified in individuals with FHI\4 have been described (Ophoff et aL.1.996; Yue et al. 1998). FHM is a distinctive form of dominantþ inherited migtaine in which patients have hemiparesis in addition to other aura synptoms such as hemianopic blur:ring of visiorç unilateral paraesthesía, numbness and dysphagia. Aural symptoms persist for 30-60 minutes followed by migraine lasting from a few hours to days (Bradshaw and Parsons '1.965; Heyk L973; Whitty 1986). There are three loci identified to date for FHM. One localisation is at lq21.-q23, another is at 1,9p13 (CACNALA) *d linkage data excluding the lmown loci suggests that at least a third as yet unidentified locus exists (]outel et al. \994 andOphoff etal. \994, Ducros etal.1997 andGardneretal. 1997\. The most coÍìmon disease causing mutation for SCA6 is an expansion of an (CAG)1. repeat located within the 3' region of the CACNAIA gene (Matsuyama et al. L997; Riess et al. 'J,997 ; Zruchenko et al. 1-997) . A base substitution in the CACN AIA gene has been identified in a family wíth progressive ataxia (Yue et al. L998) and a family with FHM and progressive late onset ataxia has been described with a point mutation in exon 13 of the CACNALA gene (Battistini et al. 1999). Further, affected individuals from a family segregating for EA-2 have been reported to have a small expansion in the (CAG)1 repeat (Jodice ef aL.1997). While all of these disorders (EA-2, FHM and SCA6) are regarded as clinically distinct, there is overlap in phenotype between the tluee groups. Figure 4-1. summarises those mutations published to date. It is interesting to note that mutations in the mouse homolog of the CACNAI.A gene cause mouse phenotypes, leøner (tgt") and totterer (tg). These mice display epilepsy as well as ataxia. The phenotype of l},Le lenner mouse is more severe with both inteurrittent epilepsy and chronic ataxia which greatly impairs survival. In these mice there is a splice site mutation producing an aberrant intracellular terminus resembling more closely the mutations detected in EA-2. The mutation in the totterer mollse, a missense mutation in the pore region of domain II, is more akin to the mutations identified in FHM. This mouse has mild ataxia but severe intermittent epilepsy (Fletcher et al.1996, Doyle et aL.1.997). These mouse models highlight the variation in phenotype observed from mutations in the CACNAI,A gene and may therefore also be good models for migraine (Hess 1'996). 10s IV DOMAIN I il P P P P I I ular t V * 1 1 2 3 4 5 6 1 2 3 4 5 6 1 2 3 4 5 þ 2 3 4 5 6 U I I U I asm¡c I cooH N H 2 ! tvtissense mutations- FHM I Oetetion and splice mutation in EA-2 O CAG repeat expansion in SCA6 Missense mutations- SCA6 f, Miissense mutation detected in current study (EA-2) Figure 4-1: Schematic representation of CACNAIA gene indicating regions of the gene in which mutations have been identified for FHM, EA-2 and SCA6. (Modified from Bulman 1997) H O o\ It remains to be determined whether all cases of EA-2 and FHM will be due to mutations in the CACNAl,A gene or whether there are multiple genes as well as multiple allelic mutations responsíble for the phenot¡>ic heterogeneity in these disorders. If the variability in symptoms is due to different mutations in the one gene then the characterisation of these mutations will allow conelation between genotype and phenotype (Terwindt et al. 1,998). This may lead to better understanding of the function of the CACNALA gene and lead to alternate therapies for EA-2 and the development of treatments for FHM and SCA6. In an attempt to identify further mutations within the coding region of the CACNAI.A gene, several patients with FHM, EA-2 and patients with possible EA-2 were screened. Affected individuals from a family (PK80284) segregating for EA-2 were also screened. 4.2Subjects - Clinical Summary 4.2.1 Episodic ataxia type 2 A total of 10 individuals were screened for mutations of the CACNA1A gene. Clinica77y,4 of these individuals were diagnosed with EA-2. However, 3 of these individuals did not have typical features of EA-2, but clinically were unable to be positively diagnosed. Screening of these patients was attempted based on the hypothesis that the at¡rical symptorns may be due to a novel mutation in the CACNA1A gene. A family of 14 individuals segregatingfor EA-2 (PK80284) was also screened in this study. The family was consistent for the chromosome 19p localisation (see results section) and affected family members were shown to be responsive to acetazolamide suggesting the possibility of mutations in the CACNAI.A gene (see Figure 4-2lor pedigree). 4.2.2 F amilial hemiplegic migraine Four individuals from a small FHM pedigree spanrring two generations were also anaþsed (Pedigree (PKS0661)-Figure 4-2). Since the age of eleveru the proband (individual II.3) has had migraine with aura which is associated with right sided hemiparesis, hemianopia and aphasia. Interictally, he has horizontal nystagmus but no other focal neurological signs. MRI of the brain showed atrophy of the cerebellar vermis. Two sporadíc cases of hemipleæ" of rrnlmown etiology were included in the ^igr"irre screening. r07 PK80284 2 3 3 ilr 0 IV PK80661 2 il I, C effected male, uneff€cted female Figure 4-2: PK80284 -Family segregat¡ng for episodic ataxia type 2. Family PK8066'l is a small family segregating forfamilialhemiplegic migraine 108 4.3 Methode 4.3.1 DNA samples Informed consent was obtained from individuals who gave blood samples. DNA was extracted from blood lymphocytes according to a standard protocol. (see lVla.terial and Methods 2.1..1) 4.3.2 Linkage analysis Analysis of microsatellite markers was as documented in lvfaterial and Methods2.2.3. Two-point linkage anaþsis was performed with the use of the Linkage 5.2 package (Chapter 2.9.2), under the assumption of autosomal dominant inheritance and a disease frequency of 1:10000. The allele frequencies were assumed to be equal for each marker and penetrance was set at 1.00. Primer sequences for microsatellite markers D'1,95406, D195413, D195906, D19S840 and D1.95226 were taken from CEPH genetic maps (Gyapay et aL 1994 and Dib et aI.1996). Primer sequences for D19S1150 were Forward primer S'GGA GAA GCA TAG AAA AGC CA 3' Reverse primer S'CCT GTT GAA AAC TCC TGA CC 3' (Accession nunrber U5 0849) Analysis of the (CAG)n repeat in exon 47 ol the CÁCNALA gene was also undertaken (Material and Methods 2.2.3). SCA6 Forward primer S'CAG GTG TCC TAT TCC CCT GTG ATC C 3' Reverse priner S'TGG GTA CCT CCG AGG GCC GCC GCT GGT G 3' (Zruchenko et al. 1997) 4.3.3 Mutation analysis - SSCA analysis A1747 exons and adjacent intron sequences of the CACNALA gene were amplified by PCR using primers described in Ophoff et al. (L996). 109 SSCA analysis was as described in Material and Methods 2.3. The gel systems used for electrophoresis wete: MDE TM gel ( mutation detection enhancement, FMC Bioproducts ) 5o/o and L0% nondenaturing polyacrylamide gel (49:1 acrylamide:bis acrylamide with 5% gþerol added) (see Material and Methods 2.3.1). MDE gels and 10% gels were run at 800V overnight while the 5% gel was run at 400V ovemight. All gels were run at room temperafure. 4.3.4 Sequence analysis Exons of altered mobility were sequenced (see lrzlaterial and Methods 2.4.1). PCR products were sequenced with both the reverse and forward primer (Ophoff et al. 1996), using a DYE terminator kit (Perkin Elmer). Sequences generated were compared wíth the published sequence (Genbank # X99897) using Lasergene software (DNA star). 4.3.5 Electronic Database Infomation URLs for data in this chapter were: Genome Database: http:/ /www.gdb.org / (for pri:ner sequences of D19S1150) Blast server at NCBI: http:/ /www.ncbi.nlm.nih.gov/BlA9T / 4.4 Results 4.4.1Linkage analysis Falnrily (PK80284) segregating EA-z was analysed for microsatellite markers within and flanking CACNAI,A. This pedigree gives the highest two point lod score of 1.36 (0 : 0.0) at several fully informative rricrosatellite markers (D19S840, D19S1150 and D'J,95226) both flanking and within CACNAI.A, Although not proving linkage, this is consistent with linkage to 19p13.1. (Figure 4-3). Further, the (CAG)n repeat ( normal alleles, n=4-16) known to be within exon47 at the 3' end of the CACNALA gene and the microsatellite marker D19S1150 within intron 7 oÍ. tJrre CACNALA gene, segîegate with the disease phenotype in the family (Figure 4-3). No expansion at the (CAG)', repeat was detected in the family. Individual IlI.7 was chosen for initial screerring by SSCA, and after observation of an aberrant band and subsequent mutation identification, all individuals from the pedigree were screened to confirm the presence of the mutation associated with the disease phenotype. 110 FAMTLY 1 (EA-2) 1 3 4 D19S406 2 1 31 31 2 1 D19S413 2 1 15 37 2 1 D19S906 1 6 32 64 1 6 D19S840 2 4 44 23 2 4 CACNLAlA c c lntragenic D19S1 150 3 2 54 41 3 2 markers (AGC)n 11 13 12 12 11 13 11 13 t 1 D19S226 1 2 44 11 2 1 3 I 1 2 3 1 ( 2 3) 1 1 2 3 1 2 2 1 31 5 2 4 6 ( 2 1) s 1 2 1 5 2 2 7 31 2 1 5 4 ( 1 3) 2 6 1 3 2 1 1 6 66 4 2 1 1 ( 2 4) 4 4 2 4 4 2 2 2 24 c ( c -) c c c 4 3 6 1 ( 3 5) 4 2 3 5 5 3 3 1 42 1 11 13 7 ( 11 't2) 12 13 11 12 12 11 11 13 11 13 4 3 3 ( 1 4) 4 2 1 4 4 1 1 1 12 I 2 3 33 2 4 14 1 5 35 2 1 41 c 3 6 56 11 13 12 13 1 3 43 O,larected female, male O,tr normatfemate, male NR no result Ø mild migraine C , - Bandshitt ,no change ( ) inferred haplotype Figure 4-3: Haplotype analysis of microsatellite markers flanking and intragenic to the CACNA1A gene. (C) Linkage is consistent with a 19p localisation. Bandshitt change detected in exon 32 cosegregatgg _ with dìsease phenotype. 11 1 4.4.2 Mutation screening During the screening by SSCA, two unpublished polymorphisms were detected in both patient samples and normal blood bank controls used in the analysis (Table 4-1). Table 4-1.: Two unpublished polymorphisms were detected in normal unrelated blood samples. Hetetozygosities calculated were based on results from 50 individuals. Intron nucleotide substitution heterozygosity position Intron 1"5 2192 - 39nt g-to-a 0.20 Intron 43 6471. - 94nt c-to-a 0.24 Bandshifts in patient matetial were detected for exon 16 (FHM-patient family PK80661) and exon 32 (EA-2 individual). No bandshifts were detected for any other exon of the CACNALA gene infamily PK80284 (EA-2). In the EA-2 individual, sequence analysis of the exon 32 bandshift revealed an 45260G transition tesulting in an Argl666}{is amino acid substitution (Figure -4). This amino acid substitution occurs in a highly conserved region of the protein (Figure 4-5). Further, this bandshift was analysed in other available fantily members (affected and unaffected) and cosegregated only with the disease phenotype (Figure 4-6). One individual (lane 1: family L, individual III.1) that inherits both the mutation and the affected haplotype was classified clinically to be unaffected with respect to cerebellar dysfunction; however, that individual does experience migraine. Sequence analysis revealed that the base change in exon 1.6 detected in the family with FHM was the same mutation as previously reported by Ophoff et al. 1,996. The C to T transition at nucleotide 2272 results in a Thr666Met amino acid substitution' 4.4.3 Sequence comparison The nucleotide sequence from exon 32 (nt 5237-5267) of the human CACNAIA gene was compared to sequences in the Genbank database. The altered base (G at nt 5260) was found to be conserved both within the same species for different calcium channel gene members and also across species (Figure 4-7). Analyses of the protein sequence for similarity using BLASTp algorithm indicate that the residue which is altered in the affected individuals is conserved over many species, including M. musailus, O. cuniculus, D. ommøtø ønd C. elegans, Results from BLASTp also revealed that this same residue was consetved for other members of the calcium channel gene family, including an N-type calcium c-harurel. (Figure 4-5). IT2 nt nt 5251 5264 Ê C T T T c T E E A E C T c SEQUENCE OF INDIVIDUAL III.7 FROM FAMILY 1 WITH EA-2 t G E T T T E T C CG E E T c SEQUENCE OF NORMAL INDIVIDUAL t (, Figure 4-4:Arrows indicatesG5260A transistion detected by direct dye terminator sequencinl organism access¡on # aa prote¡n sequence ea 1064 rìematode (u55374) 1026 L FL R LFRAARL L QGYTIRILLIT V electr¡c ray (447447) 1551 FINLS FL R LFRAARLIKLLR QGYTIRILLIIT v 1589 rabbit (14æ78) 1658 FGI{I{FINLSFL R LFRAARLIKLLR QGYTIRILLIYT v 1590 mouse (u76716.1) 1552 FGI{NFINLSF R LFRAARLIKLLR QGYTIRÏLLIIT v 1696 human (X99æ7) 1654 1692 PKæ284 EA-2 (¡ndlllT) 1654 EFGN}IFII{LSF H L FRAARLIK LL RQGYTIRI L LTTFVQ 1692 R 1666 H gene.was used for the search.This region Figure zt-S : Prote¡n similarity alignment with BL{STp algorithm. The human sequence (X99S94 !r9m e¡on.Q!_ot he CACNA|A wãs found to be h¡ghly coñseÑeA across spec¡es, particularly at the subst¡tuted arginine residue, Arg1666His (boxe{, identified in afiected individuals from family (PK8O284). This search also revealed conservation at this res¡due for N-type calcium channels. 9') FAMTLY 1 (EA-2) 6 10 11 12 1 7 3 4 LANE 1 234567 I 9101112 13 J J Figure 4-6: SSCA anatysis of exon 32 of the CACNAIA gene through EA-2 family (Pl(80284). The bandshift (indicated by the arrow) was. detected in all aflected individuals inituOing the individual in lane 1. This individual did not have ataxia but had migraine (see text for details). This band shift was sÐ in Arg1666His substitution. l\) characterised to result an organism access¡on # channel type nt# sequence alignment nl# human x99897 p/qtype 5237 C TTC ATC AAC CTG AG CTTTC TCC G CCTCTTC 5267 mouse mmu76716 4668 C TTC ATC AAC CTG AG C TTTC TCC tr CCTCTTC 4698 5309 rabbit x57689 5207 C TTC ATC AAC C TG ÅG C TTC CTG C G CCTCTTC 4794 mouse uo4999 n-type 4764 C TTC ATC AAC C TAAG C TTCCTTC G CCTCTTC 4854 human humcachnta n-type 4826 TTC ATC AACC TCAGC TTC C TC C G CCTCTT (nt: nucleotide) Figure 4-7: Sequence comparison using Blastn algorithm. Human sequence (X99897) was used in the search. The G base at position 5260 (boxed) is conserved across both species and channel types. (J) (.l) 4.5 Diecussion Much of the data presented in this chapter has been published in the journal Human Genetics - see Appendix IV. Mutations were only detected in two of the families tested, one with EA-2 and another family with FHM. For the sporadic cases with possible EA-2 the mutations remain undetermined. There are several explanations for the absence of mutations. Screening by SSCA detects approximately 80% of mutations and therefore mutations may go undetected. Several of the individuals tested did not have classical features of EA-2 and it is most likely that these atypical symptoms are caused by mutations at other loci. Fa-rr-ilial hemiplegic migraine has been localised to 1,9p13 in only 50"/o ol families tested (Joutel et aI.'J,994, Ophoff et al.1994). Given the high frequency of migraine in the general population it is likeþ that the symptoms in these patients are due to mutations in an alternate gene. Prior to this study three mutations leading to disruption of the reading frame have been described in patients with EA-2. Two mutations, a deletion and a splice site mutation, both lead to a presumed truncated protein product (Ophoff et aI. 1996). Similarly, a de noao mutation in exon 23 of. the CACNAI.A gene leading to a premature stop codon has been identified in a patient with sporadic EA-2 (Yue et al. 1998). Furthermore, in one family with symptoms of EA-2 rather than SCA6, ¿m exp¿u1ded (CAG)', repeat has been identified fodice et al. L997). It was speculated in this study that the expanded (CAG) repeat might affect mRNA stability, splicing efficiency or affect processes at the transcriptional/ translational level. The mutations described to date f.orEA-2 result in presumed truncated proteins. Thus, the identification of a novel missense mutation resulting in a potentially altered protein of nonnal size is of great significance since it is the first mutation not leading to a premafure stop codon, and truncated protein. The mutation identified in these individuals is a G5260A transition in exon 32 (giving rise to an Arg]66óHis amino acid substitution) of the CACNALA gene. No other bandshifts for all the other 46 lcrown exons of the CACNAIA gene were identified in this family. Furthermore, there was no expansion at the (CAG)n repeat located in the 3' portion of the gene. The region of the CACNALA gene in which the mutation has been detected is the IVS4 region of the calcium drarurel (Figure 4-1). The 54 domains are considered to be the voltage sensors of calcium channels and have an unusual, highly conserved pattern of an arginine residue at lI4 every third or fourth position. These arginine residues are interleaved with hydrophobic residues(Tanabe etal.'1.987 and Stea et al. 1995).Th"ArgL666His substitution alters this highly conserved region, thus it is likeþ that this mutation alters the ability of the voltage sensor to function efficiently. A similar mutation affecting the IS4 domain has been previously shown to be responsible for FHM (Ophoff et al.1996). Given the high degree of species homology, the importance of an Arginine residue at every third or forth position in 54 domains, the presence of a similar mutation in an IS4 domain in FHM and the failure to detect this mutation in a Iarge number of normal control chromosomes it is proposed that this is the disease causing mutation. It is of considerable interest that one individual from this pedigree (III.1) is clinically normal with no evident signs of episodic ataxia but does experience mþaine. Therefore it is possible that the missense mutation detected in this individual manifests as migraine only. Although there were no bandshifts detected in the additional 46 exons of the CACNALA gene tested, the sensitivity of screening by SSCA is not absolute and an additional mutation may have been unidentified (Orita et al. 1989; Sheffield et al. 1993; Ranvik€lavac et al. 'J.994; ]ordanova et aL. \997). The mutation detected in the individual with familial hemiplegic migraine, cerebellar atrophy and nystagmus is the same as that originatly reported in the study by Ophoff et al. (1996). Further studies have also identified this same mutation in approximately 50% of families with FHM and permanent cerebellar ataxia (Ducros et al. 1999). Th" mutation described in all these patients is a C to T transition at nucleotide 2272tr. the 1156 domain in exon L6 of the CACNALA gene and results in a Thr666Met substitution. The normal sequence at the mutated site is CCTGA(C)GGG. The cytosine C in parentheses is mutated to thymidine T. The dinucleotide CpG is a known hotspot for mutation in the human genome (Cooper and Krawczak'l-.993). Approximately one third of human point mutations occur at these sites (Ollila1996\. Thus, it is líkeþ that the mutation described for the FHM patients is the result of similar mutational mechanism and represents a commonly occuning recutrent mutation in the CACNAIA gene. Recent studies on the effect of larown mutations of the CACNAI.A have enabled some insight into the consequences of these mutations on the action of the calcium channel. Expression of mutant alphalA subr¡nits im Xenopus laeais oocytes demonstrated that the 115 recurrent mutation Thr666Met changed the channefs inactivation kinetics. This particular mutation was demonstrated to slow recovery from inactivation. Conversely, a second mutation previously described for familial hemiplegic mþaine, IleL8L1-Leu, was shown in similar expression studies to accelerate recovery from inactivation (Kraus et al. L998). Patients with both of these mutations have hemiplegic migraine and associated cerebellar ataxia, however, the penetrance of the ataxic features in these individuals varies greatly both between and within famiües (Ducros et aI.1999). A previously described substitutiorç ArgL92Ght, occurs in the IS4 region of the CACNAI.A calcium channel (Ophoff et al. 1996). The substitution identified in the present study (Arg1666His), also occurs in a membrane spafldng segment, this time in the fourth domaio IVS4. Expression studies of the Arg192Glu substitution indicated that there is no detectable electrophysiological change (Kraus et al. 1998). Th" individuals described with this mutation, Arg192GIu, have pure hemiplegic migraine with no apparent evidence of associated cerebellar ataxia (Ophoff et a1.1996). Taken together, these results suggest that clinically similar phenotypes may result from mutatíons exhibíting discrete functional consequences, at least in Xenopus Løeais oocytes. \Á/hile it is difficult to predict the significance of the Arg1666His substitution identified in this study without functional analysis, it is conceivable that the phenotypic variation seen in the EA-2 family (PK80284) can be likened to that seen in families with hemiplegic migraine and associated cerebell,ar ataxia (Ducros et al. 1999). Variability of phenotype has also been observed in a family segregating for a mutation within exon 6 of the CACNAtA gene.In this family described by Yue et aL. (1997) there are affected individuals with progressive ataxia without episodic features and several affected individuals with both progressive ataxia in combination with episodic ataxia (not responsive to acetazolamide). Additionally, it was noted that several individuals with progressive ataxia also experienced episodic attacks of migraine without aura. Therefore within the one family considerable variation in phenot¡re is observed. There was no expansion at the (CAG)^ repeat within exon 47 of the CACNAI.A gene observed in this farnily. Thus, similar to the mutation identified in the present study, a single missense mutation has variable phenotypic consequences. LT6 It is not clear whether variation in symptoms is due to different effects of the underlying mutations or whether other modifying genes or environmental factors are involved in disease progression. Alternate splicing of alphalA subunits generates distinct subcellular localisations, and biochemical and electrophysiological properties. The same alphalA isoform coexpressed with different ancillary beta subunits gives rise to distinct types of currents (Sakuri et al. 1996, Moreno et aI.1997). Thus, it has been speculated that a mutation in the CACNA1A gene may have distinct effects on the various generated calcium currents, dependent upon the alphaLA splice variant or combination with associated auxiliary subunits fonrring the channel. Furtherrnore, it has been suggested that pure hemiplegic migraine mutations may have no effect on cerebellar alphalA calcium currents, while mutations causing herrriplegic migraine with associated cerebellat ataxia may modify both cerebellar and non cerebellar alphalA calcium currents (Ducros et al. 1999). Similarþ theÐ one may postulate that the nonsense mutation in EA-2 individuals described in this study may effect different calcium currents resulting in variation of phenotype. These data suggest that a novel missense mutation in the IVS4 domain of the CACNA1A gene may have variable phenotype, includingboth migraine and EA-2. The mutation identified in exon 32 in the present study represents the first missense mutation not leading to a prematute stop codon and subsequent presumed truncated protein described for EA-2. The characterisation and functional analysis of this and additional mutations in the CACNALA gene may enable us to estabhsh of phenotype- genotype correlations and gain further insight into the protein domains wíthin the CACNALA gene inboth EHM and EA-2. NB: Subsequent to the preparation of this thesis, additional nrissense mutations have been described. These mutations were similarly shown to exhibit variable penetration in mutation carriers (Denier et aL.1999) L17 Chapter 5: LATE ONSET ATAXIAS Page SUMMARY 722 5.1 Introduction 723 5.2 Material and Methods L26 5.2.1 Subjects 726 5.2.2 Linkage analyeie 130 5.2.2.7 Assesement of candidate loci 130 5,2.2.2 SLINK 130 5,2.3 Genome scfeen 131. 5.2.3.7 Linkage analysis t3r 5.2.3.2 Two point lod scores l.gt 5.2.3.3 EXCLUDE 731 5.3 Resulte 5.3.1 Linkage analysis 732 5.3.1.1 Candidate loci 132 5.3.2 SLINK results 133 5.3.3 Genome screen 134 5.3.4 EXCLUDE results L34 5.3.5 Regione of interest L35 5.4 Discussion L39 118 CHAPTER 5 LATE ONSET ATAXIAS SUMMARY Two late onset SCA families (PK80237 and PK80248) were analysed for involvement of l$own SCA loci. These analyses revealed that neither of these families had an expansion at the SCA1", SCA2, SCA3, SCA6, SCA7, SCAS or DRPLA loci. Fu¡thermore/ linkage to the SCA4, SCAS, SCA10 and SCA11 loci was excluded for family PK80237. Due to the small size of family PK80248 linkage anaþsis was not attempted. Although the chances of attaining a lod score as high as +3 were unlikely for famiþ PK80237, a genome screen was conducted in this family. Two point lod scores were calculated from linkage analysis using both affected orrly genotypes and age dependant liability classes. As expected no lod score of +3 or greater was achieved; however, several regions with a hint of linkage were detected (by lod scores of greater than +1). Those regions which were unable to be excluded but show a hint of linkage include chromosomes 4, 7, 8, and 14. Results from EXCLUDE analysis indicate the most likely positions to be on chromosomes I and 14. These results while unable to identify the genetic location of the disease gene in family PK80237 highlight the extensive genetic heterogeneity lcrown to exist for these disorders. Results from this family together with others reported in the literature indicated that there are up to 16 loci (both characterised and unidentified) responsible for SCA. The eventual characterisation of these as yet undiscovered genes will aid in the understanding of pathogenesis of these disorders. Further, the identification of new genes will enable molecular confirmation of diagnosis in affected individuals whose phenotype is not attributable to lqrown SCA mutations. LT9 5.1 Introduction The familial late onset spinocerebellar ataxias (SCAs) are clinically and genetically heterogeneous. The clinical refinement for newly delineated genetic entities within this group of disorders has been greatly aided in the last six years with the molecular characterisation of eight loci; spinocerebellar ataxia (SCA) 1, 2, 3, 6, 7, 8, !2 and dentatorubral pallidoluysian atrophy (DRPLA) (Orr et al. 1993, Kawaguchi et aI.L994, Koide et aL. 1994, '1,996, Nagafuchi et al.1994,Imbert et aL. L996, Lindbatd et al. 1996, Sanpei et al. David et al. '1,997 and Ztuchenko et al. L997). The major mutation described is an expansion of an otherwise normally polymorphic (CAG)'. repeat with the increase of copy number of this repeat above a normal threshold resulting in disease state. There also exists at least four other locations: SCA4 (chromosome L6), (Flanigan et al.'1.996), SCAS (chromosome 11), (Ranum et al. 1995), SCA10 (chromosone 22), (Zt et aL.1,999) and most recently SCA11 (chromosome L5), (Worth et aL.1,999). At the outset of this study in 1995, only the genes for SCA1. (chromosorte 6; 1,993), Machado Joseph disease (MID; 1.994) (chromosome 14) and dentatorubral pallidoluysian atrophy (chromosome 12; L994) had been cloned (Orr et aI.1.993, Kawaguchi et aL t994, Koide et al''1"994 and Nagafuchi et al. 1.994). SCA3 was subsequentþ identified to be due to a (CAG). expansion and allelic to MJD (Schols et al. 1995). Expansions of a (CAG)rt repeat had been demonstrated as the basis for all of these disorders. The gene for SCA2 had been localised to a 31. cM region at L2q23-24JJ. as early as L993 (Twells et al. 1993) with refinement of this localisation in L995 to a 3cM interval flanked by microsatellite markers D12S1339 and D12S1341 (Allotey et al. 1995). The gene was subsequentþ identified by independentþ by three groups tn 1996 with relatively small expansions of a (CAG)^ repeat resulting in the disease phenotype (Imbert et al. 1996, Sanpei et aL.1996, Pulst et aI.1,996). The genetic localisation Qpla-21..1) for SCAT was originally shown to be between the microsatellite markers D351289 and D3Sl-217 (Gouw et al. 1995). This localisation was later refined and the gene shown to reside in a 5 cM region between markers D3S1312 and D3S1600 (David et al. '1.996). Towards the end o1 1995 it was observed that the SCAT protein contained an expanded (CAG)'. repeat (Trottier et al. 1995a), a result substantiated by Lindbald et al. (1,996) using the repeat expansion detection (RED) assay. The actual gene r20 was cloned ir.'L997, confirming the existence of a (CAG)n repeat as the basis for the disorder (David eT. aL.1997). SCA6 was identified during a genotype study of (CAG)'. repeats in patients with late onset neurological diseases when Zhuchenko et al. (1997), detected. (CAG)' repeat expansions in the human alpha-(14)-voltage dependent calcium channel subunit. CACNAI.A maps to the short arm of chromosome L9 at 1,9pT3 and interestingly point mutations in this same gene result in episodic ataxia type 2 (EA-2) and familial hemiplegic migraine (FHM) (Ophoff et aI. t9e6). Recently SCAS has been demonstrated to be due to an untranslated (CTG)' repeat expansion (Koob et al. L999). Molecularly, SCAS has more in common with myotonic dystrophy (DM), a phenotypically distinct disorder. For both DlvI, a progressive muscle disorder with symptoms including myotonia, muscle weakness and sometimes mild mental retardation (Harper, !989), and SCA8, the CTG is located within the 3'untranslated region (presumed for SCAS), has similar pathogenic expansion size and is in the same orientatiory CTG. This intriguing find breaks the convention of the causative mutation for SCA being a translated (CAG)n repeat (ie polyglutamine). Recent data however, suggests that this expanded allele may be present in low frequency in unaffected individuals challenging the significance of this expanded allele (Stevanin et al. 2000, Worth et al. 2000). Expansions of the (CAG)', repeat at the SCA12 locus (chromosome 5) have been identified in a single pedigree (Holmes et al.'J,999). The repeat expanded in this family is located in the 5' region of PPP2R2B. Additional to the characterised mutations several genetic localisations for SCA were also identified during the course of this study. SCA4 was localised to chromosome 16 (Flanigan et aL. 1996) *d SCAS to chromosome Ll. (Ranum et al. L994). More recently a locus was identified on the long arm of chromosonte 22 (SCA10 at 22q13) and another (SCA11) to a 7.6cM region at chromosome 1,5qL4-21.3 (Zu et al.1999, Worth et al. 1999). There are in total 12 different chromosomal locations identified for these clinically similar diseases (Figure 5-1). L2L I I I I I I I I I I I I 12 3 4 56 78910 11 12 SCAT SCA12 SCAI SCA5 12p DRPLA 12qSCA2 I r E I I IJ I IJ I H f 13 14 15 16 17 18 19 20 21 22 YX SCAS SCA3/ SCA11 SCA4 SCA6 SCAIO MJD I SCn localisations Figure 5-1: Twelve chromosomal localisations exlst for the late onset SCAs. The genes for 8 of these SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCAI2 and DRPLA have been characterised.. r22 \Atrhenthe clinical identification and appraisal of a patient with an inherited SCA is made, the molecular analysis at the afore mentioned loci may confirm diagnosis. However, these molecular studies do not always reveal the presence of an associated repeat expansiory thus thwarting intended confirmation of the diagnosis. If enough family members are available and consenting, then evidence of linkage to a known genetic location may confirm diagnosis. Flowever, if the mutation screen and the linkage analysis are rrnable to confirm a diagnosis then a genome screen may be undertaken in large families to identify the location of the novel gene in the family. Large pedigrees segregating for SCA, not due to any of the coûunon mutations, represent valuable resources for the identification of new SCA disease causing genes. During the course of this study a large pedigree was ascertained which was segregating for autosomal dominant spinocerebellar ataxia (PK80237). A second smaller family (PK80248) was also available for DNA genotyping. This family was not large enough to submit (6 DNA samples available for analysis) to a total genome screen and consequently only SCA loci with loown mutations were tested. The following chapter examines the progress of analysis of SCA loci made in these two families. 5.2 Material and Methods 5.2.1 Subjects (Farrily members from PK80237 and PKS0234 were assessed and blood samples collected by Drs E Haan, G Suthers, K Boundy and Ms S. White WCH Adelaide) Family PK80237 Clinically this family (Pedigree: Figure 5-2) was diagnosed with spinocerebellar ataxia having symptoms including gait ataxia, dysarthria, and generalised incoordination. Affected individuals have no opthalmoplegia nystagmus, or paraethesia. Additionally, there were no extrapyramidal signs and no fisfurbance of cognitive function identified. Pedigree (") itt Figure 5-2 indicates the initial pedigree which was used for genome screening. The initial pedigree structure was made up of two main branches of nine and twelve children. Additionally, seven siblings in the second gerreration were available for genotype analysis making a total of 29 individuals with a potential of 2'l' informative meioses. Thus this family appeared to be adequate to undertake linkage analysis. t23 During the course of the study additional family members were collected, these are depicted in Figure 5-2 (b). Age at onset of symptoms varied, individuals III.19 and III.25 had onset at 60 and 63 respectively, while age at onset for affected individuals in generation IV was earlier, rangrng from mid 20s to 39 yeats indicating the presence of anticipation ín this family. At the beginning of the study the ages of generation IV ranged from 29 to 60 years and it is possible that several individuals may be presymptomatic carriers of the disease gerre. To avoid potential problems with unethical presymptomatic testing and incomplete penetrance blood samples were not collected from individuals younger than approximately 30 years. Bloods from additional family members were collected over a period of.2yearc. (Pedigree Figure S-2b-extended pedigree). DNA extracted from these individuals was not analysed in the entire genome screen however, these samples were tested for markers at regions showing hints of linkage as indicated by results from the genome screen in the initial pedigree (see results 5.3.5). Family PK80248 A small family of lL indíviduals, 4 of whom are affected with SCA, was also directed to the laboratory for mutation screening. DNA samples were available from 6 individuals. Symptoms in affected family members include: gait ataxia and dysarthria and as such affected members were classified as having SCA (Figure 5-3). t24 6 I 24 'ts Á lv Pedigrê€ a - ¡nltial P€dlgreb-s,(ttrded O O O O afæted, undfected f€male - blue lìlHn and blue outl¡ne ¡ndlcate DNA úvall8blè I I tr E af'a.rêd, un€útæted male - blue lill-ln and b¡ue outllnê indl€te DNA availablo É ds@sedmale m pr6um6d alfscted, not clln¡cally æ6s€d pedigree (b) ¡n the text. J ('rN 2 1 2 3 4 6 OO OO affected, unaffected female - blue fill-in and blue outline indicate DNA available tr - brue rirr-in and brue outrine I t E î.li",gis'JüîXui:0ff," É deceased male m presumed affected, not clinically assessed Figure 5-3: Late onset SCA pedigree (Pl(80248) consists of 11 family members, 6 of which have DNA available. Given the small size of this pedigree, only known SCA loci were screened. r26 5.2.2 Linkage analysis 5.2.2.1 Assessment of candidate loci. Mutation screening for expanded (CAG)', repeat alleles at lqnown late onset SCA loci was undertaken to ensure that the disease phenotype segregating in both family PK80237 and PK80248 was not due to mutations at these localisations (SCA1, SCA} SCA3/MJD, SCA6, SCA7, SCAS and DRPLA) (lvlaterial and Methods, chapter 2.2.3). The primers used in the analysis are the same as those referred to in chapter I (section 8.3). Additionally, linkage analysis (in family PK80237 only) at these loci was also carried out to exclude possible point mutations. For family PK80237 analysis of microsatellite markers at the chromosome11.,16,22 and'1.5 localisations for SCA4, SCAS, SCA10 and SCA11", respectively, was completed to ensure that these loci were not involved (Material and Methods chaptet 2.2.3). Analysis of all these markers was conducted on the initial pedigree (PK80237) as indicated in Figure 5-2a. 5.2.2.2 SLINK The initial pedigree (Family PK80237-Figtte 5-2a) was tested by the SLINK program to explore suitability for a genome screen (Table 5-1a) (Material and Methods chapter 2.9.1). Parameters used for this analysis were: A) 100% penetrance,l.ar:lrtly structure affected individuals plus generation III individuals, or B) 80% penetrance, all individuals, or C) 6Oy" penetrance, all individuals, or D) age dependent liability classes (see 5.2.3.2 following for details) (for all these situations 0 : 0.10) r27 5.2.3 Genome Ecreen 5.2.3.1 Linkage analysis Manual analysis o1246 microsatellite markers was undertaken by the candidate to identify the region of linkage in family PK80237, initial pedigree (Figure 5-2a) (lvlaterial and Methods 2.2.31The average distance between markers was 20cM. Additional markers were assessed in individuals from the extended family to further investigate regions showing hints of linkage, or suggestive of linkage. The majority of primel sequences for analyses of these microsatellite markers are reported in Gyapay et al.'1.994 and Dib et a1.I996. 5.2.9.2 Two point lod scores Calculation of two point lod scores was based on pedigree structure and affection status as indicated in the initial pedigree, PK80237 (Figure 5.2a). Two point linkage analysis was performed using the linkage 5.2 package (Lathrop and Lalouel1984) under the assumption of autosomal dominant inheritance and a disease frequency of 1:L0 000. Allele frequencies were assumed to be equal for each marker tested. Varying penetrance values were set to compensate for apparently unaffected individuals who may develop symptoms later (ie presymptomatic). Age dependent penehance values (liability classes) were assigned as follows: greater or equal to 80 years old - 1.00, 70-79 years old - 0.90, 60-69 years old - 0.80, 50-59 years oLd - 0.70, 40-49 years old - 0.60 and 20-39 years old - 0.50. Two point lod scores were calculated for the pedigree shown in 5-2a (PK80237) with either 1) all individuals with penetrance values assigned as above, or 2) 'affected only analysis' (ie genotype results for affected individuals only included in the analysis) s.2.3.3 EXCLUDE Results from the two point linkage analyses for the initial pedigree were examined using the EXCLUDE programme (Material and Methods chapter 2.9.4). This enables the most probable regions of linkage to be identified. 128 5.3 Results 5.3.1 Linkage analysis 5.3.1.1 Candidate loci Linkage analysis revealed that the genetic localisation for SCA in family PK80237 was not at already identified loci (SC41,2,3,4,5,6,7,8,'J.0,11 and DRPLA). Further, no (CAG) repeat expansions at these loci were detected in affected members of this family (PK80237) or the smaller SCA family (PK80248) (results not shown). Linkage results from those loci tested are given in tables 5-L and 5-2. The initial pedþee structure (Figure 5-2a) was the one used in the analysis. Table 5-1: Two point lod scores from analysis of (CAG)n repeats at SCA loci in family PK80237. Two point LOD scores at 0 : MARKER O.O 0.01 0.05 0.10 0.20 0.30 0.40 SCAl -infinity 4.71 -3.60 -2.48 -1.30 -0,68 -0.29 SCA2 -infinity -2.88 -1,.37 -0.73 -0.21 -0.06, -0.05 SCA3 -infinity -8.69 -4.86 -3.17 -L.57 -0.75 -0.26 SCA6, -infinity -5.88 -3.16 -2.03 -0.98 -0.45 -0.15 K.A7 -infinity -0.53 0.1. 0.30 0.40 0.35 0.21 SCAS -infinity -0.90 -0.74 -0.30 -0.10 0.01 0.17 DRPLA -infinity -2.90 -2.57 -'1,.87 -1.02 -0.53 -0.21 Table 5-2: Two point lod scores from analysis of microsatellite markers near SCA localisations-Chromosome 16 (SCA4), chromosome L1 (SCAS) chromosome 22 (SCA10), chromosome 15 (SCAL1) infamily PK80237. Two point LOD scores at 0 : MARKER O.O 0.01 0.05 0.10 0.20 0.30 0.40 D165402 -infinity -2.09 -0.88 -0.52 -0.38 -0.32 -0.15 D165393 -infinity --6.10 -3.07 -'t.79 -0.72 -0.29 -0.10 D11s903 -infinity -5.88 -3.42 -2.28 -1.18 -0.59 -0.23 GATA -infinity --3.09 -1,.72 -1..14 -0.59 -0.30 -0.11 D115905 -infinity -5.38 -2.71, -1.63 -0.69 -0.26 -0.06 D225274 -infinity -3.11, -'1..76 -1.18 -0.58 -0.24 -0.06 D15S123 -7.48 4.08 -2.16 -1..33 -0.58 -0.23 -0.05 I29 5.3.2 SLINK resulte Results from the simulated linkage study, SLINK for family PK80237 are shown in Table 5-3. The simulated linkage analysis, SLINK indicates that for a genome screen with markers at 20cM intervals (ie 0 = 0.10) there is a good chance of detecting linkage when the entire pedigree is used i:respective of any penetrance value used. A lod score greater than l- represents a hint of linkage and additional markers in this a.rea can then be analysed with the expectation of approaching the maximum lod scores shown in Table 5-3. One needs to be cautious since a 90% penetrance value assumes a low number of presymptomatic individuals in generation III, and it may not reflect the situation, however, when penetrance is set low, at 600/o, the chance of detecting linkage is dramatically reduce d (32% for lod score of L). It was decided to proceed with the genome screen using liability classes rather than a single penetrance value for all individuals in two point lod score calculations thus increasing the chance of detecting.linkage (66'/" of detecting a lod score of 1). Table 5-3: SLINK results for family PK80237 (initial pedigree). Four different scenarios A: affected individuals from generation III and all individuals in generation II (affected only) B: allindividualsg}o/o penetrance, C: allindividuals 60% penetrance and D age dependant liability classes (0 = was set at 0.10 for all calculations). Lod score A B C D Affected only 90% penetrance 60% penetrance liability classes 1 325 Yo 75.0Y' 32.0% 66.0Y" 2 71.0% 55.0% 15.5% 40.5% 3 0,0% 36.0% 't.5To 19.5T' maximum lod Í2.461 [s.88] ís.2el ls.2el 130 5.3.3 Genome Bcreen Two point lod scores were calculated according to pedigree 5-2a (PK80237) with either 1) allindividualswith age dependent penetrance values rangingfrom 100% to 50% as described in material and Methods section (5.2.3.2) or 2)'affected only analysis' (ie genotype results for affected individuals only included in the analysis) Results from the entire genome screen are in Appendices II and IIL Analysis of the genotype data obtained revealed several regions of potential interest for both analyses; however, no lod score greater than +3 was achieved at any marker (Tables 5-5 and 5-7 - section 5.3.5). Results whidr were above a lod score of +1 indicate a hint of linkage. Thus, for the 'all individuals'analysis, (1) above,lod scores greater than +1 were obtained for chromosomes L,3,5,8, and 20 (Table 5-7). Analysis of affected only genotypes indicated possible linkage to chromosomes 3, 4, 5, 7, 8, and 14 (Table 5-5). Genotyping of these and additional markers in the extended family (Figure 5-2b) was able to exclude some of these regions. Details of these analyses can be found in section 5.3.5. 5.3.4 EXCLUDE results The two point data from both 1) all individuals (age dependant liability classes (penetrance)) and 2) affected individuals only, were used in the EXCLUDE analysis. Results from the EXCLUDE analysis indicate several regions of possible linkage. From the analysis using all individual data with varying age dependent penetrance (L above) regions of linkage (highest chromosome probability) were indicated on chromosomes 5, 11, and 18 while the highest likelihood for most probable position was for chromosome 1 (Table 5-4). This arises from the fact that the highest lod score is achieved atDIS473 (0 : 0.1) (Table 5- e) EXCLUDE results usíng two point lod scores from affected only analysis (2 above) indicated 2majot regions onchromosomes 8 and L4, at approximately equal probability. 131 Table 5-4: EXCLUDE results from two point lod scores of genome screen in family PK80237 with 10cM coverage of microsatellite markers. Probability (%) Max Likelfüood Chromosome AII AÍÍ All Aff 1 8.67 0.00 150.54 5.03 2 11.80 0.01 47.70 47.70 3 0.14 o.o7 3.38 27.O3 4 0.00 L.62 2.t7 90.08 5 21.45 0.06 3.95 6.58 6 0.01 0.00 1.00 1.00 7 o.74 o.2L 2.06 23.29 I 0.01 45.80 2.80 3039.46 9 o.12 0.00 0.98 L.36 10 0.05 0.04 5.77 2.59 L\ 21..77 0.02 9.83 0.99 12 9.88 0.00 294 0.98 13 0.00 0.00 0.90 0.95 L4 0.13 s1..75 o.93 2909.12 15 0.01 0.00 3.63 1.22 76 1.80 0.20 2.19 12.70 77 0.00 0.00 0.88 0.95 18 37.34 o.22 2.21 30.37 \9 o.27 0.00 2.79 1..27 20 0.01 0.00 5.26 1.72 21 0.01 0.00 1.02 1.06 22 0.00 0.00 o.37 1..2L Note: Probabilities are expressed as percentages, Max likelihood = maximum likelfüood:- likelihood of the most probable position - rounded upto whole number, All refers to EXCLUDE analysis using ínitial pedigree, all individuals - age dependent penetrance values; Aff refers to EXCLUDE analysis using affected individuals only - initial pedigree. 5.3.5 Regions of interest Results from the EXCLUDE analysis for affected only individuals gave two clear regions of suggestive linkage to chromosomes 8 and L4. Two point analysis of microsatellite markers in the initial pedigree gave several regions hioti^g at linkage (indicated by lod score above +1). Microsatellite markers at these regions (for both affected only and age dependant liability classes) were assessed in the extended pedigree (affected only analysis) to try to reduce the number of potential localisations (Tables5-6,5-8,5-9 and 5-10). 132 EXCLUDE results indicating chromosomes lL as a possible location for linkage arose from uninformative markers, and analysis of additional markers subsequently excluded these regions (data not shown). Affected only analysis (extended pedigree) was able to exclude regioru on chromosomes L, 5 and 20. More importantly the regions whidr were unable to be excluded by analysis of the extended pedigree and additional microsatellite markers include chromosomes 4, 7, 8, and 14 (Tables 5-8 and 5-L0). Table 5-5: Two point lod scores for family PK 80237 (initial pedigree affected individuals only) and microsatellite markers tluoughout the genome. Results listed in this table are those identified from the genome screen to be above +L and thus taken as hints of linkage (results for D18S62 are discussed in the following) . Two point LOD scores at 0 : marker 0.0 0.01 0.05 0.1 0.2 0,3 0.4 D351304 1..43 1.40 1.28 1-.13 0.81 0.48 0.16 D45391 L.47 1..44 1.32 L.1.6 0.84 0.49 0.16 D5S408 L.25 1.22 1.11 0.96 0.66 0.35 0.10 D7S509 0.97 0.94 0.83 0.70 0.43 0.20 0.05 D85532 1.51 L.47 1.33 1,;t4 0.76 0.39 0.10 D85553 1.s9 1.s6 1..43 1.26 0.89 0.51 0.16 D14S285 L.43 "t.40 7.28 1.13 0.81 0.48 0.16 D145290 1.47 1.44 L.32 1.16 0.84 0.49 0.16 D18S62 0.25 0.24 0.22 0.18 0.11 0. 05 0.01 Table 5-6: Two point lod scores of microsatellite markers in family PK80237 identified to be above +1 in initiat pedigree (affected only analysis -Table 5-7) and extended pedigree - affected individuals ooly). Linkages at microsatellite markers indicated in bold were able to be excluded. Two point LOD scores at 0 : marker 0.0 0.01 0.05 0.1 0.2 0.3 0.4 -t.9't D3S1304 -0.90 't.47 "1..87 1.48 0.94 0.38 D45391 -1,.4't. 't.24 1,.73 1.74 1..39 0.88 0.38 DS54108 -7.06 -3.20 -1,.75 -0.38 0,72 0.77 0.08 D75501 -7.10 -2.07 -0.73 4,27 -0.04 -0.05 -0.05 -t.20 D7S509 't.17 1.02 0.85 0.52 0.24 0.07 D8S532 -1.:o.92 -3.91 -7.93 -1,.12 -0.38 -0.0!) 0.00 D83553 1.18 1.1.6 1.10 1.02 0.86 0.45 0.18 D14S285 -1.08 1.28 1.72 1..69 1.34 0.89 0.42 D145290 -0.70 1..72 1.43 1.47 't.25 0.98 0.44 D18S62 1.87 1.84 7.70 1..49 1.05 0.63 0.27 133 Table 5-7: Two point lod scores for family PK 80237 (initial pedigree age dependant liability classes used in the analysis) and rricrosatellite markers throughout the genome. Results listed in this table are those identified from the genome screen to be above +1 and thus taken as a hint of linkage. Two point LOD scores at 0 : Marker 0.00 0.01 0.05 0.10 0.20 0.30 0.40 D1S236 -2.32 0.49 1..07 1.20 1.10 0.78 0.33 D1s473 -0.63 0.33 1,.49 1,.78 1.6,5 0.92 0.35 D351263 -7.91 0.77 1.38 1..52 1.38 0.95 0.35 D5S408 1..34 1.33 1.30 1..23 1.00 0.68 0.27 D8S532 0.78 0.78 0.79 0.77 0.64 0.42 0.14 D83260 1.27 1.30 t.36 1.36 1..19 0.80 0.28 D18S62 0.47 0.47 0.45 0.41 0.29 0.14 0.03 D20595 -2.31 0.29 0.87 1.00 0.92 0.64 0.26 Table 5-8: Two point lod scores of microsatellite markers identified to be above +1 in initial pedigree (age dependant liability classes used in the analysis -Table 5-9) and extended pedigree - age dependant liability classes). Linkages at microsatellite markers indicated in bold were able to be excluded. Two point LOD scores at 0 = Marker 0.00 0.01 0.05 0.10 0.20 0.30 0.40 D75236 -7.M -3.20 -1.1.5 -0.38 0.12 0.17 0.08 D1s,473 -5.89 -2.22 -0.38 o.24 0.56 o.47 0.24 D351263 -'t.57 1.54 '1.39 1.20 0.8L 0.46 0.19 D5ru8 -7.06 -3.20 -1..1,5 -0.38 0.r2 o,t7 0.08 D8S532 -1:0.92 -3.91 -1..93 -L.12 -0.38 -0.ü, 0.00 D85260 1..27 1..22 1.11 0.94 0.60 0.32 0.08 D18S62 't.87 1.84 1,.70 1,.49 1.05 0.63 0.27 D20595 -11.38 -4.25 -2.29 -1.55 -0.91 -0.50 -0.22 Table 5-9: Two point lod scores from affected only analysis - extended pedigree and rricrosatellite markers adjacent to D18S62. The marker D18S452 is 0.0cM from D1.8S62 and D18S431,, thus excluding this location. LOD score at 0 : marker recomb. cM 0.0 0.01 0.05 0.10 0.20 0.30 0.40 z max 0 D18S1132 7.2 -15.31 -5.80 -3.14 -2.07 -1.04 -0.50 -0.19 D18562 0.0 't.87 1.84 1,.70 1.49 1.05 0.63 0.27 L.87 0.00 D185471 0.0 2.62 2.57 2.34 2.05 1.43 0.80 0.24 2.62 0.00 D1BS452 -9.65 -2.53 -0.7\ -0.13 0.15 0.12 0.03 Note: (recomb - recombination the value listed at the end of the row is the genetic distance in cM from the microsatellite marker directly below. Recombination distances are based on data given in Díb et al. 1996) Although two point lod scores in all individuals analysis were not above +1 for D18562' this region was indicated by the EXCLUDE prograrrr:rte (Table 5-4) and therefore exarnined further. Haplotype anaþsis around D18S62 failed to establish linkage. The microsatellite marker D18S452 which genetically maps to the same place as D18S62 and D18S471 (Dib et aI.1,996) excluded this region (Table 5-9). L34 Additional markers were analysed in order to exclude regions at D3S1304, D3S'1,263, D45391, D75509, D8S553, DBS260, D14S285 and D14S290. The microsatellite marker D3S1560 is 3.6cM from D3S1304; D3S3680 is genetically at the same place, 0c\í, as D351263; D451,609 is 0.1cM from D4S39'1., D45418 is O.6cM from D4S1609, D451618 is 1..7 cM from D4S418; D75495 is 1.2cM away from D7S509; D752560 is 0.6cM from D75495; D8S544 is 0.5cM from D8S553, D8S533 is genetically at the same place, OcM, as D8S553, D851797 is 0.5cM from D8S553; D85171.8 is 0.5cM from D8S260; D]/5274 is 3.8cM from D14S285 while D1,451O26 is 0.5cM from D14S290 and D],45982 is 0.5cM from D1,45290. Results in the following table exclude linkage at and around regions of several of these locations, inficated in bold (Table 5-10). Recombination distances are based on data givenin Dib et al. t996. Table 5-10: Two point lod scores for various microsatellite markers, listed above, and family PK80237 . Affected orùy extended pedigree was used in these analysis. Two point LOD scores at 0 = Marker 0.00 0.01 0.05 0.10 0.20 0.30 0.40 D3S1560 -9.58 -5.06 -2.81 -1,.40 4.14 -0.07 -0.04 D3S3630 -3.47 -2.?S -0.97 -0.49 -o.12 -0.01 0.00 D4S1609 1.55 1.52 1.39 1.23 0.88 0.51 0.16 D4S418 't.25 1,.20 '1.02 0.90 0.84 0.51 0.05 D4S1618 1.00 0.80 0.75 0.65 0.50 0.44 0.30 D7Sø:gs 7.25 0.90 0.Bs 0.30 -0.20 -0.06 0.00 D752560 0.87 0.67 0.58 0.47 0.20 -0.05 0.00 D752450 0.91 0.89 0.54 0.34 0.20 0.00 -0.03 D8Sil4 't.27 't.20 1.05 0.80 0.67 0.50 0.07 D85533 1.55 1,.52 1..39 '1,.22 0.66 0.49 0.15 D851841 7.34 7.27 1..12 1.00 0.79 0.56 0.23 D8S171,8 -2.49 -0.81 -0.18 o.o2 0.12 0.09 0.03 D145274 0.96 0.87 0.76 0.46 0.25 0.13 0.02 D1451026 1.45 1.30 1..15 0.98 0.78 0.56 0.21, D145982 1.50 1..47 1.35 '1,.19 0.85 0.50 0.16 Thus, these results indicate that the localisation for the SCA gene segregating in family (PK80237) remains undetermined with possible linkage to chromosomes 4, 7, 8, or 14 (Table 5-10). Multipoint analyses of these regions were unable to resolve this with no lod score greater than +2 calculated (data not shown). 135 5.4 Discussion It is evident that great genetic heterogeneity exists for the late onset ataxias. To date L2 different locations have been identified, SCAL. 2, 3, 4, 5, 6, 7, 8, L0, 11, 12 and DRPLA (Orr et aL.1993, Kawaguchi et al. 1994, Koide et aL.1994, Nagafuchi et aI.1994, Imbert et al. '1,996, Lindbald et aL.1996, Sanpei et aI.1996, David et al.1997, Zruchenko et al. Dgn. Expansions at the SCA12 locus have been identified in a single family and consequentþ was not screened in this analysis. Analysis of the other SCAs in families PK80237 and PK80248 was unable to confim genetic localisation:- no (CAG)', repeat expansions were observed in affected family members (PK80237 and PK80248). Additionally, no linkage to these loci was identified in family PK80237, excluding the possibility of a point mutation corrferring similar phenotypes to repeat expansion in these genes (Table 5-1). Given that linkage and mutation analysis excluded all larown loci in family PK80237, it was decided to try to identify the novel localisation for the gene segregating in this family. Simulated linkage analysis (SLINK); however, indicated a low chance (0% - 36%) of obtaining a two point lod score of +3 for the different scenarios tested from the initial genome screerL (ie 'affected only' analysis and all family members with varying age dependent penetrance - see results section for details). Chances of achieving a lod score of L were significantly better, ranging fuom 32%-75%. The maximum lod score achievable with initial pedigree and affected only analysis is 2.46 while the maximum lod score able to be obtained for a fully informative marker with all individuals included in the analysis was 5.88. A total genome screen was undertaken on the initial pedigree (Figure 5-2) however, tesults revealed no regionwith a lod score above +3. Regions showing a hint of linkage as indicated by a lod score of +1 or greater were analysed further in the extended pedigree (Figure 5-2b). Affected only analysis and analysis on the initial pedigree indicated several regions of potential linkage (lod scores above 1): these included chromosomes 3, 4, 5, 8, 'L4 (affected only analysis) and chromosomes L, 3, 5, I and 20 (initial pedigree - varying age dependent penetrance) (Tables 5-5 and 5-7). EXCLUDE analysis using two point lod scores generated from affected only analysis highlighted two regions at chromosomes I and 14 with equal likelihood for gene localisation (Table 5-4). EXCLUDE analysis using two point lod scores from varying age dependent penetrance (initial pedigree) indicated chromosomes 5, l"L and 1,36 1,8 as possible locations, however, the highest likelihood of the most probable position for this gene indicated chromosome 1 (Table 5-4). Thus, it was indicated from all these analyses that the regions to be looked at in greater detail are on chromosomes 1, 3, 4, 5, 7, 8, \T, 14, 18 and 20. The corresponding lod scores are listed in Tables 5-5 and 5-7. The microsatellite markers which gave indication of linkage were tested in the extended pedigree, results are in Table 5-6 and 5-8' The region on chromosome L8 was excluded with the microsatellite marker D18S452 on analysis of the extended pedigree (Table 5-9). The possible chromosome LL localisation arose from unirrformative markers, and these region were excluded wíth the use of adjacent microsatellite markers (results not shown). Several other regioru¡ were unable to be excluded when additional markers were analysed in the extended pedigree. These included regions on chromosomes4,7,8 and 14 (Table 5-10). Multþoint analyses in these regions were unable to ídentify a region of lod score *2 or greater. Thus, the genetic localisation for the disease gene segregating in famiþ PK80237 was unable to be assigned, although results from exclude analysis indicates that the most likely regions to be on chromosomes 8 and 1.4. It is most likely that several family members are currently presymptomatic, leading to the inability to map this disease gene. As existing unaffected family membets become symptomatíc, the linkage data already generated will be reassessed and linkage will be revealed. These results highlight the problems encountered when dealing with late onset disorder. SLINK analysis on this family predicted a low chance (11.0y" for lod score of +2) of detecting linkage using affected only analysis, which was subsequently experienced with the difficulty in mapping this famiþ (PK80237) despite genotyping 26T nicrosatellite markers from throughout the genome. It was anticipated that these difficulties would be encountered and thus at the same time as conducting a genome screen, alternate methods for identifying the gene in this family were sought (see chapters 6 andT for details) Family PK80248 is too small (Figure 5-3) to conduct a genome screen and thus the mutation responsible for the disease in this family remains uril Although the exact genetic location for the SCA gene segregating in family PK80237 could not be identified, these results and those from other laboratories, emphasise the extent of genetic heterogeneity that exists withh the late onset SCAs. As previously mentioned there are !2 other identified loci for SCA, including DRPLA, a clinically distinct ataxia with t37 phenotype including dementia and epilepsy. Worth et al. (1999) indicated that thete was another family in their study not mapping to the chromosome L5 localisatiory SCA10, (or any other previously identified location). Similar1y, Zu et al. (1999\ described two families which did not map to chromosome 22 or other localisations (ie SCA4 and SCAS - chromosome 15 (SCA1-0 locus) was not tested). Most recently a (CAG)' expansion in the TATA-binding protein gene (TBP) has been identified in a sporadic case of severe ataxia with associated intellectual deterioration (Koide et al. !999). Although this case was early onset, the (CAG)', repeat within this gene was tested in families PK80237 and PK80248. No expansion was detected and no linkage evident for family PK80237 (see chapter 7 lor details). Taking all this data into consideration it is possible that more than 16 different SCA loci may exist. The majority of SCA cases, to date, have been attributed to mutations in the genes shown to have an (CAG)', repeat expansion. Vatious groups have reported differing frequencies of these mutations ranging frotr'1.io/o - 90To for familial cases (see chapter I for details). The unidentified genes for SCA4, SCAS, SCA10 and SCA11 loci have been mapped in single familíes and as such may represent private syndromes of SCA (Ranum et aL.1994, Flanigan el al.'J,996, Worth et al. '1.999, Za et aI. 1999). The locus on chromosome 22has been identified by two independent groups, Zu et aL.1999 and Matsuura et al. 1999; both families mapped to very sinrilar regions, have the additional phenotype of seizr¡res and are of Hispanic Mexican origin. Thus, it is likely that these two families may be related and have the same founder mutation. Although the eventual identification of the disease gene for these apparently rare types of SCA may not result in direct mutation detection for many affected families, these genes may be responsible for at least some of the many sporadic cases where the molecular basis is unlorown. The identification of these genes, and that responsíble for the phenotype in family PK80237 will expand the understanding of the pathogenesis in the SCAs. Further, it will be of interest to see if polyglutamine expansions are responsible for these disorders, or if altemate mechanism(s) exist. 138 Chapter 6 : REPEAT EXPANSION DETECTION Page SUMMARY 743 6.1 Introduction 144 6.2 Repeat expansion detection asEay 145 6.3 Monoclonal antibody (1C2) detection of expanded polyglutamine tracte 1,50 6.4 Material and Methods 152 6.4.7 RED assay 1.52 6.4.2 Analysis ol SEF2-UERDA-I loci 1s3 6.4.3 Monoclonal Ab -lC2 153 6.5 Results 154 6.5.1 RED assay 154 6.5.2 SEF2-VERDA-I loci 156 6.5.3 Monoclonal Ab -lC2 1s6 6.6 Diecuseion 158 r39 CHAPTER 6 : REPEAT EXPANSION DETECTION SI]MMARY Given the difficulty of detecting linkage in SCA family (PK80237) other methods to identify the disease causing mutation were employed. At the outset of this study the major mutations detected for SCA loci were expansions of (CAG)' repeats, all of which are translated to polyglutamine. Several methods have been devised to search for additional (CAG)n repeat expansions including the repeat expansion detection assay (RED assay) and the hybridisation of an antibody specific to polyglutamine (1C2). These two methods were utilised in an attempt to identify a novel (CAG)n repeat expansion in famiþ (PK80237). No (CAG)', repeat expansion was detected by either technique, however, there are limitations to both of these techniques. A small (CAG)n repeat expansion or alternativeþ another completely different mutation other than expansions (deletions, point mutations or insertions), or expansion of another repeat motif would go undetected by both of the approaches used. L40 6.l lntroduction The major mutation causing late onset spinocerebellar ataxia is an expansion of (CAG)n repeats. This is the molecular basis at six of the SCA genes identified and characterised to date. Expansion of (CAG)n is the only feature in common for these genes, which have no obvious homology with one another at either the DNA or protein level. Many studies have documented expansions of an otherwise normally polymorphic (CAG)t to repeat copy number associated with disease manifestation (Orr et al. '1,993, Kawaguchi et al. 1994, Koide et al.'1.994, Nagafuchi et al. 1994, Imbert et aI. 1.996, Lindbald et al. 1996, Pulst et aL. 1.996,Sanpei et al. 1996, David et al.'J.997, Zhuchenko et al. 1997). Early experiments indicated that the (CAG) repeat expansion and subsequent translation to a polyglutamine tract contributes to an accumulation of product targeted to neural cell types, leading to the accumulation of a toxic protein which contributes to the cellular degeneration and associated cerebellar ataxia (Ross, 1995). More recently though, it has been shown that these accumulations also occur in nuclei of non-neural cell types while other experiments indicate that the aggregations are not necess ary for disease initiation, although they appear to be involved in disease progression. Further, it has been postulated that these toxic proteins may be sequestered by the cells as a defence mechanism rather than being the direct canse of pathogenicity (review Zoghbi and Orr 1999). Whatever the biological significance of these accumulations, it would appeil that very different proteins have a common mechanism resulting in very sinrilar diseases. Given that the sole unifying feature of the majority of SCA genes cloned and characterised to date is the expansion of (CAG)'. repeats, it is therefore reasonable to hypothesise that a significant proportion of as yet unidentified SCAs may also be due to expansions of (CAG)n tepeats. At the outset of this study (CAG)n repeat expansions were the only form of mutation identified. To this end there are several techniques which have been devised to identify such repeat expansions. Each method is slightþ different but all reþ on the fact that a CAG repeat may be expanded in molecularly undiagnosed cases with spinocerebellar ataxia type symptoms. r4l 6.2 Repeat Expansion Detection Assay The first of these methods has been termed the Repeat Expansion Detection (RED) assay (Schalting et al. 1993). This method was devised to detect not only repeat expansions of the (CAG). but also other larown pathogenic repeat expansion such as (CCG)". Expansions of (CCG)^ are the prevalent mutation in the most common form of familial mental retardation, Fragile X syndrome. This repeat expansion resides in the 5'untranslated region of the FMR1 gene (Warren and Ashley 1995). Another clinically distinct disorder, Myotonic dystrophy (DM) is due to expansions of (CTG)" in the 3'untranslated region of the gene, DMPK (Brook et aL.1992, Mahadevan et al. 1992 and Fu et aL.1992). The RED assay is able to detect expansions at these and other loci, including expansions at SCA loci. The following discussion shall refer to the use of this technique in reLation to the (CAG)'. repeats specifically giventhat the sample group to be assessed has late onset SCA. All of the above mentioned disorders including many of the lflown SCA loci exhibit a phenomenon lflown as anticipation. Anticipation is the increase in severity and/or the earlier age of onset of disease progression. Molecular analysis indicates that the phenomenon of anticipation is due to the unstable nature of repeats. It is clear that be transmitted from expansion mutations (termed dynamic mutations) ^ty not stably one generation to the next and thus lead to more severe disease progression" arrd/ or earlier age of onset. Thus, anticipation is a good indicator of a disease in which the mutation involved in manifestation has a reasonable likelfüood of being an expansion of a repeated sequence (Sutherland et al. 1991). L42 The main benefit of the RED assay is that this technique is able to ídentify repeat expansions i^ *y region of the genome. Figure 6-1 outlines the basic principle of the assay. No prior knowledge regarding mapping details or unique sequence is necessary. \4/hile this appears to be a highly desirable attribute, it is also of limited value when a (CAG). expansion is identified in a family segregating fot SCA in that discovery of a (CAG)n repeat by the RED assay yields no information regarding the localisation or unique flanking sequence around the (CAG)', expansion. Methods have beerr devised, howeveç to enable cloning of the identified (CAG)n repeat expansion (see below for explanation). Nevedheless, the RED assay on its own does provide useful information regarding the existence or otherr,r.ise of a potential (CAG)1 expansion in families. The RED assay has been successfully utilised to identify the gene for SCAT (Lindbald et aI. !996). Prior to testing by the RED assay, linkage analysis had localised SCAT to 3p14- 2l.L,however the mutation at this locus was unlmown (Benomar et al. 1995, Gouw et al. 1.995, Holmberg et al. 1995). As anticipation is a hallmark of this disorder (and of the majority of SCAs) it thus represented a good candidate disease for assessment by the RED assay. DNA from affected individuals from families with SCAT and lorown to map to the 3p1,4-2l.L localisation were tested. All affected individuals were shown to have an expansion of a (CAG)n as detected by the RED assay (Lindbald et al. 1996). The characterisation of the actual gene causing mutation was deter:nined by another group (David et al.1997) using more traditional positional cloning techniques, whictr confirmed the mutational basis to be a highly unstable (CAG)n repeat expansion. Additionally, for SCA7, the identification of a protein with an expanded polyglutamine tract confirmed the validity, reliability and utility of the RED assay. (Trottier et al. 1995a). The results of the RED assay have further unveiled the presence of large expansions of CAG repeats in approximately 29o/o of control samples (Lindbald et al. 1995). Two apparentþ non pathogenic loci have been characterised and identified as SEF2T (chromosome 18) and ERDA1 (chromosome 17). These two loci account for nearly 95% o1 all nonpathogenic expansions detected (Nakamoto et al. 1997, Breschel et aL. 'J,997). It is therefore useful to assess the expansions of these loci in conjrrnction with the RED assay. This way any expansions detected by the RED assay can easily be assigned to one or other of these loci and new (CAG)^ repeat expansions more confidently identified. L43 (CTG)r z Oligonucleotides t Annealing (CAG)n repeat t Ligation (*) * * x 200-300 cycles t Denaturation I Cycling t Ligation products are MULTIMERS of (CTG)tz oligonucleotides Ligation products are run out on polyacrymide and hybridised with (CAG)n oligonucleotide Figure 6-1 : Schematic representation of RED assay: (CTG)Iz oligonucleotides are hybridised to genomic DNA . Adjacent (CTG)17- mers are ligated together. This process goes through a large number of cycles (200-300). The resultant ligation products are multimers of the (CTG)I7-mer. Thus genomic DNA containing a (CAG)n expansion will have corresponding larger multimers (adapted from Lindbald et al. 1997). L44 New developurents have allowed the original RED assay to become a cloning tool in the event of identification of a (CAG). repeat (Koob et al. L998.) Briefly, the cloning method, or RAPID technique, relies on fractionation of digested DNA by electrophoresis, to reduce genomic complexity. Subsequent analysis of these fractíons by additional RED assays identifies the fraction containing the (CAG)', repeat. Positive repeat containing fractions are then identified and cloned into a suitable vector system. Clones are selected by hybridisation to poly (CAG), seguenced and subsequently patient material is PCR amplified with unique primers identified which flank the repeat. Application of this technique has recently led to the identification of a novel SCA due to expansions of a (CTG)n repea! SCAS (Koob et al. 1999). Sanpei et al. (1.996) developed an alternative method to clone disease genes involved in these polyglutamine disorders. This technique is refened to as the direct -identification of ¡epeat expansion and gloning lechnique or DIRECT method. This technique enables the selective detection of expanded (CAG)', repeats by genomic Southern blot. The genomic fragment containing the expanded allele c¿u:r be cloned thus enabling molecular characterisation of the disease causing gene. This method has been successfully applied to identify the gene responsible for SCA2 (Sanpei er aL.1.996). The principles of this technique are outlined in Figure 6-2.It is of considerable interest that the final allele subcloned in this study was not an expanded alleles but instead one in the normal range, containing 22 (CAG)n repeat copies. The long unstable and apparently non-pathogenic (CAG)n repeat expansion at the ERDAL locus, however, have been successfully identified using the DIRECT technique (Ikeuchi et al. 1998). t45 il iltIt t ¡lltrl¡l lll ll¡!llllll lll¡llllll ¡rr¡lllllll ll (CAG)n repeat 5', Step 1: PCR in presence ot ¡a 3foonfr JI JZ 32 2 2 5' 132 p 32 p 3' ilil ¡tt ilIttt ililt¡ll¡Ill¡l l lll¡ll llllllltll¡Illtl¡l (CAG)n repeat 5' biotin Step 2:Strand separation using strepavidin-coated beads generates(CAG)n probe with high specific activity an aa 32 JZ 2 JZ JZ a1 p p p P p p ililililtilrIIlIl¡ll¡lllllllllllllllllllllll¡III¡lll r) unrque (CAG)n probe sequence Ìt(¡) 6 (ú Step 3: Detection of a disease-specific expanded (CAG) repeat IE] I L_t Step 4: Gel purification and cloning. (ln wTro packaging and of phage genomic library and subsequent screening by plaque hybridisation using (CAG )n probe Genomic blot Figure 6-2: Schematic representation of the DIRECT assay. A single stranded (CAG)n repeat (high specific activity) probe was prepared by the incorporation ot s-sh dATP during PCR (step 1). This probe is separated using streptavidin-coated beads (step 2). Disease specific expanded (CAG)n repeat bands are selectively detected by Southern blot under stringent hybridisation conditions (step 3). This fragment is then gel purified and cloned into MAPII lor subsequent screening (step 4) (adapted from Sanpeiet a1.1996). t46 6.3 Monoclonal antibody (1C2) detection of expanded polyglutamine tracts It is important to reiterate at this point that the (CAG)n expansions common to the majority of SCA loci characterised are located within the open reading frame. Fu¡ther, the CAG repeated unit is subsequently translated into a polyglutamine tract. The diseases which have this property have thus been termed polyglutamine disorders. For the majority of the SCAs the pathogenic mechanism is the expansion of the otherwise normally polymorphic sequence coding for the polyglutamine tract. Protein products which have polyglutamine tracts in the normal range (typically between 10 to 35 glutamines) are well tolerated by cells with no apparent adverse affect. Flowever, when these same protein products have polyglutamines beyond a threshold level (that is 35-40 glutamines in the majority of SCAs), they become pathogenic. This comrnon property allowed the development of a technique which identifies proteins with expanded polyglutamine tracts. The method devised capitalises on the fact that polyglutamine tracts occttr norrnally in several non pathogenic proteins (Trottier et al. 1995a). Polyglutamine tracts occur in many eukaryotíc proteins, particularþ in several transcrþtion factors (Gerber et al. 1,994). In the human transcription factor, TATA-binding protein (TBP), the most corrunon polyglutamine tract is 38 copies. A rare allele of 42 glutamine copies also exists. Until recently this gene had the longest known polyglutamine tract not associated with a dieease phenotype (Imbert et al- 1994). There has now been a report of one sporadic case of early onset SCA and associated mental impairment with an expanded polyglutamine tract of 63 copies (Koide et al. 1999). Several apparentþ non pathogenic alleles at the SCA3/MJD locus of 43 and 44 glutanines have been detected but these are rare observations (Hsieh 1'997). A monoclonal antibody (Ab) which specifically identified the polyglutamine containing regionwas raised against the TBP protein (Lescure et aI. 1995). This monoclonal antibody (1C2) was utilised to detennine if it would identify other proteins which contained expanded polyglutamine tracts. Western blot (WB) analysis of lymphoblastoíd cell line (LCL) extracts from patients with Huntington disease (HD) showed that the normal protein and expanded allele protein migrated differentþ through a polyacrylamide gel (Trottier et al. \995a). Expansions of a (CAG)n repeat are linown to cause HD. Huntington disease is also a member of the so called polyglutamine disorders, although it is clinically distinct from the SCAs. L47 Initial studies using the 1C2 Ab against HD affected individuals indicated that the monoclonal Ab would recognise only the expanded, pathogenic protein. Normal tange glutamine copy number proteins gave little or no signal. Additionally, it was observed that the binding oL LC2 was strongly influenced by the length of the polyglutamine tract. The longer the tract the greater the degree of binding (Trottier et al. 1995b). This has been subsequentþ confinrted by kinetic analysis of the interaction of the F(ab) fragment of the 1,C2 Ab and polyglutamine tracts under near native conditions. The F(ab) fragment has a much stronger affinity for longer polyglutarrine tracts than those in the normal range and this association is very stable, dissociating 100 times more slowly than from the normal length counterpart (Myszka 1997). These experiments indicate that expanded polyglutamine adopts a conformation which is preferentially recognisedby 1C2. -I.,C2 It is easy to realise the benefits of using the Ab as an indicator or probe for detection of proteins containing expanded polyglutamine in individuals affected with SCAs. This method has been successful in the identification of proteins with expanded glutamine tract copy numbers in patients with both SCA2 and SCA7. \4/hile this technique allows the identification of proteins with potentially pathogenic polyglutamine expansions, to date there has been no successful application of the LC2 antibody i^ the identification of a unique gene for a polyglutamine disorder. Attempts to screen two cDNA expression libraries from LCLs of individuals affected with SCA2 and SCAT failed to identify any clones (Trottier et al. L995b). Under bacteriophage plaque screening conditions, four novel polyglutamine coding cDNAs have been identified (Imbert et al. 1.996); however, none of these have been shown to be associated with a poþglutamine expansion disease. Although the specific expanded DNA sequence may not be captured with the use of this technique alone, the 1C2 Ab screening of SCA patient protein extracts provides evidence that there exists a novel polyglutarrrine expansion in affected individuals. This chapter describes the use of both the RED and monoclonal Ab detection assays to assess whether the symptoms in the large family with late onset ataxia (PK80237) is due to an expansion of a (CAG) repeat. This family was chosen for analyses by these techniques for a number of reasons: r48 L. This family clinically has spinocerebellar ataxia. (see 5.2. for details) Th" majority of SCA mutations identified to date have been due to expansions of a (CAG) repeat therefore it is hypothesised that a similar mechanism exists as the causative mutation in this famiþ. 2. Strong evidence of anticipation is noted in this family with age of onset in the first generation on average at approximately 60 years of age. Age of onset in the second generation is approximately 20 years earlier (ie approximately 40 years old). The existence of anticipation contributes further evidence that the underlying mutation in this family may be due to an expansion of a (CAG) repeat. 3. No expansion mutations at known SCA loci were detected in family PK80237 and linkage to these loci was excluded indicating the existence of an additional locus. (see 5.4.2). These rrethods were applied in parallel with a total genome screen (Chapter 5) in an attempt to maximise the chance of identifying the causative mutation in this family (PK80237). 6.4 Material and Methods 6.4.L RED aseay (RED assay experiments were kindly carried out by Ms Annette Osborne within the Department of Cytogenetics and Molecular Genetics, WCH, Adelaide) Genomic DNA extraction: DNA was extracted using a standard phenol/chlorofonrr extraction method (Material and Metho ds 2.1.1) Oligonucleotides : repeat oligonucleotides comprising of (CTG)rz and (CAG)rz repeats were synthesised and used as annealing units and probes, respectively, in the RED assay. RED assay was undertaken as describedinchapter 2.7 L49 Individuals loaded on the polyacrylamide gel included 1) unknown SCA affected individuals from PK80237 DNA#4527,5245,5035, 5040, 5034, 463L, 4542 2) unaffected individual from PK80237 DNA#522 3, 5213, 52-J,4,5097,5129,5L30,4630 3) lcrownSCA1 control DNA#4561 Expanded (CAG) allele = 45 copies 4) lcrown Spinal bulbar muscufar atrophy (SBMA) control DNA#4286 Expanded (CAG) allele = 40 copies 5) larown Myotonic dystrophy (DM) control DNA#2669 Expanded (CTG) allele = greater than 200 CTG copies (NB : Mutations causing SBMA are expansions of (CAG) tepeat, mutations causing DM are expansions of (CTG) repeat) Experiments gave eqrrivocal results prompting numerous repetitions of both filter construction and hybridisation. 6.4.2 Analysie oÍ SEF2-I/ERDAI loci Amplification of non-pathogenic (CAG)n expansions at the SEF2-1, and ERDAL loci were assessed as per chapter 2.2.3 Primers used in the analysis are SEF2-1 Forward primer 5' AAT CCA AAC CGC CCT CCA AGT 3' Reverse primer 5' CAA AAC TTC CGA AAG CCA TTT CT 3' (Nakamoto et a7.1,997) ERDA-1 Forward primer 5' ATG GAT TGT TCC AAG GAG 3' Reverse primer 5' AGG TGG AAG GAA GGT CTT 3' (Buschel et aL.1.997) 6.4.3 Monoclonal Ab (Protein extractiory western blot preparation and transfer were undertaken by the candidate. Probing of the filter was performed by Dr. Yvon Trottier at Institut de Genetique at de Biologie Moleculaire et Cellulaire, INSERIvI, Cedex, France. as part of collaborative agreement). 150 Lymphoblastoid cell lines (LCLs) were established from individual75L0,PK8O237 (This was done by Ms Rosalie Smith withinthe department of Cytogenetics and Molecular Genetics, WCH, Adelaide) Protein extracts from LCLs were extracted according to protocol (Material and Methods Chapter 2.8.1) Protein extracts loaded on gel included: GEL 1 L) Normal male 2) Normal female 3) 7510 unknownSCA 4) lcrownHD controlExpanded CAG:69 copies. 50 pg of each protein was run on6% andl?o/o polyacrylamide gels. A lalown molecular marker was also loaded on this gel. Thís gel was transferred to 45pm cellulosenitrate (Schleicher and Schuell) and probed initially with 1C2 Ab, stripped and then subsequently hybridised with anti-huntingtin Ab. (Material and Metho ds 2.8.2, 2.8.3) 6.5 Results 6.5.1 RED assay Genomic DNA from affected and unaffected individuals from two generations of pedigree (PK80237) were subjected to RED assay. The oligo used for detection was a (CAG)rz repeat oligonucleotide. This is complimentary to (CTG)' repeat ligation products and thus able to detect expansion of (CAG) repeat if present. On each gel an appropriate SCA control sample with 45 (CAG) repeat copies, SBMA control sample with 40 (CAG) repeat copies or leown DM control with a CTG repeat expansion of greater than 200 CTG repeats was loaded, as each of these disorders represents expansion of the same (AGC) DNA sequence (atthough transcribed as different strands of the repeat in different diseases). A total of 4 assays were carried out to ensure that reliable results were obtained. Results for the control sample were positive in each case. Ffowever, in all4 replicated experiments, no expansions of (CAG) were detected in individuals from the SCA pedigree (PK80237) (Figure 6-3). At least 10 other RED assays were carried out in which there was a large amount of lane background, or no signal for positive controls. 151 357bp 306bp 25Sbp 204bp 1 53bp 153bp 1 02bp 102bp Lane Figure 6-3: Example of results from RED assay. Four replicate experiments were carried out and all indicated that there were no (CAG) expansions detected in affected members of the SCA pedigree (PK 80237). lndividuals in lanes 2-7 are affected individuals from PK 80237. Lane 1 contains RED assay results from a known SCAI individual, (CAG) expansion=4s (CAG) copies. Lane I contains RED assay results from SBMA control, expanded (CAG) allele=40 (CAG) copies Lane 10 contains RED results from a known Myotonic dystrophy control, expanded (CTG) > 200(CTG) copies. (102bp represents 2 ligation r52 products, 153bp 3ligation products etc,) 6.5.2 SEF2-1ÆRDA-1 loci Analysis at the SEF2-1, and ËRDA-1 loci indicate that there was no expansion segregating in family (PK80237). Alleles segregating in affected members for SEF2T were in the unexpanded range 1.0-29 (CAG) copies; while those for ERDA1 were 25-30 (CAC) copies, both of which are in the normal (ie unexpanded) range (Figure 6-a). Alleles at both the ERDA-L and SEF2-1 loci were sequenced by dye primer sequencing reactions to confirm repeat copy number (see method section for details of sequencing- 2.4.L results not shown). 6.5.3 Monoclonal Ab IC2 Protein was extracted from sample (75L0) (a lymphoblastoid cell line). The westem blot (GEL L) was probed first with the Ab 1C2, stripped and then probed with anti HD antibodies. Probing with anti huntingtin Ab was done to assess the concentration of protein. Comparative amounts of protein were loaded on the gel and consequently equal interuity hybridisation signal was detected for each sample when probed with anti HD Ab (results not shown). Probing of this filter (GEL 1) with 1,C2 Ab gave no indication of expansion of a polyglutamine tract in the protein extract from sample 7510. Results from the protein extracts of the HD individual indicated that there was hybridisation to both the normal and expanded HD alleles, confirning a positive hybridisation result (results not shown). In conclusion, experiments using the monoclonal Ab LC2 were unable to detect a new expanded polyglutamine protein in extracts from an affected individual (7510) from family PK80237. 153 30 25 25 26 26 29 30 26 26 1 0 1 0 1 0 1 7 1 7 7 30 25 30 29 29 30 30 30 29 1 0 1 7 1 7 1 7 1 7 7 a. alleles at ERDA1 locus in SCA pedigree b. alleles at SEF2-1 locus in SCA pedigree Figure 6-4 : Range of normal alleles detected in the SCA family PK8O237 at the ERDAI (a) and SEFz-l(bl loci. No expansions were detected at either locus, supporting results of the RED assay. 154 6.6 Discusaion Results from the application of the 1C2 monoclonal Ab to detect proteins with expanded poluglutamine tracts verify those observed by the RED assay. Together these results indicate that there is no significant detectable expansion of a polyglutamine tract. \Ä/hile these findings imply absence of a large polyglutamine expansion segregating in this family it is not conclusive evidence that no expansion exists. The RED tecturique proved to be notoriously difficult to get reliable and reproducible results. Only four results gave strong signal in the control sample; however, there were another L0 attempts which resulted in either low signal for the control or general non specific lane background. This may be explained by there b"i.g a small expansion in the unlmown SCA DNA samples. A small expansion m.ay not have been observed due to technical problems regarding intensity of ladder bands. If conditions were not optimal, concentrations of smaller ligation products may have been inadequate, thus giving correspondingly low, and therefore undetectable, hybridisation signal. It is krown that the RED assay detects larger expansions more readily than smaller expansions and that small expansions may miss detection (Burgess et al. 1998). The RED assay is able to detect expansion at several different loci. These include DM and FRAXA (Schalling et al.1993). These two disorders have large expanded alleles of greater than 50 (CTG) and 230 (CCG) repeats respectively. Of the SCA loci SCAZ and SCAS were independentþ identified by the RED assay (Lindbald et aL.7996 and Koob et aL \999). Affected alleles lor SCAT are generally between 38-130 (CAG). repeats, while the a-ffected (expanded) alleles at the SCAS locus are in the range of Tl.0-\27 (CTG) repeat units, thus these loci have the largest expanded alleles for the SCA loci. The SCA loci SCA2 and SCA6 which have the smallest associated polyglutamine expansion have not been documented to have been detected by the RED assay. It may well be that the sensitivity of the RED assay does not permit efficient detection of expanded (affected) alleles in the shorter range. Indeed pathogenic SCA6 alleles are in the normal range for other (CAG) loci arrd are therefore unlikely to be detected by RED assay. 155 Further support for the results of the RED assay, with respect to the mutation causing SCA infamily PK80237, is implied from results of amplification at t}lre SEF2L and ERDA1 loci (Figure 6-3). In combinatiorv these two loci account lor 95o/o of expansions detected in normal individuals (Nakamoto et al. -J.997, Breschel et al. 1,997\. Affected individuals from family PK80237 have alleles well within the normal range (25-30 (ERDA-1) and 10- 29 (SEF2-1): Figure 6-3). While the absence of expansions at these loci does not directþ validate the results of the RED assay it does however, confirm that no potential normal expansions at these loci were missed by the assay. Results from experiments at the protein level concur with the presence of a small or no expansion in family PK80237. The western blot included a lane containing protein extract from an individualwith a loownHD (CAG)rrrepeat expansion. Hybridisation of this blot detected the expanded allele in the HD patient but gave no signal indicating an novel expanded allele for the SCA patient (7510). Thus, it was assumed that no expanded allele was detected by the 1C2 Ab in the protein extract of the affected individual tested (7510). To date there is no experimental evidence published whích indicates that expansions at the SCA6 locus are detected by the 1C2 monoclonal antibody. Further, in screens of individuals with consistent SCA phenot¡>e no novel expansions were detected (Stevanin et al. 1996, Lopes Cendes et al.'J.996). Th" specificity of binding by the 1C2 Ab strongly correlates with the length of the polyglutamine. The threshold for detection of polyglutamines is approximately 33 polyglutamines. Ataxin-1 (SCA1, protein) with less than 50 polyglutamine is not detected and this is most likely to be due to low expression of the protein in LCLs (Trottier et al. 1995). These results indicate that the 1C2 Ab may not recognise small polyglutamine expansions. Altematively it may be that the protein containing a potential polyglutarrrine expansion may not be expressed or be poorly expressed in the tissue/cell t¡re examined by western blot analysis. (In the case of sample 7510 the tissue used for protein extraction was LCLs). The size of repeat expansion in most SCA disorders characterised to date generally conelates with age of onset (Jodice et al.'1.994, Ranurn et aI. 1994, Maruyama et al. 1,995 and Cancel et al. 1,997). Thus, individuals with earlier age of onset generally have larger expansions. The age ol onset for the individual tested (7510\ was approximately 42 yearc of age and therefore the length of the potential expanded allele may be below the detectable threshold. 156 It is possible that the conditions used for western blots (denaturing conditions) -.y not be conducive to detection of smaller expansions. When the 1C2 antibody has been used to screen cDNA expression libraries, small polyglutanrine repeats were easily detected. The conditions for the Western blot are much more stringent using a denafurant and it may well be that the target protein is unfolded with SDS, a reducing agent, and heat. Therefore it may be that a Targer repeat expansion is needed before conformational alterations are detected by this experimental system (Imbert et aL.1,996). It is evident that the success of detection of a new polyglutamine expansion protein relies heavily on both threshold and level of expression. For sample 75L0 it may well be that both the (CAG)', repeat copy number and expression of the protein in LCLs is not optimal for detection with the 1C2 Ab. An additíonal method is available which may support the results indicated by the RED and 1C2 hybridisation assays. The DIRECT (5lirect jdentjfication of repeat expansions and gloninglechnique) identifies expanded CAG repeats by genomic southern blot and allows subsequent cloning of the genomic fragments containing the (CAG) repeat. This method was first described and used in the cloning of SCA2 (Sanpei et aI. \996). It is interesting to note that the final allele subcloned in ttìis study was in the nonrral range rather than the affected range. The long unstable and apparently non-pathogenic (CAG)n repeat at the ERDA-1 locus, however, was identified using the DIRECT technique (Ikeuchi et al. 1998). A major disadvantage of the DIRECT technique is that large amounts of genomic DNA are necessary to optimise the conditions for positive identification of (CAG)' expansions. Genomic DNA is digested with many restriction enzymes to obtain a genomic fragment of optimal size for cloning. There is no combination of restriction enzymes that is guaranteed to provide the best results and many digestions may need to be tmdertaken before the desired result is achieved. Predominantly it was because of this large usage of DNA that this approach was not attempted. Many DNA samples from family PK80237 did not have large yields of DNA and would have been exhausted if subjected to this method. There may be altemate reasons for not detecting a (CAG) repeat expansion in affected members of family (PK80237). It is possible that the mechanism causing the disease symptoms in this family ís not due to a repeat expansion. A point mutation in the calcium ion channel gene, CACNAIA, has been identified in a family with progressive r57 ataxia (Yue et al. 1998). Therefore it is possible that a sirrilar mechanism may be responsible for the disease segregating in family PK80237. Linkage analysis (see 5.2.2.1) excludes the likelihood of a mutation in the CACNA1A gene for family PK80237, however, point mutations in a similar gene is possible and such a lesion would go undetected by both the 1C2 hybridisation method and the RED assay. There also is the possibility that a small (CAG)n repeat expansion is the disease causing mutation. A small disease causing expansion such as that identified for SCA6, could easily be missed by both techniques. Recently, a (CTG)'. expansion in the 3'untranslated regionhas been shown to be expanded in a novel SCA locus (SCA8) (Koob et al. L999), If the ataxia in famiþ PK80237 is due to a sinrilar expansion then it that would have gone undetected at least by the 1C2 hybridisation technique. Additionally a similar but smaller expansion may have escaped detection with the RED assay. Additional trinucleotide repeat sequences (eg. (CAA), which still code for polyglutamine) may be pathogenic. Alternatively other repeat motifs (eg dinucleotides or others) may be pathogenic if they reside in the untranslated region as for DM and SCA8. Such mutations may still result in autosomal dominant inheritance. While the majority of late onset neurological disorders exhibiting anticipation are due to an expansion of (CAG)' repeat, this may be due to an experimental bias since this repeat has been the predominant one looked for. Many other trinucleotide repeats have been shown to expand including several resulting in disease phenotype:- GAA-Friedeich ataxía; Campuzano et al. (1996) and ACG - pseudoachondroplasia; Delot et al. (1999). It may be that another repeat expansion other than (CAG)' could be involved in the pathogenesis of the SCA in family PK80237 and thus r¡ndetectable by both the RED assay conducted and IC2 Ab hybridisation. Lr summary, the results from both the antibody hybridisation experiments and RED assay indicate that there is no (CAG)' repeat expansion detected which is responsible for the symptoms in the SCA family (PK80237). Flowever, there are major limitations for both assays and as such it is possible that a small expansion of a (CAG)tr repeat may have gone undetected. Alternatively another disease causing mutation as discussed above would be undetectable by the methods used. Therefore, while these techniques would detect an expansion of a (CAG) repea! mutations of another nature would go undetected. 158 Chapter 7: SCREENING OF (CAG)n POSffIVE cDNA CLONES Page SUMMARY 163 7.1 Infroduction 164 7.L.l Library aource L65 7.1.2 Heterozygosity 165 7.7.3 Composition of repeafllengfh 165 7.1.4 Position of repe 166 7,\.5 Genetic location of the cDNA clone 166 7.2 Material and Methods 170 7.2.1 Sporadic cases and small families 170 7.2.2 Family PK80237 177 7.2.3 Anonymoue (CAG) poeitive cDNA clonea t7L 7.2.4 Linkage analysis 772 7.3 Results 173 7.3.1 Sporadic and small families analysis 773 7.3.2 Linkage analysia - PK8O237 174 7.4 Diecussion 175 159 CHAI,-TER 7 SCREENING OF (CAG)" POSITIVE cDNA CTONES SUMMARY (CAG). positive cDNA clones were screened in another approach to identify the disease causing mutation in SCA family PK80237 and 128 other sporadic and familial cases of SCA. Of the fourteen different (CAG)n positive cDNA clones examined, the (CAG)' marker within only CTG2Oa had allele sizes representing a possible expansion in three affected individuals. However, this allele was revealed to be within the upper range of normal polymorphic variation and excluded as an expanded disease causing mutation when analysis in nonrral control individuals detected this allele at a similar frequenry as that determined in the affected individuals. No other alleles suggestive of expansions were detected in the affected individuals for any of the cDNA clones tested (CTG7a, CTG4a, CTG3a, }J-J.6,}ì3, CAGRL, L237, CTG-81, CTG-833, TFIID, i.8, i.L8L and T58373). This excluded expansions of (CAG)'. alleles contained within these clones as the disease causing mutatíon in the SCA individuals tested. 160 T.llntuoduction An alternate method to those described in chapter 6 for the detection and identification of expanded (CAG)n repeats in individuals affected with SCA relies on screening previously described (CAG)n markers not yet associated with SCA. The rationale for this approach is based on the fact that the majority of SCA mutations identified so far are due to unstable CAG/CTG repeat expansions (which may or may not be translated). Various cDNA libraries have been screened with (CAG). oligonucleotide probes and positive clones have been sequenced to assess the composition and length of the tepeat. There have been numerous laboratories which have used this strategy or altemativeþ screened available EST databases for the identification of (CAG)n positive clones (Li et al. L993, Jiang et al. L995, Neri et al. t996, Margolis et al. L996, Margolis et al. L997, Bulle F et al. 1997, Reddy et al. L997, Pawlak A et al. t998, Albanese et al.'1.998, Kaushik et al. 1998). Table 7-1 summarises these data. More than 300 different (CAG)^ positive cDNA clones have been identified. It is feasible that an expansion in any of them could be disease causing ie result in spinocerebellar ataxia or similar symptoms. This mrmber, 300, represents those published in the literature but there are also many more clones which exist in databases alone. Both published and unpublished clones can be found at a number of sites; CHLC - http:/ /www.chlc.org, IMAGE - http:/ /www.bio.llnl.gov/bhp/image/ifii/ht1m, CEPH http:/ /www.cephb.fr /cdnaand Genbank -http:/ /www.ncbi.nlm.nih.gov/Web/Genbank/. Care must be taken when choosing clones from these tesouÍces as there is no guarantee that the irrformation extracted relates to discrete entities; ie identical clones may be recorded under different names. It is difficult to screen every (CAG)n positive clone from such a Large number and therefore several selection critetia were utilised to improve the chance of identifying a clone carrying an CAG/CTG repeat which may be expanded in SCA patients. T6L These selection criteria are as follows 7.I.lLibrary source: The cDNA library sources from whictr (CAG)n positive clones were chosen were foetal or adult brain libraries. This is the tissue affected in spinocerebellar ataxía and therefore expression of the disease causing transcript is essential. Additionally, the selection of clones made from specific regions of the brain lcnown to be affected in the SCA disorders (eg cerebellum) muy increase the chances of choosiog u relevant candidate clone, and thus identifying a new SCA gene. The cDNA clones need not be exclusively expressed in these tissues; however, (CAG)n positive cDNA clones which did not show expression in brain but rather expression elsewhere were not chosen for screening. T.T.2Heterozygosity: At the outset of this study it appeared that the majority of SCA, causing expansions occurred in repeats which were higtrly polymorphic in the normal r¿mge of alleles sizes (Orr -J.994, et aL. 1993, Kawaguchi et al. Koide et al. 1994, Nagafuchi et al. 1994, Lindbald et al. 1996, David et al.1997). Coruequently, the second consideration taken into account when choosing which (CAG)n positive cDNA clone to test was the heterozygosity. Characterisation of the SCA2 and SCA6 loci however, indicate that high heterozygosity of normal alleles may not necessarily be a global feature of the SCA genes. Therefore the (CAG). repeats may not need to be highly polymorphic to be potentially pathogenic. (Imbert etaL.1996, Pulst etaL.1996, Sanpei etal.1'996, Zruchenko etal.1997). 7.1.3 Repeat compositio4y'length: Two important factors to take into consideration are both the length and complexity of the (CAG)n repeat stretch in the cDNA clone. A longer repeat stretch has the potential.to be more unstable on transmissioru although this is not always the case. Most importantly the number of consecutive (CAG)'. repeats is a good indicator of potential instability und hence, pathogenic expansion. To date all of the expanded SCA alleles are perfect repeats. (Orr et aI. t993, Kawaguchí et al. 1994, Koide et al. 1.994, Nagafuchi et al. 1994, Imbert et aI.t996, Lindbald etaL.1996, Sanpei etaL.1.996, David etaI.\997, Zhuchenkoetal. 1997) cDNA clones generally greater than L0 (CAG). repeats and of perfect (CAG)n repeat units were selected for screening. r62 7.1.4 Position of the repeat: Another useful attribute whic-h can be utilised when deciding which cDNA clones to select to testing is the knowledge that the repeats all exist within the open reading frame of the protein and are translated to polyglutamine tracts. Therefore, if information regarding location of the (CAG)' repeat \^rithin the cDNA clone is available this can irrfluence the decision of whether to choose that clone for screening. If analysis of the sequence in which the repeat is embedded suggests that the repeat could be translated as polyglutamine, this would be a positive selection criterion. This option may not always be available as many of the cDNA clones [sted in databases and published represent only partial cDNA clones and the potential open reading frame can not be determined. 7.1.5 Genetic location of the cDNA clone: If genetic mapping data are available for cDNA clones this can provide important information. Clones which map to lmown regions of SCA localisations or chromosomes ¿üe excellent positional candidates for the relevant families and applicable also to sporadic cases (ie cDNA clones which may map to localisations for SCA4 (chromosome 16) (Flanigan et aI.'1.996), SCAS (chromosome 11) (Ranum et aL 1994), SCA10 (chromosome 22) (Zn et al.1.999) and SCA11 (chromosome L5 (Worth et al. 1999). Some or all of the above criteria were taken into consideration when cDNA clones were chosen for screening both sporadic (isolated) cases and familial cases of SCA. Previously published primers or new primers designed from published sequence flanking the (CAG)tt repeat were synthesised and used to amplify genomic DNA. Samples were screened in an attempt to identify a new expansion. This approach has been successfuI in the identification of DRPLA (Koide et aL. L994) and most recently SCA6 (Zhud:renko et al. 1997). 163 Table 7-1: Summary of a proportion of (CAG)n repeat positive cDNA clones from the fterature. This list does not include all the identified (CAG)n repeats; however, it does indicate the vast number available for testing. Chromosome 1- library source localisation het (alleles) clone CTG-811 brain (cerebral chr L s0% Q) cortex) i.l.g02 breast, placenta chrl (1q32qa1) 32% (2 7 clones3 adult brain chr L ND CTG4aa frontal cortex (AD) chr 1 21,% (3) H454 foetal brain chr L 0% (1) DT1P1A45 adult brain chr 1 (1q12) 0% (1) DT1P2C65 adult brain chr 1 (1p33) 12% (u*) Chromosome 2 library source localisation het (alleles) clone T6511 adult brain chr 2 ND L69,¿ foetal brain chr 2 (2q37.3) 75y" (9) L2344 foetal brain chr 2 (2q27.2) 74% (3) DT1PTB65 adult brain ctu2(2p23.7) 0% (1) Chromosome 3 - library eource localisation het (alleles) clone CTG-8331 brain (cerebral cþrr3,12 70% Q) corbx) 2.1162 foetal brain chr 3 (3p14) 88% (e) 2.462 foetal brain c}lrr 12,3 68%(9)<.hr12 i.1912 foetal liver, spleen chr 3,11,8 58y, (2) 3 cloness adult brain chr 3 ND DT1P1B10-1s adult brain chr 3 (3p21.33) 73% (u*) DT2P1C45 adult brain chr 3 (3p24.3) 50% lunk) Chromosome 4 library source localisation het (alleles) clone 2.179', foetal brain chr 4 (4q28.3) 22% (5) 4 clones3 adult brain chr 4 ND H34 foetal brain chr 4 31,% (5) Chromosome 5 library source localisation het (alleles) clone CTG-A31 brain (cerebral cll.r 5,6 o% (1) corÞx) r.1822 breast chr 5 s% (3) 3 clones3 adult brain chr 5 ND DT1P2C125 adult brain chr 5,6 50% (Unk) Chromosome 6 - library source localisation het (alleles) clone CTG-A31 brain (cerebral chr 5,6 0% (1) corÞx) 4 clones3 adult brain chr 6 ND 4 CTG20a frontal cortex (AD) chr 6 15% Q) HM4 foetal brain chr 6 (6q14-15) oy" (1) L64 Table 7-1.: continued Chromosome 7 library source localisation het (alleles) clone G1W973 adult brain chrT ND F2g4 foetal brain chrT (7q36.3) 0% (1) Chromosome 8 library soutce localisation het (alleles) clone i.1.81'z foetal liver, spleen chr 3,11,8 58% Q) 3 clones3 adult brain chr 8 ND Ig54 foetal brain chr 8 46% ß\ Chromosome 9 library source localisation het (alleles) clone 3 clones3 adult brain chr 9 ND H424 foetal brain chr 9 25% Chromosome 10 library soulte localisation het (alleles) clone crc-845d1 brain (cerebral chr L0 0% (1) cortex) 2 cloness adult brain chr 10 ND Chromosome 11 library source localisation het (alleles) clone i.1g1z foetal liver, spleen chr 3,1L,8 s8% (2) 7 clones3 adult brain chr 1,1 ND DT2P1G755 adult brain chr 11 (11q11) 0'/r ft\ Chromosome 12 library source localisation het (alleles) clone CTG-833I brain (cerebral chr3,12 70% (n cortex) crc-837*1 brain (cerebral chr 12 85% (13) cortex) 2.4G foetal brain chr12,3 68'/,(9)<.hr12 M178853 adult brain chr 12 ND Hl"4 foetal brain chr 12 (12p12) 20% (2) L1144 foetal brain chr 12 (12q13.12) 0% (1) DT1P1B115 adult brain chr 12 (12q21,.1) o% (1) DT1P1B10-25 adult brain cht 12 (12q21,.1) 18% (Unk) r73t foetal brain c}:rr12 38% NB : *CTG-837 is the clone shown to be expanded in DRPLA' Chromosome 13 - library source localisation het (alleles) clone CTG-A41 brain (cerebral chr 13 20% (2) cortex) i.g2 infant brain chr L3 (13q13.1-13.2) 907" (15) 2 clones3 adult brain chr 13 ND 165 Table 7-L: continued Chromosome 14 library source localisation het (alleles) clone 3 clonesg adult brain ch¡ 14 ND DT2P1F55 adult brain chr L4 (14q11".2) 0% (1) Chromosome 15 library source localisation het (alleles) clone 2 cloness adult brain chr 15 ND DT1^P2D25 adult brain chr 15 (15q15.1-21.1) 16% runk) Chromosome 16 library sourte localisation het (alleles) clone CTG-M31 brain (cerebral chr L6 0% (1) cortex) 5 cloness adult brain chr 16 ND r-1264 foetal brain chr 16 25% Q\ Chromosome 17 library source localisation het (alleles) clone 6 clonesr adult brain chr 77 ND DT1P2E115 adult brain chr17 (17q24.1) o% (1) DT1P1A45 adult brain chr17 (17q21..1.-25.1) 0% 0\ Chromosome 18 library soutrce localisation het (alleles) clone 2 clones3 adult brain chr 18 ND DT1P1.B125 adult brain chr 18 ft8q22j1.-22.2) ND Chromosome 19 library source localisation het (alleles) clone 2.812 foetal brain chr 19 s8% (3) 2.702 foetal brain chr 19 (19q13.a3) s% Q) 7 clones3 adult brain chr 19 ND CTG3aa frontal cortex (AD) chr L9 (19q13.13) 62% (3) DT1P1A25 adult brain chr 19 (19q13.32\ 0y" (1\ Chromosome 20 library sou¡ce localisation het (alleles) clone CTGTaa frontal cortex (AD) chr 20 20% (}',) H164 foetal brain chr 20 (20q13.13) 60% (3\ Chtomosome 21, library source localisation het (alleles) clone R55nr adult brain chr 2L ND Chromosome 22 library source localisation het (alleles) clone 2 clones3 adult brain chrr22 ND L66 Table 7-L: continued X Chromosome clone soulce localisation het CTG-BZ brain (cerebral chrX ND cortex) H39 foetal brain chr X (Xp11.4) 31% (3) DT1P2A75 adult brain chr X (Xp11.22) s0% (Unk) DT1P2H1O5 adult brain chr X (Xq21.33) 0% (1\ References are given as superscripts: l.Li et al. 1993,2.Neri et al. 1996, 3.Bulle F et al. L997, 4 Margolis et al. 1997, S.Reddy et al. L997;Wherc more than one clone/chromosome exists, the number of clones is indicated in parentheses. All libraries screened are from human; Unk - unknown; AD - adult; chr - chromosome; ND - not determined. Table 7-1- represents only a proportion of the (CAG). positive CDNA clones available to screen for potential expansions. Those selected for study in both familial and sporadic cases of SCA are listed in Table 7-2 (See Results section). 7.2 Matetial and Methods 7.2.lSpotadic cases and small families Patient samples analysed were referred to the diagnostic laboratory as either having a family history of spinocerebellar ataxia or as isolated (sporadic) cases of SCA. The majority of the L28 cases were late onset (onset of symptoms after 50 years) with no indication of any previous family history. Description of clinical features varied. Some requests for testing included good clinical descriptions eg. cerebellar atrophy, dysarthria and gait ataxia; however many requests had limíted clinical information describing patients as having general ataxia often with few or no associated signs b"i^g given. Patient blood samples for analysis were collected by alatge number of different neurologists and clinical geneticists. DNA extracted from these patients was examined for expansions at known SCA loci (SCAI, SCA}, SCA3/MJD SCA6, SCA7, SCAS and DRPLA as well as for the (CAG)tt markers from within the positive cDNA clones listed in Table 7-2. Results from the loolvn SCA loci screerring are addressed in the following chapter (Chapter 8). L67 7.2.2Family PK80237 Results from family PKS0237 indicate several possible localisations for the disease causing mutation. No expansion at lcnown SCA loci were detected in this family. This family exhibits anticipation and as such is a good candidate family to be tested for expansion of (CAG)n positive cDNA clones. (See Chapter 5.2.I for detailed clinical description of family and5.2.2 for a summary of linkage results inthis family.) 7.2.3 Anonymous (CAG) poeitive cDNA clones. Selection criteria as indicated in the introduction were observed when choosing which cDNA clones to screen. Eight (CAG) positive cDNA clones tested in sporadic cases and small family material as listed in Table 7-2a. Additionally, 52 sporadic SCA cases have been examined for expansions at the TFIID locus. Çonditions used for analysis of these (CAG)' repeats is outlined in Material and Methods section 2.2.3). Primer sequences are as follows: CTG20a Forward primer s'CAC CAT GTC GCT GAA GCC CC 3' Reverse primer s'CGC CGG GCT TGC GGA CAT TG 3' CTGTa Forward primer S'TGC AGC TCC AAC AAC AGC AAC 3' Reverse primet S'CTG CTG CAT CGG TC'G CTG CTG 3' CTG4a Forward primer S'CGT CCC GCT GTC TTC TGC TTC 3' Reverse primer S'AC'G CGA ACC CAG TCG TTC TCC 3' CTG3a Forward primer S'GGG CAC TC'G GGC CAC TGA C'G 3' Reverse primer 5'CCT GGG CAC AAG CGG ACA CC 3' }I-J.6 Forward primer S'GC'G TGG CTA TGA TGA TGC 3' Reverse primer S'TGA AGA CCT GGGGTT GCT 3' H3 Forward primer S'GCA CAG CAG CAA CAA AGG 3' Reverse primer S'GTC CTA AGG GAG ACC AAT 3' L237 Forward primer S'GGT TCC CTG CAC AGA AAC CAT C 3' Reverse primer S'AGA TGC CAC CGC ATT CGG 3' CTG21a, CTG7a, CTG4a, CTG3a HL6, .H3 andL237- Margolis et al.'l'997 CAGR1. Forward primer 5' GAT AAA ACG AAG GGA AAA 3' Reverse primer s'CAG AAA TGG ATC AAA AAT 3' Margolis et aI.1996 168 Additionally, family PK80237 was screened for expansions at the cDNA loci indicated in Table 7-2aand also for expansions at a further six cDNA clones. These additional clones are listed tnT able 7 -2b. Primer sequences for these additional clones are listed below: CTG-81 Forward primer S'AGT TCC GCC AGC CCT TGA GAG 3' Reverse primer s'Grc AGC TGC CTG CCT CTT GAT 3' CTG-833 Forward primer S'CAA AAA AGC ACÇ TGG TAC TAA 3' Revetse primer S'GGGCIG GAG CCT TTT TAC TCG C 3' CTG-81 and CTG 833 - Li et aL.1,993 TFIID Forward primer s'ATG CCT TAT GGC ACT GCA CTG ACC 3' Reverse primer s'CTG CTG GGA CGT TGA cTG CTG AAC 3' Imbert et al.'J,994 i.8 (R18580) Forward primer s'GAT AAA AGG AAG GGA AAA G 3' Reverse primer s'GCA ACA CTC AGA AAT C'G 3' i.181 (R853e0) Forward primer s'GGA CAA AGC TAC ATG TCA G 3' Reverse primer s'GGT GAG TGT CCT TCT G 3' T58373 Forward primer S'AGG CAG CTC TCC TGA AAG CTT CTC C 3' Reverse primer S'AGC CTT TTT ACT CGC GGC GGT GAT C 3' i.8 and i.181 and T58373 sequences are found at URL: http:/ /www.cephb.fu/cdna Results were repeated for individuals with apparent homozygous normal alleles to ensure no expanded alleles were undetected. Further long overexposure to autoradiography fillr affirmed absence of expanded alleles. 7.2.4Linkage analysis Linkage at markers indicated in Table 7.2 were assessed in family PK80237. The mode of irrtreritance was assumed to be autosomal dominant and penetrance values from L00% to 60% wereused in calculations. Liability classes were assigned as follows : greater or equal to 80 years old - 1.00, 70-79 years old - 0.90, 60-69 years old - 0.80, 50-59 years old - 0.70, 40-49 years old - 0.60 and20-39 years old - 0.50. Additionally, two point lod scores, using affected family members only in the analysis, were calculated. L69 Table 7-2: (CAG)'., positive cDNA clones screened in sporadic and familial cases of SCA. 7.2a Clone cDNA source heterozygosity Repeat comp translated (Q) Chromosome * CTG20a frontal cortex ls% 13P(1oD Qæ 6 * CIGTa frontal cortex 20% 8 P complex QvQvQr,Qru 20 CTG4a frontal cortex* 21.% 8P no \ CTG3a frontal corbx" 627o 6P Qtt 19 m6 foetal brain 60% 12P Qrt 20 H3 foetal brain 31% 8P Qr¿ 4 CAGRl# adult brain 88% 3P no 13 1237# foetal brain 33% 15P no 1,6 7-2b Clone cDNA sourte heterozyg,g-qill-*8".pçg_t-"_o_np^___.*tsHþ-F"dlQ__-*Ç_t:ggtp-l*o^+9*"-*- crC-n-*^-*;"äb";ft&""* töi;* e p a;* 1 CTG-Bæ# cerebral cortex 70% 13P no 3 TFIID-# urknown >50% up to 42I yes 6 i.8 (R18580)3# infant brain 90% 13P unk 13 i.181(R85390)# liver, spleen 58% 10P unk 3,17,8 T58373# ovary Unk 17P unk unk Note: repeat comp - repeat composition: P - perfect (CAG) repeat, I - imperfect or interrupted repea! complex indicates that repeat does not encode for perfect polyglutamine tract (eg CAA and CAG code for Q); Qo indicates the number of conceptual translation of (CAG) or (CAA) tracts encoding an uninterrupted polyglutamine. (see *TFIID refs for further details); unk - unknown;# denotes screened in family PK80237-linkage analysis is known transcription initiation factor - see discussion for further details 7.3 Results 7.3.l Sporadic cases and small fanily analysis No (CAG)', exp¿rnsions were detected for any of the eight CDNA clones tested in spotadic cases and small families. A new allele from CTG2Oa was detected, prompting analysis in a number of blood banks (normal control individuals). This potentially expanded allele within CTG2Oa was eluted from a polyacrylanride gel and sequenced. The exact copy number of this new allele was 16, (CAG) repeat units (Material and Methods 2.3.3, 2.4.1). This new allele was also detected in these norrtal presumably unaffected controls and thus is unlikely to be pathogenic (Table 7-3). Table 7-3: Frcqaency of alleles at the CTG2Oa locus in normal control and SCA affected individual CTG2Oa alleles (CAG)n copy # reported het. (L) affected het controls het 125 12 0.97 0.9L 0.88 128 13 0.03 0.08 0.08 137 16 0.00 0.01 0.03 chromosomes 38 256 100 (1) Margolis et al.1997; het-heterozygosily 170 7.S.2Linkage analysis - PK80237 No expanded alleles were detected in affected family members of family PK80237. The (CAG)^ repeat alleles analysed in this famiþ are indicated in Table 7.2. Further linkage analysis of these markers indicated that there was no linkage to any of the genes containing these repeats (Table 7-4,7-5). Table 7-4: Linkage analysis results from Two point lod scores between (CAG) repeat markers and SCA family PKBO237. All individuals in the pedigree were included in the linkage analysis -varying penetrance between 60% and 700% compensates for presence of at risk individuals not yet exhibiting symptoms. Table 7-4: Líabilrty classes Clone 0.0 0.01 0.05 0.1 0.2 0.3 0.4 CTG-B1 -infinity -4.10 -2.48 -1.33 -0.24 0.11 0.09 CTG-833 -infinity -72.72 -6.03 -3.41 -1,.24 -0.38 -0.07 TFIID -infinity -5.68 -2.97 -1.86 -0.82 -0.31 -0.07 T51846 -infinity -12.72 -6.04 -3.42 -'1.24 -0.38 -0.08 L237 -infinity -7.98 -6.56 -3.90 -2.00 -1,.20 .0.54 CAGRl -infinity -3.45 -2.67 -1.30 -0.90 -0.30 -0,04 T85390 -infinity -8.24 4.78 -3.13 -1.38 -0.53 -0.12 R18580 -infinity -12.39 -6.28 -3.82 -1.65 -0.65 -0.16 Table 7-5: Two point lod scores calculated between (CAG)n repeat markers and family PKS0237. Calculations were based on genotypes from affected family members only. Table 7-5: AÍf.ected onlv analysis CLONE O.O 0.01 0.05 0.1 0.2 0.3 0.4 CTG-81 -4.04 -1.33 -0.60 -0.31 -0.07 -0.01 0.00 CTG.B33 -7.86 -2.5't -1.20 -0.70 -0.29 -0.12 -0.03 TFIID -3.32 -0.81 -0.19 0.02 0.12 0,09 0.03 T51846 -3.19 -0.25 0.34 0.50 0.49 0.34 0.12 L237 4.24 -'l...25 -0.62 -0.39 -0.19 -0.08 -0.02 CAGRl -8.03 -2.66 -1.31 -0.77 -0.31 -0.11 -0.02 T85390 -4.06 -1.37 -0.69 -0.42 -0,18 -0.07 -0.02 R18580 -5.75 -3.14 -1.71 -1.08 -0.49 -0.19 -0.05 T7L 7.4 Discussion Whilst the analysis of random (CAG). repeats is not the most direct route for identification of a disease causing mutation this approach is warranted given the strong association that expansions of CAG repeats have in this group of disorders, the SCAs. Furthermore, there are a finite number of such repeats in the genome. DRPLA and SCA6 are examples of diseases identified by such a protocol (Koide et al. L994, Zhuchenko et al. 1997). Most recently a (CAG)', expansion in the TATA-binding protein gene (TBP) has been identified in a sporadic case of severe ataxia with associated intellectual deterioration (Koide et al. l,eee). Eight (CAG)nrepeats from cDNA clones mapping to various chromosomes were analysed in 128 sporadic cases and small families affected with SCA (Table 7-2). No expansions were detected at any of these (CAG)'. repeats and thus, it would appear that these (CAG)' repeats are not involved in neurodegenerative disorders in the sample group tested. Specific reasons for choosing several of the clones are now discussed. One of the clones, CAGRL, was chosen because of its high heterozygosity (88%) and the f act that this (CAG)n repeat has been shown to have unusually large alleles of 45-50 (CAG) repeat copies in some normal individuals. Additionally, this repeat is known to be transmítted unstably and to show somatic mosaicism. Several families with different fisorders and exhibiting anticipation have been screened for expansion of this (CAG)n repeat but to date no association has been made between dísease phenotype and expansion (Margolis et al.1996, Margolis et al. t999). It may be that if clinical features are associated with expansions of this repeaf the association will be with larger copy numbers than those observed to date (Margolis et al.L999). CAGR1 is highly expressed in the brain, particularly the cerebellum, when compared to other tissues. The CAG repeat, unlike the majority of the expansions causing SCAs, is within the S'untranslated region of the gene (Margolis et al. 1.996). T?re newest SCA locus to be identifie{ SCA8, is due to an expansion of a CTG repeat in the 3'untranslated region of the associated gene (Koob eL aL.1,999). Therefore, it remains plausible that expansions of the CAGRL (CAG)n repeat may be pathogenic. Flowever, no expansiotìs were detected in the sample group tested in this study. L72 A new allele at the CTG2Oa locus was detected in 3 affected individuals screened. At 16 (CAG) repeat copies this allele is only three (CAG) copies greater than that previously described. Nevertheless, it was of considerable interest since an allele of this size had not been detected previously in normal individuals (Margolis et al. L997). On examination of a further 100 u¡related, normal blood bank control chromosomes, this allele was detected in a similar frequency to that detected in the affected sample group (Table 7.3). This large allele was therefore excluded as a potential pathogenic allele. Linkage analysis in farnily PK80237 indicated several possible genetic locations (see Chapter 5 for details). These included regions on chromosomes 4, 7, 8 and 1.4. From the literature there are no (CAG)', positive cDNA clones which reside specifically at the potential locations for this disease gene. Several (CAG)' containing cDNA clones have been assigned to these chromosomes, including those listed under the appropriate chromosome indicated in Table 7-'J.,b:uI none lie within the tentative genetic intervals assigned for the SCA gene in family, PK80237. Further, data from the repeat expansion assays (Chapter 6) indicated that the disease causing mutation in PK80237 nay not necessarily be a (CAG)t repeat expansion. The (CAG)'. repeat located within the TATA binding protein gene (TBP), also lcrown as TFIID. (Hoffmann et aI. '1,990) was analysed for a variety of reasons. This gene is an important general transcription factor which contains a long imperfect polymorphic (CAG) repeat. The (CAG) repeat resides witÌìin the coding region of the TBP gene and is translated as a polyglutamine. There are several forms of the repeat sequence, all of which have CAA repeat intermptions eg CAA CAG CAA (CAG)7-TL (Polymeropoulos et aI.199'1,, Gostout et al. 1993). This repeat motif is not urùike that found in normal alleles of the SCA2 locus (Cancel et aL.1997). Similarlp (CAT) repeat interruptions have been identified in normal (unexpanded) alleles at the SCA1 locus (Ch*g et al.'1.993). Thus, it is conceivable that conversion of this repeat to a perfect composition and subsequent expansion may be pathogenic. In addition, this repeat is highly polymorphic with alleles ranging typically fuom25-42 glutamine residues (Gostout et al. 1993). This gene has been genetically placed on the q arm of chromosome 6 at 6q27, telomeric to the microsatellite marker D6S1'32 (Imbert et aL,1994). 173 The sporadic cases in this study have been examined at this locus with no expansions identified. Therefore in this subset of patients, there is no suggestion that an expansion of the (CAG) repeat in this gene is involved in disease progression. Subsequentþ a de nouo expansion of the polyglutamine repeat within the TBP gene has been identified (expanded allele of 63 polyglutamine repeats) (Koide et al. 1999). The affected ind:ividual identified to have an expansion within TFIID has cerebellar ataxia and associated mental retardation, with onset at age six. This is the third disotder to be identified by screening CAG positive cDNA clones. There are many more cDNA clones which contain (CAG)n tracts which could be screened for expansions in this group of SCA patients. These untested clones are good candidates for evaluation in these and other spinocerebellar ataxia patients in an attempt to find additional SCA genes (Riggrns et aL.1.992, Li et al. 1993, Margolis et al. L996, Reddy et al. '1.997, Albanese et al. 1998). Other (CAc)nrepeat containing cDNA clones have been tested in SCA individuals, but as yet no expansions have been identified (Pujana et al. 1.997). Except for the clones CTG-833 and the (CAG) repeat within TFIID, the clones tested by this group did not overlap with those chosen for the present study. Of the 128 samples tested (excluding family PK80237\, the majority are sporadic cases or cases where additional family members were unavailable for testing. Thus, linkage to uncharacterised but localised SCA genes could not be tested. Therefore it remains possible that the SCA symptoms in these patients may be due to mutations in the as yet uncharacterised genes for SCA4, SCAS, SCAL0 and SCA1L or at other as yet unidentified SCAloci(Ranum etaL.1994, Flanigan etaL.1.996, Worth etal.1"999,ZuetaI.1"999). In summary, results from this study were unable to identify a novel (CAG)n repeat expansion but those tested (Table 7-2\ werc able to be excluded as the mutation causing SCA in the subset of patients screened. 174 Chapter I : SPINOCEREBELLAR ATAXIA FREQUENCY ANALYSIS Page SUMMARY 779 8.1 Introductlon 180 8.2 Subjects L82 8.3 Material and Methode 182 8.3.1 PCR analysio - SCA loci/ FRDA locus 782 8.4 Sequencing 184 8.5 Reeults 184 8.4.1 Summary and comparieon Table 186 8.6 Discussion 188 t75 CHAPTER 8 SPINOCEREBELLAR ATAXIA FREQUENCY ANATYSIS SUMMARY A series o1 'J,28 Australian patients with clinical indications for SCA were screened for expansions at larown SCA loci; SCA1., SCA2, SCA3/MJD, SCA6, SCA7, SCAS and DRPLA. These same individuals were also examined for expansions at the Friedreich ataxia (FRDA) locus. Eighteen of the affected patients tested were ascertained as having family history of spinocerebellar ataxia. The relative frequency of mutations detected at the loci tested was calculated. We detected expansions in 22% of patients fiagnosed with autosomal dominant spinocerebellar ataxia and in 10% of patients with insufficient evidence of, or no, family history of SCA. Overall the most coÍunon expansions were detected at the SCA1 locus (5.5%) and at the SCA3/MJD locus (3%). In the sporadic cases mutations were detected in one case each at the FRDA and SCAT loci. No (CAG)" expansion mutations were detected at the SCA? SCA6, SCAS or DRPLA loci. L76 8.1 Introduction The disorders commonly referred to as spinocerebellar ataxias (SCAs) are both clinically and genetically heterogeneous. The classificatíon of these disorders has been simplified over the past six years due to the identification of the causative gene and associated mutations at7 difÍerent loci (Table 8-1). Mutations for the following SCA loci have been identified: spinocerebellar ataxia 1 (SCAI) IMIM'J,64400], SCA2 IMIM 183090], Machado Joseph disease (MID/SCA3 IMIM 109150], SCA6 [MIM183086], SCAT [MIM164500] and dentatorubral pallidoluysian atrophy (DRPLA) [MIM125370]. The coÍrmon mutation identified in all of these disorders is an expansion in affected individuals of a normally polymorphic (CAG). repeat. As a general guide the normal range can be considered to be less than 40 (CAG)n repeat units and the affected range greater than 40 (CAG)n repeat units (Table 8-1). This (CAG)', repeat is transcribed as a polyglutamine tract in all cases (Orr et al. 1"993, Kawaguchi et al.'1,994, Koide et al.'J.994, Nagafuchi et aI.1994,Imbert et al. 1.996, Pulst et '1,996, al. L996, Lindbald et aL Sanpei et al. 1996, Zruchenko et al. 1997 , David et al. 1997) . Expansions at the SCA6 locus are notably smaller, in the range 21,-27 (CAG) repeat units and it is possible that this disorder is due to a different mechanism than that for the other SCAs. This is further supported by the identification of a point mutation in the gene responsible for SCA6, the calcium channel gene, CÁCNA1A causing a sirrilar phenotype (Yue et aL L998). The gene for SCAS is the most recent to be characterised. The underlying mutation identiÉied in affected individuals at this lor:us (SCA8) has been demonstrated to be a (CTG)n repeat expanded within the presumed 3' untranslated region of the gene. \{hile it would appear that the mechanism for the disease ptogression in individuals with this form of SCA is different to those previously described SCAs, identification of an expanded allele at this locus may provide confirmation of diagnosis (Koob et al. 1999). Recent data however, suggests that this expanded allele may be present in low frequency in unaffected individuals challenging the significance of this expanded allele (Stevanin et al. 2000, Worth et al. 2000). L77 Several other genetic localisations are also loown to exist for the SCAs. These include SCA4 (chromosome L6) (Flanigan et al. 1996), SCAS (chromosome 11) (Ranum et al. L994), SCA10 (chromosor:ireàZ)(Z:uetaI.1,999) andSCAll (chromosome15) (Worthet al. 1999). As yet no associated genes or mutations for these localisations have been identified and conseçluently ro direct molecular investigation is available for these four loci. Whlst it is possible that the mechanism responsible for these disorders will be an expansion of a (CAG) repeat this remains to be validated. Expansions of the (CAG)n repeat at the SCAL2locus (chromosome 5) have been identified in a single pedigree (Holmes et aI.'J.999). The repeat expanded in this family is located in the 5' region of PPP2R2B. Since this repeat expansion has not been identified in any other individuals with SCA, the SCA12 locus not investigated in the current study. Table 8-1: Summary of affected (expanded) and normal ranges for SCA loci. Locus Chromosome Normal Affected range ïange SCAl 6 19-38 40-81 SCA2 12 22-28 37-50 scA3/MlD L4 L3-36 68-79 SCA6 19 4-20 21-27 SCAT 3 7-17 38-130 SCAS 13 't6-37 107-127 DRPLA 12 8-25 54-68 The mutation responsible for 98% of all Friedreich ataxia (FRDA) patients is ¿m homozygous expansion of a (GAA)n repeat. Unlike the SCAs this repeat is not within the coding region of the gene but rather wittÌin the first intron of the associated gene (Campuzano et al. 1,996). It has been shown that this GAA repeat expansion is homozygously expanded in a small proportion of SCA cases and consequently, inclusion of testing at this locus in a general screen for SCA expansion mutations may improve molecular diagnosis (Geschwind et al' 'J'997a, Moseley et aI. 1998). A number of studies have revealed geographic correlations for specific SCA (CAG)tr repeat expansions. Results clearly indicate that there are strong founder effects and some populations may almost exclusively express a particular SCA expansion (Mizushima et al. !998, Lopes-Cendes et aL.1997, Watanabe et al. 1998, Riess et aL.1997. Matsuyama et al. 1.ee7). T7B Further support for these founder effects is indicated in studies by Takano et al. (1998). They demonstrated that in populations where a particular form of SCA is more prevalent there are also a greater number of alleles in the upper end of the normal range when compared to other populations. It is assumed that the higher repeat copy number normal alleles are predisposed to becoming expanded alleles at the corresponding disease loci. Given the obvious genetic and clinical heterogeneity within the SCAs, the molecular evaluation at lanown SCA loci c¿m prove to be valuable for confirmation of diagnosis for patients. In this present study we determined the frequency of SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, DRPLA and FRDA in 128 Australian patients (both sporadic and familial cases) in an attempt to detennine which of the SCA loci have most clinical relevance to Australian patients. The frequencies calculated were compared to previously published frequencies (Table 8-2). 8.2 Subjects Patient samples anaþsed are the same as those described in chapter 7 (See 7.2: Íor clinical details) Only the sporadic cases and cases from small families were subjected to analysis in this chapter. Results and discussion at known SCA loci for family PK80237 and PK80248 were addressed in Chapter 5. The blood samples used in the analysis were obtained from patients after inforrned consent. They were collected by several neurologists and clinical geneticists' 8.3 Material and Methods 8.3.1 PCR analysis - SCA loci and FRDA locus Primer sequences are detailed below: SCA1: Repl F S'CAG TCT GAG CCA GAC GCC C'GG ACA C 3' ReP2 R S,ATG AGC CCC GGA GCC CTG CTG AGG T 3, (Orr et al.1,993) Expected product size of normal alleles approximately 150 base pairs. SCA2: (DAN1-UH13 F s',CGT GCG AGC CGG TGT ATG GG 3', DAN1.-UH15 R 5' GGC GAC GCT AGA AGG CGG CT 3' (Imbert et al.1996) Expected product size of normal alleles approximately 200 base pairs. 179 scA3 / MJD: MJD25 F s'CCA GTG ACT TTG ATT CG 3' MJD52 R 5' TGG CCT TTC ACA TGG ATG TGA A 3' (Kawaguchi et al. 1994) Expected product size ol normal alleles approximately 200 base pairs SCAT: 4U1.024F 5' TGT TAC ATT GTA GGA GCG GAA 3' 4U71.6 R 5' CAC GAC TGT CCC AGC TAT CAC TT 3' (David et aL.1,997) Expected product size of normal alleles approximately 300 base pairs. DRPLA: CTG-837 F s'CAC CAG TCT CAA CAC ATC 3' CTG-837 R s'TCC CCA GTG GGT GC'G C'GA ATG CTC 3' (Koide etaI.!994). Expected product size of normal alleles approximately 150 base pairs Minor modifications from previously published primer sequences were utilised for analysis at the SCA6 locus. S-5-R1 was used as published but a new forward primer (designated S- 5-F2) was designed from published sequence Forward primer (S-5-R1) s'TTC CGT AAG TGG AAG CCC AGC CCC C 3' Reverse primer (S-5-F2) 5'TTC CGT AAG TGG AAG CCC AGC CCC C 3' (Zhuchenko et al. 1.997). The combination of S-5-F1 and S-5-F2 gave less non specific bands than S-5 F1/R1 under our experimental conditions. Expected product size of normal alleles approximately 200 base pairs. Alleles at the SCAS locus were amplified using primers SCAS-F3 and SCAS-R4 SCAS F3 5'TTT GAG AAA GGC TTG TGA GGA CTG GAA TG 3' SCAS R4 5' GGT CCT TCA TGT TAG AAA ACC TGG CT 3' (Koob et al. 1999) Expected product size of normal alleles approximately2T0 base pairs. PCR conditions used for all of the above sets of primers are described in lvlaterial and Methods 2.2.3 All products were resolved on a 5% denaturing polyacrylarnide gel and compared to lcrown controls. Sizes of loown controls were ascertained by sequence analysis (Material and Methods 2.4.1). All patient samples whidn scored homozygous in the normal range at any SCA locus were analysed in duplicate and long exposures of gels were obtained to ensure that any potential expanded alleles would not miss detection. Also, positive controls were amplified in each run and on each occasion expanded alleles were easily detected. 180 FRDA The Friedreic-h ataxia alleles were amplified using a long range PCR kit (Boehringer Mannheim) (Material and Metho ds 2.2.2). FRDA primers GAA F 5' C'æ ATT C'GT TGC CAG TGC TTA AAA GTT AG 3' GAA R 5' GAT CTA AGG ACC ATC ATG GCC ACA CTT GCC 3' (Campuzano et al. t996). Expected product size oL normal alleles approximately 470-520 base pairs. Resultant products were run out on 2.5% agarose gels. Again positive controls were included in each run to ensure expanded alleles amplified adequately. 8.4 Sequencing Any expanded alleles detected at the SCA loci were eluted from the poþacrylamide gel (Material and Methods 2.3.3) and sequenced to establish (CAG)n repeat copy number. (Material and Metho ds 2.4.I). This same sequencing protocol was used to detenrrine normal allele sizes of control samples. 8.5 Results Repeat expansions at the SCA1, SCA} SCA3/MID, SCA6, SCA7, SCA8, DRPLA and FRDA loci were analysed in 128 patients comprising familial and sporadic cases of clinically diagnosed SCA. Eighteen of these individuals were documented to have a family history of SCA-like symptoms. Of these familial cases, 3 had expansions at the SCAL locus (1,6.7%) and L had an expansion at the MJD locus (5.5yo). For the sporadic cases/ 4 of the remaining 110 (3.6%\ were found to have expansions at the SCA1 locus. Another 3 cases (2.7%) had expansions detected at the SCA3/MJD locus. One individual had an expansion at the SCAT locus and another had an homozygous expansion at the FRDA locus. Independentþ expansions at SCAT and FRDA account for 0.8% of the cases (Figure 8-1). The detection rate for all cases was'1,0% (Table 8-2). One individual with sporadic ataxia was heterozygolrsfor expansion at the FRDA locus. Further analysis may ascertain if there is a point mutation in the other allele of the FRDA gene. There were no apparent expansions detected in *y patient sample at any of the SCAZ, SCA6, SCAS or DRPLA loci (Table 8- 2). 181 \ CAG copy number = 47 ./ \ CAG copy number CAG copy ranges from 45-52 number = 75 ti *l t SCAl SCAT scA3 Figure 8-2: Expansions at SCA1, SCA3 and SCAT loci. Expanded alleles are indicated with arrow heads. Expanded alleles were sequenced to determine (CAG)n repeat copy number. r82 (cAc) copy number 45 38 36 34 I i 30 34 34 30 34 45 34 36 38 Figure 8-3: SCA affected individuals genotyped at the SCAI locus. Alleles near the upper limit of the normal range were sequenced to determine sequence composition. Alleles 36 and 38 (CAG)n repeat copies depicted here have nomal (intenupted) repeat sequence (Table 8-2). 183 ethnic origin (ner ) SCAI SCA2 SCA3 SCA6 SCAT DRPLA SCAS FRDA TOTAL Familial German (1+2) NS 14% NS 13% NS NS NS NS NA Japanese (3) 0% 5.9% 33.7% 5.9% NS 19.8% NS NS 65% Brazilian (4) 6hF e/"s 9% F ev.s 44hF so/"s NS NS 0/o NS NS 5V/. Portuguese (5) o% 4% 70% 0/o NS 0% NS NS 74/" NS Canada (various) (6) 10%F se6 s NS 41"/"F lz"t"s Oo/o NS 1% NS 52% France (various) (7) NS 15/"F zy"s NS NS NS NS NS NS NA NS US (various) (8) 3% NS 21o/"F ty"s NS NS NS NS NA NS US (various) (9) NS NS NS 12% NS NS NS NA s.zt"s US (various) (10) 5.6% 15.2% 20.8% 15.?/o 4.5% NS NS 11"/"R 72% NS UK (various) (11) 35% 40% 15o/" NS NS NS NS 90/" UK (various) (12) 5l"F ty"s 5t"F tws O/"F ry"s 5!"F sl"s NS O/"F ly.s NS 3%S 15% 157dS) Aust (various) 17o/oF s.æ/"s 0o/o 6"/oF zz%s o"h r%s OY" Oo/o 1%S 2P/o 87dS) Table 2: Comparison of results from literature of ditferent ethnic groups. Results from this study (in bold) compare well with those from the UK study (REF 12) (F = familial cases S = sporadic cases R = recessive cases of SCA) REFs: 1 Reiss 1997 et al. 1997, 2 Schols et al. 1998, 3 Watanabe et al. 1998, 4 Lopes-Cendes et a1.1997, 5 Silveiraetal. 1998,6Silveiraetal. 1996,7Canceletal. 1997,8 Ranumetal. 1995,9Geschwindetal. 1997, 10 Moseley et al. 1998,11 Giunti et al. 1998, 12 Leggo et al. 1997, H Àoo Several alleles detected at the SCA1 locus in affected individuals were in the upper end of the normal range at 36-38 (CAG)n repeats. These alleles were sequenced to determine repeat composition and repeat size (Figure 8-2 (previous page), Table 8-3). Table 8-3: Repeat sequences for alleles of 36 and 38 (CAG) repeat units at the SCA1 locus. Sequences are interrupted with CAA motifs indicating that these alleles are likely to be non pathogenic. (CAG) copv number Repeat confisuration 36 (CAG)r zCATCAGCAT (CAG)r e 36 (cAG)l ?CATCAGCAT(CAG)r o 38 aCA CAG 6 8.6 Discussion This study ex¿rmines the detection rate of mutations at the SCAL, SCA2, SCA3/MJD, SCA6, SCA7, SCA8, DRPLA and FRDA loci in Australian patients with symptoms of spinocerebellar ataxia. The study group was directed to the laboratory for analysis from various sources and thus clinical assessment was not uniform. This ethnically diverse patient group can be classified into two separate groups; L) having larown family history of spinocerebellar ataxia and 2) no lmown famíly history of spinocerebellar ataxia andf or insufficient clinical data to assess family history. Interestingly the individual identified to have an expansion 47 (CAG) copies at the SCAT locus has no apparent family history of SCA. This individual developed symptoms at the early age of.24 years. Blood samples from other family members were unobtainable and thus analysis of allele sizes in the parents of this patient was not possible. Although it is lcrown that both the parents of the affected individual do not have any symptoms of SCAT, it may be that one of them is presymptomatic and may develop symptoms later, or that paternity needs to be questioned. It is also conceivable that one or other of the parents of this individual may carС an apparentþ nonpathogenic, mild expansion at the SCAT loci. The existence of an apparent premutation or ( intermediate) r¿mge allele has been documented in several cases. Alleles of 28, 35 and 36 (CAG) repeat units have been detected in asymptomatic individuals. It is of particular interest to note that paternal transmissions may lead to expression of symptoms up to 50 years earlier in the offspring, with most juvenile cases resulting from patemal transmissions (Stevanin et aL. 1998, Benton et al. 1998). Thus, the identification of this 185 possible de nouo mutation has considetable clinical significance for this family. Several alleles detected at the SCA1 locus were at the limits of the normal (CAG) repeat copy range. Alleles of approximately 36 and 38 repeat units were detected in several individuals. At both the SCA1 and SCA2 loci it has been shown that normal allele sequences are interrupted with CAT and CAA respectively (Chung et aL.L993, Cancel et al. 1997). The difference between the normal and affected size ranges for SCAI. is close with the normal range from 19-38 (CAG) copies and the affected range starting at 40 (CAG) copies. Therefore, particularly for an allele size of approximately 38 (CAG) repeat copies, sequence anaþsis allows accurate sizing and determination of repeat strucfure. Sequence analysis determined the exact (CAG) repeat copy number and the sequence composítion of alleles in the upper end of the normal rÉmge at the SCA1 locus for several individuals (Table 8-3). Results indicate that all of the larger alleles at the SCA1 locus had intermpted repeats and were within the normal stze range implying that these are normal alleles and not the disease causing mutation in these individuals. Frequency analysis for the familial cases of SCA indicates that the most prevalent (CAG)tt expansion detected was at the SCA1 (16.7%) and SCA3/MID loci (5.5%) (Table 8-2). This varies from other reports of Caucasian populations where the majority of expansions detected were at the SCA3 locus (Silveíra et aL.1996, Lopes-Cendes et al.'1.997, Silveira et aL. L998, Wanatabe et al. 1998). However, the results are similar to those findings in the United Kingdom (Leggo et al''J,997). Their series of mostly English/European patients also represented sporadic and familial cases. Additionally, no expansions at the SCA2 or SCA6 loci were detected. This contrasts directly with results from other laboratories and is most likely due to different ethnic compositions being tested (Table 8-2). Further, it would appear that the overall detection rate in our patient group is less than othergroups (TableS-2). Severalpossiblereasons for this are the large number of sporadic cases in our series, the lack of control over clinical indications for testing and the great ethnic diversity that exists in Australia. Moreover, many of the patients tested had limited clinical information supplied at the time of referral and thus, diagnostic testing at the SCA loci may not have been clearly indicated. 186 Mutations remain undetected in the remaining 78% of individuals with hereditary SCA. There remains the possibility that the SCA symptoms in some of these patients may be due to mutations in the as yet uncharacterised genes for SCA4, SCAS SCA10 and SCA11. Additional family members were not available and therefore linkage analysis could not assess the relevance of these loci. Alternatively, the symptoms in these patients may be due to non genetic causes such as i.j*y (eg stroke) or other environmental influences. We are able to show from this study that the most common mutations detected in Australian patients with familial SCA, are exparu¡ions at the SCA1 and SCA3/MID 1oci. Together mutations in these (CAG)' repeats accounted for 22.2o/o of cases in the sample tested. There remains, howeveç a large proportion of cases which are unaccounted for. The proportion is even high". in sporadic cases where 92% of cases tested are of unlcrown cause. Presently then, clinicians can expect a 1O% detection rate for a-ll cases referred for testing, with this figure rising to 22o/o if a strong family history exists. Results of this study would suggest that screening for expansions at the SCAI. and SCA3/MJD is well justified in families with inherited forms of SCA. Flowever, given the very different relative frequencies of detection of SCAs in other populations and the ethnic diversity that exísts in Australia a screen for all of the SCA mutations would provide a more thorough service. For a large number of the SCA cases tested in this study the urolecular basis remains unidentified emphasising the genetic and clinical heterogeneity underlying this group of disorders. The identification of the genes responsible for the as yet uncharacterised SCA loci may well enable molecular confirmation of diagnosis of some of the currently unresolved cases. Results from analysis of family (PK80237) indicates that this family does not map to any of the leown SCA localisations (see Chapter 5: Late onset ataxias for results). Thus, this linkage analysis study and those published for SCA4 (Flanigan et aL 1996), SCAS (Ranum et al.'1.994), SCA10 (Zu et al. L999) and SCAL1 (Worth et al. 1999) confirm the existence of at least 5 more genes responsible for spinocerebellar ataxia. The characterisation of new genes for this extremely heterogeneous group of disorders will aid diagnosis, highlighting the need for their discovery. As new mutations are discovered it will be important to rescreen previously undiagnosed cases of spinocerebellar ataxia in an attempt to identify the molecular basis of their disease. L87 Chapter 9: CONCLUSIONS Inherited ataxias are a clinically and genetically heterogeneous group of disorde¡s. Those chosen for study were the congenital, early and late onset ataxias. Prior to the cortmencement of this study several loci had been identified for syndromal forms of congenital ataxia, and one locus identified for an X-linked form; however, no genes had been identified (Nikali et al. '1.995, Illarioshkin et al. 1996). The present study, localised a congenital ataxia to chromosome 3p. This represents the first genetic locus for an autosomal dominant pure nonprogressive congenital ataxia (NPCA). Several candidate genes reside at this region including inositol L,4,5-triphosphate receptor type 1 (ITPRI), neural cell adhesion molecu-le (CALL) and plasmacytoma-associated neuronal glycoprotein (PANG). Each of these genes is a plausible candidate given their neural involvement, however, perhaps the most likely of the three is LTPRI.. These receptors are present in both neural and nonneural cells with the ner:ral form most abundant in Purkinjie cells (Yamada et al. 1,994). Mice whidr arc ltprl deficient often die in utero; however, many of the live bom have severe ataxia and tonic-clonic seizures, dyirg before they are weaned. ITPR1 in these mice is assumed to be essential for brain function (Matsumoto et al. 1996). Given the phenotype of these mice and the involvement of the P/Q-type calcium channel c-1 subunit, CACNALA, in episodic ataxia type 2 and SCA6 this gene, (LTPRL), is a good candidate. The genes characterised for the early onset ataxias include a potassium charurel (KCNÁ-I - episodic ataxia type 1., EA-1) (Browne et al. 1994) *d a calcium channel (CACNAIA - episodic ataxia type 2, EA-z) (Ophoff et al.'1.996). Mutations in the CACNALA gene have been identified not only in EA-z but also in familial hemiplegic migraine (FHM) and SCA6 (Ophoff et al. 1996, Zruchenko et al. L997). Prior to the ptesent study the mutations characterised for EA-2 were all nonserìse mutations leading to presumed truncated proteþ while the mutations described for FHM were all missense mutations. Two recurrent mutations for FHM have been described while those for EA-2 are all private mutations (Ophoff et aL.1,996). The family presented here has EA-2 and was screened for mutations in the CACNA1A gene. This analysis revealed a novel missense mutation in exon 32 oL the calcium channel gene which leads to a G52604 transitiorç resulting in Arg1666His substitution. This is the first reported missense mutation for EA-2. 188 While it is difficult to predict the significance of the Argl666His substitution identified in this study without functional analysis, it is conceivable that the phenotypic variation seen in the EA-2 family is sirrilar to that seen in families with hemiplegic mþaine and associated cerebellar ataxia (Ducros et aL.1999). Additional studies by another laboratory (Denier et aL.1999) have also identified missense mutations in C,ACNAIA resulting in episodic ataxia 2 with variable phenotype observed in mutation carriers. Variability of phenotype has also been observed in a family segregating for a mutation witÌìin exon 6 of the CACNALA gene. In this family described by Yue et al. (L997) there are affected individuals with progressive ataxia without episodic features and several affected individuals with both progressive ataxia in combination with episodic ataxia (not responsive to acetazolamide). Additionally it was noted that several individuals with progressive ataxia also experienced episodic attacks of migraine without aura. Therefore withh the one family considerable variation in phenotype is observed. There was no expansion at the (CAG) repeat within exon 47 of the CACNALA gene observed in this family. Thus, similar to the mutation identified in the present study a single missense mutation has variable phenotypic consequences. It is not clear whether the variation in symptoms both within and between families is due to modifying genes or environmental factors involved in disease progression. The characterisation and functional analysis of this newly characterised mutation and additional mutations in the CACNALA gene may enable us to obtain a bettet understanding of phenotype-genotype conelation and add further information enablíng greater comprehensionof theactionof the CACNAI.A geneinbothfamilialhemiplegicmigraine and episodic ataxia type2. \Â/hile results for the congenital and early onset ataxias were able to identify a genetic location and novel mutation respectively, the tesearch conducted on the late onset ataxias was less successful. Affected members in a large late onset SCA family (PK80237) were shownnot to have (CAG)n repeat expansions at any of the characterised SCA loci (SCA1, SCA2, SCA3/MJD ,SCA6, SCA7, SCAS and DRPLA), and additionally this famiþ did not map to any lmown localisation for SCA. Despite linkage analysis, it remains unmapped. These results and those of other groups (Ranum et aL.'J,994, Flanígan et al. 1996, Za et al. 189 1999, Worth et aI. 1999, Koide et al.'J.999) confirm the existence of at least 5 more genes responsible for spinocerebellar ataxia bti"g-g the total number of loci for SCA to 76. Alternate methods of identifying the disease causing mutation were utilised in family PK80237. These methods relied on the fact that at the outset of the study all the SCA mutations described were due to expansions of a (CAG)' repeat subsequentþ ttanslated to polyglutamine. The two methods used were: 1) screening of (CAG)tr markers identified from cDNA clones, and 2) identification of proteins containing polyglutamine expansions. Both techniques failed to identify a novel (CAG)n expansion in family PK 80237. Additionally a group o1128 sporadic and familial SCA individuals were also tested for expansions at eight (CAG). repeat positive cDNA clones, and agairç no new SCA genes were detected. Significantþ the last SCA locus to be identified SCAS (Koob et al.'J.999) ís not due to a (CAG)n expansion within the coding region of the gene, but rather a (CTG)t expansion within the 3' untranslated region. Furthermore, a point mutation in the CACNAI.A gene has been shown to cause progressive ataxia (Yue et al. 1998). It is possible that mutations such as these or altemate mutations (eg. expansions of other repeat motif, both within the translated or untranslated regions) *uy cause SCA. Thus, mechanisms other than a (CAG)n repeat would go undetected by the methods used in this study. Additionally, T28 sporadic and familial cases of SCA were screened for mutations at the SCAL, SCA2, SCA3/MJD, SCA6, SCAT SCAS and DRPLA loci. The mutation detection rate of 22% lor familial cases and 8% for sporadic cases demonstrates the value of molecular diagnosis. The relative frequency of SCA expansions has been shown to differ between populations, with some populations having near exclusive expression of a particular SCA expansion (Riess et al. \997, Matsuyama et aL 1.997, Lopes-Cendes et al. 1997, Mizushima et al. 'J.998, Watanabe et al. 1998). Our results are similar to those detected in the UK population, and given the heritage of the Australian populatiory this was not unexpected. 190 From results of the linkage analysis and mutation screening it is evident that the SCAs are genetically heterogeneous with still many cases molecularly unclassified. Thus, the characterisation of additional genes for this group of disorders will be beneficial for both the prognosis of affected individuals and for presymptomatic testing in unaffected individuals. Certainly many advances have occurred in the molecular r¡nderstanding of polyglutamine disorders; however, much of the functional understanding is less clear. Early experiments indicated that the pathogenic mechanism of these disorders was aggregation of polyglutamine in the nucleus of neuronal cells (Davies et al. 1997, Paulson et al. 1997). These findings were confirmed in many of the polyglutamine diseases although most recently additional experiments indicate that the inclusions are not necessarily the cause of pathogenesis. Aggregates have been detected in both neural and non neuronal cells (Sathasivam et al. 1,999), experiments in transgenic mice indicate that pathogenesis (or initiation of disease progression) is not dependant on aggregation, and further, it has been suggested that aggregation may impart a protective mechanism (Saudou et al. 1998, Klement et al. 1998, Reddy et al. 1998). Although the exact biological role of these aggregates in polyglutamine disorders is not yet understood it is important to note that the aggregates result from glutamine expansion induced misfolding. Thus, it has been suggested that the identification of the factors that are able to modify the aggregation process may help in unravelling this complex pathogenic process (Zrogbi and Orr 1,999). Perhaps the most important finding has been the apparent reversal of phenotype observed in transgenic mice for Huntington disease, leading to speculation that HD and other ner:rodegenerative disorders may be treatable (Yamamoto et al. 2000). Although at the outset of this study it appeared that the majority of SCAs were due to expansions of a (CAG)', repeat, subsequent studies have broken this convention;. SCAS is possibly due to an expansion of a (CTG)'., repeat in the 3' untranslated region (Koob et al. '1.999), SCA6 is due to mild expansions in CACNALA (Zhuchenko et aL 1997) and addítionally a point mutation in this same gene has been shown to cause progressive ataxia similar to SCA6 (Yue et aL.1997). Results from the expansion detection assays indicate that the mutation segregating in family PK80237 may not be an (CAG)n repeat expansion. Alternatively, expansions of other repeat sequences (giving rise to polyglutamine) may result in an SCA phenotype, or similar to the expansion detected irl SCA8, the expansion may be in the untranslated region. Identification of the mutation segregating in thís family 191 and mutations responsible for SCA , SCA5, SCA10 and SCA1L witl províde additional insights into the range of genes and disease mechanisms involved. It remains to be determined if these genes willbreak from tradition or remain to be polyglutamine disorders. r92 REFERENCES Adelman JP, Bond CT, Pessia M, Maylie J. Episodic ataxia results from voltage- dependent potassium channels with altered functions. Neu¡on 1995 Dec;I5(6):1449-54 Albanese V, Holbert S, Saada C, Meier-Ewert S, Lebre AS, Moriniere S, Bougueleret L, Le GalI I, Weissenbach J, Lennon G, Lehrach H, Cohen D, Carm HlvI, Neri C. CAG/CTG and CGG/GCC repeats in human brain reference cDNAs: outcome in searctring for new dynamic mutations. Genomics 1998 Feb 1';47(3):414-8 Allotey R, Twells R, Cemal C, Norte BS, Weissenbach J, Pook h4 Williamson R, Chamberlain S. The spinocerebellar ataxia 2 locus is located within a 3-cM interual on chromosomeL2q2S-24.1. Am J Hum Genet 1'995 Jul;57(1):185-9 al Shawan SA, Bruyn GW, aI Deeb SM. Lissencephaly with pontocerebellar hypoplasia. I Child Neurol 199 6 lN4ay ;IL(Q :2a1,-a Ambrose CM, Duyao MP, Barnes G, Bates GP, Lin CS, Srinidhi J, Baxendale S, Hummerich lt Lehrach F{, Altherr IVI, et al. Structure and expression of the Huntington's disease gene: evidence against simple inactivation due to an expanded CAG repeat. Somat Cell Mol Genet 1994 J an;20 (1):27 -38 Bain PG, O'Brien MD, Keevil SF, Porter DA. Familial periodic cerebell¡ar ataxia: a problem of cerebelliar intracellular pH homeostasis. Ann Neurol1,992Feb;31,(2):147-54 Ballabio A. The rise and fall of positional cloning? Nature Genet 1993 3:277-279. Bandmarur O Davís MB, Marsden CD and Wood NW. The human homologue of the weaver mouse gene in familial and sporadic Parkinson's disease (Letter) Ner:roscience '1.996 72:877-879 Basler E, Grompe IvI, Parenti G, Yates J, Ballabio A. Identification of point mutations irr the steroid sulfatase gene of three patients with X-linked ichthyosis. Am J Hum Genet 1992}l4av50(3):483-91 Battistini S, Stenirri S, Piatti IvI, Gelfi C, Righetti PG, Rocchi & Giannini Ð Battistini N, Guazzi GÇ Ferrari I\lI, Carrera P. A new CACNAI.A gerre mutation in acetazolamide- responsive familial hemiplegic migraine and ataxia. Neurology.1.999 Jul 13;53(1):38-43. Becher MW, RubinszteinDC, Leggo J, Wagster MV, Stine OC, Ranen NG, Franz ML, Abbott MH, Sherr M, MacMillan JC, Barron L, Porteous \zt, Harper PS, Ross CA. Dentatorubral and pallidoluysian atrophy (DRPLA). Clinical and neuropathological findings in genetically confirmed North American and European pedigrees. Mov Disord 1,997 Jlul;1.2(a) : 5 1 9-3 0 L93 Benomar A, Krols L, Stevanin G, Cancel G, LeGuem E, David G, Ouhabí FI, Martin JJ, Durr A, Zaim A, et al. The gene for autosomal dominant cerebellar ataxia with pigmentary macular dystrophy maps to chromosome 3p12-p21,.1. Nat Genet 1995 May;10(1):84-8 Benton CS, de Silva & Rutledge SL, Botrlega S, Ashizawa T, Zoghbi FIY. Molecular and clinical studies in SCA-7 define a broad clinical spectrum and the infantile phenotype. Neurology 1 998 Oct;51 (4) : L081-6 Biïd AP. CpG-rich islands and the function of DNA methylation. Nature 1986 May 1,5 -21 ;321, (6 0 67 ) :209 -13 Bonten E, van der Spoel A, Fornerod M, Grosveld G and d'Azzo A. Characterisation of human neuraminidase defines the molecular basis of the metabolic storage disorder sialidosis. Genes Dev. 1.99 6 1 0 (24) : 31 5 6 -31'69 Borsani G, Ballabio A, and Banfi S. A practical guide to orient yourself in the labyrinth of genome databases. Hum MolGenet 1998 10: T641'-1'648 Botstein D, White RL, Skolnick M, Davis RW. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am I Hum Genet 1980 May;32(3):3'1,4-3'J. Bradshaw R and Parsons M. Hemiplegic Migraine A Clinical study Q.J.Med 1965 34:65-85 Breschel TS, Mclnnis MG, Margolis RL, Sirugo G, Corneliussen B, Simpson SG, McMahon FJ, MacKiruron DF, Xu ]F, Pleasant N, Huo Y, Ashworth RG, Grundstrom Ç Grundstrom T, KiddKK, DePaulo I& Ross CA. A novel heritable, expanding CTG repeat in an intron of the SEF2-1 gene on chromosome 18q2L.L Hum Mol Genet 1997 Oct;6(11):1855-63 Brook JD, McCurrach ME, Harley HG, Buckler AJ, Church D, Aburatani H, Hr¡nter K, StantonVP, Thirion JP, Hudson T, et al. Molecular basis of myotonic dystrophy: expansion of a trinucleotide (CTG) repeat at the 3' end of a transcript encoding kinase family member CelT t992 F eb 2l ;68(4):7 99 -808 Browne DL, Gancher ST, Nutt ]G, Brunt ER, Smith EA, Kramer P, Litt M. Episodic ataxiaf myokymia syndrome is associated with point mutations in the human potassium channel gene, KCNAL. Nat Genet 1994 Oct;8(2):!36- 0 Brunt ER and van Weerden TW. Familial paroxysmal kinesigerric ataxia and continuous myokymia. Brain 1.990 Oct;113(Pt 5):1361-82 L94 Buckler Aj, Chang DD, Graw SL, Brook JD, Haber DA, Sharp PA, Housman DE. Exon amplification: a strategy to isolate mammalian genes based on RNA splicing. Proc Natl Acad Sci U S A 1991 May 1;88(9):4005-9 Burgess CE, Lindblad K, Sidransky E, Yuan QP, Long RT, Breschel T, Ross CA, Mckuris M, LeeP, Giruis EI, Lenane lvf, Kumra S, Jacobsen L, Rapoport lL, Sdralling M. Large CAG/CTG repeats are associated with childhood-onset schizophrenia. Mol Psychiatry 1 998 ]u1;3( 4):321.-7 Bulle F, Chianrrilkulchai N, Pawlak A, Weissenbach J, Gyapay G, Guellaen G' Identification and chromosomal localization of human genes containing CAG/CTG repeats expressed in testis and brain. Genome Res 1997 lu'l;7(7):705-15 Bulman DE Phenotype variation and newcomers in ion charurel disorders. Human Molecular Genetics, 1,997 6(\0) Review: L679-1'685 Campuzano V, Montenrrini L, Molto MD, Pianese L, Cossee M, Cavalcanti F, Monros E, Rodius F, Duclos F, Monticelli A, et al. Friedreidrrs ataxia: autosomal recessive disease caused by an intronic GAA triplet repeat expansion. Science 1996 Mar 8;271,(525a):1.423-7 Campuzano V, Monterrrini L,Llutz Y, Cova L, Hindelang C, Jiralerspong S, Trottier Y Kish S], Faucheux B, Trouillas Ð Authier F], Durr A, Mandel JL, Vescovi A" Pandolfo M, Koenig M. Frataxin is reduced in Friedreich ataxia patients and is associated with mitochondrial membranes. FIum MoI Genet 1997 Oct;6(11):L771'-80 Cancel G, Durr A, Difierjean O, Imbert G, Burk K, Lezin A Belal S, Benomar A, Abada-Bendib M, Vial C, Guimaraes ], Chneiweiss H, Stevanin G, Yvert G, Abbas N Saudou F, Lebre AS, Yahyaoui M, Hentati F, Vemant ]C, Klockgether T, Mandel fL, Agid Y, Brice A. Molecular and clinical correlations in spinocerebellar ataxia 2: a study o1 32 families. Hum MolGenet 1997 May;6(5):709-15 Carney jP, McKrright C, VanEpps S, Kelley MR. Random rapid amplification of cDNA ends (RRACE) allows for cloning of multiple novel human cDNA fragments containing (CAG)n repeats. Gene l, 9 95 Apr 3; 1 55 (2) :289 -92 Chee M, Y*g R, Hubbell E, Berno A, Huang XC, Stern D, Winkler ], Lockhart DJ, Morris MS, Fodor SP. Accessing genetic informationwith high-density DNA arrays. Science 'J.9 9 6 O ct 25 ;27 4(5287) : 61.0 - 4 Clt*g MY Ranum LP, Duvick LA, Servadio A, Zoglrrbí FfY, Orr HT. Evidence for a mechanism predisposing to intergenerational CAG repeat instability in spinocerebellar ataxia type I. Nat Genet 1.993 Nov;5(3):25a-8 195 Church D[4 Stotler CJ, Rutter JL, Murrell I& Trofatter ]4, Buckler A] Isolation of genes from complex sources of mammalian genomic DNA using exon amplification. Nat Genet 199 4 J an;6(L) : 98-1 05 Collins FS. Positional cloning: Let's not call it reverse any more Nat Gen 1,992 (1)1-6 Collins FS. Positional cloning moves from perditional to traditional. Nat Genet 1995 Apr;9(4):347-50 Collins FS, Patrinos A, ]ordan E, Chakravarti A, Gesteland f{, Walters L. New goals for the U.S. Human Genome Project: 1,998-2003. Science 1998 Oct 23;282(5389):682-689 Cooper DN, Smith BA, Cooke HJ, Niemann S, Schmidtke I. An estimate of unique DNA sequence heterozygosity in the human genome. Hum Genet 1985;69(3):2O'l'-5 Cooper DN and Krawczak M. Human gene mutation 1993 Review Bioscience, E¡rnsham Cossee lvl, Durr A, Schmitt tvl, Daht N, Trouillas P, Allinson P, Kostrzewa }vI, Nivelon{hevallier A, Gustavson KH, Kohlschutter A, Muller U, MandelJL, Brice A, Koenig M, Cavalcanti F, Tammaïo A, De Michele G, Filla A, Cocozza S, Labuda lvl, Montenrtini L, Poirier J, Pandolfo M. Friedreich's ataxia: point mutations and clinical presentation of compound heterozygotes. Ann Neurol 1999 F eb;45 (2):200 -6 Crawfurd M d'4, llarcourt RB and Shaw PA. Non progressive cerebellar ataxía, aplasia of pupillary zone of iris and mental subnormality (Gillespie's s¡rndrome) affecting 3 members of a non consanguineous family in two generations. I Med Gen1979 1,6:373-378 David G, Giunti P, Abbas N Coullin P, Stevanin G, Horta W, Gemmill & Weissenbach J, Wood N, Cunha S, Drabkin FL Harding AE, Agid Y, Brice A. The gene for autosomal dominant cerebelliar ataxia type II is located in a S-cM region in 3pL2-pL3: genetic and physicat mapping of the SCAT locus. Am J Hum Genet'J.996 Dec;59(6\:\328-36 David G, Abbas N, Stevanin Ç Durr A, Yvert G, Cancel G, Weber C, Imbert G, Saudou F, Antoniou E, Drabkin H, Gemmill & Giunti P, Benomar A, Wood N, Ruberg M, Agid ! Mandel JL, Brice A. Cloning of the SCAZ gene reveals a higtrly unstable CAG repeat expansion. Nat Genet 1,997 Sep;17(1):65-70 Davies SW, Turmaine M, Cozens BA, DiFiglia M, Sharp AH, Ross CA, Scherzinger E, Wanker EE, Mangiarini L, Bates GP. Formation of neuronal intranuclear inclusions underlies the neurological dysfunction in mice transgenic for the HD mutation. Cell'1,997 Aug 8;90(3):537-48 196 Delot E, King LM, Briggs MD, Wilcox WR and Cohn. Trinucleotide expansion mutations in the cartilage oligomeric matrix protein (COMP) gene. Human Mol Genet L999 8(1):123-128. Denier C, Ducros A, Vahedi Ç Joutel A, Thierry P, Ritz A, Castelnovo G, Deonna T, Gerard P, Devoize |L, Gayou A, Perrouty B, Soisson T, Autret A, Warter |M, Vighetto A, Van Bogaert P, Alamowitch S, Roullet E, Tournier-Lasserve E High prevalence of CACNA1A truncations and broader clinical spectrum in episodic ataxia type 2. Neurology L9 9 9 lun 10 ;52(9) :181. 6 -2 Dib C, Faure S, Fizames I Samson D, Drouot N, Vignal A, Millasseau P, Marc $ }j:azanj, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J. A comprehensive 'J'996 genetic map of the human genome based on 5,264 microsatellites. Nature M;ar Laþ80(657o):152-4 Dollfus It ]oanrry-Flinois O, Doco-Fenzy M, Veyre L, Joaruny-Flinois L, Khoury M, Jonveaux P,Abitol M and Dufier JL. Gillespie syndrome phenotype with a t(X;11)(p22.23;p12) de noao translocation Am J opthamol1998 125(3): 397-399 Donis-Keller H, Green P, Helns Ç Cartinhour S, Weissenbach B, Stephens Ç Keith TP, Bowden DW, Smith D& Lander ES et al. A genetic linkage rnap of the human genome. Cell1987 5'J.:3I9-337 Doyle I, Ren )Ç Lerunon G, Stubbs L. Mutations in the CacnlLa4 calcium channel gene are associated with seizures, cerebellar degeneration, and ataxia in tottering and leaner mutant mice. Mamm Genome'J'997 F eb ;8(2) :113-20 Ducros A, Joutel A, Vahedi K Cecillon I\t Ferreira A, Bernard E, Verier A, Echenne B, Lopez de Munain A, Bousser MG, Tournier-Lasserve E. Mapping o1 a second locus for familial hemiplegic migraine to Lq2l-q23 and evidence of further heterogeneity. Ann Neurol 't 997 D ec;42(6) :885-90 Ducros A, Denier C, ]outel A, Vahedi K Michel A" Darcel F, Madigand M, Guerouaou D, Tison F, Julien J, Hirsch E, Credru F, Bisgård C, Lucotte G; Després P, Billard C, Barthez MA, Ponsot G, Bousser MG, Tournier- Lasserve E Recurrence of the T666M Calcium Charurel CACNAI.A Gene Mutation in Familial Hemiplegic Migraine with Progressive Cerebell¡ar Ataxia. Am J Hum Genet 1999 64 (1) : 89-98 Durr A, Cossee IvI, Agid Y, CampuzarroY, Mignard Ç Penet C, Mandel fL, Brice A, Koerrig M. Clinical and genetic abnormalities in patients with Friedreich's ataxia. N Engl ] Med 1996 Oct T7 ;335(16):11'69 -7 5 L97 Durr A, Hahn-Barrrra V, Brice A, Pecheux C, Dode C, Feingold J. Homozygosity in Huntington's disease. J Med Genet 1999 Feb;36(2):I72-3 Edwards JH. Exclusion mapping. J Med Genet'J'987 24:539-543 Eichler EE, Richards S, Gibbs RA, Nelson DL. Fine structure of the human FMR1 gene. Hum Mol Genet t993 A:ug;2(8):n'a7-53 (Pubtshed erratum appears in Hum Mol Genet 199 4 Apr ;3( ) :684-5) Epplen Ç Epplen JT, Frank G, Miterski B, Santos EJ, Schols L Differential stability of the (cAA)r, tract in the Friedreich ataxia (STM7) gene. llum Genet 1997 Jtn;99(6):83a-6 Farher TW and Mustian UM Vestibulocerebellar ataxia. Arch Neurol1,963 8: 471- 480 Fenichel and Phillips Familial aplasia of the cerebellar vermis: possible X-linked dominant inheritance Arch Neurol 1989 46:582-583 Filla A, De Michele G, Campanella G, Peretti A, Santoro L, Serlenga I Ragno M, Calabrese O, Castaldo I, De Joanna G, Cocozza S. Autosomal dominant cerebellar ataxia type I. Clinical and molecular study in 36 Italian families including a comparison between SCA1 and SCA2 phenotypes. J Neurol Sci1'996aOct;'142(1'-2):140-7 Filla A, De Mchele G, Cavalcanti F, Pianese L, Monticelli A, Campanella G, Cocozza S. The relationship between trinucleotide (GAA) repeat l".gth and clinical features in Friedreidn ataxia. Am J Hum Genet 1'996b Sep;59(3):554-60 Flanigan K Gardner K Alderson Ç Galster B, Otterud B, Leppert MF, Kaplan Ç Ptacek L] Autosomal dominant spinocerebellar ataxia with sensory axonal neuropathy (SCAa): clinical description and genetic localization to chromosome 16q22.1. Am J Hum Genet 1996 Arg;59 (2):392-9 Fletcher CF,L:utz CM, O'sullivan TN Shaughnessy ID ]r, Hawkes & Frankel WN Copeland NG, Jenkins NA. Absence epilepsy in tottering mutant mice is associated with calcium channel defects. CellL996 Nov L5;87(4):607-17 Friede RL and Boltshauser E. Uncommon s)¡ndromes of cerebellar vermis aplasia. Joubert syndrome. Dev Med Child Neurol 1978:20:758-763 Friend SH, Bemards fÇ Rogelj S, WeinbergRAu Rapaport JM, Albert DM and Dryyla TP. A human DNA segment with properties of the gene that predisposes to retinoblastoma and osteosarcoma. Nature L986 323:643-6. Fu YFI, Pizzuti A, Fenwick RG |r, King J, Rajnarayan S, Dunne PW, Dubel J, Nasser GA" AshizawaT, de Jong P, et al. An unstable trþlet repeat in a gene related to myotonic muscular dystrophy. Science 1,9 92 I|l4;ar 6 ;255 (50 49) : 1 25 6 -8 198 Furman JM, Baloh RW, Chugani H, Waluch V and Bradley WG. Infantile cerebellar atrophy Annals of Neurologyl9&5 L7 399-402 Gardner K Barmada MM, Ptacek LJ, Hoffman EP. A new locus for hemiplegic migraine maps to chromosome 1q31. Neurology 1997 Nov;49(5):L23L-8 Gastier fM, Brody T, Pulido |C, Businga T, Sunden S, Hu X Maitra S, Buetow KH, Murray JC, Sheffield VC, Boguski M, Duyk GÌvI, Hudson TJ Development of a screening set for new (CAG/CTG)' dynamic mutations. Genomics-1"996 Feb L5;32(1):75-85 Gerber HP, Seipel Ç Georgiev O, Hofferer lvf, Hug IvI, Rusconi S, Schaffner W. Transcriptional activation modulated by homopolymeric glutanine and proline stretches. Science 19 9 4 F eb 11. ;263 (5148) : I 08 -1 1 Geschwind DH, Perlman S, Grody WW, Telatil M, Montermini L, Pandolfo M, Gatti RA. Friedreich's ataxia GAA repeat expansion in patients with recessive or sporadic ataxia. Neurology 1997 a Oct;49 (4):1'004-9 Geschwind DH, Perlrrran S, Figueroa CP, Treiman LJ, Pulst SM. The prevalence and wide clinical spectrum of the spinocerebellar ataxia type trinucleotide repeat in patients with autosomal dominant cerebellar ataxia. Am I Hum Genet 1997b Apr;60(4):842-50 Gir¡nti P, Sabbadini G, Sweeney MG, Davis MB, Veneziano L, Mantuano E, Federico A, Plasmati & Frontali M, Wood NW. The role of the SCA2 trinucleotide repeat expansion in 89 autosornal dominant cerebelLar ataxia families. Frequency, clinical and genetic correlates. Brain'1.998 Mar ;121,(Pt 3\ :459 -67 Glaser T, Ton CÇ Mueller R, Petzl-Erler ML, Oliver C, Nevin NC, Housmann DE and Maas RL. Absence o1 PAX6 gene mutations in Gillespie syndrome (partial aniridia 'J,994 cerebell¡ar ataxia and mental retardation). Genomics L9:145-1'48 Goldowitz D and Smel.ne RJ. Tune into the weavel channel Nature Genet 19951'J,: 'J.07-'1.09 Gostout B, Liu Q and Sommer SS. "Cr¡>tic" repeating triplets of purines and pyrimidines (cRRY(i)) are frequent and polymorphic: analysis of coding cRRY(i) in the proopiomelanocortin (POMC) and TATA-binding protein (TBP) genes. Am J Hum Genet 1 993 Jrrn; 5 2(6) :1182-90 Gouw LG, Kaplan CD, Haines JH, Digre KB, Rutledge SL, Matilla A, Leppert IvI, ZoS.bi HY,Ptacek L|. Retinal degeneration characteizes a spinocerebellar ataxia mapping to chromosome 3p. Nat Genet L995 May;L0(1):89-93 Griggs RC, Moxley RT 3d, Lafrance RA and McQuillen J. Hereditary paroxysmal ataxia : response to acetazolamide. Neurolo gy 197 I D ec ;28 (12) :1259 - 6 4 r99 GusellaJF, WexlerNS, ConnedlyPlW NaylorSL, Anderson MA, Tanzi RE, Watkins PC, Ottina K, Wallace MfÇ Sakaguchi AY, et al. A polymorphic DNA marker genetically linked to Huntington's disease. Nature 1983 Nov 17-23;306(5940\:234-8 Gyapay G, Morissette ], Vignal A, Dib Ç Fizames C, Millasseau P, Marc S, Bernardi G, Lathrop M, Weissenbach f. The 1993-94 Genethon human genetic linkage map. Nat Genet 1994 Jun;7(2 Spec No):246-339 Guyer MS and Collins FS. How is the Human Genome Project doing, and what have we leamt so far? Proc Natl Acad Sci USA 1995 9210841-10848. Hackam AS, Wellington CL, Hayden MR. The fatal attraction of polyglutamine- containing proteins. Clin Genet 1998 Apt;53(\:233-42 Hagberg B, Sarurer G and Steen G. The dysequilibrium syndrome in cereb,ral palsy. Acta Paediatr Scand 1972:61(suppl 226):1-63 Haines JL, Schut LJ, Weitkamp L& Thayer ìvI, Anderson VE. Spinocerebellar ataxia in a large kindred: age at onset, reproduction, and genetic linkage studies. Neurology 1,984 Dec;34(I2\:'1,542-8 HardingAE. Freidriech's ataxia: a clinical and genetic study of 90 families with an analysis of early diagnostic criteria and intrafamilial clustering of clinical features. Brain 'J,981;104:589-620. Harding AE. The hereditary ataxias and related disorders. 1984 Edinburgh: Churchill Livingstone. Harding AE. Clinical features and classification of inherited ataxias. Adv Neurol 1993;6T:1.-L4 Harper PS 1989 Myotonic Dystrophy 2"d ed W B Saunders, Philadelphia Hess EJ. Migraines in mice? Cell 1996 Dec 27;87(7):11'49-51 Heyk H. Varieties of hemiplegic migraine. Headache 1'973 12:T35-'l'42 Hoffmann A, Horikoshi M, Wang CK Schroeder S, Weil PA, Roeder RG. Cloning of the Schizosaccharomyces pombe TFIID gene reveals a strong conservation of functional domains present in Saccharomyces cerevisiae TFIID. Genes Dev 1990 Jul;4(7):1141,-8 Flousman D. Gain of glutamines, gain of function? Nat Gen 1995 'J'0:3-4 Holmberg M, Johansson |, Forsgren L, HerJbel J, Sandgren O, Holmgren G. Localization of autosomal dominant cerebell¡ar ataxia associated with retinal degeneration and anticipation to chromosomeSpT2-p21..1. Hurn Mol Genet t995 Aag;a(QIaaLS 200 Holmes SE, O'Hearn EE, Mckuris MG, Gorelick-Feldman DA, Kleiderlein]f, Callahan C, Kwak NG, Ingersoll-Ashworth RG, Sherr M, Surrurer A], Sharp AH, Ananth U, Seltzer WK Boss MAu Vieria-Saecker AM, Epplen ]T, Riess O, Ross CA,Margolis RL. Expansion of a novel CAG trinucleotide repeat in the 5' region of PPP2R2B is associated with SCA12.Nat Genet.'J.999 D ec ;23(\:39T-2. Hsieh IvI, Tsai lIF, Lu TM, Yang CY, Wu HM, Li 5Y.1997 Studies of the CAG repeat in the Machado-Joseph disease gene in Taiwan. Hum Genet L997 Aug;100(2):155-62 Ikeuchi T, Sanpei K, Takano H, Sasaki H, Tashiro K Cancel G, Brice A, Bird TD, Schellenberg GD, Pericak-Vance MA, Welsh-Bohmer KA, Clark LN Wilhelmsen Ç Tsuji S. A novel long and unstable CAG/CTG trinucleotide repeat on chromosome L7q. Genomics L998 Apt'1,5 ;49 (2):321' -6 Illarioshkin SN, Tanaka lI, Markova ED, Nikolskaya NN, Ivanova-Smolenskaya IA and Tsuli S. X-linked non progressive congenital cerebellar hypoplasia: clinical description and mapping to chtomosome Xq. Arur Neurol 1996 40(1): 75-83 Imamura S, Tachi N and Oya K. Dominantly inherited early onset non progtessive cerebellar ataxia syndrome. Brain Dev 1993 15:372-376 Imbert G, Trottier Y, Beckmann ] and Mandel JL. The gene for the TATA binding protein (TBP) that contains a highly polymorphic protein coding CAG repeat maps to 6q27 Genomics L994 21, 667-668 Imbert G, Saudou F, Yvert G, Devys D, Trottier Y, Garnier JM, Weber C, Mandel |L, Cancel G, Abbas N, Durr A, Didierjean O, Stevanin G, Agid Y, Brice A. CLoning of the gene f.or spinocerebellar ataxia 2 reveals a locus with high sensitivity to expanded CAG/glutamine repeats. Nat Genet 1996 Nov;L4(3\:285-91' Ioannou PA, Amemiya CT, Garnes J, Kroisel PM, ShizuyaH, Chen C, Batzer MA, de Jong PJ A new bacteríophage PL-derived vector for the propagation of large human DNA fragments. Nat Genet L994|an;6(1):8a-9 Jeffreys Af Wilson V and Thein SL. Hypewariable 'minisatellite' regions in human DNA. Nature L985 3t4:67-73 ]odice C, Malaspina P, Persichetti F, Novelletto A, Spadaro IvI, Giunti P, Morocutti Ç Terrenato L, Harding AE, Frontali M. Effect of trinucleotide repeat length and parental sex on phenotypic variation in spinocerebellar ataxia I. Am J Hum Genet ß9a $):959-65 20r jodice C, Mantuano E, Veneziano L, Trettel F, Sabbadini G, Calandriello L, Francia A, Spadaro M, Pierelli F Salvi F, Ophoff RA, Frants RR and Frontali M. Episodic ataxia type 2 (EAz) and spinocerebellar ataxia type 6 (SCA6) due to CAG repeat expansion in the CACNALA gene on chromosomeT9p. Hum Molec Genet 1'997 Oct6(11):1'973-8 Jiang JX, Deprez RH, Zwarthoff EC, Riegman PH. Characterization of four novel CAG repeat-containing cDNAs. Genomics 1995 Nov 1;30(1):91-3 Jordanova A, Kalaydjieva L, Savov A, Claustres I\4 Schwarz M, Estivill & Angelicheva D, Flaworth A, Casals T, Kremensky I. SSCP Analysis: A blind sensitivity trial. Human Mutation 1997 1,0 :65-70 Joutel A, Bousser MG Biousse V, Labauge Ð Chabriat FI, Nibbio A, Maciazek ], Meyer B, Bach MA, Weissenbach j, et al. A gene for familial hemiplegic migraine maps to chromosome 1.9. Nat Genet 1993 Sep;5(L):a0-5 ]outel A, Ducros A, Vahedi Ç Labauge P, Delrieu O, Pinsard N, Mancini J, Ponsot G, Gouttiere F, Gastaut JL, et al. Genetic heterogeneity of familial hemiplegic migraine, Am J Hum Genet 1994 D ec;55(6):11'66-72 Kan YW, Dozy AM. Polymorphism of DNA sequence adjacent to human beta- globin structural gene: relationship to sickle mutation. Proc Natl Acad Sci USA 1978 Nov;75(11):5631-5 Kaushik N, Malaspina A, Schailing M, Baas F, de Belleroche J. Isolation and characterization of trinucleotide repeat containing partial transcripts in human spinal cord. Neurogenetics. 1998 Aag;L(4):239 -47 . Kawaguchi Y, Okamoto T, Taniwaki h[, Aizawa M, Inoue lvI, Katayama S, Kawakami H, Nakamura S, Nishimura M, Akiguchi I, et al. CAG expansions in a novel gene for Machado-Joseph disease at chromosomeL4q32.1. Nat Genet 1.994 Nov;8(3):221'-8 Kim U], BÍren BW, Slepak T, Mancino V, Boysen C, Kang HL, Simon MI, Shizuya H. Construction and chatactetization of a human bacterial artificial chromosome library. Genomics 19 9 6 Jun 1, ;3 4(2) z2L3 -8 Klement IA, Skirurer PJ, Kaytor MD, Yi H, Hersch SM, Clark }JB, ZoghbiHY, Orr FIT Ataxin-1 nuclear localization and aggregation: role in polyglutamine-induced disease in SCA1 transgenic mice. CeIl1998 Oct 2;95(1):41-53 Koide & Ikeuchi T, Onodera O, Tanaka H, Igarashi S, Endo K Takahashi H, Kondo R, Ishikawa A, Hayashi T, et al. Unstable expansion of CAG tepeat in hereditary dentatorubral-pallidoluysian atrophy (DRPLA)' Nat Genet 1"99 4 6:9 -13 202 Koide IÇ Kobayashi S, Shimohata T, Ikeuchi T, Maruyama M, Saito lv{, Yamada M, Takahashi H and Tsuji S. A neurological disease caused by urr expanded CAG trinucleotide repeat in the TATA-binding protein gene: a new polyglutamine disease? Hum Mol Genet 'J.999 8:2047-2053 Konigsmark BW and Weiner LP. The olivopontoatrophies: a review. Medicine (Baltimore) 1,970 May;49(3) :227 -4'1, Koob MD, Benzow KA, Bird TD, Day JW, Moseley ML, Ranum LP Rapid cloning of expanded trinucleotid.e repeat sequences from genomic DNA. Nat Genet 1998 Jan;18(1):72- 5 Koob MD, Moseley ML, Schut LJ, Benzow KA, Bird TD, Day JW, Ranum LP. An rrntranslated CTG expansion causes a novel form of spinocerebellar ataxia (SCAB). Nat Genet 1999 Apr ;21.(4) :37 9 -84 Kraus R! Sirmegger MJ, Glossmarur H, Hering S, Striessnig J. Familial hemiplegic migraine mutations change alphalA Ca2+ channel kinetics. ] Biol Chem 1998 Mar 6;273(1.0):5586-90 Kruglyak L. The use of a genetic map of biallelic markers in linkage studies. Nat Genet 19 97 S ep ;17 (1) :21, - a Landegren U. Laboratory protocols for mutation detection 1996 Oxford University Press. Lathrop GM and Lalouel JM. Easy calculations of Lod scores and genetic risks on small computers Am J Hum Genet'J.984 36:460-65 Lathrop GI\4 Lalouel Jlv{, Julier C, Ott J. Strategies for multilocus linkage analysis in humans.Proc Natl Acad Sci U S A. 1984 |un; 81(11):3443-6. Leggo J, Dalton A, Morrison PJ, Dodge A, Connarty ¡ø, Kotze MJ, Rubinsztein DC. Analysis of spinocerebellar ataxia types '1.., 2, 3, and 6, dentatorubral-pallidoluysian atrophy, and Friedreich's ataxia genes in spinocerebellar ataxia patients in the UK. J Med Genet 1997 D ec;3a$2):982-S Lescure A, Lutz Y, Eberhard D, Jacq X, Krol A, Grummt I, Davidson I, Chambon P, Tora L. The N-terminal domain of the human TATA-binding protein plays a role in transcription from TATA-contoining RNA polymerase II promoterc 1994 EMBO J Mar 1.;13(5):L166-75 Li SH, Mclnnis MG, Margolis RL, Antonarakis SE, Ross CA. Novel triplet repeat containing genes inhuman brain: cloning, expression, and length polymorphisms. Genonics 'J,9 93 Jun;\ 6 (3) :57 2-9 203 Lindblad K, Nylander PO, De bruyn A, Sourey D, Zander C, Engstrom C, Holmgren G, Hudson T,Chotai J, Mendlewíczl, et al. Detection of expanded CAG repeats in bipolar affective disorder using the repeat expansion detection (RED) method. Neurobiol Dis 1995 Feb;2(1):55-62 Lindblad K, Savontaus ML, Stevanin G, HoLnberg M, Digre K, Zander C, Ehrsson H, David G, Benomar A, Nikoskelainen E, Trottier I Holmgren G, Ptacek LJ, Anttinen A, Brice A, Schalling M. An expanded CAG repeat sequence in spinocerebellar ataxia type 7. Genome Res 1996 Oct;6(10):965-7L Liu a and Sommer SS. Parameters affecting the sensitivities of dideoxy fingerprinting and SSCP PCR Methods Appl 1994 4:97-L08. Lopes-Cendes I, Gaspar C, Trottier Y, Mandel J-L and Rouleau GA. Searching for proteins containing polyglutamine expansions in a large group of spinocerebellar ataxia patients Am Soc Hum Genet 1996 A1559 [Abstract] Lopes-Cendes I, Teive HG, Calcagnotto ME, Da Costa ]C, Cardoso F, Viana E, Maciel ]4, Radvany J, Armda WOTrevisol-Bittencourt PC, Rosa Neto P, Silveira I, Steiner CE, Pinto Junior W, Santos AS, Correa Neto Y, Wemeck LC, Araujo AQ, Carakushansky G, Mello LR, fardim LB, Rouleau GA. Frequency of the different mutations causing spinocerebellar ataxia (SCAI, SCA} MJD/SCA3 and DRPLA) in a large group of Brazilian patients. Arq Neuropsiquiatr \997 Sep;55(38\:519 -29 Lorenzetti D, Bohlega S, ZoghArHY. The expansion of the CAG repeat in ataxin-2 is a frequent cause of autosomal dominant spinocerebellar ataxia. Neurology 1997 Oct;49(4):1009-13 Lovett M, Kere J, Hinton LM. Direct selection: a method for the isolation of cDNAs encoded by large genomic regions. Proc Natl Acad Sci U S A 1991 Nov 1;88(21):9628-32 Mahadevan lvl, Tsilfidis C, Sabourin L, Shutler G, ,A.memiya Ç Jansen G, Neville C, Narang M,Barcelo |, O'Hoy K, et al, Myotonic dystrophy mutation: an unstable CTG repeat in the 3'untranslated region of the gene. Science'J.992 Mar 6;255(5049):1253-5 Mallery DL, Tanganelli B, Colella S, Steingrimsdottir H, van Gool AJ, Troelstra C, Stefanini M, Lehmann AR. Moleculat analysis of mutations in the CSB (ERCC6) gene in patients with Cockayne syndrome.Am J Hum Genet. 1'998lan;62(1):77-85. 204 Margolis RL, Stine OC, Mckuris MG, Ranen NG, Rubinsztein DC, Leggo J, Brando LV, Kidwai AS, Loev SJ, Breschel TS, Callahan C, Simpson SG, DePaulo fR, McMahon F], ]ain S, Paykel ES, Walsh C, Delisi LE, Crow TJ, Torrey EF, Ashworth RG, Macke JP, Nathans J, Ross CA. cDNA cloning of a human homologue of the Caenorhabditis elegans cell fate-determininggene mab-2L: expression, chromosomal localization and analysis of a highly polymorphic (CAG)' trinucleotide repeat. Hum Mol Genet 1996 May;5(5):607-1,6 Margolis RL, Abrahâm M& Gatchell SB, Li SlI, Kidwai AS, Breschel TS, Stine OC, Callahan C, Mckrris MG, Ross CA. cDNAs with long CAG trinucleotide repeats from human brain. Hum Genet 1997 Jú;'J,00(1)il,a-22 Margolis RL, Stine OC, Ward CM, Franz ML, Rosenblatt A, Callahan C, Sherr M, Ross CA, Potter NT. Unstable expansion of the CAG trinucleotide repeat in MAB21L1: report of a second pedigree and effect on protein expression. J Med Genet 1999 lart;36(L):62-4 Maruyama H, Nakamura S, Matsuyama Z, Sakai T, Doyu M, Sbue G, Seto M, Tsujihata lvf, Oh-i T. Nishio T, Stmohara N Takahashi & Hayashi M, Nishino I, Ohatake T, Oda T, Nishimura IvI, Saido T, Matsumoto It Baba lvl, Kawaguchi Y, Kakizuka A and Kawakami H. Molecular features of the CAG repeats and clinical manifestation of Machado-]oseph disease Hum Mol Gen L995 Aþ):807-812 Matsumoto IvI, Nakagawa T,Inoue T, Nagata E, Tanaka K, Takano H, Minowa O, Kuno f, Sakakibara S, Yamada M, Yoneshima lI, Miyawaki A, Fukuichi T, Furuichi T, Okano Ft Mikoshiba K and Noda T. Ataxia and epileptic seizures in mice lacking type L inositol 1.,4,5-füphosphate receptor. Nature 19 9 6 37 9 :1 68 -17 L Matsuura T, Achari M, Khajavi lvl, Bachinski LL, ZoghbtFfY, Ashizawa T. Mapping of the gene for a novel spinocerebellar ataxia with pure cerebellar signs and epilepsy. Ann Neurol L9 99 l|l4ar ; 45 (3) : 407 -11 Matsuyama Z, Kawakami H, Maruyama FI, Izumi Y, Komure O, Udaka F, Kameyama M, Nishio T, Kuroda Y, Nishimwa M, Nakamura S. Molecular features of the CAG repeats of spinocerebellar ataxia 6 (SCA6) Hum Mol Genet 1997 6(8):1,283-1287 Mattick ], Sutherland G and Foote S. The Human Genome Project and Genome Research in Australia Todays Life Science!999 March/April34-40 Maurer DJ, O'Callaghan Bl Livingston DM. Orientation dependence of trinucleotide CAG repeat instability inSaccharomyces cerevisiae. MolCell BioL\996 Dec;16(12):6617-22 Maxam AM and GilbertWA. A new method for sequencing DNA. Proc Natn Acad Sci U.S.A'1.977 ;7 4:560-564 20s McDonald TV, Yu Z,NßngZ,Palrta E, Meyers MB, Kang K-W, Goldstein SAN and Fishman GI. A minK-HERG complex regulates the cardiac potassium current I(Kr) Nature 1.997 388:289-292 McPhaul MJ, Marcelli lvt Tilley WD, Griffin JE, Isidro-Gutierrez RF, Wilson ]D. Molecular basis of androgen resistance in a family with a qualitative abnormality of the androgen receptor and responsive to highdose androgen therapy. I Clin Invest 1991 Apr;87(4):14L3-21, M"oy DE, Kobayashi Y, Bailey CK, Taye AA, Fischbeck KH Cleavage, aggregation and toxicity of the expanded androgen receptor in spinal and bulbar muscular atrophy. Hum Mol Genet 1998 Apr;7 (4):693-701. Mizushima K, Watanabe M, Abe K, Aoki M, Itoyama Y, Shizuka M, Okamoto K, Shoji M. Analysis of spinocerebellar ataxia type 2 in Gu¡ma Prefecture in Japan: CAG trinucleotide expansion and clinical characteristics. J Neurol Sci 1.998 Apr 1;156(2):180-5 Mohrenweiser FfW, Tsujimoto S, Gordon L, Olsen AS. Regions of sex-specific hypo- and hyper-recombination identified through integration of L80 genetic markers into the metric physical map of human chromosome 1.9. Genomics 1998 lanl5;47(2):153-62 Moseley ML, Benzow KA, Schut LJ, Bird TD, Gomez Clll4', Barkhaus PE, Blindauer KA, Labuda lr¿I, Pandolfo lr4, Koob MD, Ranum LP. Incidence of dominant spinocerebellar and Friedreich triplet repeats anong 361. ataxia families. Neurology 1998 Dec;51(6):1,666- 71 Mock BA, Connelly MO, McBride W, Kozak CA, and Marcu KB. Plasmacytoma- associated Neuronal Glycoprotein, Pøng maps to mouse chromosome 6 and human chromosome 3 Genomics'J,996 34:226-228 Moreno It Rudy B and R Beta subunits influence the biophysical and pharrnacological differences between P and Q-type calcium currents expressed in a mammalian cell line. Proc Natn Acad Sci U.S.A '1,997 94:1.4042--J.4047 Monaco AP, Neve RL, Colletti-Feener C, Bertelson CJ, Kurnit DM, Kunkel LM. Isolation of candidate cDNAs for portions of the Duchenne muscular dystrophy gene. Nature 1986 Oct 1,6-22;323(6089) :646-50 Montenrrini L, Andermann E, Labuda IvI, Richter A, Pandolfo ìvI, Cavalcanti F, Pianese L, Iodice L, Farina G, Monticelli A, Turano lvl, Filla A, De Michele G, Cocozza S. The Friedreich ataxia GAA triplet repeat: premutation and normal alleles. Hum MoI Genet 1997 Attg; 6 (8) :1.261. -6 206 Myers RM, Maniatis T and Lerman LS. Detectíon and localisation of single base changes by denaturing gradient gel electrophoresis. Meth Enzynol-1.987 155;501.-527 Myszka DG. Kinetic analysis of macromolecufar interactions using surface plasmon resonance biosensors. Curr Opi^ Bíotechnol Feb1997 1;8(1):50-7 Nagafuchi S, Yanagisawa H, Sato K, Shirayama T, Ohsaki E, Bundo lt4, Takeda T, Tadokoro K Kondo I, Murayama N et al. Dentatorubral and pallidoluysian atrophy expansion of an unstable trinucleotide on chromosome 12p. Nat Genet \994 6:'J,4-'1,8. Naito H and Oyanagi S. Familial myoclonus epilepsy and choreoathetosis: hereditary dentatombral-pallidoluysian atrophy. Neurology 1982 32:898-807 Nakamoto M, Takebayashi Ft Kawaguchi Y Narumiya S, Taniwaki M, Nakamura Y, Ishikawa Y, Akiguchi I, KimunJ, Kakizuka A. A CAG/CTG expansion in the normal population. Nat Genet 1.997 Dec;1.7(4):385-6 NeriC, Albanese V, Lebre AS, Holbert S, Saada C, Bougueleret L, Meier-Ewert $ Le Gall I, Millasseau P, Bui H, GiudicelliC, Massart C, Guillou S, Gervy P, Poullier E, Rigault P, Weissenbach J, Iænnon G, Chumakov I, Dausset J, Lehrach Ft Cohen D, Cann HM. Survey of CAG/CTG repeats in human cDNAs representing new genes: candidates for inherited neurological disorders. llum Mol Genet 1996 Jul;5(7):100L-9 Nikali Ç Suomalainen A, Terwilliger ], Koskinen T, Weissenbach J and Peltonen L Raridom search for shared chromosomal regions in four affected individuals: The assignment of a new herefitary ataxia locus. Am I Hum Gen 1995 56:1088-1095 Nikali Ç Isosomppi J, Lonnqvist T, Mao J Suomalainen A and Peltonen L. Toward cloning of a novel ataxia gene: Refined assignment and physical map of the IOSCA locus (SCA8) on10q24 Genomics 1997 39:185-1.91. Ohshima K Kang S, Larson JE, Wells RD Cloning, characterization, and properties of seven triplet repeat DNA sequences. Biol Chem 1996lull2;271,(28):L6773-83 Ollila ]. Sequence specificity in CpG mutation hotspots. FEBS letters 1996 396:T19- t22 Ophoff RA, vanEijk R, Sandkuijl LA, Terwindt GlvI, Grubben CP, Haan J, Lindhout D, Ferari MD, Frants RR. Genetic heterogeneity of familial hemiplegic migraine. Genomics 19e4JuI1.;22(1):21-6 207 Ophoff RA, Terwindt GlvI, Vergouwe MN, vanEijk & Oefner P], Hoffman SM, Lamerdin JE, Mohrenweiser HW, Bulman DE, Ferrari lvl, Haan J, Lindhout D, van Ommen GJ, Hofker MFI, Ferrari MD Frants RR. Familial hemiplegic migraine and Episodic ataxia Type 2 are caused by mutations in the Ca 2+ channel gene C,4CNL414 CelT 1996 87:543- 552 Orita IvI, Suzuki Y, Sekiya T, Hayashi K. A rapid and sensitive detection of point mutations and genetic polymorphisms using polymerase chain reaction. Genomics L989 5:874-879 Orr HT, Ch*g MY Banfi S, Kwiatkowski TJ Jr, Servadio A, Beaudet al., McCall AE, Duvick LA, Ranum LP, Zog}r,lVrHY. Expansion of an unstable trinucleotide CAG repeat in spinocerebellar ataxia type L. Nat Genet 1993 Jul;4(3):221-6 Ott J. Analysis of Human Genetic Linkage (rev ed) 1991 John Hopkins University Press Baltimore. Ouahchi K Arita lvI, Kayden H, Hentati F, Ben Hamida M, Sokol & Arai H, lnoue K Mandel |L, Koenig M. Ataxia with isolated vitamin E deficiency is caused by mutations in the alpha-tocopherol transfer protein. Nat Genet 1995 Feb;9(2):1,a1-5 Parrish JE and Nelson DL. Methods for finding genes. A major rate-limiting step in positional cloning. Genet Anal Tech Appl 1993 Apr;7O(2):29-aI Patel K Cox R, Shipley J, Kiely F, Frazer K Cox D& Lehach I{, Sheer D. A novel and rapid method for isolating sequences adjacent to rare cutting sites and their use in physical mapping. Nucleic Acids Res 1991 Aag25;19(1,Q:a371,-5 Patil N, Cox DIÇ Bati D, Faham IvI, Myers RM and Peterson AS. A potassium charurel mutation in weaver mice implicates membrane excitability in granule cell differentiation Nature Gen 1995'].,'J,: L26-129 Pau-lson }JL,Petez MK Trottier Y, Trojanowski JQ, Subramony SH, Das SS, Vig P, MandelJL, Fischbeck KH, Pittman RN. Intranuclear inclusions of expanded polyglutamine protein in spinocerebellar ataxia type 3. Neuron 1997 Arg;L9(2):ß3-a4 Paulson HL. Protein fate in neurodegenetative proteinopathies: polyglutamine diseases join the (mis)fold. Am J Hum Genet 1999 Feb;64(2):339-45 Pawlak A, Chiannikulchai N Ansorge W, Bulle F, Weissenbach J, Gyapay G, GuelLaen G. Identification and mapping of 26 human testis mRNAs containing CAG/CTG repeats. Mamm Genome 1998 Sep;9(9):7a5-8 208 Pearson CE, Sinden RR. Alternative structures in duplex DNA formed within the trinucleotide repeats of the myotonic dystrophy and fragile X loci. Biochemistry !996 Apr 16;35(15):504L-53 Perez MK Paulson HL, Pendse SJ, Saionz Sj, Bonini NM, Pittman RN. Recruitment and the role of nuclear localization in polyglutamine-mediated aggregation. ] Cell Biol 1998 D ec 1. 4;1 43 (6) :L 457 -7 0 Polymeropoulos MFI, Rath DS, Xiao lt Merril CR. Trinucleotide repeat polymorphísm at the human transcription factor IID gene. Nucleic Acids Res L99L Aug 11,;19(15\:4307 Polymeropoulos MH, Ide SE, Becker K Naylor SL. Linkage and cytogenetic mapping of a CAG repeat containing human cDNA to 3p24.2-p22. Cancet Genet Cytogenet 1996 Nov;92$):a6-9 Pujana MA, Gratacos M, Corral ], Banchs I, Sanchez A, Genis D, Cervera C, Voþini V, Estivill X Polymorphisms at L3 expressed human sequences containing CAG/CTG repeats and analysis in autosomal dominant cerebellar ataxia (ADCA) patients. Hum Genet 1997 Nov;101 (1) :L8-21 Pulst SM, Nechiporuk A, Nedriporuk T, Gispert S, Chen XN, Lopes-Cendes I, Pearlman S, Starkman S, Orozco-Diaz G, Lunkes A, Delong P, Rouleau GA, Auburger G, Korenberg JR, Figueroa C, Sahba S. Moderate expansion of a normally biallelic trinucleotide repeat in spinocerebellar ataxia type 2. Nat Genet 1-996 Nov;M(3):269-76 Prosser ) and van Heyningen V, PAX6 mutations reviewed Hum Mutat 1998 11(2):e3-108 Rakic P and Sidman RL. Weaver mutant mouse cerebellum: defective neural migration secondary to abnormality of Bergmann cells Proc Nabr Acad Sci U.S.A. 1'973 70: 240-244 Ramsay M. Yeast artificial chromosome cloning. Mol Biotechnol L994 Apr;1(2):181- 201 Ranum LP, Chung MY, Banfi S, Bryer A, Schut LJ, Ramesar fÇ Duvick LA, McCall A, Subramony SFI, Goldfarb L, et al. Molecular and clinical correlations in spinocerebellar ataxia type I: evidence of familial effects on the age of onset. Am I Hum Genet 1994 55(2):244-252 Ranum LP, Schut LJ, Lwdgren IK Orr HT, Livingston DM, Spinocerebellar ataxia type 5 in a family descended from the grandparents of President Lincolr maps to chromosome 1,1,. Nat Genet 1994 Nov;8(3):280- 209 Ranum LP, LundgrenlK Schut LJ, Ahrens MJ, Pertnan S, Aita J, Bird TD, Gomez C, Orr HT. Spinocerebellar ataxia type 1 and Machado-]oseph disease: incidence of CAG expansions among adult-onset ataxia patients from 3L1 families with dominant, tecessive, or sporadic ataxia. Am J Hum Genet 1995 Sep;57(3):603-8 Ranvik-Glavac M, Glavac D, Dean M. Sensitivity of single stand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene. Hum Mol Genet 1994 3:801-807 Reddy PH, Stockburger E, Gillevet P, Tagle DA Mapping and characterization of novel (CAG)n repeat cDNAs from adult human brain derived by the oligo capture method. Genomics 1997 D ec 1, ;46(2) :17 4-82 Riess O, Laccone FA, Gispert S, Schols L, IJhlke C, Menezes Vieira-Saecker AM, Herlt S, Wessel Ç Epplen JT, Weber BHF, Kruez F, Chahrokh-Zadah S, Meindl A, Lunkes A, Aguiar ], Maceþ MJr., Krebsova A Macek M, Sen., Burk K Tinschert S, Schreyer I, Pulst SM and Auburger G. SCA2 trinucleotide repeat in German SCA patients Neurogenetics 1997 t(I):59-6a Riess O, Schols L, Bottger II, Nolte D, Vieira-Saecker AI\4 Schimmhg C, Kreuz F, Macek M ]r, Krebsova A, Macek M Sen, Klockgether T, Zuhlke C, Laccone FA. SCA6 is caused by moderate expansion in the sLA-voltage-dependent calcium channel gene Hum Mol Genet 1997 6 (8) 1283-T287 Richards R[, Sutherland GR. Simple repeat DNA is not replicated simply. Nat Genet 1,9948eb;6(2):fla-6 Risch N. Linkage strategies for genetically complex traits. IL The power of affected relative pairs. Am J Hum Genet L990 Feb;46(2):229-aL Rivier F and Echerure B. Dominantly inherited hypoplasia of the vermis Neuropediatrics 1992 23 :20 6 -208 Ross C. I{hen more is less: pathogenesis of glutamine repeat neurodegenerative diseases. Neuron 199515 493-496 Sakura ÉI, Bond C, Warren-Perry M, Horsley S, Keamey L, Tucker S, Adelman J, Turner R and Ashcroft FM. Characterisation and variation of a human inwardly-rectifying K-channel gene (KCN/6) ; a putative ATP-sensitive K-drannel subunit. FEBS lett 1995 367:L93-197. Sakurai T, Westernbroek RE, Rettig ], Hell I and Catterall WA. Biochemical properties and subcellular distribution of the 81 and rbA isoforms of alphalA subunits of brain calcium charurels. J Cell8io11996134: 511,-528 2to Sanguinetti MC, Curran lvfB, Zou A, Shen J, Spedtor PS, Atkinson DL and Keating MT. Coassembly of K(v)LQT1 and minK (IsK) proteins to form cardiac I(Ks) potassium channel Nature ']',996 384:80-83 Sanpei K Takano Ft Igarashi S, Sato T, Oyake M, Sasaki H, Wakisaka A, Tashiro K Ishida Y, Ikeuchi T, Koide R, Saito M, Sato A, Tanaka T, Hanyu S, Takiyama Y, Nishizawa M, Shimizu NNomura Y, Segawa lvl,Iwabuchi K, Eguchi I, Tanaka H, Takahashi H, Tsuji S. Sanpei Identification of the spinocerebellar ataxia type 2 gene using a direct identification of repeat expansion and cloning technique, DIRECT. Nature Genet'1,9961,4:277-284 Sarkar PS, Chang HÇ Boudi FB, Reddy S CTG repeats show bimodal amplification inE. coli Cell1998 95: 531-540 Sathasivam K Hobbs C, Turmaine M, Mangiarini L, Mahal A, Bertaux F, Wanker EE, Doherty P, Davies SW, Bates GP. Formation of polyglutanr-ine inclusions in non4NS tissue. Hum Mol Genet 1999 May;8(5):813-22 Sato K, Kashfüara K Okada S, Ikeuchi T, Tsuji S, Shomori T, Morimoto Ç Hayabara T. Does homozygosity advance the onset of dentatorubral-pallidoluysian atrophy? Neurology 1995 Oct;45 (L0) :1934-6 Saudou F, Finkbeiner S, Devys D, Greenberg ME. Huntingtin acts in the nucleus to induce apoptosis but death does not correlate with the formation of intranuclear inclusions. Cell 1998 Oct 2¡95(1):55-66 Savitsky K, Bar-Shira A, Gilad S, Rotman G, Ziv Y, Vanagaite L, Tagle D, Smith S, Uziel T, Slez S, AshkenaziM, Pecket I, Frydman N,'I, Harriik R, Patanjali S& Simmons A, Clines GA, Sartiel A, Gatti RA, Chessa L, Sanal O, Lavin MF, Jaspers NG], Taylor MR, Arlett CF, Miki T, Weissman SM, Lovett M, Collins FS and Shiloh Y. A single Telangiectasia gene with a product similar to P1-3 kinase. Science 1995 268 L749-1753 Schalling M, Hudson TI, Buetow KH, Flousman DE. Direct detection of novel expanded trinucleotide repeats in the human genome. Nat Genet 1993lun;4(2\:135-9 Schols L, Vieira-Saecker AlyI, Schols S, Przuntek H, Epplen JT, Riess O. Trinucleotide expansion within the MJD1, gene presents clinically as spinocerebellar ataxia and occurs most frequentþ in German SCA patients. Hum Mol Genet L995 Jun;4(6):1001-5 Schols L, Amoiridis G, Buttner T, Przuntek H, Epplen JT, Riess O. Autosomal dominant cerebellar ataxia; phenotypic differences in genetically defined subtypes? Ann Neurol 19 97 D ec ; 42(6) :9 24-32 2TL Schultze-Bahr E, Wung Q, Wedekind H, Haverkamp W, Ctren Q, Sun Y, Rubie C, Hordt M, TowbinlA, Borggrefe M, Assmann G, Qu )Ç Somberg |C, Breithhardt G, Oberti C and Funke H KCNE1 mutations cause Jervell and Lange-Nielsen syndrome. (Letter) Nature Genet L997 17:267-268 Sharp D, BlindermarrL, Combs KA, Kienzle B, Ricci B, Wager-Smith K, GilCM, Turck CW, Bouma ME, Rader DJ, et al. Cloning and gene defects in microsomal triglyceride transfer protein associated with abetalipoproteinaemia. Nature 1993 Sep 2;365(6441\:65-9 Sheffield VC, Cox DR, Lerman LS and Myers RM. Attachment o1 a 40-base pair G+C rich sequence (GC clamp) to genomic DNA fragments by the polymerase chain reaction results in improved detection of single-base changes Proc Natr Acad Sci U.S.A. 1989 86:232-236. Sheffield V, Beck ]S, Kwitek AE, Sandstrom DW, Stone EM. The sensitivity of single strand conf ormation polymorphism analysis. Genomics \993 1'6:325 -332 Silveira I, Lopes-Cendes I, Kish S, Maciel P, Gaspar C, Coutinho P, Botez MI, Teive H, Arruda W, Steiner CE, Pinto-Junior W, Maciel JA, Jerin S, Sack G, Anderrrrann E, Sudarsky L, Rosenberg & Macleod P, Chitayat D, Babul IÇ Sequeiros J, RouleauGA Frequency of spinocerebellar ataxia type 1, dentatorubropallidoluysian atrophy, and Machado-)oseph disease mutations in a large group of spinocerebellar ataxia patients. Neurology'J"9 9 6 | an; 46 (L) :21. a -8 Sisodia S. Nuclear inclusions in glutamine repeat disorders: are they pernicious, coincidental, or beneficial? Cell 'J,998 95:1-4 Splawski I, Tristani-Firouzi ItvI, Lehmann MH, Sanguinetti MC and Keating MT. Mutations in the hminK gene cause long QT syndrome and suppress I(Ks) function Nature Genet 1997 17:338-340 Stea A, Soong, TW and Snutctr, TP, Voltage gated calcium charunels in ligand- and voltage-gated ionchannels. R.A. North ed. (CRC Press) t995, pp 113-151 Steinlin M. Non progressive congenital ataxias Brain development 1998 20(4):199- 208. Steinlin M, Zanrnger B and Bolthauser E. Non progressive congenital ataxia with or without cerebellar hypoplasia: a review of 34 subjects Developmental Medicine and Child neurology 1,998 40 :'J.48-1 54 2r2 Stevanin G, Trottier Y, Cancel G, Durr A, David G, Didierjean O, Burk K Imbert G, Saudou F, Abada-Bendib M, Gourfinkel-An I, Benomar A, Abbas N, Klockgether T, Grid D, Agid ! Mandel JL, Brice A. Screening for proteins with polyglutarrrine expansions in autosomal dominant cerebell¡ar ataxias. Hum Mol Genet 1996 Dec;5(12):1,887-92 Stevanin G, Giunti P, Belal GDS, Durr A, Ruberg M, Wood N, Brice A De novo expansion of intermediate alleles in spinocerebellar ataxia 7. Hum Mol Genet '1,998 Oct;7(11):1809-13 Stevanin, G.; Herman, A.; Durr, A.; ]odice, C.; Frontali, M.; Agid, Y.; Brice, A. : Are (CTG)n expansions at the SCAS locus rare polymorphisms? (Letter) Nature Genet. 24:213 only,2000. Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee [Ç Marafukulam A, O'Connor K, Perkins S, Piercy M, QirlF,Reif T,SandersC,SheX,SunWL,Tabar P,VoytickyS,CowlesS,FanJB, Cox D& et al. An STS-based radiation hybrid map of the human genome. Genome Res. 1.997 May;7(5):422-33. Sutherland G& Haan EA, Kremer E, Lynch M, Pritchard M, Yu S, Richards RI. Hereditary unstable DNA: a new explanation for some old genetic questions? Lancet 1991 Aug 3; 338 (87 62) :289 -92 Sutherland G& Richards RI. Simple tandem DNA repeats and human genetic disease. Proc Natl Acad Sci U S A 1,995 Apr 25;92(9):3636-41, Takano H, Cancel G, Ikeuchi T, Lorenzetti D, Mawad & Stevanin G, Didierjean O, Durr A, Oyake M, Shimohata T, Sasaki & Koide R, Igarashi S, Hayashi S, Takiyama Y, Nishizawa M, Tanaka H,ZoghbiH, Brice A, Tsuji S Close associations between prevalences of dominantþ inherited spinocerebellar ataxias with CAG-repeat expansions and frequencies of large normal CAG alleles in Japanese and Caucasian populations. Am J Hum Genet 1998 Oct;63(4):1060-6 Tanabe T, Takeshima H, Mikarri A, Flockerzi V Takahashi H, Kangawa K, Kojima M, Matsuo H, Hirose T, Numa S. Primary structure of the receptor for Calcium ctrannel blockers from skeletal muscle. Nature L987 328:313-318I Telenius H, Almqvist E, Kremer B, Spence N, Squitieri F, Nichol Ç Grandell U, Starr E, Benjamin C, Castaldo I, et al. Somatic mosaicism in sperm is associated with intergenerational (CAG). changes in Huntington disease. Hum Mol Genet Feb;4(2):189-95 (Published erratum appears in Hum MolGenet 1995 May;4(5):974 2r3 Terwindt GM, Ophoff RA, Haan ], Frants R& Ferrari MD. Familial hemiplegic migraine: a clinical comparison of families linked and unlinked to chromosome \9.DMGRG.Cephalalgia 1996 May;16(3) :153-5 Terwindt GIvl, Ophoff RA, Haan J, Vergouwe MN van Eijk R, Frants RfÇ Ferrara MD. Variable clinical expression of mutations in the P/Q-type calcium channel gene in familial hemiplegic migraine : Dutch Migraine Genetics Research Group Neurology '1998 50:1105-11.L0 Tomiwa K, Baraitser M and Wilson |. Dominantþ inherited congenital cerebell¡ar ataxia with atrophy of the vermis Paediatric Neurology 1987 3:360-362 Trottier Y,Lutz Y, Stevanin G, Imbert G, Devys D, Cancel G, Saudou F, Weber C, David G, Tora L, et al. Polygluta:nine expansion as a pathological epitope in Huntingtonrs disease and four dominant cerebell¡ar ataxias. Nature 1995a 378 403-406 Trottier Y, Devys D, Imbert G, Saudou F, An I,Llutz Y, Weber C, Agid Y Hirsch EC, Mandel jL. Cellular localization of the Huntington's disease protein and discrimination of the normal and mutated form. Nat Genet 1995 May;10(1):10a-10 Tyson J, TraneþaergL, Bellnran S, Wren Ç Taylor J, Bathen J, Aslaksen B, Sorland S], Lund O, Malcolm S, Pembrey M, BhattacharyaS, Bitner€lindziczM.IsK and KvLQTL: mutation in either of the two subunits of the slow component of the delayed rectifier potassium charurel can cause ]ervell and Lange-Nielsen syndrome Hum Molec Genet 1997 6L:2179-21.85 von Brederlow B, Hahn AF, Koopman WJ, Ebers GC, Bulman DE. Mapping the gene for acetazolamide responsive hereditary paryoxysmal cerebellar ataxia to chromosome L9p. Hum Mol Genet 1.995 F eb;4(2) :27 9 -8a Wadia N, Pang J, Desai J, Mankodi A, Desai M, Chamberlain S. A clinicogenetic analysis of six Indian spinocerebellar ataxia (SCA2) pedigrees. The significance of slow saccades in diagnosis. Brain 1998 Dec;I2T(Pt L2):2341'-55 Watanabe FI, Tanaka F, Matsumoto N4 Doyu M, Ando T, Mitsuma T, Sobue G' Frequenry analysis of autosomal dominant cerebellar ataxias in Japanese patients and clinical characterization of spinocerebellar ataxia type 6. Clin Genet 1998 Jan;53(1):13-9 W*g Q, Curren I\dE,, Splawski I, Burn TC, Millholland JM, VanRaay TJ, Shen J Timothy KW, Vincent Glvt de Jager T, Schwartz PJ, Towbin JA, Moss AJ Atkinson D, Landes GM, Connors TD and Keating MT. Positional cloning of a novel potassium charurel gøte: KVLQTL mutations cause cardiac arrhythmias. Nature Genet'J,996 12:17-23 214 W*g DG, FanJB, Siao CJ, Berno A, Young P, Sapolsky R, Ghandour G, Perkins N Winchester E, Spencer J, Kruglyak L, Stein L, Hsie L, Topaloglou T, Hubbell E, Robinson E, Mittmann M, Monis IvI, Shen N, I0burn D, Rioux j, Nusbauñ C, Rozen S, Hudson TJ, Lipshutz R, Chee M and Lander ES. Large scale identificatioru mapping and genofiring of single nucleotide polymorphisms in the human genome. Science 'l,,998 280:'I,,077-1,082 Wanen ST, Ashley CT Jr. Triplet repeat expansion mutations: the example of ftugil" X syndrome. Ann Rev Neurosci 1995 18:77-99 Warrick JM, Paulson HL, Gray-Board GL, Bui QT, Fischbeck KH, Pittman RN, Bonini NM. Expanded polyglutamine protein forms nuclear inclusions and causes neural degeneration in Drosophila. Cell 1 998 Jlun 12;93(6):939 -49 Weber JL and May PE. Abundant class of human DNA polymorphisms which can be typed using polymerase chain reaction Am I Hum Genet'1,989 44:388-96 Weeks DE, Ott ] and Lathrop GM slink: a general simulation program for linkage analysis Am I Hum Genet 47:4204 Wei MFI, Karavanova I, Ivanov SV Popescu NÇ Keck CL, Pack S, Eisen JA, Lerman MI. IÍr silico-initiated cloning and molecular characterization of a novel human member of the L1 gene family of neural cell adhesion molecules. Hum Genet L998 Sep;L03(3):355-64 Wells RD and Warren ST. Genetic instabilities and hereditary ner:rological diseases. Academic Press 1994 CahÍ.ornia. 'J"969 White JC. Familial periodic nystagmus, vertigo and ataxia. Arch Neurol 20: 276-280 White JK Auerbach W, Duyao MP, Vonsattel JP, Gusella JF, Jolmer AL, MacDonald ME. Huntingtin is required for neurogenesis and is not impaired by the Huntington's disease CAG expansion. Nat Genet 1997 Dec;17(4):40a-N \Mhite MB, Carvalho M, Derse D, O'Brien SJ and Dean M Detecting single base substitutions as heteroduplex substitutions. Genomic s 1992 1'2; 301-30 6. Whitty CWM Famiüal Herriplegic Migraine I Neurol Neurosurg Psychiatry 1986 16:I72-178 Worth PF, Giunti P, Gardner-Thorpe Ç Dixon PH, Davis MB and Wood NW 1999 Autosomal dominant cerebellar ataxia type III: Linkage in a large Britísh famiþ to a 7.6cl|l4 region on chromosome L5q1- 4-21.3 Am J Hum Genet 1999 Artg;65(2):A20-6 215 Worth, P. F.; Houlderu H.; Giunti, P.; Davis, M. B.; Wood" N. W. : Latge, expanded repeats in SCAS are not confined to patients with cerebell¡ar ataxia. (Letter) Nature Genet. 24:214-2L5. 2000. Wyman AR and White RA A highly polymorphic locus in human DNA Proc Natr Acad Sci U.S.A. 1980 77:6754-58 Yamada N. Makino Y, Clark RA, Pearson DW, Mattei MG, Guenet JL, Ohama E, Fujino L, Miyawaki, A, Furuichi T and Mikoshiba K. Human inositol L,4,5-triphosphate type-l receptor. InsP3Rl: structure, functiorU regul,ation of expression and chromosomal localisation. Biochem J 1994 302:781-790 Yamasaki I\4, Thompson Ð Lemmon V Neuropediatrics 1997 Jun;28(3):175-178 CRASH s¡mdrome: mutations inLlCAM correlate with severity of the disease. Yamamoto A, Lucas JI and HenR Reversal of neuropathy and motor dysfunction in a conditional model of Huntington's disease. Cell2000 March 31; TO'J':57-66 Yu S, Pritchard IvI, Kremer E, Lynch M, Nancarrow J, Baker E, Holman K, Mulley JC, Wanen ST, Sctrlessinger D, et al. Fragile X genotype characterized by an unstable region of DNA. Science 1991 May 24;252(501'O):1179-81' Yue Q, ]en ]C, Nelson SF, Baloh RW. Progressive ataxía due to a missense mutation in a calcium-channel gene. Am J Hum Genet 1997 61' (5):1078-1'087 Yue Q, ]en JC, Thwe MI\[ Nelson SF, Baloh RW. De nooo rtatation in CACNALA caused acetazolamide-responsive episodic ataxia. Am I Med Genet 1998 77(4):298-30'J' Zruchenko O, Bailey ], Bonnen P, Ashizawa T, Stockton DW, Amos C, Dobyns WB, Subramony S}J., Zoghbí FfY, Lee CC. Autosomal dominant cerebellar ataxia (SCA6) associated with small polyglutamine expansions in the aLA voltage-dependent calcium channel. Nature Genet 1997 1,5:62-69 Zoghbt FfY and Orr HT Polyglutamine diseases: protein cleavage and aggregation Current Opinion in Neurobioll999 9:566-570 ZrtL, Figueroa KR Grewal R, Pulst SM Mapping of a new autosomal dominant spinocerebellar ataxia to chromosorte22 Am J Hum Genet 1.999 Feb;64(2):59a-9 2t6 APPENDIX I Two point lod scores for microsatellite markers within the human genome (indicated by DXSA number -these numbers identify specific chromosome (X) and microsatellite marker (A)) and congenital ataxia family (PK80284). Microsatellite markers are on average 20 cm apart. Two point lod scores at 0 = MARKER O.O 0.01 0.05 0.1 0.2 0.3 0.4 D15468 -infinity -10.31 4.94 -2.81. -1.00 -0.25 0.03 D15214 -infinity -10.57 -5.55 -3.44 -L.52 -0.6,1, -0.16 D1S450 -infinity -4.14 -2.11. -1.30 -0.58 -0.24 -0.07 D152667 -infinity -7.05 -3.08 -1.57 -0.39 0.01 0.10 D152697 -infinity -6.32 -2.99 -\.69 -0.62 -0.20 -0.03 D1S199 -infinity -3.95 -1.36 -0.43 0.22 -0.34 0.25 D75234 -infinity -12.30 -6.68 -4.30 -2.10 -1.02 -0,40 D1S255 -infinity -3.21, -1.72 -1..16 -0.70 -0.37 -0.12 D152797 -infinity -6.75 -2.79 -1,.29 -0.13 0.24 0.24 D1S2890 -infinity -0.72 -0.49 0.84 0.93 0.74 0.42 D1S230 -infinity -5.50 -2.21, -0.97 -0.03 0.25 0.22 D1S2841 -infinity -3.29 -0.75 0.11 0.60 0.55 0.29 D15207 -infinity -1..59 0.25 0.81 1.00 0.77 0.39 '1,.24 D1S2868 7.99 1,.96 1.81 1..62 0.855 0.44 D15206 0.s2 -2.53 -0.60 0.10 0.55 0.57 0.38 D152726 -infinity -2.88 -0.35 0.51, 0.98 0.88 0.52 \ D15252 -infinity -6.36 -3.02 -1.72 -0.65 -0.22 -0.06 D15498 -infinity -5.17 -1.93 -0.74 0.10 0.28 0.20 D15484 -infinity -2.5L -0.37 0.38 0.78 0.69 0,38 D152878 -infinity -3.48 -0.93 -0.04 0.49 0.48 0.24 D15196 -infinity -3.53 -0.96 -0.06 0.50 0.50 0.25 D1S218 -infinity -6.83 -2.85 -1,.34 -0.18 0.17 0:1.6 D1S238 -infinity -8.57 -3.91 -2.09 -0.6't -0.04 0.11 D15413 -infinity -2.83 -0.89 -0.17 0.32 0.40 0.27 D15249 -infinity -4.90 -2.10 -1.03 -0.27 -0.05 0.02 D1S425 -infinity -6.97 -3.60 -2.24 -7.04 -0.47 -0.76 D13213 -infinity -8.7s -4.10 -2.31 -0.85 -0.30 -0.11 D152800 -infinity -2.90 -0.98 -0.30 0.16 0.24 0.17 2t7 D152785 -infinity -1L.16 -5.74 -3.56 -1,.64 -0.740 -0.27 D152842 -infinity -8.25 -3.62 -1.85 -0.46 0.01 0.09 D1S2836 -infinity -4.26 -'t.64 -0.66 0.07 0.26 0.20 D25319 -infinity -4.85 -'t.62 -0.45 0.34 0.48 0.33 D2S22IL -infinity -8.57 -3.91 -2.09 -0.61 -0.04 0.11 D251,62 -infinity -8.61 -3.94 -2.73 -0.64 -0.06 0.10 D2S305 -infinity -5.30 -2.61 -\.54 -0.63 -0.23 -0.05 D25165 -infinity -9.50 -4.74 -2.82 -1,.14 -0.40 -0.08 D25367 -infinity -6.33 -2.99 -1..68 -0.58 -0.13 0.04 D252259 -infinity -8.88 -4.18 -2.32 -0.75 -0.12 0.09 D25397 -infinity -10.73 -5.33 -3.16 -7.26 -0.42 -0.05 D25337 -infinity -9.M -4.34 -2.47 -0.88 -0.21 0.03 D252368 -infinity -4.94 -1,.67 -0.46 0.40 0.58 0.42 D25236 -infinity -0.63 -0.02 0.17 0.25 0.21 0.13 D252333 -infinity -4.06 -1,.46 -0.51 0.18 0.33 0.25 D252216 -infinity -8.47 -3.81 -2.01, -0.54 0.00 0.13 D25160 -infinity -10.97 -5.58 -3.42 -1.53 -0.64 -0.18 D25347 -infinity -5.97 -2.53 -1,.17 -0.07 0.29 0.28 D25112 -infinity -'t.73 -0.51 -0. 10 0.17 0.21, 0.14 D252313 -infinity -5.68 -2.38 -7.12 -0.14 0.17 0.17 D25142 -infinity -9.45 -4.73 -2.85 -1.20 -0.45 -0.09 D252330 -infinity -5.78 -2.49 -1,.25 -0.29 0.02 0.07 D2S335 -infinity -11.33 -5.89 -3.67 -1.68 -0.74 -0.24 D25364 -infinity -1-t.20 -5.77 -3.58 -'t.62 -0.70 -0.22 D2Sl17 -infinity -13.45 -7.30 -4.76 -2.4't -1.21 -0.48 D25325 -infinity -13.03 -6.90 -4.39 -2.11, -0.98 -0.35 D252382 -infinity -9.78 -5.01 -3.08 -1,.38 -0.58 -0.18 D25126 -infinity -7.76 -3.73 -2.14 -0.79 -0.22 0.00 D25396 -infinity -12.84 -6.74 4.26 -2.03 -0.93 -0.31 D25206 -infinity -7.13 -3.74 -2.37 -1,.14 -0.53 -0.18 D2S338 -infinity -1'l...75 -6.30 4.07 -2.04 -1.03 -0.43 D25125 -infinity -5.56 -2.29 -1.07 -0.15 0.11 0.72 D351297 -infinity 1..72 2.19 2.18 1.85 1.35 0.73 D3S1304 -infinity 2.78 3.1,6 3.05 2.45 1.64 0.74 D351263 -infinity -0.56 1.22 1,.71, 1,.73 1.30 0.67 D352338 -infinity 0.70 1.80 2.02 1.80 1.27 0.60 D351266 -infinity -0.56 1..22 1.71 't.73 1,.29 0.63 D351277 -infinity -13.32 -7.\8 4.65 -2.U -7.17 -0.47 218 D3S1289 -infinity -12.67 -6.97 -4.55 -2.26 -7.09 -0.40 D351300 -infinity -5.43 -2.78 -L.70 -0.67 -0.20 -0.01 D351285 -infinity -11.33 -5.9't -3.71 -1,.74 -0.79 -0.27 D3S1.566 -infinity -3.41, -'t.47 -0.76 -0.24 -0.04 0.02 D3S3681 -infinity -5.47 -2.18 -0.95 -0.01 0.26 0.23 D351271, -infinity -7.ß -3.50 -1,.97 -0.78 -0.40 -0.26 D351278 -infinity -3.55 -1.58 -0.83 -0.24 -0.03 0.03 D351267 -infinity -10.83 -5.44 -3.30 -1..M -0.62 -0.21 D351292 -infinity -8.12 -3.85 -2.\1 -0.66 -0.11 0.03 D3S1569 -infinity -11,.12 -5.71. -3.55 -1..66 -0.79 -0.30 D351279 -infinity -9.92 -5.6'1, -3.75 -1.98 -1.04 -0.43 D3S1614 -infinity -9.19 -4.5't -2.67 -1..13 -0.47 -0.1s D351565 -infinity -12.40 -6.31 -3.85 -1.68 -0.68 -0.19 D351262 1.09 1,.07 0.97 0.86 0.63 0.41 0.20 D3S1601 -infinity -11..63 -6.20 -3.98 -1.98 -0.97 -0.37 D45472 -infinity -12.64 -6.54 -4.08 -1.90 -0.88 -0.M D452935 -infinity -7.07 -3.65 -2.28 -1.11 -0.60 -0.30 D45403 -infinity -3.37 -1,.4't -0.68 -0.12 0.06 0.08 D4S419 -infinity -6.38 -2.84 -1.45 -0.37 -0.05 0.01 D4S391 -infínity -10.97 -s.52 -3.33 -1..4'1. -0.58 -0.19 D4S405 -infinity -8.57 -3.93 -2.14 -0.70 -0.16 0.00 D457592 -infinity -0.9-t 0.23 0.49 0.39 0.13 -0.01 D45392 -infinity -3.93 -2.03 -1.35 -0.76 -0.39 -0.16 D452964 -infinity -9.12 -4.4-t -2.5s -0.99 -0.36 -0.14 D4S1534 -infinity -2.27 -0.99 -0.56 -0.39 -0.45 -0.32 D43+:14 -infinity -10.99 -6.17 -4.15 -2.23 -1,.19 -0.51 D451572 -infinity -17.11. -9.56 -6.41. -3.41. -1..n -0.71 D45406 -infinity -10.34 -5.56 -3.58 -1.76 -0.84 -0.30 D45/.02 -infinity -\4.56 -7.76 -5.00 -2.50 --t.27 -0.52 D451575 -infinity -5.65 -2.39 -1.18 -0.30 -0.07 -0.05 D4v24 -infinity -11.06 -6.22 -4.19 -2.2s -1.\9 -0.49 D45413 -infinity -6.36 -2.98 -7.63 -0.52 -0.12 0.00 D451597 -infinity -3.54 -1.53 -0.67 0.05 0.23 0.16 D4S1539 -infinity -3.60 -7.62 -0.86 -0.26 -0.04 0.03 D4S415 -infinity -9.38 -4,65 -2.76 -1.11 -0.38 -0,06 D451535 -infinity -5.74 -2.45 -1.2L -0.27 0.01 0.04 D45426 -infinity -10.70 -5.29 -3.11 -1.22 -0.39 -0.04 D5S1981 -infinity -2.45 -1,.1,4 4.64 -0.25 -0.10 -0.04 2r9 D55406 -infinity -5.71 -2.U -L.06 -0.09 0.15 0.11 D5S630 -infinity -7.66 -3.49 -1.84 -0.50 -0,03 0.07 D55416 -infinity -1.53 -0.27 0.16 0.41, 0.39 0.25 D5919 -infinity 4.51 -1.9'1, -0.96 -0.26 -0.03 0.03 DsS4.26 -infinity -5.58 -2.31, -1.10 -0.21 0.02 -0.0L D5S418 -infinity -5.73 -2,47 -L.25 -0.33 -0.05 -0.01 D5907 -infinity -8.89 -4.67 -2.91 -1.32 -0.60 -0.24 D55647 -infinity -9.12 4.39 -2.51 -0.91 -0.25 0.00 D55424 -infinity -5.94 -2.64 -1.39 -0.42 -0.09 -0.03 D55641 -infinity -7.04 -3.68 -2.33 -1..14 -0.57 -0.23 D55428 -infinity -7.61 -3.62 -2.07 -0.80 -0.30 -0.11 DsS644 -infinity -7.69 -0.51 -0.17 0.05 0.11 0.06 D55433 -infinity -10.64 4.89 -2.80 -1.06 -0.36 -0.09 D552027 -infinity 4.21. -1.60 -0.63 0.07 0.25 0.19 D552115 -infinity -4.34 -1..77 -0.85 -0.23 -0.10 -0.09 D55436 -infinity -12.M -6.35 -3.90 -1.74 -0.74 -0.24 D5S410 -infinity -10.90 -5.49 -3.32 -1.42 -0.56 -0.15 D5s422 -infinity -5.08 -2.41 -'t.37 -0.50 -0.14 0.00 D55400" -infinity 0.0 0.0 0.0 0.0 0.0 0.0 D5S408 -infinity -7.U -3.35 -1.80 -0.54 -0.06 0.08 D657574 -infinity -10.89 -5.48 -3.32 -7.42 -0.56 -0.16 D65309 -infinity -7.81 -3.78 -2.18 -0.82 -0.25 -0.02 D6v70 -infinity -7.87 -3.87 -2.31, -1.01 -0.48 -0.22 D65289 -infinity -11.33 -5.90 -3.69 -1.71 -0.76 -0.25 D65422 -infinity -LL.04 -5.64 -3.48 -1.58 -0.69 -0.22 D65276 -infinity -12.29 -6.21 -3.76 -1.61 -0.64 -0.17 D651610 -infinity -8.54 -3.89 -2.10 -0.66 -0.15 -0.02 D65257 -infinity -8.30 -3.65 -1.85 -0.41 0.10 0.18 D65/.60 -infinity -7.69 -3.45 -1..76 -0.39 0.07 0.15 D6s4.62 -infinity 4.19 -1..89 -0.97 -0.27 -0.06 -0.05 D65434 -infinity -12.86 -6.73 4.23 -7.96 -0.86 -0.27 D65287 -infinity -72.56 -6.46 -4.01. -1.83 -0.82 -0.29 D65262 -infinity -9.7s -s.00 -3.07 -1.35 -0.54 -0.14 D65292 -infinity -12.76 -6,63 -4.13 -'1..87 -0.78 -0.22 D63471 -infinity -11,.71, -5,74 -3.55 -1.59 -0.67 -0.20 D65308 0.58 0.61, 0.64 0.56 0.27 0.00 -0.07 D6941. -infinity -L2.85 -6.72 4.22 -1.94 -0.84 -0.26 D651581 0.54 0.53 0.47 0.40 0.27 -0.1.6 0.08 220 D65264 -infinity -0.34 0.25 0.41 0.44 0.33 0.18 D65446 -infinity 4.65 -2.00 -0.98 -0.16 0.12 0.15 D65281 -infinity -5.25 -2.56 -L.49 -0.57 -0.77 -0.01 D7S531 -infinity -7.36 -3.33 -'1..74 -0.43 0.06 0.'t6 D75517 -infinity -5.01 -1..79 -0.64 0.16 0.35 0.27 D75513 -infinity -6.63 -3.28 -1.95 -0.82 -0.32 -0.08 D75507 -infinity -12.86 -6.76 -4.30 -2.09 -1.00 -0.38 D734.93 -infinity -72.86 -6.74 -4.26 -2.03 -0.96 -0.36 D75576 -infinity -8.87 -4.21 -2.39 -0.90 -0.31 -0.07 D7S484 -irrfir,ity -1..98 -0.69 -0.23 0.09 0.1,6 0.12 D7S510 -infinity -5.05 -1..n -0.55 0.32 0.50 0.36 D75519 -infinity -2.U -0.9't -0.22 0.25 0.33 0.23 D75502 -infinity 4.93 -1.68 -0.49 0.34 0.49 0.33 D75669 -infinity -7.17 -3.19 -1.65 -0.43 -0.01 0.08 D75630 -infinity -4.32 -1..67 -0.68 0.07 0.26 0.21 D75657 -infiniW -7.20 -3.22 -1.68 -0.M 0.01 0.12 D75515 -infinity -8.86 4.16 -2.31 -0.74 -0.11 0.10 D75486 -infinity -10.15 -5.21. -3.15 -1.30 -0.46 -0.08 D75530 -infinity -6.52 -3.15 -1.81 -0.65 -0.16 0.02 D75640 -infinity -10.62 -4.88 -2.75 -0.93 -0.18 0.08 D75684 -infinity -1'1..27 -5.86 -3.68 -1,.73 -0.79 -0.26 D75667 -infinity -2.67 -'t.33 -0.79 -0.32 -0.11 -0.02 D75636 -infinity -9.75 -s.00 -3.07 -1.35 -0.54 -0.14 D75798 -infinity -11.15 -5.72 -3.52 -1.55 -0.62 -0.16 D752465 -infinity -6.24 -2.92 -1,.64 -0.60 -0.20 -0.04 D85264 -infinity -6.43 -2.51, -1.06 -0.01 0.25 0.19 D85277 -infinity -3.83 -7.24 -0.31 0.31 0.39 0.26 D8S550 -infinity -4.95 -2.29 -1,.26 -0.43 -0.74 -0.05 D85549 -infinity -2.01 -0.77 -0.30 0.10 0.21. 0.16 D85258 -infinity -2.2't -0.35 0.25 0.55 0.48 0.28 D8S1n1 -infinity -0.68 0.50 0.83 0.87 0.65 0.34 D85505 -infinity 0.54 1..66 't.90 '1,.74 1.26 0.65 D85285 -infinity 4.59 -2.03 -0.92 -0.06 0.17 0.12 D85260 -infinity -6.80 -2.82 -1.30 -0.11 0.27 0.27 D85270 -infinity -6.43 -2.52 -7.07 -0.02 0.26 0.22 D8S1784 -infinity -3.88 -7.25 -0.27 0.38 0.45 0.27 D85514 -infinity -3.44 -1,.46 -0.72 -0.74 0.06 0.09 D8S2B4 -infinity -7.41 -3,33 -1.73 -0.42 0.06 0.17 22r D85272 -infinity -7.42 -3.79 -2.18 -0.81 -0.22 0.01 D95288 -infinity -9.69 -4.94 -3.02 -1.30 -0.51 -0.12 D9S286 -infinity -14.85 -8.00 -5.17 -2.55 -t.21, -0.43 D95285 -infinity -2.18 -0.87 -0.38 0.00 0.11 0.09 D95157 -infinity -11..n -6.32 -4.09 -2.04 -1.00 -0.38 D95171. -infinity -14.55 -7.72 -4.92 -2.U -1.06 -0.35 D9S161 -infinity -9.24 -5.14 -3,45 --t.87 ,1..02 -0.44 D9S1817 -infinity -12.s6 -6.46 -4.00 -1.81. -0.78 -0.24 D95273 -infinity -1.86 -4.18 -2.35 -0.81 -0.19 0.03 D95175 -infinity -7.6'1. -3.66 -2.76 -0.95 -0.43 -0.16 D95767 -infinity -10.35 -5.58 -3.62 -1.83 -0.92 -0.36 D95283 -infinity -8.98 -4.30 -2.48 -0.96 -0.35 -0.10 D%287 -infinity -8.65 -3.99 -2.19 -0.72 -0.18 -0.01 D9S1690 -infinity -8.74 -4.06 -2.23 -0.73 -0.17 -0.02 D951677 -infinity -9.05 4.38 -2.56 -1.05 -0.40 -0.11 D951776 -infinity -10.38 -5.02 -2.92 -1.15 -0.43 -0.12 D951682 -infinity -4.M -2.39 -1.55 -0.78 -0.39 -0.15 D95290 -infinity -8.63 -3.95 -2.12 -0.60 -0.01 0.15 D95164 -infinity -14.55 -7.72 4.92 -2.34 -1.06 -0.35 D%7826 -2.97 -0.75 -0.1,4 0.06 0.15 0.72 0.06 D95158 -infinity -3.83 -1.85 -1.09 -0.45 -0.18 -0.05 D105249 -infinity -8.98 -4.30 -2.48 -0.96 -0.35 -0.10 D10S591 -infinity -5.6't -2.76 -0.84 0.13 0.33 0.20 Dl05189 -infinity -11..32 -5.88 -3.66 -1.65 -0.69 -0.20 D105547 -infinity 0.13 0.60 0.61 0.35 0.13 0.09 D10S1653 -infinity -4.83 -2.19 -1..17 -0.35 -0.0s 0.04 D10S548 't.99 1,.96 1.81 1.62 't.24 0.85 0.44 D\0s197 -infinity -10.41, -5.03 -2.90 -1.08 -0.31 -0.01 D103208 -infinity -4.91. -2.22 -1.11 -0.23 0.06 0.10 D103196 -infinity -2.75 -1.04 -0.35 0.15 0.25 0.77 D10S1652 -infinity -10.74 -5.36 -3.22 -1,.37 -0.55 -0.15 D105537 -infinity -5.15 -1.89 -0.70 0.16 0.37 0.29 D10S1686 -infinity -s.60 -2.35 -L.14 -0.21, 0.12 0.17 D105185 -infinity -8.35 4.28 -2.63 -7.1,6 -0.47 -0.12 D105192 -infinity -9.'t6 -4.44 -2.56 -0.94 -0.25 0.02 D105597 -infinity -7.88 -4,42 -2.97 -'t.57 -0.82 -0.33 D10S1-693 -infinity -10.86 -5.44 -3.26 -1.34 -0.47 -0.08 Dl05587 -infinity -12.33 -6.66 -4.28 -2.07 -0.97 -0.34 222 D105217 -infinity -7.05 -3.09 -1.58 -0.40 -0,02 0.05 D10S1651 -infinity -8.08 -4.04 -2.43 -1.03 -0.41 -0.12 D105212 -infinity -0.93 -0.30 -0.09 0.05 0.07 0.05 D1154046 -infinity -18.19 -9.95 -6.53 -3.32 -1.65 -0.63 D1151338 -infinity 4.95 -2.30 -"t.28 -0.46 -0.16 -0.07 D115902 -infinity -L3,15 -7.00 -4.47 -2.15 -0.99 -0.33 D115904 -infinity -8.84 -4.18 -2.36 -0.86 -0.26 -0.02 D11S935 -infinity -8.62 -4.56 -2.97 -1,.42 -0.67 -0.23 D115905 -infinity -7.67 -3.65 -2.06 -0.71. -0.16 0.03 D1154191 -infinity -6.87 -2.97 -1.40 -0.23 0.1L 0.08 D115987 -infinity -3.56 -1.00 -0.10 0.47 0.49 0.24 D1151314 -infinity -2.57 -0.65 0.02 0.43 0.41 0.2L D115937 -infinity -6,85 -2.90 -1.40 -0.26 0.09 0.09 D11S901 -infinity -5.54 -2.25 -L.00 -0.05 0.24 0.21 D11S4175 -infinity -6.88 -2.93 -7.43 -0.27 0.13 0.18 D115898 -infinity -10.56 -5.19 -3.01 -1.14 -0.33 0.00 D115908 -infinity -5.28 -2.s9 -1,.52 -0.59 -0.19 -0.02 D115925 -infinity -10.73 -5.33 -3.76 -1,.26 -0.42 -0.05 D1154151 -infinity -7.03 -3.05 -1..52 -0.30 0.1L 0.17 D1151320 -infinity -6.37 -3.01 -1.68 -0.56 -0.09 0.06 D11596,8 -infinity -4.95 -2.28 -'t.23 -0.36 -0.02 0.07 D125352 -infinity 4.04 -1,.47 -0.s5 0.07 0.21, 0.16 D125299 -infinity -2.98 -0.48 0.34 0.74 0.61 0.33 D125336 -infinity -3.15 -0.64 0.19 0.62 0.54 0.31 D125364 -infinity 4.11, -1.50 -0.53 0.17 0.31 0,22 D12S310 -infinity -2.50 -1.20 -0.71, -0.32 -0.16 -0.07 D7251.617 -infinity -7.46 -3.46 -1.90 -0.62 -0.11 0.05 D125345 -infinity -13.53 -7.86 -5.40 -2.96 -1.59 -0.66 D12S85 -infinity -2.24 --0.94 -0.46 -0.11 -0.01 0.02 D12S368 -infinity -7.12 -3.79 -2.42 -1,.1,4 -0.49 -0.15 D12583 -infinity -9.02 -4.35 -2.54 -1.03 -0.41 -0.13 D1Æ326 -infinity -6.22 -3.31 -2.08 -0.95 -0.40 -0.12 D12S351 -infinity -10.74 -5.34 -3.17 -1,.28 -0.43 -0.06 D1?5346 -infinity -11,.48 -5.87 -3.55 -1.50 -0.58 -0.17 D72578 -infinity -13.12 -6.W 4.48 -2.77 -1.01 -0.35 D12579 -infinity -12.97 -6.86 -4.38 -2.13 -1.01 -0.36 D12586 -infinity -1't.13 -5.73 -3.57 -'t.67 -0.78 -0.29 D125324 -infinity -11.48 -6.04 -3.83 -1.83 -0.86 -0.31 223 D1251659 -infinity -6.45 -2.52 -1.04 0.04 0.31 0.22 D1251723 -infinity -6.56 -2.64 -1.18 -0.11 0:t6 0.12 D133175 3.10 3.04 2.81. 2.51 1.88 1,.19 0.49 D13S2L7 -infinity -2.74 -1..39 -0.86 -0.38 -0.16 -0.05 D735171. -infinity -5.22 -2.55 -1..49 -0.s9 -0.20 -0.02 D135218 -infinity 4.97 -2.36 -1.40 -0.64 -0,33 -0.13 D135263 -infinity -71,.16 -s.74 -3.56 -7.64 --0.74 -0.27 D135153 -infinity -10.s6 -5.18 -3.05 -1,.21, -0.4L -0.06 D13S156 -infinity -3.87 -1.83 -1.01 -0.32 --0.05 0.04 D135170 -infinity -10.57 -5.21. -3.09 -1.30 -0.53 -0.17 D135265 -infinity -11..75 -6.30 -4.07 -2.02 -4.99 -0.38 D13S159 -infir.ity -12.56 -6.44 -3.96 -'t.74 --0.69 -0.18 D133158 -infinity -14.13 -7.75 -5.04 -2.49 --1.18 -0.42 D135173 -infinity -5.99 -3.26 -2.14 -1.10 -4.55 -0,21. D1351265 -infinity -11.15 -5.74 -3.58 -7.66 -0.75 -0.25 D135285 -infit ity -8.62 -4.55 -2.91 -1.42 -0.68 -0.26 D1.45261 -infinity -4.07 -1.55 -0.68 -0.13 -0,03 -0.04 D145283 -infinity -8.83 4.17 -2.36 -0.90 -0.35 -0.17 D145275 -infinity -10.86 -5.49 -3.35 -1.50 --0.69 -0.27 D14570 -infinity -13.40 -7.23 -4.68 -2.34 -1.15 -0.43 D145288 -infinity -13.58 -7.39 -4.83 -2.45 -'t.22 -0.48 Dl4S276 -infinity -11.43 -6.01 -3.82 -1.85 -0.88 --0.32 D14S63 -infinity -7.25 -3.85 -2.46 -1.20 --0.s7 -0.20 D145258 -infinity -4.83 -2.80 -1.86 -0.87 -0.37 -0.11 D1.4574 -infinity -6.23 -3.50 -2.35 -'t.26 --0.66 -0.27 D14S68* -infinity 0.0 0.0 0.0 0.0 0.0 0.0 D14S280 -infinity -7.10 -3.72 -2.36 -.15 -0.55 -0.21, D14S65 -infinity -6.91, -3.47 -2.08 -0.89 -0.37 -0.11 D14S985 -infinity -\6.98 -9.M -6.30 -3.30 -1.68 -0.65 D145292 -infinity -3.74 -1,18 -0.26 0.33 0.41 0.27 D15S128 -infinity -11.03 -5.60 -3.41 -1.45 -0.55 -0.12 D15S1002 -infinity -9.33 -4.61, -2.72 -1..07 -0.34 -0.03 D15S165 -infinity -11.75 -6.21, -3.91, -1.83 -0.83 -0.30 D15S1007 -infinity -8.86 4.18 -2.35 -0.81 -0.19 -0.03 D1551012 -infinity -5.78 -2.46 -1,.17 -0.15 0.20 0.22 D155994 -infinity -8.57 -3.89 -2.06 -0.55 0.03 0.16 D155978 -infinity --6.35 -3.00 -1.68 -0.56 -0.10 0.05 D15S117 -infinity -7.16 -3.16 -1.61 -0.34 0.12 0.19 224 D155153 -infinity -4.40 -1.75 -0.74 0.04 -0.26 0.22 D15S131 -infinity -8.25 -3.62 -1.85 -0.45 0.03 0,1.4 D155205 -infinity 4.99 -1,.75 -0.59 0.20 0.33 0.19 D155127 -infinity 4.88 -'1..65 --0.49 0.30 .40 0.19 D155130 -infinity -4.76 -2.31" -1.35 -0.58 -0.25 -0.08 D15S120 -infinity -5.44 -2.21. -1.04 -0.19 0.05 0.08 D]65423 -infinity -3.08 -0.55 0.30 0.76 0.67 0.34 D16S404 -infinity -0.68 0.51 0.85 0.89 0.64 0.27 D1653075 -infinity -3.43 -1..54 -0.82 -0.18 0.07 0.1L D1653103 -infinity 0.38 0.88 0.93 0.71 0,39 0.15 D1653046 -infinity -2.72 -0.80 -0.13 0.29 0.32 0.20 D1653068 -infinity -4.14 -1".55 -0.61 0.03 0.15 0.07 D1653136 -infinity -6.87 -2.93 -'t.44 -0.30 0.06 0.10 D165415 -infinity -3.52 -1,.27 -0.39 0.23 0.33 0.20 D165503 -infinity -7.44 -3.48 -1..97 -0.79 -0.34 -0.13 D165515 -infinity -12.56 -6.49 -4.05 -1.90 -0.90 -0.35 Dl65516 -infinity -1.98 -0.47 0.11 0.44 0.38 0.17 D16S3091 -infinity -6.04 -3.27 -2.11 -1.05 -0.51 -0.L9 D165520 -infinity -9.20 4.47 -2.58 -0.97 -0.30 -0.04 D175849 -infinity -1.76 0.09 0.69 0.95 0.80 0,47 D175831 -infinity -7.04 -3.07 -1.55 -0.33 0.09 0,'L6 D175938 -infinity -8.32 -3.66 -1.86 -0.40 0.12 0.20 D1751852 -infinity -8.84 -4.17 -2.35 -0.84 -0.22 0.02 D175799 -infinity -5.74 -2.47 -1.24 -0.30 0.02 0.08 Dt75921, -infinity -11.33 -5.90 -3.69 -L.70 -0.74 -0.23 D1751857 -infinity -7.76 -J./ J -2.13 -0.77 -0.19 0.02 D175798 -infinity -7.64 -3.65 -2.10 -0.83 -0.30 -0.07 D17S1868 -infinity -9.86 -4.9't -2.89 -1.17 -0.45 -0.13 D175787 -infinity -10.91, -5.51 -3.34 -1.45 -0.60 -0.19 D175944 -infinity 4.68 -2.13 -1.23 -0.64 -0.41 -0.17 D175949 -infinity -7.74 -3.73 -2.16 -0.85 -0.28 -0.04 D775785 -infinity -6.92 -3.55 -2.19 -0.99 -0.42 -0.12 D175784 -infinity -7.61 -3.59 -2.03 -0.76 -0.28 -0.12 Dt73928 -infinity -10.64 -4.89 -2.80 -1.06 -0.37 -0.14 D18S59 -infinity -11.88 -6.39 4.73 -2.05 -1.00 -0.37 D18563 -infinity -8.35 -4.30 -2.67 -1,.23 -0.55 -0.79 D185452 -infiníty -14.85 -8.00 -5.17 -2.55 -'1,.21 -0.43 D185464 -infinity -6.04 -3.32 -2.20 -1,.16 -0.61 -0.25 225 D18S53 -infinity -6.75 -3.97 -2.8'1, -1.66 -0.91 -0.36 D18978 -infinity -11_.97 -6.36 -4.03 -1..93 -0,92 -0.35 D18S1102 -infinity -5.73 -3.02 -1,.93 --0.94 -0.45 -0.17 D78974 -infinity -10.82 -5.43 -3.27 -1.39 -0.55 -0.14 D18S64 -infinity -7.21 -3.22 -'t.67 -0.43 -0.01 0.06 D18568 -infinity -10.59 -5.21 -3,06 -1".23 -0.M -0.11 D18S61 -infinity -7.44 -3.45 -1.91, -0.67 -0.20 -0.04 D1851161 -infinity -0.93 -0.30 -0.09 0.05 0,07 0.05 D18962 -infinity -15.03 -8.17 -5.33 -2.69 -1,.32 -0.49 D18S70 -infinity -12.84 -6.75 -4.30 -2.11 -1.04 -0.40 D19S406 -infinity -0.53 0.10 0.30 0.40 0.35 0.21, D1%226 -infinity -2.70 -1.40 -0.76 -0.25 -0.10 -0.08 D195242 -infinity -7.82 -3.n -2.75 -0.75 -0.1,6 0.05 D19912 -infinity -9.26 -4.53 -2.63 -0.98 -0.26 0.02 D19S418 -infinity -7.54 -3.90 -2.37 -1.02 -0.42 -0.13 D19S413 -infinity -3.90 -1.90 -1.06 -0.28 0.06 0.13 D20S104 -infinity -9.90 -5.72 -3.94 -2.18 -1.18 -0.50 D205171 -infinity -2.80 -'t.44 -0.89 -0.39 -0.15 -0.04 D205120 -infinity -10.07 -5.88 -4.07 -2.28 -1.25 -0.53 D20St07 0.L6 0.29 0.51 0.60 0.55 0.37 0.13 D20S189 -infinity -4.20 -1.60 -0.60 -0.10 0.26 0.24 D205717 -infinity -7.53 -3.51 -1,.94 -0.62 -0.10 0.07 D20S109 -infinity -3.11 -7.76 -1.18 -0.58 -0.24 0.06 D225303 -infinity -2.88 -1..37 -0.73 -0.21, -0.06 -0.05 D225315 -infinity 4.26 -1.55 -0.50 0.26 0.40 0.24 D22920 -infinity -2.99 -1.35 -0.65 -0.07 0.13 0.13 D225274 -infinity -2.45 -0.92 -0.31 0.72 0.20 0.14 D225275 -infinity -1.38 -0.57 -0.25 -0.06 -0.06 -0.1, 226 APPENDIX II Two point lod scores for microsatellite markers within the human genome (indicated by DXSA number -these numbers identify specific chromosome (X) and microsatellite marker (A)) and spinocerebellar ataxia family (PK80237). Microsatellite markers are on average 20 cm apart. The following lod scores are based on the initial pedigree (all individuals). Unaffected individuals are assigned penetrance values (liability classes) to compensate for possible presymptomatic carriers (see chapter 5.2.3.2). Two point lod scores at 0 = MARKER O.OO 0.01 0.05 0.1 0.2 0.3 0.4 DlS160 -8.06 -3.68 -2.1,4 -1.40 -0.46 -0.24 -0.05 D15170 -10.63 -4.92 -2.88 -L.87 -0.83 -0.32 -0.07 D75234 -10.82 4.76 -2.67 -1.65 -0.6,5 -0,2't -0.04 Dts1,64 -9.056 4.07 -2,12 -1.20 -0.37 -0.06 0.01 D15236 -2.32 0.49 7.07 7.20 1.10 0.78 0.33 D15430 -9.41. -3.32 -1.74 -0.87 -0.15 0.05 0.04 D15104 -11,.33 -5.21, -3.03 -1,.93 -0.82 -0.30 -0,06 D15243 -11.05 -4.55 -2.75 -1.80 -0.80 -0.30 -0.06 D1.5102 -5.25 -2.89 -2.05 -7.44 -0.68 -0.27 -0.06, AMY2B 4.49 -1.5L -0.61 -0.17 0.L9 0.23 0.10 D1S245 -8.73 -3.28 -1,.72 -1.00 -0.35 -0.09 -0.01 D15303 -5.05 -2.49 -1.58 -1.07 -0.50 -0.20 -0.04 D1S103 -9.43 4.18 -2.6L -1.83 -0.94 -0.41, -0.10 D1S235 -8.89 -3.43 -'t.86 -7.12 -0.42 -0.12 -0.01 D13431 -6.72 -3.33 -1,.97 -1..26 -0.54 -0.19 -0.04 D1s/73 -0.63 0.33 1,.49 1.78 1.65 1.19 0.47 D15252 -7.76 -2.66 -1.31 -0.77 -0.31 -0.11 -0.02 D15498 -3.89 -1.11. -0.46 -0.21, -0.04 0.01 0.01 D15484 -7.95 -2.60 -1.27 -0.74 -0.30 -0.11 -0.02 D152878 -0.19 -0.20 -0.22 -0.21, -0.14 -0.06 -0.01 D1S196 -3.87 -1..11. -0.46 -0.22 -0.04 0.01 0.01 D1S2836 -3.43 -0.78 -0.17 0.01 0.08 0.05 0.01 D25319 0.42 0.60 0.90 1.00 0.92 0.66 0.27 D25162 4;t4 -1,.36 -0.48 -0.11 0.13 0.13 0.05 D2S168 -5.15 -0.18 0.43 0.59 0.56 0.34 0.09 D25177 -15.41, -7.17 4.4',t -2.93 -1.37 -0.55 -0.13 D25123 -'t4.49 -6.32 -3.58 -2.22 -0.94 -0.35 -0.08 D25380 -9.18 -3.79 -2.1,6 -1,.37 -0.59 -0.21, -0.04 D25145 -8.28 -3.76 -2.18 -'t.43 -0.65 -0.26 -0.06 227 D25713 -7.93 -3.42 -0.88 0,01 0.52 0.45 0.76 D2572L -9.98 -4.58 -2.83 -1.9't -0.92 -0.38 -0.09 D25114 -9.30 -4.33 -2.64 -1.73 -0.77 -0.30 -0.07 D?5141 -0.31 -0.27 -0.13 0.02 0.09 0.09 0.04 D25124 -4.81 -3.83 -2.40 -1.70 -0.86 -0.35 -0.08 D2S111 -9.18 -3.43 -1,.52 -0.69 -0.05 0.11 0.06 D25152 -7.43 -1.58 -0.17 0.38 0.71. 0.63 0.30 D25155 -9.51, -4.05 -2.42 -1.60 -0.75 -0.30 -0.07 D2S159 -9.28 4.74 -2.58 -7.6t -0.71, -0.28 -0,07 Dß206 -13.83 -6.45 -3.50 -2.17 -0.93 -0.36 -0.09 D2S140 -8.51 -3.-t4 -1,.72 -1.10 -0.50 -0.20 -0.05 D25126 -7.03 -3.51 -1.54 -0.71 -0.05 0.13 0.08 D3S1304 -2.32 -2.21, -L.81. -1..39 -0.67 -0.22 -0.04 D351263 -1,.9't 0.77 1.38 1,.52 1.3B 0.95 0.35 D3S1286 -3.59 -0.86 -0.05 0.30 0.50 0.39 0.14 D351277 -13.05 -5.60 -3.24 -2.10 -0.96 -0.38 -0.09 D351289 -7.08 -4.42 -2.54 -1.71 -0.89 -0.39 -0.10 D351372 -4.58 -1.85 -1,.06 -0.69 -0.31 -0.12 -0.03 D3S1300 -10.33 -6.47 -3.77 -2.42 -1.09 -0.42 -0.10 D351261, -8.31 -2.54 -0.97 -0.30 0.20 0.26 0.12 D351274 -5.11 -2.0s -L.15 -0.68 -0.23 -0.04 0.01 D351271, -8.65 -3.28 -"t.78 -1.08 -0.42 -0.13 -0.02 D351278 -9.78 4.02 -2.32 -'t.46 -0.58 -0.17 -0.02 D351292 -5.32 -2.52 -1.53 -1.01 -0.47 -0.19 -0.04 D351279 -7.76 -2.41, --t.04 -0.50 -0.08 0.04 0.02 D351282 -7.85 -2.16 -0.76 -0.19 0.22 0.25 0.11 D351262 4.13 -1.35 -0.48 -0.11 0.13 0.13 0.05 D3S1311 -7.90 -3.76 -2.18 -'t.4't -0.63 -0.24 -0.05 D451614 -4.73 -2.13 -1,.28 -0.85 -0.40 -0.16 -0.04 D43412 -7.98 -2.53 -0.91, -0.21, 0.26 0.33 0.15 D454.32 -6.87 -3.99 -2.69 -1.85 -0.86 -0.33 -0.07 D45394 -10.92 -5.36 -3.26 -2.09 -0.91, -0.34 -0.07 D4S1599 -3.90 -2.98 -7.94 -1..02 -0.9't -0.35 -0.10 D4S391 -1,.07 -0.99 -0.72 -0.47 -0.16 -0.02 0.01 D45428 -4.91. -1.83 -0.88 -0.38 0.06 0.16 0.08 D45392 -6.35 -5.94 -4.54 -3.95 -2.65 -1..94 -0.82 D4s423 -9.68 -6.13 -3.72 -2.48 -7.17 -0.47 -0.11 D4S1613 -0.72 -0.70 -0.56 -0.47 -0.26 -0.11 -0.03 228 D43427 -9.29 -5.L6 -3.02 -7.99 -0.95 -0.39 -0.10 D43420 -5.87 -3.05 -'t.95 -t.29 -0.57 -0.21 -0.05 D4S1585 -12.68 -2.96 -1,.39 -0.67 -0.04 0.13 0.08 D4S1595 4.34 -1,.62 -0.84 -0.47 -0.12 0.00 0.01 D4S1554 -14.53 -6.00 -3.49 -2.24 -0.99 -0.37 -0.08 D4S4.26 4.77 -2.01. -"t.12 -0.67 -0.24 -0.06 -0.01 D55392 -2.38 -1.95 -'1.23 -0.90 -0.40 -0.2't, -0.1.0 D55678 --6.98 -5.23 -3.26 -'t.65 -0.90 -0.13 0.00 D5S630 -1,6.22 -7.42 -3.90 -2.37 -0.98 -0.35 -0.07 DsS635 0.13 0.L3 0.L4 0.t4 0.10 0.05 0.01 D55502 -5.68 4.23 -3.52 -2.0'1, -0.92 -0.31 -0.06 Dss431 -8.91 -3.49 -2.00 -1",31 -0.62 -0.27 -0.07 D55424 -infinity 4.72 -2.47 -1..47 -0.56 -0.79 -0.04 D5S401 -14.50 -5.45 -2.68 -1.55 -0.60 -0.22 -0.05 DsS644 4.15 -1,48 -0.78 -0.49 -0.20 -0.07 -0.01 D592L -9.54 -2.77 -0.78 -0.09 0.32 0.30 0.12 Dss500 -20.47 -5.70 -3.17 -1.95 -0.78 -0.26 -0.04 D5S410 -14.34 -5.53 -3.22 -2.12 -0.99 -0.40 -0.10 D5S400 -7.81, -2.09 -0.66 -0.07 0.33 0.33 0.13 D55408 1,.34 1.33 1.30 1.23 1.00 0.68 0.27 D65344 -5.73 -2.96 -1.98 -1.35 -0.60 -0.23 -0.05 D65309 -12.80 -6.4't_ -3.78 -2.45 -1.10 -0.43 -0.1,0 D65289 -15.06 -6.53 -3.87 -2.5'1, -1,.12 -0.43 -0.10 D65291, -2.76 -2.64 -1.88 -1.26 -0.58 -0.23 -0.05 D65273 -12.92 -5.57 -3.16 -2.00 -0.84 -0.30 -0.06 D65452 -8.36 -3.05 -1.58 -0.93 -0.35 -0.11 -0.02 D65257 -12.46 -5.69 -3.38 -2.27 -1.09 -0.45 -0.11 D65275 -4.32 -1.60 -0.84 -0.50 -0.20 -0.07 -0.02 D6v62 -7.93 -2.87 -'1.43 -0.81 -0.24 -0.02 0.01 D65268 -7.85 -4.76 -3.07 -2.14 -1.07 -0.44 -0.10 D65292 -5.04 -3.25 -2.25 -1.62 -0.82 -0.35 -0.08 D6S311 -7.81, -5.08 -3.69 -2.32 -0.94 -0.32 -0.06 D65290 -3.92 -1.2't, -0.47 -0.15 0.09 0.12 0.05 D65264 -9.25 -3.88 -2.35 -1..60 -0.79 -0.33 -0.08 D6S281 4.30 -1.57 -0.73 -0.34 -0.03 0.03 0,01 D7S531 -0.62 -0.53 -0.30 -0.21, -0.21. -0.10 0.00 D75507 -72.57 4.72 -2.48 -'I-".48 -0.55 -0.16 -0.02 D75576 -3.45 -2.55 -'t.7't -1.27 -0.61 -0.26 -0.07 229 D75526 -6.26 -3.4'1. -2.20 -1..49 -0.71, -0.29 -0.07 D75528 -0.66 -0.60 -0.42 -0.27 -0.11 -0.03 -0.01 D7S520 -12.35 -5.44 -3.14 -2.04 -0.93 -0.36 -0.08 D75634 -8.2'1, -2.47 -0.99 -0.35 0.14 0.19 0.07 D75524 1.34 1.31 1,.L9 1,.04 0.72 0.39 0.12 D75527 -4.68 -'1..92 -0.98 -0.48 -0.05 0.05 0.02 D7S515 4.31 -0.31 -0.30 -0.28 -0.19 -0,09 -0.02 D75501 -13.83 -3.59 -L.89 -1.05 -0.26 0.04 0.07 D7S5L4 -0.34 -0.33 -0.22 -0.07 0.08 0.09 0.04 D75635 -4.24 -'t_.52 -0.74 -0.40 -0.L0 0.00 0.01 D7S509 4.94 -4.28 -2.52 -1.58 -0.63 -0.19 -0.03 D75505 -6.2L -3.40 -2.10 -1,.34 -0.53 -0.15 -0.01. D7S550 4.24 -1.51 -0.74 -0.38 -0.09 0.00 0.01 D85264 -8.26 -3.95 -2.37 -L.60 -0.78 -0.23 -0.08 D85265 -10.26 4.78 -2.95 -1,.92 -0.84 -0.31 -0.07 D8S282 -8.93 -3.76 -1,.56 -0.81 -0,1s 0.05 0.04 D85283 -5.64 -3.36 -2.00 -1.30 -0.60 -0.24 -0.06 D8S532 0.78 0.78 0.79 0.77 0.64 0.42 0.'t4 D85260 't.27 1.30 '1.36 1,.36 1.19 0.80 0.28 D85553 -0.49 -0.43 -0.24 -0.07 0.13 0.15 0.07 D85286 -5.13 -2.37 -1..47 -0.97 -0.43 -0.15 -0.03 D8S257 -3.61, -0.99 -0.29 -0.01 0.20 0.19 0.08 D8S281 -3.11. -2.00 -1.11 -0.62 -0.15 0.01 0.02 D85284 -9.14 -5.36 -3.20 -2.05 -0.87 -0.31 -0.06 D85256 -L5.98 -6.38 -3.42 -2.01, -0.88 -0.32 -0.07 D85274 -12.02 -5.85 -3.45 -2.27 -1,.04 -0.47 -0.09 D95178 -14.80 -6.75 -4.15 -2.79 -7.32 -0.54 -0.13 D9S156 -8.17 4.76 -3.06 -2.15 -7.07 -0.45 -0.11 D95757 -1'1,.82 -5.67 -3.42 -2.2'1, -0.94 -0.32 -0.06, D95169 -'t.65 -'t.56 -L.26 -0.96 -0.51 -0.22 -0.05 D95175 -10.00 -6.90 4.28 -2.82 -1.30 -0.52 -0.12 D95152 -2.31 -1,.6'1, --1.03 -0.60 -0.32 -0.10 0.01 D%176 -4.08 -1.39 -0.71, -0.44 -0.20 -0.09 -0.03 D95154 -10.20 4.37 -2.58 -'1...69 -0.77 -0.30 -0.07 D%179 -8.08 -3.15 -7.67 -1.00 -0.36 -0.06 -0.01 D95158 -10.23 -8.56 -5.62 -4.23 -3.01. -1,.06 -0.35 D105249 0.51 0.49 0.44 0.38 0.25 0.13 0.04 D103189 -2.53 -1..73 -0.96 -0.55 -0."16 -0.01 0.01 230 D105191 -5.99 4.45 -2.80 -1.90 -0.89 -0.36 -0.08 D105197 4.93 -2.76 -7.24 -0.76 -0.29 -0.10 -0.02 D105220 -13.87 -5.73 -3.35 -2.21, -1.03 -0.42 -0.10 D10S210 -13.93 -7.41, -4.40 -2.90 -'1,.u -0.54 -0.13 D10Ss41 -72.8't -5.03 -2.73 -'t.67 -0.67 -0.24 -0.06 D10S185 -13.72 -6.03 -3.54 -2.31 -1.05 -0.40 -0.09 D10S530 -4.03 -3.03 -2.05 -1,.M -0.72 -0.30 -0.07 D105190 -8.74 -3.67 -2.07 -1.30 -0.54 -0.18 -0.04 D105587 -13.00 -5.25 -2.93 -1.84 -0.76 -0.29 -0.06 D105212 -3.75 -1.03 -0.27 0.06 0.29 0.27 0.1L D115931 -3.77 -1..09 -0.29 0.05 0.27 0.22 0.08 D115908 -2.96 -L.65 -0.92 -0.52 -0.24 -0.12 0.00 D11S933 -10.73 -5.27 -3.39 -2.33 -1.13 -0.46 -0.11 D115910 -0.24 -0.23 -0.18 -0.13 -0.05 -0.02 0.00 D115968 4.25 -1.58 -0.90 -0.61 -0.31 -0.13 -0.03 D115922 -5.66 -2.30 -1,03 -0.52 -0.14 -0.02 0.00 D7151392 4.43 -1.10 0.07 0.46 0.55 0.36 0.1.1 D115904 -5.03 -2.39 -1,.60 -'t.19 -0.66 -0.29 0.07 D12598 -3.73 -1.09 -0.26 0.05 0.27 0.22 0.08 D12S310 0.15 0.28 0.21, 0.12 0.10 0.10 0.03 D12587 0.13 0.16 0.12 0.11. 0.09 0.02 0.00 D72596 -0.96 -0.65 -0.23 -0.20 -0.10 -0.03 0.01 D12580 -9.34 -4.04 -2.48 -1..70 -0.86 -0.38 -0.10 D12S101 -13.4't -5.59 -3.18 -2.01, -0,86 -0.31 -0.07 D12Ss8 -6.97 -3.87 -L.96 -1,.14 -0.47 -0.17 -0.04 D12S105 -10.73 -5.01. -2.85 -'t.77 -0.72 -0.26 -0.06 D12576 -12.38 -4.59 -2.37 -'1,.39 -0.50 -0.15 -0,02 D12597 4.87 -2.15 -1.38 -0.99 -0.51 -0.20 -0.05 D13S17s -15.11 -6.43 -3.63 -2.33 -1.06 -0.42 -0.10 D135260 -9.28 -3.98 -2.30 -'t.49 -0.68 -0.27 -0.06 D135171, -12.4'1, -5.96 -3.45 -2.21, -0.96 -0.36 -0.08 D13S1s5 -12.79 -6.63 -3.75 -2.40 -1.09 -0.44 -0.L1 D13S160 -5.45 -2.75 -7.79 -1..20 -0.54 -0.20 -0.04 D1.3S170 -7.79 -2.57 -1,.22 -0.68 -0.24 -0.08 -0.02 D135159 -7,95 -2.83 -L.46 -0.89 -0.39 -0.15 -0.04 D135173 -13.63 -5.52 -3.17 -2.05 -0.94 -0.38 -0.09 D135285 -7.37 -2.34 -0.87 -0.26 0.19 0.22 0.08 D14580 -5.69 -2.88 -1.84 -7.23 -0.58 -0.24 -0.06 23r D14575 -3.77 -2.69 -1.81 -7.29 -0.64 -0.24 -0.05 D14S285 -1.97 -1.89 -1..47 -1.09 -0.56 -0.21 -0.04 D745290 -L.01 -0.92 -0.63 -0.37 -0.08 -0.03 0.02 D145277 -0.95 -0.60 -0.23 -0.13 0.02 0.03 0.03 D145293 -0.79 -0.75 -0.59 -0.42 -0.19 -0.06 -0.01 D155128 -3.39 -0.68 0.07 0.37 0.49 0.34 0.10 D15S118 -2.06 -1..92 -1.48 -1.05 -0.46 -0.16 -0.03 D155123 -5.78 -5.15 -3.19 -2.09 -0.96 -0.38 -0.09 D155119 -0.96 -0.59 -0.36 -0.72 0.02 0.00 0.01 D155117 0.12 0.15 0.1,4 0.10 0.06 0.03 -0.03 D15S15s -5.24 -2.s7 -'1,.66 -L.15 -0.58 -0.25 -0.06 D155125 -8.44 4.35 -2.26 -1..36 -0.55 -0.20 -0.05 D15S11.5 -17.22 -4.72 -2.58 -7.64 -0.72 -0.27 -0.06 D15S201 -Lt.22 -4.72 -2.58 -7.64 -0.72 -0.27 -0.06 D155130 -6.39 -3.54 -2.33 -1.59 -0.75 -0.31 -0.08 D165521. -6.97 -3.87 -1.96 -7.14 -0.47 -0.17 -0.04 D1.6S407 4.20 -L.18 -0.30 0.72 0.42 0.39 0.77 D165292 4.73 -1,.74 -0.83 -0.36 0.04 0.14 0.07 D163524 0.12 0.14 0.20 0.22 0.20 0.12 0.04 D165298 0.12 0.15 0.14 0.10 0.06 0.03 -0.03 D16y19 -3.53 -0.81 -0.07 0.23 0.37 0.26 0.07 D165514 4.57 -2.04 -1.03 -0.53 -0.09 0.05 0,04 D165518 -7.90 -2.49 -1.05 -0.46 -0.01. 0.09 0.04 D165413 -10.06 -4.53 -2.74 -1.81 -0.&1 -0.34 -0.08 D165303 -4.53 -1.85 -7.72 -0.78 -0.42 -0.19 -0.05 D175926 -8.12 4.09 -2.05 -'1,.17 -0.40 -0.10 -0.01 D17S804 -5.87 -2.81 -1,.47 -0.85 -0.29 -0.07 -0.01 D175958 -11.08 -5.01 -2.90 -1..91 -0.89 -0.36 -0.09 D175798 -1't.46 4.24 -2.14 --t.25 -0.47 -0.15 -0.03 D17S806 -12.07 -6.45 -4.03 -2.66 -1..23 -0.49 -0.12 D175794 -7.24 4.48 -2.97 -2.0'1, -0.96 -0.39 -0.09 D175807 -9.46 -4.23 -2.51, -1.65 -0.77 -0.31 -0.07 D17S801 -12.86 -5.98 -3.41. -2.15 -0.90 -0.32 -0.07 D175784 -1'1.27 -5.76 -3.13 -1.92 -0.8L -0.31 -0.07 D175928 4.70 -'t.94 -1.04 -0.59 -0.16 4.01 0.01 D18359 -4.97 -2.00 -0.68 -0.20 0.11 0.12 0.04 D18562 0.47 0.47 0.45 0.41, 0.29 0.1,4 0.03 D18553 -3.81 -7.42 -0.73 -0.44 -0.19 -0.07 -0.01 232 D18557 -0.07 -0.05 0.01 0.08 0.L4 0.12 0.04 D18564 -5.78 -1,.99 -0.68 -0.20 0.L3 0.16 0.07 D18S61 -8.23 -2.79 -1.38 -0.78 -0.26 -0.06 0.00 D185461 -7.98 -2.99 -1.58 -0.67 -0.40 -0.14 -0.03 D195191 -5.77 -4.74 -3.09 -2.11 -0.9e -0.40 -0.09 D19Éi406 -8.00 -2.58 -1.05 -0.38 0.72 0.18 0.06 D19S413 -6.03 -2.36 -0,95 -0.33 0.13 0.20 0.08 D19S424 -4.47 -1..69 -0.77 -0.29 0.10 0.14 0.04 D195226 -7.87 -2.19 -0.75 -0.17 0.22 0.24 0.10 D1%274 -4.85 -1.90 -0.64 -0.19 0.L1 0.12 0.05 D195418 -6.29 -3.25 -'t.69 -0.95 -0.28 0.04 0.00 D205117 -8.64 -3.\9 -L.6'1, -0.88 -0.24 -0.02 0.01 D20S95 -2.31, 0.29 0.87 1.00 0.92 0.64 0.26 D205189 -0.0L -0.01 -0.01 -0.01 -0.01 0.00 0.00 D20S104 -12.82 -5.27 -3.00 -1.95 -0.91 -0.37 -0,09 D20S107 4.91 -2.89 -1.5L -0.91. -0.37 -0.13 -0.03 D20S109 -13.60 -5.52 -3.20 -2.09 -0.96 -0.38 -0.09 D20S120 -14.88 -6.79 -3.90 -2.46 -1.08 -0.42 -0.10 D205173 4.04 -1.03 -0.22 0.13 0.31 0.22 0.06 D20517't" -15.32 -5.16 -2,37 -1..23 -0.32 -0.04 0,00 D215r256 -3.9 -"t.27 -0.40 0.02 0.33 0.31 0.12 D2151257 --10.19 -4.61, -2.60 -1.57 -0.57 -0.15 -0.01 D2151252 -7.60 -4.48 -2.13 -1.08 -0.25 0.00 0.02 D215267 -4.20 -1.1.8 -0.30 0.12 0.42 0.39 0.17 D215212 -lt.23 -5.60 -3.24 -2.06 -0.87 -0.30 -0.06 D22920 -8.31. 4.28 -2.60 -1.72 -0.80 -0.32 -0.07 D225315 -9.88 4.17 -2.11 -1..24 -0.47 -0.13 -0.02 D225274 -8.67 -3.31, -1.82 -1.15 -0.50 -0.19 -0.04 D225278 -9.50 -3.95 -2.29 -1..46 -0.63 -0.23 -0.05 D225275 -4.18 -1.51 -0.81 -0.52 -0.25 -0.11 -0.03 D225303 -5.98 -3.19 -2.16 -1.53 -0.77 -0.32 -0.08 233 APPENDIX III Two point lod scores for microsatellite markers within the human genome (indicated by DXSA number -these numbers identify specific chromosome (X) and microsatellite marker (A)) and spinocerebellar ataxia family (PK80237). Microsatellite markers are on average 20 cm apart. The following lod scores are based on the initial pedigree (affected individuals only used in the analysis). Two point lod scores at 0 = MARKER O.OO 0.01 0.05 0.1 0.2 0.3 0.4 D15160 -3.97 -1,.52 -0.81 -0.50 -0.22 -0.08 -0.02 D1S170 -5.99 -2.66 -1..32 -0.79 -0.33 -0.12 -0.03 D15234 -6.97 -2.27 -0.91 -0.42 -0.07 0.02 0.01 D7St64 -5.91 -2.62 -L.28 0.76 -0.31 -0.12 -0.03 D15236 -2.83 -0.52 0.07 0.24 0.26 0.16 0.05 D15430 -3.09 -0.65 -0.05 0.13 0.19 0.L2 0.04 D1S104 -7.37 -2.28 -0.97 -0.48 -0.11 0.00 0.01 D15243 -3.72 -1.22 -0.56 -0.32 -0.12 -0.04 -0.01 D1S102 -3.26 -0.81 -0.20 -0.01 0.08 0.06 0.02 AMY2B -3:t4 -1.71 -0.93 -0.56 -0.23 -0.09 -0,02 D15245 4.24 -2.64 -1..31 -0.n -0.31 -0.11 -0.02 D15303 -3.65 -T.L't -0.46 -0.21, -0.04 0.01 0.01 D1S103 -5,87 -2.60 -'1..26 -0.74 -0.30 -0.11 -0.02 D1S235 -0.19 -0.20 -0.22 -0.21, -0.14 -0.06 -0.01 D1S431 -3.59 -1.77 -0.46 -0.22 -0.04 0.01 0.01 DLS473 -3.23 -0.78 -0.17 0.01 0.08 0.05 0.01 D15252 -4.53 -1.85 -7.12 -0.78 -0.42 -0.19 -0.05 D15498 0.42 0.60 0.90 1.00 0.92 0.66 0.27 D15484 -0.31 -0.27 -0.13 0.02 0.09 0.09 0.04 D152878 -5.15 4.18 0.43 0.59 0.56 0.34 0.09 D15196 0.42 0.ó0 0.90 1.00 0.92 0.66 0.27 D1S2836 -2.32 -2.27 -1.81 -1,.39 -0.67 -0.22 -0.04 D25319 -10.89 -5.39 -3.52 -2.44 -1.18 -0.48 -0.11 D25162 -8.96 -3.54 -'t.94 -1,.17 -0.42 -0.11 -0.01 D2S168 -8.82 -3.45 -1.87 -1.11 -0.38 -0.09 -0.01 D25177 -7.40 -3.67 -2.15 -1..43 -0.68 -0.28 -0.07 D25123 -9.41, -4.01, -7.37 -0.39 0.28 0.35 0.16 D2S380 -1.0.43 -5.34 -3.35 -2.27 -1.09 -0.44 -0.11 D25145 -8.95 -3.85 -2.22 -'t.42 -0.60 -0.21, -0.04 D25113 -0.24 -0.20 -0.08 0.03 0.13 0.12 0.04 ?34 D25121, -5.01 -2.s2 -7.67 -'1,.20 -0.55 -0.19 -0.04 D2S114 -7.65 -1,.99 -0.58 -0.02 0.35 0.32 0.13 D2574L -2.U 0.76 0.87 1..12 't.1.4 0.85 0.38 D25124 -2.84 -1.86 -1.03 -0.59 -0.18 -0.04 -0.01 D2S111 -6.25 -3.34 -'t.74 -0.96 -0.25 -0.02 0.00 D25152 4.59 -'t.91, -'t.12 -0.73 -0.33 -0.13 -0.03 D2S155 -6.94 -3.36 -L.48 -0.65 0.03 0.20 0.11 D25159 -6.28 -3.48 -2.37 -'t.64 -0.78 -0.31 -0.07 D25206 -2.86 0.10 0.68 0.82 0.74 0.49 0.17 D2S140 -10.26 -4.85 -2.96 -1.98 -0.93 -0.38 -0.09 D25126 -9.75 4.1't -2.49 -1..67 -0.79 -0.32 -0.08 D3S1304 1.43 1.40 t.28 1.13 0.81 0.48 0.L6 D351263 -4.04 -1.33 -0.60 -0.31 -0.07 -0.01 0.00 D351286 -3.30 -0.62 -0,02 0.15 0.19 0.11 0.03 D351277 -7.59 4.13 -2.76 -'t_.33 -0.58 -0.23 -0.05 D351289 -7.86 -2.15 -7.20 -0.70 -0.29 -0.72 -0.03 D351312 -4.10 -1.40 -0.72 -0.44 -0.19 -0.08 -0.02 D3S1300 4.24 -1,.25 -0.62 -0.39 -0.19 -0.08 -0.02 D357261 -8.19 -2.80 -1,.44 -0.89 -0.39 -0.15 -0.04 D351274 -3.32 -0.81 -0.19 0.02 0.12 0.09 0.03 D351271. -7.59 -2.21, -0.91. -0.42 -0.07 0.02 0.0L D351278 -7.42 -2.2L -0.91 -0.42 -0.07 0.02 0.01 D357292 0.30 0.29 0.26 0.27 0.13 0.06 0.02 D351279 a.79 -2.80 -1.M -0.89 -0.39 -0.15 -0.04 D351282 -3.19 -0.25 -0.34 0,50 0.49 0.34 0.12 D351262 -3.80 -1.11 -0.46 -0.21, -0.04 0.01 0.01 D3S1311 -7.59 -2.51. -1,.20 -0.70 -0.29 -0.12 -0.03 D4S16t4 -3.94 -1..25 -0.59 -0.33 -0.12 -0.04 -0.01 D45412 -3.57 -0.90 -0.30 -0.11 -0.01 0.00 0.00 D45432 -4.19 -2.36 -1.05 -0.55 -0.17 -0.04 -0.01 D45394 -72.29 4.20 -2.16 -1,.33 -0.58 -0.23 -0.05 D4S1599 -0.01, -0.01 -0.01 -0.01 -0.01 0.00 0.00 D4S391 '1.47 1,.44 1,.32 7.16 0.83 0.49 0.16 D43428 -3.19 -0.22 0.37 0.53 0.53 0.36 0.13 D45392 -0.07 -0.05 0.0L 0.08 0.14 0.12 0.04 D45423 -72.71 4.20 -2;t6 -1,.33 -0.58 -0.23 -0.05 D4S1613 -0.05 -0.04 -0.04 -0.03 -0.02 -0.01 0.00 D454.27 -7.83 -3.25 -]..73 -1.06, -o.M -0.16 0.03 235 D45420 -3.07 -0.40 0.19 0.34 0.32 0.19 0.05 D4S1585 -3.19 -0.52 0.07 0.23 0.25 0.14 0.04 D4S1595 -3.35 -0.74 -0.14 0.04 0.10 0.06 0.01 D4S1554 -12.11 -4.20 -2.16 -1.33 -0.58 -0.23 -0.05 D45426 -3.80 -1.11 -0.49 -0.23 -0.06 -0.01 0.00 D55392 -1,.97 -1,89 -1..47 -1.09 -0.s6 -0.2-t. -0.04 D55678 -1.01 -0.92 -0.63 -0.37 -0.08 -0.03 0.02 D55630 -12.29 -4.20 -2.76 -1.33 -0.58 -0.23 -0.05 D5S635 0.60 0.59 0.52 0.43 0.25 0.11 0.02 D5S502 -0.79 -0.75 -0.59 -0.42 -0.19 -0.06 -0.01 D5S431 -4.11, -1..41 -0.72 -0.43 -0.19 -0.08 -0.02 D5S424 -7.82 -2.M -1.11 -0.61 -0.21. -0.06 -0.01 D55401 -7.96 -2.59 -'1.27 -0.76 -0.34 -0.L4 -0.04 D5S644 4.10 -1.40 -0.72 -0.44 -0.19 -0.08 -0.02 D5S421. 4.36 -3.13 -1.70 -1,.07 -0.48 -0.19 -0.05 D5S500 -7.73 -2.41 -1.10 -0.59 -0.20 -0.06 -0.01 D5S410 -8.07 -2.68 -1,.34 -0.80 -0.34 -0.13 -0.03 D55400 -7.89 -2.2L -0.9L -0.42 -0.07 0.02 0.01 D55408 't..25 1..22 't.11, 0.96 0.66 0.35 0.10 D65344 4.14 -L.M -0.75 -0.47 -0.21 -0.08 -0.02 D65309 -8.74 -3.03 -1..63 -1.03 -0.46 -0.18 -0.04 D65289 -12.07 -3.99 -1..97 -1,.16 -0.47 -0.17 -0.03 D65291, -0.18 -0.18 -0.20 -0.19 -0.13 -0.06 -0.01 D65273 -8.23 -2.U -L.47 -0.91. -0.40 -0.16 -0.04 D63/.52 -8.19 -2.80 -1..44 -0.89 -0.39 -0.15 -0.04 D65.257 -12.10 -4.04 -2.02 -1,.2't -0,50 -0.18 -0.04 D65275 -4.10 -'t.40 -0.72 -0.44 -0.19 -0.08 -0.02 D65462 -8.02 -2.65 -1.30 -0.76 -0.30 -0.11 -0.02 D65268 -7.83 -2.48 -1..17 -0.68 -0.28 -0.11 -0.03 D65292 -3.62 -'t.66 -0.88 -0.53 -0.2't -0.07 -0.02 D65311 -7.89 -4.L6 -2.76 -'t.33 -0.58 -0.23 -0.05 D65290 -3.77 -1.12 -0.48 -0.25 -0.08 -0.02 0.00 D65264 -4.18 -1..47 -0.76 -0.47 -0.22 -0.10 -0.03 D6S281 -3.72 -0.81 -0.19 0.02 0.13 0.11- 0.04 D75531. -0.49 -0.43 -0.24 -0.07 0.13 0.15 0.07 D75507 4.41 -1..72 -1.05 -0.73 -0.37 -0.15 -0.04 D75516 0.23 0.24 0.24 0.22 0.14 0,06 0.01 D75526 -8.19 -2.80 -L.44 -0.89 -0.39 -0.15 -0.04 236 D75528 0.30 0.29 0.26 0.21 0.13 0.06 0.02 D75520 -12.71 -4.06 -2.03 -1,.22 -0.51 -0.19 -0.04 D75634 -7.89 -2.2L -0.91 -0.42 -0.05 0.04 0.03 D75524 0.30 0.29 0.26 0.2-t, 0.13 0.06 0.02 D75527 4.31 -2.50 -7.17 -0.66 -0.23 -0.06 -0.01 D7S515 -0.10 -0.10 -0.08 -0.06 -0.03 -0.01 0.00 D7S501 0.52 0.52 0.50 0.45 0.32 0.17 0.05 D75514 0.12 0.12 0.08 0.05 0.01 0.00 0.00 D7S63s -3.84 -1.15 -0.52 -0.30 -0.13 -0.06 -0.02 D75509 0.97 0.94 0.83 0.70 0.43 0.20 0.05 D7S505 -4.27 -1.58 -0.92 -0.64 -0.32 -0.13 -0.03 D7S550 -3.89 't.21, -0.57 -0.33 -0.15 -0.07 -0.02 D85264 -4.98 -2.63 -1,.29 -0.76 -0.30 -0.10 -0.02 D8S26s 4.9Í3 -2.63 -1..29 -0.76 -0.30 -0.10 -0.02 DBS282 -7.41, -2.39 -1..07 -0.57 -0.18 -0.05 -0.01 D8S283 -3.38 -0.80 -0.18 0.0L 0.09 0.06 0.02 D8S532 1.51 L.47 1.33 1,.14 0.76 0.39 0.10 D85260 -2.65 -0.22 0.37 0.53 0.53 0.36 0.13 D8S553 1.59 1.56 1,.43 1,.26 0.89 0.51 0.16 D8S286 -3.07 -0.43 0.1.5 0.30 0.30 0.17 0.04 D85257 -3.53 -1,.71, -0.45 -0.21, -0.04 0.01 0.01 D8S281 0.51 0.50 0.47 0.43 0.30 0.16 0.04 D85284 -7.9s -3.25 -1.73 -1.06 -0.44 -0.16, -0.03 D8S256 -8.16 -2.88 -1,.51, -0.94 -0.41 -0.16 -0.04 D85274 -3.55 -0.95 -0.M -0.14 -0.03 -0.01 0.00 D95178 -8.55 -3.1.4 -1..70 -1.08 -0.48 -0.19 -0.05 D9S156 -3.43 -'t.57 -0.87 -0.57 -0.27 -0.11 -0,03 D9S157 -3.49 -0.52 0.09 0.28 0.32 0.22 0.08 D95169 0.44 0.42 0.34 0.26 0.1.4 0.06 0.01 D%175 -3.49 -3.44 -2.75 -1.33 -0.58 -0.23 -0.05 D95152 -0.19 -0.20 -0.22 -0.21, -0.14 -0.06 -0.01 D95176 -4.06 -L.37 -0.69 -0.42 -0.18 -0.07 -0.02 D95154 -8.19 -2.80 -1,.44 -0.89 -0.39 -0.15 -0.04 D95779 -8.03 -2.66 -1.31 -0.77 -0.31 -0.11 -0.02 D96158 0.51 0.50 0.47 0.43 0.30 0.16 0.04 D105249 -0.10 -0.L1 -0.14 -0.15 -0.11 -0.05 -0.01 Dl05189 0.53 0.53 0.51, 0.46 0.33 0.17 0.05 D105191 -5.06 -2.47 -1.50 -0.96 -0.42 -0.15 -0.03 237 D105197 -3.72 -0.81 -0.19 0.02 0.13 0.11 0.04 D105220 -7.89 -2.51, -1.18 -0.67 -0.25 -0.09 -0.02 D105210 -8.53 -3.25 -1,.73 -1.06 -0.44 -0.16 -0.03 D10S541 -3.49 -0.52 0.09 0.28 0.32 0.22 0.08 D10S185 -7.59 -4.13 -2.16 -1.33 -0.58 -0.23 -0.05 D105530 0.51 0.51 0.49 0.45 0.32 0.17 0.05 D10S190 -3.19 -0.22 0.37 0.53 0.53 0.36 0.13 D10S587 -7.89 -2.2'1" -0.91 -0.42 -0.07 0.02 0.01 D105212 -3.45 -0.81 -0.20 0.00 0.08 0.06 0.02 D115931 -5.75 -3.14 -1.71. -1.08 -0.49 -0.19 -0.05 D115908 0,15 0.28 0,27 0.12 0.10 0.10 0.03 D115933 -10.46 4.20 -2.76 -1..33 -0.58 -0.23 -0.05 D115910 -0.04 -0.04 -0.03 -0.02 -0.01 -0,01 0.00 D115968 -3.69 -7.24 -0.58 -0.32 -0.11 -0.03 0.00 D115922 -4,05 -1.51 -0.81 -0.51 -0.23 -0.09 -0.02 D1151392 -3.89 -1.29 -0.63 -0.37 -0.15 -0.05 -0.01 D115904 -3.45 -0.91 -0.29 -0.08 0.03 0.04 0.01 D12598 -8.55 -3.14 -7.77 -1.08 -0.49 -0.19 -0.05 D12S310 0.12 0.14 0.20 0.22 0.20 0.12 0.04 D12587 0.12 0.1s 0.14 0.10 0.06 0.03 -0.03 D12596 0.47 0.47 0.45 0.41. 0.29 0.14 0.03 D12S80 -8.03 -2.65 -1.23 -0.81 -0.36 -0.L5 -0.04 D12S101 -72.29 4.20 -2.16 -1.33 -0.58 -0.23 -0.05 D12Ss8 -4.08 -1,.40 -0.77 -0.51 -0.26 -0.11 -0.02 D12S105 -7.97 -2.59 -'t.27 -0.m -0.34 -0.14 -0.04 D12576 -72.17 -3.99 -1,.97 -1.16 -0.47 -0.17 -0.03 D12597 4.45 -1,.74 -0.98 -0.64 -0.29 -0.12 -0.03 D135175 -10.77 4.20 -2.16 -1.33 -0.58 -0.23 -0.05 D135260 -7.46 -2.80 -1".M -0.89 -0.39 -0.15 -0.04 D735177 -8.56 -4.05 -2.03 -1.'.22 -0.51 -0.19 -0.04 D13S155 -1-t.39 4.20 -2.16 -1.33 -0.58 -0.23 -0.05 D13S160 -3.89 -1.35 -0.67 -0.41 -0.17 -0.07 -0.02 D13S170 4.61 -2.65 -1.31, -0.77 -0.31 -0.11 -0.02 D135159 4.6't -2.65 -1.31 -0.77 -0.31 -0.L1 -0.02 D13S173 -7.34 -2.57 -1.18 -0.67 -0.25 -0.09 -0.02 D135285 -7.46 -2.s1 -1.18 -0.67 -0.25 -0.09 -0.02 D14S80 -3.28 -0.70 -0.10 0.06 0.10 0.04 0.00 D1"4575 0.51 0.51 0.49 0.45 0.32 0.77 0.05 238 D145285 1..43 1.40 1..28 1.13 0.81 0.48 0.16 D145290 L.47 1.44 't.32 1,.16 0.84 0.49 0.16 D145277 -0.96 -0.59 -0.36 -0.12 0.02 0.00 0.01 D145293 0.26 0.24 020 0.1.5 0.06 0.02 0.00 D155128 -3.92 -1.40 -0.72 -0.44 -0.L9 -0.08 -0.02 D15S118 -3.2't -0.8L -0.19 0.02 0.12 0.09 0.03 D15S123 -7.48 -4.08 -2.1,6 -1..33 -0.58 -0.23 -0.05 D15S119 0.51 0.51 0.49 0.45 0.32 0.17 0.05 D15S117 -0.49 -0.43 -0.24 -0.07 0.13 0.15 0.07 D15S155 -3.29 -0.72 -0.12 0.06 0.11 0.06 0.01 D15S125 -5.30 -2.54 -1.2'1, -0.69 -0.27 -0.09 -0.02 D15S115 -6.86 -4.05 -2.03 -1..22 -0.51 -0.19 -0,04 D155201 4.13 -1,.59 -0.93 -0.65 -0.32 -0.13 -0.03 D1,5S130 -5.78 -2.31, -0.99 -0.50 -0.12 0.00 0.02 D165521 0.44 0.42 0.34 0.26 0.14 0,06 0.01 D16S/1.07 -3.19 -0.22 0.37 0.53 0.53 0.36 0.13 D165292 -3.49 -0.52 0.09 0.27 0.31 0.20 0.07 D165524 -0.21 0.20 0.17 0.1,4 0.09 0.04 0.01 D165298 -0,18 -0.18 -0.20 -0.19 -0.13 -0.06 -0.01 D165419 -3.76 -1.08 -0.45 -0.24 -0.09 -0.04 -0.01 D165514 -3.44 -0.80 -0.18 0.01 0.09 0.06 0.02 D165518 -7.89 -2.51, -1,.1,6 -0.64 -0.20 -0.04 0.00 D1"6913 -8.49 -2.80 -1,.44 -0.89 -0.39 -0.15 -0.04 D165303 -4.19 -1,.49 -0.80 -0.50 -0.23 -0.09 -0.02 D175926 -4.08 -'t.40 -0.77 -0.51 -0.26 -0.11 -0.02 D17S804 -4.27 -1,.67 -0.86 -0.50 -0.18 -0.06 -0.01 D175958 -6.63 -2.35 -1.04 -0.54 -0.16 -0.04 0.00 D775798 -6.76 -2.48 -1,.16 -0.65 -0.24 -0.08 -0.02 D17S806 -7.59 -2.5L -1.18 -0.67 -0,2s -0.09 -0.02 D175794 -4.18 -1.63 -0.96 -0.66 -0.33 -0.14 -0.03 D17æ07 -5.21 -2.80 -'t.M -0.89 -0.39 -0.15 -0.04 D17S801 -8.95 4.20 -2.1,6 -1.33 -0.58 -0.23 -0.05 D77S7U :7.42 -2.80 -1.M -0.89 -0.39 -0.15 -0.04 D175928 -3.42 -0.87 -0.26 -0.06 0.04 0.04 0.01 D18559 -7.82 -2.5! -1.18 -0.67 -0.25 -0.09 -0.02 D18562 0.25 0.24 0.22 0.18 0.11 0.05 0.0L D18553 4.36 -1..69 -0.95 -0.61 -0.28 -0.11 -0.03 D18S57 0.90 0.89 0.85 0.78 0.59 0.36 0.12 239 D18564 0.1ó 0.15 0.09 0.05 0.01 0.0L 0.00 D18S61 -7.86 -2.26 -0.96 -0.47 -0.10 0.00 0.01 D18S461 -7.71. -2.21 -0.91, -0.42 -0.06 0.03 0.02 D19S191 -2.89 -1.35 -0.75 -0.51 -0.25 -0.09 -0.02 D19S406 -4.04 -1.47 -0.76 -0.46 -0.21 -0.09 -0.02 D19S413 -3.94 -1.39 -0.67 -0.37 -0.12 -0.03 -0.01 D1W24 -3;1,4 -0,55 0,04 0.27 0.24 0.14 0.04 D1%226 -4.08 -1..77 -0.01 -0.65 -0.30 -0.12 -0.03 D795214 -3.2-t -1.11. -0.46 -0.23 -0.06 -0.01 0.00 D19S418 -3.21, -0.82 -0.23 -0.05 0.02 0.01 0.00 D20Sr77 -7.59 -2.21, -0.91 -0.42 -0.07 0.02 0.01 D20595 -3.49 -0.83 -0.22 -0.02 0.06 0.04 0.01 D205189 0.20 0.20 0.77 0.'t4 0.08 0.04 0.01 D205104 -12.08 -4.02 -L.99 -7.19 -0.48 -0.18 -0.04 D205107 -3.92 -1,.40 -0.72 -0.44 -0.19 -0.08 -0.02 D20S109 -12.1-t 4.20 -2.16 -1.33 -0.58 -0.23 -0.05 D205120 -12.29 4.20 -2.16 -1.33 -0.58 -0.23 -0.05 D205173 0.47 0.47 0.45 0.41 0.29 0.74 0.03 D205171, -12.29 4.20 -2.1,6 -1.33 -0.58 -0.23 -0.05 D2151256 -4.78 -2.21, -0.91 -0.42 -0.07 0.02 0.01 D215t257 -6.82 -2.59 -1".27 -0.77 -0.34 -0.L4 -0.04 D2157252 -7.02 -2.25 -0.94 -0.49 -0.10 0.00 0.01 D215267 0.26 0.24 020 0.15 0.06 0.02 0.00 D215212 -10.49 -4.20 -2.16 -1..33 -0.58 -0.23 -0.05 D22S420 4.70 -1..09 -0.40 -0.12 0.07 0.08 0.03 D225315 -8.49 -2.80 -'t.M -0.89 -0.39 -0.15 -0.04 D225274 -8.19 -2.80 -1,.44 -0.89 -0.39 -0.15 -0.04 D2?s.278 -8.04 -2.62 -'t.29 -0.77 -0,33 -0.13 -0.03 D225275 4.19 -1.47 -0.77 -0.49 -0.22 -0.09 -0.02 D2ß303 -3.91, -"t.23 -0.59 -0.35 -0.16 -0.07 -0.02 240 APPENDD( IV Detectíon of a novel missense mutation and second recurrent mutation in the CACNALA gene in individuals with EÑ-zand FHM. Kathryn L Friend, Denis Crimmins, Thanh G Phan, Carolyn M Sue, Alison Colley, Vicüor SC Fung, John GL Morris, Grant R Sutherlan{ Robert I Richatds. - A paper published in Human Genetics 24L A Friend, K.L., Crimmins, D., Phan, T.G., Sue, C.M., Colley, A., Fing, V.S.C., Morris, J.G.L., Sutherland, G.R. & Richards, R.I. (1999) Detection of a novel missense mutation and second recurrent mutation in the CACNA1A gene in individuals with EA-2 and FHM. Human Genetics, v. 105(3), pp. 261-265 NOTE: This publication is included on pages 242-246 in the print copy of the thesis held in the University of Adelaide Library. It is also available online to authorised users at: http://doi.org/10.1007/s004399900101 APPENDIX V Comprehensive Screening of Australian SCA patients reveals prevalence of SCA1 (CAG)n repeatexpansions.KFriend,KBoundy,EHaan,DBurrows,EThompsonandRlRichards-Apaperfor submission to Neurology Abstract 128 Australian individuals exhibiting symptoms prompting molecular genetic testing for spinocerebellar ataxia were screened for expansions at known SCA loci; SCA1, SCA2, SCA3/MJD, SCA6, SCA7, SCAS and DRPLA. These same individuals were also examined for homozygous expansions at the Friedreich ataxia (FRDA) locus. Eighteen affected patients were ascertained as having family history of spinocerebellar ata¡ria. The relative frequency of mutations detected at the loci tested was calculated. Expansions were detected in 22Yo of patients with autosomal dominant spinocerebellar ataxia and in 8% of patients with insufficient evidence of, or no family history. The most common expansions in all cases were detected at the SCAI locus (5.5%) and SCA3/MJD locus (3%). For the sporadic group expansions at the FRDA and SCAT loci were detected in one case each. No expanded alleles were detected at the SCA2, SCA6, SCAB or DRPLA loci. In an attempt to identify other disease causing expansions we screenod patients at eight previously published (CAG)n positive cDNA clones. No expansions were detected excluding these clones as candidates for disease genes in the group tested. There remains the possibility that the SCA symptoms in these patients may be due to mutations in the as yet uncharacterised genes for SCA4, SCA5, SCA1O and SCAll. These results highlight the extensive genetic heterogeneity of the spinocerebellar ataxias and emphasise the importance of discovery of new SCA mutations. 242 Introduction The disorders commonly referred to as spinocerebellar ata:rias (SCAs) are both clinically and genetically heterogeneous. These neurodegenerative diseases are clinícally characterised by progressive cerebellar ataxia often associated with nystagmus and dysarthria. Diagnostic classihcation of these disorders has been greatly simplified over the past six years due to the identification of the causative gene and associated mutations at 7 different loci. The loci in which mutations have been identified are; spinocerebellar ataxia I (SCAI) IMIM 1644001(On et al. 1993), SCA2 IMIM 183090] (Imbert et al. 1996, Pulst et al. 1996 and Sanpei etaI. 1996), Machado Joseph disease (MJD/SCA3 IMIM 109150] (Kawaguchi et al. 1994), SCA6 [MIM183086] (Zhuchenko et al. 1997), SCAT [MIM164500], (Lindbald et al. 7996, David et al. 1997) and Dentatorubral pallidoluysian atrophy (DRPLA) [MIM125370], (Koide et al.l994,Nagafrrchi et at. 1994). The common mutation identified in all of these disorders is an expansion of a normally polymorphic (CAG) repeat in affected individuals. As a general guide the normal range can be considered to be less than 40 (CAG) repeat units while the affected range is greater than 40 (CAG) repeat units. This (CAG)n repeat is transcribed as a polyglutamine tract in all cases. (On et aL. lgg3,Kawaguchi et aL."1.994, Koide et al. 1994, Nagafuchi et al. 1994, Imbert et aI. 1996, Lindbald et al. l996,Pulst et al. 1996, Sanpei et al. 1996, David et al. 1997, Zhuchenko et al. 7997). The gene for SCAS is the most recent to be characterised. The underlying mutation identified in affected individuals at this locus (SCA8) has been demonstrated to be an (CTG)1 repeat expanded within the presumed 3' untranslated region of the associated gene. While it would appear that the mechanism for the disease progression in individuals with this form of SCA is different to those previously described SCAs, identification of an expanded allele at this locus may provide confirmation of diagnosis (Koob et al. 1999). Recent data, however, suggests that 243 expanded alleles may be present in low frequency in unaffected individuals challenging the significance of this expanded allele (Stevanin et al. 2000, Worth et al. 2000). Additionally, expansions of the (CAG)nrepeat at the SCA12 locus (chromosome 5) have been identified in a single pedigree (Holmes et aL.1999). The repeat expanded in this family is located in the 5' region of PPP2R2B. Several other genetic localisations are known to exist for the SCAs. These include SCA4 (chromosome 16) (Flanigan et al. 1996), SCA5 (ckomosome 11) @anum et aL. 1994), SCA10 (chromosome 15) (Worth et al, 1999) and SCAI l (chromosome 22) (Za et al. 1999). As yet no associated genes or mutations for these localisations have been identified. Whilst it is most likely that the mechanism responsible for these disorders will be an expansion of a (CAG) repeat this remains to be validated. Given the genetic and clinical heterogeneity of the SCAs the molecular evaluation of patient material at known SCA loci can prove to be valuable for confirmation of diagnosis. The mutation responsible for 98% of all Friedreich ataxia (FRDA) patients is an homozygous expansion of a (GAA)n repeat. Unlike the SCAs, this repeat is not within the coding region of the gene. It is instead within the first intron of the gene (Campuzano et al. 1996). It has been shown that the GAA repeat expansion in intron I can be homozygously expanded in some cases of SCA. Consequently, inclusion of testing at this locus in a general screen for SCA expansion mutations may improve molecular detection (Geschwind et al. t997, Moseley et al. 1ee8). A number of studies have revealed that some geographically unique populations of SCA patients have differing prevalence of SCA (CAG)n repeat expansions. Results clearly indicate that there is a strong population bias and some populations may have exclusive expression of a particular SCA expansion. (Lopes-Cendes I et al. 1997, Matsuyama et al. 1997, Riess O et al.lggT,Mizushima K et al. 1998, Watanabe H et al. 1998). Further support for these apparent founder effects is indicated in studies by Takano et al. (1993). This group showed that tn populations where a particular form of SCA is more 244 prevalent there are also a greater number of alleles in the upper end of the normal range when compared to other populations. It is assumed that the higher copy number alleles are predisposed to becoming expanded alleles at the corresponding disease loci. In this present study we determined the frequency of SCAI, SCA2, SCA3, SCA6, SCA7, SCA8, DRPLA andFRDA inl28 Australian patients (both sporadic and familial cases) in an attempt to determine which of the SCA loci have most diagnostic value in Australian patients. The frequencies calculated were compared to previously published frequencies. Additionally, given that all the mutations identiflred thus far for SCAs are due to an expansion of an otherwise normally occuning (CAG)n repeat it is reasonable to consider that the as yet unidentified loci may also be due to an expansion of a (CAG)n. To investigate this we screened our patient sample set for expansions at I (CAG)n repeats detected in anonymous oDNA clones. Material and Methods Subjects Patient samples analysed were referred to the diagnostic laboratory as either having a family history of spinocerebellar ataxia or as isolated (sporadic) cases of SCA. The majority of the cases were late onset (onset of symptoms after 50 years) with no indication of family history. Description of clinical features varied. Many requests had limited clinical information such as general alaxiawith few, if any other, associated signs. Patient blood samples for analysis were collected by a large number of different neurologists and medical geneticists. Informed consent was obtained from each individual tested. PCR Analysis (SCAs) Repeat expansion at the SCA1 locus was analysed using primers Repl and Rep2 (On et al. 1993). Primers MJD25 and MJD52 were used to amplify the (CAG)n repeat expansion at the SCA3/ÌvIJD locus (Kawaguchi et al. 1994) while repeat copy number at the SCA2 locus was analysed using primers DAN1-UH13/UH15 (Imbert et al. 1996). SCAT expansions were 24s amplifiedusingprimers 4U1024 and4U7l6 (David et aI. 1997) and the primers CTG-B37-F and CTG-B37-R were used to determine the allele sizes at the DRPLA locus (Koide et al. 1994). At the SCA6 locus minor modifications from previously published primer sequences were utilised. S-5-Rl was used as published but a new forward primer (designated S-5-F2) 5'TTCCGTAAGTGGAAGCCCAGCCCCC3' was designed from published sequence (Zhuchenko et al. 1997). The combination of S-5-F I and S-5-F2 gave less non speciflrc bands than S-5 Fl/Rl under our experimental conditions. Alleles at the SCAS locus were amplified using primets SCAS-F3 and SCAS-R4 (Koob et aL.1999). PCR conditions used were the same as those used by Chamberlain et al. 1988 with the substitution of 7-deaza dGTP @harmacia) for dGTP and the inclusion of '2p dCTP, The only other modifîcation was a reduction of the final concentration of dNTPs to 400¡tM. All products were resolved on a 5o/o denaturing polyacrylamide gel and compared to known controls. Atlele sizes of these controls were determinedby sequencing. All patient samples which scored homozygous in the normal range at any SCA locus were analysed in duplicate and long exposures of gels were obtained to ensure that any potential expanded alleles would not miss detection. Also, positive controls were amplified in each run and on each occasion expanded alleles were easily detected. The Friedreich ataxia alleles were amplified using long range PCR kit (Boehringer Mannheim). The primer pair GAA-F and GAA-R were used (Camprnano et al. 1996). Resultant products were run out on 2.5o/o agarose gels. Again positive controls were included in each run to ensure expanded alleles amplified adequately. Anonymous (CAG) positive cDNA clones. Several selection criteria were observed when choosing which oDNA clones to screen. The first of these was that the (CAG)n repeat unit was conceptually translated to polyglutamine and the second that the repeat was of perfect, uninterrupted composition. The eight (CAG) positive oDNA clones tested are listed below: 246 Forward and reverse primers were synthesised for the following; CTG2}a (chr ó), CTGTa (chr 20), H16 (chr 20), CAG4a (chr 1), CAGR1 (chr 13), H3 (chr 4 ), CAG3a (chr19) and L237 (cfu 16). (Margolis et al. 1996, Margolis et al.1997) Additionally primers for the (CAG)n repeat at the TATA-binding protein gene (TBP) were synthesised. This repeat has been shown to be expanded in a sporadic case of severe ataxia with associated intellectual deterioration (Koide et aL.1999). Conditions used for analysis of these (CAG)n repeats is the s¿ùme as described for analysis of expansions at the SCA loci. Results and Discussion This study examines the detection rate of mutations at the SCA1, SCA2, SCA3iMJD, SCA6, SCA7, SCA8, DRPLA and FRDA loci in Australian patients with clinically suspected spinocerebellar ata:ria. The study group was directed to the laboratory for analysis from various sources and thus clinical assessment was neither uniformed nor formalised. This ethnically diverse patient group can be classified into two separate groups; 1. known family history of spinocerebellar atair ataxiaand/or insufficient clinical data to assess family history (sporadic). It was on the basis of these subgroups that we analysed the frequency of SCAs in each group. Repeat expansions at the SCA1, SCA2, SCA3/MJD, SCAó, SCA7, SCA8, DRPLA and FRDA loci were analysed in 128 patients (familial and sporadic cases). 18 individuals were documented to have a family history of SCA-like symptoms. Of these familial cases, 3 had expansions detected at the SCAI locus (16.7%) and I had an expansion at the MJD locus (55%). For the sporadic cases 4 of the remaining 110 (3.6%) were found to have expansions at the SCA1 locus. Another 3 cases (2.7%) had expansions detected at the SCA3/MJD locus. One individual had an expansion at the SCAT locus and another had an homozygous expansion at the FRDA locus detected. Independently each of these account for 0.8% of the cases. The detection rate for all cases (sporadic and familial) is 10%. One sporadic individual 247 was heterozygous for expansion at the FRDA locus. Further analysis may ascertrain if there is a mutation in another portion of the FRDA gene. There were no apparent expansions detected in any patient sample at the SCA2, SCA6, SCAS or DRPLA loci (Table 1). Results from the familial cases indicate the most prevalent SCA (CAG)n expansion detected was at the SCAI (16.7%) and SCA3AvIJD loci (5.5%). This varies from other reports of Caucasian populations where the majority of expansions detected were at the SCA3 locus. However, these results compare favourably with those detected in sporadic and familial cases from the UK (Leggo et al. 1997). Additionally, we did not detect any expansions at the SCA2 or SCA6 loci which directly contrasts with results from other groups (Table 1). Further, it would appear that the overall detection rate in this patient group is less than other groups (Table 1). Several possible reasons for this are the large number of sporadic cases, the lack of control over strict clinical criteria for testing and the great ethnic diversity that exists in Australia. Moreover, many of the patients tested have limited clinical data and thus diagnostic testing at the SCA loci may not have been entirely appropriate in these cases. Screening of the Australian population as indicated by this study would suggest that screening for expansions at the SCA1 and SCA3/NIJD attains reasonable detection of mutations in families with inherited forms of SCA. However, given the very different relative frequencies of detection of SCAs in different populations and the ethnic diversity that exists in Australia a screen which includes all the SCAs would provide a more thorough service. Moreover, screening for all loci in sporadic cases would achieve the best detection. It will be interesting to elucidate the mutation causing the disease in the remaining 78% of individuals with hereditary SCA. Symptoms in these patients may be due to mutations in the SCA4 (chromosome 16), SCA5 (chromosome 11), SCA10 (chromosome 22) or SCAll (chromosome 15) loci (Ranum et al. 1994, Flanigan et al. 1996, Worth et al. 1999, Zu et al. 1999). Rapidly progressive ataxia have been shown to be due to a point mutation in the CACNA1A gene (SCA6) (Yue et al 1997). However, given the large size of this gene, 248 screening for mutations is not feasible in a diagnostic setting, Insufficient material from familial cases was available to assess linkage at these loci (ie. SCA4, SCA5, SCAIO and SCAI l). While endeavouring to identify a disease causing locus, several (CAG)n positive cDNA clones were screened for possible expansions. Whilst this method is not the most direct route for identification of a disease causing mutation it is warranted given the high number of unidentified cases of SCA and the strong role expansions of CAG repeats play in this group of disorders. Other groups have examined other (CAG)n repeat containing oDNA clones with no expansions identified (Pujana et al. 1997). FIowever, DRPLA and SCA6 are examples of diseases identified by such a protocol (Koide et al. 1994, Zhuchenko et al. 1997). Most recently a (CAG)', expansion in the TATA-binding protein gene (TBP) has been identified in a sporadic case of sevete ataxia with associated intellectual deterioration (Koide et al. 1.eee). Eight (CAG)n repeats from oDNA clones which map to various cluomosomes were analysed (CTG2Oa, CTG7a, H16, CAG4a, CAGRI, H3, CAG3a and L237) Margolis et al. 1996, 1997)). Additionally the (CAG)n repeat associated with TBP was screened. No expansions were detected at any of these (CAG)n repeats and thus, it would appear that these (CAG)n repeats are not involved in the neurodegenerative disorders of the patient sample examined. There are many more cDNA clones which contain (CAG)n tracts and are therefore good candidates for testing in these and other spinocerebellar ataxia patients in an attempt to find a pathological expansion responsible for disease progression. ßiggtns et al. 7992,Li et al. 1993, Margolis et al. 1996, Reddy et al. 1997, Albanese et al. I 998). \üe are able to demonstrate from this study that the most common mutations detected in Australian patients with familial SCA, are expansions at the SCAI and SCA3AvÍJD loci. Together, mutations in these (CAG)n repeats account for approximately 22.2o/o. There remains, therefore, a large proportion of cases which are unaccounted for. The molecular diagnosis in sporadic cases is even more unclear with 92% of cases tested of unknown cause. 249 Presently then, clinicians can expect a llYo detection rate for all cases, with this figure rising to 220/o if a strong family history exists. The identificationof the mutations at the SCA4, SCA5, SCA1O and SCAI1 loci may well enable molecular diagnosis of some of the cwrently unresolved cases. We also have a large SCA family which does not map to any of the SCA localisations (SCAI, SCA2, SCA3, SCA4, SCA5, SCA6, SCA7, SCA8, SCA10, SCA1l or DRPLA) (unpublished data). Results from this family and other linkage analysis suggests the existence of at least 4 more genes responsible for spinocerebellar ataxta(Worth et al. 1999,Zt et al. 1999, Koide et al. 1999). A large number of SCA cases remain undiagnosed clearly emphasising the genetic and clinical heterogeneity that prevails within this group of disorders. The identification of new genes responsible may aid diagnosis hightighting the need for identification of new genes for this exfiemely heterogeneous group of disorders. As new mutations are discovered it will be important to rescreen previously negative cases of spinocerebellar ataxia. 250 ethnic origin (ner ) SCA1 SCA2 SCA3 SCA6 SCAT DRPLA SCAS FRDA TOTAL Familial German (1+2) NS 14o/" NS 13% NS NS NS NS NA Japanese (3) 0% 5.9/o 33.7% 5.9% NS 19.8% NS NS 65% Brazilian (4) 6%F eøs 9% F oøs 44o/"F eov"s NS NS o% NS NS 59% Portuguese (5) 0% 4% 7Oo/" 0% NS 0% NS NS 74h Canada (various) (6) 10/"F z"l"s NS 41"hF ttv-s 0"h NS 1V" NS NS 52% NS NA France (various) (7) NS 157" F s"s NS NS NS NS NS NS NA US (various) (8) 3% NS 21"/"F t*s NS NS NS NS NS NA US (various) (9) NS NS NS 1?/" NS NS NS 11"/"R s.zt"s US (various) (10) 5.6% 15.2"/" 20.8% 15.æ/" 4.5/" NS NS 72% NS UK (various) (11) 35Y" 4O/o 15o/o NS NS NS NS 90h 157dS) UK (various) (12) 5/"F lvæ 5o/"F qxs O1"F tv"s 5%F szs NS 0"/"Fl'^s NS 3%s 15% Aust (various) 17o/"F s.ø*s o% 6/"F z.rxs Oo/o 1%S Oo/o o"h 1olos 2P/o 8%(S) Table 2 ; Comparison of results from literature of ditferent ethn¡c groups. Results_from this study (in bold) compare well with those from the UK study (REF 12) (F = familial cases S = sporadic cases R = recessive cases of SCA) REFs : 1 Reiss 1997 et al. 1997, 2 schols et al. 1998, 3 Watanabe et al. 1998, 4 Lopes-Cendes et a1.1997, 5 Sitveira et al. 1998, 6 Silveira a ai. lggO, 7 Cancel et al. 1997, I Ranum et al. 1995, 9 Geschwind et al. 1997, 10 Moseley et al. 1998,11 Giunti et al. 1998, 12 Leggo et al. 1997, ¡! (.Ir Cancel G, Durr A, Didierjean O, Imbert G, Burk K, Lezin A, Belal S, Benomar A, Abada-Bendib M, Vial C, Guimaraes J, Chneiweiss H, Stevanin G, Yvert G, Abbas N, Saudou F, Lebre AS, Yahyaoui M, Hentati F, VernantJC, Klockgether T, Mandel JL, Agid Y, Brice A. Molecular and clinical correlations in spinocerebellar ataxta 2: a study of 32 families. Hum Mol Genet 1997 May;6(5):709-15 Camptzano V, Montermini L, Molto MD, Pianese L, Cossee M, Cavalcanti F, Monros E, Rodius F, Duclos F, Monticelli A, et al Friedreich's ataxia: autosomal recessive disease caused by an intronic GAA triplet repeat expansion. Science 1996 Mar 8;271(52s4):r423-7 Chamberlain JS, Gibbs RA, Ranier JE, Nguyen PN, Caskey CT. Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucleic Acids Res. 1988 Dec 9;16Q3):rll4l-56. David G, Abbas N, Stevanin G, Durr A, Yvert G, Cancel G, Weber C, Imbert G, Saudou F, Antoniou E, Drabkin H, Gemmill R, Giunti P, Benomar A, Wood N, Ruberg M, Agid Y, Mandel JL, Brice A Cloning of the SCAT gene reveals a highly unst¿ble CAG repeat expansion. Nat Genet 1997 Sep;17(l):65-70 Filla A, De Michele G, Campanella G, Perretti A, Santoro L, Serlenga L, Ragno M, Calabrese O, Castaldo I, De Joanna G, Cocozza SAutosomal dominant cerebellar ataxiatype I. Clinical and molecular study in 36 Italian families including a comparison between SCAI and SCA2 phenotypes. J Neurol Sci 1996 Oct;142(l-2):140-7 Flanigan K, Gardner K, Alderson K, Galster B, Otterud B, Leppert MF, Kaplan C, Ptacek LJ Autosomal dominant spinocerebellar ataxia with sensory axonal neuropathy (SCA4): clinical description and genetic localization to chromosome 16q22.1. Am J Hum Genet 1 996 Aug;59(2):392-9 Geschwind DH, Perlman S, Figueroa CP, TreimanLJ, Pulst SM The prevalence and wide clinical spectrum of the spinocerebellar ataxiatype trinucleotide repeat in patients with autosomal dominant cerebellar ataxia. Am J Hum Genet 1997 Apr;60(4):842'50 Geschwind DH, Perlman S, Grody WW, Telatar M, Montermini L, Pandolfo M, Gatti RA Friedreich's ataxtacAA repeat expansion in patients with recessive or sporadic ataxta. Neurology 1997 Oct;49(4): I 004-9 252 Giunti P, Sabbadini G, Sweeney MG, Davis MB, VenezianoL, Mantuano E, Federico A, Plasmati R, Frontali M, WoodNW The role of the SCA2 trinucleotide repeat expansion in 89 autosomal dominant cerebellar ataxta families. Frequency, clinical and genetic correlates. Brain 1998 Mar;l2I (Pt3):459-67 Imbert G, Saudou F, Yvert G, Devys D, Trottier Y, Garnier JM, Weber C, Mandel JL, Cancel G, Abbas N, Durr A, Didierjean O, Stevanin G, Agid Y, Brice A Cloning of the gene for spinocerebellar ataxia 2 reveals a locus with high sensitivity to expanded CAG/glutamine repeats. Nat Genet 1996 Nov;14(3):285-91 Kawaguchi Y, Okamoto T, Taniwaki Nf, Aizawa M, Inoue lvI, Katayama S, Kawakami H, Nakamura S, Nishimura M, Akiguchi I, et al. CAG expansions in a novel gene for Machado- |oseph disease at chromosonel4q12.1. Nat Genet 1994 Nov;8(3):221'-8 Koide & Ikeuchi T, Onodera O, Tanaka H, Igarashi S, Endo K Takahashi H, Kondo R, Ishikawa A, Hayashi T, et al. Unstable expansion of CAG repeat in hereditary dentatorubral-pallidoluysian atrophy (DRPLA). Nat Genet 199 4 6 :9 -13 Koide R, Kobayashi S, Shimohata T, Ikeuchi T, Maruyama M, Saito IrtI, Yamada M, Takahashi H and Tsují S. A neurological disease caused by * expanded CAG trinucleotide repeat in the TATA-binding protein gene: a new polyglutamine disease? Hum Mol Genet 1999 8:2O47-2053 Koob MD Moseley ML, Schut Ll, Benzow KA, Bfud TD, Day JW, Ranum LP. An untranslated CTG expansion causes a novel form of spinocerebellar ataxia (SCA8). Nat Genet 1999 Apt ;21, @):37 9 -8a LeggoJ, Dalton A, Morrison PJ, Dodge A, Connarty M, Kotze MJ, Rubinsztein DC Analysis of spinocerebellar ataxia types t, 2, 3, and 6, dentatorubral-pallidoþsian atrophy, and Friedreich's ataxia genes in spinocerebellar ataxta patients in the UK. J Med Genet 1997 Dec;34(12):982-5. Li S-H, Mclnnos MG, Margolis RL, Antonarakis SE and Ross CA Novel triplet repeat containing genes in human brain: cloning expression and length polymorphism. Genomics 16, 572- 57e (tee3) Lindblad K, Savontaus ML, Stevanin G, Holrnberg M, Dige K, Zander C, Ehrsson H, David G, Benomar A, Nikoskelainen E, Trottier Y, Holmgten G, Ptacek LJ, Anttinen A, Brice A, Schatling M An expanded CAG repeat sequence in spinocerebellar ata> 1996 Oct;6(10):965-71 253 Lopes-Cendes I, Teive HG, Calcagnotto ME, Da Costa JC, Cardoso F, Viana E, Maciel JA, Radvany J, Amrda WO,Trevisol-Bittencourt PC, Rosa Neto P, Silveira I, Steiner CE, Pinto Junior W, Santos AS, Correa Neto Y, Werneck LC, Araujo AQ, Carakushansky G, Mello LR, Jardim LB, Rouleau GA Frequency of the different mutations causing spinocerebellar ataxia (SCAI, SCA2, MJD/SCA3 and DRPLA) in ù large group of Brazilian patients. Arq Neuropsiqu íatr 1997 Sep; 5 5(38)'. 5 19 -29 Lorenzetti D, Bohlega S, Zoghbi HY The expansion of the CAG repeat in ataxin-2 is a frequent cause of autosomal dominant spinocerebellar ataxia. Neurology 1997 Oct;49(4):1009- 13 Margolis RL, Stine OC, Mclnnis MG, Ranen NG, Rubinsztein DC, Leggo J, Brando LV,Kidwai AS, Loev SJ, Breschel TS, Callahan C, Simpson SG, DePaulo JR, McMahon FJ, Jain S, Paykel ES, Walsh C, Delisi LE, Crow TJ, Torrey EF, Ashworth RG, Macke JP, Nathans J, Ross CA. oDNA cloning of a human homologue of the Caenorhabditis elegans cell fate-determining gene mab-21: expression, chromosomal localization and analysis of a highly polymorphic (CAG)n trinucleotide repeat. Hum Mol Genet 1996 May;5(5):607-16 Margolis RL, Abraham MR, Gatchell SB, Li SH, Kidwai AS, Breschel TS, Stine OC, Callahan C, Mclnnis MG, Ross CA cDNAs with long CAG trinucleotide repeats from human brain. Hum Genet 1997 Jul;100(1):ll4-22 Mizushima K, Watanabe M, Abe K, Aoki M, Itoyama Y, Shizuka M, Okamoto K, Shoji M Analysis of spinocerebellm ataxia type 2 in Gunma Prefecture in Japan: CAG trinucleotide expansion and clinical characteristics. J Neurol Sci 1998 Apr 1;156(2):180-5 Moseley ML, Benzow KA, Schut LJ, Bird TD, Gomez CI|ll', Barkhaus PE, Blindauer KA, Labuda M, Pandolfo M, Koob MD, Ranum LP Incidence of dominant spinocerebellar and Friedreich triplet repeats ¿rmong 361 ataxia families. Neurology 1998 Dec;51(6):1666-71 Nagafuchi S, Yanagisawa H, Sato IÇ Shirayama T, Ohsaki E, Bundo M, Takeda T, Tadokoro K, Kondo I, Murayama N, et al. Dentatorubral and perllidoluysian atrophy expansion of an unstable trinucleotide on chromosomel2p. Nat Genet 1994 6:'1,4-18. Orr HT, Chung MY, Banfi S, Kwiatkowski TJ Jr, Servadio A, Beaudet AL, McCall AE, Duvick LA, Ranum LP, Zoghbi HY Expansion of an unstable trinucleotide CAG repeat in spinocerebellar ataxiatype 1. Nat Genet 1993 Jul;4(3):221-6 254 Pujana MA, Gratacos M, Corral J, Banchs I, Sanchez A, Genis D, Cervera C, Volpini V, Estivill X Polymorphisms at 13 expressed human sequences containing CAG/CTG repeats and analysis in autosomal dominant cerebellar ataxta (ADCA) patients. Hum Genet 1997 Nov;l0l(1):18-21 Pulst SM, Nechiporuk A, Nechiporuk T, Gispert S, Chen XN, Lopes-Cendes I, Pea¡lman S, Starkman S, Orozco-Diaz G, Lunkes A, DeJong P, Rouleau GA, Auburger G, Korenberg JR, Figueroa C, Sahba S Moderate expansion of a normally biallelic trinucleotide repeat in spinocerebellar ataxtatype 2, Nat Genet 1996 Nov;I4(3):269-76 Ranum LP, Schut LJ, Lundgren JK, Orr HT, Livingston DM Spinocerebellar ataxia type 5 in a family descended from the grandparents of President Lincoln maps to chromosome 11. Nat Genet 1994 Nov;8(3):280-a Ranum LP, Lundgren JK, Schut LJ, Ahrens MJ, Perlman S, Aita J, Bird TD, Gomez C, On HT Spinocerebellar ataxiatype 1 and Machado-Joseph disease: incidence of CAG expansions amongadult-onset ataxtapatients from 3ll families with dominant, recessive, or sporadic ataxta. Am J Hum Genet 1995 Sep;57(3):603-8 Riess O, LacconeFA, Gispert S, Schols L, Uhlke C, Menezes Vieira-SaeckerAM, Herlt S, Wessel K, Epplen JT, WeberBHF, Kruez F, Chahrokh-Zadah S, Meindl A, Lunkes A, Aguiar J, Macek MJr., Krebsova A, Macek MSen., Burk K, Tinschert S, Schreyer I, Pulst SM and Auburger G. SCA2 trinucleotide repeat in German SCA patients Nuerogenetics 1997a l:l 59-64 Riess O, Schols L, Bottger H, Nolte D, Vieira-Saecker AM, Schimming C, Kreuz F, Macek M Jr, Krebsova A, Macek M Sen" Klockgether T, ZuhIke C, Laccone FA SCA6 is caused by moderate CAG expansion in the alphalA-voltage-dependent calcium channel gene. Hum Mol Genet 1997b Aug;6(8):1289-93 Sanpei K, Takano H, Igarashi S, Sato T, Oyake M, Sasaki H, Wakisaka A, Tashiro K, Ishida Y,Ikeuchi T, Koide R, Saito M, Sato A, Tanaka T, Hanyu S, Takiyama Y, Nishizawa M, Shimizu N, Nomura Y, Segawa M, Iwabuchi K, Eguchi I, Tanaka H, Takahashi H, Tsuji S Identification of the spinocerebellar ata> expansion and cloningtechnique, DIRECT. Nat Genet 1996 Nov;14(3):277-84 Silveiral, Lopes-Cendes I, Kish S, Maciel P, Gaspar C, Coutinho P, Botez MI, Teive H, Amrda W,Steiner CE, Pinto-Junior W, Maciel JA, Jerin S, Sack G, Andermann E, 255 Sudarsky L, Rosenberg R, Macleod P, Chitayat D, Babul R, Sequeiros J, Rouleau GA Frequency of spinocerebellar ataia type 1, dentatorubropallidoluysian atrophy, and Machado-Joseph disease mutations in a large group of spinocerebellar ataxia patients. Neurolo gy 19 9 6 J an;4 6(l):2 I 4 -8 Silveiral, Coutinho P, Maciel P, Gaspar C, Hayes S, Dias A, Guimaraes J, Lotueiro L, Sequeiros J, RouleauGA Analysis of SCAI, DRPLA, MJD, SCA2, and SCA6 CAG repeats in 48 Portuguese ataxiafamilies. Am J Med Genet 1998 ll/;ar 28;8lQ):134-8 Takano H, Cancel G, Ikeuchi T, Lorenzetti D, Mawad R, Stevanin G, Didierjean O, Durr A, Oyake M, Shimohata T, Sasaki R, Koide R,Igarashi S, Hayashi S, Takiyama Y, Nishizawa M, Tanaka H, Zoghbi H, Brice A, Tsuji S Close associations between prevalences of dominantly inherited spinocerebellar ataxias with CAG-repeat expansions and frequencies of large normal CAG alleles in Japanese and Caucasian populations. Am J Hum Genet 1998 Ocü63(4):1060-6 Watanabe H, Tanaka F, Matsumoto M, Doyu M, Ando T, Mitsuma T, Sobue G Frequency analysis of autosomal dominant cerebellar ataxias in Japanese patients and clinical characteization of spinocerebellar ataxiatype 6. Clin Genet 1998 Jan;53(1):13-9 Worth PF, Giunti P, Gardner-Thorpe C, Dixon Plt Davis MB and Wood NW 1999 Autosomal dominant cerebell¡ar ataxia type III: Linkage in a large British famiþ to a 7.6cM region on chromosome 15q14-2L.3 Am I Hum Genet 1999 Aag;65(2):a20-6 Zhuchenko O, Bailey J, Bonnen P, Ashizawa T, Stockton DW, Amos C, Dobyns WB, Subramony SH, Zoghbi HY, Lee CC Autosomal dominant cerebellar atøxia (SCA6) associated with small polyglutamine expansions in the alpha lA-voltage-dependent calcium channel. Nat Genet 1997 J an;l 5(l\.62-9 Zu L, Figueroa KP, Grewal R, Pulst SM Mapping of a new autosomal dominant spinoc ereb ellar ataxia to chromosome 256 APPENDD(VI Localisation of autosomal dorninant purs congenital ataxía to 3pter. K Friend, T Dudding, R Richards - A paper in preparation ABSTRACT Mapping studies in a large family (PK80284) segregating for congenital ataxia with associated mental retardation, or non progressive congenital ataxia (NPCA), indicate linkage to chromosome 3p: maximum two point lod score 4.26 at 0:0 for the microsatellite marker D3S3630. This represents the first genetic localisation for an autosomal dominant pure congenital ataxia. Several plausible candidate genes with neurological involvement reside within the genetic interval identified: inositol 1,4,5 - triphosphate receptor type L (ITPRl), neural cell adhesion molecule (CALL) and plasmacytoma - associated neuronal glycoprotein (PANG), and are currently b.itg screened for mutations. Significantþ NPCA is the most difficult category of the congenital ataxias to clinícally diagnose since within this group considerable clinical heterogeneity exists. For the majority of cases prognosis is not possible from early developmental milestones, neurological signs or neuroimagþg (Steintin et al. L998a). Thus, this genetic localisation will lead to the eventual identification and characterisation of the disease gene and availability of precise molecular diagnosis and improve prognosis. 257 Intuoduction Published clinical data pertaining to the hereditary congenital ataxias is sparse, based on few familial cases, with limited family material available and assessed. This particular group of ataxias is characterised by early symptoms of hypotonia and developmental delay, with slightþ later presentation of ataxia. In generat the ataxia is a chronic problem, neither deteriorating nor improving significantly with age, however, improvement is noted in some individuals as they presumably leam to compensate for motor problems (Fururan et al. 1984, Fenichel and Phillips 1989). These disorders can be classified into two distinct groups: 1) non progressive ataxia without additional symptoms (pure congenital ataxia) and 2) syndromes with associated congenital ataxia. Pure congenital ataxia or non progressive congenital ataxia (NPCA) can be due to abnormalities such as cerebellar hypoplasia. Accurate diagnosis of the more distinctive syndromal congenital ataxias may be possible by clinical assessment (Al Shawan et al. lees). The majority of disorders in this group fall into the broad category of pure congenital ataxia and while clinical identification of this class of ataxias is possible, it is a very general classification. Whilst it is commonly accepted that these disorders are clinically and genetically heterogeneous, a diagnosis of congenital ataxia can be useful for clinical assessment. Early prognosis from developmental milestones, neurological signs and neuroimaging is difficul! however, follow up of individuals c€ur lead to a more confident clinical diagnosis of these non-progressive congenital ataxias (Steinlin 1.998a, Steinlin et al. 1ee8b). There has been little genetic characterisation for the congenital ataxias. Mutations in the paired box homeotic gene, PAX6, have been proposed to be involved in the autosomal recessive syndromal congenital ataxia, Gillespie syrrdrome (Glaser et aI. 1994; Dollfus et al. L998). Mutations in this same gene have been shown to cause aniridia (absence of the iris). Partial aniridia is an associated phenotype descríbed in patients with Gillespie slmdrome, leading to the supposition that this gene may somehow be implicated. Apart from this minor overlap in phenotype, however, there is little evidence to support the involvement of 258 PAX6, and in fact most data suggests the contrary. Glaser et al. (!994) detected no changes nPAX6 by SSCA analysis in three families with Gillespie s¡rndrome and in the same study two of the families segregated independentþ of the 11p13 localisation of the PAX6 gene. Further evidence which excludes the involvement of lJ:re PAX6 gene in Gillespie syndrome is provided from a study by Dollfus et al. (L998). This group identified a patient with Gillespie syndrome and a de noao translocation t(X;11)(p22.32;p12). The 11p12 breakpoint is close to the physical location of the PAX6 gene, however, fluotescent in situ hybridisation and mutation screeningof PAX6 indicate that the gene remains physically unaltered. To date the orùy sound genetic information regarding the congenital ataxias has been the genetic localisation of two congenital ataxias, an autosomal recessive syndromal form and an X-linked pure congenital ataxia. The rare autosomal recessive syndromal congenital ataxia, infantile onset spinocerebellar ataxia (IOSCA) has been genetically localised at I0q24 (Nikali et al. 1995). Although no gene(s) has been identified for this disorder, two potential candidate genes PAXZ, a transcription factor, and CYPL7, a cytochrome with a major role in steroid productiorç lie within and close to the critical region respectively. Although CYP77 does not lie immediately within the region defined by ancestral recombination; it was considered as a candidate gene because of the clinical finding of hypogonadism in females with IOSCA. Sequence analysis of the coding regions of both these genes revealed no djfferences when compared with normal control samples, although mutations within the intronic sequences (eg splice site mutations) or regulatory regions were not excluded in this screen (Nikali et aL.1997). The clinically more homogeneous group of pure congenital ataxias with associated mental retardation has only an X-linked form genetically positioned. This pure congenital cerebellar hypoplasia syndrome has been mapped to a 38 cM interval on the short arm of the X chromosome (Illarioshkin et al. \996) *d remains the only reported genetic localisation to date. Thus, it is important to study families which fall into this clinical category in order to gain an understanding of the genetic mechanism, with the ultimate goal ol elucidating the function of all of the genes involved in these disorders. The following describes linkage mapping in a single family with non progressive congenital ataxia (NPCA) which does not segregate with the X chromosome. 259 Material and Methoda Subjects - Clinical description A large family segregating for an autosomal dominant congenital ataxia was analysed in an attempt to localise and eventually identify the gene involved in the disorder. This family consisted of.47 tndividuals, of which DNA was available and collected from 25 individuals, L5 of whom were classified as affected (Pedigree: Figure 1). Clinically this family has non progressive congenital ataxia with associated mental retardation. Ataxia is present ftom birth and delay in walking has been noted in affected individuals. Older members of the pedigree experience gait ataxia and dysarthria although grtor the non progressive nature, symptoms vary in this older generation and affected members often have more mild symptoms as they have apparently learned to compensate for motor problems. Individual II.8 was apparentþ difficult to examine, having received hip damage from a car accident, thus affecting assessment of gait ataxia. Individual III.L has not been personally examined but is thought to be unaffected from information gained by other family members, however, it is believed that this individual does have dysarthria. Individual III.18 is a poor student at school and has nystagmus as the only sign of cerebellar ataxia - notably in this male, gait ataxia and dysarthria were absent. Additionally several affected members, III.6 and IV.2, have marked vennal hypoplasia on MRI (magnetic resonance imaging). llowever, this clinical feature is not universal among apparentþ similarly affected individuals. Individuals II.6, III.7 and III.9 do not have abnormalities detected on MRL IT is important to note that MRIs have not been conducted on any other individuals and thus, this has not been established as a reliable indicator for phenotype. The phenotype characterised in this famiþ most closely resembles that described by Fenichel and Phillips (19S9). AJfected individuals are described to have non progressive ataxia from birth. Additionally, magnetic resonance imaging results indicating hypoplasia of the cerebellar vermis was described in some but not all affected individuals (Furman et al. 260 1985, Tomiwa et aL 1987, Rivier and Echerure 1992 and Imamura et al. L993). Although few affected individuals with this, or a similar disorder, have been described the clinical description appears consistent with that described in the family central to the present study. Linkage analysis Aasessment of known SCA loci. I4/hile it is unlikely that a (CAG)'. expansion at any of the lüown late onset SCA loci is involved in this disorder it is possible that another mutation within one of these genes may cause a clinically distinct but allelic congenital ataxia. To test this hypothesis, linkage analysis at SCA loci (SCAL, SCA2, SCA3/MID, SCAÇ SCAT and DRPLA) was undertaken to exclude an allelic mutation at one of these genes. The primer sequences for these analyses are described below; Repeat expansion at the SCA1 locus was analysed using ptimers Repl and Rep2 (Orr et a1.L993). Primers MJD25 and MJD52wereused to amplify the (CAG)', repeat expansion at the SCA3/MJD locus (Kawaguchi et al1,994) while repeat copy number at the SCA2 locus was analysed using primers DAN1-UH13/UH15 (Imbert et aI.1.996). SCAT expansions were amplified using primers 4UL024 and4U7t6 (David et aI.!997) and the primers CTG- 837-F and CTG-837-R were used to detennine the allele sizes at the DRPLA locus (Koide et aI.I994). At the SCA6 locus minor modifications from previously published primer sequences were utilised. S-5-R1 was used as published but a new forward primer ( designated S-5-F2) 5' TTC CGT AAG TGG AAG CCC AGC CCC C 3' was designed from published sequence (Zhuchenko et al. 1997). The combination of S-5-F1 and S-5-F2 gave less non specific bands than S-5 F1/R1 under our experimental conditions. PCR conditions used were the same as those used by Chamberlain et al, 1.988 with the substitution of 7-deaza dGTP (Pharmacia) for dGTP and the inclusion of 32p dCTP. The only other modification was a reduction of the final concentration of dNTPs to 400pM. All products were resolved on a 57" denaturirg polyacrylamide gel and compared to larown conhols. (Allele sizes of these controls were determined by sequencing.) Additionally, linkage was also tested to microsatellite markers, D10S530 and D10S192, at the chromosome 10 localisation identified for a rare recessive form of congenital ataxia (IOSCA). This was carried out to exclude the hypothesis that this gene might be involved. Primer pairs used in the analysis for chromosome 10 were D10S192 and D10S530. 26r Linkage analysis to other known loci SCA4, SCAS and SCAL1, was also undertaken to eruure that these loci were not involved. Microsatellite markers used for these analyses wel€ D165402, D16S393 (SCA4), D11S903, GATA, D11S905, (SCAs) D225274 (SCA11). Linkage analysis \ /hen linkage to lcrown SCA localisations was excluded, an automated genome screen was conducted to identify the region linked to the disease gene in this family. The average distance between markers was 20cM. Primer sequences for analysis of microsatellite matkers were obtained from several sources. The majority of sequences are reported in Gyapay et al. (1.994) and Dib et al. (1996), whilst others were accessed through CHLC (Cooperative Human Linkage Centre at http: / / www.ctrlc.org/ ). Calculation of two point lod scores was based on the pedigree structute and affection status as indicated in the pedigree (Figure 1). The two point linkage analysis was performed using the Linkage 5.2 package (Lathrop and Lalouel 1984) under the assumption of autosomal dominant inheritance and a disease ftequency of 1:L0 000. The allele frequencies were assumed to be equal for each marker tested. Given that age of onset is early, penetrance was set at 1,.00. Results from the two point linkage analysis from the extended pedigree were examined using the EXCLUDE. This procedure condensed genome-wide lod scores to highlight the most probable regions of linkage, which were then subjected to precise multipoint analysis. Multipoint mapping Multipoint analysis of chromosome 3 markers D3SSL297, D3S3630, and D3S1304 The genetic distances set between adjacent markers were ascertained from various maps (Gyapay et al.1994, Dib et aL.1996). Resulte Linkage analysis Known SCA localisatlons Linkage analysis revealed that the gene segregating in this family with congenital ataxia was not any of those for the already identified loci (SC41,2,3,4,5,6,7,1,0 and DRPLA), excluding the possibility oI a different type of mutation inthese genes. Further, CAG repeat expansion analysis revealed that there was no expansion in affected members of this family (PK80284) 262 for those genes lcrown to have CAG expansions associated with SCA (SCAI, SCAZ, SCA3, SCAT and DRPLA) (results not shown). Additionally, microsatellite markers ünked to a rare autosomal recessive disorder IOSCA, located at 10q24, were screened; again no evidence of linkage to this locus was found. Linkage analyses for all of these sites are in Tables 1 artd2. Table 1: Two point lod scores for (CAG)'. repeat polymorphism at known SCA loci in family PK80284 (NPCA). Two point lod scores at 0 : MARKER O.OO 0.05 0.1 o.2 0.3 0.4 rc41 -infinity -3.60 -2.48 -1.30 -0.68 -0.29 SCA2 -infinity -7.37 -o.73 -o.2L -0.06 -0.05 SCA3 -infinity -4.86 -3.17 -1.57 -o.75 -o.26 DRPLA -infinity -2.57 -1.87 -1.O2 -0.53 -0.21 SCA6 -infinity -3.1.6 -2.O3 -0.98 -0.45 -0.15 SCAT -infinity 0.1 0.30 0.40 0,35 0.21 Table 2: Two point lod scores for microsatellite markers at SCA localisations- chromosome 16 (SCA ), chromosome 1L (SCAS) chromosome 22 (SCA11) and chromosome 10 (IOSCA) and family PK80284. Two point lod scores at 0 : MARKER O.O 0.01 0.05 0.L o.2 0.3 0.4 D165402 -infinity -2.O9 -0.88 -0.52 -0.38 -0.32 -0,15 D165393 -infinity --ó.L0 -3.O7 -1.79 -o.72 -o.29 -0.10 D115903 -infinity -5.88 -3.42 -2.28 -1.18 -0.59 -0.23 GATA -infinity --3.09 -L.72 -1.14 -0.59 -0.30 -0.11 D115905 -infinity -5.38 -2.71. -1..63 -o.69 -o.26 -0.06 D105530 -infinity -L.39 -o.72 -0.44 -o.19 -0.08 -0.02 D105192 -i"fioity -2.19 -0.88 -0.38 0.02 0.14 o.12 D225274 -infinity -3.11 -1.76 -1.18 -0.58 -o.24 -0,06 263 Genome Ecfeen Automated genotyping to complete the anaþsis of the genome was undertaken at the AGRF. This service generates raw genotype data which can then be readily analysed by linkage programs (ie MLINK); all linkage analyses were undertaken by the candidate. Markers examined were spaced on average 20 cM apart. Two point LOD scores were calculated using the extended pedigree in Figure 3-1. Individuals III.7 and IV.6 were not analysed for all markers due to exhausted and limited DNA supplies respectively. Results from the entire genome screen are in Appendix I. Analysis of the genotype data obtained revealed several regions of potential interest, including chromosomes 3, L3 and 21. Analysis of additional markers revealed linkage at chromosome 3p (Table L), with the regions on chromosomes 2l- and L3 excluded (data not shown). The microsatellite markers D3S3630 gave a lod score suggestive of linkage (z :2.89 at 0=0.05). Additional markers at this possible chromosome 3 localisation were assessed to clarify the possibility of linkage to this region (Table 1). Individual II.8 was difficult to examine due to hip injuries sustained in a car accident and therefore was assigned unlmown affection status to assist determining genetic location. A maximum lod score of 4.26 (g = 0.00) was attained for the microsatellite marker D3S3630. Results from haplotype analysis (pedigree - Figure 2) indicate the that the disease gene lies distal to D3S1304 on tip o1 chromosome 3p. 264 Table 1: Initial two point lod scores for extended pedigree and chromosome 3 microsatellite markers - Individual IL8 coded as unaffected. Two point lod score at 0= MARKER O.O 0,01 0.05 0.1 o.2 0.3 0,4 D3S1307 -infinity 1.26 1.77 1.81 1.55 1.O9 0,53 D357297 -infinity 1.72 2.\9 2.\8 1.85 1.35 o.73 D3S3630 -infinity 2.49 2.89 2.79 2.25 1.50 o.66 D3S1304 -infinity -0.56 t.22 1..7L L.73 1.30 0.67 D351263 -infinity o.70 1.80 2.O2 1.80 \.27 0,60 D3S2338 -infinity -o.56 1.22 1..71 L.73 1.29 o.63 Table 2z Two point lod scores for extended pedigree and microsatellite markers on chromosome 3 - Lrdividual II.8 coded as tmlinown. Two point lod score at 0= MARKER O.O 0.01 0.05 0.1 o.2 0.3 o.4 D33\307 3.01 2.96 2.77 2.57 7.94 1.31 o.61. D351297 3.87 3.O2 2.85 2.68 1.85 1.35 o.73 D353630 4.26 4.19 3.89 3.49 2.65 1.72 o.74 D3S1304 -infinity 1.14 2.22 2.41. 2.12 1.51 0.75 D35\263 -infinity o.41. 1.53 t.77 1.60 1.13 0.54 D352338 -infinity -0.86 o.94 L.45 1.52 1..L4 o.57 3.4.L EXCLUDE results Using data from the initial pedigree, results from the EXCLUDE analysis support the same regions indicated by two point linkage analysis, confirrring that regions on chromosome2l and 3 are the most likeþ locations for the congenital ataxia disease gene segregating in the family (PK80284) exarnined. Although the ptobability indicates that the disease gene is most likeþ on chromosome 21. (89%), the results for likeUhood of most likeþ position indicate greater involvement of chromosome 3 (Table 3). Additional markers in these regions were tested in the family to identìfy which of these regions is more consistent with linkage. Haplotype analysis was consistent with the location of the disease gene being on chromosome 3p, assuming an unknown affection status for individual II.8 (Figure 1). This individual is difficult to examine due to hip damage resulting from a car accident. 26s Table 3: Exclude results from lod scores genome screen of. 20 cM coverage of microsatellite markers; (Probabilities are expressed as percentages, Max likelihood = maximum likelihood: likelihood of the most probable positíon - rounded up to whole number). Chromosome Probability (%) Max Likelihood 1 0.08 33\1 2 0.00 5 3 10.62 4711186 4 0.00 1. 5 0.00 2 6 0.00 1 7 0.00 72 I 0.03 2976 9 0.00 't 10 0.00 20 1.1 0.00 1 12 0.00 40 13 0.00 7271, 14 0.00 1 15 0,00 J 16 0.00 6 17 0.00 9 18 0.00 1 79 0.00 6 20 0.00 1. 2't 89.27 1604542 22 0.00 3 266 Multipoint analysis Multipoint anaþsis for microsatellite markers D1SL297, D3S3630 and D3S1304 was conducted to identify the maximum lod score. The maximum lod score achievedwas 3.43, with the most likeþ location of the gene to be between D3S3630 and D3S1297 (Figure 2). Discussion Microsatellite markers on distal 3p gave the highest two point lod scores (Tables 1, and 2). Although there was discordance between clinical and marker data - individual II.8 was presumed to be clinically unaffected although appeared to have inherited the "disease" chromosome 3p. This individual was difficult to examine for gait ataxia, having received hip damage from a car accident and thus for the purpose of identifying the localisation on 3p, an unknown clinical status may in fact be more appropriate for this individual. Reassessment of two point lod scores after recoding II.8 to affection unlcrown gave a maximum two point lod score o14.26 at D3S3630. Multipoint analysis with the phenotype of this individual (II.8) set as unaffected, achieved a maximum lod score of 3.43, placing the disease between D3S3630 and D3S1297, t}ltus confirming the results of the two point analysis. Recombination events indicate the critical region to be distal of D3S1304, within a genetic distance of l,8.9cM (Gyapay et al.1996). Database searches revealed the following genes, among others, within this interval :- Inositol 1,4,5.-triphosphate receptor type 1-, neural cell adhesion molecule and plasnacytoma-associated neuronal gþoprotein. Each of these genes could be considered a valid positional candidate for the following reasons: Type 1 inositol'1,4,5 - triphosphate receptors (ITPRI) couple to calcium charurels and bind inositol 'J.,4,5 - triphosphate enabling the release of calcium from the endoplasmic reticulum. These receptors are found in both neuronal and non neuronal tissues wíth the neuronal fortr most abundant in Purkinje cells (Yamada et aL.1,994). Mice which are ITPRL deficient most often die in utero; however, the majority of those which are bom alive have severe ataxia and tonic-clonic seizures, dy*g before they are weaned. Electroencephalograms of these mice indicate that ITPR1 is essential for norrnal brain functioru although the cerebell,ar Purkinje cells appear to be spared (Matsumoto et al. 1996). Mutations in the calcium channel gene CACNA1A cause both episodic ataxia type 1 and spinocerebellar ataxia 6 (Ophoff et al. 1,996 and Zhuchenko et al. 'J,997) and thus it could be speculated that mutations tn ltprl may give rise to an ataxic phenotype. 267 While endeavouring to identify genes contributing to the mental retardation in 3p- syndrome patients, Wei et al. (1998) characterised the neural cell adhesion molecule gene (CALL). This gene was shown to be expressed at specific developmental stages in the central nervous system, spinal cord and peripheral nervous system. This gene can be considered given the apparent overlap in phenotype (mental retardation) with 3p- syndrome patients and the high expression in neural tissues. Additionally, mutations in the neural cell adhesion molecule LL cause mental retardation and brain malformations, tefer:red to as CRASH slmdrome (Corpus callosum hypoplasia, retardation, adducted thumbs, spasticity and hydrocephalus) (Yamasaki et aI.1997). The third and final gene to be considered a candidate is plasmacytoma -associated neuronal glycoprotein (PANG), again a neuronal adhesion molecule. The mouse homolog (Pøng\ is expressed only in the brain and has been considered a candidate to examine in the neurological murine mutants opf (opisthotonous) and dfw (deaf waddler) (Mock et al. tee6). These genes are currentlybeing examined for molecular defects in this family. Screening for mutations in these genes represents the continuation of the positional candidate approach to identifying a disease causing mutation for this disorder. The candidate region at this stage remains too large (18.9cM) for positional cloning, however; additional families, if available for screening, r:.ay enable the reduction of the candidate interval for more effícient application of the positional candidate approach. Continual searches of databases may uncover other candidate genes as they are submitted and become available to the general scientific community. It is speculated that mutation screening of ITPRI, CALL and PANG may result in the identification of the disease causing mutation in this and possibly other families with NCPA. Localisation to the 3pter region represents the first genetic localisation for an autosomal dominant pure congenital ataxia. Significantly this is the more difficult category of the congenital ataxias to diagnose since within this group significant clinical heterogeneity exists. For the majority of cases early prognosis is not possible from early developmental milestones, neurological signs or neuroimaging (Steinlin et al. 1998a), thus the identification of genetic localisation and the evenfual characterisation of the disease gene will enable molecular diagnosis and perhaps provide a basis for improved prognosis. 268 4 5 7115 I '10 14 1ô 7et1 7119 75A9 71 13 7114 8065 7121 75€5 'f6 4 t6 19 7567 8682 e6E3 7570 7117 7120 8370 7114 7566 tv 2 71',1E 75æ 6684 8665 E686 ¡,tr Atlecled mab. unalfected maþ O.o Allecled temale, unalfecled fernale @ Unknor,vn afieclþn stalus N) identifying four digit numbers have given Hood samples for DNA extaction and subsequent genotype analysis. 4 5 ffi1307 ß147 ffi K1304 Dæ1æ DSru 4 6 7 I 10 11 14 10 2S 2 il 43 2 2 21 2 2 5t 1 712'l 2 1 22 4 1 2 42 24 24 3 2 62 14 4 1 41 32 23 52 14 æ ilt 4 'f6 19 øw 868Ét 7570 75AA 7567 23 46 2 14 2 42 1 13 4 7114 7'12. 8tt84 E665 868ô 33 12 12 11 32 32 21 21 -i253 32 ?2 ¡,tr Alf€ded male, unaflæt€d mdê 41 21 21 a,O Afieded fmale, unaffæt€d fmde O Ltìkìm alfæt¡m 6tatuÊ nr- no @lt Figure 2: Haplotype analysis of in family 1K89281 |pp?leqt giggas.e..haplotype is.indicated. in green. Rðcombinant'eveiris in individuals gene lieb distal to D3S1304. lndividual ll.8 (indicated in green) inherits the atfected haplotype. This indivudual ihus clinical assessment of this individual is unclear. For two point linkage analysis this individual was coded as unknown affection status. N) o{ +4 D3S1297 D3S3630 D3S1304 +3.43 t t t +3 o ()o U' o 9+2 P 'õc 'Fo- :i +1 0 0 5 10 15 Distance (cM) Figure 3:The multipoint linkage map calculated by LINKMAP module of LINKAGE (version 5.2). The highest likelihood of the locus for the congenital ataxia segregating in family (PK80284) is in the interval defined by flanking markers D3S1297 and D3S3630. 27t